article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
a review of the literature, including two dermatology studies, indicates that patients prefer their physicians to wear white coats, not only for identification purposes but to build trust and confidence. this preference holds stable whether studies have addressed general practitioners, specialists, or dermatologists specifically. a study in which subjects were shown digital photographs of doctors with or without white coats found that subjects perceived the doctors wearing white coats to have greater authority, to be more friendly and to be more attractive. no study has assessed the prevalence of dermatologists wearing white coats on their websites. given that patient preferences are well known and that websites are a major marketing and communication tool, we conducted an observational study to evaluate the prevalence of dermatologists in white coats on websites. to estimate national trends, we evaluated six states from varying regions : northwest (oregon), southwest (arizona), west (colorado), midwest (indiana), northeast (massachusetts), and southeast (south carolina). one author (ah) used google to search the terms arizona dermatology, colorado dermatology, indiana dermatology, massachusetts dermatology, oregon dermatology, and south carolina dermatology. during october 1824, 2010 she evaluated the first 100 websites for each search term, assessing for relevancy, redundancy, and english language use. if multiple photos or videos of a dermatologist existed on the site, she only recorded one image per dermatologist with the profile image taking priority. she recorded the total number of dermatologists, their gender, and whether they were photographed with or without white coats. massachusetts and south carolina had the highest white coat prevalence rate at 29% and 39%, respectively. colorado had the lowest rate at 13%, one third of south carolina s rate. there was moderate variation by gender between various states : arizona and colorado had a higher prevalence of women wearing white coats, while the other four states had a higher prevalence of white coat - wearing men. table 1white coat prevalence by state.arizonacoloradoindianamassachusettsoregonsouthcarolinatotaltotal : whitecoats17% (13)13% (12)20% (11)29% (38)20% (12)39% (23)23% (109)total : nowhitecoats3% (64)87% (82)80% (43)71% (91)80% (48)61% (36)77% (364)men : whitecoats11% (5)8% (4)23% (8)33% (21)21% (7)43% (16)23% (61)men : nowhitecoats89% (41)92% (47)77% (27)67% (42)79% (26)57% (21)77% (204)women : whitecoats26% (8)19% (8)16% (3)26% (17)19% (5)32% (7)23% (48)women : nowhitecoats74% (23)81% (35)84% (16)74% (49)81% (22)68% (15)77% (160)adata expressed as percent (number). data expressed as percent (number). the results indicate that, on their websites at least, dermatologists are largely not wearing white coats. prevalence rates vary by state, but in all six states the majority of dermatologists did not wear white coats. the east coast is customarily known for being more traditional, which may account for its relatively high white coat prevalence rate. physicians report various reasons for not wanting to wear white coats - infection risk, discomfort, and interfering with the patient - physician relationship. however, a recent study found no statistically significant difference between bacterial or methicillin - resistant staphylococcus aureus contamination of physician s white coats versus newly laundered physician attire after an eight hour work day. the study also found no difference in bacterial contamination at the wrists of doctors wearing white coats versus newly laundered attire, suggesting that white coats may pose no greater risk of infection than newly laundered clothing. further, infection risk and comfort are not significant concerns when posing for a photo for one s website. a recent study on dermatology patients indicates that most patients prefer their dermatologist to wear a white coat, while a study involving digital images of doctors with and without white coats patients perceive doctors to have more authority, be more friendly and be more attractive when they are wearing a white coat. while white coats can provoke anxiety in some, such as in reported white coat hypertension, they may also have a positive placebo effect in others. since many non - physician healthcare professionals also wear white coats, white coats may not be as helpful to patients for identification of the physician as they once were. rather, identification badges clearly marked as doctor or physician may help to alleviate confusion for patients. however, we chose states in distinct geographic areas of the country in an effort to measure a representative sample of the entire united states. it is also possible that photographs on websites do not accurately reflect dermatologist attire in the office. photographs on websites are nonetheless important. as most dermatologists websites are designed primarily to market their practice, it would follow that they should accommodate patient preferences. while recruiting new patients through the internet currently may not be paramount, using practice websites as advertising tools is likely to become more important as younger patients turn to the web to find medical information and recommendations for health care providers. thus, as dermatologists develop and update their websites, we suggest donning a white coat to visually brand medical professionalism. in our study sample, most (77%) dermatologists did not wear white coats on their practice website. our results were approximately equal among men and women, but east coast states had the highest rates of white coat - wearing physicians (29% in massachusetts and 39% in south carolina), whereas colorado had the lowest rate (13%). since patients report they prefer their dermatologist wear a white coat, and practice websites may be patients first introduction to their dermatologists, dermatologists should consider presenting themselves wearing white coats online. | physicians wearing white coats are perceived as having more authority, being more friendly and being more attractive than those not wearing white coats, and patients report that they prefer their dermatologist to wear a white coat. the aim of the study was to determine the prevalence of dermatologists wearing white coats on practice websites. we searched google for dermatology practice websites in six states representing distinct geographic regions in the united states. the first one hundred search results were evaluated, and photographs of dermatologists on these websites were examined for the presence or absence of white coats. most (77%) of dermatologists did not wear white coats. the highest prevalence was in the eastern states of massachusetts and south carolina, with 29% and 39%, respectively. colorado had the lowest rate at 13%. rates were essentially equal when segmented by gender. although patients report that they prefer their dermatologist to wear a white coat, dermatologists often do not wear a white coat on their practice websites. |
rheumatoid arthritis (ra) is characterised by a progressive, erosive polyarthritis, resulting in immune - mediated joint destruction and eventual disability.components of the immunoinflammatory response include acute phase proteins, auto - reactive t cells, b cells, and their respective inflammatory mediators. the consequence is a self - perpetuating chronic inflammatory response involving a complex interplay between infiltrating inflammatory cells and the structural cells of the synovial joint [1, 2 ]. matrix metalloproteinase-3 (mmp-3) is produced predominantly by chondrocytes and synovial fibroblasts and is found in high concentrations in the synovial fluid, with elevated levels also found in the serum of ra patients. mmp-3 production is upregulated by the proinflammatory cytokines il-1, tnf, ifn, and il-17a, as well as by serum amyloid a (saa), an acute phase reactant, with counter - regulatory inhibition from il-4 and il-13 [410 ]. cytokine / saa - driven production of mmp-3 in the rheumatoid joint appears to be a key mediator of cartilage destruction, while bone resorption is facilitated by mmp-3-mediated removal of the outer osteoid layer, enabling attachment of osteoclasts to the underlying bone. moreover, mmp-3 mediates the proteolytic activation of pro - mmp-9 released from both inflammatory and structural cells. aside from its role in promoting the recruitment of neutrophils, monocytes, t cells, and osteoclasts, mmp-9 promotes the release of membrane - bound vascular endothelial growth factor (vegf), thereby contributing to angiogenesis and disease progression. with respect to its diagnostic and prognostic potential, elevated serum concentrations of mmp-3, while having no specificity for ra, have been found in many [1321 ], but not all [2225 ], studies to correlate with disease severity and response to chemotherapy. however, the global interrelationships of mmp-3 with proven genetic markers of disease susceptibility, such as the shared epitope (se), as well as with other systemic biomarkers such as autoantibodies, cytokines, cartilage breakdown products, and the acute phase reactants crp and saa in particular, have not been well characterised. crp and saa are synthesised in the liver in response to proinflammatory cytokines such as tnf, il-1, and il-6. monocytes / macrophages, endothelial cells, synovial fibroblasts, and chondrocytes can also produce saa. unlike crp, saa is also locally expressed and accumulates in inflamed tissue with histological studies demonstrating expression of saa in the perivascular and lining layer of ra synovial tissue, in regions of leukocyte recruitment and angiogenesis, especially at the cartilage pannus junction. saa is apparently a more sensitive marker of inflammation in ra than crp, with the saa / crp ratio, possibly being of more significance. saa augments the inflammatory response in a cytokine - like fashion by attracting monocytes / macrophages, leukocytes and t lymphocytes, while promoting neutrophil survival and endothelial activation and stimulating the production of the proinflammatory mediators tnf, il-1, il-6, il-8, and il-17, thus initiating an amplifying loop. exposure of synovial fibroblasts and chondrocytes to saa promotes mmp-3 mediated adhesion molecule expression, as well as phagocytosis and chemotaxis of monocytes and neutrophils, thereby contributing to synovial inflammation, hyperplasia, angiogenesis, and joint destruction. saa has also been implicated in the pathogenesis of atherosclerosis and premature cardiovascular disease, an important aspect in the management of patients with ra, thus making it a potential target for therapy to control both ra and its complications. the objectives of the current study were to assess the relationships between circulating mmp-3 and (i) se ; (ii) biomarkers of inflammation and cartilage degradation ; (iii) disease activity and radiographic changes in comparison with crp and saa in a cohort of predominantly black female south africans with early disease - modifying antirheumatic drugs (dmard) naive ra. baseline data was reviewed from 128 patients who were part of the gauteng rheumatoid arthritis trial (great), a prospective study of early dmard naive ra patients [2729 ]. patients were recruited from the rheumatology clinics of two tertiary hospitals, chris hani baragwanath hospital and steve biko academic hospital, attached to the universities of the witwatersrand and pretoria, south africa, respectively, and the study was approved by the research ethics committees of the faculties of health sciences of both institutions. demographic data, duration of symptoms, education level, medication history, clinical assessment including 28 joint count, and the presence of extra - articular involvement were recorded, as was disease activity measured according to the health questionnaire disability index (haq - di) and simplified disease activity index (sdai), and have been described in detail elsewhere for this cohort of patients [2729 ]. radiographs of the hands and feet were scored according to the modified larsen score. in each case, 32 joint areas were scored : 8 pip (proximal interphalangeal), 2 thumb ip (interphalangeal), 10 mcp (metacarpophalangeal), 4 areas in each wrist, and 8 mtp (metatarsophalangeal) joints. venous blood was collected as described previously, followed by prompt separation of serum and storage at minus 20c until analysed. these were assayed using nephelometric, immunofluorimetric, and multiplex suspension bead array procedures as previously described, while haemoglobin concentrations and erythrocyte sedimentation rates were measured using standard haematological procedures. serum concentrations of mmp-3 were measured using the quantikine total mmp-3 immunoassay (elisa) according to the instructions supplied by the manufacturer (r & d systems, minneapolis, mn, usa) and the results expressed as nanograms (ng)/ml serum. serum levels were measured in healthy controls (15 females and 10 males, age range 2464). serum levels were measured using the kamiya human comp elisa system (kamiya biomedical company, seattle, wa, usa) and the results expressed as micrograms / ml. this was performed as described previously using high - resolution reverse sequence - specific oligonucleotide probes and luminex technology, with classification as se or non - se genotypes according to the method of tezenas du montcel. [30, 31 ]. descriptive statistics of continuous variables were done by using a measure of central tendency (mean or median) and a measure of variability (standard deviation or range). frequencies and percentages were used to describe categorical variables of the nominal or ordinal scales. cytokine data were not normally distributed, and therefore the spearman 's pairwise correlations were used to find the strength of each cytokine, demographics with mmp-3 and comp, and between themselves. a p value of il-6 > ifn- and vegf (table 3). comp correlated positively and significantly with rf (r = 0.23, p < 0.006), but not with any of the clinical indices or other inflammatory biomarkers. a weak positive correlation between comp and smoking history (ever smoked) subgroup analysis revealed no differences in mmp-3, saa, crp, or comp levels in risk allele negative or positive patients. given the key role of saa in activating the synthesis of mmp-3 by synovial chondrocytes and fibroblasts [9, 34 ], correlations of this acute phase reactant, as well as those of crp, with clinical and traditional noncytokine indices of disease activity were determined and these are shown in table 4. correlations included evaluation of the saa / crp ratio, but this did not reveal any significant associations (data not shown). both acute phase proteins, especially crp, were found to have stronger associations with disease activity in early ra than mmp-3. consistent with data from other studies finding elevated mmp-3 levels in 62%80% of patients [14, 35 ], mmp-3 levels were found to be elevated in 56.25% of our patients. although no correlations with se were detected, mmp-3 was found to correlate significantly with measures of disease activity, specifically sdai, esr, crp, and saa. in addition to these, correlations with predominantly proinflammatory cytokines, especially il-8, il-6, ifn, and vegf (table 3), were also observed. in a study of 144 patients with ra showed significant correlations with il-8, il-1 and crp, the strongest correlation being with crp (r = 0.601, p < 0.001). a smaller study by ribbens. in 20 patients with ra showed correlations of mmp-3 and disease activity score (das), crp, and il-6 level. few studies have examined serum levels of mmp-3 in a dmard nave early ra cohort of predominantly black females, exploring the associations with clinical parameters of disease activity, acute phase response, se, and a wide range of cytokines, chemokines, and growth factors. recent developments in the management of ra are aimed at rapid disease control, as well as early introduction of efficient therapies, which makes the search for useful biomarkers such as mmp-3 important. this contention is underscored by an interest in the development of an automated serum detection procedure for mmp-3 and the recent introduction of a commercially available multibiomarker disease activity (mbda) test. the mbda test includes mmp-3 in the quantitative assessment of disease activity, having shown significant correlations with das 28-crp (auroc = 0.77 ; p < 0.001 for seropositive patients and auroc = 0.70 ; p < 0.001 for seronegative patients). in the current study, the levels of circulating saa, a mediator of synthesis of mmp-3, as well as those of crp, were found to be elevated in 74.4% and 76.1% of patients, respectively, and correlated significantly with measures of disease activity, as described in previous studies, some of which suggest that saa is a more sensitive marker in ra than crp. however, this was not confirmed in the current study, with crp being equivalent or slightly superior to saa as a marker of disease activity in early ra. because saa is also locally released and expressed in the synovial tissue, we reasoned that the saa / crp ratio may be a more accurate index of disease activity than the individual biomarkers. with regard to poor prognostic markers, such as the presence of nodules, erosive disease, and the larsen score, correlations with crp and saa, but not with mmp-3, were evident. no associations of saa or crp with the se risk alleles or comp were observed. importantly, the correlations of both crp and saa with sdai were considerably stronger than those of mmp-3 with sdai, demonstrating that measurement of either of these acute phase reactants, but preferably crp, is probably the best serological determinant of disease activity in early ra. cartilage destruction is one of the consequences of uncontrolled synovial proliferation, with serum levels of cartilage degradation products such as comp having been shown to be associated with ra disease activity and future radiological damage. in the current study, comp levels were elevated in 34.6% of patients compared to other studies showing percentage of elevated comp levels ranging from 41% to 67% [38, 39 ]. comp was found to correlate weakly with smoking history (ever smoked), rf, and mmp-3, but no correlations were found with measures of disease activity as reflected in some previous studies which described correlations with crp, das, esr, and rheumatoid nodules. mmp-3 is an important effector of cartilage metabolism ; hence, the correlation with comp is not surprising. although no correlations between comp and radiographic changes were found, this may simply reflect increased cartilage turnover rather than destruction in early disease. the correlation of mmp-3 with comp and lack thereof with the acute phase reactants studied may suggest that mmp-3 is a better biomarker to predict disease progression ; thus, combining measurement of crp with that of mmp-3 may be a useful strategy predict disease progression. in conclusion, the most significant and original findings of the current study are (i) elevated levels of circulating mmp-3, which may identify a subset of ra patients likely to develop severe disease, are significantly associated with sdai, proinflammatory cytokines, and most strongly with crp and saa ; (ii) crp and saa are more strongly correlated with disease activity in early ra than mmp-3 ; (iii) measurement of either crp or saa in combination with mmp-3 on presentation may be useful in the assessment of disease activity and prediction of progression in early ra. | matrix metalloproteinase-3 (mmp-3) is involved in the immunopathogenesis of rheumatoid arthritis (ra), but little is known about its relationship to genetic susceptibility and biomarkers of disease activity, especially acute phase reactants in early ra. mmp-3 was measured by elisa in serum samples of 128 disease - modifying, drug - nave patients and analysed in relation to shared epitope genotype, a range of circulating chemokines / cytokines, acute phase reactants, autoantibodies, cartilage oligomeric protein (comp), and the simplified disease activity index (sdai). mmp-3 was elevated > 1.86 ng / ml in 56.25% of patients (p < 0.0001), correlated with several biomarkers, notably il-8, il-6, ifn, vegf and comp (r values = 0.220.33, p < 0.0140.0001) and with crp and saa levels (r = 0.40 and 0.41, resp., p < 0.0000) and sdai (r = 0.29, p < 0.0001), but not with erosions or nodulosis. however, the correlations of crp and saa with sdai were stronger (respective values of 0.63 and 0.54, p < 0.001 for both). comp correlated with smoking, rf, and mmp-3. mmp-3 is significantly associated with disease activity, inflammatory mediators and cartilage breakdown, making it a potential biomarker of disease severity, but seemingly less useful than crp and saa as a biomarker of disease activity in early ra. |
the goal of endodontic treatment is to eliminate diseased pulpal tissue and to create an environment that allows periapical tissues to heal and to prevent the development of apical periodontitis. affected teeth are retained by removing diseased tissue, sealing the canal system, and subsequently restoring the coronal tooth structure. although many factors of technical order are involved in the failure of endodontic treatment, the emergence of bacteria that resist therapy and proliferate in the root canal, or that contaminate the canal after endodontic treatment through coronal microleakage, is primarily responsible for unsuccessful treatment. frequently, the success of endodontic treatment is associated with an appropriate apical sealing. however, the coronal seal reached using restorations has been considered important. in certain situations, the filling can be exposed to the oral environment, as in the case of failures or losses of restorations, fractures of the dental structure or the restorative material, or during the intraradicular preparation for post placement. furthermore, the prosthetic crown may come off, exposing the intracanal post to the buccal environment. theoretically, any bacteria present in the oral cavity can invade the root canal and participate in the installation of an infectious process. enterococcus faecalis, bacterium species frequently isolated in root canals with endodontic failure, represent a small portion of the initial microbiota of teeth with pulp necrosis and periradicular lesions. this bacterium demonstrates resistance to endodontic disinfection procedures during chemical - mechanic preparation and the capacity to survive in root canals as a single species without the need for a cooperative relationship with other bacteria. despite not simulating some conditions of the oral cavity, as the temperature changes, the influence of the diet and saliva flow and the use of human saliva remain the most simulating in a real clinical situation. the dental literature is increasingly recognizing the importance of the coronal seal. in this context, the importance of an adequate coronal seal in endodontically treated teeth is clear during therapeutic sessions, after filling the root canals, or after placement of the intracanal post and its prosthetic crown. therefore, the objective of this study was to investigate the recontamination of root canals of endodontically treated teeth prepared to receive an intracanal post, and those with an intracanal post but without a prosthetic crown and exposed to fresh human saliva. the null hypothesis accepted in this study was that the root canals with intracanal post but without a prosthetic crown can be recontaminated when exposed to fresh human saliva. these specimens were obtained from the teeth bank of the pelotas dental school (federal university of pelotas, brazil, rs) after the ethics committee approved this study (document no. the teeth were stored in 0.9% saline and kept moist at 37c throughout the experiment. the crowns were removed with a diamond disk in a low - speed handpiece at the level of the enamel - cement junction, except for the teeth in the negative control group, which stayed intact. a mechanical - chemical preparation following the step - back technique was carried out on the 30 extracted single - rooted human teeth. the working length was measured by introducing a # 10 k - file (maillefer, dentsply maillefer ind. petrpolis, rj, brazil) into the root canal and establishing it 1 mm from the root apex. all canals where then instrumented to a size # 20 file at working length. to standardize the diameter of the apical foramen, the coronal portion of the canal was prepared with gates - glidden burs # 2 and # 3. 1 ml of 1% of hypochlorite (naocl) (wirath indstria e comrcio ltda, so paulo, sp, brazil), followed by 1 ml of 17% of ethylenediaminetetraacetic acid (edta) (iodontosul, souza e leonardi ltda., porto alegre, rs, brazil) were used to irrigate the canals between each file to remove organic and inorganic debris. then, 1 ml of sterile saline solution was used (basa, indstria farmacutica basa ltda., caxias do sul, rs, brazil) to remove tissular debris, complemented by irrigating solutions (naocl and edta)., baro de angra, paraba do sul, rj, brazil) previously sterilized to the diameter of the last file size (# 40). the root canals were obturated using a lateral condensation technique with gutta - percha cones of size 40 (as the main cone) previously disinfected with 1% naocl for 30 minutes and endodontic cement., petrpolis, rj, brazil), prepared to the appropriate consistency following the manufacturer 's instructions, and was introduced into the canal together with the main and accessory gutta - percha points (dentsply ind. when the obturation was concluded, the excess material was removed with a heated paiva condenser along with part of the obturation up to two - thirds of the working length. x - rays were taken (kodak ltda., so jos dos campos, sp, brazil) to verify the quality of the filling and the space for the intracanal post and x - ray images were taken of the root filling (dabi atlante, ribeiro preto, sp, brazil) with a radiation exposure time of 0.5 s. the radiographic film was aligned parallel to the long axis of the tooth, and the central beam was directed along the buccal - lingual plane perpendicular to the film. the teeth were randomly divided into five groups as follows : group 1 (g1)=10 endodontically treated root canals prepared to receive an intracanal post and group 2 (g2)=10 endodontically treated root canals cemented with a prefabricated intracanal post without a prosthetic crown. five teeth with instrumented root canals, opened access cavities, and not obturated served as positive control group 1 (pc1), five teeth with no instrumented root canals and access cavities opened served as positive control group 2 (pc2), and five intact (without endodontic treatment) teeth served as the negative control group (nc) (figure 1). flowchart of the experimental groups the root canals of g2 were etched with 37% phosphoric acid (dentaltec ltda., joinville, sc, brazil) for 15 s, washed with physiological solution, and dried with sterile absorbent paper points. following conditioning of the root canal dentin, the prime & bond 2.1 adhesive system (dentsply ind. ltda., petrpolis, rj, brazil) was applied according to the manufacturer 's instructions. then, carbon fiber posts (angelus indstria de produtos odontolgicos s / a, londrina, pr, brazil) were cemented using resin cement (cement - post, angelus indstria de produtos odontolgicos ltda., londrina, pr, brazil) also according to the manufacturer 's instructions. all the teeth were kept at 37c and in 100% relative humidity for 2 weeks to allow the endodontic cement in groups 1 and 2 and the control groups (pc 1, pc 2, and nc) to reach completely cure. all samples were sterilized with radiation using a cobalt 60 machine (embrarad empr.,. (2000). a glass tube with rubber stoppers was adjusted for use in this experiment. using a heated instrument, a perforation was made in the center of every rubber stopper and one tooth was inserted under pressure up to its cement - enamel junction, to ensure that its crown was outside the vial and its root was within the vial. cylinders prepared from 10 ml sterile plastic syringes were adapted on the external surface of the stoppers to create a chamber around the crown of the tooth. then, the glass tube was filled with brain heart infusion (bhi, acumedia manufacturers, inc., lansing, mi, usa) sterile broth and the root apex was immersed in the broth., itapevi, sp, brazil) was applied in the interface between the tooth and the stopper to prevent the saliva from penetrating through this space into the bhi broth. one ml of sterile methylene blue (1%) was placed inside every chamber mounted in adapted plastic syringes to assure the efficiency of the sealing of the cyanoacrylate. if the medium becomes blue, then the sealing was ineffective and the specimen needs to be discarded. a parafilm (american national can, chicago, il, usa) was used to block the interface flask - stopper of the apparatus. thirty ml of human saliva was collected from a volunteer at 8:00 a.m. every day of the experiment. the volunteer did not engage in oral hygiene for at least 12 hours before the saliva collection. the volunteer chewed a piece of parafilm (1 g) to stimulate salivation. the saliva was stored in a brown 100 ml glass screw - top container, according to magura,. the chamber of each apparatus was filled with 3 ml of human saliva mixed in bhi broth in a 3:1 (v / v) ratio and with 1 ml of the methylene blue dye solution added. human saliva was changed every 3 days to ensure that the microorganisms did not lack nutrients. the entire apparatus was aerobically incubated at 37c and 100% relative air humidity, and the appearance of turbidity in the bhi broth was checked daily for the 40 days. the number of days it took for bacterial growth to appear was indicative of the total recontamination of the root canal by bacteria from saliva. the turbidity was measured visually with the mcfarland scale, trying to approximate the turbidity of inocula to the concentration of cells in a suspension. care was taken with the evaporation of the bhi broth to keep the roots totally immersed in the medium inside the apparatus during the experiment. every 48 hours, 4 ml of liquid mixture inside the apparatus chamber were removed and replaced with another 4 ml of sterile bhi broth to avoid saturating the bacterial medium. data were statistically analyzed using the kaplan - meier survival analysis test and the holm - sidak method. the apparatus used to evaluate the microleakage was prepared according to siqueira jr.,. a glass tube with rubber stoppers was adjusted for use in this experiment. using a heated instrument, a perforation was made in the center of every rubber stopper and one tooth was inserted under pressure up to its cement - enamel junction, to ensure that its crown was outside the vial and its root was within the vial. cylinders prepared from 10 ml sterile plastic syringes were adapted on the external surface of the stoppers to create a chamber around the crown of the tooth. then, the glass tube was filled with brain heart infusion (bhi, acumedia manufacturers, inc., lansing, mi, usa) sterile broth and the root apex was immersed in the broth. cyanoacrylate (super bonder, henkel loctite adesivos ltda., itapevi, sp, brazil) was applied in the interface between the tooth and the stopper to prevent the saliva from penetrating through this space into the bhi broth. one ml of sterile methylene blue (1%) was placed inside every chamber mounted in adapted plastic syringes to assure the efficiency of the sealing of the cyanoacrylate. if the medium becomes blue, then the sealing was ineffective and the specimen needs to be discarded. a parafilm (american national can, chicago, il, usa) was used to block the interface flask - stopper of the apparatus. thirty ml of human saliva was collected from a volunteer at 8:00 a.m. every day of the experiment. the volunteer did not engage in oral hygiene for at least 12 hours before the saliva collection. the volunteer chewed a piece of parafilm (1 g) to stimulate salivation. the saliva was stored in a brown 100 ml glass screw - top container, according to magura,. the chamber of each apparatus was filled with 3 ml of human saliva mixed in bhi broth in a 3:1 (v / v) ratio and with 1 ml of the methylene blue dye solution added. human saliva was changed every 3 days to ensure that the microorganisms did not lack nutrients. the entire apparatus was aerobically incubated at 37c and 100% relative air humidity, and the appearance of turbidity in the bhi broth was checked daily for the 40 days. the number of days it took for bacterial growth to appear was indicative of the total recontamination of the root canal by bacteria from saliva. the turbidity was measured visually with the mcfarland scale, trying to approximate the turbidity of inocula to the concentration of cells in a suspension. care was taken with the evaporation of the bhi broth to keep the roots totally immersed in the medium inside the apparatus during the experiment. every 48 hours, 4 ml of liquid mixture inside the apparatus chamber were removed and replaced with another 4 ml of sterile bhi broth to avoid saturating the bacterial medium. data were statistically analyzed using the kaplan - meier survival analysis test and the holm - sidak method. regarding the possibility of recontamination of the root canals, a statistically significant difference was observed among the groups through the kaplan - meier survival analysis test (p<0.001) (figure 2). possibility of recontamination of the root canals - kaplan - meier survival analysis test (p < 0.001) this analysis was complemented by the holm - sidak method (p=0.05), which showed differences among the groups nc and g1, pc1 and pc2, and pc1 and g2. an analysis of the statistical average of the recontamination time of each group using the kaplan - meier survival analysis test verified that no recontamination occurred during the 40 days of the study in the group of intact teeth (nc). in the group of open teeth and not instrumented (pc2), contamination occurred on an average of 1.6 days. in the group of instrumented root canals and not obturated (pc1), contamination occurred on average once a day. in the group of teeth prepared to receive an intracanal post (g1), recontamination occurred on average on 4.9 days, and in the group of root canals that received intracanal posts cemented with resinous cement (g2) but without a prosthetic crown, contamination occurred on an average of 22.4 days (table 1). distribution of root canals exhibiting bacterial microleakage after 40 days the root canals instrumented, filed, and prepared to receive an intracanal post and later exposed to fresh human saliva (g1) had an index of 90% (n=9) leakage during a period of 24 hours. the group of teeth that received an intracanal post cemented with resinous cement and exposed to fresh human saliva (g2) showed that 20% of the samples were recontaminated in 24 hours and 30% in 48 hours ; however, after 14 days, only one more sample showed recontamination. at the end of the 40 days, based on the literature, the presence of recontamination of the root canals exposed to human saliva was typically observed, showing the importance of restoration in teeth with a prefabricated intracanal post. furthermore, the exposure of endodontically treated teeth to the buccal environment may necessitate endodontic retreatment. the microorganisms in human saliva can quickly cross the root canal in the absence of coronal sealing, reaching the root apex, and provoking infectious and inflammatory processes in the periradicular tissues. the group of opened and instrumented root canals used as a positive group (pc1) was penetrated by human saliva microorganisms during a period of 24 h and, as expected, proved that root canals exposed to the oral cavity are infected in a short period. in the group with open teeth and not instrumented (pc2), the time requested for the apical contamination was longer than for the group with open teeth and instrumented (pc1). this result may have been from the instrumentation that provided a more open root canal with the removal of smear - layer and debris, promoting a wider road for the arrival of microorganisms to the root apex without interference, as in teeth not instrumented. the g1 teeth had an index of 90% of root canal microleakage during a period of 24 h, demonstrating that the 4 mm of remaining filling material did not represent a barrier for the bacterial coronal leakage. the indicative time of turbidity of the bhi broth for g1 was practically the same as that for instrumented root canals without fillings (pc1). according to timpawat, amornchat and trisuwan (2001), most of the endodontic cements have an antibacterial effect that can limit the entrance of bacteria. certain new sealers, such as epiphany and guttaflow with primer, along with apexit, showed better resistance to bacterial penetration than other new or traditional sealers tested. however, this phenomenon is not in accordance with the results of this study. (1991) suggested that the presence of zinc in gutta - percha and the endodontic cement used in their study might have inhibited bacterial penetration and growth. the root canals that received carbon fiber posts cemented with resinous cement experienced a small percentage of bacterial microleakage in the first 24 and 48 hours (20% and 30% sample leakage, respectively). otherwise, technical failures and microcracks might have helped with this recontamination. the use of resinous cement could not have prevented the leakage but helped to slow it. furthermore, in 30% of the samples, complete recontamination of the root canals was not evident during the 40 days of the experiment. despite the advantages of using resinous cements, the procedure is very sensitive to mistakes such as allowing filling material remnants to stay in the pulp chamber, which would create a difficult acid condition for adhesion. in this study, autopolymerized resinous cement was used to guarantee polymerization in the entire extension of the root canal because passing light through the canal is known to be difficult. definitive restoration should be done preferably as soon as possible, except when the treatment requires a longer period. in this case, an adequate temporary restoration should be done and the root canal should be dressed with an antimicrobial material to reduce bacterial penetration. additionally, the root canal dressing prevents the presence and proliferation of microorganisms that resist the chemical - mechanic preparation of the root canal and protects the periapex. the findings of this in vitro study show that the contamination of a root canal exposed to fresh human saliva is rapid. they affirmed that root canals directly exposed to saliva could be quickly recontaminated from the solubilization of the endodontic cement and the permeability of the filling. however, they could not define when the bacterial leakage provokes an event of periradicular infection, because such an event depends on other factors, including the virulence of microorganisms, defense capacity of periradicular tissues, nutrition, and bacterial interactions. however, the presence of microorganisms in the periapex indicates that chronic or sharp lesions can grow. despite the limitations of the in vitro leakage tests the use of human saliva has an advantage because it is faithfully closer to the real clinical situation. however, it does not simulate similar variables that exist in the buccal environment given temperature changes, the influence of the diet, and salivary flow. further studies are necessary to investigate the relationship between the leakage of root fillings and the reactions of periradicular tissues. (1991) evaluated root canals filled and exposed to the oral environment for three months and suggested retreatment of the root canals. this result is in accordance with the results of the present study, in which the recontamination of root canals without the protection of a coronal restoration and complete filling of the root canal occurred in less than one week. furthermore, 70% of the root canals that received an intracanal post cemented with resin cement experienced recontamination after 29 days. however, clinically determining whether contact between saliva and the periradicular tissues continues to contraindicate the definitive dental restoration of a tooth whose root canals remained exposed to the oral cavity for a short period remains impossible. hence, new studies are extremely important to estimate when a retreatment is necessary for teeth exposed to the buccal cavity. this study showed that root canals with an intracanal post become recontaminated when exposed to fresh human saliva in a short period. | objectivethe aim of this study was to investigate the coronal microleakage of endodontically treated teeth prepared to receive an intracanal post and teeth with an intracanal post but without a prosthetic crown and exposed to contamination by fresh human saliva.material and methodsa mechanical - chemical preparation following the step - back technique was carried out in 35 extracted single - rooted human teeth. the teeth were randomly divided into five groups : g1=root canals instrumented, obturated, and prepared to receive an intracanal post (n=10) ; g2=root canals with cemented posts but without coronal sealing (n=10) ; pc1=positive control root canals instrumented and open (n=5) ; pc2=positive control 2 root canals without instrumentation and open (n=5) ; and nc = negative control healthy teeth (n=5). the crowns were removed except for the control group of intact teeth. the root canals were obturated and sterilized with cobalt 60 gamma irradiation and were then adapted in an apparatus using a brain heart infusion (bhi) medium and fresh human saliva for contamination. microbial growth was indicated by the presence of turbidity in the bhi liquid medium.resultsdata were submitted to the kaplan - meier survival analysis and the holm - sidak statistic method, which observed an index of 90% of microleakage in root canals after 24 hours for g1 and 70% of microleakage in samples at the end of 40 days for g2.conclusionthe results show that root canals with an intracanal post but without a prosthetic crown can be recontaminated when exposed to fresh human saliva in a short period. |
interleukin-6 (il-6), initially designated as a b cell differentiation factor 1, is a representative cytokine featuring redundancy and pleiotropic activity 2 - 4. in the early phase of infectious inflammation, il-6 is produced by monocytes and macrophages immediately after the stimulation of toll - like receptors (tlrs) with distinct pathogen - associated molecular patterns (pamps) 5. in noninfectious inflammations, such as burn or traumatic injury, damage - associated molecular patterns (damps) from damaged or dying cells stimulate tlrs to produce il-6 6. this acute il-6 expression plays a central role in host defense by stimulating various cell populations. when acting on hapatocytes, il-6 strongly induces a broad spectrum of acute - phase proteins such as c - reactive protein (crp), serum amyloid a (saa), fibrinogen, hepcidin, haptoglobin, and antichymotrypsin, whereas it reduces albumin, cytochrome p 450, fibronectin, and transferrin 7, 8 (figure 1). crp is a good biomarker of inflammation and is used as such in clinical laboratory tests. if the free concentration of the anti - interleukin 6 receptor antibody, tocilizumab is maintained in serum at more than 1 g / ml, crp remains negative 10, so that the serum crp level is a hallmark for checking whether il-6 activity is completely blocked in vivo. continuously high levels of hepcidin induced by il-6 block iron transporter ferroportin 1 in macrophages, hepatocytes, and gut epithelial cells and lead to hypoferremia and anemia of chronic inflammation 11, whereas long - term high levels of saa result in amyloid a amyloidosis 12. in lymphocytes when cd4-positive nave t cells are primed, a specific cytokine prompts their differentiation into an effector t cell subset. il-6 together with tgf- preferentially promotes differentiation of il-17-producing t helper cells (th17) that play a crucial role in the induction of autoimmune tissue injury, whereas il-6 inhibits tgf--induced regulatory t cell (treg) differentiation 13, 14. the resultant th17/treg imbalance leads to breakage of immunological tolerance and is of pathological importance for the development of various autoimmune and chronic inflammatory diseases 15. the function of il-6 in hematopoiesis is to induce maturation of megakaryocytes into platelets as well as activation of hematopoietic stem cells 17. il-6 production in bone marrow stromal cells generates the receptor activator of nf - kappab ligand (rankl), which is an essential factor for the differentiation and activation of osteoclasts and bone resorption, thus leading to osteoporosis 18. enhanced angiogenesis and increased vascular permeability are pathological features of inflammation, and these characteristics are due to the excess production of vascular endothelial growth factor (vegf), which is induced by il-6 in inflamed lesions such as seen in synovium tissue of rheumatoid arthritis 19. the promotional activities of il-6, such as the proliferation of keratinocytes or collagen production in dermal fibroblasts, may contribute to autoimmune skin diseases including psoriasis and systemic sclerosis 20, 21. furthermore, il-6 stimulates the growth of cells such as myeloma / plasmacytoma cells and mesangial cells 22 - 24. il-6 triggers signal transduction after binding to the il-6 receptor (il-6r) 25, 26. there are two forms of il-6r, a transmembrane 80-kda form with a short cytoplasmic domain and a soluble form (sil-6r). after binding of il-6 to transmembrane il-6r, the resultant il-6/il-6r complex associates with gp130 27 - 29, and the activated il-6 receptor complex is formed as a hexameric structure consisting of two molecules each of il-6, il-6r and gp130 (so - called a classical signaling) 30, 31. the expression of transmembrane il-6r is limited to a few cell types but the il-6/sil-6r complex can also transduce the il-6 signal to various cells which do not express transmembrane il-6r but express gp130 (known as a trans - signaling mechanism) 32, so that il-6 affects a wide variety of cells. when il-6 is synthesized transiently, it promptly participates in the host defense against environmental stress such as infection and injury and at the same time provides an sos (warning) signal by triggering a broad spectrum of biological events. once the source of stress is removed from the host, il-6-mediated activation of the signal transduction cascade is terminated by negatively regulatory systems in conjunction with the normalization of serum il-6 and crp levels. however, dysregulated persistent il-6 production has been implicated in the development of various autoimmune, chronic inflammatory diseases and even cancers 2 - 4, 33. the reason(s) why such dysregulated continuous il-6 production is induced remains to be clarified and elucidation of the mechanism(s) underlying persistent il-6 synthesis in diseases is of particular importance to make their pathogenesis clear. it was found that in human immunodeficiency virus (hiv)-positive cases of multicentric castleman 's diseases all patients were infected with the kaposi sarcoma - associated herpes virus (kshv) and that sustained synthesis of both virus - derived il-6, which directly binds to and stimulates human gp130, and of host - derived human il-6 contribute to the development of the disease 34. moreover, numerous animal models of diseases have also disclosed the pathologic role of il-6 in disease development and that il-6 blockade by means of gene - knockout or administration of anti - il-6 or anti - il-6r antibody can suppress such disease development either preventively or therapeutically. for example, il-6 blockade strategy demonstrably limited susceptibility to castleman 's disease - like symptoms in il-6 transgenic mice 35, as well as in various mouse models of rheumatoid arthritis 36 - 48, systemic lupus erythematosus 49 - 51, scleroderma 52, 53, c - peptide - induced myositis 54, experimental autoimmune uveoretinitis 55, 56, experimental autoimmune encephalomyelitis 57, and many other diseases. because of the pathological role of il-6 in various diseases, blockade of il-6 was expected to constitute a novel treatment strategy for these diseases 3, 58, 59. consequently, a humanized anti - human il-6r monoclonal antibody (chemical name : tocilizumab, generic name : actemra outside of the eu or roactemra inside the eu) was developed, by grafting the complementarity - determining regions of a mouse anti - human il-6r antibody onto human igg1. the resultant tocilizumab then blocks il-6-mediated signal transduction by inhibiting il-6 binding to transmembrane and soluble il-6 receptors. clinical trials of tocilizumab have demonstrated its outstanding efficacy for rheumatoid arthritis 60 - 66, systemic juvenile idiopathic arthritis 67 - 71 and castleman 's disease 72, 73. for patients with moderately to severely active rheumatoid arthritis, tocilizumab is now being used as an innovative drug in more than 90 countries worldwide. as a monotherapy or in combination with disease - modifying antirheumatic drugs, it has significantly suppressed the disease activity and radiographically detected progression of joint deformity, thus improving daily functional activity. tocilizumab was also approved as the first line biologic for the treatment of systemic juvenile idiopathic arthritis in japan, india, usa and eu and for castleman 's disease in japan and india. furthermore, favorable results of recent pilot studies, case series or case studies have suggested that tocilizumab may have broad application for other diseases. these diseases include systemic autoimmune diseases such as systemic lupus erythematosus 74 - 76, systemic sclerosis 77, polymyositis 78, vasculitis syndrome including giant cell arteritis 79 - 84, takayasu arteritis 79, 82, 85 - 87, cryoglobulinemia 88, myeloperoxidase - antineutrophil cytoplasmic antibody - associated crescentic glomerulonephritis 89 and rheumatoid vasculitis 90. the application of tocilizumab may also extend to organ - specific autoimmune diseases including crohn 's disease 91, relapsing polychondritis 92, 93, acquired hemophilia a 94, autoimmune hemolytic anemia 95, 96, as well as to chronic inflammatory diseases such as adult - onset still 's disease 97 - 113, amyloid a amyloidosis 114 - 120, polymyalgia rheumatica 79, 84, 121, remitting seronegative symmetrical synovitis with pitting edema 122, behcet 's disease 123, 124, uveitis 125, graft - versus - host diseases 126, 127, and tumor necrosis factor receptor - associated periodic syndrome 128 (table 1). some studies have reported that tocilizumab is efficacious for spondyloarthritis 129 - 135, although others observed only minor effects 136 - 138. in addition, tocilizumab is reportedly effective for pulmonary arterial hypertension 139 - 141, atopic dermatitis 142, and sciatica 143. finally, it was observed that during tocilizumab treatment of patients with rheumatoid arthritis, hba1c levels and insulin resistance indices such as the homeostasis model assessment of insulin resistance (homa - ir) and the leptin - to - adiponectin ratio improved 144, 145, while serum levels of reactive oxygen metabolites decreased 146. it can thus be expected that long - term tocilizumab treatment may offer protection against the progression of atherosclerosis leading to cardiovascular events 147. indeed, large - scale genetic analyses demonstrated a causal association between il-6r - related pathways and coronary heart disease 148, 149, and a randomized, open - label, parallel - group, multicenter study to evaluate the rate of cardiovascular events of tocilizumab in comparison to a tnf inhibitor, etanercept in patients with rheumatoid arthritis (clinicaltrials.gov, identifier : nct01331837) is now in progress. to establish broad clinical indications for tocilizumab for various diseases, the current clinical trials are listed in table 2. on the basis of the pathologic role of il-6 and the outstanding beneficial effect of tocilizumab, targeting il-6 is a rational strategy for the treatment of various diseases and other biologics of il-6 inhibitors are also being developed 32. these include fully human anti - il-6r, anti - il-6r nanobody, anti - il-6 antibody, and anti - il-6/anti - igg avimer protein consisting of the igg - binding domain fused to the n - terminus of a 3-domain il-6 binding region, which results in a 19-kda heterotetrameric avimer. these novel biologics block il-6-mediated both classical and trans - signaling pathway by inhibiting il-6 binding to both transmembrane and soluble il-6r. by contrast, the fusion protein soluble gp130-fc selectively targets il-6/sil-6r trans - signaling pathway. it is hypothesized that il-6 trans - signaling is a local and temporal danger signal with fewer and less important physiological functions under non - stressed conditions than classical signaling on the basis of several animal models 32, 150. il-6 participates in the host defense against environmental pathogens, whereas dysregulation of il-6 production has been implicated in the development of various autoimmune and chronic inflammatory diseases 2 - 4, 33. the pleiotropic activity of il-6 also indicates that il-6 blockade represents a rational treatment strategy for various diseases. a good example of the efficacy of such treatment is the dramatic improvement engendered by tocilizumab in amyloid a amyloidosis and anemia of inflammation through inhibition of their respective responsible proteins, saa and hepcidin synthesis 151, 152. however, the mechanisms through which tocilizumab exerts its therapeutic effects on various phenotypically different autoimmune and inflammatory diseases are not yet well understood. in recent years, it has been shown that th17 and/or th1 > > il-6, in combination with tgf-, promotes the differentiation of nave t cells into th17, but inhibits tgf--induced treg differentiation, indicating that il-6 is a very important factor for determining the th17/treg balance 14. dysregulated il-6 production leads to predominance of th17 over treg but anti - il-6r antibody can repair this imbalance. it has been demonstrated in several animal disease models that il-6 blocking suppresses antigen - specific th17 and/or th1 differentiation but induces antigen - specific treg 47, 48, 55 - 57. furthermore, it has been shown that tocilizumab in fact corrects th17/treg imbalance in rheumatoid arthritis patients 153. in another study, it was found that tocilizumab induced a significant reduction in the peripheral pre - switch and post - switch memory b cells of rheumatoid arthritis patients 154 and that tocilizumab but not the tnf inhibitor significantly reduced somatic hypermutation in immunoglobulin gene rearrangements in pre - switch memory b cells 155, thus suggesting that modulation of memory b cells may be one possible target for tocilizumab. moreover, tocilizumab treatment led to a reduction in the pathologic cd38cd19igd plasma cells of sle patients 74 and could lessen the survival of plasmablasts, which produce the anti - aquaporin 4 antibody in neuromyelitis optica 156. these findings suggest that the clinical effect of tocilizumab is also mediated through its inhibition of pathological autoantibody production. because of the therapeutic efficacy of tocilizumab, il-6 plays a major role in the onset or development of various phenotypically different diseases. il-6 is produced by a panoply of cells including monocytes, macrophages, dendritic cells, t and b cells, neutrophils, mast cells, fibroblasts, synovial cells, keratinocytes, endothelial cells, stromal cells, mesangial cells, glial cells, neurons, chondrocytes, osteoblasts, smooth muscle cells, and others in response to various stimuli 2 - 4, 33. such phenotypic difference of diseases is conceivably due to differences in cells which generate il-6 through abnormal transcriptional activation of the il-6 gene 157, 158 and/or inhibition of il-6 mrna degradation 159, 160, or dose - dependent effects of il-6 produced by cells recruited into the organs. some virus products from kshv, human immunodeficiency virus (hiv), human lymphotropic virus-1 (htlv-1) and hepatitis b virus have been reported to affect il-6 gene activation and/or mrna degradation 161 - 168. therefore clarification of the cell source of il-6 production and of the mechanism(s) through which dysregulated continuous il-6 synthesis is induced constitutes an important issue for future studies into the pathogenesis of diseases. | interleukin (il)-6, a cytokine featuring redundancy and pleiotropic activity, contributes to host defense against acute environmental stress, while dysregulated persistent il-6 production has been demonstrated to play a pathological role in various autoimmune and chronic inflammatory diseases. targeting il-6 is thus a rational approach to the treatment of these diseases. indeed, clinical trials of tocilizumab, a humanized anti - il-6 receptor antibody have verified its efficacy and tolerable safety for patients with rheumatoid arthritis, castleman 's disease and systemic juvenile idiopathic arthritis, resulting in approval of this innovative biologic for treatment of these diseases. moreover, a considerable number of case reports and pilot studies of off - label use of tocilizumab point to the beneficial effects of tocilizumab for a variety of other phenotypically different autoimmune and chronic inflammatory diseases. elucidation of the source of il-6 and of mechanisms through which il-6 production is dysregulated can thus be expected to lead to clarification of the pathogenesis of various diseases. |
while there have been many clinical limitations to the placement of implants cited in literature one of the strongest arguments against the willingness of patients towards the placement of dental implants has been the prohibitive cost of these implants. in the past few years however there have been many reports in literature that as the cost of dental implants decrease and their rates of success improve, patients reluctance towards the placement of implants may slowly be changing.[68 ] assessing a patient 's willingness to pay (wtp) is one of the most accepted methods to evaluate the acceptability of new treatment modality for the clinician. it has been used to successfully measure patient 's perception in not only in dentistry,[911 ] but in fields such as orthopedics, cardiology and health care service preferences. bidding is the oldest and most accepted tool to assess wtp of a patient and provides both clinicians and third party payment providers with a realistic estimate of how much a patient can spend on a new treatment modality. despite this, it has been stated that data on how much a patient is willing to pay for implant care and how this may influence clinical decision making is scant. although, there is some data on the factors that affect clinicians recommendation of dental implants in the middle east, the concept of wtp for implant treatment and how it influences clinical decisions remain a largely unexplored area. given this background it was decided to evaluate saudi patients wtp for implant treatment and attempt to define the clinical and socio - demographic factors influencing that decision. ethical clearance for the study was obtained from the research center of the riyadh colleges of dentistry and pharmacy (ugsrp/2011/021).the study was conducted between september 2011 and january 2012. the power of sample was calculated based on the minimum sample required for a regression analysis with a single dependent variable, with true r value of 0.1, with alpha set at 0.05 ; which was 50. a total of 100 patients (38 male, 62 female) who had one or more missing teeth were selected using convenience sampling. the sample comprised of 50 uninsured patients reporting to the outpatient dental departments of a private hospital and 50 patients reporting to a government hospital in riyadh after obtaining an informed consent. data collection was done by four of the authors, (am, eq, ha, ks) who were trained in the bidding process and collection of demographic data. given the subjective nature of wtp and differences among patients, the investigators were calibrated against the lead investigator (bg). patients who consented to participate in the study were given a form in arabic asking them to fill in their demographic data. the bidding process was administered to patients in two stage process. in the first stage, the patients were presented with different cost - benefit scenarios and then asked if they were willing to pay the median cost of a single implant in riyadh city, which was 3000 sr (1 sr = 3.77 us$). in the second phase, patients were allowed to bid for the price they would be willing to pay. patients who were unwilling to pay the median price had the price progressively reduced by 500 sr until they reached a price they would be willing to pay or the sum reached 0. patients who were willing to pay the median price for an implant had the price progressively increased by 50 riyals and asked if they would still be willing to pay for the dental implant. the price was progressively increased until the patient was no longer willing to pay for the implant or until they reached the maximum price charged for an implant in riyadh city which was 8500 sr. the factors that could influence the patients wtp were classified into socio - demographic factors and individual patient specific factors. the mean price the patient was willing to pay for an implant was compared between different demographic groups using the one way - anova. the socio - demographic and individual patient factors were then grouped into two binomial logistic regression models, with wtp as the dependent variable. ethical clearance for the study was obtained from the research center of the riyadh colleges of dentistry and pharmacy (ugsrp/2011/021).the study was conducted between september 2011 and january 2012. the power of sample was calculated based on the minimum sample required for a regression analysis with a single dependent variable, with true r value of 0.1, with alpha set at 0.05 ; which was 50. a total of 100 patients (38 male, 62 female) who had one or more missing teeth were selected using convenience sampling. the sample comprised of 50 uninsured patients reporting to the outpatient dental departments of a private hospital and 50 patients reporting to a government hospital in riyadh after obtaining an informed consent. data collection was done by four of the authors, (am, eq, ha, ks) who were trained in the bidding process and collection of demographic data. given the subjective nature of wtp and differences among patients, the investigators were calibrated against the lead investigator (bg). patients who consented to participate in the study were given a form in arabic asking them to fill in their demographic data. the bidding process was administered to patients in two stage process. in the first stage, the patients were presented with different cost - benefit scenarios and then asked if they were willing to pay the median cost of a single implant in riyadh city, which was 3000 sr (1 sr = 3.77 us$). in the second phase, patients were allowed to bid for the price they would be willing to pay. patients who were unwilling to pay the median price had the price progressively reduced by 500 sr until they reached a price they would be willing to pay or the sum reached 0. patients who were willing to pay the median price for an implant had the price progressively increased by 50 riyals and asked if they would still be willing to pay for the dental implant. the price was progressively increased until the patient was no longer willing to pay for the implant or until they reached the maximum price charged for an implant in riyadh city which was 8500 sr. the factors that could influence the patients wtp were classified into socio - demographic factors and individual patient specific factors. the mean price the patient was willing to pay for an implant was compared between different demographic groups using the one way - anova. the socio - demographic and individual patient factors were then grouped into two binomial logistic regression models, with wtp as the dependent variable. of the 100 individuals surveyed 67% said they would be willing to pay (wtp) the median price for the placement of an implant. a comparison of socio - demographic factors [table 1 ] showed that significant differences were found between gender, income groups and setting of the clinic in the mean wtp price of the patients. females had a higher mean wtp price than males ; however, the proportion of females wtp the median price was similar to that of the males surveyed. patients in the government setting had a lower wtp price than those in the private setting ; there were also fewer individuals in the government setting who were wtp the median price for the placement of an implant. the wtp price and the number of individuals wtp the median price increased proportionately with the income of the family. comparison of the income groups among the two centers showed that there was no significant difference in the income of patients attending either the government or private clinic. although students had the highest wtp price, the employment status did not seem to have a significant impact on wtp [table 1 ]. socio - demographic factors and their impact on willingness to pay price for a dental implant when the patient 's specific factors influencing the patient 's acceptance of an implant were considered, we found that there was a significant difference in the mean wtp price between groups with regard to the area of the missing tooth, the patients perception of their oral health and the their desire to want an implant. no significant difference was found between the time elapsed since extraction or the desire of the patient to replace the missing teeth. patient with an anterior missing tooth or with missing teeth in both anterior and posterior seemed to be willing to pay more for an implant than those with only a posterior tooth missing, however, the difference was not statistically significant. the patients perception of their own oral health had a significant influence on the patients wtp for an implant, with patients who considered their oral hygiene to be good or excellent were willing to pay a significantly higher price than patients who considered their oral hygiene to be poor [table 2 ]. patient specific factors and their impact on willingness to pay price for a dental implant in order to ascertain the relationship of the multiple variables to the wtp of the patients, the variables were subjected to a binomial logistic regression, with the wtp price as the dependent variable for both the socio - demographic and the patient specific variables. among socio - demographic factors [table 1 ], income and hospital setting seemed to have a significant influence on whether a patient was willing to pay for an implant or not. surprisingly gender was not a factor in whether a patient was willing to pay for an implant or not, even though females who were willing to pay for an implant had a significantly higher wtp price than their male counterparts. among the individual patient factors, whether a patient wanted an implant or not was the most important factor that would determine whether a patient would be willing to pay for an implant. the only other factor that seemed to significantly influence the patients wtp seemed to be the patients perception of their oral health [table 2 ]. the effectiveness of the bidding technique in the assessment of wtp has been documented in literature. the ease of this method was evident in our study as none of the patients we approached refused to participate in the study. usually, bidding for an object starts from the lowest price ; however, this method may result in what has been termed as the as the starting point bias ; which states that a patient who is offered a low price will refuse to bid higher making it difficult to determine the minimum wtp price. the use of the median price is said to be one of the most effective ways to negate any effect of such bias. the fact that a majority of our patients were willing to pay the starting price for a dental implant is a positive sign and is contrary to the findings of leung and mcgrath, who found that most of their subjects were not willing to meet the market price of a dental implant. one of the factors for this difference, however, could be that our study focused on patients who had actually undergone tooth loss rather than the hypothetical situations used by others. in this respect, who in a similar study on overdenture patients suggested that a majority of patients would be willing to meet the price of a dental implant if it meant an increase in oral function and stability of their dentures. the loss of function due to a missing posterior tooth is an important factor in motivating the patient to seek replacement. while the loss of esthetics as a factor in patients seeking implants to replace a missing anterior tooth or prosthesis has been discussed in literature. the role of loss of function in influencing the patients choice of an implant is often overlooked. this was evident in our study when we saw that there was no significant difference in the wtp for an implant between patients who had lost an anterior or a posterior tooth. in fact the wtp price was seen in patients who had lost both anterior and posterior teeth, suggesting that a combination of loss of function and loss of esthetics can greatly influence a patient 's decision to pay for a dental implant. there are conflicting views in literature regarding the relationship between the period of time elapsed since tooth loss and patients desire to replace missing teeth. while some have pointed out that a longer time frame elapsed since the extraction of the tooth indicates the lack of interest on the part of the patient to replace his / her teeth others have stated that a prolonged loss of function could make the patient realize the value of replacing the tooth. interestingly, we found that the number of teeth lost and the time elapsed since the time of extraction were not significant factors in influencing wtp of the patient. however, given the small size of our paper and the several possible confounding factors, this fact should be studied in greater detail. in general, females have been found to be more willing to pay for healthcare services than men. our study found that women who said they were willing to pay for implant had higher mean wtp scores than the men, however, there was no significant difference in the number of men and women willing to pay the median price of a dental implant. this seems to suggest that, although gender is an issue in the wtp for dental implants, other factors perhaps play a greater role. the influence of income on the ability to pay is a debated topic. while our findings agree with investigators who have indicated a positive association between the income group and the wtp;[2628 ] others, including a recent study with methodology very similar to ours have found no such association. a possible explanation for this could be that the studies were carried out in different countries and settings. some of the studies also used hypothetical models rather than real patients, suggesting that although such models may predict general trends, the actual loss of function that a patient who undergoes extraction experiences is difficult to replicate. the fact that patients in a government setup are less likely to be wtp, for care is documented in literature. the fact that there was no significant difference in the distribution of income groups between the private and the government hospital seems to reinforce the fact that while wtp is dependent on income, it is perhaps also influenced by the patients perception of the cost of health care at a particular institution. a positive correlation was found between the perception of oral health and the mean wtp price of the patients. while this is similar to a recent study on patients wtp for implants, it is contrary to the findings of studies on implant overdentures orthognathic surgery, and dental caries where the wtp is usually inversely proportionate to the perception of oral health. this seems to suggest that wtp for implants, especially single implants, may be driven by an understanding of needs rather than symptoms. this also perhaps, explains why the acceptability of the implant was the most significant factor in influencing whether a patient would pay for the implant or not. the acceptance rate of the implant (patients willing to place an implant after initial interview) was 87% which is higher than those reported in other countries who reported acceptance rates between 27% and 58%. one of the reasons for this variation could be because our study was conducted in a hospital setting, where people were looking to replace their teeth rather than in the general population. despite this finding, the high acceptance rate is a positive sign and indicates that patients in riyadh city are not only aware of implants, but would also like to have them placed ; and in most cases be willing to pay for them. this study was designed to serve as an initial assessment of factors influencing wtp for dental implants in saudi arabia ; however, the factors highlight trends that in all probability transcend borders. a larger sample using specific patient groups could provide us with greater insight into specific factors and serve as a useful guideline to establish payment modalities for dental implants, especially in countries where the field is relatively new. within the limitations of this study, it can be concluded that despite the cost of treatment, dental implants seem to be an attractive treatment option for the replacement of missing teeth among patients in riyadh city. the income and gender of the patient and the setting of the practice all seem to influence the wtp of the patients. the greatest factor influencing the patient 's wtp is the acceptability of the implant to the patient. | background : one of the factors that dissuade patients needing tooth replacement from choosing dental implants is the prohibitive cost. willingness to pay (wtp) is a useful tool to determine the ideal cost of an expensive procedure.aim:the aim of this study was to study the factors that influence the willingness to pay (wtp) among patients attending a private clinic and compare them to those attending a government setup.materials and methods : a total of 100 patients (38 male, 62 female) who had one or more missing teeth were presented with different cost - benefit scenarios and then asked if they were willing to pay the median cost of a single implant in riyadh city. the mean wtp price was compared using the one way - anova, factors which could possibly influence patients wtp were grouped together in a binomial logistic regression model.results:of the 100 individuals surveyed 67% said they would be willing to pay the median price for the placement of an implant. a comparison of socio - demographic factors showed that significant differences were found between gender, income groups and setting of the clinic in the mean wtp price of the patients (p < 0.05). we also found that there was a significant difference in the mean wtp price between groups with regard to the area of the missing tooth, the patients perception of their oral health and the their desire to want an implant (p < 0.05).conclusion : the majority of the patients surveyed were willing to pay the median price for an implant. willingness to pay (wtp) is a multifactorial variable which is significantly influenced by the income of the patient, the setting of the clinic and the gender ; the most significant factor being the acceptability of the implant to the patient. |
chronic obstructive pulmonary disease (copd) is now the third leading cause of death in the united states.1 in 2007, the economic burden of copd in the us was $ 42.6 billion in health care costs and lost productivity.2 although different pharmacological treatments have shown improvement in lung functions in general copd patients, the predominantly emphysema phenotypes with poor lung functions are often considered for additional surgical procedures. these include the bullectomy,3 single and double lung transplantation,4 and, more recently, lung volume reduction (lvr) surgery (lvrs).5 the latter is based on the concept that targeted resection of the damaged tissue that causes hyperinflation allows more space for the residual lung, which results in improvement of chest wall mechanics and transpulmonary recoil pressures. this and other factors appear to contribute to the physiological and symptomatic improvements that follow lvrs. the national emphysema treatment trial (nett) showed that the patients who benefited the most from lvrs in terms of survival and functional improvement were those who had predominantly upper lobe emphysema and poor exercise capacity.5,6 however, significant short - term morbidity and mortality have been associated with lvrs.7 furthermore, the associated costs of lvrs are almost prohibitive and make this a less attractive option for lvr.8 different methods of bronchoscopic lvr (blvr) have been studied, and more alternatives to lvrs are being studied in clinical trials. most of the evidence in literature exists for one - way valves, sealants / hydrogels (from here on, collectively referred to as biolvr), coil implants (lvr coils [lvrcs ]), airway bypass stents, and bronchial thermal vapor ablation (btva) therapy. the valves work by preventing inspired air from entering target airways and allow exit of trapped air from distal airways. biolvr therapy involves administration of a fibrinogen suspension and thrombin solution into the airways separately. once in contact, these products polymerize into a hydrogel in situ. a localized inflammatory reaction ensues, causing atelectasis and remodeling, as well as a volume reduction over a 4- to 6-week period. btva uses heated water to produce thermal injury of the target tissue, which is followed by permanent fibrosis and atelectasis. airway bypass stents have been used to create and maintain passages between the bronchi and emphysematous lobes. in the lvrc method, once deployed, a coil conforms to its predetermined shape, by bending in the airway and causing compression of adjacent lung tissue, thereby creating local lvr. since the advent of these new blvr techniques, there has been no head - to - head comparison of one versus another. in this meta - analysis, we sought to analyze the comparative efficacy of each blvr technique. we used combinations of the following keywords : endobronchial valves, one way valves, lung sealants, coils, lung volume reduction surgery, bronchial thermal vapor ablation, and emphysema. the search from pubmed yielded all the studies included in this meta - analysis. to ensure a thorough search of the literature, we handsearched the reference lists of the included studies and previously published meta - analyses. for inclusion in our meta - analysis, we considered only those studies that reported the pre- and post - lvr data on lung functions (in specific, the forced expiratory volume in 1 second [fev1 ], forced vital capacity [fvc ], total lung capacity [tlc ], residual volume [rv ], and diffusion lung capacity of carbon monoxide [dlco ]), the 6-minute walk distance (6 mwd), and the st george s respiratory questionnaire (sgrq). prospective nonrandomized and randomized controlled trials (rcts) were included, provided pre- and post - intervention data (absolute numbers) or mean difference (between pre- and post - intervention) were available. we included prospective nonrandomized consecutive case series but excluded case reports. prospectively conducted multicenter cohort studies with retrospective analyses were also considered eligible for inclusion. however, retrospective cohort studies, as well as studies that reported data in median and interquartile range, were excluded. figure 1 summarizes the results of the selection process. as a general rule, for multiple publications of the same trials a total of seven studies915 from the subgroup of one - way valves, one from biolvr,16 and two from btva17,18 were affected by this rule (see supplementary material for details). our primary outcomes included assessments of lung function (fev1 and fvc) measured in liters, lung volumes (tlc and rv) measured in liters, diffusion capacity (dlco) measured in ml / min / mmhg, assessment of exercise capacity (6 mwd) measured in meters, and assessment of the health - related quality of life with the sgrq. analyses of secondary outcomes were related to the safety of a particular device or procedure. as the complications associated with each procedure were distinct from each other, we were not able to pool the data for a common outcome across different subgroups. for one - way valves, we included the incidence rates of pneumonia distal to valve, pneumothorax lasting more than 7 days, and migration of valves. data from the studies on airway bypass stents and btva were not sufficient enough to analyze. this included first author s name, year of publication, number of study participants, their age and sex distribution, presence of comorbidities besides copd, type of blvr, country of origin, and study design. for the analysis, we recorded the mean of pre- and post - blvr fev1, dlco, 6 mwd, and sgrq with standard deviations (sds), and, where necessary, the mean difference with sd or 95% confidence intervals (cis). for any included study, where such information was not complete for a particular outcome of interest, this information was not included. in any included study, if outcomes were assessed at different time points, we obtained the data available for the longest follow - up. where dlco was available in mmol / min / kpa units, we used the conversion factor of 0.335 to obtain data in ml / min / mmhg.19 6 mwd reported in feet was converted into meters using the following formula : standard errors (ses) were converted into sds using the following formula : for rcts, comparing a blvr with either control or an active comparator, we extracted data only for the cohort that received blvr (see supplementary material for details). the mean changes in the outcomes from blvr along with their 95% cis were estimated by pooling the available data using comprehensive meta - analysis software (v 2.2.064, biostat, englewood, nj, usa). we separately analyzed the pooled changes in primary and secondary outcomes for each type of blvr. random effects methods were used to account for variance between and within the studies.20 statistical heterogeneity was assessed with the i statistic.21 an i>60% indicated significant heterogeneity. where moderate - to - high heterogeneity was noticed, we reported the results in random effects model. for our analysis of safety data, we used total number of events and person years to calculate the incidence rate for a particular safety outcome. person years were calculated by multiplying the number of study participants at risk with the mean duration of follow - up (in years). if the number of cases was zero, a correction factor of 0.5 was added to both the events and person years.22 data were pooled, and the results are displayed in the form of forest plots. to check for publication bias, we constructed funnel plots of effect size and standard error20,23 and also analyzed results by using the begg and mazumdar rank correlation test.24 we used combinations of the following keywords : endobronchial valves, one way valves, lung sealants, coils, lung volume reduction surgery, bronchial thermal vapor ablation, and emphysema. the search from pubmed yielded all the studies included in this meta - analysis. to ensure a thorough search of the literature, we handsearched the reference lists of the included studies and previously published meta - analyses. for inclusion in our meta - analysis, we considered only those studies that reported the pre- and post - lvr data on lung functions (in specific, the forced expiratory volume in 1 second [fev1 ], forced vital capacity [fvc ], total lung capacity [tlc ], residual volume [rv ], and diffusion lung capacity of carbon monoxide [dlco ]), the 6-minute walk distance (6 mwd), and the st george s respiratory questionnaire (sgrq). prospective nonrandomized and randomized controlled trials (rcts) were included, provided pre- and post - intervention data (absolute numbers) or mean difference (between pre- and post - intervention) were available. we included prospective nonrandomized consecutive case series but excluded case reports. prospectively conducted multicenter cohort studies with retrospective analyses were also considered eligible for inclusion. however, retrospective cohort studies, as well as studies that reported data in median and interquartile range, were excluded. figure 1 summarizes the results of the selection process. as a general rule, for multiple publications of the same trials a total of seven studies915 from the subgroup of one - way valves, one from biolvr,16 and two from btva17,18 were affected by this rule (see supplementary material for details). our primary outcomes included assessments of lung function (fev1 and fvc) measured in liters, lung volumes (tlc and rv) measured in liters, diffusion capacity (dlco) measured in ml / min / mmhg, assessment of exercise capacity (6 mwd) measured in meters, and assessment of the health - related quality of life with the sgrq. analyses of secondary outcomes were related to the safety of a particular device or procedure. as the complications associated with each procedure were distinct from each other, we were not able to pool the data for a common outcome across different subgroups. for one - way valves, we included the incidence rates of pneumonia distal to valve, pneumothorax lasting more than 7 days, and migration of valves. data from the studies on airway bypass stents and btva were not sufficient enough to analyze. data were extracted on a prespecified worksheet. this included first author s name, year of publication, number of study participants, their age and sex distribution, presence of comorbidities besides copd, type of blvr, country of origin, and study design. for the analysis, we recorded the mean of pre- and post - blvr fev1, dlco, 6 mwd, and sgrq with standard deviations (sds), and, where necessary, the mean difference with sd or 95% confidence intervals (cis). for any included study, where such information was not complete for a particular outcome of interest, this information was not included. in any included study, if outcomes were assessed at different time points, we obtained the data available for the longest follow - up. where dlco was available in mmol / min / kpa units, we used the conversion factor of 0.335 to obtain data in ml / min / mmhg.19 6 mwd reported in feet was converted into meters using the following formula : standard errors (ses) were converted into sds using the following formula : for rcts, comparing a blvr with either control or an active comparator, we extracted data only for the cohort that received blvr (see supplementary material for details). the mean changes in the outcomes from blvr along with their 95% cis were estimated by pooling the available data using comprehensive meta - analysis software (v 2.2.064, biostat, englewood, nj, usa). we separately analyzed the pooled changes in primary and secondary outcomes for each type of blvr. random effects methods were used to account for variance between and within the studies.20 statistical heterogeneity was assessed with the i statistic.21 an i>60% indicated significant heterogeneity. where moderate - to - high heterogeneity was noticed, we reported the results in random effects model. for our analysis of safety data, we used total number of events and person years to calculate the incidence rate for a particular safety outcome. person years were calculated by multiplying the number of study participants at risk with the mean duration of follow - up (in years). if the number of cases was zero, a correction factor of 0.5 was added to both the events and person years.22 data were pooled, and the results are displayed in the form of forest plots. to check for publication bias, we constructed funnel plots of effect size and standard error20,23 and also analyzed results by using the begg and mazumdar rank correlation test.24 there were eight studies for one - way valves,26,29,30,3335,38,39 four for biolvr,19,27,31,32 two for lvrc,28,37 two for airway bypass stents,25,36 and one for btva.40 table 1 outlines the baseline characteristics of the study population. on average, study participants were > 58 years old. the duration of follow - up lasted between 1 and 12 months. there were a total of four rcts. for the studies using the biolvr method, the pooled mean change in fev1 was 0.18 l (95% ci : 0.09 to 0.26 ; p 7 days (incidence rate of 0.06 ; p 58 years old. the duration of follow - up lasted between 1 and 12 months. there were a total of four rcts for the studies using the biolvr method, the pooled mean change in fev1 was 0.18 l (95% ci : 0.09 to 0.26 ; p 7 days (incidence rate of 0.06 ; p<0.001), and with valve migration (incidence rate of 0.01 ; p=0.03). biolvr and lvrcs had a unique association with treatment - related copd exacerbations with an incidence rate of 0.07 (p=0.04) and 1.30 (p=0.01), respectively (figures s8 and s9). biolvr was also associated with an increase in treatment - related pneumonias (figure s10). the begg and mazumdar rank correlation tests24 did not show evidence of publication bias for the data on primary outcomes (see tables s1 and s2). we separately analyzed studies from the subgroups of one - way valves, biolvr, and lvrcs that studied participants for a minimum of 6 months. to the best of our knowledge, this is the first meta - analysis that has systematically analyzed the effects of different forms of blvr. although our meta - analysis was designed to compare different methods used for blvr, most of the studies included in our meta - analysis studied one - way valves. consequently, this subgroup had the largest number of study participants compared to the other methods (biolvr, lvrcs, airway bypass stents, and btva). overall, the findings of our meta - analysis favor biolvr as the most efficacious method of blvr. this is because not only did this subgroup show a statistically significant difference in the assessment of lung functions (fev1, fvc, tlc, rv, and dlco), but also showed the most increase in exercise capacity (as assessed by the 6 mwd). it also seemed paradoxical that this subgroup, in fact, showed a decrease in the fev1. direct comparison of the different blvr methods for our secondary outcomes was not possible, since each method had a unique and different side effect profile. however, there did seem to be more procedure-/device - related complications associated with the one - way valves than with the lvrcs or biolvr. data from the nett research group5 indicate that, at 6 months post - lvrs, the change in fev1 was 8.1%9.3% predicted at 6 months and 6.0%8.9% predicted at 12 months. this corresponds to an improvement of approximately 30% from baseline at 6 months and 22% from baseline at 12 months. the dominant finding of the nett was an increase in the exercise capacity (defined as an increase in the maximal workload by more than 10 watts from baseline) and health - related quality of life, as measured by sgrq, in those with predominantly upper lobe emphysema, in the surgical group versus the group that received medical therapy.5 the pre- to post - surgery data from the same study indicated that the change in 6 mwd at 6 months and 12 months was 47.3232.7 m and 14.4275.1 m, respectively.5 this corresponds to an improvement of 3.88% and 1.18%, respectively, compared to baseline. this study also showed that 68% of the 508 study participants randomized to surgery achieved an overall reduction in sgrq scores. most of the studies included in our meta - analysis had a shorter duration of follow - up and a much lower number of study participants compared to the nett. however, results of our post hoc analysis correspond to an improvement in fev1 of 43% and 31.2% in the subgroups of one - way valves and biolvr, respectively. similarly, for 6 mwd, results of our post hoc analysis correspond to an approximate 13.14% improvement in the subgroup of one - way valves and 5.34% in the subgroup of biolvr. thus, a comparison of our findings, in particular for fev1, 6 mwd, and sgrq, with the data from nett, at the same duration of follow - up (612 months), suggests noninferiority, if not equivalence, for blvr. indeed, the long - term follow - up data of 5 years from the nett showed an overall survival advantage in the lvrs group compared to medical treatment.6 this data also showed significant improvements in exercise capacity and health - related quality of life (as measured by sgrq) at 3 and 4 years post - surgery, respectively. while similar long - term data do not exist for most methods of blvr, more recent data report that the 5-year survival rates in patients treated with one - way valves exceeded 80%.12 however, in terms of the overall safety profile, if lvrs is associated with approximately 5.5% (5.5% in nett and between 5% and 20% in others) 90-day mortality, then, in comparison, current published literature shows that one - way valve therapy is associated with 1%, airway bypass stents with 3%, and biolvr with 0% 90-day mortality.15,25,27,41 the mechanism of lvr differs between one - way valves, biolvr, lvrcs, airway bypass stents, and btva. from a historical perspective the first in line were the proximal obstructing devices.42,43 however, because of their failure in producing effective lvr and the high incidence of procedural pneumothoraces, these devices soon fell out of favor. it was thought that flow from the extensive collateral ventilation (cv) pathways between and within the emphysematous lobes paradoxically led to hyperinflation distal to the occlusion. the one - way valves, because of their design, are less likely to be associated with the problem of paradoxical hyperinflation. however, as was the case with one - way obstructing devices, certain factors such as cv and fissure integrity have a bearing on the long - term success of procedures with one - way valves.30,35 in the post hoc analyses of both the us and european endobronchial valve for emphysema palliation trial (vent) studies, factors such as fissure integrity on computed tomography lung scans and lobar occlusion were associated with significant lvr, and patients who exhibited these signs on computed tomography had significantly improved clinical outcomes.30 most importantly, these results were sustained at 12 months post - procedure. recently, herth validated the use of a method to assess cv for predicting efficacy of one - way valves.29 their results showed an accuracy of 75%. it is likely that current ongoing research trials with one - way valves using this approach would show better outcomes compared to the earlier studies. in contrast to the one - way valves, the effect of biolvr for lvr is not dependent on interlobar fissure integrity.32 the effects seem dose dependent, with the best effect produced by high - dose (20 ml / sub - segment) versus low - dose (10 ml / sub - segment) sealant.27 aside from some short - term complications, including treatment - related pneumonia (figure s10) and copd exacerbations (figure s8), overall, as noted above, this method has been found to be very safe with no procedural mortality reported in studies.19,27,31 this is in contrast with the frequent procedure - related complications observed with one - way valves, such as pneumonia distal to valve implantation, valve- or procedure - related pneumothorax, and valve migration, as shown in figures s5s7. we separately analyzed studies that followed participants for a minimum of 6 months to a maximum of 12 months. first, moderate - to - high heterogeneity was observed in most of the analyses. this could be because of the differences in the baseline characteristics of the study participants, procedural techniques, assessment of outcomes, and the geographic locations in which the studies were conducted. however, in order to account for the between - study variance, we used random effects model to report our results. second, excluding the subgroup of one - way valves, most of the other subgroups did not have a sufficient number of studies, hence assessment of publication bias in these subgroups was not possible. third, most of the studies included in our meta - analysis were single - arm prospective trials and not rcts and a few were pilot studies, which, as standalone studies, can not be considered powered enough to draw strong conclusions from. despite these limitations, we believe our findings are significant, as this meta - analysis provides some form of comparability between the different methods of blvr. we believe that future studies can benefit from the estimates of effect sizes provided in our meta - analysis. these preliminary findings show that, excluding airway bypass stents, most of the methods of blvr show efficacy in improving lung functions and exercise capacity. moreover, these methods could likely be noninferior, if not equivalent, to lvrs. however, it is likely that, in clinical practice, the efficacy observed for most blvr methods would be tempered with considerations of the technical peculiarities of each procedure (such as the absence or presence of cv in the case of one - way valves) and their associated complications. lvrs may still be considered first - line for patients with predominantly upper lobe emphysema and poor exercise capacity, and only a select number of patients could be considered for blvr. this is because, firstly, there is no trial that directly compares lvrs and blvr and, secondly, none of the bronchoscopic methods are approved by the us food and drug administration. given the preliminary nature of our findings, we believe that more trials are needed that are designed with a comparative effectiveness research model, involve a larger number of participants, with a much longer duration of follow - up, and with different markers of improvement than the ones traditionally used in earlier studies. | backgroundover the last several years, the morbidity, mortality, and high costs associated with lung volume reduction (lvr) surgery has fuelled the development of different methods for bronchoscopic lvr (blvr) in patients with emphysema. in this meta - analysis, we sought to study and compare the efficacy of most of these methods.methodseligible studies were retrieved from pubmed and embase for the following blvr methods : one - way valves, sealants (biolvr), lvr coils, airway bypass stents, and bronchial thermal vapor ablation. primary study outcomes included the mean change post - intervention in the lung function tests, the 6-minute walk distance, and the st george s respiratory questionnaire. secondary outcomes included treatment - related complications.resultsexcept for the airway bypass stents, all other methods of blvr showed efficacy in primary outcomes. however, in comparison, the biolvr method showed the most significant findings and was the least associated with major treatment - related complications. for the biolvr method, the mean change in forced expiratory volume (in first second) was 0.18 l (95% confidence interval [ci ] : 0.09 to 0.26 ; p<0.001) ; in 6-minute walk distance was 23.98 m (95% ci : 12.08 to 35.88 ; p<0.01) ; and in st george s respiratory questionnaire was -8.88 points (95% ci : 12.12 to 5.64 ; p<0.001).conclusionthe preliminary findings of our meta - analysis signify the importance of most methods of blvr. the magnitude of the effect on selected primary outcomes shows noninfe - riority, if not equivalence, when compared to what is known for surgical lvr. |
the et2ds is a sample of men and women aged 6075 years with type 2 diabetes. the subjects were randomly selected by sex and 5-year age bands from the comprehensive lothian diabetes register (ldr) of people with type 2 diabetes living in lothian, scotland. a sample size of 1,000 was targeted to detect associations between baseline risk factors and both cognitive ability at baseline and cognitive change during subsequent follow - up. exclusion criteria, applied at the time of physical examination, have been reported previously (5). all subjects provided written informed consent, and the study was approved by the lothian research ethics committee. physical examinations were performed between august 2006 and august 2007 by trained researchers using standard operating procedures (5). a fasting venous blood sample was taken for measurement of inflammatory markers, total serum cholesterol, and plasma a1c. following measurements of height and weight, a 12-lead electrocardiogram (ecg) was taken for subsequent minnesota coding (http://www.epi.umn.edu/ecg/). after a 10-min rest in the supine position, systolic and diastolic blood pressure was measured in the right arm using a standard stethoscope and aneroid dial sphygmomanometer. right and left brachial, posterior tibial, and dorsalis pedis systolic pressures were then taken using an aneroid sphygmomanometer and a doppler probe. a self - administered questionnaire included questions on education ; history of myocardial infarction (mi), stroke or angina ; year of diabetes diagnosis ; smoking ; current medications ; and the world health organization (who) chest pain questionnaire (6). data were collected from the information and services division of the national health service (nhs) health services scotland on all medical and surgical discharges from scottish hospitals since 1981 (scottish morbidity record [smr01 ] scheme), and any icd-10 codes (or the equivalent icd-9 codes) indicating cardiovascular or cerebrovascular disease were extracted. fluid cognitive ability was assessed using tests of : nonverbal memory and immediate and delayed verbal declarative memory (faces and family pictures subtest, logical memory subtest from the wechsler memory scale iii) ; working memory, nonverbal reasoning, and processing speed (letter number sequencing, matrix reasoning, digit symbol test from the wechsler adult intelligence scale - iii [wais iii ]) ; executive function (verbal fluency test) ; and mental flexibility (trail making test vocabulary (crystallized intelligence) was measured using the combined junior and senior mill hill vocabulary scale (mhvs) synonyms (12). as results on vocabulary - based tests vary little with ageing, they can be used to approximate peak prior cognitive ability (13). late - life cognition adjusted for vocabulary also correlates highly with actual cognitive change (14). the hospital anxiety and depression scale (15) blood samples were processed at the research clinic, and plasma was stored at 40c. assays for plasma crp, il-6, and tnf- were performed in the university department of medicine, glasgow royal infirmary. tnf- and il-6 antigen levels were determined using high - sensitivity elisa kits (r&d systems, oxon, u.k.). errors identified by comparing the double data entries were resolved by referring to the paper records. anonymized data on demographic and clinical variables from the ldr were used to compare the characteristics of study responders and nonresponders. ankle brachial index, a measure of subclinical atherosclerosis (17), was calculated by dividing the lowest of the ankle pressures by the higher of the arm pressures. smoking was categorized as current, ex, or never - smoked, with anyone stopping within the past 6 months recategorized as a current smoker. duration of diabetes was calculated to the nearest year by subtracting the self - reported year of diagnosis from the date of attendance at the research clinic. the highest self - reported level of education was categorized as primary, secondary, professional qualification, or university / college degree. scottish index of multiple deprivation (deprivation) (18) was assigned to each subject according to their postcode of residence. the following criteria were used to define mi : 1) subject recall of a doctor 's diagnosis of mi, 2) positive who chest pain questionnaire for mi, 3) ecg evidence of ischemia (minnesota codes 1.11.3, 4.14.2, 5.15.3 or 7.1), and 4) prior hospital discharge code for mi (icd-10 codes i21i23, i252). mi was recorded if two of the first three criteria were met or if both the first and last criteria were met. equivalent criteria for angina were : 1) subject recall of a doctor 's diagnosis of the condition or being on regular medication for angina, 2) positive who chest pain questionnaire for angina, 3) ecg evidence of ischemia, and 4) prior hospital discharge code for ischemic heart disease (icd-10 codes i20i25). angina was recorded if two of the first three criteria were met or if both the first and last criteria were met. stroke was recorded if two of three of the following criteria were met : 1) subject recall of a doctor 's diagnosis of stroke, 2) prior hospital discharge code consistent with stroke (icd-10 codes i61, i63i66, i679, i694), and 3) confirmation by review of clinical notes that the event was not due to a transient ischemic attack. continuous variables were normally distributed apart from trail making test scores, crp, il-6, and tnf- levels, which were transformed using natural logarithms. the inflammatory markers were trimmed for points exceeding 3.5 sds from the mean prior to analysis. scores from the fluid cognitive tests were used to obtain a general cognitive ability factor (g) via principal components analysis. age- and sex - adjusted linear regression assessed the association between cognitive scores and inflammatory markers. further adjustments were made for vocabulary (mhvs) and then for additional covariates to adjust for mood (hospital anxiety and depression scale depression score), duration of diabetes, glycemic control (plasma a1c), cardiovascular risk factors (total cholesterol, bmi, diastolic blood pressure, smoking), cardiovascular disease (mi, angina, stroke, ankle brachial index), and level of education. the analyses had over 90% power for a two - sided significance test (= 0.05) to detect a standardized coefficient of 0.10. physical examinations were performed between august 2006 and august 2007 by trained researchers using standard operating procedures (5). a fasting venous blood sample was taken for measurement of inflammatory markers, total serum cholesterol, and plasma a1c. following measurements of height and weight, a 12-lead electrocardiogram (ecg) after a 10-min rest in the supine position, systolic and diastolic blood pressure was measured in the right arm using a standard stethoscope and aneroid dial sphygmomanometer. right and left brachial, posterior tibial, and dorsalis pedis systolic pressures were then taken using an aneroid sphygmomanometer and a doppler probe. a self - administered questionnaire included questions on education ; history of myocardial infarction (mi), stroke or angina ; year of diabetes diagnosis ; smoking ; current medications ; and the world health organization (who) chest pain questionnaire (6). data were collected from the information and services division of the national health service (nhs) health services scotland on all medical and surgical discharges from scottish hospitals since 1981 (scottish morbidity record [smr01 ] scheme), and any icd-10 codes (or the equivalent icd-9 codes) indicating cardiovascular or cerebrovascular disease were extracted. fluid cognitive ability was assessed using tests of : nonverbal memory and immediate and delayed verbal declarative memory (faces and family pictures subtest, logical memory subtest from the wechsler memory scale iii) ; working memory, nonverbal reasoning, and processing speed (letter number sequencing, matrix reasoning, digit symbol test from the wechsler adult intelligence scale - iii [wais iii ]) ; executive function (verbal fluency test) ; and mental flexibility (trail making test part b). vocabulary (crystallized intelligence) was measured using the combined junior and senior mill hill vocabulary scale (mhvs) synonyms (12). as results on vocabulary - based tests vary little with ageing, they can be used to approximate peak prior cognitive ability (13). late - life cognition adjusted for vocabulary also correlates highly with actual cognitive change (14). the hospital anxiety and depression scale (15) blood samples were processed at the research clinic, and plasma was stored at 40c. assays for plasma crp, il-6, and tnf- were performed in the university department of medicine, glasgow royal infirmary. tnf- and il-6 antigen levels were determined using high - sensitivity elisa kits (r&d systems, oxon, u.k.). errors identified by comparing the double data entries were resolved by referring to the paper records. anonymized data on demographic and clinical variables from the ldr were used to compare the characteristics of study responders and nonresponders. ankle brachial index, a measure of subclinical atherosclerosis (17), was calculated by dividing the lowest of the ankle pressures by the higher of the arm pressures. smoking was categorized as current, ex, or never - smoked, with anyone stopping within the past 6 months recategorized as a current smoker. duration of diabetes was calculated to the nearest year by subtracting the self - reported year of diagnosis from the date of attendance at the research clinic. the highest self - reported level of education was categorized as primary, secondary, professional qualification, or university / college degree. scottish index of multiple deprivation (deprivation) (18) was assigned to each subject according to their postcode of residence. the following criteria were used to define mi : 1) subject recall of a doctor 's diagnosis of mi, 2) positive who chest pain questionnaire for mi, 3) ecg evidence of ischemia (minnesota codes 1.11.3, 4.14.2, 5.15.3 or 7.1), and 4) prior hospital discharge code for mi (icd-10 codes i21i23, i252). mi was recorded if two of the first three criteria were met or if both the first and last criteria were met. equivalent criteria for angina were : 1) subject recall of a doctor 's diagnosis of the condition or being on regular medication for angina, 2) positive who chest pain questionnaire for angina, 3) ecg evidence of ischemia, and 4) prior hospital discharge code for ischemic heart disease (icd-10 codes i20i25). angina was recorded if two of the first three criteria were met or if both the first and last criteria were met. stroke was recorded if two of three of the following criteria were met : 1) subject recall of a doctor 's diagnosis of stroke, 2) prior hospital discharge code consistent with stroke (icd-10 codes i61, i63i66, i679, i694), and 3) confirmation by review of clinical notes that the event was not due to a transient ischemic attack. continuous variables were normally distributed apart from trail making test scores, crp, il-6, and tnf- levels, which were transformed using natural logarithms. the inflammatory markers were trimmed for points exceeding 3.5 sds from the mean prior to analysis. scores from the fluid cognitive tests were used to obtain a general cognitive ability factor (g) via principal components analysis. age- and sex - adjusted linear regression assessed the association between cognitive scores and inflammatory markers. further adjustments were made for vocabulary (mhvs) and then for additional covariates to adjust for mood (hospital anxiety and depression scale depression score), duration of diabetes, glycemic control (plasma a1c), cardiovascular risk factors (total cholesterol, bmi, diastolic blood pressure, smoking), cardiovascular disease (mi, angina, stroke, ankle brachial index), and level of education. the analyses had over 90% power for a two - sided significance test (= 0.05) to detect a standardized coefficient of 0.10. from 5,454 invitations sent out, 1,252 people initially agreed to participate in the study and 1,066 (85%) were recruited. crude response rates varied between sex and 5-year age bands, from 13.6% in the oldest women aged 7074 years, to 27.5% in men aged 6569 years. study participants were found to be similar to the 4,388 nonresponders (table 1). despite some statistically significant differences in demographic and clinical characteristics, similarities persisted when comparison was made by sex and 5-year age band and when adjustment was made for error rates in ldr data recording (data not shown). characteristics and clinical features of the et2ds population and nonresponders data are means sd or n (%). two subjects on the ldr had no data and were discarded from the analyses (i.e., total number of nonresponders was 4,388) ; p < 0.001 (test for independence or t test for differences between groups). bp, blood pressure ; simd, scottish index of multiple deprivation. characteristics and clinical features of the et2ds population data are means sd, median (quartile range), or n (%). bp, blood pressure ; chd, coronary heart disease (mi or angina) ; dst, digit symbol test ; faces, faces and family pictures subtest ; hads, hospital anxiety and depression scale ; lm, logical memory ; lns, letter - number sequencing ; mr, matrix reasoning ; tmt, trail making test - part b ; vft, verbal fluency test. age- and sex - adjusted associations between inflammatory marker levels and cognitive test scores are shown in table 3. the associations for il-6 and tnf- were larger and statistically significant for the majority of the tests with standardized coefficients ranging from 0.074 to 0.173 (all p < 0.05). multivariate associations between biomarkers and late - life cognition, and estimated cognitive change adjustment variables are hospital anxiety and depression scale depression score, duration of diabetes, a1c, total cholesterol, bmi, diastolic blood pressure, smoking, coronary heart disease (mi or angina), stroke, ankle - brachial index, and level of education. dst, digit symbol test ; faces, faces and family pictures subtest ; lm, logical memory ; lns, letter - number sequencing ; mr, matrix reasoning ; tmt, trail making test - part b ; vft, verbal fluency test. all inflammatory measures associated with age- and sex - adjusted mhvs scores with standardized coefficients were : crp 0.075 (p < 0.05), il-6 0.091 (p < 0.01), and tnf- 0.087 (p < 0.05). age, sex, and vocabulary adjustment weakened the magnitude and statistical significance of the associations (table 3). however, the strongest il-6 and tnf- associations were retained after adjustments for both vocabulary and the other covariates. this was particularly evident for il-6 with standardized coefficients for the full models in the ranges 0.074 to 0.113. in this representative population of people with type 2 diabetes, elevated levels of plasma crp, il-6, and tnf- were significantly associated with poorer age- and sex - adjusted general cognitive abilities. the maximum effect size for the age- and sex - adjusted g associations was with il-6, which corresponded to a 0.173 decrease in g for every twofold increase in il-6 levels. adjustments for cardiovascular disease / risk factors, glycemic control, duration of diabetes, and education resulted in reductions to the effect sizes. however, this does not indicate whether these factors are confounders or whether they could be mediators in the same pathway leading to cognitive decline. the association between il-6 and g, although weakened, remained statistically significant after full multivariate adjustment, suggesting a possible role for il-6 in cognitive decline. analyses were repeated to exclude potential dementia cases (mini mental state examination score < 24, n = 33), but this did not affect the results. a limited number of high - quality studies have investigated the relationship between inflammatory biomarkers and cognition in nondiabetic populations. these studies have found associations of a modest but similar order to those reported in the present study (2024). as all our study participants had diabetes, we were not able to formally test for a differential effect size in diabetes. the strengths of the present study include the application of a cognitive test battery covering major cognitive domains and extensive phenotyping for potential confounding or mediating factors. the use of a general cognitive factor (g) helped avoid potential problems caused by multiple testing. the study population had a verified clinical diagnosis of type 2 diabetes and was shown to be representative of the target population of elderly, community - dwelling men and women with the full spectrum of severity of type 2 diabetes (from diet - controlled to insulin - treated). although cross - sectional, the present results provide the best epidemiological evidence to date for an inflammation - cognition relationship in people with type 2 diabetes. as markers of inflammation are sensitive to acute illness and alter with age, it is questionable whether a single, late - life measurement accurately reflects the lifetime risk of exposure to inflammation (25). this will be addressed in follow - up phases of the et2ds, when inflammatory markers and cognition will be remeasured and genetic predictors of inflammatory markers will be studied. in conclusion, raised circulating inflammatory marker levels are associated with poorer late - life cognitive ability in people with type 2 diabetes, even after adjustment for a vocabulary - based estimate of peak prior cognitive ability. future longitudinal studies are required to confirm the direction of the association and whether there is evidence for causality. | objectiveto determine whether circulating levels of the inflammatory markers c - reactive protein (crp), interleukin (il)-6, and tumor necrosis factor (tnf)- are associated with cognitive ability and estimated lifetime cognitive decline in an elderly population with type 2 diabetes.research design and methodsa cross - sectional study of 1,066 men and women aged 6075 years with type 2 diabetes and living in lothian, scotland (the edinburgh type 2 diabetes study), was performed. seven cognitive tests were used to measure abilities in memory, nonverbal reasoning, information processing speed, executive function, and mental flexibility. the results were used to derive a general intelligence factor (g). a vocabulary based test was administered as an estimate of peak prior cognitive ability. results on the cognitive tests were assessed for statistical association with inflammatory markers measured in a venous blood sample at the time of cognitive testing.resultshigher il-6 and tnf- levels were associated with poorer age- and sex - adjusted scores on the majority of the individual cognitive tests. they were also associated with g using standardized regression coefficients 0.074 to 0.173 (p < 0.05). after adjusting for vocabulary, education level, cardiovascular dysfunction, duration of diabetes, and glycemic control, il-6 remained associated with three of the cognitive tests and with g.conclusionsin this representative population of people with type 2 diabetes, elevated circulating levels of inflammatory markers were associated with poorer cognitive ability. il-6 levels were also associated with estimated lifetime cognitive decline. |
species of the genus fusarium are among the most destructive fungal plant pathogens known and are responsible for major yield losses during cultivation of wheat, maize, barley, and soybeans. many species of fusarium produce mycotoxins as they grow parasitically within the plant, and ingestion of contaminated grain and food products processed from this grain causes acute and chronic health problems for both humans and animals. some species of fusarium produce trichothecenes, sesquiterpenoid mycotoxins that inhibit eukaryotic protein synthesis and other cellular functions in animals that ingest contaminated feed. type a trichothecenes (e.g., t-2 toxin, ht-2 toxin, diacetoxyscirpenol) are of particular concern because they are considerably more toxic than the type b group (e.g., deoxynivalenol and nivalenol). as part of their defense response to xenobiotics, plants can modify the structure of several mycotoxins, including trichothecenes, by conjugation to sugars, organic acids, or sulfates, which reduce their phytotoxicity and may facilitate their sequestration. whereas conjugation to sugars may protect plants from the ill effects of the toxins, these so - called masked mycotoxins present a potential food safety concern because, although toxicological data are scarce, several studies highlight the potential threat to consumer safety from these substances. in particular, the possible hydrolysis of masked mycotoxins back to their toxic parents during mammalian digestion is of considerable concern. structurally t-2 toxin, 1, r = ac (figure 1) is (2,3,4,8)-4,15-bis(acetyloxy)-3-hydroxy-12,13-epoxytrichothec-9-en-8-yl 3-methylbutanoate, which in animals is known to be predominantly metabolized to the 4-o - deacetylated form known as ht-2 toxin, 1, r = h (figure 1). glucoside conjugates of t-2 toxin have been reported in fusarium - infected grain and fusarium culture material, although to date the anomericity of the 3-o - linked glucosyl group is unknown. t-2 toxin--glucoside, 2, and t-2 toxin--glucoside, 3 (figure 1), are anticipated to have very different physical properties. more importantly, the relative toxicities of the two anomers are as yet unknown, and the ability to test the naturally occurring form needs to be addressed. structures of t-2 toxin, 1 (r = ac), ht-2 toxin, 1 (r = h), t-2 toxin--glucoside, 2, and t-2 toxin--glucoside, 3. one of the most studied masked trichothecenes is deoxynivalenol-3-glucoside, which has been reported from contaminated cereal crops and in food products derived from these crops. nuclear magnetic resonance (nmr) studies have shown that the naturally occurring glucoside is deoxynivalenol-3--glucoside. plant glucosyltransferase genes that control the conversion of deoxynivalenol to deoxynivalenol-3--glucoside have been identified, and a barley glucosyltransferase gene has been engineered into wheat to improve resistance to fusarium head scab. in addition, a deoxynivalenol glucosyltransferase gene has been cloned and expressed in yeast. as a result, deoxynivalenol-3--glucoside has been prepared using yeast expression and has been available for studies on its stability during food processing and the digestive fate of this masked mycotoxin. although initial studies reported that deoxynivalenol-3--glucoside is relatively stable to gastric conditions, it was recently reported that masked mycotoxins can be deconjugated by human colon microbiota, thus releasing their parent forms. because parent toxins may be absorbed in the intestine, this cleavage should be considered of toxicological relevance depending on the colonic absorption of the target compound. we have recently shown that three species of blastobotrys are able to biotransform t-2 toxin to t-2 toxin--glucoside, 2 (figure 1), and these yeast species appeared to provide an efficient way to produce the material necessary to study the digestive fate or animal toxicity of t-2 toxin - glucoside and related compounds, as well as develop methods for their detection. it was first important to determine which anomeric form of t-2 toxin - glucoside was produced in fusarium - contaminated cereals before proceeding with larger scale studies using the yeast biotransformation product. for this reason, t-2 toxin--glucoside, 3 (figure 1), was chemically synthesized, and along with t-2 toxin--glucoside, 2 (figure 1), the yeast biotransformation product, compared to the t-2 toxin - glucoside found in contaminated grain. we present here a comparison of the chromatographic and spectroscopic properties of the two anomeric forms, their relative reactivities to antibodies prepared with t-2 toxin--glucoside or t-2 toxin, their relative phytotoxicities, the stabilities and bioavailabilities of these masked mycotoxins after ingestion, and the anomeric form of the naturally occurring t-2 toxin - glucoside. these results become particularly relevant if international standards are developed for the detection and quantitation of t-2 toxin and t-2 toxin - glucoside in cereal grains and products made from them. nmr experiments were performed with acetone - d6 as the solvent on a bruker avance amx 500 spectrometer (bruker biospin corp., billerica, ma, usa) operating at 500.11 mhz using a standard 5 mm z - gradient bbi probe at 27 c. chemical shifts are reported as parts per million from tetramethylsilane calculated from the lock solvent. the deuterated solvents used were obtained from cambridge isotope laboratories (andover, ma, usa). the pulse sequences used were those supplied by bruker, and processing was done with the bruker topspin software package (v. 1.3). additional nmr experiments with tetra - o - tips--glucosyl t-2 toxin, 6, and t-2 toxin--glucoside, 3, were performed on an agilent 600 mhz nmr spectrometer (agilent, santa clara, ca, usa). one wheat and one oat sample were extracted for comparison with t-2 toxin - glucoside standards. samples were finely ground with a tecator cyclotec 1093 (international pbi, milan, italy) laboratory mill equipped with a 500 mm sieve. ten grams of each ground sample was extracted with 30 ml of acetonitrile / water (84:16 v / v) by orbital shaking for 2 h. after filtration through filter paper, 10 ml of extract was cleaned with a mycosep 227 column (romer laboratories, union, mo, usa). purified extract (6 ml, equivalent to 2 g of sample) was dried under an air stream at 50 c. extracts of naturally contaminated cereals or t-2 toxin - glucoside standards were analyzed by lc coupled to tandem mass spectrometry (ms / ms) as previously described. lc - ms / ms analyses were performed by a qtrap ms / ms system, from applied biosystems (foster city, ca, usa) equipped with an electrospray ionization (esi) interface and an 1100 series micro - lc system comprising a binary pump and a microautosampler from agilent technologies (waldbronn, germany). the column used was a 150 3 mm i.d., 4 m, synergi hydro, with a 4 mm 2 mm i.d., 10 m, aqua c18 guard column (phenomenex, torrance, ca, usa). the flow rate of the mobile phase was 200 l / min, whereas the injection volume was 20 l. eluent a was water and eluent b was methanol, both containing 5 mm ammonium acetate. eluent b was increased from 20 to 40% in 3 min, then increased to 63% in 35 min, and kept constant for 9 min. for column re - equilibration, eluent b was decreased to 20% in 1 min and kept constant for 9 min. for ms analyses, the esi interface was used with the following settings : temperature, 350 c ; curtain gas, nitrogen, 30 psi ; nebulizer gas, air, 10 psi ; auxiliary gas, air, 30 psi ; ion spray voltage, + 4500 v, positive ion mode. the ms was operated in enhanced product ion (epi) mode, applying a collision energy (ce) for stimulation of ion fragmentation of 10, or multiple reaction monitoring (mrm) mode to observe several distinctive ions produced upon fragmentation of the toxin with ammonium adduct [m + nh4 ] ion. for t-2 toxin - glucoside, the parent ion (m / z 646) and fragment ions were monitored to observe elution of the separated t-2 toxin conjugates. operation of the lc - ms / ms instrument and interpretation of the acquired data were done utilizing the analyst (absciex) software provided by the ms instrument manufacturer. t-2 toxin - glucosides were prepared using t-2 toxin that had been isolated and purified from liquid cultures of fusarium sporotrichioides strain 5493cos9 - 1#11 as described previously. t-2 toxin--glucoside, 2 (optical rotation, []d = + 79.74, c 0.153, ch3oh), was prepared by feeding t-2 toxin to blastobotrys muscicola cultures as described previously. t-2 toxin--glucoside, 3, was synthesized as described below (figure 2). pentaacetyl--glucopyranose (1.0 g, 2.56 mmol) was dissolved in dichloromethane (20 ml), and ethanethiol (220 l, 3.07 mmol) was added followed by bf3oet (1.6 ml, 12.8 mmol) at ambient temperature under an argon atmosphere. after 2 h, the reaction mixture was diluted with dichloromethane and washed with saturated sodium bicarbonate. the aqueous phase was extracted with dichloromethane, and the combined organic phase was washed with brine and dried over sodium sulfate. the filtrate was concentrated, and the residue was purified by column chromatography over silica gel (hexane / ethyl acetate, 1:1), giving 660 mg (67%) of a colorless oil in the form of a 1:1,-mixture. to a solution of 4 (660 mg, 1.68 mmol) in methanol (16.5 ml) was added sodium methoxide (10 mg, 0.17 mmol) at ambient temperature. after 1 h, the reaction mixture was neutralized with amberlite 120. the resin was filtered off, and the filtrate was concentrated to give a colorless oil (340 mg), which was dissolved in 2,6-lutidine (15 ml) (sigma - aldrich, st. louis, mo, usa) and treated with triisopropylsilyl trifluoromethanesulfonate (2 ml, 4.9 mmol) (sigma - aldrich). the reaction mixture was heated to 130 c, and after 1.5 h, further triisopropylsilyl trifluoromethanesulfonate (2 ml, 4.9 mmol) was added. the reaction mixture was maintained at 130 c for 2 h, then further triisopropylsilyl trifluoromethanesulfonate (2 ml, 4.9 mmol) was added. after 2 h, the reaction mixture was cooled to room temperature, diluted with hexane, and washed with 0.1 m hcl until the water phase remained acidic. the filtrate was concentrated and purified by column chromatography over silica gel eluting with hexane, a colorless oil (680 mg, 53%) as a 1:1 mixture of,-isomers. a solution of 5 (110 mg, 0.13 mmol) and t-2 toxin (40 mg, 0.086 mmol) was dissolved in dry dichloromethane (0.4 ml) with 3 acid - washed molecular sieves (alfa aesar, ward hill, ma, usa). the reaction mixture was cooled to 78 c under an argon atmosphere, and then n - iodosuccinimide (26 mg, 0.15 mmol) (chem - impex int. after 0.5 h, trifluoromethanesulfonic acid (2.3 l, 0.04 mmol) (sigma - aldrich) was added to the cold solution. after 3 h, the reaction mixture was quenched with triethylamine (emd, philadelphia, pa, usa), and the molecular sieves were filtered off. the filtrate was concentrated and purified by column chromatography over silica gel (eluent, hexane / ethyl acetate 4:1) to give a colorless oil (100 mg, 95%) as a 1:5 mixture of,-isomers. h nmr (600 mhz in cdcl3) for -isomer : 5.66 (d, j = 3.3 hz, 1h, h-4), 5.63 (d, j = 5.9 hz, 1h, h-10), 5.27 (d, j = 5.5 hz, 1h, h-8), 4.91 (d, j = 5.9 hz, 1h, h-26), 4.31 (d, j = 12.1 hz, 1h, h-15a), 4.27 (dd, j = 4.8, 3.67 hz, 1h, h-3), 4.10 (d, j = 5.5 hz, 1h, h-11), 4.08 (overlapped with h-15b, 1h, h-28), 4.07 (d, j = 12.5 hz, 1h, h-15b), 3.95 (d, j = 2.9 hz, 1h, h-29), 3.90 (d, j = 5.9 hz, 1h, h-27), 3.89 (d, j = 5.8 hz, 1h, h-30), 3.84 (d, j = 5.1 hz, 2h, h-31a, b), 3.73 (d, j = 4.8 hz, 1h, h-2), 2.92 (d, j = 4.0 hz, 1h, h-13a), 2.75 (d, j = 4.0 hz, 1h, h-13b), 2.29 (dd, j = 15.0, 5.9 hz, 1h, h-7a), 2.09 (m, 1h, h-18), 2.07 (s, 1h, h-23), 2.05 (m, 1h, h-19), 2.00 (s, h-25), 1.99 (overlapped with h-25, 1h, h-7b), 1.72 (s, h-16), 0.95 (d, j = 6.2 or 5.1 hz, 1h, h-20), 0.94 (d, j = 6.2 or 5.1 hz, 1h, h-21), 0.67 (s, h-14) ; c nmr (150 mhz in cd2cl3) 172.4 (c-17), 170.2 (c-22), 169.8 (c-24), 135.1 (c-9), 124.1 (c-10), 103.4 (c-26), 83.5 (c-30), 82.8 (c-3), 80.6 (c-4), 79.5 (c-2), 78.0 (c-28), 77.3 (c-27), 71.1 (c-29), 68.0 (c-8), 66.8 (c-11), 65.7 (c-31), 64.3 (c-15), 64.1 (c-12), 48.5 (c-5), 46.7 (c-13), 43.4 (c-18), 43.0 (c-6), 26.9 (c-7), 25.7 (c-19), 22.1 (c-20), 22.1 (c-21), 20.9 (c-25), 20.6 (c-23), 20.1 (c-16), 6.2 (c-14) ; hrms - esi (m / z) [m + na ] calcd for c66h124o14si4na 1275.7966, found 1275.7947. the above,-mixture of 6 (100 mg, 0.08 mmol) was dissolved in thf (1.0 ml) and treated at 0 c with tetrabutylammonium fluoride (1.6 ml, 1.6 mmol) (acros - thermo fisher scientific inc., the reaction mixture was allowed to warm to room temperature and stirred for 2.5 h, after which it was concentrated and purified by column chromatography over silica gel (eluent, chloroform / methanol, 8:1) to give a colorless oil (42 mg, 84%) of a 1:5,-mixture. further purification of this mixture by c18 hplc (water acetonitrile 2540%) and freeze - drying gave 21 mg (42%) of the pure -isomer, 3, as a white amorphous powder. h nmr (600 mhz in cd3od) 5.96 (d, j = 3.0 hz, 1h, h-4), 5.77 (d, j = 6.00 hz, 1h, h-10), 5.31 (d, j = 5.6 hz, 1h, h-8), 4.46 (dd, j = 4.9, 3.2 hz, 1h, h-3), 4.43 (d, j = 7.7 hz, 1h, h-26), 4.37 (d, j = 6.2 hz, 1h, h-11), 4.36 (d, j = 12.7 hz, 1h, h-15a), 4.08 (d, j = 12.5 hz, 1h, h-15b), 3.81 (dd, j = 12.0, 2.2 hz, 1h, h-31a), 3.70 (d, j = 5.0 hz, 1h, h-2), 3.63 (dd, j = 12.0, 5.8 hz, 1h, h-31b), 3.34 (t, j = 9.0, 8.9 hz, 1h, h-28), 3.28 (t, j = 9.0, 9.0 hz, 1h, h-29), 3.24 (dd, j = 9.0, 7.8 hz, 1h, h-27), 3.19 (ddd, j = 9.6, 5.8, 2.2 hz, 1h, h-30), 3.03 (d, j = 3.8 hz, 1h, h-13a), 2.85 (d, j = 3.9 hz, 1h, h-13b), 2.36 (dd, j = 15.2, 6.0 hz, 1h, h-7a), 2.14 (dd, j = 7.6, 2.4 hz, 1h, h-18), 2.07 (s, h-23), 2.05 (s, 1h, h-25), 2.05 (m, h-19), 1.92 (d, j = 15.2 hz, 1h, h-7b), 1.73 (s, h-16), 0.95 (d, j = 6.6 hz, 1h, h-20), 0.94 (d, j = 6.6 hz, 1h, h-21), 0.72 (s, 1h, h-14) ; c nmr (150 mhz in cd2cl3) 174.1 (c-17), 170.8 (c-24), 170.7 (c-22), 137.2 (c-9), 125.2 (c-10), 103.8 (c-26), 83.9 (c-3), 81.3 (c-4), 80.6 (c-2), 78.4 (c-30), 78.2 (c-28), 74.9 (c-27), 71.6 (c-29), 69.4 (c-8), 68.6 (c-11), 65.9 (c-15), 65.4 (c-12), 62.8 (c-31), 50.2 (c-5), 48.0 (c-13), 44.6 (c-18), 44.5 (c-6), 28.9 (c-7), 27.0 (c-19), 22.9 (c-20), 22.8 (c-21), 21.3 (c-25), 20.9 (c-23), 20.6 (c-16), 7.2 (c-14) ; hrms - esi (m / z) [m + na ] calcd for c30h44o14na 651.2629, found 651.2618 ; optical rotation []d = + 7.51 (c 0.080, ch3oh). the first of these was a competitive indirect enzyme - linked immunosorbent assay (ci - elisa) based upon an antibody (mab 2 - 13) developed against t-2 toxin-3--glucoside, conjugated to ovalbumin (e.g., t-2g ova), as described previously. the second immunoassay format was a commercial test kit previously validated to detect t-2 toxin and ht-2 toxin (veratox for t-2/ht-2) (neogen corp., lansing, mi, usa). the methanol content indicated in the test kit instructions, the t-2 toxin - glucoside standards were prepared in 35% (v / v) methanol / water. the single - celled alga chlamydomonas reinhardtii was used to assess the relative phytotoxicity of t-2 toxin, t-2 toxin--glucoside, and t-2 toxin--glucoside, as described previously. triplicate cultures (10 ml) were initiated with 10 cells / ml containing a 100 m concentration of an individual trichothecene and grown for 6 days under fluorescent lights, with agitation of 200 rpm. culture doublings were calculated as follows : (log of the final density log of the initial cell density)/log 2. briefly, the main digestive juices were prepared by mixing salts and enzymes and were preheated at 37 c before use. a volume of 200 l of a water / methanol (25:75, v / v) solution containing the target compounds was transferred in a 4 ml septum vial, and the solvent was evaporated under nitrogen. the in vitro digestion was started by adding 75 l of artificial saliva to 200 l of the water / methanol (25:75 v / v) solution containing the target analyte (500 g / l). after 5 min of incubation at 37 c, 150 l of artificial gastric juice was added and the mixture was incubated again for 2 h. at the end of the gastric step, 25 l of 1 m bicarbonate solution with 150 l of artificial duodenal juice and 75 l of artificial bile juice were added, and then a final incubation step of 2 h was performed. finally, 25 l of acetonitrile was added to stop the reactions, and the sample was centrifuged for 10 min at 10000 rpm, prior to direct lc - ms / ms analysis. human colonic fermentation of t-2 toxin--glucoside, t-2 toxin--glucoside, and t-2 toxin was carried out as described previously. these samples were immediately placed in an anaerobic environment and then mixed and weighed to obtain a 10% fecal solution in a phosphate saline buffer (pbs). for each sample 1.8 ml of growth medium, prepared as described previously, and 1.8 ml of fecal solution were mixed and added to 0.4 ml of a toxin solution, at a final concentration of 500 g / l. each vial was then treated with a slight nitrogen flow to eliminate oxygen and perform fermentations under anaerobic condition. samples were incubated in a water bath at 37 c and shaken at a rate of 200 strokes / min. fermentations were stopped immediately to have controls and then after 30 min and 24 h, by cooling samples to room temperature and adding 0.4 ml of acetonitrile. samples were immediately centrifuged at 14000 rpm for 10 min and stored at 20 c. at the same time, samples without added mycotoxin were prepared. samples were diluted adding acetonitrile (1:2 v / v) and directly analyzed for t-2 toxin - glucoside, t-2 toxin, and ht-2 toxin by lc - ms / ms using mrm as described above. nmr spectra were recorded for t-2 toxin--glucoside, obtained by yeast biotransformation (figure 3a, c) and for chemically synthesized t-2 toxin--glucoside (figure 3b, d). both compounds are characterized by two spin systems due to a single glucopyranosyl ring and the trichothecene aglycone. the anomeric linkages are characterized by proton signals in the 4.55.5 ppm range and the c signals by proton signals between 95 and 105 ppm. t-2 toxin--glucoside gave a doublet at 4.98 ppm that integrates to a single proton (figure 3a) and correlates to an adjacent c signal at 98.18 ppm (figure 3c). the chemically synthesized t-2 toxin--glucoside is similarly characterized by a larger h1ax h2ax bond angle, resulting in a definitive j1,2 coupling constant of 12 hz for the -anomeric proton at 4.46 ppm (figure 3b). this h-1 proton correlates to the -c1 c nmr anomeric signal at 102.36 ppm (figure 3d). hence, the t-2 toxin - glucoside anomers are defined by the observed h and c chemical shifts and by the characteristic j1,2 coupling constants. these assignments were confirmed by hsqc and, together with hmbc, dept, cosy, and noesy experiments, enable the complete nmr assignment of both epimers. proton nmr spectra of (a) t-2 toxin--glucoside, (b) t-2 toxin--glucoside with signals for the h1 anomeric proton indicated and c nmr anomeric carbon signals of (c) t-2 toxin--glucoside (98.18 ppm) and (d) t-2 toxin--glucoside (102.36 ppm). the two epimeric standards, t-2 toxin--glucoside prepared with yeast and the synthetic t-2 toxin--glucoside, could be separated with lc (figure 4). in epi mode, t-2 toxin--glucoside and t-2 toxin--glucoside [m + nh4 ] ions were subjected to collision - induced dissociation. under these conditions, t-2 toxin--glucoside more readily ionized to yield an [m + h ] ion than the t-2 toxin -glucoside, as shown by the relative intensities of the residual [m + nh4 ] and [m + h ] ions (figure 5). other fragment ions were similar to those previously observed from fusarium - infected grain. lc - ms / ms chromatograms of (a) t-2 toxin--glucoside (t-2glc) and t-2 toxin--glucoside (t-2glc) standards, (b) t-2 toxin - glucoside extracted from wheat, and (c) t-2 toxin - glucoside extracted from oats. tandem mass spectrum of the [m + nh4 ] ion of (a) t-2 toxin--glucoside, (b) t-2 toxin--glucoside, (c) t-2 toxin - glucoside from oats, and (d) t-2 toxin - glucoside from wheat. to determine the form of t-2 toxin - glucoside present in contaminated oats and wheat, extracts were analyzed with lc - ms / ms and compared to the standard t-2 toxin--glucoside and t-2 toxin--glucoside (figure 4). under the conditions used, t-2 toxin--glucoside eluted at 31.4 min and t-2 toxin--glucoside at 32.0 min. t-2 toxin - glucoside was detected at 31.5 min in oat and wheat samples, consistent with t-2 toxin--glucoside (figure 4). in addition, there were differences in the mass spectra of the two isomers, showing the same fragment ions but with different relative intensities. similar to t-2 toxin--glucoside, the yeast biotransformation product, the t-2 toxin - glucoside from oats and wheat, had the prominent [m + h ] product ion from the [m + nh4 ] ion (figure 5). in this study, the stability under in vitro gastrointestinal conditions and the catabolic fate of both t-2 toxin--glucoside and t-2 toxin--glucoside were tested in a human gut microbioma assay and compared to t-2 toxin. we found that the t-2 toxin - glucosides were unchanged after incubation with human artificial saliva. these results are similar to those reported for deoxynivalenol glucoside and zearalenone glucoside and further demonstrate the stability of some - and -glucosidic bonds upon digestion. in contrast to zearalenone glucoside, which was hydrolyzed in the first 30 min of colonic fermentation, t-2 toxin and the t-2 toxin - glucosides were relatively stable for the first 30 min (figure 6). t-2 toxin was mainly transformed into its derivative ht-2 toxin (83% at t = 24 h). t-2 toxin--glucoside and t-2 toxin--glucoside were both strongly degraded after 24 h, with < 30% of the starting material remaining. the latter was mainly cleaved to release its precursor t-2 toxin (58%) with a smaller percentage of ht-2 toxin (12%), whereas the former is converted into t-2 toxin (13%), ht-2 toxin (30%), and other metabolites of unknown structure and toxicity (33%). degradation upon human colonic microbiota fermentation of (a) t-2 toxin--glucoside (t-2glc), (b) t-2 toxin--glucoside (t-2glc), and (c) t-2 toxin (t-2). ht-2 toxin (ht-2). because smaller amounts of t-2 toxin remained following colonic fermentation with t-2 toxin--glucoside, it may pose less of a risk than t-2 toxin--glucoside, which is not known to occur in crops. however, t-2 toxin--glucoside was also converted into other, as yet uncharacterized, compounds (figure 6). in addition to t-2 toxin and ht-2 toxin, other possible products of t-2 toxin - glucoside include ht-2 toxin - glucoside, t-2 triol, and t-2 tetraol. it is important to consider the toxicity of all of the products when the risk posed by t-2 toxin--glucoside in grain is assessed. the relative toxicity of t-2 toxin and the t-2 toxin - glucosides was tested with c. reinhardtii cultures. previous studies have shown that t-2 toxin is quite phytotoxic and t-2 toxin--glucoside is nontoxic. in this study, cultures grown in 100 m t-2 had only a slight increase in the number of cells, with 0.6 doubling after 4 days. in contrast, neither t-2 toxin--glucoside nor t-2 toxin--glucoside was phytotoxic, with 5.4 and 5.5 doublings, respectively, which are similar to the 5.3 doublings observed for cultures treated with acetone alone. the first immunoassay was a competitive indirect elisa format using mab 2 - 13, an antibody developed with t-2 toxin--glucoside. mab 2 - 13 recognized t-2 toxin -glucoside slightly better than t-2 toxin (cross reaction 108%), whereas t-2 toxin--glucoside was recognized more poorly, at about 57% relative to t-2 toxin (table 1 ; figure 7a). this makes this antibody - based test suitable for the detection of both t-2 toxin and the naturally occurring t-2 toxin--glucoside. (a) ci - elisa responses of t-2 toxin--glucoside (open circles) and t-2 toxin--glucoside (solid circles) with mab 2 - 13. data shown are the averages from four plates, with six replicates per toxin concentration per plate (n = 24), 1 standard deviation. response equation over the indicated concentration range (0.1200 ng / ml). (b) elisa responses of t-2 toxin (open triangles), t-2 toxin--glucoside (open circles), and t-2 toxin--glucoside (solid circles) to neogen veratox t-2/ht-2 antibody. data shown are the averages from three plates per toxin, with four replicates per toxin concentration per plate (n = 12), 1 standard deviation. data for t-2 toxin with this immunoassay are from maragos. the second immunoassay was a commercially available t-2/ht-2 kit. this kit was used to determine if an elisa, developed before the glucosides of t-2 and ht-2 toxins were even discovered, could detect these masked mycotoxins. the commercial elisa test kit for t-2 toxin and ht-2 toxin detection performed very well for detecting t-2 toxin with good sensitivity and good reproducibility. in addition, the kit cross - reacted fairly well with the t-2 toxin--glucoside, but poorly with the t-2 toxin--glucoside (table 1 ; figure 7b). however, given that t-2 toxin--glucoside is the form found in naturally contaminated samples and that the cross - reaction with this anomer was only about 16%, this test kit would not be recommended for the simultaneous screening of t-2 toxin and t-2 toxin--glucoside. the ability of plants to form trichothecene glucosides can be seen as a detoxification mechanism that plants use when infected with trichothecene - producing fungi. because trichothecenes can be virulence factors in plant disease, expression of trichothecene ugt genes in plants is a potential way to increase disease resistance to trichothecene - producing fungi. however, both the trichothecenes and their masked forms need to be considered to accurately assess the risk to human and animal health posed by plant material contaminated with trichothecenes. sufficient amounts of t-2 toxin - glucoside are needed to determine the risk posed by the masked form of t-2 toxin in cereals, to develop reliable methods for their detection, and to study the stability, digestive fate, and toxicity of t-2 toxin - glucoside formed in plant materials. whereas the synthesis of deoxynivalenol - glucoside is relatively straightforward, this method was not amenable to the preparation of t-2 toxin - glucosides because the isovaleryl and acetyl groups are labile during the synthesis. a synthesis employing a superarmed tetra - o - triisopropylsilyl protected donor offered a way to selectively remove the protecting groups from the sugar portion of the glucoside without disturbing the isovaleryl and acetyl groups of t-2 toxin, thus providing a means to synthesize t-2 toxin--glucoside. microbial t-2 toxin--glucoside was prepared as a single anomer with b. muscicola yeast cultures, on the basis of lc and lc - ms chromatographic comparisons and ms / ms analyses, the t-2 toxin - glucoside occurring in contaminated wheat and oats was found to be identical to the yeast biotransformation product, t-2 toxin--glucoside. it is notable that naturally occurring t-2 glucoside has an -linked sugar, whereas naturally occurring deoxynivalenol glucoside has a -linked sugar. although -linked sugars are more commonly found with xenobiotics and natural products including flavonoids, there is a report of fusarium cultures producing an -linked glycoside, 15-monoacetoxyscirpenol-4--glucoside. the blastobotrys glucosyltransferase that converts t-2 toxin to t-2 toxin--glucoside has not been identified, but there may be substrate preferences between the ugt that lead to trichothecene - or -glucosides. although the focus of this study was the t-2 toxin - glucosides, ht-2 toxin - glucosides have also been reported in contaminated grain and in culture material. they may be formed either by hydrolysis of t-2 toxin--glucoside or by conversion of t-2 toxin to ht-2 toxin followed by glycosylation at c-3 or c-4. it is possible that the latter route may utilize different glucosyltransferases that result in a orientation. to date, no plant ugt that converts t-2 toxin to t-2 toxin--glucoside has been identified. numerous glucosyltransferases were screened to identify one that had good substrate specificity for deoxynivalenol. although the t-2 toxin - glucoside found in naturally contaminated oats and wheat was identical to the t-2 toxin--glucoside prepared with yeast cultures, the anomericity of ht-2 toxin - glucosides has not been determined. the present study has demonstrated that naturally occurring t-2 toxin - glucoside has an -linked sugar and that t-2 toxin--glucoside can be prepared with b. muscicola in sufficient quantity to study its animal toxicity. the u.s. fda has not provided guidance levels to the agricultural industry for t-2 toxin or related trichothecenes. the european food safety authority (efsa) established a group tolerable daily intake of 100 ng / kg body weight for t-2 and ht-2 toxins. however, at present it is not possible to perform a proper risk assessment for masked mycotoxins in food, due to the lack of data on exposure and toxic properties. masked mycotoxins may elude analysis because of altered physical properties or because of modification of an epitope recognized by antibodies used for the detection, leading to an underestimation of the total mycotoxin load. possible release during food processing is also a concern, and efsa currently has a working group on the public health risk of masked mycotoxins in food and animal feed. research on masked mycotoxins is hampered by the nonavailability of analytical standards or calibrants, and only one compound, deoxynivalenol-3--glucoside, is commercially available. the occurrence of t-2 toxin--glucoside in wheat and oat samples, and its metabolism by microbes during digestion, suggests that there is a risk in underestimation of the total t-2 toxin load and a need to monitor both mycotoxins and their conjugated forms in cereals and food products. to promote research efforts in the area of masked mycotoxins, t-2 toxin--glucoside has now been made available to the scientific community by the authors. | t-2 toxin is a trichothecene mycotoxin produced when fusarium fungi infect grains, especially oats and wheat. ingestion of t-2 toxin contaminated grain can cause diarrhea, hemorrhaging, and feed refusal in livestock. cereal crops infected with mycotoxin - producing fungi form toxin glycosides, sometimes called masked mycotoxins, which are a potential food safety concern because they are not detectable by standard approaches and may be converted back to the parent toxin during digestion or food processing. the work reported here addresses four aspects of t-2 toxin - glucosides : phytotoxicity, stability after ingestion, antibody detection, and the anomericity of the naturally occurring t-2 toxin - glucoside found in cereal plants. t-2 toxin--glucoside was chemically synthesized and compared to t-2 toxin--glucoside prepared with blastobotrys muscicola cultures and the t-2 toxin - glucoside found in naturally contaminated oats and wheat. the anomeric forms were separated chromatographically and differ in both nmr and mass spectrometry. both anomers were significantly degraded to t-2 toxin and ht-2 toxin under conditions that mimic human digestion, but with different kinetics and metabolic end products. the naturally occurring t-2 toxin - glucoside from plants was found to be identical to t-2 toxin--glucoside prepared with b. muscicola. an antibody test for the detection of t-2 toxin was not effective for the detection of t-2 toxin--glucoside. this anomer was produced in sufficient quantity to assess its animal toxicity. |
influenza remains a serious health threat and a future pandemic risk, as evidenced by recent outbreaks of h5n1 and h1n1. these influenza type a strains, which cause acute upper respiratory tract infections with high morbidity and mortality, possess three viral - coat proteins : hemagglutinin (ha), neuraminidase (na), and m2. ha and na are glycoproteins that recognize terminal sialic - acid (sa) residues on host - cell surface receptors, and m2 is a proton channel critical for virus assembly and replication. upon attachment via sa binding, ha mediates viral entry into the cell. following viral replication, na facilitates the liberation of new virions from the cellular surface by cleaving the (26)- or (23)-ketosidic linkages that connect terminal sa residues to cell - surface glycoproteins. na is conserved in all wild - type influenza viruses, and its inhibition halts viral propagation by interfering with effective shedding. consequently, it is an attractive target for anti - influenza drug design. who recommends stockpiling na inhibitors such as zanamivir (relenza, glaxosmithkline) and oseltamivir (tamiflu, roche), which have recently replaced older drugs like rimantadine and amantadine. however, the threat of an h1n1 flu pandemic, the sudden emergence of oseltamivir - resistant h1n1, and the emergence of potentially pathogenic h3n2 and h5n1 strains warrant ongoing efforts to identify novel anti - influenza compounds. consequently, many researchers have expended considerable effort in the pursuit of antiviral small molecules via bioinformatics studies, hit - and - lead discovery approaches, and analogue synthesis. natural compounds constitute an indispensable source of potential inhibitors from which these studies can draw. for example, the plant flavonoids isoscutellarein and isoscutellarein-8-methyl ether, derived from the leaves and roots of scutellaria baicalensis, have been known to inhibit h1n1 na since 1995. in total, about 160 similar plant compounds have been isolated and tested to date (reviewed in ref (27)). inspired by the wealth and diversity of malaysian tropical plants, we recently developed the natural product discovery (nadi) repository (http://www.nadi-discovery.com/) as an online resource. this resource consists of several databases, including nadi - meps, which describes the ethnopharmacological use of various malaysian plants, and nadi - chem, which stores the three - dimensional structures of over 3000 compounds from more than 250 malaysian plants for use in computational - biology studies. virtual screening has shown great promise in sorting through large libraries of potential bioactive molecules like those in the nadi repository. for example, in 2008, rollinger. demonstrated how natural - product / ethnopharmacological - guided virtual screening can be used to select a particular class of natural products for subsequent study. compounds they isolated from the gum resin asafetida yielded four experimentally confirmed inhibitors that were subsequently shown to inhibit human rhinovirus in the low micromolar range. two of these compounds were present among their original virtual hits. here, we report a similar virtual screen of the nadi compound database aimed at influenza drug discovery. although the nadi provides useful ethnopharmacological information about each plant, we aimed to blindly predict the activity of each compound in silico without regard for traditional regional medical practices. the top predicted inhibitors principally came from five distinct plants : garcinia mangostana, eurycoma longifolia, tabernaemontana divaricata, brucea javanica, and momordica charantia. these plants were subjected to in vitro evaluation in order to characterize h5n1 na inhibition. all the plant extracts demonstrated some inhibitory activity ; g. mangostana extracts yielded the highest percent inhibition (82.95% at 250 g / ml). fractions obtained from the extracts of these plants were subsequently tested for na activity, ultimately leading to the isolation of 12 compounds from g. mangostana (4), m. charantia (2), b. javanica (1), t. divaricata (1), and e. longifolia (4) that also inhibited h5n1 neuraminidase. of these 12 compounds, four had already been identified as hits in our initial nadi virtual screen. we are hopeful that the virtual - screening methodology described here will become an increasingly effective tool for rapidly identifying bioactive plants for additional experimental study. the three - dimensional structures of 3000 nadi and 2000 nci compounds were obtained from www.nadi-discovery.com and dtp.nci.nih.gov, respectively. compounds that did not satisfy lipinski s rule of five for drug - likeness were discarded. an additional 58 known inhibitors of neuraminidase a with ki or ic50 values less than or equal to 25 nm were identified using the bindingdb database. structures of these compounds were generated using schrdinger s ligprep module (2011). in brief, protonation states were assigned at ph 7.0 using epik. for each compound, ligprep identified all tautomeric and one stereoisomeric state. where appropriate, one low - energy ring conformation was determined per ligand. both the small molecules and the h5n1 na receptor were prepared for docking using the autodocktools (adt) software package. the receptor was prepared from an x - ray crystal structure of h5n1 neuraminidase (pdb i d : 2hu4). hydrogen atoms were added to all ligands and na models using adt, and ligand rotatable bonds were assigned via autotors. grid boxes comprised of 60 60 60 points spaced 0.375 apart and centered on the na active site were calculated for the following atom types : c, a (aromatic c), n, o, s, h, f, cl, br, i, p, and e (electrostatic) using autogrid3. the parameters of the lamarckian genetic algorithm (lga) were as follows : population size of 50, elitism of 1, mutation rate of 0.02, crossover rate of 0.80, local search rate of 0.06, 250 000 energy evaluations, and 100 search runs. the final docked conformations were clustered using a cluster tolerance of 1.0 root - mean - square deviation (rmsd). the ligand pose with the lowest predicted free energy of binding, chosen from the most populated cluster, was used in subsequent analysis. solvents used for extraction and column chromatographic analysis were of analytical grade (ar), and solvents used in the liquid chromatographic analysis were of hplc grade. 22-(4-methylumbelliferyl)-a - d - n - acetylneuraminic acid sodium salt hydrate ], mes [2-(n - morpholino) ethanesulfonic acid ], and dana [2,3-didehydro-2-deoxy - n - acetylneuraminic acid ] were obtained from sigma (malaysia). melting points were determined using a smp20 melting point apparatus (stuart) and a differential scanning calorimeter (perkinelmer). ftir spectra were recorded using an ir prestige-21 instrument (shimadzu) and a nicolet 6700 ftir - atr spectrometer (thermo scientific) available at the centre for drug research, universiti sains malaysia. uv spectra were recorded using a u-2000 spectrophotometer (hitachi, japan) and a uv 1601pc spectrophotometer (shimadzu). ms spectra were acquired using a 1100 series lc - msd trap g2445l (agilent technologies, palo alto, usa). h and c nmr spectra were both recorded at 500 mhz using an avance iii hd spectrometer (bruker). semipolar compounds were dissolved in deuterated chloroform (cdcl3), and polar compounds were dissolved in 99% cd3od. a centrifugal tlc (cyclograph, analtech inc. ; newark, de, usa) was used to separate fractions. sample purification was achieved using a pu-980 hplc system (jasco ; tokyo, japan) equipped with a solvent delivery pump, a 7725i sample injector (rheodyne ; cotati, ca, usa) with a 250 l sample loop, a uv-975 detector (jasco ; tokyo, japan), and a d-2500 chromato - integrator (hitachi ; tokyo, japan). mass spectra were measured on a 1100 series lc - msd trap g2445 vl (agilent technologies, palo alto, california, usa). the hplc system was used to check for peak purity. a microplate reader (turner - biosystem, usa) the leaves of t. divaricata were collected around penang, oven - dried (45 c), and powdered. the seeds of b. javanica were obtained from solo, east java, indonesia, and were likewise dried and ground into powder. e. longifolia plant and root samples were identified and purchased in perak, malaysia, by the pharmaceutical company hovid berhad (ipoh). voucher specimens for all the plant materials with the exception of e. longifolia were deposited in the herbarium of the school of biological sciences, universiti sains malaysia (no. 11301, 11302, 1298, and 1299 for g. mangostana, m. charantia, t. divaricata, and b. javanica, respectively). an e. longifolia voucher specimen (no. a description of the extraction, fractionation, and isolation of specific compounds can be found in the supporting information, together with experimentally measured purities, melting points, and ir / nmr spectra. munana (sigma, m8639) in 32.5 mm mes (sigma, m8250) buffer (ph 6.5) served as the substrate, and neuraminidase from viral h5n1 (sinobio) in mes buffer served as the enzyme. the chemical compounds, plant extracts, and fractions were dissolved in 2.5% dmso and diluted to various concentrations ranging from 0.488 g / ml to 250 g / ml in mes buffer. for the assay, neuraminidase (25 l) was added to 25 l of sample solution mixed with a buffer in 96-well microplates. after 1 h, 100 ml of stop solution was added to each well, and 4-methylumbelliferone was immediately quantified fluorometrically using a modulus microplate reader (turner biosystem, usa). the excitation and emission wavelengths were set at 365 and 450 nm, respectively. the percentage of na inhibition over a range of compound concentrations was determined by fitting experimental data to the logistic graph. dana and oseltamivir carboxylate were used as standard inhibitors (positive controls) in the bioassay. the detergent assay was adapted from the work of feng and shoichet, by adding 0.01% triton - x-100 to the mes buffer. prior to performing a virtual screen of the nadi database using autodock 3.05, we first validated our docking procedure. an oseltamivir molecule was extracted from a crystallographic na structure (pdb i d : 2hu4(42)) and redocked into the same binding pocket. the docked ligand pose was similar to the crystallographic pose (rmsd = 0.84, figure 1), demonstrating that the autodock docking parameters used are amenable to this system. superimposition of the docked and crystallographic oseltamivir poses (green and blue, respectively). we next verified that our virtual - screening technique was capable of identifying known na inhibitors. the compounds of the nci diversity set 1 (presumed decoys / negatives), together with 58 known neuraminidase a inhibitors with ki or ic50 values less than or equal to 25 nm (positives), were docked using the same protocol described above. the area under the roc curve generated from this initial benchmark screen was 0.99 per the trapezoidal rule (figure 2), suggesting that our screening methodology is highly predictive. receiver operator curve generated from the initial benchmark screen of the nci diversity set i (presumed decoys) and known potent na inhibitors. the area under the curve is 0.99, suggesting the screening methodology is highly predictive. satisfied that our virtual - screening protocol could be effectively used to identify na inhibitors, we next performed a virtual screen of 3000 nadi compounds. the top 100 compounds with the best docking scores (table s1) were derived from a total of 31 local malaysian plants. g. mangostana, e. longifolia, t. divaricata, m. charantica, and b. javanica possessed the greatest number of predicted h5n1 inhibitors (table s2) and so were selected for further experimental evaluation. methanol (meoh) extracts of these five plants (figure 3), as well as their fractions (table 1 and figure s1), were tested for h5n1 na inhibition. with the exception of e. longifolia, all plants showed marked na inhibition. g. mangostana, m. charantia, t. divaricata, b. javanica, and e. longifolia had 82.95%, 72.61%, 62.79%, 55.80%, and 29.62% na inhibition at 250 g / ml, respectively. in general, isolated fractions of these plant extracts (table 1) also inhibited neuraminidase. fraction f3 from g. mangostana had 84.49% inhibition, fractions f3 and f4 from m. charantia had > 70% inhibition, all three b. javanica fractions had > 50% inhibition, and t. divaricata had only modest inhibition (12 to 36%). interestingly, though the inhibition of the whole meoh e. longifolia extract was negligible, fraction f4 from this species did demonstrate reasonable inhibition (56.47%). percent h5n1 na inhibition of five plant meoh extracts (2500.488 g / ml). the calculated ic50 for the plant extracts are g mangostana = 50.93 0.02 g / ml, m charantia = 79.43 0.06 g / ml, b. javanica = 184.93 0.04 g / ml, t. divaricata = 164.81 0.03 g / ml. efforts were next undertaken to isolate specific inhibitory compounds from the extracts of these five plants. within the time frame of the experiment, we isolated 12 compounds from the fractions of g. mangostana (4), m. charantia (2), t. divaricata (1), b. javanica (1), and e. longifolia (4) (table 2 and figure s2). of these 12 compounds, five compounds showed > 50% inhibition at 250 g / ml, with ic50 values ranging from 89.71 to 275.45 m. four of the 12 compounds were present in the original virtual screen, including gartanin, with an ic50 value of 126.64 0.13 m (table 2). an additional four compounds (rubraxanthone, kuguacin j, 13,21-dihyroeurycomanone, and 13,21-epoxyeurycomanone) were absent from the nadi database at the time of screening and so could not have been identified in silico. in contrast, -mangostin, garcinone c, eurycamanol, and daucosterol failed to rank among the top 100 hits of the virtual screen (table s1). compounds marked with asterisks were subjected to additional testing to rule out nonspecific inhibition by self aggregation. momordicin i and kuguachin j from m. charantia showed 15.58% and 21.42% na inhibition, respectively. m), far better than any of the fractions or extracts from this species. as expected, the compounds from e. longifolia exhibited low inhibition, never exceeding the 34.50% inhibition of 13, 21-epoxyeurycomanone. all four compounds from g. mangostana demonstrated > 80% inhibition at 250 g / ml, with ic50 values of 91.95 0.09, 89.71 0.08, 95.49 0.08, and 126.64 0.13 m for -mangostin, rubraxanthone, garcinone c, and gartanin, respectively. -mangostin and gartanin have been previously isolated from g. mangostana pericarps and have been shown to inhibit c. perfringens neuraminidase with ic50 values of 12.2 1.2 and 2.9 0.3 m, respectively. the presence of -mangostin, gartanin, and garcinone c in asian mangosteen pericarps has been well documented, and lian and rahmani communicated the presence of rubraxanthone in the malaysian mangosteen at a recent conference. to our knowledge, however, rubraxanthone has not been previously identified as a neuraminidase inhibitor. it is interesting to note that a series of xanthone derivatives from c. triscuspidata has also been shown to inhibit bacterial neuraminidase at the nanomolar level. among the 12 nadi compounds tested, compounds from g. mangostana showed the highest inhibition rates and were therefore selected for additional testing to rule out inhibition by nonspecific aggregation. according to feng and shoichet, most aggregators show a greater than 50% decrease in inhibition in the presence of detergent. the tested compounds demonstrated a 1015% decrease at 250 g / ml, far less than 50%. furthermore, the dose response curve of self - aggregating compounds is typically markedly less steep in the presence of detergent. in contrast, the steepness of the dose response curves of our compounds was unaffected by detergent (figure s3). garcinone c is representative of these xanthone analogues and had a consistent binding pose when docked using two distinct programs (autodock 3.05 and schrdinger s glide/2011, data not shown). we therefore focused on this compound in order to better understand the potential binding modes of these analogues. the autodock pose of garcinone c is shown in figure 4a and b. potential interactions between the docked compound and the na receptor were identified using binana, poseview, visual molecular dynamics, and visual inspection. garcinone c may form hydrogen bonds with the y347, r118, y406, d151, and q276 side chains (figure 4a), as well as extensive cation- interactions with r371, r292, and r152 (figure 4b). the crystallographic pose of oseltamivir, a potent approved drug, is shown for reference (figure 4c). predicted pose of garcinone c, docked into the neuraminidase active site. (b) predicted cation- interactions between r371, r292, r152, and the xanthone moiety. (c) the crystallographic pose of oseltamivir, a potent inhibitor, shown for reference (pdb i d : 2hu4). for example, the oseltamivir acetamide carbonyl oxygen atom forms a hydrogen bond with the r152 side chain. if the docked pose of garcinone c is correct, a 2-methylbutan-2-ol moiety is positioned at the same location ; the corresponding -mangostin and rubraxanthone moieties are entirely hydrophobic. the careful addition of a hydrogen - bond acceptor at this location may improve potency. furthermore, all approved neuraminidase inhibitors take advantage of strong electrostatic interactions between negatively charged ligand carboxylate groups and positively charged na arginine residues, most notably r371. the novel xanthone inhibitors are also predicted to form interactions with active - site arginine side chains via cation interactions. while these interactions are substantial, adding negatively charged moieties to the xanthones at the appropriate locations might lead to even stronger electrostatic interactions. finally, we note that, like other na inhibitors, the xanthone compounds are not predicted to bind in the 150-loop cavity. their predicted binding poses are adjacent, however, and moieties could potentially be added to the xanthone scaffold that extend into this highly flexible subpocket. a number of recent medicinal - chemistry studies have applied virtual screening to natural - product databases. for example, a recent virtual screen of 57 natural plant metabolites identified hesperidin and narirutin (isolated constituents of citrus junos), as well as proanthocyanidin, ursolic acid, sitosterol, tangeretrin, abbssinone, nobiletin, and tannic acid, as potential h1n1 neuraminidase inhibitors. this work was not validated by bioassay, but hesperidin is known to inhibit influenza growth. encouraged by this previous success, we aimed to demonstrate that virtual screening can be used to select specific plants from among the rich biodiversity of south east asia for further in vitro pharmacological studies. despite time and resource restraints, virtual screening proved effective at identifying active botanical / nadi compounds, even when larger - scale efforts were impossible. to demonstrate that our virtual - screening protocol could effectively identify na inhibitors, we first docked known na inhibitors and presumed decoys from the nci diversity set 1. given the promising results of our initial nci benchmark virtual screen, we next applied the same docking protocol to the compounds of the natural product database (nadi). the docking results prompted us to experimentally test five tropical plants for na inhibition, as described in the results section. remarkably, none of these five plants were mentioned in a recent review of 3000 references describing natural - product influenza inhibition, attesting to the novelty of our discovery. as far as we are aware, with the exception of g. mangostana(49) this is the first time these plants have been reported to have antineuraminidase activity. despite our success identifying true inhibitors, it is curious that the correlation between predicted free energies and experimentally measured potencies was poor. as warren. demonstrated in their critical assessment of nine docking tools, this is a general problem independent of the docking program used. one of the advantages of the method herein described is that it does not rely on a single docking score. docking scores were used only to guide the selection of appropriate plants, each containing multiple predicted na inhibitors, for further experimental examination. we identified five tropical plants that show inhibitory activity against h5n1 neuraminidase : g. mangostana, e. longifolia, t. divaricata, b. javanica, and m. charantia. parts of these plants leaves, roots, and fruits were subjected to various extraction methods, chromatographed, and further fractionated for biological testing. fractions and extracts of the five plants exhibited good to moderate anti - h5n1 neuraminidase activity. g. mangostana had the highest inhibition (82.95% at 250 g / ml). rubraxanthone, -mangostin, and garcinone c, with ic50 values ranging from 89.71 to 95.49 m, were particularly notable. while we are hopeful that further optimization of these compounds will yield more potent analogs, we acknowledge that currently approved na - inhibiting therapeutics are much stronger binders. the primary purpose of this study is to present a novel computational method for prioritizing biologically active plants for subsequent pharmacological study. the work described here affords a glimpse into the potential of both virtual screening and the nadi compound library, which contains a growing number of malaysian natural - plant products. we expect that similar virtual - screening approaches will serve as useful tools to guide the future identification of additional bioactive, medicinal plants. | recent outbreaks of highly pathogenic and occasional drug - resistant influenza strains have highlighted the need to develop novel anti - influenza therapeutics. here, we report computational and experimental efforts to identify influenza neuraminidase inhibitors from among the 3000 natural compounds in the malaysian - plants natural - product (nadi) database. these 3000 compounds were first docked into the neuraminidase active site. the five plants with the largest number of top predicted ligands were selected for experimental evaluation. twelve specific compounds isolated from these five plants were shown to inhibit neuraminidase, including two compounds with ic50 values less than 92 m. furthermore, four of the 12 isolated compounds had also been identified in the top 100 compounds from the virtual screen. together, these results suggest an effective new approach for identifying bioactive plant species that will further the identification of new pharmacologically active compounds from diverse natural - product resources. |
leptospirosis is a bacterial infection transmitted from animals to humans by direct contact through skin or mucous membranes with urine and other fluids from domestic or wild infected animals. the infection is usually present all year round, but it is more frequent during the rainy season, for the bacteria may survive for several weeks in humid, hot, and slightly alkaline environments. the clinical manifestation of the disease goes from an asymptomatic stage to a grave or even deadly state ; currently two principal types of leptospirosis are differentiated : acute and chronic leptospirosis [13 ]. risk populations are commonly described as adolescents, adults, country men, and the poorest urban populations, being also associated with raising animals in the home area, close relation with dogs and/or cats, handling excrement without protection, manipulation of beef or pork guts, lesions in feet during flooding, the use of sandals, and performing recreational activities allowing contact with stagnant water (swimming) [46 ]. the differential diagnosis includes a wide variety of infectious and noninfectious, acute and chronic diseases such as dengue, influenza, yellow fever, viral hepatitis, rheumatic, and oncologic diseases, and of the central nervous system [13 ]. in spite of being considered by the who as one of the most extended zoonose worldwide, it is suspected that there is an important underregistration. except for the antarctic, all continents regularly register cases, especially in tropical and subtropical regions. during the last years, the recording in mexico of this disease has increased as well as the number of states that report it. the initial reports date from the first decade of the past century in veracruz and yucatan ; currently, antibodies have been detected in half of the states of mexico. at the instituto mexicano del seguro social (imss) (social health services), the reporting of cases started in 1999 and it is currently classified as a transcendental disease and its notification is mandatory [10, 11 ]. the reported infection prevalence is variable, due to, among other things, the use of different laboratory tests to estimate it and the use of different cutoff values for its interpretation. currently, it is known that leptospirosis shares an ecologic niche with other diseases and the presence of overlapped breakouts have been reported in areas where it overlaps with dengue. due to the unspecific symptomatology of both infections, the state of yucatan has all the ecological conditions to harbor this disease in its population ; however, the morbidity reported in the region is low [9, 10 ]. the population of izamal is located in yucatan, a subrural community, descendent from the mayas, and very close to merida (capital state), with an average year - round temperature between 24 and 28c. the average temperature in the coldest month is of 18c, with a total annual precipitation of 7001000 millimeters of rain. the objective of the present study was to estimate the prevalence of leptospirosis infection in this community. a prospective transversal study was performed in inhabitants treated at the rural hospital number 62, at izamal locality during 2007. the subjects, older than 6 years of age, were randomly selected, one out of ten subjects in the benefit list of the opportunity program from the imss. they were invited to participate voluntarily, for which informed specific information was granted and informed consent was required. the participants were visited in their homes and each answered a questionnaire to know their personal information and to explore some risk factors regarding the infection. blood samples (7 ml vein blood) were taken with vacutainer, and total blood and serum were separated and refrigerated until they were sent to the laboratory for reference. for the diagnosis of the diseases, microscopic agglutination tests (mat) and direct observation of dark field [14, 15 ] were performed at the laboratory of tropical medicine department at the experimental medicine unit in the medicine faculty at the universidad nacional autnoma de mxico (unam). to analyze the data, once the exploration analysis was performed, simple and proportional frequencies were calculated for all variables. for continual variables, normality was verified and then central tendency (mean) and dispersion measures (standard deviation) were applied. in the bivariate analysis, prevalence and odds ratio prevalence with confidence intervals (ci) at 95% were calculated. as association measures mantel - haenszel test was used and as effect measures, prevalence odds ratio with a ci at 95% were used. to know the independent effect of each variable adjusted by the presence of other variables of interest, a logistic regression model was constructed using the spss statistic package version 13, epiinfo version 6, and epidat version 3.1. from a total of 9,540 inhabitants, surveys and samples were obtained from 240 individuals. sixty - eight individuals (33%) were males and one hundred and thirty - six (67%) were females. the average age was of 38.6 years old, with a mean of 38, ranging from 9 to 82 years. the age groups that reported a higher percentage in the samples were (a) the 2544 years group (46.6%) and (b) older than 45 years group (34.2%). regarding schooling, 86 persons (42.2%) are illiterate, 59 (28.9%) did not finish elementary school, 30 (14.7%) with complete elementary, and 29 (14.2%) with other levels. regarding household, 81.4% owned a house with 93.1% concrete or any other kind of material floor. barely more than half the studied population (56.9%) had a complete bathroom ; 27.5% defecated on the ground and 15.6% had a latrine. most of them (94.1%) had piped water service and 5.9% used water that comes from wells or that is delivered by water tankers. from this population, 94.1% lived in areas where streets were not paved and 70% lived in overcrowded homes. according to the socioeconomic level index, 82.5% had a low index, 16.6% had a medium index, and 0.9% had a high socioeconomic level index. the highest proportion of subjects referred being housewives (61%), 48.5% of participants referred handling raw animal meat and guts, and 97% of these indicated they did not use protective gloves ; in the same way, 48.5% performed agricultural labors, and from these, 95% were in contact with stagnant water, either barefoot or in contact with moist soil. from this population, 88.2% had domestic animals living in the house, 78.9% reported direct contact with animal excrement ; 73.5% referred having seen rodents in their house or their droppings in the yards. leptospirosis prevalence reported by the dark - field microscopic technique was of 88.2% (ci 95% 84.293.4), in general population. with the mat technique and cut value of 1 : 80, the prevalence was of 50.5% (ic 95% 43.457.5) ; table 1 shows the percentages of different cutoff values with this technique. predominant serovars were hardjo with 94%, followed by icterohaemorrhagiae with 3%, pomona serovar had third place with 2%, and canicola and shermani serovars both with 0.5%. regarding the number of serovars, 92% of the infected was positive to one serovar ; meanwhile, 7% were positive to two ; only 1% of the population was positive to three of more serovars. the prevalence was 96.3% (ic 95% 91.698.8) in women and 72.1% (ci 95% 60.783.5) in men. the most affected age group was the one 45 or more years old with 95.7% (ci 95% 87.999.1), followed by the 2544 year of age with 87.3%. the group 514 years old presented 80% (ci 95% 28.399.5) and the 1524 years old presented 76% (ci 95% 60.783.5). according to schooling, the group with incomplete elementary school had 93.2% (ic 95% 83.598.1) affectation, followed by the group with other studies 93.1% (ci 95% 77.299.2), and the group with complete elementary school with 86.7% (ci 95% 69.396.2) ; illiterates showed a prevalence of 83.7% (ci 95% 74.291.2). regarding housing features, 92% (ci 95%, 82.798.0) of those who defecated on open ground, resulted positive to leptospirosis. in the same way, 90% (ci 95% 74.998.0) of those having latrines, and only 85% (ci 95% 78.592.2) of those having complete bathrooms. in relation to their occupation, housewives were the most affected with 98% (ci 95% 94.399.8) of infected ; meanwhile, 87.7% (ci 95% 80.994.8) of those in contact with animal guts were positive. the highest prevalence among those who referred performing agricultural activities 89.9% (ci 95% 82.195.9) and those in contact with stagnant water 89.5% (ci 95% 82.396.1) (table 2). from the participants having domestic animals in their homes, 87.2% (ci 95% 82.092.3) were positive to the disease, and from those who were in contact with the animals ' excrements, 92.3% (ci 95% 87.597.0) were positive. of the persons who reported seeing rodents in their houses, 90% (ci 95% 84.895.1) were positive to leptospirosis (table 3). in the bivariate analysis, women had 10 times more risk of infection with leptospirosis when compared with men (rmp = 10.1, ci 95% 3.628.6, p 0.05) when compared with those who had bathroom. meanwhile, those with latrine presented 60% (rmp = 1.6, ci 95% 0.46.0, p > 0.5) more probabilities of getting sick when compared with those having complete bathrooms. the individuals reporting having performed labors in the fields had 30% more risk of infection when compared with those who did not labor in the fields (rmp = 1.3, ci 95% 0.52.6, p > 0.05). from these, those in contact with stagnant water, either by walking in it barefoot or manipulating humid soil, had two time more risk of getting sick than the group referring no contact (rmp = 2.8, ci 95% 0.229.8, p > 0.05). those reporting having contact with rodents and their droppings had an excess risk of getting sick of 80% when compared with the group with no rodents in their homes (rmp = 1.8, ci 95% 0.74.3, p > 0.05). otherwise, from those who referred having contact with domestic animal excrement, 40% (rmp = 1.4, ci 95% 1.11.6, p < 0.05) had a higher probability of getting infected with leptospirosis when compared with the group who had no contact. for the multivariate analysis, the logistic regression model was applied, in which the most significant variables of the bivariate analysis were included (p < 0.1). the variables which better explained the presence of infection by leptospira were being female and housewife, as well as being in contact with stagnant water and with excrement from domestic animals (table 4). global concordance between the two used diagnostic techniques used in this study was highest with the cut off 1 : 40 in mat (78%) (table 5). since the ending of the past century, it was foreseen that global warming in our planet would bring as a consequence changes in the ecology of many regions, and in turn, the alteration in presentation patterns of diseases, as well as the arousal and resurge of a large number of infectious diseases [1719 ]. these facts are proven with the increase of some diseases as dengue, the resurge of cholera, and the surging of some diseases, such as leptospirosis, that, even though it is not recent, it is only a few years ago when it came under the spot light due to the breakouts of this diseases as consequence of weather phenomena, characterized by important floods, and which has been confused with other pathologies, such as dengue [7, 20, 21 ]. facts are even more evident when we found the concurrence of diverse agents that produce overlapped outbreaks of different diseases as in the case of dengue and leptospirosis. this has very important repercussions regarding timely diagnosis and an effective treatment to patients. leptospirosis is an infection with a magnitude that can be much more to the one known up to date. the disease may be present as acute or chronic ; the first has a variable behavior and may cause death due to its graveness. however, the chronic cases of this disease are not generally recognized, much less notified nor quantified. up to not long ago, it was recognized that the infection could behave in a chronic manner ; nonetheless, nationwide findings and the results of the present study confirm this fact. prevalence found in previous studies are less to what we report in this work, which could be due to differences in the studied population or the cutoff values established to consider infection ; nevertheless, the direct observation performed in dark field demonstrated the presence of the bacteria in 8 of every 10 samples, which represents a high infection rate in the general population. in this sense, the comparison of the microscopic agglutination test at different cutoff values against a direct observation in the dark field (gold standard test) has allowed us to identify the ideal cutoff values that make possible considering an individual as infected either in an acute or chronicle status. this aspect is of main importance for the cutoff value established by the norma oficial mexicana (mexican official norm) (1 : 80) that is useful for the identification of recent infections ; however, it is inadequate to identify cases that are infected chronically, and that may propitiate an underestimation of the real infection prevalence in the general population. these facts place leptospirosis as a local public health problem that might be of great importance nationwide, if we consider the large variety of pathologic processes in which leptospira may intervene to cause the disease [22, 23 ] and that in most of the country 's entities there exist the convenient conditions for the infection to flourish, thus theimportance to establish active epidemiologic alert for this diseases in order to establish the real importance of this problem ; it is probable we are just observing the tip of the iceberg. the prevalence that we found is higher than the one reported in other studies performed in yucatan [24, 25 ] and the differences may be explained due to the techniques and cutoff values that were used ; in this sense, the microscopic agglutination test is targeted to the detection of specific antibodies and demonstrates the contact of the individual with leptospira in a determined moment, especially in recent infection ; however, it only detects the targeted serovar. in this way, the prevalence may be underestimated when the adequate antigens are not used. on the contrary, the direct observation in dark field identifies leptospira without being precise to the observed serovar ; therefore, both tests are complementary. nevertheless, to identify an acute or chronic infection, the observation in dark field and culture are ideal tests, and microscopic agglutination with a cutoff value of 1 : 40 may be an alternative. for all the above, the fact of not having found symptomatic individuals in the studied population, as well as the use of low antibody titers, leads us to conclude that a large proportion of the surveyed presented chronic asymptomatic infection which was determined by observation of the bacteria in dark field. the risk factors that we found are consistent with other reports and are in close relation with labor conditions, insalubrious environment, and poverty, making a priority the health education to avoid contact with contaminated elements, as well as the need to impulse social infrastructure development with this same purpose in mind. the presence of animals inside the households of the interviewed and the predominant serovars that were found show the direct contact among hogs, bovines, rats, and dogs and persons, a possible source of infection. again, due to the above, information for self - protection is an important factor to avoid direct contact with animals and their droppings. the constant report of simultaneous infections, confirmed to dengue and leptospira, in patients who were initially diagnosed with dengue, allows us to infer that the exposure and infection by both agents may be simultaneous, or, even more, that in a patient with a chronic infection by leptospira and who suffers infection by dengue, leptospira might act as an opportunistic agent and unleash an acute infection that worsens the prognostic of the patient, especially if there is no suspicion of leptospirosis, and offering antibiotic treatment on time may save his / her life. this is especially important if we consider that the rate with the highest success to eliminate an infection is offering antibiotics during the first days of the onset of the infection, which in turn might avoid the evolution of the infection to a chronic state. finally, the results here presented may serve as the bases for the doctor when establishing at first contact the treatment for patients who are suspected of dengue with renal or liver complications, and in who may also be suspected of infection by leptospira or both, especially ifs the patient lives in an endemic area. | objective. to measure the prevalence of leptospirosis with two techniques in inhabitants of izamal, yucatan and to determine its relation with some exposure factors. material and methods. transversal study in populations belonging to the hr62imss - opportunities working force in izamal, yucatan. population, including 6 years of age or more, was randomly selected to participate in the study. a questionnaire was applied for personal i d and exposure factors ; blood samples were taken for leptospirosis diagnosis. simple frequencies, proportions, tendency and dispersion measures, prevalence and odd ratios and confidence intervals (ci) of 95%, and logistic regression model were obtained. results. 204 patients, between 9 and 80 years old were included ; 180 were positive (88.2%) with the dark - field technique ; using mat cutoff at 1 : 40, 178 patients (87.3%) were positive, while at 1 : 80 there were 103 positive (50.5%). the predominant serovar was hardjo (94%). the highest prevalence was in women (96.3%) and in the > 45-year - old group (95.7%) ; feminine gender (rm = 2.31 ic 95% 3.5928.6), housewife (rm = 22.8 ic 95% 4.9106.1), being in contact with stagnant water (rm = 5.2 ic 95% 1.715.9), and being in contact with domestic animal feces (rm = 5.1 ic 95% 1.913.1), these being the most significant variables in the final logistic regression model. conclusions. the prevalence found was higher than the one nationally and internationally reported, representing an important finding, being in turn a local public health, maybe nationally. it is urgent to reinforce this research as well as to establish preventive and control measure to avoid exposure and health damages. |
it is well known that causes of chronic pancreatitis include alcohol, genetic or metabolic disorders, pancreato - biliary abnormalities and drugs. since sarles.1 reported chronic pancreatitis associated with hypergammaglobulinemia and lymphocytic infiltration with fibrosis of the pancreas in 1961, autoimmune mechanisms have come to the forefront as additional important causes of chronic pancreatitis. autoimmune pancreatitis (aip) is a benign disease and a unique form of chronic pancreatitis characterized by the presence of auto - antibodies, high serum igg4 level, diffuse pancreatic swelling, irregular narrowing of the main pancreatic duct and stenosis of the intrahepatic and extrahepatic bile ducts. lymphoplasmocytic infiltration and fibrosis of the pancreas are typical histologic findings of aip.2 igg4-associated cholangitis, described below, is commonly manifested with aip and its diagnostic criteria include : stricture of intrahepatic, proximal extrahepatic or intrapancreatic ducts ; clinical imaging findings of aip ; and elevated serum igg4.3 we now report a case of aip with accompanying multiple pseudocysts and igg4-associated cholangitis. we think that this is a unique case of aip, with clinical characteristics and course very similar to those of idiopathic chronic pancreatitis as well as other cases of aip associated pseudocyst.4 a 47-year - old male patient was referred to our hospital with pancreatic swelling, multiple cystic lesions of the pancreas on ultrasonography (usg) and a history of upper abdominal pain. intermittent upper abdominal discomfort and dyspepsia had been developing for 1 year, but there were no specific abnormal findings on esophagogastroduodenoscopy and usg. four months earlier, subsequent to an episode of abdominal pain, abdominal computed tomography (ct) had revealed pancreatic pseudocyst. post - referral abdominal ct showed diffuse pancreatic swelling and variably sized multiple pseudocysts without pancreatic parenchymal calcification (fig., he had complained intermittent vague abdominal discomfort without a history of aggravation of abdominal symptoms. a yellowish facial color developed and became more severe, and the patient was admitted for evaluation. he had been treated for pulmonary tuberculosis 20 years previously, but there was no other significant past medical or family history, including cholelithiasis. he had a 15 pack year smoking history but had no history of excessive alcohol consumption. in physical examination and systemic review, blood pressure, pulse rate, body temperature, and respiratory rate were stable and body mass index was 19.6 kg / m. laboratory data were as follows (values in parentheses indicate normal range) : white blood cell (wbc) count 6,440/mm (4,800 to 10,800/mm) ; hemoglobin 11.9 g / dl (13 to 18 g / dl) ; platelet count 266,000/mm (130,000 to 400,000/mm) ; aspartate aminotransferase (ast) 317 iu / l (0 to 37 iu / l) ; alanine aminotransferase (alt) 484 iu / l (0 to 41 iu / l) ; alkaline phosphatase (alp) 517 iu / l (35 to 129 iu / l) ; gammaglutamyl transpeptidase (ggt) 489 iu / l (8 to 61 iu / l) ; total bilirubin 12.01 mg / dl (0.01 to 1.1 mg / dl) ; direct bilirubin 10.48 mg / dl (0.01 to 0.3 mg / dl) ; amylase 82 iu / l) ; fasting blood sugar 155 mg / dl (7 to 100 mg / dl) ; hemoglobin a1c 5.5% (4.0% to 6.5 %) ; cea 5.36 ng / ml (0 to 4.3 ng / ml) ; ca 19 - 9 111.1 u / ml (0 to 37 u / ml). initial dynamic ct demonstrated diffuse pancreatic swelling and multiple pseudocysts, new intrahepatic and extrahepatic bile duct dilatation, and irregular wall thickening and a 2 cm length stenosis of the proximal common bile duct (cbd) (fig. endoscopic retrograde cholangiopancreatography (ercp) showed stenosis of the proximal cbd without demonstrating malignancy (fig. we made the provisional diagnosis of chronic pancreatitis with biliary stricture and placed a biliary stent into stenotic bile duct. during outpatient follow - up, the jaundice resolved and tumor marker and biochemical laboratory data normalized, but vague abdominal discomfort, nausea and intermittent vomiting persisted. while follow - up abdominal dynamic ct revealed no bile duct dilatation and similar pancreato - biliary abnormalities to those on the initial ct, enhanced - phase ct showed diffuse pancreatic swelling without focal enhancing mass lesion at pancreas and low attenuation of peripancreatic area which findings were compatible with aip.5 we performed additional laboratory tests for autoimmune disorders as follows (values in parentheses indicate normal range) : antinuclear antibody was negative ; antimitochondrial antibody (ama) was negative ; rheumatoid factor was negative ; igg 1,845 mg / dl (700 to 1,600 mg / dl) ; iga 201 mg / dl (70 to 400 mg / dl) ; igm 55 mg / dl (40 to 230 mg / dl) ; igg subtype iv 2.28 g / l). based on the findings of the two imaging criteria and a serologic criterion of the asian diagnostic criteria for aip, we diagnosed aip.4,6 outpatient oral prednisolone therapy was started at a dose of 30 mg / day. abdominal dynamic ct showed partial resolution of the pseudocysts, in size and numbers, and improvement of the diffuse pancreatic swelling (fig. ercp revealed normal intra- and extrahepatic bile ducts, including the cbd and main pancreatic duct, and the plastic stent previously placed at the distal cbd was removed. laboratory data concerning liver function, and levels of pancreatic enzymes and igg4 were normalized or improving (ast, 18 iu / l ; alt, 13 iu / l ; alp, 55 iu / l ; ggt, 13.6 iu / l ; total bilirubin, 0.74 mg / dl ; direct bilirubin, 0.06 mg / dl ; amylase, 30 iu / l, lipase, 10 iu / l ; cea, 2.92 ng / ml ; ca 19 - 9, 5.4 u / ml ; igg4, 1.63 the dose of oral prednisolone was subsequently tapered in phases to 10 mg as the patient 's vague abdominal discomfort, nausea and vomiting resolved. at present, the patient is asymptomatic on 10 mg oral prednisolone per day. in 1995, yoshida.7 summarized the characteristics of aip as follows : 1) increase of serum gamma globulin or igg levels ; 2) presence of auto - antibodies ; 3) diffuse enlargement of pancreas ; 4) irregular narrowing of the main pancreatic duct on ercp ; 5) fibrotic changes and lymphocyte infiltration of the pancreas on histology ; 6) asymptomatic or mild symptoms, usually no history of acute pancreatitis ; 7) stenosis of the cbd in the pancreas, with dilatation of upstream bile duct and liver dysfunction ; 8) no pancreatic calcification ; 9) no pancreatic cyst ; 10) frequently associated with other autoimmune disorders ; 11) good response to steroid treatment. there have only been a few reports of aip complicated with pancreatic cyst and such cysts are rare, probably due to the absence of severe tissue necrosis and/or lack of stasis of the pancreatic juice in this condition. in this case, when the patient visited our hospital initially, he had a history of an acute attack of pancreatitis and diffuse enlargement of the pancreas with multiple pseudocysts on imaging. chronic pancreatitis or pancreatic cystic neoplasm were therefore deemed more likely than aip. also, pseudocysts located in the pancreatic head are particularly suggestive of pancreatic cancer, and we therefore performed ercp to exclude pancreatic malignancy. responsiveness of aip to corticosteroid treatment corresponds to elevation of igg / igg4 or else the presence of other auto - antibodies such as ana.8 in addition, pseudocyst associated with aip might represent a highly active inflammatory process, and these lesions have been shown to predict responsiveness to corticosteroid treatment if associated with aip.4 though we were unable to determine the exact mechanism of the pathogenesis of the cyst in the present patient, the absence of both severe acute episodes of pancreatitis and a marked elevation of serum pancreatic enzymes prior to cyst formation suggests that severe tissue necrosis did not contribute to the pathogenesis. cyst formation in aip may be associated with a highly active state of the inflammatory process, as we found a high serum igg4 concentration that closely correlated with the active state of this disease. pseudocyst activity and progression is known to be associated with stenosis of the pancreatic duct. steroids are thought to induce pseudocyst regression through inhibition of inflammation of the pancreatic duct, thus reducing the stenosis and improving the drainage of pancreatic juice. corticosteroid treatment is clinically, radiologically, and serologically effective and has become accepted as a standard treatment for aip. there have been some studies on the shortterm effectiveness of corticosteroid treatment in aip, and, more recently, on the long - term prognosis for patients with aip, including those receiving corticosteroid treatment.9 it is difficult for all patients with aip to be treated with corticosteroid, and there is currently no consensus on when to initiate corticosteroid treatment in patients with aip. hirano.10 reported that a growing pancreatic pseudocyst developed in an aip patient who did not receive corticosteroid treatment, while nakazawa.11 reported the spontaneous disappearance of a pancreatic cyst in an aip patient without corticosteroid treatment. kawakami.12 suggested that, in aip patients, corticosteroid treatment should be started immediately after pseudocyst appearance because of the possibility of pseudocyst regression with treatment. the risk of adverse effects of corticosteroid treatment (such as susceptibility to infection, impaired glucose tolerance and peptic ulcer) should also be taken into consideration. the indications for corticosteroid therapy in aip patients have included bile duct stenosis and various other symptoms and clinical findings.10 in this case, we started corticosteroid treatment after diagnosis of igg4-associated cholangitis, which caused obstructive jaundice due to bile duct stenosis, and pseudocysts. after corticosteroid treatment, there were improvements in clinical symptoms, such as reduced abdominal discomfort and nausea. radiologic regression of the diffuse pancreatic swelling, bile duct stenosis and pseudocysts was also seen and the patient has recovered well with no complications. more studies are required regarding the long - term prognosis and appropriate duration of corticosteroid treatment for aip. | autoimmune pancreatitis (aip) is a benign disorder and a unique form of chronic pancreatitis with several characteristic features. a cystic formation that mimics a pseudocyst is a rare finding. there have been a few reports of aip complicated by pancreatic cysts. we present a case of aip with multiple pseudocysts and obstructive jaundice caused by igg4-associated cholangitis. we initially missed the diagnosis due to the pseudocyst. based on the computed tomography images, laboratory findings and the therapeutic response to steroids, the case was diagnosed as aip with pseudocysts and associated cholangiopathy. |
a five - year - old girl suffered a traumatic injury (left condylar dislocation) during a regular dental appointment. she had no history of other diseases or trauma on the face that could lead to a misinterpretation of the diagnosis before and after the condyle dislocation. at 10 years of age she began to progressively develop left side facial pain and jaw joint limitation on range of motion. unfortunately, she returned only two years later, presenting with mouth opening of 10 mm, no facial asymmetry, and no jaw joint pain or other symptoms (figs. 1 and 2). computer tomography (ct) exam was requested and revealed calcification of the left lateral pterygoid muscle, extending from the head of the mandible to the pterygoid process (fig. thus, in order to allow the patient to open her mouth wider, the proposed treatment plan included left side pterygoid muscle excision. after general anaesthesia, an intraoral incision was done along the anterior mandibular ramus and the ossified mass was easily detected after detachment of mucosa. 4) and a 35 mm mouth opening was achieved immediately after the procedure (fig. 5). new post - operative ct images showed absence of calcified mass over the medial left mandibular. laboratories tests of calcium, alkaline phosphatase presented normal results and histopathological examination showed simply calcified bone confirming the pathology diagnosed pre - surgically. however, three weeks after surgery patient started to feel limitation upon mouth opening and a new ct showed a new big mass of bone formation along the surgical tract. one month after total bone structure removal (first surgery) the patient could not open her mouth anymore (figs. 6 and 7) due to a significant calcified mass. traumatic miosytis ossificans is a rare clinical pathology, uncommon in the region of head and neck, and was first described by thoma in 1958 as a calcification and an intramuscular haematoma ossification after trauma. several other trauma injuries have been reported as the main cause for this condition, including third molar extraction, neck imobilization with cervical collar after laminoplasty, repeated absolute alcohol injection as trigeminal neuralgia treatment, temporomandibular joint luxation caused by 3-h mouth opening during periodontal surgery, direct or proximal physical trauma, odontogenic infection and anaesthetic injection. it is not completely understood why some patients developed an ossification of muscles after trauma, but it has many pathogenesis theories as follows : (1) displacement of bony fragments into the soft tissue and haematoma with following proliferation ; (2) detachment of periosteal fragments into the surrounding tissue with proliferation of osteoprogenitor cells ; (3) migration of subperiosteal osteoprogenitor cells into surrounding soft tissue, through periosteal perforation induced by trauma ; and, the most feasible and more accepted content among clinician, (4) metaplasia of extraosseous cells in contact to bony morphogenetic proteins derived from the lysis of bone fragments displaced within the soft tissue during traumatic injury. another possibility could be a genetic polymorphism inducing the disease in certain patients as in fibrodysplasia ossificans progressive, as described by carey. the masseter has been reported to be the predominant muscle involved with ossification, followed by temporalis, genioglossus, buccinator, medial pterygoid and lateral pterygoid. and males are more affected than females. elevated alkaline phosphatase was cited during evolution in some mo cases, perhaps resulting from disease inflammatory progress. early and complete excision of the involved muscles plus additional procedures in order to try to avoid recurrence are the worldwide therapy of choice for most surgeons. all procedures conducted in this case, such as osteotomy of the muscle attachment region, fat insertion (considered to prevent heterotopic bone formation) for haematoma formation prevention, associated to non - surgical treatments, such as corticosteroids, nonsteroidal anti - inflammatory drugs, bisphosphonates, and a low - dose radiotherapy and warfarin, have been reported as successful. unfortunately, the results from this case were not as expected and the patient developed a new calcified bone. as current follow up, this patient could benefit from a new surgical procedure or tmj prosthesis insertion. also, fractioned radiotherapy has shown some benefit for this pathology, but it compromises the region and contraindicates a surgery afterwards. another surgical procedure could result in scarring and recidive and tmj prosthesis would not prevent heterotopic bone formation. after all considerations, her father has decided to wait until his daughter grows older. the surgical technique used in this case avoided invasive gap arthroplasty to access lateral pterygoid muscle and anaesthetic scarring formation, by using an intraorally incision accessing the muscle directly as reported previously. the authors of these study did not see any relation with the condylar dislocation that the patient had five years prior to the pathology, and they could not find any real cause for the myositis ossificans of lateral pterygoid muscle. the outcome of the surgical procedure was not successful, perhaps due to the expression of the disease, indicating the need to further physiologic and genetic studies to elucidate the aetiology of mo as well as to provide directions to an adequate treatment choice for such cases. all authors participated in the treatment of the patient, before and after surgery.key learning pointintra oral access is a viable surgical option.post-operative images (ct) is mandatory for this kind of pathology.recurrence should be discussed and addressed with patient and family. intra oral access is a viable surgical option.post-operative images (ct) is mandatory for this kind of pathology.recurrence should be discussed and addressed with patient and family. | introductionmyositis ossificans (mo) is characterized as heterotopic bone formation within muscle. mo rarely occurs in the head and neck region. excision of the heterotopic bone is the standard treatment. this report summarizes a case of a 12-year old female with mo involving the lateral pterygoid muscle. the heterotopic bone was excised using an intraoral incision. despite intensive physical therapy, the operation failed as evidenced by new bone formation in the area within three weeks of the operation.presentation of casea twelve years old female patient presenting with mouth opening of 10 mm, no facial asymmetry, and no jaw joint pain or other symptoms. computer tomography (ct) exam was requested and revealed calcification of the left lateral pterygoid muscle. no other masticatory or head muscles showed any signs of calcification. the calcified muscle was completely removed beyond the ossified segment and a 35 mm mouth opening was achieved immediately after the procedure. one month after total bone structure removal (first surgery) the patient could not open her mouth anymore due to a significant calcified mass.discussionthe surgical technique used in this case avoided invasive gap arthroplasty to access lateral pterygoid muscle and anaesthetic scarring formation, by using an intraorally incision accessing the muscle directly.the authors of these study did not see any relation with the condylar dislocation that the patient had five years prior to the pathology, and they could not find any real cause for the myositis ossificans of lateral pterygoid muscle.conclusionthe outcome of the surgical procedure was not successful, perhaps due to the expression of the disease, indicating the need to further physiologic and genetic studies to elucidate the aetiology of mo as well as to provide directions to an adequate treatment choice for such cases. |
a gastrointestinal duplication is defined as a spherical structure, with a muscular coat lined by a mucous membrane. they can be found anywhere in the gastrointestinal tract, from the base of the tongue to the anus, most commonly occurring in the ileum (35%). gastric duplication cysts are a rare phenomenon and account for only 29% of all gastrointestinal duplications. the majority is circular, non - communicating and surrounded by a smooth muscular coat. they can be found anywhere in the stomach, with the majority being located on the greater curvature. gastric duplication cysts are rarely diagnosed in the adult population and occur more commonly in young children, who may present with symptoms of abdominal pain, gastric outlet obstruction or a palpable abdominal mass [2, 3 ]. clinically important ectopic tissues can include gastric, duodenal and pancreatic tissues, as demonstrated in our case report. a 28-year - old female presented to our clinic with a 4-month history of right upper quadrant and epigastric pain exacerbated by food. the patient also reported increased postprandial fullness followed by multiple episodes of nausea and emesis. a computerized tomography (ct) scan of the abdomen and pelvis showed a large cystic mass within the antrum of the stomach (fig. this was confirmed with an esophagogastroduodenoscopy ; however, there was concern that this mass was extending past the pylorus into the duodenum, causing a gastric outlet obstruction. figure 1:an abdominal ct scan demonstrating a cystic mass within the stomach (black arrow) an abdominal ct scan demonstrating a cystic mass within the stomach (black arrow) the patient underwent an exploratory laparotomy. the mass was contained within the gastric antrum and did not involve other visceral or solid organs. histopathologic examination of the lesion demonstrated a 6-cm cyst with gastric mucosa and well - developed pancreatic tissue, including acinar and ductal elements (fig. the cyst lumen was focally lined by duodenal type mucosa and was negative for dysplasia or malignancy. figure 2:histological section showing both gastric and duodenal tissues located within the cyst (a), along with pancreatic tissue (b) histological section showing both gastric and duodenal tissues located within the cyst (a), along with pancreatic tissue (b). the stomach accounts for 29% of all duplications diagnosed, which is the least common site followed by esophagus colon and ileum. most cases will occur in females compared to males (8:1), with the majority of cases being diagnosed in the pediatric population within the first 3 months of life and rarely after 12 years of age [2, 3 ]. preoperative workup can include abdominal ultrasound, ct scan, magnetic resonance imaging and more recently endoscopic ultrasound [4, 5 ]. although gastric duplication cysts are a rare entity, they can present with a multitude of symptoms. adult patients can present with abdominal pain, nausea, vomiting, dysphagia, dyspepsia, abdominal distention and potentially anemia. weight loss can also occur secondarily to abdominal pain and distention as seen in our patient. hemorrhage, perforation, malignancy or complete gastric outlet obstruction can occur based on location or type of ectopic tissue present. although gastric duplication cysts can be found anywhere in the stomach, the most common location is the distal greater curvature. they may communicate with the gastric lumen as described in our case ; however, the majority is non - communicating with a cystic configuration [1, 7 ]. another distinctive feature is that any type of gastrointestinal mucosa can line the cyst. both gastric and pancreatic ectopic tissues can be seen, which are the most common and tend to be the most clinically significant, as patients can develop complications, such as bleeding, peptic ulcer disease or pancreatitis. even more rare are complex duplications, which can present with gastric mucosa and islands of heterotopic tissues such as respiratory, duodenal and pancreatic tissue. multiple treatment modalities have been reported in the literature including enucleation, formation of cystgastrostomy and even endoscopic removal. complete excision is recommended not only for symptomatic relief as seen with a gastric outlet obstruction, but also because of the risk of malignant degeneration. though rarely reported, there have been at least 14 cases of adenocarcinoma diagnosed in gastric duplication cysts after resection in the english literature. if malignant transformation is suspected, surgical resection is the treatment of choice. gastric duplication cysts are a rare entity, which can contain various heterotopic tissues, such as duodenal or pancreatic islands. surgical excision should be performed in patients who can tolerate surgery when the cyst is symptomatic or the risk of malignant degeneration is of concern. gastric duplication cysts should be contained in the list of differentials when evaluating submucosal gastric masses. verbal and written informed consent was obtained from the patient for publication of this case report and any accompanying images. a copy of the written consent is available for review by the editor of this journal. | gastric duplication cysts are an uncommon finding, especially in the adult population. presenting symptoms can be non - specific, but can include abdominal pain, nausea and emesis. in this report, we present a 28-year - old female diagnosed with a communicating gastric cyst with both gastric and duodenal mucosa, along with pancreatic tissue and no evidence of dysplasia or malignancy. the clinical picture, diagnosis and treatment are described and compared to findings in the literature. |
plasma membrane - located trail - r1/r2 induce both cell death and non - apoptotic signaling pathways.tumor cells show elevated intracellular levels of trail - r1/r2.nuclear trail - r2 interacts with the microprocessor complex, inhibits let-7 maturation and enhances tumor cell proliferation. plasma membrane - located trail - r1/r2 induce both cell death and non - apoptotic signaling pathways. nuclear trail - r2 interacts with the microprocessor complex, inhibits let-7 maturation and enhances tumor cell proliferation. what is the mechanism of nuclear import / export of trail - r2 and how is this regulated?which mirnas, beside let-7, are regulated by ntrail - r2?what are additional specific functions of ntrail - r2 ? is there any impact of other trail - rs (trail - r1, -r3 and -r4) on nuclear localization and function of trail - r2?do trail - r1, trail - r3 and trail - r4 possess independent specific nuclear activities?is there a specific function of cytoplasmic trail death receptors ? what is the mechanism of nuclear import / export of trail - r2 and how is this regulated ? which mirnas, beside let-7, is there any impact of other trail - rs (trail - r1, -r3 and -r4) on nuclear localization and function of trail - r2 ? do trail - r1, trail - r3 and trail - r4 possess independent specific nuclear activities ? the death ligand tnf - related apoptosis - inducing ligand (trail), a member of the tnf cytokine superfamily, interacts with five different receptors, plasma membrane - expressed trail - r1 - 4 and a soluble receptor, osteoprotegerin (opg), all members of the tnf receptor superfamily. two trail receptors, trail - r1/dr4 and trail - r2/dr5/trick / killer, contain a cytoplasmic death domain (dd) and are hence able to induce apoptosis. trail has governed particular interest because of its apparent tumor cell - specific apoptosis - inducing capacity. consequently, trail and agonistic trail death receptor - specific antibodies are regarded as promising therapeutic agents for treatment of various malignancies and are currently under clinical investigation. however, many tumor cells are resistant to trail - mediated apoptosis and, furthermore, trail death receptors may induce pro - inflammatory, invasion- and metastasis - promoting non - apoptotic signaling pathways under certain conditions. these observations point to the necessity to improve trail - r1/r2-targeting therapies by combination with molecules sensitizing to cell death and at the same time inhibiting potentially harmful non - apoptotic signaling. overexpression of trail - r1 and/or trail - r2 has been demonstrated for many tumor entities (table 1). importantly, these studies detected mainly an intracellular localization of the receptors, suggesting that intracellular trail - r1 and trail - r2 may provide a growth advantage or other benefit for tumor cells. indeed, correlation of the expression status with clinical parameters disclosed prevalent prognostic significance of high death receptor expression, identifying predominantly trail - r2 and occasionally also trail - r1 as negative prognostic markers (table 1). for example, high trail - r2 expression correlated with higher tumor grade, positive nodal status and shortened survival of breast cancer patients. strong trail - r2 expression also negatively correlated with disease - free survival of patients suffering from metastatic hnscc. for stage i and ii nsclc, high trail - r2 expression correlated with poorly differentiated tumors and significantly reduced patient survival. similarly, poorly differentiated areas of stage iii nsclc showed high expression of trail - r1 and trail - r2, but only trail - r2 positivity was associated with an increased risk of death. moreover, pancreatic cancer cells with stem cell characteristics also express trail - r2 at increased levels. correspondingly, high intracellular expression of trail - r2 has been demonstrated for stem cells at the base of the intestinal crypts in the small intestine. thus, trail - r1 was identified as an independent prognostic marker for a more favorable course of colorectal carcinoma. in bladder cancer, higher levels of either trail - r1 or trail - r2 correlated with longer recurrence - free survival. in glioblastoma multiforme, high expression of both trail - r1 and trail - r2, of note mainly expressed at the cell surface, was found to be associated with longer overall survival of the respective patients. so far, mainly the overall tissue expression level of trail receptors and occasionally also their presence at the cell surface were taken into account when estimating their values as a prognostic marker for cancer. however, recent discoveries on trail - r2 functions revealed that even though an enormous body of information on death receptors has been gathered, our knowledge of the cellular functions of these receptors is still incomplete. the authors report that nuclear trail - r2 (ntrail - r2) is engaged in microrna (mirna) maturation, thus performing functions entirely different from its classical role as a plasma membrane - located signal transducer. with this finding, the frequently observed high intracellular expression of trail - rs in tumors gains importance and demands careful re - evaluation. here we review the known functions of human trail death receptors with respect to their subcellular compartmentalization. the novel nuclear functions of trail - r2 will be discussed in comparison to nuclear functions of other conventionally plasma membrane - located cytokine and growth factor receptors. the best understood function of trail - r1 and trail - r2 is the induction of apoptosis (reviewed in gonzalvez and ashkenazi and see figure 1). upon trail ligation, trail death receptors cluster into higher multimeric complexes and gain the capability of assembling a disc (death - inducing signaling complex) at their intracellular dd. through this domain, trail - r1 and trail - r2 recruit the adaptor protein fadd (fas - associated protein with death domain) that in turn, via death effector domain (ded), recruits the inactive pro - forms of the initiator caspases pro - caspase-8 and -10. proximity - induced self - cleavage of pro - caspases within the disc leads to their activation and subsequent dissociation from the membrane - localized receptor complexes. besides death receptors, trail can also bind to two additional plasma membrane - bound receptors, trail - r3 and trail - r4. trail - r3 is a glycosylphosphatidylinositol - anchored receptor lacking transmembrane and cytoplasmatic domains and is therefore not capable of inducing intracellular signaling. trail - r4 is more homologous to the trail death receptors, but because of a truncated dd, it is unable to induce apoptosis. efficiency of the initiator caspase activation may be influenced at the disc level, for example, by variation of its composition. it has been shown that the complex formation between death receptors trail - r1 and trail - r2 and the apoptosis - incompetent receptors, trail - r3 or trail - r4, leads to impaired disc function. in addition, recruitment of the proteolytically inactive caspase homolog cflip (cellular flice - like inhibitory protein) represents an apoptosis - inhibiting mechanism. in some cells, activated initiator caspases may directly activate the effector caspases 3, 6 and 7, which in turn cleave a broad range of protein substrates and execute cell death. such cells have been classified as the so - called type i cells with respect to apoptosis induction. in contrast, type ii cells use the loop way via engagement of the intrinsic apoptosis pathway to amplify the death signal generated at the disc. in these cells, caspase-8-mediated cleavage of the bh3-only protein bid generates its truncated form (tbid) that, by association with bax and bak, leads to the mitochondrial outer membrane permeabilization (momp) and to the release of pro - apoptotic mitochondrial proteins like cytochrome c, smac / diablo (second mitochondria - derived activator of caspase / direct iap binding protein with low pi) and htra2/omi (high temperature requirement protein a2/omi) into the cytosol. cytosolic cytochrome c together with atp and apaf-1 (apoptotic protease activating factor-1) form a second caspase - inducing platform, the apoptosome, that mediates the activation of caspase-9. an alternative trail - induced apoptosis pathway has been described in hepatocytes (figure 1). in these cells, trail - r2 is internalized upon trail stimulation by endocytosis, targeted via vesicular transport to lysosomes that become permeabilized and release cathepsin b, subsequently promoting cell demise. lysosomal membrane permeabilization (lmp) as a precondition for the execution of apoptosis in these cells requires the pacs-2 (phosphofurin acidic cluster sorting protein 2)-mediated recruitment of bim and bax to lysosomal membranes. under conditions when caspases are inhibited, plasma membrane - expressed trail death receptors may also induce an alternative death pathway known as necroptosis. for this pathway, a pivotal role of the kinases rip-1 (receptor - interacting protein-1), rip-3 as well as pseudo - kinase mlkl (mixed lineage kinase domain - like) has been shown, but the exact molecular mechanisms of trail - induced necroptosis are still not fully understood. over the past years, it has become increasingly evident that trail - r1 and trail - r2, besides death signaling pathways, can also activate multiple non - cell death signal transduction pathways like nf-b (nuclear factor -light - chain - enhancer of activated b cells), pkc (protein kinase c), pi3k (phosphatidylinositide 3-kinases), akt / pkb, src (rous sarcoma virus oncogene cellular homolog) and tak1 (transforming growth factor- activated kinase 1), as well as different members of the map - kinase family like erk1/erk2 (extracellular regulated kinases), jnk (c - jun n - terminal kinase) and p38 (figure 1). regarding the molecular determinants for trail - mediated activation of cell death or non - apoptotic pathways, the engagement of different protein complexes has been proposed. in this respect, non - apoptotic pathways have been suggested to be activated within a secondary signaling complexes formed downstream of the disc. besides fadd and pro - capase-8, the secondary signaling complex also include specific adaptor proteins like rip1, traf2 and nemo. different localizations of aggregated trail receptors within specific plasma membrane domains have also been proposed to determine the formation and activity of ligand - induced trail - r1/r2 signaling complexes. hence, aggregated trail receptors localized in lipid rafts were shown to be involved in the apoptotic signaling, whereas those localized outside lipid rafts form complexes capable of non - apoptotic signaling. alternative to the mapks activation via secondary protein complexes, their stimulation via effector caspases was described in prostate cancer cells. here, two different proteolytic fragments of mst1 (mammalian sterile 20-like kinase 1) generated upon cleavage by caspases-3 or -7 selectively activate erk or jnk and p38, respectively. this multiplicity and heterogeneity of trail - induced pathways, as briefly outlined, is responsible for the observed broad cellular effects of this cytokine ranging from the induction of cell death, establishment of a death - resistant phenotype and expression of pro - inflammatory molecules promoting cell proliferation, migration and invasion (figure 1). particularly in apoptosis - resistant tumor cells, trail - induced pro - inflammatory pathways may result in enhanced invasion and metastasis in vivo. a comprehensive overview of trail - induced non - apoptotic signaling pathways and their functional relevance in different cellular systems is provided in the recent review by azijli. in addition to their plasma membrane expression, trail - r1 and trail - r2 are also often found in the cytoplasm of several cell types (tables 1 and 2). however, in most cases the cytoplasmic localization of trail death receptors was not resolved in detail. thus, it still remained unclear whether the intracellular staining in cancer cells observed by immunohistochemistry reflects localization of trail receptors in the membranes of organelles within the secretory and/or endocytotic pathway or whether a non - membraneous cytosolic localization of the receptors was also detected in these cases. the presence of trail - r1 and trail - r2 in soluble cytosolic fractions of diverse tumor cells was demonstrated recently. as the subcellular fractionation was performed without the use of any detergent, it can be concluded that these receptors are not anchored in intracellular membranes, but are present in the non - membraneous cytosolic compartment. the function of these soluble trail death receptors remains to be shown. in colon carcinoma, the cytoplasmic staining of trail death receptors was interpreted as the presence of these receptors in the trans - golgi network, a finding previously described for melanoma cells. the study on apoptosis - resistant breast cancer cells demonstrated the presence of trail receptors in autophagosomes rather than the plasma membrane. treatment of these cells with different inhibitors of autophagy led to a re - appearance of both trail death receptors on the cell surface and sensitized these cells toward trail - mediated death. a correlation of apoptosis resistance with intracellular presence of death receptors in breast cancer cells was also proposed in another study. finally, as internalization of trail death receptors in response to trail treatment has been demonstrated in cell lines, the cytoplasmic localization of trail receptors in tumor tissue could be caused by an autocrine or paracrine activation of their internalization by stroma and/or tumor cell - derived trail. summing up, despite the variety of intracellular trail death receptor locations, the frequently observed loss of trail death receptors at the cell surface in tumors seems to be a general principle for the acquisition of trail resistance in cancer cells. in addition, high cytoplasmic levels of these receptors as well as their presence in soluble form suggest specific pro - tumoral functions in this location. few relatively recent studies show the localization of trail receptors in the nucleus (tables 1 and 2). an early report on the melanoma cell line, mel - fh, demonstrated trail - r1 as predominantly expressed in the nucleus, where it colocalized with trail - r3 and trail - r4. nuclear presence of trail - r1 and trail - r2 has also been shown for normal and psoriatic skin, with ntrail - r2 being more strongly expressed in psoriatic lesions and in the dermis of psoriatic skin compared with healthy skin. in the same study, cd4 + and cd8 + cells of the inflammatory infiltrate showed exclusive nuclear staining for trail - r1. nuclear presence of trail - r2 was also described for nonmalignant, normal lung bronchial epithelial cells in basal nuclei. however, staining of these cell nuclei was in general weak and restricted to a small number of cells. only very few studies have addressed the functional relevance of ntrail - r2. again, as for the presence of trail - r1/r2 in the cytoplasm, the nuclear sequestration has been proposed as an apoptosis - resistance mechanism. trophoblast cells of the human placenta were found resistant to trail - mediated apoptosis and expressed high levels of trail - r2 that was mainly localized in the nucleus. following stimulation with tnf, trail - r2 relocated to the plasma membrane and the cells became trail sensitive. another study demonstrated that inhibition of the nuclear import of trail - r2 sensitized hela and hepg2 cells to trail - induced apoptosis. two very recent studies provide hints for surprizing and entirely novel functions of ntrail - r. in one report, the pattern of intracellular distribution of trail - r during the development of the mouse cns was studied. the authors demonstrated that the expression of trail - r was not only restricted to proliferating zones but, importantly, was mainly located in the cell nuclei, suggesting a specific, proliferation - associated function of ntrail - r. another study investigating human nuclear trail receptors finally uncovered specific functions of ntrail - r2 connecting this receptor to the process of mirna maturation (figure 2). briefly, in several different tumor cells, ntrail - r2 interacts with the core microprocessor complex drosha / dgcr8 and with several of its accessory proteins, p68, nf45 and hnrnpa1. through this interaction, ntrail - r2 inhibits maturation of the mirna let-7 and consequently increases the levels of let-7 targets lin28b and hmga2. hmga2 and lin28b proteins are highly expressed in embryonic tissues, downregulated in differentiated tissues and, because of low expression of let-7, re - expressed in tumors, where their levels positively correlate with tumor progression. in this scenario, inhibition of let-7-maturation by ntrail - r2 enhances the malignancy of tumor cells. in line with this notion, it was observed that trail - r2 was expressed at higher levels in cell nuclei of pdac tissue than in nuclei of peritumoral normal duct cells. moreover, high ntrail - r2 correlated with high nuclear hmga2 expression in the same tissue and with worse prognosis of patients with early - stage pdac. furthermore, knockdown of trail - r2 resulted in decreased growth of experimental orthotopic tumors in mice, and progressive decrease of trail - r2 expression as well as its exclusion from the nuclei accompanied the differentiation of pancreatic tumor cells into three - dimensional duct - like structures in vitro. the correlation of nuclear localization of trail receptors and survival of cancer patients was analyzed, to the best of our knowledge, in only one additional report. in a study on nsclc tumors from patients treated with chemotherapy, all four trail receptors were detected in the nuclei and cytoplasm. in these patients, however, high nuclear and cytoplasmic expression of trail - r2 correlated with improved survival. however, it is well known that chemotherapeutic agents upregulate trail - r2 in cells with wild - type p53. unfortunately, the p53 status was not analyzed in this study and it may be possible that the observed positive correlation simply reflects the better prognosis of patients with wild - type p53. in agreement with this interpretation, other studies on untreated lung cancer patients, as well as patients suffering from other cancers, have instead found negative correlations between high overall expression of trail - r2 and the survival time of the patients. the nuclear presence of trail death receptors represents a new example of plasma membrane receptors that can localize to the nucleus, where they elicit functions distinct from their canonical signal transduction pathways that originate at the plasma membrane. most prominently, the receptor tyrosine kinases (rtks), and among them the members of the epidermal growth factor receptor (egfr) family, have been found to shuttle to the nucleus in response to ligand binding (reviewed by carpenter and liao and wang.). here, via interaction with classical transcription factors or with rna helicase a (rha), in addition, via interaction with rna - polymerase i, egfr2 increases rrna expression and cellular translation. egfrs may also phosphorylate nuclear proteins such as pcna, and dna - dependent protein kinase (dna - pk), thus influencing a variety of other nuclear processes like dna replication and dna damage repair. other rtks found in the nucleus are fibroblast growth factor receptors (fgf - r1, -r2 and -r3 ; reviewed by bryant and stow) vascular endothelial growth factor receptors (vegf - r1, see cai. and vegf - r2, insulin receptor, cmet, trka, growth hormone receptor and receptor tyrosine kinase - like orphan receptor 1 (ror1). particularly well understood are functions of nuclear fgf - r1 that, via its interaction with 90-kda ribosomal s6 kinase (rsk1), activates the transcription factor creb, thus regulating the transcription of genes involved in proliferation and differentiation. as rsk1 phosphorylates several transcription factors as well as histone h3, the ability to activate rsk1 enables nuclear fgf - r1 to regulate a plethora of biological processes. besides rtks, other types of cell surface transmembrane receptors have also been described as being localized in the nucleus. type i transforming growth factor receptor (tr1) can localize to the nucleus following tgf- treatment, where it can interact with hnrnpa1, thus stimulating the alternative splicing of pre - mrna for egfr1. it is noteworthy that hnrnp a1, besides its known regulatory role in splicing, was also described as an accessory protein of the microprocessor complex interacting with ntrail - r2 in this context. however, in contrast to the findings for trail - r2, no association of tr1 with mirna maturation has been described till now. cd40 and the b cell - activating factor receptor (baff - r), both members of the tnf receptor superfamily, also localize to the nucleus in normal and malignant b cells, in addition to their plasma membrane expression. in the nucleus, these receptors interact with c - rel and enhance transcription of several nf-b target genes. nuclear baff - r, in addition, interacts with ikk- and histone h3, leading to increased ikk--mediated phosphorylation of histone h3. the surprising role of ntrail - r2 in regulating let-7-maturation strongly demands future research on the mechanisms of intracellular trafficking of this receptor. regarding the mechanism by which full - length plasma membrane receptors passage to the nucleus, the intracellular trafficking of rtks might serve as a model. following ligand binding at the cell surface, egfrs are internalized via endocytosis, moved by retrograde transport in endosomal vesicles into the er and subsequently translocated through the er membrane into the cytosol by action of the sec61 translocon. free cytosolic full - length receptors can then be bound at their tripartite nuclear localization motif (nls) by -importin and finally imported into the nucleus through the nuclear pore complex. an alternative model for the entry of full - length egfr family members into the nucleus involving a passage of these receptors into the nucleoplasm through a sec61 translocon in the inner nuclear membrane has also been proposed. for fgf - r1 it was shown that soluble cytoplasmic and nuclear forms and, on the other hand, plasma membrane receptors represent separated pools of different origin and with distinct functions. it has been proposed that fgf - r1 is synthesized at er - attached polyribosomes and either enters golgi, becomes extensively glycosylated and reaches the plasma membrane or, in non - glycosylated form, exits pre - golgi vesicles and translocates as soluble cytoplasmic form complexed with rsk1 into the nucleus via nuclear pores. the origin of the soluble form of ntrail - r2 as well as the mode of its nuclear translocation is currently completely unknown. the receptors may either originate from the plasma membrane or from the non - membraneous soluble cytoplasmic receptor pool. the latter pathway seems to be more likely, as neither inhibition of endogenous secreted or plasma membrane expressed trail via neutralizing antibodies nor the treatment of cells with recombinant trail influenced the nuclear levels of trail - r2. it has been reported recently that mutation of these sequences or knockdown of importin- resulted in a diminished nuclear presence of trail - r2 and, in parallel, enhanced expression at the plasma membrane. in contrast to this study, experiments performed in our laboratory using the same nls - mutated trail - r2 form did not reveal any impact of these nls sequences on the nuclear import of the recombinant trail - r2 in panc1 and mda - mb-231 cells (a. trauzold, unpublished observations). however, we can not rule out that the overexpressed nls - mutated trail - r2 interacts with endogenous trail death receptors and utilize them as trojan horses for nuclear import in these cells. further studies are necessary to clarify the exact mechanism of the translocation of trail - r2 to the nucleus. another important question concerns the mechanism(s) by which ntrail - r2 inhibits the drosha - mediated processing activity toward pri - let-7. drosha and dgcr8 constitute the core of the microprocessor complex that associates with multiple accessory proteins as hnrnpa1, p68, ksrp, nf45 and nf90. the core complex is capable of pri - mirna processing in the absence of cofactors, whereas the associated factors in the larger complex may facilitate or alter the selectivity of nuclear mirna processing. accordingly, pri - let-7 is processed in a complex manner involving stimulatory factors (p68 and ksrp) as well as inhibitors (hnrnpa1, nf45 and nf90 ; figure 3). it seems likely that ntrail - r2 modulates the pri - let-7 processing by interaction with nf45, hnrnpa1 and p68. this may be facilitated by either sequestration of activators or stabilization of an inhibitory complex. it can be assumed that via its interaction with aforementioned proteins, ntrail - r2 might also influence the maturation of other mirnas in addition to let-7. in this respect it is worth mentioning that p68 has been implicated in the recognition of a subset of pri - mirnas targeting these for drosha - mediated processing. analysis of global changes of mirna levels in cells with knockdown of trail - r2 indicates the existence of further trail - r2-regulated mirna, besides the members of the let-7-family being most prominently represented. however, the array results have to be independently verified and, in addition, the question of whether these mirnas are regulated by ntrail - r2 or by plasma membrane - expressed trail - r2 remains to be answered. further investigations should also tackle the structural basis for the interactions of ntrail - r2 with proteins of the microprocessor complex. as the core components drosha and dgcr8 were found to interact with trail - r2 in an indirect manner, attempts should be made to delineate the physical contact sites between trail - r2 and the accessory proteins, that is, hnrnpa1, p68, nf45 and nf90. insights into the structural constraints of the interaction sites might allow the design of pharmacological inhibitors of these interactions, opening opportunities for targeted therapeutic interventions in the future. in spite of more than a decade of research on trail death receptors, until very recently only their canonical signaling functions at the plasma membrane or within the endosomal / lysosomal compartment have been investigated. however, a number of reports also pointed to the intracellular presence of trail - r1 and trail - r2. in intracellular compartments, trail death receptors are likely to neither contribute to canonical apoptosis signaling nor to non - apoptotic signal transduction, regardless of whether they are soluble within cytosol, trapped within the trans - golgi network, in autophagosomes or are present in the nucleus. the elevated intracellular expression of trail death receptors in cancer and the emerging evidence for their compartmentalization - dependent functions make clear that it is not sufficient to determine the general receptor expression in cells or tissues in a given experimental context. instead, it is important to perform differentiated analyses of the subcellular distribution of receptors for the understanding of both the molecular biology and the disease - related relevance of trail death receptors, especially when conclusions on the impact of these receptors for disease prognosis are drawn. now, a first study has demonstrated a functional impact of the nuclear localization of trail death receptors in cancer cells. trail - r2 was found to associate with components of the large microprocessor complex inhibiting the processing of pri - let-7 mirna. such an effect of ntrail - r2 on mirna processing is clearly distinct from the known nuclear functions of other cell surface receptors as egfr family members, other rtks or cytokine receptors that can modulate dna - associated processes like replication, transcription or dna damage repair and rna splicing. thus, these novel findings will stimulate the search for unknown trail - r2-specific nuclear functions, among them regulation of other mirnas and possibly also rna- and dna - targeting mechanisms. this will further broaden the range of possibly affected nuclear regulatory processes of plasma membrane receptors that emerge as important regulators in the cell nucleus. the findings on a specific function of ntrail - r2 should also promote the search for possible unknown nuclear functions of other members of the death receptor family. in this respect, the capability of trail - r1 and trail - r4 to specifically interact with trail - r2 in the nucleus also raises the question of the capacity of these receptors to modulate the nuclear functions of trail - r2. finally, these recent insights into trail receptor biology might open new perspectives for anti - cancer therapies targeting processes regulated by ntrail - r2. | localized in the plasma membrane, death domain - containing tnf - related apoptosis - inducing ligand (trail) receptors, trail - r1 and trail - r2, induce apoptosis and non - apoptotic signaling when crosslinked by the ligand trail or by agonistic receptor - specific antibodies. recently, an increasing body of evidence has accumulated that trail receptors are additionally found in noncanonical intracellular locations in a wide range of cell types, preferentially cancer cells. thus, besides their canonical locations in the plasma membrane and in intracellular membranes of the secretory pathway as well as endosomes and lysosomes, trail receptors may also exist in autophagosomes, in nonmembraneous cytosolic compartment as well as in the nucleus. such intracellular locations have been mainly regarded as hide - outs for these receptors representing a strategy for cancer cells to resist trail - mediated apoptosis. recently, a novel function of intracellular trail - r2 has been revealed. when present in the nuclei of tumor cells, trail - r2 inhibits the processing of the primary let-7 mirna (pri - let-7) via interaction with accessory proteins of the microprocessor complex. the nuclear trail - r2-driven decrease in mature let-7 enhances the malignancy of cancer cells. this finding represents a new example of nuclear activity of typically plasma membrane - located cytokine and growth factor receptors. furthermore, this extends the list of nucleic acid targets of the cell surface receptors by pri - mirna in addition to dna and mrna. here we review the diverse functions of trail - r2 depending on its intracellular localization and we particularly discuss the nuclear trail - r2 (ntrail - r2) function in the context of known nuclear activities of other normally plasma membrane - localized receptors. |
what is less appreciated is that, according to the us renal data system, 217 hospitalisations per 1,000 patient - years are attributed to congestive heart failure (chf). in the general population, single measurements of brain natriuretic peptide (bnp) and its n - terminal fragment (nt - probnp) accurately discriminate between chf and other causes of breathlessness that lead to hospital admissions. concentrations of these natriuretic peptides are related to left ventricular (lv) filling pressures and wall stress. in dialysis patients, fluid overload and lv structural and functional abnormalities are both frequent and difficult to differentiate. in dialysis patients, bnp and nt - probnp levels single, cross - sectional measurements of nt - probnp are powerful predictors for all - cause mortality and cardiovascular death, and baseline nt - probnp measurements may facilitate efforts to stratify the risk in patients starting hd. however, few studies have examined the diagnostic utility of serial assessments of nt - probnp in the hd population. nevertheless, monitoring bnp levels is currently used for patients with heart failure as troughton. showed that bnp - guided treatment of heart failure reduced total cardiovascular events and delayed the time to the first event compared with intensive clinically guided treatment. in the family of natriuretic peptides, nt - probnp seems to be the best predictor of clinical outcome and the best marker of extracellular fluid overload. this peptide is larger and has a longer half - life than bnp (the active form), making its measurement easier. therefore, we sought to examine the relationship between an increase in nt - probnp levels and future clinical events in a prospective cohort, i.e. whether follow - up nt - probnp measurements add further prognostic information in hd patients. more specifically, we assessed the value of the relative changes in nt - probnp as independent predictive markers of chf events. a prospective cohort study of hd patients was conducted during 18 months. both prevalent and the medical history of all patients was collected at baseline, and events occurring during follow - up were systematically recorded. patients were followed up for the occurrence of medical adverse events, i.e. chf events, cardiac ischaemia, arrhythmia, hospitalisation for other cardiac events or infectious disease, and death. the patients were censored at the time of renal transplantation, death, and first chf event. this study was approved by the local institutional review board, and informed consent was obtained from all patients who participated in the study. at the beginning of the follow - up, i.e. at baseline, measurement of the nt - probnp level was performed every month. serum nt - probnp was quantified by electrochemiluminescence immunoassay on the cobas e601 analyser (roche diagnostics corp.). the variability of the nt - probnp assay is always below 6% in our lab (recommended : below 9%). a chf event was defined as the first admission for chf requiring hospitalisation and any episode of chf requiring a session of additional dialysis as an emergency in our centre. the clinical diagnosis of chf was made by the attending physician on the basis of the presence of symptoms and signs of chf including moderate to severe dyspnoea (class iii and iv according to the new york heart association), raised jugular venous pressure, and basal crepitations. this information was retrieved from the computerized medial medical record system (echo, nantes, france) that keeps detailed records of all hospitalisation and/or acute events. the following characteristics of the patients were collected at baseline to adjust our analyses : age and sex, weight and height (body mass index), time on dialysis, comorbidities including diabetes, coronary artery disease, valvular heart disease, arrhythmia, hypertrophic cardiomyopathy, dilated cardiomyopathy, and altered lv ejection fraction (lvef ; < 40% on 2-dimensional echocardiography). quantitative variables were presented as mean standard deviation (min max) and binary variables were presented as proportions. then, patients were divided according to the outcome criteria, i.e. the occurrence of a chf event, and their characteristics and levels of nt - probnp at baseline were compared. we assessed the evolution of nt - probnp separately in patients without a chf event and in patients who developed a chf event. this regression analysis was a nested case - control study. in a nested case - control study, cases of a disease that occur in a defined cohort are identified and, for each, a specified number of matched controls is selected from among those in the cohort who have not developed the disease by the time of disease occurrence in the case. the nested case - control design is particularly advantageous for studies of biologic disease precursors. the evolution of the nt - probnp measurements before a chf event was compared to the evolution of the nt - probnp measurements at the same time for the controls, using a polynomial regression for repeated measurements. then, the usefulness of the relative change in nt - probnp level to predict the risk of a chf event was assessed by the analysis of receiver operating characteristic (roc) curves. the relative change in nt - probnp was defined as the proportion of increase or decrease in nt - probnp measured compared to the previous measurement. a prospective cohort study of hd patients was conducted during 18 months. both prevalent and the medical history of all patients was collected at baseline, and events occurring during follow - up were systematically recorded. patients were followed up for the occurrence of medical adverse events, i.e. chf events, cardiac ischaemia, arrhythmia, hospitalisation for other cardiac events or infectious disease, and death. the patients were censored at the time of renal transplantation, death, and first chf event. this study was approved by the local institutional review board, and informed consent was obtained from all patients who participated in the study. at the beginning of the follow - up, i.e. at baseline, measurement of the nt - probnp level was performed every month. serum nt - probnp was quantified by electrochemiluminescence immunoassay on the cobas e601 analyser (roche diagnostics corp.). the variability of the nt - probnp assay is always below 6% in our lab (recommended : below 9%). a chf event was defined as the first admission for chf requiring hospitalisation and any episode of chf requiring a session of additional dialysis as an emergency in our centre. the clinical diagnosis of chf was made by the attending physician on the basis of the presence of symptoms and signs of chf including moderate to severe dyspnoea (class iii and iv according to the new york heart association), raised jugular venous pressure, and basal crepitations. this information was retrieved from the computerized medial medical record system (echo, nantes, france) that keeps detailed records of all hospitalisation and/or acute events. a chf event was defined as the first admission for chf requiring hospitalisation and any episode of chf requiring a session of additional dialysis as an emergency in our centre. the clinical diagnosis of chf was made by the attending physician on the basis of the presence of symptoms and signs of chf including moderate to severe dyspnoea (class iii and iv according to the new york heart association), raised jugular venous pressure, and basal crepitations. this information was retrieved from the computerized medial medical record system (echo, nantes, france) that keeps detailed records of all hospitalisation and/or acute events. the following characteristics of the patients were collected at baseline to adjust our analyses : age and sex, weight and height (body mass index), time on dialysis, comorbidities including diabetes, coronary artery disease, valvular heart disease, arrhythmia, hypertrophic cardiomyopathy, dilated cardiomyopathy, and altered lv ejection fraction (lvef ; < 40% on 2-dimensional echocardiography). quantitative variables were presented as mean standard deviation (min max) and binary variables were presented as proportions. then, patients were divided according to the outcome criteria, i.e. the occurrence of a chf event, and their characteristics and levels of nt - probnp at baseline were compared. we assessed the evolution of nt - probnp separately in patients without a chf event and in patients who developed a chf event. this regression analysis was a nested case - control study. in a nested case - control study, cases of a disease that occur in a defined cohort are identified and, for each, a specified number of matched controls is selected from among those in the cohort who have not developed the disease by the time of disease occurrence in the case. the nested case - control design is particularly advantageous for studies of biologic disease precursors. the evolution of the nt - probnp measurements before a chf event was compared to the evolution of the nt - probnp measurements at the same time for the controls, using a polynomial regression for repeated measurements. then, the usefulness of the relative change in nt - probnp level to predict the risk of a chf event was assessed by the analysis of receiver operating characteristic (roc) curves. the relative change in nt - probnp was defined as the proportion of increase or decrease in nt - probnp measured compared to the previous measurement. the mean age of the population was 59.84 17.4 years (18.388.3), and 36% were female. the mean hd duration was 46 74.3 months (0482). in total, 61.4% of our patients were caucasian, 11.5% were black, and 27.1% of other origins. patients had a history of diabetes in 25% of the cases and a history of coronary artery disease in 30.5%. echocardiographic data from baseline showed hypertrophic cardiomyopathy, dilated cardiomyopathy, and altered lvef in 25.4, 7.2, and 23% of the cases, respectively. the mean follow - up was 12.5 months (218), during which 44 (18.6%) patients developed a chf event, of which 22 patients required hospitalisation and 22 patients required a session of additional dialysis in our centre. the length of hospitalisation was 8.64 6.1 days (121), depending on the need for further exploration or the patient 's general condition. table 1 provides a comparison of the patients baseline characteristics according to their evolution with or without a chf event. baseline nt - probnp levels were significantly higher among patients who subsequently developed a chf event than among those who did not (2,438 vs. 7,982 patients who developed a chf event had significantly more dilated cardiomyopathy (18.2 vs. 4.7%, respectively) and/or altered lvef (47.7 vs. 17.2%, respectively) at baseline compared with patients who did not develop a chf event. the body mass index was lower in the group of patients who subsequently developed a chf event. the graphical representation of the evolution of nt - probnp before a chf event showed a clear increase of the biomarker during the months preceding the chf event (fig. the regression analysis showed that this difference of evolution was statistically significant (p < 0.05) for the measurement during approximately the 2 months preceding the event. the proportion of the increase or decrease in nt - probnp measured at two consecutive visits was assessed as a predictor of a chf event (fig. the auc was 0.80. if the threshold of positivity was chosen in favour of specificity, then, at 20% of the relative increase in nt - probnp, the sensitivity of the test was 0.57 and the specificity 0.77. if the threshold was chosen in favour of sensitivity, then, if all positive relative changes were considered as predictors, the sensitivity was 0.97 but at the price of a low specificity of 0.59. only 1 patient had a decrease in nt - probnp between the two last visits before a chf event. the mean age of the population was 59.84 17.4 years (18.388.3), and 36% were female. the mean hd duration was 46 74.3 months (0482). in total, 61.4% of our patients were caucasian, 11.5% were black, and 27.1% of other origins. patients had a history of diabetes in 25% of the cases and a history of coronary artery disease in 30.5%. echocardiographic data from baseline showed hypertrophic cardiomyopathy, dilated cardiomyopathy, and altered lvef in 25.4, 7.2, and 23% of the cases, respectively. the mean follow - up was 12.5 months (218), during which 44 (18.6%) patients developed a chf event, of which 22 patients required hospitalisation and 22 patients required a session of additional dialysis in our centre. the length of hospitalisation was 8.64 6.1 days (121), depending on the need for further exploration or the patient 's general condition. table 1 provides a comparison of the patients baseline characteristics according to their evolution with or without a chf event. baseline nt - probnp levels were significantly higher among patients who subsequently developed a chf event than among those who did not (2,438 vs. 7,982 patients who developed a chf event had significantly more dilated cardiomyopathy (18.2 vs. 4.7%, respectively) and/or altered lvef (47.7 vs. 17.2%, respectively) at baseline compared with patients who did not develop a chf event. the body mass index was lower in the group of patients who subsequently developed a chf event. the graphical representation of the evolution of nt - probnp before a chf event showed a clear increase of the biomarker during the months preceding the chf event (fig. the regression analysis showed that this difference of evolution was statistically significant (p < 0.05) for the measurement during approximately the 2 months preceding the event. the proportion of the increase or decrease in nt - probnp measured at two consecutive visits was assessed as a predictor of a chf event (fig. the auc was 0.80. if the threshold of positivity was chosen in favour of specificity, then, at 20% of the relative increase in nt - probnp, the sensitivity of the test was 0.57 and the specificity 0.77. if the threshold was chosen in favour of sensitivity, then, if all positive relative changes were considered as predictors, the sensitivity was 0.97 but at the price of a low specificity of 0.59. only 1 patient had a decrease in nt - probnp between the two last visits before a chf event. these data show that the relative change in nt - probnp plasma levels is a significant risk predictor of a chf event. all patients were monitored by monthly nt - probnp plasma level measurements. a relative increase of 20% in nt - probnp measurements was associated with a risk of developing a chf event during the next month, with a sensitivity of 0.57 and a specificity of 0.77, given by the roc curve analysis. of note, baseline nt - probnp levels were higher among patients who suffered a chf event than among those who did not. wang. made similar observations and concluded that baseline nt - probnp measurement was an important risk predictor of cardiovascular congestion in peritoneal dialysis patients ; the baseline nt - probnp level was noted to be at least 3-fold higher among patients who developed subsequent circulatory congestion. however, the present data on monitoring serial nt - probnp measurements provide more important prognostic information that could potentially be used for assessing treatment adequacy and adjusting therapy in the hd population. if all positive relative changes were considered as predictors of a chf event, the sensitivity would be high and the specificity of the test by roc analysis would be 0.59. although the specificity is not so high, we know that inflammation, malnutrition, and anaemia are significantly related to nt - probnp levels. gutierrez. measured baseline nt - probnp concentrations in incident hd patients and calculated the change in concentrations after 3 months in a subset of 585 patients. patients with the greatest increase in nt - probnp after 3 months of dialysis had a 2.4-fold higher risk of mortality than those with the greatest decrease in nt - probnp. interestingly, a change in weight was only weakly associated with changes in nt - probnp in the univariate analysis, and this association was attenuated in the multivariate - adjusted analysis. these data suggest that monitoring nt - probnp not only reflects fluid volume overload but also myocardial damage. an increased bnp level is a sensitive marker of lv diastolic dysfunction in hd patients. thus, in addition to monitor nt - probnp levels, other methods assessing dry weight should be performed, including clinical examination, bioimpedance analysis, and relative plasma volume monitoring. have reported that bnp and interdialytic fluid retention are independent and incremental predictors of mortality in hd patients. dry weight is a very subjective parameter based first on clinical examination and blood pressure. patients with altered lv function suffer from anorexia, and, in our study, the body mass index was lower in the group of patients who subsequently developed a chf event. for these patients, it could be difficult to determine the clinically overload status and the risk of chf event. whereas there is growing enthusiasm for longitudinally following natriuretic peptide concentrations in patients with cardiac failure to help guide therapy, it is unclear whether employing a similar strategy would be advantageous in hd patients. prospective randomised studies are needed to determine the cost analysis and cost - effectiveness of nt - probnp - guided therapy in the hd population. a dynamic change in the nt - probnp plasma level is an important risk predictor of chf events. we showed an increase of nt - probnp concentrations before the occurrence of a chf event in hd patients. prospective randomised studies are needed to determine whether specific therapeutic interventions driven by longitudinal changes in nt - probnp can significantly improve outcomes in hd patients. | backgroundcross - sectional studies have shown that b - type natriuretic peptide (bnp) and its n - terminal fragment (nt - probnp) are predictive of cardiovascular death in haemodialysis (hd) patients. in the present study, we tested the hypothesis that monitoring nt - probnp measurements adds further prognostic information, i.e. predicts congestive heart failure (chf) events.methodsin a prospective cohort of 236 hd patients, nt - probnp levels were measured monthly during 18 months. patients were divided according to the occurrence of chf events. in a nested case - control study, we assessed the evolution of nt - probnp levels.resultson average, the 236 hd patients were followed up for 12.5 months, a period during which 44 patients developed a chf event (half requiring hospitalisation). at baseline, patients who developed a chf event had significantly more dilated cardiomyopathy and/or altered left ventricular ejection fraction and higher nt - probnp levels compared with patients who did not develop a chf event. during follow - up, we observed a significant increase in nt - probnp levels preceding the chf event. at a 20% relative increase of nt - probnp, the sensitivity of nt - probnp as a predictor of chf events was 0.57 and the specificity 0.77.conclusionthe relative change in nt - probnp levels is a significant risk predictor of a chf event. |
the recognition, diagnosis and treatment of conditions affecting the neurovascular bundle at the thoracic outlet have been clarified in recent years. the whole subject has been usually grouped together under the name of thoracic outlet syndrome (tos) which is considered as one of the most controversial clinical entities in medicine. tos generally affects young patients, with an average age of 36 and a male preponderance, however, this is changing as women become more active in sports and physical occupations. a delay in diagnosis is common, which is frustrating for the patient and may lead to permanent psychological damage. more recently, it has been suggested to divide tos into three main variants depending on the principle component ; venous, arterial or neurological. these three may co - exist to a greater or lesser degree, but treatment of the dominant component usually results in complete resolution of symptoms. despite many reports of operative and non - operative interventions, rigorous scientific investigation of this syndrome leading to evidence based management is lacking. thoracic outlet syndrome is caused by extrinsic compression of neurovascular structures between the 1st rib and clavicle associated with a wide range of symptoms such as pain, weakness, paresthesias and vascular insufficiency, muscle imbalance of the neck, shoulder, and back. the clinical manifestations are caused by multilevel brachial nerve and subclavian artery or vein compression. the heterogeneity of symptoms and signs of such disease, the absence of widely recognized signs or cost effective laboratory tests, and the lack of sufficient diffusion of the syndrome in the medical literature, makes its diagnosis a difficult challenge and its treatment controversial. tos has been reported as caused by a variety of diseases but seldom if not ever by the presence of a subpectoral mass. we report the successful surgical treatment of a rare case of a young lady who suffered of brachialgia, loss of strength and raynaud s phenomenon and presented with a magnetic resonance imaging showing a subpectoral infraclavicular multilobar lipoma. a 30-year old lady from bangladesh was referred with a 6 months history of increasing subpectoral and shoulder pain, right arm swelling, right forearm paresthesias and an expanding mass in the right supraclavicular region. clinical examination revealed a firm, tender mass in the supraclavicular fossa, overlying the skin, that extended downward and spread around and between pectoral muscles. the patient had been referred by general practitioner to undergo a thoracoscopic sympathectomy but the clinical pattern induced more accurate investigations. contrast computed tomography (ct) and magnetic resonance imaging (mri) t1 and t2-weighted sequences by fat - suppression techniques, revealed a 125 72 46 mm subpectoral thinly septated hypodense mass extending from the neck to the anterior right hemithorax. the ovoidal well capsulated mass in the right retroclavear and subclavear region, between the axillary artery and vein, displaced the axillary 1). the lesion compressed the brachial plexus and was consistent with either a lipoma or liposarcoma. the ulnar and median nerve conduction study and electromyography revealed a generally decreased conduction at cubital tunnel level. inr was maintained between 2 and 3 because the risk of thrombosis was considered more important than an intraoperative hemorrhage. moreover, the features and the location of the mass would suggest a short surgical time. the surgical procedure was performed under general anaesthesia, in dorsal decubitus and right arm hyperadduction to better expose axillary region and right hemithorax. an axillary incision was made along the anterior border of the latissimus dorsi muscle and the lateral border of the pectoralis minor from high in the axilla to the 4th rib level. the fat and lymphatic tissue were removed and access to the axillary vein was gained where a lipomatous mass was detected. the mass followed the axillary vessels, separating the artery upward and anteriorly from the vein downward, in a complete subpectoral position, developing itself up to the supraclavicular fossa and displacing the subclavian artery anteriorly. no infiltration of surrounding structures was detected so the mass was carefully isolated following the vascular bundle and the brachial plexus up to the subclavicular edge and supraclavicular fossa (fig. the mass was completely removed with no need of a further supraclavicular incision and a 10 french drain was left in place. final pathology was consistent with a capsulated 120 60 25 mm lipoma of 160 g showing some steatonecrotic area in its context but no sign of malignancy (fig. the patient was discharged on the 2nd postoperative day without any complication. at 6 months from surgery the patient was completely symptom - free, a computed tomography showed no recurrence and last but not least, esthetical results were excellent. a 30-year old lady from bangladesh was referred with a 6 months history of increasing subpectoral and shoulder pain, right arm swelling, right forearm paresthesias and an expanding mass in the right supraclavicular region. clinical examination revealed a firm, tender mass in the supraclavicular fossa, overlying the skin, that extended downward and spread around and between pectoral muscles. the patient had been referred by general practitioner to undergo a thoracoscopic sympathectomy but the clinical pattern induced more accurate investigations. contrast computed tomography (ct) and magnetic resonance imaging (mri) t1 and t2-weighted sequences by fat - suppression techniques, revealed a 125 72 46 mm subpectoral thinly septated hypodense mass extending from the neck to the anterior right hemithorax. the ovoidal well capsulated mass in the right retroclavear and subclavear region, between the axillary artery and vein, displaced the axillary 1). the lesion compressed the brachial plexus and was consistent with either a lipoma or liposarcoma. the ulnar and median nerve conduction study and electromyography revealed a generally decreased conduction at cubital tunnel level. inr was maintained between 2 and 3 because the risk of thrombosis was considered more important than an intraoperative hemorrhage. moreover, the features and the location of the mass would suggest a short surgical time. the surgical procedure was performed under general anaesthesia, in dorsal decubitus and right arm hyperadduction to better expose axillary region and right hemithorax. an axillary incision was made along the anterior border of the latissimus dorsi muscle and the lateral border of the pectoralis minor from high in the axilla to the 4th rib level. the fat and lymphatic tissue were removed and access to the axillary vein was gained where a lipomatous mass was detected. the mass followed the axillary vessels, separating the artery upward and anteriorly from the vein downward, in a complete subpectoral position, developing itself up to the supraclavicular fossa and displacing the subclavian artery anteriorly. no infiltration of surrounding structures was detected so the mass was carefully isolated following the vascular bundle and the brachial plexus up to the subclavicular edge and supraclavicular fossa (fig. 2). the mass was completely removed with no need of a further supraclavicular incision and a 10 french drain was left in place. final pathology was consistent with a capsulated 120 60 25 mm lipoma of 160 g showing some steatonecrotic area in its context but no sign of malignancy (fig. the patient was discharged on the 2nd postoperative day without any complication. at 6 months from surgery the patient was completely symptom - free, a computed tomography showed no recurrence and last but not least, esthetical results were excellent. thoracic outlet lesions are usually represented by an enlarging neck or supraclavicular mass that is typically associated to upper shoulder or arm pain. tos real incidence in the general population is not known due to the absence of widely recognized signs or cost effective laboratory tests, and the lack of sufficient diffusion of the syndrome in the medical literature, it is also a poorly defined medical entity. the actual incidence seems generally low (from 3 to 80 cases per 1000) even though in more recent studies the incidence appears to be higher, and this disease is an often misdiagnosed cause of chest, neck and shoulder pain and one of the frequent upper extremity neuropathies related to sport. main causes of tos are congenital abnormalities such as cervical rib, prolonged transverse process, and muscular abnormalities (scalenus anticus muscle, a sickle - shaped scalenus medius) or fibrous connective tissue anomalies, neck and shoulder trauma (whiplash injuries), functional acquired causes, more rarely tumors, hyperostosis and osteomyelitis. all forms are rare, but clinically significant because, when unrecognized or inadequately treated, they can cause chronic pain syndromes, long - term limitations in use of the upper extremities, and substantial disability even in relatively young, active, and healthy individuals. accurate diagnosis of tos can be a substantial challenge in practice, because of a lack of physician awareness, overlapping of clinical features, and an absence of clearly defined diagnostic criteria. neurogenic compressive symptoms of brachial plexus consist of pain, numbness, and paresthesia affecting the neck, upper back, shoulder, arm, and hand with weakening grip. these symptoms are typically dynamic, with marked exacerbation during positional maneuvers such as the 3-min elevated arm stress test (east). the vascular tos, namely compression of one or more veins and arteries, is characterized by spontaneous swelling of the entire arm, cyanotic discoloration, heaviness, pain, weak or no pulse in the affected arm, tiny black spots on fingers. recognition and conservative management of these problems make the necessity for surgery a rare event. decompression of the brachial plexus, with or without 1st rib resection, is a technically demanding surgical procedure requiring expertise in peripheral nerve, vascular and thoracic surgery. the clinical pattern in our patient and the typical localization of the mass were strongly consistent with a thoracic outlet syndrome since a neurovascular compression in the upper extremity was present following a pressure on the nerves and vessels in the thoracic outlet area. to the author s best knowledge this is the 2nd published case of tos caused by a subpectoral lipoma but greater in size and with infraclavicular extension. many lesions of the subcutaneous region come to surgical pathology labeled as lipomas ; and, not uncommonly, a portion of these actually turn out to be something more interesting. normally, lipomas have a low degree of cellularity and no nuclear atypia ; the presence of either is cause for concern. sometimes increased cellularity is due to a diffuse low - grade form of fat necrosis as in our case. the exact etiology of lipomas remains disputed and endocrine, dysmetabolic, genetic and traumatic factors have been often considered. a lipoma characteristically grows by simple expansion in a well encapsulated fashion with no tissue infiltration that is more characteristic of liposarcomas. despite their benign nature lipomas the most popular surgical approach for tos is transaxillary 1st rib resection (tar) where a transverse incision is made over the 3rd rib just inferior to the axillary hairline and deepened between the pectoralis major and the latissimus dorsi muscle. the scalene muscle attachments to the 1st rib are released and the rib is excised extraperiosteally from the chondrosternal articulation to the costotrasverse articulation. the rationale for this approach is that 1st rib resection permits the widening of both the interscalenic triangle and the costoclavicular space. other procedures include supraclavicular incision, preferred by neurosurgeons or posterior subscapular approach which is reserved to more complicated tos [1012 ]. our surgical approach was suggested by the age of the patient and anterior location of the mass. differently from standard transaxillary procedure it did not require release of scalene muscle attachments nor 1st rib resection even though the careful caudocranial separation of the neurovascular bundle was technically demanding. benign subpectoral infraclavicular masses should be taken into consideration when evaluating a possible thoracic outlet syndrome in patients with brachialgia, loss of strength and raynaud s phenomenon. a thorough radiological assessment, preferably by mri with fat suppression technique as in our case, is mandatory to ascertain neurovascular compression by large lipomas. written informed consent was obtained from the patient for publication of this case report and accompanying images. a copy of the written consent is available for review by the editor - in - chief of this journal on request. | highlightsthoracic outlet syndrome (tos) is caused by compression of neurovascular structures.diagnosis of tos is a difficult challenge and its treatment is controversial.tos has been reported as caused by several diseases but never by a subpectoral mass.we report a case of tos caused by a subpectoral infraclavicular multilobar lipoma.the surgical outcome was uneventful and the patient symptom - free at 6 month follow up. |
epidural steroid injections are commonly performed procedures in medicine by many specialties including orthopedics. normal inadvertent injection of potassium chloride (kcl) during anesthesia procedures is reported by many anesthesiologists ; however, to the best of our knowledge, it has not been reported by orthopedic surgeons. here, we report a case of paraplegia that developed after accidental use of kcl instead of ns as diluent along with methylprednisolone and local anesthetic. the purpose of this case report is to diagnose the case, to approach for its management, and to caution the beginner regarding its occurrence if utmost attention is not given before injecting a drug. a 50-year - old male patient presented to us with l5 nerve root radiculopathy, conservative managements such as nonsteroidal anti - inflammatory drugs and physiotherapy after which epidural administration of 80 mg of methylprednisolone was planned. our routine method of epidural injection is to take 80 mg of methylprednisolone and 2 ml of 2% lignocaine in 20 ml of syringe and to dilute it up to 20 ml using 0.9% ns. after aseptic preparation of the local site, the previously prepared solution was injected into the sacral hiatus using a 22-gauge needle. immediately after injection, approximately over a period of 5 min, he developed progressive weakness of both the lower limbs. his blood pressure was recorded as 210/110 mmhg and heart rate was 124 beats per minute. labetalol was given immediately ; however, patient 's blood pressure was refractory to the treatment. electrocardiography showed features suggestive of hyperkalemia such as tachycardia, absent p - wave, and tall t - wave. we reviewed the medication administered and found that instead of ns, 15% kcl was used as diluents by a junior assistant by mistake. blood samples showed normal studies, except raised potassium levels (7 mg / dl). potassium chelating agent (ksylate) was used to decrease potassium concentration in the blood. after 2 h of treatment, blood pressure and heart rate returned to normal levels. return of sensory modalities occurred after 6 h, and by that time, the patient had developed spasticity. the patient became neurologically normal in the next 2 h. the patient was discharged the following day from the intensive care unit. the sacral hiatus provides the most caudal and direct route of entry to the epidural space and allows for the administration of steroid - based solutions for the treatment of lumbar pathology. advantages of the caudal approach are a dramatically decreased incidence of dural puncture. kcl has often been confused with 0.9% ns because the two solutions have similar looking ampoules distinguished only by different colored writing. different concentration of kcl injection leads to almost similar spectrum of symptoms and with full recovery. the patient developed lower limbs warmness, increase heart rate, raised blood pressure, intense pruritus on the chest, agitation, increased sensory and motor blocks, and respiratory failure secondary because of pulmonary edema, and the patient required ventilatory support. the patient recovered totally after 24 h. tessler. reported that sufentanil 25 m, meant for postoperative analgesia, was inadvertently diluted to 10 ml with 15% kcl instead of 0.9% ns and was then injected through an epidural catheter into the epidural space in the postoperative room. sixty minutes later, she developed hypertension which responded well to hydralazine 10 mg and labetalol 25 mg intravenous (iv). the patient recovered completely within 12 h. liu. reported two patients who underwent thoracotomy for resection of pulmonary or esophageal carcinoma. postoperatively, accidently kcl was mixed with morphine and was injected through epidural catheters for pain management. the patient complains severe injection pain over the lower extremities or the abdomen, followed by progressive weakness and numbness over the lower extremities and lower abdomen, and subsequent respiratory difficulties. in addition to endotracheal intubation and ventilatory support, steroids were administered both iv and epidurally to suppress spinal cord irritation. both the patients regained motor and sensory functions 14 and 18 h later, respectively, without any sequela. shanker. had reported a case in which 11.1% of kcl was accidently injected in epidural space. lin. had correlated different epidural kcl concentrations with temporary or permanent sensory and motor deficits. in their study, rats had been used as a study model, and hence, it can not be applied for human. mechanism of symptoms observed in epidural injection of potassium chloride in most of the cases reported, the method of treatment is supportive. it took approximately more than 12 h to recover fully. in this case report, we used calcium gluconate and potassium binder along with supportive measures, and the patient recovered completely in 8 h. paraplegia after unintentional epidural administration of kcl is reversible more often than not if diagnosed early and treated immediately. the method of treatment is mostly supportive and symptomatic, but recovery can be enhanced with the use of membrane stabilizing agents and potassium binders. | epidural injection of steroid is given for back pain resistant to other conservative management. normal saline (ns) is used as diluent in 80 mg methylprednisolone and a local anesthetic. due to a similar looking ampoule of ns and potassium chloride (kcl), there is a probability of accidental use of kcl instead of ns. we present a case of a 50-year - old male patient having low back ache refractory to other conservative treatments. epidural injection of steroid was given, but accidently kcl was mixed with methylprednisolone instead of ns. he developed severe cramps in the lower limbs, pruritus, and sweating, and finally paraplegia. electrocardiography and blood showed features suggestive of hyperkalemia. he was given calcium gluconate and potassium chelating agent along with supportive measures. the patient recovered within 8 h. it is concluded that calcium gluconate and potassium chelating agent can be used if accidentally kcl is injected in epidural space. |
the oxidative phosphorylation (oxphos) system is unique among fundamental metabolic pathways in animals (aside from maintenance and gene expression of mitochondria) in that functional oxphos complexes are composed of subunits encoded by two different genomes. the different hereditary modes of the mitochondrial (mt) and nuclear (nu) genomes substantially increase the complexity of maintaining functional interactions among oxphos subunits. the role of oxphos in the fundamental process of aerobic atp production means that slight perturbations to inter - genomic coordination result in a wide range of human pathologies (wallace 2010). in addition, minimal divergence of oxphos subunits may result in reproductive incompatibility among closely related populations (rand. consequently, the successful interaction of oxphos proteins encoded by mt and nu genomes plays a central role in fundamental processes at the cellular, organismal, and population levels of biological organization. the oxphos system provides a rare opportunity to investigate the coevolution of subunits that must successfully interact in electron transport and atp production, yet are subject to potentially the very different evolutionary forces that govern the mt and nu genomes. it produces about 80% of energy in the form of atp in almost all eukaryote cells and is the major role - player making mitochondria the powerhouse of the cell. meantime, reactive oxygen species, the by - product of normal metabolism, can damage dna, cell membranes and lipid, decrease bioenergetic efficiency, and thus lead to age, disease, and death in humans (ballard and melvin 2010 ; wallace 2010). the oxphos apparatus includes five complexes (i v), each composed of between 4 and 30 + subunits (de grassi. complexes i iv transfer electrons through a series of redox reactions coupled to the transport of protons into the intermembrane space. complex v employs the resulting electrochemical gradient to phosphorylate adp to atp. like most multimeric protein complexes an added level of complexity arises from the fact that the composition of four of the five oxphos complexes includes subunits encoded by both mt and nu genomes. any mismatch between mt and nu genomes likely results in a slowing of electron transfer, which increases reactivity of electron with oxygen, corresponding to a rise in free - radical leak (lane 2011). evolution of oxphos must therefore be coordinated among a large number of interacting subunits and among genomes, and compensatory amino acid substitutions may, in some cases, be favored to maintain function. complex i (nadh : quinone oxidoreductase) and complex ii (succinate dehydrogenase) receive electrons from reducing equivalents (nadh and fadh2) produced by the krebs cycle. the electrons are transferred to ubiquinone, which freely diffuses within the mt inner membrane and transfers electrons to complex iii (cytochrome bc1). complex iii transfers electrons from ubiquinol to cytochrome c. this small protein is localized on the intermembrane space side of the mt inner membrane. it transfers electrons to complex iv (cytochrome c oxidase), where oxygen is reduced to water. coupled with the process of electron transport, complexes i, iii, and iv transport protons to the intermembrane space. the generated proton gradient across the mt inner membrane drives atp synthesis in complex v (atp synthase) (mitchell 1961 ; saraste 1999 ; boekema and braun 2007). the mt genome has a constant gene content composition in all metazoan species (with few exceptions), including 13 protein - coding genes, 2 rrna genes, and 22 trna genes. the rrna and trna genes are involved in mt protein synthesis, whereas the 13 protein - coding genes all encode components of oxphos (shadel and clayton 1997 ; gray. 1999). at least 60 oxphos subunits are encoded in the nu genome. despite the fundamental importance of oxphos to aerobic life, mt protein - coding genes are not highly conserved and evolve at rates that is 550 times that of typical nu genes in vertebrates (lynch 2007). this increased rate has been observed in a range of animal species, including primates (brown. 1979), galapagos tortoises (caccone. 2004), lice (johnson. 2003), drosophila (haag - liautard. 2008), wasps (kaltenpoth. 2012), and nematodes (denver. 2000). the rapid evolutionary rate of mt genomes may be due to their cell cycle - independent replication of mtdna (bogenhagen and clayton 1977), increased exposure to mutagenic oxygen radical species (beal 1996), lack of protective histones, and limited dna repair capacity (croteau and bohr 1997). moreover, the mt genome differs from the nu genome in being effectively haploid, maternally inherited, and exhibiting little recombination (moritz. 1987 ; lightowlers. 1997 ; ballard and melvin 2010). haploid maternal inheritance means that the effective population size for mt genes is approximately one - fourth that of nu autosomal genes, increasing the fixation rate of polymorphic sites (gabriel. in addition, the lack of recombination in animal mitochondria reduces the ability to purge deleterious mutations (gabriel. incompatibility between mt and nu genomes has been shown to reduce hybrid fitness in copepods (willett and burton 2001), drosophila (sackton. nu incompatibility may be an important contributor to the process of speciation (gershoni. 2009) and the evolution of two separate sexes (hadjivasiliou., amino acid substitutions may be deleterious if they affect domains involved in interaction, yet there is the potential for compensatory changes at interacting amino acid sites to reduce or eliminate any negative effects. such interacting sites are generally proximal to each other in the three - dimensional protein structure (pazos and valencia 2008). under the compensatory model, substitutions that may destabilize protein structures or inhibit function could be compensated by a subsequent (or simultaneous) substitution at an adjacent site (pollock., the elevated evolutionary rate of mtdna suggests that deleterious substitutions occur more frequently in mt genes and compensatory changes may then occur in proximal sites of nu - encoded proteins. in bacteria (sharp and li 1987), drosophila (comeron and kreitman 1998 ; dunn. 2001), and mammals (wolfe and sharp 1993), the rate of nonsynonymous substitutions (dn) is positively correlated with the synonymous substitution rate (ds) and both dn and ds are higher in mt than nu genes. if nonsynonymous substitutions of mt genes drive corresponding nonsynonymous substitutions of nu oxphos genes, we expect to see the acceleration of dn in nu oxphos genes relative to most nu genes not involved in oxphos (nu non - oxphos). nu coevolution at the molecular level but have been restricted to a few genes or a small number of species (e.g., nu genes cyc1 and uqcrfs1, and mt gene mt - cytb [willett and burton 2001 ], or genes involved in oxphos complex iv [goldberg. 2003 ]). here, we describe a broader study of 73 oxphos genes and a comparison between oxphos and 77 non - oxphos housekeeping genes. under a compensatory evolution scenario, we predicted that dn of mt oxphos > nu oxphos > nu non - oxphos genes. we tested the compensatory substitution model by comparing the evolutionary rates (both ds and dn) of 13 mt protein - coding genes (mt oxphos genes), 60 nu oxphos genes, and 77 non - oxphos genes in 47 vertebrate species, including 7 fishes and 40 mammals. the seven fish species are phylogenetically disparate, spanning some 250 myr of evolutionary history (betancur - r. 1a), whereas most of the mammal lineages emerged within the last 80 myr (meredith. this study employed genome sequences of 7 teleost fishes and 40 mammals from which we acquired the coding regions of 13 mt oxphos and 60 nu oxphos genes. for comparison comparators as oxphos genes contribute to critical function and should be highly expressed in virtually all cell types. these were chosen randomly with respect to genome location and represent a wide range of functions. they should be broadly representative of functionally important and relatively highly expressed loci in the nu genome. all sequences were downloaded from the ensembl genome browser (www.ensembl.org, last accessed september 11, 2013) using a pipeline procedure (vilella. a phylogenetic gene tree was used to identify orthologous and paralogous sequences so that we used only the former. each gene sequence a few genes were unavailable in the genome sequences ; however, at least 87% of the genes were present in 33 species. the majority of the missing genes were not core oxphos subunits whereas the specific genes that were absent varied among species. 1a), whereas the phylogeny of mammals was from meredith. (2011) (fig. the program codeml implemented in the computer software paml v.4.7 (yang 2007) was used to estimate dn and ds for each gene. the site - model m0 (model : 0, nssites : 0, and fix - omega : 0) was used when estimating dn and ds. for each gene, the estimated substitution rates are the sum of dn or ds values from each branch of the tree, so total rate values will vary with the number of taxa in the tree. the intent here was not to compare the absolute values between fishes and mammals, but instead to examine the patterns among mt oxphos genes, nu oxphos genes, and non - oxphos genes within taxonomic groups (where the number of branches was identical). codon frequencies were estimated from the average nucleotide frequencies at three codon positions. to avoid problems arising from local optima (yang and nielsen 1998), replicate runs with three different starting values of (0.3, 0.9, and 4.3) were used. different starting yielded similar, and in many cases identical, ds and dn estimates for each gene among three runs (supplementary table s2, supplementary material online). the average ds and dn from the three runs was used in the subsequent analysis. we tested the hypothesis that there are differences in ds and dn among three groups of genes : 13 mt oxphos genes, 60 nu oxphos genes, and 77 non - oxphos genes. a shapiro wilks test was performed to assess the normality of ds and dn for all genes and bartlett s test was performed to evaluate homogeneity of variance. wallis test followed by post hoc tukey s hsd tests were used to assess differences among the groups. a wilcoxon signed - rank test was performed to evaluate differences between mt and nu oxphos genes in each of the five oxphos complexes. each of the oxphos complexes is composed of multiple subunits and each subunit may be more or less important to the core catalytic activity of the complex. noncore, where core genes encode subunits that retain structural, functional, and sequence homology with prokaryotic systems. for example, unlike human complex i, which consists of 43 subunits, bacterial complex i consists of 14 subunits. these 14 subunits all have homologs in human complex i, and thus are referred as core subunits. these include seven nu oxphos genes (ndufs13, ndufs78, and ndufv12) and seven mt oxophos genes (mt - nd16, mt - nd4l) (janssen. similarly, in complex iv, bovine mt oxphos genes (mt - cox13) share high similarity to their bacterial counterparts and can be considered the functional core of the eukaryotic oxidase (richter and ludwig 2003). complex ii is only composed of four nu subunits (sdha - d), all of which share high sequence similarity with escherichia coli (cecchini 2003). in complex v, six human subunits have bacterial homologs (atp5a1, atp5b, atp5c1, atp5d, atp5f1, and atp5g3) (yoshida. 2001) and were categorized as core subunits. because e. coli does not have a homolog of complex iii (lenn. 2008), none of the nu oxphos genes in complex iii were categorized as encoding core subunits. we estimated the total synonymous and nonsynonymous substitution rates on each tree for fishes (fig. 1b) separately using maximum likelihood methods. because neither ds nor dn was normally distributed and each exhibited significant variance heterogeneity, nonparametric statistics were used to compare the different groups of genes. we found significant differences (kruskal wallis) in ds and dn among the three groups of genes : 13 mt oxphos genes, 60 nu oxphos genes, and 77 non - oxphos genes (table 1). the ds of mt oxphos genes was significantly higher than that of nu oxphos and non - oxphos genes in both (fig. the ds of mt and nu genes were 16.02 9.64 and 2.02 0.87, respectively, in fishes and 72.27 26.56 and 8.85 4.15, respectively, in mammals. no significant difference of the ds was detected between nu oxphos genes and non - oxphos genes (fig. we note that a small number of mt genes had exceptionally high ds values, which may indicate substitutional saturation, leading to violation of the assumptions of the maximum likelihood estimation method. as predicted, the dn of mt oxphos genes was significantly higher than that of nu oxphos genes, which in turn was significantly higher than that of non - oxphos genes (fig. 2.comparison of synonymous substitution rate (ds) and nonsynonymous substitution rate (dn) among mitochondrial oxidative phosphorylation (mt oxphos), nuclear oxphos (nu oxphos), and non - oxphos genes in 7 fishes (a, b) and 40 mammals (c, d). whisker - ends are at the 5th and 95th percentiles. p nu oxphos nu oxphos non - oxphos non - oxphos non - oxphos0.987dsmammalsnu oxphos > non - oxphos0.670dnfishesmt oxphos > nu oxphos0.037dnmammalsmt oxphos > nu oxphos non - oxphos non - oxphos non - oxphos0.0007dnmammalsnu oxphos > non - oxphos nu core oxphos nu core oxphos nu noncore oxphos nu noncore oxphos non - oxphos non - oxphos nu noncore oxphos0.9995dsfishesnu core oxphos non - oxphos0.969dsmammalsnu noncore oxphos nu core oxphos0.002dnmammalsmt oxphos > nu core oxphos nu noncore oxphos nu noncore oxphos non - oxphos non - oxphos non - oxphos0.988dnmammalsnu core oxphos > non - oxphos0.198dnfishesnu noncore oxphos > non - oxphos non - oxphos<0.0001 comparison of synonymous substitution rate (ds) and nonsynonymous substitution rate (dn) among mitochondrial oxidative phosphorylation (mt oxphos), nuclear core oxphos (nu core oxphos), nuclear noncore oxphos (nu noncore oxphos), and non - oxphos genes in 7 fishes (a, b) and 40 mammals (c, d). p < 0.05, p < 0.01, p < 0.001. statistical summary for the comparison of synonymous substitution rate (ds) and nonsynonymous substitution rate (dn) among mitochondrial oxidative phosphorylation (mt oxphos), nuclear core oxphos (nu core oxphos), nuclear noncore oxphos (nu noncore oxphos), and non - oxphos genes in 7 fishes and 40 mammals given that mt genome is derived from once free - living bacteria, it is clear that most of the bacterial genes have now been removed to the cell nucleus. however, what has not been well resolved is why not all genes have been removed to the nucleus (alberts. the remained genes in mitochondria thus are the resources for any potential problems involved in the interaction between mt, we used estimated rates of synonymous and nonsynonymous substitutions among all oxphos genes and a broad genomic sample of housekeeping genes. specifically, we examined the hypothesis of compensatory evolution between mt and nu oxphos genes by comparing their evolutionary rates (both ds and dn) relative to non - oxphos genes in two distinct vertebrate lineages. we found that the mean ds of mt genes was about 79 times higher than that of nu genes. this magnitude is consistent with the well - established pattern of high ds in animal mt genes (brown. although the products of nu oxhpos genes are transported into mitochondria where they function, they are expected to show mean ds similar to the non - oxphos genes because the coding sequences reside in the nu genome. our results show this to be the case and suggest that differences in nonsynonymous rates are due to selective factors rather than different mutation rates. mt transplants interacting partners should result in diminished functional performance, and this disruption should increase as the level of evolutionary divergence increases (rand. 2004). in mouse (mus musculus domesticus) cell lines carrying mitochondria from six different murid species spanning 212 myr of divergence, a near - linear association between disruption of respiratory chain function and evolutionary distance has been observed (mckenzie. this phenomenon has also been observed in primates (kenyon and moraes 1997), copepods (willett and burton 2001), drosophila (sackton. introgression experiments of drosophila simulans siii mtdna type into the sympatric population siiii nu background did not show a difference in catalytic properties of mitochondria, indicating that some naturally occurring mutations in mtdna can be accommodated by different nu background and mt nu interaction (pichaud. 2012). at the dna sequence level, higher evolutionary rates of mt genes could drive accelerated evolutionary rates of nu genes as compensatory response in the nu genes contributes to the maintenance of function. several studies of the primate complex iv showed that seven nu oxphos genes : cox4i1 (wu. 2002), cox7a1h (schmidt. 1999), cox5a (doan. 2004), cox8al (osada. 2003), cox6b1, cox6c, and cox7c (doan. 2004), together with two mt oxphos genes : mt - cox1 (andrews and easteal 2000 ; wu. 2000) and mt - cox2 (adkins and honeycutt 1994), have shown accelerated dn in the lineage leading to hominids relative to other primates. however, in these cases it is not clear whether accelerated dn is due to compensatory changes driven by the higher mt rate, or is due to selection for increased oxphos efficiency associated with increased brain size in the hominid lineage. this study showed that when all complexes were analyzed together, the dn of 13 mt oxphos genes was significantly higher than that of 60 nu oxphos genes, and both of these were significantly higher than dn of 77 non - oxphos genes. the apparent acceleration dn of nu oxphos genes is consistent with a compensatory response to the higher dn of mt oxphos genes. contrary to expectations, our results showed that the dn of mt genes was not always higher than that of nu genes in each complex. mt genes with higher dn than nu genes were only observed in complexes i and v. in fishes, the dn of mt genes was lower than that of nu genes in complexes iii and iv. in mammals, the dn of mt genes was lower than that of nu genes in complex iv, but higher in complex iii. (2003) found that in the anthropoid lineage, the fast - evolving region (12 n - terminal amino acid residues) of cox8l encodes amino acid sites contacted with mt - cox1 sites in three - dimensional structure. this suggested structurally mediated cytonuclear coevolution, which was driven by faster evolving mt oxphos genes. similarly, the only mt gene in complex iii (mt - cytb) showed lower dn than its corresponding nu oxphos genes in fishes. although dn of mt - cytb was higher than nu genes in complex iii in mammals, the difference is not statistically different. one explanation for the lower dn of mt oxphos genes in complexes iii and iv could be functional constraints on core subunits. mt - cytb is the only mt gene in complex iii and its structure has been shown to be conserved among vertebrates (kocher. similarly, mt - cox1 and mt - cox2 have been recognized as the core enzyme catalytic subunits and are conserved from bacteria to bovid (tsukihara. it therefore seems likely that functional constraints are stronger on core subunits, regardless of which genome encodes them. the higher dn of nu oxphos genes relative to non - oxphos genes in general is due mainly to higher rates of noncore proteins alone. the more recently derived noncore subunits (or accessory oxphos families) appear to be important contributors to oxphos assembly and/or stabilization (ugalde. 2004), but do not contribute directly to catalytic activity of electron transport and atp synthesis (de grassi. thus, maintenance of primary amino acid sequences of the noncore subunits appears to be less important to oxphos function than that of the core subunits and the intensity of selection on these proteins is therefore reduced. it is possible that different domains within a protein may be under different selective regimes and such domains may have different evolutionary rates. such differences could be obscured by combining domains and estimating dn for each gene as a whole. for example, a gene with a small but highly functionally constrained domain combined with large relatively unconserved domains would exhibit high dn despite having an important conserved function. had we obtained high relative dn for core oxphos genes, such a result would have been consistent with a compensatory evolution hypothesis but could have been due to such overestimation of dn. however, a salient result here is the relatively low estimates of dn for several mt and core nu oxphos genes. it seems unlikely that differential selection on domains could lead to underestimation of dn if the compensatory evolution hypothesis (which predicts elevated dn values) was a major factor influence in oxphos evolution. we can not exclude the possibility of a few compensatory changes in nu oxphos genes as they keep pace with changes in mt oxphos genes because assessment of evolutionary rates does not allow examination of individual sites. neither can we reject compensatory changes in mt genes in response to changes in the nu genome ; indeed, the rapid rate of mt genome evolution could allow these genes to more readily respond to changes in nu components. nonetheless, compensatory changes in either direction do not appear to occur with a frequency sufficient to contribute to differences in evolutionary rates among genes or groups of genes. therefore, despite the necessary interaction of the products of two different genomes, oxphos evolution appears to be driven largely by conventional natural selection for functional efficiency acting on individual subunits, regardless of their genome of origin. supplementary tables s1 and s2 are available at genome biology and evolution online (http://www.gbe.oxfordjournals.org/). | oxidative phosphorylation (oxphos), the major energy - producing pathway in aerobic organisms, includes protein subunits encoded by both mitochondrial (mt) and nuclear (nu) genomes. how these independent genomes have coevolved is a long - standing question in evolutionary biology. although mt genes evolve faster than most nu genes, maintenance of oxphos structural stability and functional efficiency may involve correlated evolution of mt and nu oxphos genes. the nu oxphos genes might be predicted to exhibit accelerated evolutionary rates to accommodate the elevated substitution rates of mt oxphos subunits with which they interact. evolutionary rates of nu oxphos genes should, therefore, be higher than that of nu genes that are not involved in oxphos (nu non - oxphos). we tested the compensatory evolution hypothesis by comparing the evolutionary rates (synonymous substitution rate ds and nonsynonymous substitution rate dn) among 13 mt oxphos genes, 60 nu oxphos genes, and 77 nu non - oxphos genes in vertebrates (7 fish and 40 mammal species). the results from a combined analysis of all oxphos subunits fit the predictions of the hypothesis. however, results from two oxphos complexes did not fit this pattern when analyzed separately. we found that the dn of nu oxphos genes for core subunits (those involved in the major catalytic activity) was lower than that of noncore subunits, whereas there was no significant difference in dn between genes for nu non - oxphos and core subunits. this latter finding suggests that compensatory changes play a minor role in the evolution of oxphos genes and that the observed accelerated nu substitution rates are due largely to reduced functional constraint on noncore subunits. |
pain continues to be a clinical problem difficult to solve for a significant proportion of patients due to the incomplete knowledge we have about the adaptive changes that occur in the neural substrates of the nociceptive system and glial cells in response to episodes of persistent pain. these changes primarily are associated with chronic inflammation processes or injury to peripheral and central nerves. in a chronic inflammatory process, tissue damage induces a persistent stimulation of nociceptors, which are peripheral nerve endings of primary afferent fibers responsible for pain transmission. chronic activation of nociceptors by different chemical mediators induces hypersensitivity or nociceptive sensitization, which is reflected in changes in the basal activation levels of neurons and altered gene transcription (plasticity). this allows the appearance of hyperalgesia or an exaggerated response to a nociceptive stimulus and allodynia, or a nociceptive response against an innocuous stimulus. great advances in this field occurred in the 1980 's when two groups demonstrated that nmda receptor antagonists inhibit the hyperexcitability of nociceptive neurons in the spinal cord induced by stimulation of c fibers [2, 3 ]. as mentioned above, the nmda receptor is important in the establishment of chronic pain. however, today we know other factors that may modulate this pain, such as glial cells. in the last decade numerous studies have shown that glial cells of the spinal cord have close contact with neurons, and this led to the proposed term tripartite synapses. this process contributes to synaptic modulation of neuronal excitability and synaptic transmission by increasing nociception transmission and thus the persistence of chronic pain. it has been shown that astrocytes and microglia in the dorsal horn of the spinal cord are active under a variety of conditions that cause chronic pain and hyperalgesia, such as inflammation due to the subcutaneous administration of inactivated mycobacteria and peripheral nerve trauma, among others. because nmda receptors and glia have an important role in the pathophysiology of chronic pain, we propose to evaluate if the coadministration of ()-cpp and ppf could enhance the analgesic effect of each drug on chronic inflammatory pain. similar results have been published in our laboratory, but using a behavioral test of paw pressure technique the utilization of electrical nociception (c reflex and windup) allowed us to test the drugs by a stronger procedure, since this nociceptive test is more demanding than mechanical nociception. the ultimate goal of drug combination is to obtain effective analgesia with a reduction in the incidence and severity of side effects, a fact that can be achieved by using lower doses of the drugs. the experiments were done in male sprague - dawley adult rats weighting 250300 g, both normal and monoarthritic. the experiments were run in accordance with the universidad de santiago de chile ethical committee and the ethical guidelines for investigations of experimental pain in conscious animals. in order to minimize unnecessary suffering to the animals, also, all the animals were submitted to a supervision protocol as described by morton and griffiths. briefly, this protocol allows us to quantify the pain (nociception) caused by an experimental procedure. if the scores go above a certain number, animals have to be euthanized or the procedure has to be stopped immediately. immediately after finishing an experimental procedure, the animals were euthanized with an overdose of urethane. monoarthritis was induced in rats of 120 to 150 g by the method described by butler.. in brief, rats were inoculated with a volume of 50 l of freund 's adjuvant, in the right ankle joint. the adjuvant consisted of a solution of 60 mg of mycobacterium butiricum, 6 ml of mineral oil, 4 ml of sodium chloride (0.9%), and 1 ml of tween 80. subsequently, this mixture was autoclaved at 120c for 20 min and stored at room temperature until use. the injection of adjuvant produces a localized arthritic syndrome that becomes stable around the fourth week after - inoculation and establishes a persistent pain with hyperalgesia of the tibiotarsal joint which is maintained for a period exceeding two months. monoarthritic rats were used between the 4th to the 5th week after induction of monoarthritis. around 90%95% of the injected rats developed mechanical hyperalgesia. normal and monoarthritic rats were anesthetized with an intraperitoneal injection of 30% urethane dissolved in saline and then submitted to the c reflex and wind - up paradigm. the c reflex and windup are obtained by electrical stimulation by means of supramaximal (meaning a stimulus able to produce an electromyographic response) electric shocks applied subcutaneously to the fourth and fifth toes of the hind paw, territory innervated by the sural nerve, using two stainless steel electrodes. the stimulation was performed with a pulsed stimulation of 2 ms duration and a frequency of 1 or 0.1 hz depending on the experiment. after 20 minutes of stimulation at 0.1 hz to stabilize the response, the threshold current was determined (6.3 0.4 ma for normal rats and 3.7 0.6 ma for monoarthritic rats, n = 8 animals) and then twice the threshold intensity (meaning a current that elicits an electromyographic response in the 50% of the cases) was maintained throughout the experiment at 0.1 hz, constituting the c reflex response. when assessing the wind - up response the frequency of stimulation was raised to 1 hz. electromyographic recording was taken in a time window between 150 and 450 ms after the stimulus, in order to exclude the a- fibers response and then digitalized. the recordings were made before and after administration of saline, () cpp, ppf, or both. for the c reflex and windup, records were taken at 5, 15, and 30 min. in the case of the c reflex, the values obtained were the average of the first 10 responses, while for the windup, we used the slope obtained for the first 7 recordings showing an increment in the response, calculated from the absolute value of the integrated response of the electromyogram (expressed in volt per second). this c fiber activated reflex is equivalent to the r - iii reflex recorded in man, representing a direct proportionality among subjective pain perception and the electromyographic intensity. results were expressed as the area under the curve (auc) and then the groups were statistically compared. statistical analysis of the data was performed by analysis of variance (anova) for the c reflex and windup. for all outcomes, the significance level was set at p < 0.05 and plotted as follows : p < 0.01 = and p < 0.001 =. results were expressed as mean percentage of the antinociceptive effect standard error (se) for each experimental group versus baseline obtained before the injection of serum or of each of the drugs under study, as appropriate. ()-cpp (tocris bioscience) was administered in single doses of 3.97 g. ppf (sigma) was administered in repeated doses of 1.42 g/10 l, once daily for a period of 10 days. injection consisted of the administration of the drugs into the subarachnoid space between lumbar vertebrae l5 and l6, using a hamilton syringe with a needle 26gx1/2. entry into the subarachnoid space was evidenced by a slight movement in the tail of the rat as a result of the mechanical stimulation of the needle penetrating the meninges of the spinal cord. the daily ppf i.t. injection was done under brief halothane anesthesia (2 minutes at 96 : 4, oxygen : halothane, in percent). no sign of motor impairment was found in the rats submitted to these intrathecal injections as revealed by behavioral observations. to evaluate the antinociceptive effect of both drugs in monoarthritic rats individually and in combination, the animals were separated in the first stage of the study into 2 groups : (1)intrathecal administration of ()-cpp : 3.97 g/10 l (n = 5),(2)daily i.t. ppf administration of 1.42 g/10 l (n = 5) for 10 days,(3)daily administration of ppf at 1.42 g/10 l (n = 5) for 10 days.. administration of ()-cpp : 3.97 g/10 l (n = 5). intrathecal administration of ()-cpp : 3.97 g/10 l (n = 5), daily i.t. ppf administration of 1.42 g/10 l (n = 5) for 10 days, daily administration of ppf at 1.42 g/10 l (n = 5) for 10 days. administration of ()-cpp : 3.97 g/10 l (n = 5). controls were provided by normal and monoarthritic rats receiving saline, as follows:(1)normal group of the same age as the monoarthritic rats, receiving i.t. injection of saline instead of ()-cpp, before testing (n = 5),(2)monoarthritic saline group, receiving i.t. daily injection of saline for a period of 10 days followed by an i.t. injection of saline at day eleven, or a single injection at day eleven (n = 5). injection of saline instead of ()-cpp, before testing (n = 5), monoarthritic saline group, receiving i.t. injection of saline at day eleven, or a single injection at day eleven (n = 5). the administration of the ed30 ppf for 10 days did not produce a significant change on the area under the curve (auc) compared to saline control (figure 1(a)). for saline, the auc value was 191.8 146 (mean sem) and for ppf was 432 151. injection of the ed30 of ()-cpp resulted in a significant increase in the antinociceptive activity, being 22 times greater than the saline control group in the c reflex (auc for ()-cpp was 4265 200). injection of the effective doses of both combined drugs produced an antinociceptive activity 13 times greater than controls in the c reflex (auc for ppf/()-cpp was 2504 300). the effect of ppf in the windup was nonsignificant (figure 1(b)). for saline, injection of the ed30 ()-cpp was the biggest response (auc = 4281 529) being of approximately the same magnitude of ()-cpp from c reflex in normal rats from figure 1(a). nevertheless, for either normal and monoarthritic rats, the administration of both drugs did not show an additive effect ; rather, the response was located in between (the auc value for the combination of ppf and ()-cpp was 2398 745). figure 2(a) shows the absence of effect to the application of the ed30 i.t. the auc value was 127.1 50 (mean sem) and for ppf was 369 77. ()-cpp increases the auc 11.5 times in respect to saline (auc for ()-cpp was 1464 565). the application of the ed30 for the combination of both drugs resulted in an increase in the antinociceptive activity of around 32 times in respect to saline (auc for ppf/()-cpp was 4037 119). this represents a clear increment of antinociception with respect to the sum of the effects of the drugs separately, indicating a clear supra additive effect. the effect of ppf in the windup was nonsignificant (figure 1(b)). for saline, injection of the ed30 ()-cpp showed an auc = 1488 277, being of approximately the same magnitude of ()-cpp from c reflex in monoarthritic rats from figure 2(a). the application of the ed30 for the combination of both drugs resulted in an increase in the antinociceptive activity of 117% with respect to the sum of the effects of each drug separately, (auc for ppf/()-cpp was 2649 748), indicating a more modest supra additive effect. results obtained in this study show that there exists an analgesic effect when combining a glial inhibitor (ppf) and an nmda - receptor antagonist (()-cpp) in both normal and monoarthritic rats using the c reflex and wind - up paradigm. ppf has inhibitory effects on activity of phosphodiesterase type i, ii, and iv and on adenosine extracellular transporters in glial cells, thereby modifying intracellular cyclic nucleotide homeostasis leading to a decrease of the production of proinflammatory cytokines and free radicals in these cells. as mentioned before, we used the ed30 values obtained from the randall - selitto determinations from morales. there was no effect of ppf alone in both normal and monoarthritic rats. for normal rats, one would not expect that ppf produces antinociception, since ppf is only able to act on activated glial cells, generated by a neuronal lesion or chronic pain. nevertheless, this apparent absence of ppf effect in monoarthritic rats deserves some attention. the value of 1.42 g/10 l ppf administrated daily for ten days is rather low and may be not enough to completely inhibit the glial cells. the idea was to use the minimal ppf concentration that in combination presents an effect, modest in normal rats, but important in monoarthritic rats, without the saturating effects that might obscure the results if ppf concentration would have been greater. in monoarthritic rats, the effects of the combined drugs are possibly supra additive. briefly, a supra additive effect for two or more drugs implies that the sum of the effects produced by the drugs alone is lower than the effects produced by the combination. nevertheless, as pointed by chou, in order to have a supra additive effect of drugs, it is necessary that the mechanisms of action of both drugs are at least partially independent, situation in agreement with ppf and ()-cpp, one acting as a glial inhibitor and the other directly blocking the nmda glutamate recognition site. in normal rats, the results indicate that ()-cpp presents an antinociceptive effect for both the c reflex and windup. this appears to be unexpected, since the nmda receptor should not be active under acute pain conditions. but there is abundant evidence in the literature indicating that the nmda receptors are active in acute pain conditions [9, 17 ]. also, this effect was tested on three different nociceptive tests : tail - flick, hot plate, and formalin, indicating that nmda receptors may be involved in functionally divergent nociceptive systems, but this is not necessarily in contradiction with the role of the nmda receptor on the establishment and persistence of chronic pain episodes. in this case, two major mechanisms appear to contribute to the resultant of this increased synaptic efficacy : (1) alterations in ion channels (kv4.2 k channels) and receptor activity (nmda and (2-amino-3-(5-methyl-3-oxo-1,2-oxazol-4-yl)propanoic acid) (ampa) receptors) and (2) trafficking of ampa receptors to the membrane. both events are due to phosphorylation by protein kinases, thereby increasing synaptic efficacy by altering channel open time, increasing bursting, removing the mg channel blockade, and promoting trafficking of receptors to the synaptic membrane [19, 20 ]. these mechanisms clearly represent a positive intracellular feedback loop, whereby membrane receptor activation by pronociceptive neurotransmitters leads to increased activity of the same receptors via phosphorylation by protein kinases. a second positive, but extracellular, feedback loop is represented by the products of the camkii - phosphorylated enzymes nitric oxide (no) synthase and cyclooxygenase-2, the diffusible messengers no and prostaglandin e2, which retrogradely diffuse to presynaptic nociceptive axon terminals and increase neurotransmitter release. nevertheless, the effect of ()-cpp and ppf in normal rats is not additive ; the combination of both drugs results in a response located in between ()-cpp and ppf antinociception. in monoarthritic rats, for c reflex and windup, on the contrary, there was a supra additive response. as discussed earlier, even though the effect of ppf was not statistically significant for c reflex and windup, the resultant auc for the combination of ()-cpp and ppf showed an increment in antinociception bigger than the effect of the drugs alone. for the c reflex, the auc combination of ppf and ()-cpp was higher than the sum of the effects of ppf and ()-cpp alone. for the windup, the values were more modest, being only 70% higher than the sum of the auc of the ppf and ()-cpp alone. this result is not surprising, since ppf and ()-cpp have to act on a monoarthritic condition, were glial proinflammatory cytokines (interleukin-1, interleukin-6, and tumor necrosis factor, among others) are overexpressed, requiring higher doses of ppf to act effectively. we show for the first time that the glial inhibitor ppf can synergistically enhance the effect of ()-cpp, a drug that inhibits the activity of the nmda receptor in the c reflex and spinal windup. this contribution opens a field of the association of glial inhibitors and nmda receptor blockers for the treatment of chronic pain episodes. | the nmda receptor is central in the generation and maintenance of chronic pain. this receptor has several sites of modulation. one is the glutamate recognition site that can be blocked by ()-3-(2-carboxypiperazin - yl)propyl-1-phosphoric acid or ()-cpp. we investigated whether the effect of glial inhibition produced by propentophylline (ppf) can be enhanced when combined with ()-cpp. we used sprague - dawley rats with experimental monoarthritis, administering intrathecally the ed30 for both drugs (3.97 g of ()-cpp and 1.42 g of ppf), since this combination produces an antinociceptive supra - additive effect when used in mechanical nociception (randall - selitto test). the combination of ()-ppf and cpp produced an antinociceptive effect which was greater than that each drug alone as tested by both the c reflex and windup. we conclude that the antinociceptive effect of the combination of ()-ppf and cpp possibly generates a supra additive interaction type in monoarthritic rats. |
ventilator - associated pneumonia (vap) develops commonly in mechanically ventilated patients and is a major cause of morbidity and mortality in the intensive care unit. in a study published in this issue of critical care, pelekanou and colleagues investigated the differences in innate and adaptive immune responses in 36 septic patients with vap and 32 patients with sepsis due to other infections, like pyelonephritis, bacteremia, intra - abdominal infection, and community- and hospital - acquired pneumonia. there was evidence of a more pronounced immunoparalysis in patients with vap than in those with other bacterial infections. this was supported by the decreased number of cd3/cd4cells, the increase in monocyte apoptosis, and the lower release of pro - inflammatory cytokines, namely tumor necrosis factor - alpha and interleukin-6, from monocytes after stimulation with lipopolysaccharide (lps) in the group of patients with vap. it is known that anergic monocytes from patients with septic shock showed increased susceptibility to apoptosis when compared with monocytes from normal hosts. patients with vap are more compromised due to various factors like critical illness, malnutrition, invasive interventions, and the loss of anatomic defense mechanisms, some of which may contribute to monocyte unresponsiveness or lymphocyte depletion. the authors report that endotracheal intubation in septic patients without vap was not independently associated with similar numeric and functional alterations in lymphocytes and monocytes. nevertheless, the study might have been underpowered to detect such differences. additionally, one important finding of the study was the observation that septic patients with vap whose monocytes failed to adequately respond to monocyte stimulation had decreased survival rates when compared with those with an increased cytokine release from monocytes. a similar trend was observed in non - vap - related sepsis, but it was not statistically significant. previously published work from this group had demonstrated that early monocyte apoptosis was linked to survival advantage in patients with sepsis due to vap. what remain to be determined are whether a separate mechanism associated with monocyte anergy and enhanced apoptosis exists in vap - related sepsis and how is it related to mortality. one concept that may be useful in trying to answer monocytes exposed to low doses of lps exhibit a decreased responsiveness to subsequent stimulation by endotoxin. endotoxin tolerance has been considered a paradigm of immunoparalysis, which is present not only in sepsis but also in systemic inflammatory response syndrome and other diseases like cystic fibrosis and acute coronary syndrome. endotoxin tolerance could support the theory of vap pathogenesis that is embraced by the authors. gradual exposure of the host to increasing bacterial inocula originating from aspiration of oropharyngeal flora may contribute to a state of immunoparalysis through the mechanism of endotoxin tolerance. although endotoxin tolerance has been implicated in increased susceptibility to secondary infections, a number of studies in experimental models of sepsis have exhibited a protective role of endotoxin tolerance [9 - 11 ]. using a model similar to that of endotoxin tolerance, the authors attempted to mimic vap pathogenesis by using augmenting concentrations of gram - negative bacteria to sequentially stimulate ex vivo peripheral blood mononuclear cells (pbmcs) isolated from healthy volunteers and assessed their apoptosis parameters. an increase in cd14 monocyte apoptosis was observed when compared with non - stimulated pbmcs and pbmcs that had only a unique bacterial challenge with the highest concentration of bacterial inoculum used. moreover, a question raised by the results is whether lymphocyte depletion, monocyte apoptosis, and monocyte anergy in vap are immunoparalysis markers that could be used as prognostic factors or are underlying dysregulations that contribute to the pathogenesis of vap. although patients in the two groups did not differ significantly in terms of age, disease severity, underlying conditions, diabetes mellitus, corticosteroid use, the presence of other recent infections, or additional factors that may affect the immune response to sepsis, the duration of critical illness prior to enrollment was not reported. it would be reasonable to expect a more frequent occurrence of longer hospitalization, surgery, trauma, neurosurgical conditions, or other critical illness prior to the development of septic shock in the group of patients with vap. thus, it is hard to know whether any of the above - mentioned factors independently contributed to the observed monocyte unresponsiveness, monocyte apoptosis, and cd3/cd4 cell decrease in this group, and more work is needed before those changes are attributed solely to vap. lps : lipopolysaccharide ; pbmc : peripheral blood mononuclear cell ; vap : ventilator - associated pneumonia. | current evidence regarding potentially different host response mechanisms in sepsis according to the type of initiating infection is sporadic. it is possible that alterations in cell populations, variations in effector molecules, and the degree of apoptosis differ between sepsis caused by ventilator - associated pneumonia (vap) and non - vap sepsis. vap is one of the most common infections and leading causes of sepsis in the intensive care unit, and mortality remains high. a better understanding of the unique pathophysiologic features of vap is needed in order to develop interventions that target those specific pathways. |
hepatocellular carcinoma (hcc) is the one of the most common malignant cancers that occurs in worldwide. hcc is the third most common cause of cancer - related death in south korea, where the death rate from hcc is 22.5/100,000 of the population.1 although recent progress in therapeutic modalities for hcc has improved the prognosis of hcc to some degree,2 the majority of patients are diagnosed with inoperable multiple intrahepatic and/or extrahepatic metastases, and no more than 30% of patients are suitable to undergo curative resection.2 the lung (55%) is the most common site of extrahepatic spread from an hcc, followed by the abdominal lymph nodes (41%) and bone (28%), as shown in studies performed in the u.s.3 the most common site of extrahepatic spread from an hcc is the lung (67%), followed by the bone (12%), the adrenal gland (9%) and the peritoneum (5%) in south korea.4 although hcc has a poor prognosis mostly, several studies about the treatment of hcc with pulmonary metastases have been reported ; however, there has been no standard therapeutic strategy determined for hcc with pulmonary metastases.5 - 7 in this report, we describe the case of a recurrent hcc with extensive lung metastases that was rapidly aggravated, despite of undergoing conventional transarterial chemoembolization (tace) with adriamycin. both the intrahepatic hcc and pulmonary metastases were successfully treated with the combinated therapeutic protocol of monthly hepatic arterial infusion chemotherapy (haic) with epirubicin, cisplatin, and systemic infusion of 5-fluorouracil (5-fu). a 49-year - old man was admitted to our department due to extensive pulmonary metastases of hcc with intrahepatic recurrence. the patient was initially treated with radiofrequency ablation therapy 15 months prior for a single hcc that was 4 cm in diameter and located in segment 7 of the liver. it was found 3 months prior that a 6.9 cm sized - single hcc recurred locally, with a few pulmonary metastases. the patient was underwent conventional tace with adriamycin alone twice during a one - month period. the patient had alcohol drinking history of 80 to 150 g ethanol content by u.s. the laboratory findings showed leukocyte count of 3,200/mm, hemoglobin level of 12.5 g / dl and platelet count of 104,000/mm. iu / l), alanine aminotransferase (alt, 20 iu / l) and alkaline phosphatase (alp, 188 iu / l) were normal. the total bilirubin level (0.5 mg / dl ; normal range, 0.2 - 1.4 mg / dl), albumin level (4.4 g / dl ; normal range, 3.3 - 5.2 g / dl), prothrombin time 13.7 sec (80.5% ; inr, 1.25) demonstrated adequate hepatic reserve, and then the pugh - child classification was class a. elevation of the serum -fetoprotein (afp) level (202,530 ng / ml ; normal range, 0 - 8.1 ng / ml) was found. serum hepatitis b surface antigen (hbsag) was positive, hepatitis b e antigen (hbeag) was negative and hbv dna was not detectable in serum, indicating a non - infective hbv carrier status. considering both the occupation of the patient and hcc status, which was tnm 4b stage and clip score 1, we modified the intrahepatic arterial infusion of epirubicin and cisplatin and systemic intravenous infusion of 5-fluorouracil (ec / f) protocol for hcc that jang.8 had reported. this protocol consisted of hepatic arterial infusion chemotherapy (haic) with the use of 50 mg / m epirubicin and 60 mg / m cisplatin and systemic 12-hour infusion of 200 mg / m 5-fu. dose modification for the use of epirubicin and cisplatin was calculated as follows : calculated dose=(dose per bsa [body surface area])(leukocyte count/4000)(1-(pugh - child score-5)/10)(1-(age-45)/100). every-4 to 5-week modified ec / f - based treatment was perfomed for 10 times repeatly. the total accumulation doses of epirubicin and cisplatin were 502 mg and 600 mg, respectively. there was neither significant cytopenia nor decline of hepatic function with the use of this protocol. after the end of the second cycle of treatment, the serum afp level was dramatically decreased from 462,704 ng / ml to 575 ng / ml. at the end of the sixth cycle, the serum afp level was normalized to 4.47 ng / dl, and also the pulmonary metastatic nodules had nearly disappeared (figs. 1 and 2). the treatment was continued until tenth cycle as a 0.7 cm - sized isolated nodule was still observed in the left lower lung field in a dormant state. after 13 months of the disease - free interval (dfi), another 1 cm - sized hcc was found in the left hepatic lobe. to identify another tumors that were possibly missed on ct images, we performed haic with the same regimen and added the use of percutaneous intra - tumoral chemo - injection therapy with a mixture of 500 mg 5-fu and 4 mu interferon gamma to the target tumor (fig. no evidence of recurrence in both liver and lung was found, which was based on image analysis and expression of tumor markers up to december 2008. for liver and lung, although systemic chemotherapy has been used for advanced hcc, the disease has been reported to have a low response rate and the use of systemic chemotherapy has been unable to demonstrate a significant survival improvement.9,10 because most hcc patients have liver cirrhosis with limited hepatic reserve, the patients are not adequate candidates for chemotherapy and are likely to have more side effects associated with the cytotoxic effects of anti - cancer drugs.11 as almost all hcc obtain the blood supply from the hepatic artery, haic was developed as a therapeutic option for advanced hcc. intra - arterial infusion provides a high concentration of drug to the tumors12 and efficient delivery of drugs to tumors occurs by the use of angiography or by the use of an implanted chemoport subcutaneously. administration of anti - cancer drugs is divided into several sessions and can lower the dose of one - shot arterial chemoinfusion, so that the systemic cytotoxicites of drugs can be minimized and the risk of hepatic dysfunction associated with chemotherapy can be reduced. a number of studies have shown a superior results for the use of intra - arterial chemotherapy as compared to the use of systemic chemotherapy.13 - 15 drugs such as cisplatin, 5-fu, epirubicin and mitomycin c have been tried as single or combination agents for haic.8,16 - 18 the deoxynucleotide 5-fluoro-2'-deoxyuridine-5'-monophosphate derived from 5-fu blocks dna synthesis by inhibiting thymidylate synthase. cisplatin enhances 5-fu cytotoxicity by inhibiting intracellular l - methionine metabolism and by consequently increasing the reduced folate pool.19 based on these effects, studies with combination chemotherapy with cisplatin and 5-fu have been attempted. toyoda.16 reported that the objective response (or) rate of continuous local arterial infusion with cisplatin and 5-fu for severe advanced hcc was 14.3%. ando.17 showed that the or rate of arterial infusion chemotherapy with 5-fu and cisplatin for hcc with tumor thrombosis of the main trunk of the portal vein was 44.4%. jang.8 reported that the or rate and median survival time for patients undergoing combination therapy comprised of transarterial infusion of epirubicin and cisplatin, systemic infusion of 5-fu and additional percutaneous ethanol injection was higher as compared to the use of conventional tace with adriamycin and gelfoam in patients with unresectable hcc. in addition, kogure.18 reported a case of a patient with an hcc with tumor invasion to the inferior vena cava and multiple pulmonary metastases who was treated with the administration of epirubicin, cisplatin and mitomycin c by hepatic artery and bronchial artery infusion, which led to complete remission. in the present case, we modified an original protocol reported by jang.8 to reduce the admission period because of the occupational situation for the patient and used calculated doses of epirubicin and cisplatin for intrahepatic arterial infusion and one - day low fixed dose systemic infusion of 5-fu. although the hcc did not respond to adriamycin alone, which was used just before visiting our department, the modified ec / f protocol showed a dramatic treatment effect after the second cycle of administration. after the end of the sixth cycle of treatment, both liver and pulmonary metastases had the nearly completely responds and the serum afp level was normalized, as shown in fig. a question arises why the hcc in this case responded completely to the modified ec / f therapy despite both the non - responsiveness to adriamycin, which belongs to the same pharmacological group as epirubicin and the use of the one - day low dose 5-fu in the protocol. several case reports have suggested that the use of cisplatin sometimes leads to a complete remission of advanced hcc with pulmonary metastases.20 - 22 as the original ec / f therapeutic protocol demonstrated efficiency in the treatment of advanced hcc, it is possible that combination treatment might contribute to a good result. in conclusion, this case indicates that chemosensitivity plays a more important role in hcc treatment than any other clinical prognostic factors, such as the afp level, tumor volume, presence of metastases, vascular invasion, the type of administration and dosage. | we report a case of hepatocellular carcinoma (hcc) with pulmonary metastases treated with repeated hepatic arterial infusion chemotherapy (haic) comprising epirubicin and cisplatin, and systemic infusion of 5-fluorouracil (a modified ec / f protocol), which led to complete remission. a 49-year - old man with compensated liver cirrhosis experienced intrahepatic recurrence of hcc with extensive lung metastases. the modified ec / f therapeutic protocol, which was applied at the tenth cycle every 4 - 5 weeks, resulted in disappearance of the pulmonary metastases and normalization of serum -fetoprotein levels. a single small hcc lesion was found in the left lobe of the liver 13 months after the final chemotherapy session. haic with the same regimen was conducted again, followed by percutaneous intratumoral chemoinjection therapy with 5-fluorouracil and interferon-. thereafter, there was no evidence of recurrence in either the liver or the lung, as evidenced by image analysis and expression of tumor markers. the disease - free intervals for the liver and lung were 41 and 54 months, respectively. |
secondary amyloidosis can occur as a complication of chronic systemic inflammatory and infectious diseases. until now there has been no report of secondary amyloidosis associated with ms. we report herein a case of renal biopsy - proven secondary amyloidosis in a patient with ms. a 41-year - old woman with ms was hospitalized due to aggravated quadriparesis and edema in both lower extremities. a percutaneous renal biopsy procedure was performed, the results of which revealed secondary amyloid - a - type amyloidosis associated with ms. multiple sclerosis (ms) is a demyelinating autoimmune disease of the central nervous system. its pathological triad comprises central nervous system inflammation, demyelination, and gliosis.1 secondary amyloidosis, which develops secondarily to chronic inflammatory conditions such as rheumatoid arthritis, is now called amyloid - a (aa) amyloidosis because a major factor in the protein deposition process involves a cleaved product of the acute - phase protein, serum amyloid a (saa).2 cerebrovascular amyloid deposits in the region of demyelinated plaques without systemic amyloidosis have been reported rarely in cases of ms;3 however, there is no report in the literature of ms related to aa amyloidosis. this article presents a case of ms with secondary aa amyloidosis, presenting with nephrotic syndrome. she had been diagnosed with ms at an age of 33 years. at 26 years of age, the patient experienced her first episode of quadriparesis with sensory changes in both lower extremities. at 33 years, she noticed decreased visual acuity for several days. at 40 years, she was admitted to the hospital due to quadriparesis, dysarthria, and confusion, and her brain mri showed brain, medullary, and spinal cord lesions (fig. one year later, she was hospitalized again due to aggravated quadriparesis ; she also complained of edema in both lower extremities. steroid pulse therapy was performed again and the motor weakness in her upper extremities improved, but she continued to complain of dyspnea, orthopnea, and peripheral edema. her chest x - ray showed cardiomegaly with pulmonary edema, but her echocardiogram showed normal findings. laboratory studies showed the following parameters : white blood cell count 6,500/mm, red blood cell count 2.9310/mm, hemoglobin 9.6 g / dl, hematocrit 28.1%, platelets 248,000/mm, serum sodium 144 meq / l, serum potassium 4.7 meq / l, serum chloride 109 meq / l, serum creatinine 1.2 mg / dl, serum blood urea nitrogen 78 mg / dl, serum albumin 2.5 g / dl, serum total protein 5.0 g / dl, serum cholesterol 218 mg / dl, and serum saa 44.4 g / ml (reference level < 8 g / ml). in addition, anti - nuclear antibody, anti - neutrophil cytoplasmic antibody, rheumatoid factor, and cryoglobulin were not detected in this patient 's serum, which was also negative for hepatitis b surface antigen and anti - hepatitis - c antibody. a percutaneous renal biopsy procedure confirmed the presence of aa - type amyloidosis (fig. we performed immunofixation electrophoresis on her serum and urine to exclude a plasma - cell dyscrasia. aa amyloidosis was confirmed in view of the positive immunohistochemical staining for amyloid a and negative staining for kappa and lambda ; however, with the exception of a past history of non - febrile asymptomatic bacteriuria and a short - lasting minor decubitus sore on the coccyx, there was no evidence of other systemic infection or inflammatory disease. consequently, this case was diagnosed as secondary aa - type amyloidosis associated with ms. we present herein the clinicopathological findings of a patient with ms who developed aa amyloidosis approximately 15 years after the onset of ms. amyloidosis is caused by the extracellular deposition of pathologic, insoluble, fibrillar proteins in organs and tissues. precursor proteins are known to change into fibrils through multiple mechanisms that differ among the various types of amyloid. secondary amyloidosis is caused by the deposition of amyloid originating from saa, which is an acute - phase protein produced in response to inflammation4 and occurs most commonly among patients with chronic inflammatory diseases such as rheumatoid arthritis, juvenile rheumatoid arthritis, and inflammatory bowel disease.5 familial mediterranean fever (fmf) is also an inflammatory disease characterized by episodic fever and serositis. livneh.6 reported the development of aa amyloidosis in up to 90% of untreated fmf patients. a high prevalence of fmf was recently reported in one ms cohort in turkey.7 these data suggest that ms is related to secondary amyloidosis, although until now there have been no reports of secondary amyloidosis in patients with ms. one previous study found that saa levels were increased in the peripheral blood of patients with relapsing - remitting type ms. saa plays an important role in the conversion of innate immunity into the acquired immune response present during periods of acute and chronic inflammation.8 therefore, increases in levels of saa in ms patients may be considered evidence of the role of inflammation in ms, and may be a precursor of amyloid fibrils. however, there are no reports of increased levels of saa in asymptomatic bacteriuria or decubitus sores. the clinical presentations and symptoms dependupon the distribution pattern and the amount of amyloid deposited. the main treatment protocol for aa amyloidosis is management of the underlying inflammatory disease process, which usually focuses on the surgical debridement of inflammatory tissue, antibiotic treatment of infectious processes, anti - inflammatory medications (colchicine and anti - tumor necrosis factor blockade), and immunosupp ressive (cyclophosphamide) agents.9 however, these treatments, have not yet been established in randomized controlled studies. in our case, disease - modifying agents for ms (e.g., interferon-, glatiramer acetate) could be considered for the treatment of ms - associated secondary amyloidosis. there have been two previous reports of localized amyloid deposits in ms;5 however, there have been no reported cases of associated systemic amyloidosis. this is the first published case of secondary amyloidosis presenting as nephrotic syndrome associated with ms. the findings of this case suggest strongly that ms is a chronic inflammatory disease and that secondary amyloidosis can develop in ms. | backgroundmultiple sclerosis (ms) is a demyelinating disease of the central nervous system. secondary amyloidosis can occur as a complication of chronic systemic inflammatory and infectious diseases. until now there has been no report of secondary amyloidosis associated with ms. we report herein a case of renal biopsy - proven secondary amyloidosis in a patient with ms.case reporta 41-year - old woman with ms was hospitalized due to aggravated quadriparesis and edema in both lower extremities. laboratory findings showed nephrotic - range proteinuria and hypoalbuminemia. a percutaneous renal biopsy procedure was performed, the results of which revealed secondary amyloid - a - type amyloidosis associated with ms.conclusionsthis is the first report of secondary amyloidosis associated with ms. |
various pathological conditions such as os odontoideum, rotatorysubluxation, dens fracture or trauma, rheumatoid arthritis, and congenital or acquired ligamentous instability can affect the atlantoaxial instability1). gallie reported atlantoaxial arthrodesis by posterior wiring and autologous grafting9), and magerl and seeman introduced the c1-c2 transarticular screw fixation16). however, this technique is technically demanding and requires precise radiological and intraoperative knowledge of the localization of the vertebral artery to minimize the risk of iatrogenic damage. they reported that the procedure is technically demanding and that anexact three - dimensional understanding of the anatomy of the region and of the vertebral artery is important. modern atlantoaxial instrumentation techniques are transpedicle screws and screw - rod constructs which is modified by harms and melcher17,21). in contrast to the relatively high rate of nonunion with wiring techniques, the rates of successful fusion with modern instrumentation and techniques exceed 95%5). biomechanical studies showed a construct stability of screw - rod constructs similar to transarticular screws8,14). so, some authors suggested that spine surgeons should reconsidered the use of bracing for c1 - 2 fusion procedures where rigid segmental fixation has been achieved4). although they concluded the external cervical orthoses may be not necessary with class iii evidence4), cervical collars were effective to provide an optimal environment for bone fusion by restrict the range of neck movement. herein, this article reported a two - times unlucky case of pedicle screws fracture after atlantoaixial fusion with several episode of neck hyperflexion, and emphasized the limitation of neck movement after cervical posterior fixation. forty three years - old man who complained persistent neck pain and whole body tingling sensation was visit the neurosurgical clinic to treatment. he was an orthopedic surgeon, and self - diagnosed his symptom as os odontoideum with atlantoaxial instability. the operation was recommended to this patients, and proceeded after a week because he should stop the cardiovascular medication which was continued after cardiac stent insertion. skull traction was applied in the prone position after general anesthesia with endotracheal intubation was done. gentle manipulation of the neck through the traction device was used under fluoroscopic control in an attempt to obtain reduction. the posterior elements of the vertebrae c1-c4 were freed by subperiosteal dissection through a standard posterior midline approach. posterior c1 lateral mass screws, c2 pedicle screws, and screw - rod constructs were applied to the patient, and 3ml of demineralized bone matrix (dbm) was applied to the c1-c2 area after decortications. finally, the wound was closed in layers over a subcutaneous drain. during the operation any event was not happen, and the patient was improved immediately after the operation. the clinicians recommended the philadelphia brace until at least 2 months after operation to provide an optimal environment for bone fusion by restrict the range of neck movement. simple radiographs were checked during follow - up periods, and a screw fracture in c2 level was observed after 5 weeks after the operation (fig. 2). the clinician did not undergo the revision operation, because the specific symptom related to the screw fracture was not observed. postoperative neck immobilization was emphasized to patient once more, and closed follow - up was planned. but, the unilateral fixation of cervical spine did not achieve the desired clinical course, and the remnant c2 screw was also broken after 9 weeks after the operation (fig. cervical computed tomography (ct) showed mild erosion in occipital bone inferior cortex by rod construct which is not directly contact in normal position, but could irritate when it motioned (fig. 3). irritation of fractured screws to the occipital bone could be happened by the relatively close distance between the occipital bone and c1 posterior arch in preoperative image studies (fig. 1). finally, after several conversations with the patient, the patient had undergone the revision operation in 26 weeks after operation. the revision operation was done using translaminar screw fixation without removal of fractured screws because it was nearly impossible to remove it without destruction of c2 bony structures (fig. indeed, the autologous morselized bone grafts were obtained from the posterior iliac crest, and applied to the c1-c2 area after decortication. but, he complained sustained neck pain in 4 months after second operation, and non - union was suspected simple radiographs. checked ct revealed scant bony union at operated cervical level, but cervical instability was not suspected in radiographs (fig., the patient was admitted to other university hospital and undergone the third operation for non - union of atlantoaixial lesion. complications associated with craniocervical fusion surgery were analyzed by lall.15). in this reports, 22 reports described data derived from 2,274 procedures were included, and the most commonly encountered perioperative complications were related to instrumentation failure after nonunion with rates as high as 7% during occipitocervical fusion and 6.7% during atlantoaxial fusion. other commonly encountered complications included injury to the vertebral artery with 1.3 - 4.1% incidence during placement of c1-c2 transarticular screws, dural tears, and wound infection. the screw breakout was observed 10 cases (0.7%) of 1,530 among c1-c2 transarticular screw, lateral mass screw, and pedicle screw complications6,12,15,18). but, the screw fracture after transpedicle screws and screw - rod constructs is very rare with no relevant article in the literature review. indeed, additional surgical procedure not related small aneurysm and non - union after atlantoaixial fusion is not well documented. herein, the authors concentrically reviewed the complicated two - times unlucky case, and emphasized the importance of postoperative immobilization to prevent the unintended clinical course of patients. fixation of the atlantoaxial complex using polyaxial - head screws and screw - rod constructs seems to be a reliable technique and should be considered an efficient alternative to the previously reported techniques13). the polyaxial screws are incorporated as part of amodular system for fusions to atlantoaxialcervical spine. this technique avoids damage to the c1-c2 facet joint and thus can be used in patients who require an open reduction maneuver followed by temporary limited fixation13). but, this construct system is not perfect technique as this case presented, although the biomechanical properties of this construct are similar to transarticular screws8,14). both transpedicle screws and screw - rod constructs modified by harms and melcher at c2 level was fractured within 9 weeks after the first operation (first screw fracture was happen in 5 weeks after the operation). the postoperative radiographs showed normal alignment of atlantoaxial spine, but displacement of atlantoaxial spine aligment was observed after sequential screw fractures (fig. the cannulated screws were pointed to cephalad trajectory and fractured tip close to screw head was pointed to caudal trajectory (fig. 2, 5). in the point of screw fractures morphology, the dynamic forces contributing the screw fracture were derived from hyperflexion of neck motion as figure 5 indicated. this situation is also correlated with not following instructions of using philadelphia brace to provide an optimal environment for bone fusion by restrict the range of neck movement. reviewed published series describing c1 - 2 posterior instrumented fusions with screw - rod constructs or transarticular screws and compared rates of fusion with and without postoperative external cervical orthoses3). online databases were searched and all including studies provided class iii evidence, and no studies directly compared outcomes with or without external cervical orthoses use. there was no significant difference in the proportion of patients who achieved successful fusion between patients treated with external cervical orthoses and without external cervical orthoses for c1 - 2 posterior instrumented fusion patients. the estimates fusion rates were 97.4% with external cervical orthoses use and 97.9% without external cervical orthoses use for screw - rod constructs. so, they concluded that external cervical orthoses may be unnecessary after c1 - 2 fusion with modern instrumentation, and recommended prospective, randomized studies with validated radiographic and clinical outcome metrics are necessary to determine the utility of external cervical or- thoses. is interesting ; however, the external cervical orthoses are so effective that they can certainly assist inproviding an optimal environment for bone fusion. indeed, this review compared the outcomes focusing only the fusion rate after c1 - 2 posterior instrumented fusions without considering the other complications such as screw fracture. so, the opponent proposed that the need for bone fusion in this mostmobile area of the spine is so important for the stabilization of the area and long - term results for the patient that we would certainly err in favor of external cervical orthoses10). indeed, it is emphasized that internal fixation of posterior arthrodesis using tricorticated bone graft is important factor for successful bone fusion7). c1 lateral mass screw and c2 pedicle screw with polyaxial screw and rod system supplemented with miniplate for interlaminar fusion might be an efficient alternative method to treat various atlantoaxial instabilities22). the operation was completed by longer c1 lateral mass screws and c2 translaminar screws fixation. c2 translaminar screws commonly used as an alternative or salvage technique because it offers biomechanical stability similar to that of other c2 fixation methods but with minimal risk to neural and vascular structures3). c1 lateral mass screws and c2 translaminar screws fixation is equivalent to c1 lateral mass screws and c2 pedicle screws fixation in flexion / extensionand anterior - posterior translation2,3,19). radiographically demonstrated bony fusion was reported from 91.7% to 97.6% in c2 translaminar screws fixation3,19). but, this presented patient could n't achieve the bony fusion in imaging studies during 4 months follow - up period after second operation, nevertheless using the autogenous iliac crest graft. but, the dynamic simple radiographs were stable in flexion / extension view of cervical lateral radiographs, although the bony fusion was not satisfied (fig. 6). the patient was also not satisfied to bony fusion and underwent reoperation in other hospital. complications after operation were graded as minor, moderate, or major as classified by rampersaud.20). minor complications required little (1 day) or no increase in the duration of stay with minimal or no additional treatment required. moderate complications warranted treatment, increased the duration of stay by 2 - 7 days, and/or created no long - term sequelae (6 months). major complications required significant levels of treatment, increased the duration of stay by > 7 days, and/or created longterms equelae (6 months). in addition, these authors described an adverse event as any unexpected or undesirable incident happening as a result of surgery, either directly or indirectly. thus, a complication can occur as a result of an adverse event, but it is also possible for an adverse event to happen without an associated complication. in this report, a patient with two - times repeated unlucky complication following atlantoaxial fusion was described ; screw fracture and non bony union. this complication could include to unexpected and major compilations in classification by rampersaud.20). the authors considered that the first step of unfortunate clinical course is fail of neck immobilization during recovery period after atlantoaxial fixation. some authors suggested that spine surgeons should reconsidered the use of bracing for c1 - 2 fusion procedures according to the bone fusion rate4), but the authors want to emphasized this clinical failure without postoperative immobilization. to quote the appropriate saying, " a stitch in time saves nine. " continuous complication after atlantoaixial fusion is rare, but the clinical course is unlucky to patients. this screw fractures could be happen without solid bone fusion by the overweight as lever function in harms and melcher methods which fixated the anterior column instability. | a patients with atlantoaixial instability and osodontoideum underwent atlantoaixial fusion (harms and melcher technique) with demineralized bone matrix. but, unfortunately, the both pedicle screws in c2 were fractured within 9 weeks follow - up periods after several suspected episode of neck hyper - flexion. fractured screws were not contact to occipital bone in several imaging studies, but it could irritate the occipital bone when neck extension because the relatively close distance between the occipital bone and c1 posterior arch. the patient underwent revision operation with translaminar screw fixation with autologus iliac bone graft. postsurgical course were uneventful except donor site pain, but the bony fusion was not satisfied after 4 months follow - up. the patient re - underwent revision operation in other hospital. continuous complication after atlantoaixial fusion is rare, but the clinical course could be unlucky to patients. postoperative immobilization could be important to prevent the unintended clinical course of patients. |
the first occurred in april may 2003 in 2 communities (vila sanso, 140 inhabitants, and vila paulo fontelles, 835 inhabitants).in the municipality of parauapebas (64s, 4954w). august 2004 in 1 community (vila tapara, 2,000 inhabitants) in the municipality of porto de moz (145s, 5214w) (figure 1). map of brazil showing locations where oropouche fever outbreaks were identified during 20032004 and previous locations of this disease. a total of 125 and 109 serum samples were collected from residents of parauapebas and porto de moz, which represented 12.8% and 5.45% of all inhabitants, respectively. criteria for sampling were a history of acute fever several weeks before or during the survey or clinical symptoms similar to those of oropouche fever. all serum samples were analyzed by hemagglutination inhibition (hi) test (7) and immunoglobulin m elisa (8) for specific hi and igm antibodies to orov. hi titers > 20 and elisa results greater than the cut - off value (optical density > 0.200) were considered positive (8).virus isolation was conducted by intracranial injection of newborn mice with a 1:10 (v / v) suspension of serum samples in phosphate - buffered saline, ph 7.4, as described elsewhere (9). fifty - four and 11 serum samples from parauapebas and porto de moz, respectively, were used for virus isolation. two orov strains were isolated from patients in parauapebas, and 2 strains were isolated from patients in porto de moz. to genetically characterize the viruses, 2 isolates were selected from parauapebas (brazil 2003a and brazil 2003b) and 2 from porto de moz (brazil 2004a and brazil 2004b). viral rna was extracted from vero cells infected with human samples, and s rna was amplified by using a 1-step reverse transcription phylogenetic trees were constructed for nucleocapsid gene nucleotide sequences by comparison with other orov nucleocapsid gene sequences in genbank (table 1) ; neighbor - joining analysis (10) implemented in mega version 2.1 (11) was used. bootstrap analyses were performed on 1,000 replicates to generate confidence for groupings (12). of 125 serum samples from patients in parauapebas, hi results were positive for 16 (12.7%) from vila sanso, 6 (4.8%) from paulo fontelles, and 4 (3.2%) from other localities. igm was detected in 16 (12.7%), 8 (4.8%), and 6 (4.8%) serum samples from these 3 areas, respectively. of 117 serum samples from patients in porto de moz, 56 (46.7%) had hi antibodies and 61 (52.1%) had igm to orov. a total of 71.9% of female patients in parauapebas and 59% in porto although all age groups were affected, persons 514 years of age had the highest frequency of symptoms (30.4%) and those < 14 years of age had the lowest frequency (4.8%) (table 2). symptoms most frequently reported were fever (100%), headache (79.3%), joint pain (68.7%), and muscle pain (30%). seventy percent of patients reported 1 episode of recurrence of fever, characterized by fever, headache, and other symptoms 23 weeks after onset of initial symptoms (2,3). full - length s rna of the 4 orov strains contained 754 nt and encoded 2 overlapping open reading frames, the nucleocapsid (693 nt and 231 aa) and nonstructural protein (273 nt and 91 aa). two small noncoding regions were also found at the 3 and 5 ends of these reading frames, spanning nt positions 144 and 741754, respectively. phylogenetic analysis of brazil 2003 and 2004 isolates grouped strains from parauapebas (brazil 2003a and brazil 2003b) into orov genotype i and strains from porto de moz (brazil 2004a and brazil 2004b) into orov genotype ii (figure 2). comparative small (s) rna phylogenetic tree constructed by using the neighbor - joining method for oropouche virus strains isolated in parauapebas and porto de moz, par state, brazil. bootstrap values were placed over the 3 nodes for each main group (i, ii, and iii). oropouche fever is the second most common arboviral disease (after dengue fever) in the brazilian amazon region. from 1960 to 1980, oropouche fever outbreaks were detected only in par state, mainly in belm and neighboring areas, where thousands of people were infected (2,3). orov was then detected in other amazonian states including amazonas, amap, acre, rondnia, and tocantins ; and non - amazonian states, including maranho in northeastern brazil and tocantins in central brazil (3,8). recently, orov isolated from callithrix sp.in arinos, minas gerais state, southeastern brazil was characterized as genotype iii, which indicated the presence of this genotype in brazil (6). orov from this species has been identified only in panama (5). from 1980 to 2005, sporadic cases or self - limited outbreaks of oropouche fever were reported in areas of the brazilian amazon, which suggested silent endemic circulation of the virus (13). in 2003 and 2004, several cases of oropouche fever were detected in parauaebas and porto de moz in par state. parauaebas is located in the carajs mineral province and porto de moz is located in the altamira region. genetic characterization of strains indicated the presence of genotype ii in the eastern amazon region. this genotype had been associated with cases of oropouche fever in restricted western amazonian areas (rondnia state), as well as in peru (5). this finding suggests movement of orov genotype ii across the amazon region from western to eastern areas or emergence of this genotype after silent circulation for several years. genotype i (brazil 2003a and brazil 2003b) found in parauapebas was closely related to trinidadian and brazilian isolates obtained from 1955 through 1960 (trinidad 55 and brazil 60) (5). genotype ii strains isolated in porto de moz were genetically related to strains isolated in peru during the 1990s (peru 92, 93, 97, 98a, 98b) and rondnia state in 1991 (brazil 91a, 91b), as reported by saeed. these data indicate that parauapebas and porto de moz orov isolates are genetically distinct and have different ancestor viruses (figure 2). recognition of different orov genotypes in the brazilian amazon, as well as new genetic information, is useful for understanding the epidemiology and genetic diversity of this emergent human pathogen. | oropouche fever has reemerged in parauapebas and porto de moz municipalities, par state, brazil. serologic analysis (immunoglobulin m elisa) and virus isolation confirmed oropouche virus (orov) in both municipalities. nucleotide sequencing of 2 orov isolates from each location indicated genotypes i (parauapebas) and ii (porto de moz) in brazil. |
andropause is a condition of decreasing testosterone in men that usually begins to occur at about 40 years of age. many men also find it difficult to acknowledge there may be a problem by refusing to even talk about the symptoms. ignorance and fear of the andropause condition abounds in the general public and even among health professionals. over 10,000 articles on climacteric (or menopause) for women can be found but relatively less has been conducted on the male equivalent. attaining knowledge regarding andropause will help the caregivers and gerontologists to achieve the ultimate goal of a dignified healthy ageing and maintain the highest quality of life. thus, it 's adding life to years and not simply years to life while ignorance about andropause persists, having an instrument turns out to be a necessity. the study was investigated to the standards of massq (2012) within male older adults to introduce a relevant criterion. about 382 men with age range of 50 - 80 and with the mean age of 65.3 2.32 were sampled with the cluster - ratio sampling method from the eight cities of khuzestan province in southwestern iran (n = 228784 aged persons in the province) [appendix 1 ]. the massq questionnaire mainly consists of a 25-item disability / symptom scale regarding andropause that was investigated by authors and literature reviews. each item in the disability / symptom scale has five response options from 1 = none to 5 = extremely severe. if the 25 items are completed, a scale score ranging from 25 (no symptoms) to 125 (most severe symptoms) can be calculated. the questionnaire was translated into persian from its english version by three instructors and an english language expert. the four translated versions were compared by the authors, and the researchers developed a common persian text from them. afterward, the persian version of the massq was translated back into english by an english language expert who had not seen the original english text and by a linguist. the english statements of the questionnaire that had been translated from persian into english were compared with the original version, and any necessary revisions were made as well. from the eight cities of khuzestan province in southwestern iran, that is, ahwaz, behbahan, dezful, shoushtar, abadan, mah - shahr, masjid soleiman, and ramhormoz, about 400 aged men responded to the iranian version of the massq. of the 400 responders, 382 had responded to all of the 25 items used in the massq and were included in the analysis. the mean age of the samples was 65.3 2.32 (range : 54 - 86) years. the questionnaire was translated into persian from its english version by three instructors and an english language expert. the four translated versions were compared by the authors, and the researchers developed a common persian text from them. afterward, the persian version of the massq was translated back into english by an english language expert who had not seen the original english text and by a linguist. the english statements of the questionnaire that had been translated from persian into english were compared with the original version, and any necessary revisions were made as well. from the eight cities of khuzestan province in southwestern iran, that is, ahwaz, behbahan, dezful, shoushtar, abadan, mah - shahr, masjid soleiman, and ramhormoz, about 400 aged men responded to the iranian version of the massq. of the 400 responders, 382 had responded to all of the 25 items used in the massq and were included in the analysis. the mean age of the samples was 65.3 2.32 (range : 54 - 86) years. coefficients of cronbach 's alpha (= 0.89), split - half (0.91), convergent validity (0.72), divergent validity (-0.32) criterion validity (0.67) were estimated, which were significant at p < 0.01. the exploratory factor analysis demonstrated that the 25-items of massq for aged samples are organized into four factors (factor 1 : sexual, factor 2 : somatic, factor 3 : psychic, and factor 4 : behavioral) which clarify 83% of the scale 's variance. second - order confirmatory factor analysis pointed out that the factors were well matched up onto a principal factor. according to the table 1, the rotated factor matrix pattern of varimax for the massq 's subscale questions was considered. varimax - rotated factors matrix of the massq consequently, the four - factor model was appropriate for the data and the fit index techniques for adjusting the scale. the indexes of the model 's goodness of fit refer to the integrity of the four - factor model with data. the root mean square error of approximation (rmsea) and standardized root mean residual (srmr) must be less than 0.05 that indicate to good models. the model pointed out the goodness of fit of the model in the study (agfi = 0.92, gfi = 0.91, rmsea = 0.006, ifi = 0.94, nfi = 0.91, cfi = 0.97). as closer measure to 1 in the normed fit index (nfi), the comparative fit index (cfi), goodness - of - fit statistic (gfi), the incremental fit index (ifi), and the adjusted goodness of fit index (agfi), they refer to the goodness and fit of model. the aim of the study is to look for the relevant instrument regarding common symptoms of an aged - related issue called andropause within aged males in the iranian social context, even the issue still is challengeable. so, the andropause symptoms self - assessment questionnaire (massq, 2012) was used and evaluated. the results stated to the well - adjusted reliability and validity of massq and usefulness of it in the relevant studies as well. therefore, future researchers should not limit themselves to the western scales but should also consider specific cultural factors. additionally, it is suggested that in future studies, the female menopause symptoms self - assessment questionnaire, which are compatible with iran 's native culture, be conducted and evaluated as well. validity and reliability in the aged male community of the iranian society and it can be employed to measure andropause symptoms. it is applicable by gerontologists for the future studies as well as to the geriatrics in their diagnostics. ethical matters, for example, plagiarism, uninformed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, and so on, have been totally observed by the authors. ethical matters, for example, plagiarism, uninformed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, and so on, have been totally observed by the authors. | background : andropause is a condition of decreasing testosterone in men that usually begins to occur at about 40 years of age. many men find it difficult to acknowledge there may be a problem by refusing to even talk about the symptoms.aims:the study was conducted to the standards of massq (2012) within male older adults to introduce a relevant criterion.materials and methods : about 382 men with age range of 50 - 80 and with the mean age of 65.3 2.32 were sampled with the cluster - ratio sampling method from the eight cities of khuzestan province in southwestern iran. the aged samples replied to the 25 items of massq.results:coefficients of cronbach 's alpha (= 0.89), split - half (0.91), convergent validity (0.72), divergent validity (0.32), and criterion validity (0.67) were estimated, which were significant at p < 0.01. the exploratory factor analysis demonstrated that the 25-items of massq for aged samples are organized into four factors (sexual, somatic, psychic, and behavioral) which clarify 79% of the scale 's variance. second - order confirmatory factor analysis pointed out that the factors are well - matched up onto a principal factor. consequently, the four - factor model was well appropriate for the data by the fit index techniques for adjusting the scale [adjusted goodness of fit index = 0.92, goodness - of - fit statistic = 0.91, root mean square error of approximation = 0.006, incremental fit index = 0.94, normed fit index = 0.91, comparative fit index = 0.97].conclusions : the results pointed to the well - adjusted reliability and validity of massq and its usefulness for the relevant studies as well. |
though metastases are generally widely disseminated, a minimal metastatic state has been recently recognized, with a distinct natural history and an intermediate prognosis between that of localized and metastatic disease. in 1995, s. hellman and r. weichselbaum first coined the term oligometastases : the definition of such a state came after years of research on the natural history of human solid tumors, especially breast cancer. within this framework, they also developed the idea that local treatments such as radiation therapy would probably have an increasing role, especially in those patients with slowly progressing cancer. several years later, methods of morphological and metabolic imaging have improved dramatically, new systemic therapies are able to prolong survival and the oligometastatic state is increasingly encountered in most common tumors, including lung, breast, colorectal and prostate cancer. a combination of local therapies with systemic treatments at different time - points in the natural history of the disease is currently being offered to patients in a number of institutions worldwide, both in clinical studies and outside experimental trials [36 ]. recent data suggest that oligometastases may be relatively common, at least among certain tumour types, for example breast cancer. it is accepted that the oligometastatic state can occure in three categories of patients : patients who present with oligometastatic disease at diagnosis, those with oligoprogressive disease after cytoreductive therapy, and those with oligorecurrent disease after curative locoregional therapy. oligo are less than or equal to five in no more than three different organs, even if the definition can be discussed and adapted to specific clinical presentations. radiotherapy may play a unique role in this scenario, as the technological advances in the field of radiation oncology allow for rapid non - invasive delivery of very high radiation doses to specific sites. stereotactic body radiation therapy (sbrt) or stereotactic ablative radiotherapy (sabr) has been extensively investigated in recent years, showing high local control rates (lcrs) and promising progression - free survival estimates in selected metastatic patients, at the price of a very limited toxicity. by the term sbrt, philosophy of cancer treatment with highly focused radiation doses in one or few sessions (less than or equal to eight), administered with ablative intent. however, determining the clinical advantages or superior survival of this strategy when compared with systemic therapy or observation alone is challenging because of the predominantly retrospective nature of existing data ; this has raised substantial concerns about positive selection biases in reported series (better performance status, longer disease - free interval, smaller metastatic burden, less aggressive course). in many cases it is unclear whether better than expected outcomes are seen due to the efficacy of the ablative treatments or to patient selection (more indolent tumor biology). prognostic data are lacking for adequate patient selection ; the ability to predict rapidly versus slowly progressive disease would be of major importance for the design of customized therapeutic strategies as well as for prospective clinical trials. in general, evidence supporting the concept of prolongation of progression - free survival (and sometimes overall survival [os ]) by the combined use of systemic and local therapies comes from observational cohort studies using surgery and/or radiotherapy taken together. perhaps the best evidence for a local ablative approach for oligometastatic disease comes from surgery for lung or liver oligometastases from colorectal cancer (crc) performed sequentially following systemic treatment. however, in recent years only limited prospective data from pioneer researchers has become available. the purpose of the present review is to focus on the role of sbrt as local ablative therapy for most common oligometastatic cancer subtypes, with the aim of discussing its results and possible applications as a disease - specific local therapy option either with or without systemic therapies. oligometastatic non small cell lung cancer (nsclc), presenting with one to five synchronous or metachronous metastatic lesions, has recently been considered a distinct disease state. locally ablative therapies are often used for such clinical presentations ; however, the subset of patients who may benefit from these interventions at metastatic sites or at the primary lesion has not been conclusively identified. these issues are reflected by the heterogeneous survival outcomes reported in several retrospective and a limited number of prospective studies on oligometastatic lung cancer. a single - arm phase ii study enrolled 39 patients presenting with stage iv disease with less than four synchronous sites of distant metastasis. the primary lesion was treated with radiotherapy alone or in combination with chemotherapy, and all sites of distant metastases were treated with surgery or sbrt. the median os was 13.5 months, though six patients were progression - free after 2 years. an individual patients ' data meta - analysis of outcome of sbrt in oligometastatic nsclc with one to five synchronous or metachronous metastases treated with surgical metastectomy, sbrt / radiosurgery, or radical external - beam radiotherapy (and curative treatment of the primary lung cancer) showed a median survival time of 19 months among patients with controlled primary tumors. aggressive treatment to the primary tumor and metastases improved os, supporting the hypothesis that oligometastatic nsclc represents a clinically distinct and potentially curable disease. collen. also reported on a phase ii prospective study of sbrt to primary tumor and metastatic locations in oligometastatic nsclc. sbrt could be delivered after induction chemotherapy, but after radiation no further treatment was given until progression. with 26 patients enrolled and 16.4 months of median follow - up time, a total of 87 sites were irradiated, including 48 metastases. with 30% showing complete metabolic response and 30% showing partial response rate, the median os was 23 months, with 67% of patients alive at 1 year. recently, an individual patient data meta - analysis on oligometastatic lung cancer patients showed that factors predictive of os were : synchronous versus metachronous metastases (p 3 cm (p < 0.02). the median pfs was 14 months, with a pfs rate of 56% and 40% at 1 and 2 years, respectively. table 2 summarizes the results of the studies investigating the use of sbrt for crc oligometastases. as for other oligometastatic scenarios, there is a lack of prospective controlled data comparing surgery or stereotactic radiotherapy versus observation or systemic therapy alone. the ongoing pulmicc trial (uk, clinicaltrials.gov identifier nct01106261) is an example of a feasibility study with the aim to determine whether it will be possible to recruit sufficient patients for a larger phase iii randomized trial powered to detect statistical differences in os between metastasectomy and active monitoring. this trial is completing patient recruitment, and will hopefully give us important information not only on clinical endpoints (os is the secondary endpoint), but also on which patients are routinely offered surgery. the orchestra trial (a randomized multicenter clinical trial for patients with multi - organ colorectal cancer metastases comparing the combination of chemotherapy and maximal tumor debulking versus chemotherapy alone, nct 01792934) will also hopefully provide useful clinical evidence. available data on metastasis - directed therapies for oligometastatic prostate cancer consists of small and heterogeneous studies, but a recent systematic review on the role of local therapies in patients with regional and/or distant recurrences after curative treatment helped in clarifying the possible role of local therapies (including sbrt) in this patient subset. as pointed out by the authors, interest in ablative metastasis - directed therapies for recurrent / metastatic prostate cancer emerged after the introduction of novel imaging modalities (for example choline positron emission tomography, pet) that increased the detection of oligometastic patients, potentially justifying a local approach either with or without systemic treatments. fifteen single - arm case series were identified with a total of 450 patients. in most of the patients (98%), oligometastatic recurrence was diagnosed through choline - pet co - registered with computed tomography scans. nodal, bone and visceral metastases were treated in 78%, 21% and 1% of the patients, respectively. patients were treated with either rt (66%) or lymph node dissection (34%). adjuvant androgen deprivation was used for 61% of patients. in the case of nodal metastases, overall, 51% of patients were progression free at 13 years after local therapies, with most of them receiving adjuvant treatment. for sbrt, grade 2 toxicity was observed in 8.5% of patients, and there was one case of grade 3 toxicity. for lymph node dissections, 11% and 12% of grade 2 and grade 3 complications, respectively, of the 15 studies, six used sbrt as a metastasis - directed therapy [6166 ]. casamassima. reported on a series of 25 patients with nodal metastases, with a median follow - up time of 24 months that pfs at 3 years was 17%. described the results of sbrt to bone metastases only in 40 patients, with a median follow - up of 14 months. the median pfs was not reached, and 75% of the patients were alive at 17.5 months. in the series by ahmed., 15 patients received sbrt for bone metastases, 1 for nodal metastasis and 1 for liver metastasic, with a median pfs of 12 months.. reported on a series of 34 oligorecurrent patients (including recurrent primary), with a median follow - up time of 16.9 months ; the median pfs was not reported (42.6% at 30 months). the first study, retrospective on 50 patients, reported a median time to distant recurrence of 15.6 months ; the latter prospective, again including 50 patients, reported this time as 57.6 months. median pfs was not reached (58.6% at 3 years) in the first study, and it was 19 months in the second. the median follow - up times were very similar (31 and 25 months, respectively). a recent multi - institutional analysis on oligometastatic treatment - nave patients was conducted with the aim of estimating the potential benefit of sbrt in terms of distant pfs, reducing the heterogeneity by pooling individual patient data from various studies. in total, the median distant pfs was 21 months, and no grade 3 or more toxicity occurred. given this result, the authors concluded that sbrt is safe and associated with a prolonged distant pfs. table 3 summarizes the results of the reported studies on the use of sbrt for oligometastatic / oligorecurrent prostate cancer. table 3.studies investigating the use of sbrt in oligometastatic prostate cancerstudypatientseligibility criteriastudy designsite of metastasestherapymedian follow - up (months)median pfs (months)median os (months)other therapy (percentage)casamassima. 25nodal recurrence onlyretrospective observationallymph nodessbrt29pfs rate at 3 years 17%os rate at 3 years 92%nrmuacevic. 40bone metastasesprospectivebonesbrt14nrnot reached (75% alive at 17.5 months)chemotherapy (20%), previous rt (20%), adt (47.5%)ahmed. 17<5 metastasesretrospective observationalbone, lymph nodes, liversbrt612nr (cancer - specific survival 100% at 12 months)jereczek - fossa. 34recurrent primary, node or metastaticretrospective observationalnodalsbrt16.9nr (30 months pfs 42.6%)nradt (55%)schick. 50synchronous or metachronous oligometastasesretrospective observationallymph nodes, bone, visceralsbrt313-year pfs (clinical) 58.6%nr (os at 3 years 92%)adt (100%)decaestecker. 50oligorecurrent metastatic, <3 lesionsprospective observationallymph nodes, bone, visceralsbrt2419nr (androgen deprivation free survival 25 months)adt (70%)ost. 119<3 metastases, treatment - naive, recurrentpooled analysis of individual patient datalymph nodes, bone, visceralsbrt3621nr (os at 5 years 88%)adt (50%)srs = stereotactic radiosurgery, sbrt = stereotactic body radiation therapy, pfs = progression - free survival, os = overall survival, adt = androgen deprivation therapy, na = not applicable, studies investigating the use of sbrt in oligometastatic prostate cancer srs = stereotactic radiosurgery, sbrt = stereotactic body radiation therapy, pfs = progression - free survival, os = overall survival, adt = androgen deprivation therapy, na = not applicable, nr = not reported. the interpretation of these results is complex due to the extreme heterogeneity of the reported series, and no conclusions can be drawn on the role of sbrt. what emerged is that sbrt is a safe, low - toxic treatment, in comparison with surgery, and its potential in delaying progression is high. again, as for other cancer subtypes, prospective studies are needed to validate this hypothesis. identifying patients who are most likely to benefit from metastasis - directed radiation therapy is probably the most significant challenge, as well as obtaining high quality prospective data on treatment efficacy. as the lcr achievable with either surgery or stereotactic radiotherapy has increased over time, with acceptable toxicity, it is important to select those patients who will have the maximal benefit. currently, oligometastatic patients are defined eligible for local therapies through the use of clinical variables extracted from retrospective series, such as the number of metastases, the disease - free interval, the tumor type, the control of the primary tumor, the possibility of using efficient systemic therapies (e.g. for oncogene - driven lung cancer) and the presence of specific biological features (for example estrogen - receptor positivity for breast cancer). most of these criteria are the same as those used to select patients for lung or liver surgery. intracranial involvement, traditionally considered a worse prognostic factor, may not be interpreted the same in the era of radiosurgery to multiple intracranial sites. however, these relatively simple clinical criteria appear insufficient for proper patient selection, being surrogates for the tumor 's biology. a study on resected pulmonary metastases and of the combination of primary and metastatic tumors has identified a microrna signature that may select patients whose disease is unlikely to progress rapidly. the same group showed that, when restricted to lung metastases, microrna signatures are able not only to classify patients as oligo versus polymetastatic but also to differentiate those patients with a low recurrence probability following surgical resection. these studies need a prospective validation, but represent a significant step forward in the identification of biomarkers in this setting. other researchers focused their attention on metabolic response after ablative therapy : one study showed that only 10% of patients with a partial response on first post - radiotherapy pet, and 29% of those in complete response, progressed during follow - up. in metastatic breast cancer, circulating tumor cells (ctcs) showed the potential to be a powerful predictive toll for response to systemic therapy. theoretically, ctcs might also be used as a powerful biomarker for both evaluating the presence of a true oligometastatic state and predicting outcome after ablative therapies. the eradication of previously detectable ctcs could indicate that the primary source of ctcs was the treated lesions and not occult sites reseeding. the need for prospective controlled studies has been already discussed for the various examined histologies ; currently, a significant number of clinical trials in different diseases are exploring the effect of sbrt in terms of better pfs, prolongation of the time interval all these efforts will be crucial for elucidating the exact role of sbrt in oligometastatic disease, and their result are awaited with great anticipation. sbrt appears a safe and efficient way to treat oligometastases from different primary tumors, with very high lcrs and low toxicity. due to the predominant nature of existing data, mainly retrospective, and the intrinsic heterogeneity and complexity of this population, there are still doubts about the wide application of sbrt in clinical practice. however, as for surgery, the encouraging results obtained so far have increased the use of sbrt worldwide. in specific subpopulations, we showed that there is a trend towards a significant improvement in pfs and os rates. ongoing and future trials are warranted to better establish its role, and important translational studies are ongoing and we hope will provide us with very helpful information about patient selection in the future. funding to pay the open access publication charges for this article was provided by the japan radiation research society and the japanese society for radiation oncology. | oligometastases from solid tumors are currently recognized as a distinct clinical entity, corresponding to an intermediate state between local and widespread disease. it has been suggested that local ablative therapies (including surgery, radiofrequency ablation and radiation therapy) play an important role in this setting, in combination or not with systemic therapies, particularly in delaying disease progression and hopefully in increasing the median survival time. stereotactic body radiation therapy (sbrt) rapidly emerged in recent years as one of the most effective and less toxic local treatment modalities for lung, liver, adrenal, brain and bone metastases. the aim of this review was to focus on its clinical role for oligometastatic disease in four major cancer subtypes : lung, breast, colorectal and prostate. on the basis of the available evidence, sbrt is able to provide high rates of local tumor control without significant toxicity. its global impact on survival is uncertain ; however, in specific subpopulations of oligometastatic patients there is a trend towards a significant improvement in progression - free and overall survival rates ; these important data might be used as a platform for clinical decision - making and establish the basis for the current and future prospective trials investigating its role with or without systemic treatments. |
the sacroiliac joint is a frequent source of pain in patients presenting with low back or buttock pain.113 in a recent study by sembrano and polly, 200 consecutive new patients were examined in a spine clinic with a chief complaint of low back pain and no prior history of spine, sacroiliac joint, or hip surgery.12 sixty - five percent of these patients were found to have pain attributed to the spine only, while 5% had pain attributed to the sacroiliac joint only, and 14.5% had pain attributed to both.12 the mainstay of therapy for disorders of the sacroiliac joint has been nonoperative treatment, including modification of activity, nonsteroidal anti - inflammatory drugs, physical therapy, sacroiliac joint injections, and radiofrequency ablation.6,13,14 the durability of these interventions is not well established. many different techniques have been described for fusion of the sacroiliac joint.15 to date, the clinical studies have primarily consisted of small case series using a variety of assessments of success.16 more recently, the oswestry disability index (odi) has been used to evaluate outcomes in patients with sacroiliac joint pain.17 this tool is well validated for patients with low back pain.18 because of the overlap between low back pain and sacroiliac joint pain, it makes intuitive sense to use it. with the use of a common outcome tool while this does not provide the same level of evidence as a randomized controlled trial, it does provide some potential insight into the effect of different treatments. the aim of this research was to compare the perioperative measures and patient - reported outcomes of two different surgical techniques for sacroiliac joint fusion. the first group was a cohort of patients who underwent arthrodesis using an open anterior ilioinguinal approach, local bone grafting, and anterior plating (open group). the second group underwent minimally invasive surgery (mis), comprising transgluteal, iliosacral fixation with triangular, porous coated titanium implants (mis group). the patients underwent either open or mis sacroiliac joint fusion by one of two spine surgeons. all patients had sacroiliac joint disruption / degenerative sacroiliitis confirmed by specific provocative physical examination tests, diagnostic / therapeutic fluoroscopic image - guided sacroiliac joint injections using a local anesthetic and steroid, and had failed nonoperative treatment.19 deidentified medical records for patients with a minimum of 1-year follow - up were reviewed and analyzed. a minimal clinically important difference (mcid) for the odi12 of 12.8 was applied to the differences between the preoperative and postoperative odi scores for both groups. the mcid is defined as the smallest change in a treatment outcome that a patient would identify as important and has been used previously in the treatment of lumbar spine disorders.20 the fisher s exact test was used to compare categorical measures, such as sex of patient and history of prior lumbar surgery. the shapiro whitney u test was used to compare measures such as patient age, surgical time, and odi scores between groups, and the wilcoxon signed - rank test was used to compare preoperative and postoperative odi scores within groups. all tests were performed using vassar stats.21 a hochberg correction for multiple comparisons was performed.22 the results are presented as percent for categorical variables, such as male and female, or median with range for continuous variables, such as age and odi scores. the sacroiliac joint was approached anteriorly through an ilioinguinal incision of approximately 20 cm in length. the iliacus was elevated from the iliac fossa with a subperiosteal dissection and a retractor placed inside the iliopectineal line of the pelvis. with retraction, electrocautery was used to expose the superior capsule of the sacroiliac joint. under headlamp illumination, the capsule was removed off the iliac and sacral portion of the sacroiliac joint with a 15 blade. the sacroiliac joint cartilage was resected using a series of curettes and rongeurs, removing all cartilage back to the posterior ligament and structures. all the bone graft was packed into the sacroiliac joint after predrilling both the sacral and the iliac side with multiple 2.5 mm drill holes. a three - hole 4.5 mm reconstruction plate was contoured and fixed with a fully threaded 6.5 mm cancellous screw on the sacral side and with two cortical screws on the iliac side (figure 1). the plate was inspected to make sure there was no soft tissue under it or stretched over it. the soft tissues were allowed to fall back in place and a 1/8 inch hemovac drain was placed into the iliac fossa. gelfoam (pfizer, inc, new york, new york, usa) was placed into the bone graft harvest site. the external oblique and transversalis fascia were repaired to the gluteal fascia with multiple figure - of - eight sutures and the wound closed in layers. postoperatively, a program of gradual return to weight - bearing and exercise was employed. this protocol consisted of toe - touch weight - bearing for 6 weeks, 4 weeks of pool therapy with progressive weight - bearing, and finally 8 weeks of land - based therapy focusing on core body strengthening. mis sacroiliac joint fusion using a series of triangular fusion implants (ifuse implant system ; si - bone inc., san jose, ca, usa) was performed in all cases by a single neurosurgeon in private practice. the patient was placed in the prone position on a radiolucent table to facilitate the use of intraoperative fluoroscopy. after general endotracheal anesthesia was administered, the patient was prepped in the normal sterile fashion. a 3 cm lateral incision was made into the buttock region and the gluteal fascia was bluntly dissected to reach the outer table of the ilium. a steinmann pin was passed through the ilium across the sacroiliac joint lateral to the neural foramen within the sacrum. after a soft tissue protector was passed over the pin, a hand drill was used to create a pathway and decorticate the bone. finally, a triangular broach was used to further decorticate the bone and prepare the pathway to receive the first implant. using a pin guidance system, the second implant was generally located above or immediately lateral to the s1 foramen, and the third between the s1 and s2 foramina (figure 2). the incision was then irrigated and the tissue layers were closed with vicryl and monocryl sutures (ethicon, inc, somerville, nj, usa). patients were instructed to ambulate with the assistance of a walker for the first 4 weeks, after which time toe - touch ambulation was recommended for a further 4 weeks. after 8 weeks of gradual return to full weight - bearing, the patients began 4 weeks of physical therapy. the sacroiliac joint was approached anteriorly through an ilioinguinal incision of approximately 20 cm in length. the skin and subcutaneous tissue were incised. with sharp dissection, the iliacus was elevated from the iliac fossa with a subperiosteal dissection and a retractor placed inside the iliopectineal line of the pelvis. with retraction, electrocautery was used to expose the superior capsule of the sacroiliac joint. under headlamp illumination, the capsule was removed off the iliac and sacral portion of the sacroiliac joint with a 15 blade. the sacroiliac joint cartilage was resected using a series of curettes and rongeurs, removing all cartilage back to the posterior ligament and structures. all the bone graft was packed into the sacroiliac joint after predrilling both the sacral and the iliac side with multiple 2.5 mm drill holes. a three - hole 4.5 mm reconstruction plate was contoured and fixed with a fully threaded 6.5 mm cancellous screw on the sacral side and with two cortical screws on the iliac side (figure 1). the plate was inspected to make sure there was no soft tissue under it or stretched over it. the soft tissues were allowed to fall back in place and a 1/8 inch hemovac drain was placed into the iliac fossa. gelfoam (pfizer, inc, new york, new york, usa) was placed into the bone graft harvest site. the external oblique and transversalis fascia were repaired to the gluteal fascia with multiple figure - of - eight sutures and the wound closed in layers. postoperatively, a program of gradual return to weight - bearing and exercise was employed. this protocol consisted of toe - touch weight - bearing for 6 weeks, 4 weeks of pool therapy with progressive weight - bearing, and finally 8 weeks of land - based therapy focusing on core body strengthening. mis sacroiliac joint fusion using a series of triangular fusion implants (ifuse implant system ; si - bone inc., san jose, ca, usa) was performed in all cases by a single neurosurgeon in private practice. the patient was placed in the prone position on a radiolucent table to facilitate the use of intraoperative fluoroscopy. after general endotracheal anesthesia was administered, the patient was prepped in the normal sterile fashion. a 3 cm lateral incision was made into the buttock region and the gluteal fascia a steinmann pin was passed through the ilium across the sacroiliac joint lateral to the neural foramen within the sacrum. after a soft tissue protector was passed over the pin, a hand drill was used to create a pathway and decorticate the bone. finally, a triangular broach was used to further decorticate the bone and prepare the pathway to receive the first implant. using a pin guidance system, the second implant was generally located above or immediately lateral to the s1 foramen, and the third between the s1 and s2 foramina (figure 2). the incision was then irrigated and the tissue layers were closed with vicryl and monocryl sutures (ethicon, inc, somerville, nj, usa). patients were instructed to ambulate with the assistance of a walker for the first 4 weeks, after which time toe - touch ambulation was recommended for a further 4 weeks. after 8 weeks of gradual return to full weight - bearing, the patients began 4 weeks of physical therapy. from 2006 to 2012, 49 consecutive patients from two institutions underwent either open or mis sacroiliac joint fusion. of these patients, ten were excluded due to incomplete records, resulting in 39 patients included in the analysis, ie, 22 in the open group and 17 in the mis group. there was a total of 12 statistical comparisons, and a hochberg22 correction for multiple comparisons was performed. this correction resulted in p - values 0.01 being significant. in the open group, there were 13 females and nine males with a median age of 51 (range 3 474) years, while the mis group had eleven females and six males with a median age of 66 (range 3982) years ; the mis patients were significantly older than the open group patients (table 1). of the 22 patients in the open group, eleven (50%) had a history of spine surgery, while 14 of 17 (82%) patients in the mis group had a history of spine surgery (table 1). the surgical time for the open group (median 128 [range 73180 ] minutes) was significantly longer than that for the mis group (median 27 [range 1872 ] minutes), and the length of hospital stay for the open group (median 3 [range 26 ] days) was significantly longer than that for the mis group (median 1 [range 12 ] days, table 1). odi scores were collected preoperatively and at a median of 15 (range 1118) months postoperatively in the mis group and at a median of 13 (range 1133) months postoperatively in the open group. the postoperative odi scores improved significantly compared with baseline scores in both groups, from a median of 64 (range 4478) to a median of 46 (range 1080) in the open group (table 2 and figure 3) and from a median of 53 (range 1484) to a median of 13 (range 030) in the mis group (table 2 and figure 4). in addition, the odi change in the mis group (median 4 2 [range 0 80 ]) was significantly greater than that in the open group (median 9 [range 8 to 56 ], table 2). finally, the percent change was significantly greater in the mis group (median 78% [range 0%100% ]) compared with the open group (median 6% [range 13% to 85% ], table 2). the scores were worse in four patients (18%), unchanged in three patients (14%), and improved in 15 patients (68%). in the mis group, odi scores were unchanged in one patient (6%) and improved in 16 patients (94%). ten patients in the open group (45%) reached the threshold of mcid and 14 patients (82%) reached the threshold of mcid in the mis group (table 3). there was no significant difference in preoperative odi scores between open group patients with prior lumbar surgery (median 68 [range, 4478 ]) and those without prior lumbar surgery (median 64 [range 4473 ], p>0.114). similarly, there was no significant difference in postoperative odi scores between open group patients with prior lumbar surgery (median 60 [range 1080 ]) and those without prior lumbar surgery (median 44 [range 1072 ], p>0.167). the sample size of the mis patients without prior lumbar surgery (n=3) was too small for analysis with the nonparametric mann postoperatively, three patients in the mis group experienced transient trochanteric bursitis and were treated with medical management, one patient developed a hematoma at the operative site, one patient had transient toe numbness of unclear relationship to sacroiliac joint fusion surgery, and one patient had a malpositioned implant that was subsequently removed. there were three complications in the open group, with one patient developing pulmonary embolism that resolved with treatment and two requiring revision due to a failed implant and nerve root irritation. odi scores were collected preoperatively and at a median of 15 (range 1118) months postoperatively in the mis group and at a median of 13 (range 1133) months postoperatively in the open group. the postoperative odi scores improved significantly compared with baseline scores in both groups, from a median of 64 (range 4478) to a median of 46 (range 1080) in the open group (table 2 and figure 3) and from a median of 53 (range 1484) to a median of 13 (range 030) in the mis group (table 2 and figure 4). in addition, the odi change in the mis group (median 4 2 [range 0 80 ]) was significantly greater than that in the open group (median 9 [range 8 to 56 ], table 2). finally, the percent change was significantly greater in the mis group (median 78% [range 0%100% ]) compared with the open group (median 6% [range 13% to 85% ], table 2). the scores were worse in four patients (18%), unchanged in three patients (14%), and improved in 15 patients (68%). in the mis group, odi scores were unchanged in one patient (6%) and improved in 16 patients (94%). ten patients in the open group (45%) reached the threshold of mcid and 14 patients (82%) reached the threshold of mcid in the mis group (table 3). there was no significant difference in preoperative odi scores between open group patients with prior lumbar surgery (median 68 [range, 4478 ]) and those without prior lumbar surgery (median 64 [range 4473 ], p>0.114). similarly, there was no significant difference in postoperative odi scores between open group patients with prior lumbar surgery (median 60 [range 1080 ]) and those without prior lumbar surgery (median 44 [range 1072 ], p>0.167). the sample size of the mis patients without prior lumbar surgery (n=3) was too small for analysis with the nonparametric mann postoperatively, three patients in the mis group experienced transient trochanteric bursitis and were treated with medical management, one patient developed a hematoma at the operative site, one patient had transient toe numbness of unclear relationship to sacroiliac joint fusion surgery, and one patient had a malpositioned implant that was subsequently removed. there were three complications in the open group, with one patient developing pulmonary embolism that resolved with treatment and two requiring revision due to a failed implant and nerve root irritation. in this study, both techniques resulted in significant clinical improvement for patients, consistent with several previously reported case series demonstrating improvement using various assessment tools.17,2327 the percentage of patients who reached the threshold for an mcid of 12.8 points2831 indicates that the change was not only statistically significant but also clinically significant. however, the mis group experienced over four times greater improvement in odi score (median 42 versus 9, respectively) and 82% of patients exceeded mcid values (versus 45% in the open group). in addition, the median percent difference in odi was significantly greater in the mis group than in the open group (median 78% versus 16%, respectively). finally, the surgical times and length of hospital stay were significantly reduced in the mis group. although the mis group demonstrated several advantages compared with the open group, this information is a little harder to interpret because there is heterogeneity between the two cohorts. for example, although not statistically significant, the open group was more disabled than the mis group at baseline, as indicated by the mean preoperative odi scores. it is possible that the mis technique gives slightly greater percentage improvement or it could be that patients who have greater initial disability have less improvement with surgical intervention. propensity - matched cohorts or a randomized controlled trial (rct) would be required to investigate this question further. the criteria for selection of these two cohorts are that there were preoperative and postoperative odi scores available for patients initially diagnosed with a sacroiliac joint disorder. the selection process for offering surgery to the patients was based upon the individual surgeon s experience. image - guided diagnostic / therapeutic sacroiliac blocks were used to confirm the sacroiliac joint as the generator of their pain. there was no prespecified threshold of relief that was used as a cutoff, although most agree that a minimum patient self - report of at least 50% pain relief for the duration of the local anesthetic is a minimum criterion. in addition, the patients were treated at two medical centers by two different surgeons, which may have contributed to the different effects of the treatments. there are many potential confounding variables in the treatment of patients with sacroiliac joint pain. frequently they have spine pathology that may have been treated surgically and the odi as used does not discriminate between sacroiliac joint - based low back / buttock pain and spine - based low back / buttock pain. while there is compelling evidence that there are radiographic changes within the sacroiliac joint after lumbosacral fusion, it is not well established that these radiographic findings have a high correlation with symptoms.32,33 similarly, it is not clear if patients with previous spine fusions respond to all sacroiliac joint fusion techniques in a manner similar to that of patients who have isolated sacroiliac joint pain. poorer outcomes were reported by slinkard who used an open anterior approach and mason using a hollow modular anchorage screw mis technique, while rudolf,26 cummings and capobianco,35 and sachs and capobianco36 reported similar outcomes for both patient groups after using the same triangular implant as that used in the present study. another limitation is that the odi is a patient self - report of pain and limitation.37 other studies in spine pathology suggest that a patient s psychological status affects their interpretation of pain.38 similarly, workers compensation is a well - recognized negative prognostic factor for patients with low back pain.39 presumably, this will be similar for patients with sacroiliac joint pain. emerging data and thought also suggest that socioeconomic status affects outcomes as well.40,41 these were not controlled for or compared in this cohort. further, the postoperative treatment protocol was not prespecified and varied between the two cohorts. even when the postoperative protocol is well specified, the authors experience is that patient compliance is variable. patients willingness to comply with toe - touch weight - bearing starts to decrease when they start to feel better. for example, preoperative and postoperative odi outcomes were available for two distinct surgical treatments used in sacroiliac joint disorders. the comparative nature of this study with its patient - reported outcomes reflects actual clinical practice at two different centers but with similar patient populations. lastly, this study provides some evidence that sacroiliac joint fusion can result in functional improvement, regardless of technique. of note, cases for the open si joint fusion group in this study is the same cohort from a recently published propensity matched study by ledonio but the cases for the mis group in this study are not.42 in the future, development of standard reporting of the nonoperative treatment strategy, diagnostic strategy, and standardized reporting of patient characteristics will improve the comparability of surgical cohorts. this will allow propensity - matching and provide better insight as to whether or not a particular surgical technique is better than another. in conclusion, both the open and mis sacroiliac joint fusion techniques resulted in statistically and clinically significant improvement for patients with sacroiliac joint pain refractory to nonoperative management who had a temporary response to image - guided diagnostic / therapeutic block. however, mis sacroiliac joint fusion resulted in at least four - fold improvement in odi scores over the open technique (median 44 versus 9, respectively). additionally, nearly 40% more patients in the mis group reached mcid, and the surgical times and hospital stays were significantly reduced. surgeons who treat sacroiliac disorders via their surgical technique of choice are encouraged to report their case series using the odi and attempt to characterize their patient cohorts as much as possible. | backgroundthe mainstay of sacroiliac joint disruption / degenerative sacroiliitis therapy has been nonoperative management. this nonoperative management often includes a regimen of physical therapy, chiropractic treatment, therapeutic injections, and possibly radiofrequency ablation at the discretion of the treating physician. when these clinical treatments fail, sacroiliac joint fusion has been recommended as the standard treatment. open and minimally invasive (mis) surgical techniques are typical procedures. this study aims to compare the perioperative measures and oswestry disability index (odi) outcomes associated with each of these techniques.methodsa comparative retrospective chart review of patients with sacroiliac joint fusion and a minimum of 1 year of follow - up was performed. perioperative measures and odi scores were compared using the fisher s exact test and two nonparametric tests, ie, the mann whitney u test and the wilcoxon signed - rank test. the results are presented as percent or median with range, as appropriate.resultsforty-nine patients from two institutions underwent sacroiliac joint fusion between 2006 and 2012. ten patients were excluded because of incomplete data, leaving 39 evaluable patients, of whom 22 underwent open and 17 underwent mis sacroiliac joint fusion. the mis group was significantly older (median age 66 [3982 ] years) than the open group (median age 51 [3474 ] years). surgical time and hospital stay were significantly shorter in the mis group than in the open group. preoperative odi was significantly greater in the open group (median 64 [4478 ]) than in the mis group (median 53 [1484 ]). postoperative improvement in odi was statistically significant within and between groups, with mis resulting in greater improvement.conclusionthe open and mis sacroiliac joint fusion techniques resulted in statistically and clinically significant improvement for patients with degenerative sacroiliitis refractory to nonoperative management. however, the number of patients reaching the minimal clinically important difference and those showing overall improvement were greater in the mis group. |
cystic fibrosis (cf) is a multifaceted autosomal recessive disease caused by mutations in the cf transmembrane conductance regulator (cftr) gene. although its pulmonary manifestations are responsible for the major morbidity and mortality associated with the disease, cf is also characterised by a multitude of clinical extrapulmonary manifestations. in addition, the great heterogeneity in disease severity among people with cf means that the design of therapeutic interventions is particularly challenging. micrornas (mirna) are a class of regulatory biomolecules with important functions in numerous biological processes and are aberrantly expressed in many human diseases. therefore, it is important to elucidate the roles of these molecules in cf pathophysiology. although the term microrna was first coined in 2001, the first mirna, lin-4, was discovered eight years earlier by lee and colleagues, in the nematode caenorhabditis elegans. having been initially discovered to play important roles in developmental biology, interest in these small rnas has dramatically increased since this time as they have been found to have significant roles in a range of other biological processes such as proliferation and apoptosis. the latest version of mirbase (http://www.mirbase.org/, v21), the most comprehensive microrna bioinformatics repository, contains entries from 223 species corresponding to over 35,000 micrornas. expression levels of mirnas vary greatly between cells and tissues, and aberrant levels of mirna are associated with many diseases in humans. as a rule, mammalian mirnas are initially transcribed in the nucleus into longer primary mirna (pri - mir) of up to 1000 nucleotides in length. these stem - loop structured pri - mirs are generally transcribed by rna polymerase ii and subsequently undergo cleavage in two sequential steps. the initial processing occurs in the nucleus by the rna endonuclease (rnase) type iii enzyme drosha with the involvement of other proteins, as part of the microprocessor complex. drosha cleaves the pri - mir liberating shorter hairpin pre - mirna structures (pre - mir), which are approximately 70100 nucleotides in length, and these are actively transported into the cytoplasm via a process involving the protein exportin 5. once in the cytoplasm, the pre - mir is further processed by the rnase iii enzyme dicer, resulting in a mature mirna duplex with 5 phosphate and two - nucleotide 3 overhangs. generally, micrornas regulate gene expression posttranscriptionally by binding in a sequence - specific manner to mirna responsive elements (mres), particularly in the 3 untranslated region (utr), of a target mrna. they are recruited by argonaute (ago) proteins, particularly ago2 to form the multiprotein rna induced silencing complex (risc) [8, 9 ]. mirnas can guide the risc to a target mrna which then induces cleavage degradation or translational repression of that mrna [10, 11 ]. although most mirna studies have largely focused on mirna - mrna interactions in the 3utr of target mrna, these interactions can also occur in the 5utr and coding sequence (cds) [12, 13 ]. as a single mirna can regulate many target mrnas and each mrna may harbour several mres, validation of targets can be difficult and time consuming however, many computational tools are currently available for predictions and these are continuously improving. these are the quality of seed match, evolutionary conservation of a particular microrna, thermodynamics (specifically free energy) of mirna::mrna target binding, and site accessibility or mrna secondary structure. various online tools aid in these predictions and some well - known examples include targetscan, pictar, diana - microt, microrna.org, rna22, and rnahybrid, which all utilise different algorithms and different sources of mrna sequences. yet, bioinformatic target prediction databases have high false positive and false negative rates, and experimental validation is ultimately required to truly determine mirna::target mrna binding and biological function. it has been proposed that the expression and function of micrornas themselves are regulated at three levels : transcription, processing, and subcellular localization. at the level of transcription, mirna expression can be controlled by many factors such as chromatin modifications, dna methylation, and activity of transcription factors to name a few. mirna processing can be affected by intrinsic or acquired alterations in the mirna microprocessor machinery, thereby controlling mirna function. these are termed mirna sponges, given their ability to soak up mirnas and reduce their interactions with target mrnas. additionally, single nucleotide polymorphisms (mirsnps) that affect mirna binding and function are being increasingly reported. analysis of multiple organs and tissues suggests that mirnas have dual roles as both regulators of development and in maintenance of homeostasis [9, 16, 17 ]. widespread changes in mirna expression have been observed during lung development, and dicer knockout mice, who have disrupted mirna processing, display a lethal phenotype as a result of impaired lung growth. various studies demonstrate that mirna expression remains relatively constant over time in the adult lung, supporting the notion that mirnas play a central role in maintenance of lung homeostasis in the developed lung. however, expression of mirna is altered in pathological states, such as lung inflammation and disease. mirnas have been shown to play important roles in the regulation of innate immunity and inflammation. at the most basic level, mirnas are important in haematopoiesis and differentiation of immune cells [20, 21 ]. numerous mirnas are induced in innate immune cells, with mirs-155, -146, and -21 being expressed at particularly high levels [22, 23 ]. with known roles in regulation of inflammation, mirnas are increasingly being examined within the context of inflammatory lung diseases such as cf. lining the airway epithelium in the cf lung is a depleted airway surface liquid layer (asl) and more mucus than normal. impaired mucociliary clearance promotes bacterial colonisation and generates a highly proinflammatory environment wherein innate immune responses are frequently activated. another characteristic of the cf airway lumen is the high numbers of infiltrating neutrophils which are inherently dysfunctional and contribute to the preexisting protease - antiprotease imbalance. accumulation of misfolded cftr may contribute to endoplasmic reticulum (er) stress responses in the airway epithelium, and collectively these features are central to the pathology and physiology of cf lung disease. numerous micrornas had altered expression between cf and non - cf bronchial epithelium ; the altered mirnas were predicted to regulate expression of proteins involved innate immunity, inflammation, ion conductance, and er stress, amongst others. these cells contribute to the barrier function via three essential components : intercellular tight and adherens junctions (regulating epithelial permeability), secreted antimicrobial factors, and the mucociliary escalator. furthermore, it acts as a key mediator of both innate and adaptive immune responses toward invading pathogens. toll - like receptors (tlrs) are a key group of pattern recognition receptors which mediate the recognition of and response to microbial infections and are highly expressed on myeloid cells. the expression of tlrs is, however, not confined to immune cells, and these receptors are also expressed at high levels on other cell types, including airway epithelial cells (aecs) such as tracheal, bronchial, and alveolar type ii cells. in the cf lung, tlrs expressed by aecs contribute to the airway immune response by regulating the expression and secretion of cytokines, chemokines, and antimicrobial peptides and through enhancing the expression of cell surface adhesion molecules. target of myb1 (tom1) is a tollip - binding protein recently shown to act as a negative regulator of tlr2, tlr4, and il-1 induced signalling pathways in cf bronchial epithelial cells. tom1 was predicted to be regulated by mir-126, a mirna that is significantly downregulated in cf bronchial brushings compared to controls. to validate this observation the coexpression of mir-126 and tom1 was evaluated in cf and non - cf bronchial epithelial samples and cell lines, and a reciprocal expression pattern was evident ; the effect of overexpression of mir-126 on tom1 gene and protein levels was examined in a cf bronchial epithelial cell line, and a mir-126::tom1 mrna interaction was functionally validated using a reporter system. this was the first report of altered mirna expression affecting innate immune responses in the cf lung and suggests that decreased mir-126 may engender a tlr hyporesponsive state which could be important at times of infective exacerbations where a rapid and robust response is required. in addition to the epithelium, bone marrow derived cells such as monocytes, macrophages, neutrophils, and dendritic cells are important in the cf lung. these are constantly recruited to the infected cf lung to clear pulmonary pathogens, but numerous studies have suggested an impairment of these cells in the context of the cf. it has been well established that the cf lung is dominated by a neutrophilic inflammation. although neutrophils are required for antimicrobial defense, their accumulation over periods of time and poorly controlled release of their toxic granular content can lead to parenchymal lung tissue damage [27, 28 ]. neutrophils from people with cf have been found to release more elastase and have defective phagocytic capacity and oxidative burst compared to controls. impaired bacterial killing by cf neutrophils has been shown to be a result of excessive protease cleavage of important molecules such as the il-8 chemokine receptor cxcr1 on neutrophils and also impaired cftr - dependent phagosomal chlorination. recent work has shown that neutrophils from people with cf have altered cytosolic ion concentrations resulting in impaired degranulation. monocytes originate from precursors in the bone marrow and circulate in the bloodstream, until they are attracted to infection or inflammatory signals in particular tissues, such as the lung, where they differentiate into macrophage or dendritic cell populations. the monocyte / macrophage lineage of myeloid cells has three primary roles in the immune response : phagocytosis, antigen presentation, and immunomodulation. in the lungs, monocytes primarily differentiate into alveolar macrophages. their numbers are increased in balf of young noninfected cf patients and similarly in cf mouse models [37, 38 ]. emerging evidences suggests that these cells are hyperresponsive in people with cf, when exposed to bacterial agonists [3941 ]. cf macrophages also appear to be defective in intracellular bacterial killing [4244 ] and efferocytosis (i.e., scavenging of apoptotic neutrophils) [4547 ]. hector and colleagues have examined mirna expression in cf myeloid cells (neutrophils and mononuclear cells) and found changes in specific mirnas including decreased mir-9 in cf neutrophils and increased mir-126 in cf mononuclear cells versus the same cells from healthy control cells (andreas hector, university of tuebingen, personal communication). functional studies will define if these changes in mirna expression impact on dysfunctional processes such as those described above. the cf lung is a high protease milieu and bacterial - derived proteases can contribute to this protease burden. for example, pseudomonas aeruginosa secretes the metalloproteases pseudomonas elastase (pse) and alkaline protease (apr), capable of cleaving a wide range of host proteins and of altering the physiology of the cf airways [4850 ]. high numbers of neutrophils contribute significantly to the abnormally high concentrations of neutrophil - derived proteases, for example, neutrophil elastase [5153 ], proteinase 3, and cathepsin g ; however a range of other endogenously expressed cysteine, metallo-, and aspartyl proteases generated by other cell types are also important. these include the cysteinyl protease cathepsin s which can be expressed by bronchial epithelial cells and antigen presenting cells such as macrophages and dendritic cells. weldon and colleagues have recently found that the expression and activity of cathepsin s is increased in the balf of children with cf, including a cohort of ps. aeruginosa - negative preschool children, compared to non - cf children with recurrent infection, indicating that upregulation of cathepsin s may be cf - specific. interestingly, they illustrated that this is due, in part, to decreased mir-31 which they have shown regulates the transcription factor interferon regulatory factor 1 (irf-1), which controls cathepsin s expression. levels of mir-31 were lower in cf versus non - cf cell lines, primary bronchial epithelial cells, and bronchial brushings. other studies have looked at alternative roles of mirna in other aspects of inflammation in cf. aeruginosa induces the production of proinflammatory cytokines such as il-8 in the cf airway epithelium. fabbri. found that mir-93 is decreased in cf bronchial epithelial ib3 - 1 cells during infection with this cf pathogen. they also demonstrated that the decrease in mir-93 expression is correlated with an increase in il-8 levels and that mir-93 directly targeted il-8 mrna. the cftr gene encodes a membrane bound ion transport protein that belongs to the atp - binding cassette (abc) superfamily of transporter proteins. the gene, containing 27 exons, was mapped by positional cloning in 1985 to the long arm of chromosome 7 (7q31). its protein product, which is 1480 amino acids in length, primarily functions as an ion channel that, in concert with the ca - activated cl channel (cacc), works to secrete cl and fluid required to hydrate the airway mucus but has the additional ability to transport bicarbonate and glutathione. although the mechanism is still not fully understood, evidence is emerging for the role of cftr in regulating the epithelial na channel (enac) and the failure of mutated forms of cftr in restricting salt absorption through enac. therefore, in the cf airway, epithelial cftr dysfunction leads to airway surface liquid volume depletion due to an imbalance between cftr - mediated cl secretion and enac - mediated na absorption. indeed transgenic mice overexpressing the -subunit of enac develop a cf - like lung pathology and have been used as a model of cf lung disease. transcription can begin at different start sites depending on the tissue or developmental stage in question. for example, cftr is positively regulated by a selection of transcription factors including c / ebp proteins and foxa factors, amongst others ; cftr is also posttranscriptionally regulated by mirnas. a number of studies have examined the role of micrornas in the control of cftr expression and various micrornas were demonstrated to regulate cftr [6775 ]. although different experimental situations were examined, such as different cell lines and response to cigarette smoke, mir-101, mir-145, mir-494, and mir-509 - 3p have been repeatedly implicated in many of these studies, strongly highlighting their roles in regulating cftr expression. for example, oglesby and colleagues demonstrated that mir-145, mir-223 and mir-494 were upregulated in cf bronchial brushings and cell lines, inversely correlated with cftr levels, and were shown to directly target cftr mrna. ramachandran. showed that mir-494 and mir-509 - 3p are increased in cf primary airway epithelial cells, regulate cftr, and are regulated by nf-b. in the most recent study, viart. identified mirnas that participate in cftr downregulation in the lung after birth. having compared the mirna expression profiles of adult and foetal lungs, three mirnas in particular (mir-145, mir-150, and mir-451) were found to have a temporal effect, being significantly upregulated in the adult lung and therefore contributing to downregulation of cftr. they also demonstrated how inhibitors based on these mirnas can affect cftr gene expression and function in air - liquid interface culture and suggest that these may be developed as tools for cftr correction in people with cf. the er is the site of protein translation, folding, and processing for transport to secretory vesicles. misfolded variants of cftr, for example, the class ii p.phe508del-cftr protein, accumulate in the er and fail to reach the apical surface of epithelial cells to function as anion channels. er perturbation can lead to er stress and the initiation of signalling networks aimed at restoring er equilibrium. recent evidence has implicated mirnas in regulation of the upr, in contexts other than cf [7780 ]. however one recent study has examined whether altered mirna expression regulates expression of upr genes in cf airway epithelium. activating transcription factor 6 (atf6) is an er resident transcription factor and a key component of the upr. its activation leads to transcriptional induction of atf6-regulated genes which function primarily to restore correct protein folding in the er. the role of mirna in basal regulation of atf6 was investigated in cf and non - cf bronchial epithelial cells in vitro and in vivo. three of these, mir-145, mir-221, and mir-494, were upregulated in a p.phe508del-cftr versus non - cf bronchial epithelial cell line and also in p.phe508del-cftr versus non - cf bronchial brushings. after experimentally validating atf6 as a molecular target of these mirnas through the use of a luciferase reporter vector containing the full length 3utr of atf6, the human studies were complemented by analysing the expression of key mirnas in a mouse model of cf lung disease. expression of mir-221, which is also predicted to regulate murine atf6, was significantly increased in native airway tissues of enac - overexpressing transgenic mice with cf - like lung disease versus wild type littermates, demonstrating structural and functional conservation between humans and mice. these findings implicate enac - overexpressing transgenic mice as a useful animal model for studies manipulating mir-221 levels in vivo using mirna overexpression strategies to limit er stress - mediated inflammation. in this review, we have discussed current data regarding mirna studies in cystic fibrosis. what is clear is that mirna dysregulation exists in cf, with many studies highlighting an altered mirna expression profile in the cf lung, be it in cell lines, primary cell cultures, or bronchial brush samples. some of these aberrantly expressed mirnas have been demonstrated to be involved in the regulation of key components of inflammatory signalling and, more recently, the upr. although this is an emerging field, some work is beginning to be carried out with respect to the development of strategies to ultimately modulate mirna levels in vivo in the cf lung, through the use of mirna mimics and inhibitors. finally, the potential of mirna as biomarkers of cf disease progression remains underexplored in comparison to other diseases such as cancers. the expression of these may become particularly useful for predicting and determining cf lung disease in infants and children, where currently used surrogate markers and biomarkers are of little use. | the cystic fibrosis lung is a complex milieu comprising multiple factors that coordinate its physiology. micrornas are regulatory factors involved in most biological processes and it is becoming increasingly clear that they play a key role in the development and manifestations of cf lung disease. these small noncoding rnas act posttranscriptionally to inhibit protein production. their involvement in the pathogenesis of cf lung disease stems from the fact that their expression is altered in vivo in the cf lung due to intrinsic and extrinsic factors ; to date defective chloride ion conductance, endoplasmic reticulum stress, inflammation, and infection have been implicated in altering endogenous mirna expression in this setting. here, the current state - of - the - art and biological consequences of altered microrna expression in cystic fibrosis are reviewed. |
, females can gain direct benefits (arnqvist and nilsson 2000), such as replenishment of depleted sperm stores, access to male - held resources, food and chemical gifts (vahed 1998). females that have already mated may trade - up by mating with or selectively using sperm from successively more genetically beneficial males as they encounter them in the environment. females may choose mates that provide their mutual offspring with superior genes or females may seek combinations of maternal and paternal genes to avoid genetic incompatibility or increase offspring heterozygosity (yasui 1998 ; jennions and petrie 2000 ; mays and hill 2004). if male fertilization success is correlated with offspring viability, females that mate multiple times and allow sperm competition to determine offspring paternity will have more viable offspring than females that mate with a single male sivinski (1984). alternatively, by genetic bet - hedging, a female that mates multiple times may potentially improve her fitness by creating genetically diverse offspring that can survive unpredictable environmental conditions in the future (jennions and petrie 2000). however, mating with multiple partners can also be costly for females (sakaluk 1990), thus it is expected that females mate only as often as needed to maximize fitness. field cricket females can mate large numbers of times. based on molecular analysis of wild caught female gryllus bimaculatus, females may mate as many as seven times (bretman and tregenza 2005), and based on an enclosure study, female gryllodes sigillatus may mate as many times as 15 times in a lifetime (sakaluk. however, the effects of large numbers of matings on female lifetime reproductive success are generally overlooked (arnqvist and nilsson 2000). in past studies of gryllus vocalis, females that mated many times gained diminishing direct benefits from doing so : females gained fecundity and fertility benefits from mating up to ten times, but failed to gain additional benefits from more matings (gershman 2007a). however, the consequences of g. vocalis females mating multiply with different partners rather than repeatedly with the same male have not been explored. in this paper, i examine whether females are willing to mate more times than maximizes their direct benefits because these large numbers of matings provide genetic benefits. one experimental approach used to separate direct from indirect benefits is to control the number of times that females mate, but vary the number of mating partners. this approach holds constant the effect of the direct benefits that females receive from mating, but varies the genetic contributions of partners. if females gain genetic benefits, females mating with multiple partners should have increased offspring viability as compared to females mated with a single partner (sivinski 1984). past studies in which female crickets were paired repeatedly with the same partner versus multiply with different partners show that females that mate with more partners have more offspring that successfully hatch (tregenza and wedell 1998 ; simmons 2001 ; fedorka and mosseau 2002) and/or higher offspring survival to adulthood (ivy and sakaluk 2005 ; fedorka and mosseau 2002). however, these studies examine only the consequences of mating relatively few times, and the effects of large numbers of matings on genetic benefits are not known. in this study, to determine whether the indirect benefits of multiple mating decrease as females mate more times, females were assigned to mate five, ten or 15 times either repeatedly with the same male, or multiply with different males. if females receive diminishing genetic benefits from mating with increasing numbers of different males, i predict an effect of partner identity (repeated mate versus different mates) on offspring hatchling success, as well as an interaction between the effect of numbers of matings and partner identity on hatching success. vocal field crickets, gryllus vocalis (weissman. 1980), were collected from the botanic gardens at the university of california, riverside. the lab colony was initiated with 50 adult males and 50 adult female crickets in spring 2002, and supplemented each subsequent spring with 30100 additional field - caught adults. because of the large numbers of breeding individuals in the colony as well as the frequent supplementation with field - caught individuals (including potentially mated females) the colony has continuously held a high degree of genetic diversity. crickets were maintained in a growth chamber under simulated summer conditions : 28c with a daily cycle of 14 h light to 10 h dark. animals were given access to moistened cotton for water and oviposition, and maintained on a diet of rabbit chow provided ad libitum. the basic experimental design was a 3 2 factorial, with females allowed to mate at one of three levels : five, ten or 15 times, and either mated repeatedly with the same male or multiply with different males. the numbers of matings were chosen based on a previous experiment, in which female gryllus vocalis were found to mate on average 15 times out of 28 opportunities (gershman 2007b). high mating treatment, because 15 matings is a large number of matings that could reasonably be completed by at least half of the females assigned to this treatment. females from the five, ten, and 15 mating treatment groups were given 7 days, 14 days and 21 days, respectively, to complete their matings, or they were dropped from the study. this was done to control for the possibility that individual variation in female propensity to mate was associated with other measures of condition such as fecundity or overall health. thus, females would be equally likely to be dropped from the experiment due to failure to mate their assigned number of matings at all levels of numbers of matings. females from all treatment groups that died before 21 days were eliminated from the study to prevent females from being differentially eliminated from the treatment groups with more matings. three hundred and sixty virgin females were daily given the opportunity to mate with a new male, starting at 5 days after adult eclosion. mating trials took place at the start of the dark cycle (simulated night) under low light conditions. females were housed individually in transparent 0.2 l cups with constant access to food (rabbit chow) and moist cheesecloth for water and oviposition. for 1 h a day, females were placed with novel males in a clean 0.2 l cup. matings were counted as successful if the copulation resulted in a spermatophore being attached to the female s genital opening. females in the five, ten and 15 mating treatment groups were assigned to mate with either the same male repeatedly or with novel males for each encounter. in the multiple male treatment groups, males were given a mating opportunity once per night, rotating though the five, ten and 15 mating treatment groups. males in the multiple mate treatments were used for 3 weeks and then retired. thus males used with the same partner and males used with different females were on average the same age, and were of similar sexual experience. more females were assigned to the repeated male treatments than the multiple male treatments to compensate for mating pairs dropped from the study due to problems with males, such as male unwillingness to mate or male premature death. two hundred and fifteen females were assigned to the repeated male treatments, and 145 assigned to mate with multiple males. females were provided with moist cheesecloth for oviposition, which was collected every other day until the natural death of the female, and incubated at 28c. at 28c, gryllus vocalis eggs generally take 1015 days to hatch and embryos that failed to hatch before 15 days died without hatching (personal obs.). after 15 days of incubation, eggs and hatchlings were frozen and counted. if eggs had hatched or contained eyespots or visibly segmented embryos, they were counted as fertile. eggs that were either unfertilized or failed to develop to the eyespot stage were counted as not fertile. it was not possible to visually distinguish unfertilized eggs from fertilized eggs that ceased to develop at the earliest stages, so this measure of fertility is a conservative estimate. date of natural death for each female was noted. in analysis of the effects of experimental treatments, only females who had survived at least 21 days (the maximum length of time of the longest treatment group) were included. for the time following completion of experimental treatments until 21 days, females were transferred daily to a clean cup for 1 h to simulate the handling stress and deprivation of food, water, and oviposition sites experienced by the females that were still receiving mating opportunities. gryllus vocalis females can have long or short hindwings, and wing length affects fecundity in other orthopteran species (zera and denno 1997). wing morph was recorded for each female. because larger females can lay more eggs, body size of each female although body size and wing morph were included in a preliminary mancova, neither contributed significantly to the model, and were dropped from subsequent analyses. fecundity was calculated as the total number of eggs that a female produced in her lifetime. fertility was calculated as the proportion of fertilized eggs out of the total number of eggs laid per female. fertility was measured to evaluate whether mating with multiple males provides females with sperm replenishment benefits. hatchability was calculated as the proportion of hatched eggs per female out of the total number of fertilized eggs per female. hatchability was included to assess pre - hatching offspring mortality and determine whether polyandry gives offspring viability benefits. three hundred and sixty virgin females were randomly assigned to the six mating treatment groups (five, ten and 15 matings with the same male ; five, ten and 15 matings with different males : n = 70, 72, 71 ; 49, 50, 48). ninety females were eliminated because they failed to mate the assigned number of times within the limited period of time allotted (n = 18, 19, 13 ; 14, 13, 12). fifty - one females were dropped from the study because although they completed their assigned number of matings, they died before 21 days (the duration of the longest mating trials) was completed (n = 10, 9, 9 ; 8, 7, 9). thirty - three females from the repeated mating group were dropped because their assigned mate died before the females had mated their assigned number of times. one hundred and seventy - five females were included in this analysis. as a proportion, fecundity, fertility, hatchability and survival were standardized to correct for differences in scale among the three dependent variables. outliers exceeding 1.5 times the interquartile range from the quartiles and outliers exceeding 3 mahalanobis distances were removed. with these corrections, the data conformed to the assumptions of normality, independence and equality of variance, and lack of multicollinearity among dependent variables. multivariate analysis of variance was performed to determine the effect of numbers of matings and mate (same versus different male) on four dependent variables : fecundity (total number of eggs laid), fertility (proportion of fertilized eggs per female out of the total number of eggs laid per female), hatchability (proportion of hatched eggs per female out of the total number of fertilized eggs per female) and survival (female post - experimental survival in days). multivariate analysis of variance and factorial analysis of variance were performed using spss 11, and jmp 5.1.1 software. number of matings had an effect on the manova combined dependent variable of fecundity, fertility, hatchability and survival (wilks lambda f8, 332 = 3.107 p = 0.002). females that mated more times laid more eggs (table 1, fig. females that mated more times also had increased fertility (table 1, fig. the number of times that females mated did not have an effect on either the proportion of eggs hatching out of the number of fertilized eggs (table 1, fig. 1c), or female post - experimental survival (table 1, fig.. table 1analysis of variance for the effect of number of matings (five, ten or 15 matings), mate (mating with the same male or with different males) and the interaction between number of matings and mate on female g. vocalis fecundity (number of eggs laid), fertility (proportion of laid eggs that were fertilized), hatchability (proportion of fertilized eggs that hatched) and post - experimental survivalfecundityfertilityhatchabilitysurvivalnumber of matings (5, 10, 15)df2,1822,1812,1812,185f10.528.320.4070.0484p0.0014 0.0044 0.5240.826mate (same male or different males)df2,1822,1812,1812,185f4.111.140.0720.135p0.0440.2870.7890.714number of matings matedf3,1823,1813,1813,185f0.07470.01220.0250.101p0.7850.5650.3760.751p - values indicated by asterisks are statistically significant with a sequential bonferroni correction for multiple comparisonsfig. 1means and standard errors for a the total number of eggs laid per females, b the proportion of eggs laid that were fertilized, c the proportion of fertilized eggs that hatched, and d female post - experimental survival. females mated five, ten or 15 times either repeatedly with the same male repeatedly (open circles) or with different males (dark circles). comparisons between numbers of matings (pooling females that mated repeatedly with the same male and different males) were conducted using student - newman - keuls tests to control for multiple comparisons. analysis of variance for the effect of number of matings (five, ten or 15 matings), mate (mating with the same male or with different males) and the interaction between number of matings and mate on female g. vocalis fecundity (number of eggs laid), fertility (proportion of laid eggs that were fertilized), hatchability (proportion of fertilized eggs that hatched) and post - experimental survival p - values indicated by asterisks are statistically significant with a sequential bonferroni correction for multiple comparisons means and standard errors for a the total number of eggs laid per females, b the proportion of eggs laid that were fertilized, c the proportion of fertilized eggs that hatched, and d female post - experimental survival. females mated five, ten or 15 times either repeatedly with the same male repeatedly (open circles) or with different males (dark circles). comparisons between numbers of matings (pooling females that mated repeatedly with the same male and different males) were conducted using student - newman - keuls tests to control for multiple comparisons. snk values of p 0.05 are indicated by the same letter. whether females mated repeatedly with the same partner versus multiply with different partners did not have a combined effect on fecundity, fertility, hatchability and survival (wilks lambda f4,166 = 1.15 p = 0.335). on average, females that mated with different partners laid more eggs than females that mated repeatedly with the same partner, but this effect was not statistically significant with correction for multiple comparisons (table 1, fig. the interaction between mate (repeated versus multiple) and number of matings did not have an effect on fecundity, fertility, hatchability and survival (wilks lambda f8, 332 = 0.537 p = 0.828) (table 1). in this study, female crickets gained direct benefits from mating large numbers of times. females that mated more times laid more eggs, but only up to a point at which additional matings did not yield additional fecundity benefits. in field crickets, male ejaculate contains not only sperm but also prostaglandin precursors (as well as other substances) that stimulate oviposition in females (loher and dambach 1989). these oviposition - stimulating substances could potentially be considered a nuptial gift that delivers a direct benefit for females. however, the results of this, and previous studies (gershman 2007a) indicate that females appear to be willing to mate more times than is necessary to maximize their reproductive success. whether this behavior constitutes conflict between the sexes over females present versus future allocation of reproductive effort or a confluence of interests between males and females in maximizing fecundity begs further examination. this effect supports the hypothesis that females may benefit from mating multiple times if their sperm stores become depleted or inviable over time, requiring replacement. the proportion of fertilized eggs that females laid continued to increase with large numbers of matings, suggesting that even large numbers of matings provide additional sperm replenishment benefits for females. this result runs contrary to the traditional expectation that because females could receive a lifetime s supply of sperm in a single mating, additional matings are unnecessary for sperm supply. further, the saturation point for female benefits of numbers of eggs laid is not found with sperm replenishment. presumably there exists a point beyond the range of numbers of matings used in this study where the benefits of sperm replenishment also diminish as female fertility is limited by factors other than sperm depletion or inviability. females that mated with different males had a tendency to lay more eggs than females that mated repeatedly with the same male. although the result was not statistically significant in this paper, it has been corroborated by additional research (gershman 2008a) in which females paired with familiar partners removed male sperm packets faster than females paired with novel partners. if females differentially remove sperm packets when paired with repeated or different partners, selective sperm packet removal likely affects the amount of oviposition - stimulating chemicals transferred from males during copulation, and consequently the numbers of eggs that females lay. if females mating repeatedly with the same partners remove their sperm packets more rapidly, females would likely receive less oviposition - stimulant and consequently lay fewer eggs (gershman 2008a). mating with different males rather than mating repeatedly with the same male did not increase hatchability, the proportion of fertilized eggs that hatch. this result is inconsistent with the results of many published studies in crickets and other taxa in which the offspring of females that mated with multiple partners had a higher viability than the offspring of repeated partners (simmons 2005 ; jennions and petrie 2000). however, in taxa as diverse as birds, lemon sharks, grasshoppers and field crickets, mating with more than one male failed to increase offspring viability (caesar and forsman 2009 ; dibattista. (2008) found that although increasing mating frequency reduced female longevity and fecundity, females that mated at a higher frequency produced daughters with higher lifetime reproductive success (priest. thus the effects of polyandry may manifest themselves in later stages of offspring development. alternatively, it is possible that mating with more males confers genetic benefits for females, but this effect was not revealed by the experimental design used in this study. if females that have mated with five males have already received the maximum hatchability benefits, they would not gain additional hatchability benefits from mating more than five times. this result rules out a possible motivation for females to mate large numbers of times. in addition, in this study females were provisioned with ad libitum food and water. a previous study on gryllus vocalis demonstrated that diet can mediate the effect of multiple mating on female fecundity (gershman 2008b) such that females fed on a low quality diet do not gain fecundity benefits from mating more times. it is possible that diet may also mediate the effect of mating with multiple partners on indirect benefits. if females on a reduced quality diet provision fewer resources to each egg, heterogeneous offspring may be more beneficial than when females are able to provide more provisioning to eggs. previous results indicated that females fail to receive additional direct benefits from mating large numbers of times. further, the results from this paper demonstrate that females also do not gain substantial benefits in hatching success from mating large numbers of times. it is likely that under more hazardous field conditions, environmental influences would set an upper limit to female mating rate. however, although females may be willing to mate more than ten times under laboratory conditions, there are neither substantial costs nor benefits to this behavior. | female crickets can potentially gain both direct and indirect benefits from mating multiple times with different males. most studies have only examined the effects of small numbers of matings, although female crickets are capable of mating many times. the goal of this paper is to examine the direct and indirect benefits of mating large numbers of times for female reproductive success. in a previous experiment, female gryllus vocalis were found to gain diminishing direct benefits from mating large numbers of times. in this study i attempt to determine whether mating large numbers of times yields similar diminishing returns on female indirect benefits. virgin female gryllus vocalis crickets were assigned to mate five, ten or 15 times with either the same or different males. females that mated more times gained direct benefits in terms of laying more eggs and more fertilized eggs. females that mated with different males rather than mating repeatedly with the same male did not have higher offspring hatching success, a result that is contrary to other published results comparing female reproductive success with repeated versus different partners. these results suggest that females that mate large numbers of times fail to gain additional genetic benefits from doing so. |
the wide varieties of rare intraocular and orbital neoplasms differ in presentation in the pediatric population when compared to these same lesions in adults. while most pediatric ophthalmic tumors are benign, they may have a significant impact on vision and may result in significant morbidity and mortality. some congenital tumors may present in the first year of life, while others typically present later in childhood. clinical examination signs that should raise concern include leukocoria (white pupil), strabismus, restriction of ocular motility, asymmetric eye position within the orbit, decreased vision, high pressure in the eye, inflammation of the eyelids or conjunctiva, pseudohypopyon (inferior whitish layer in the anterior chamber of tumor cells), vitreous hemorrhage or inflammation, and an afferent pupillary defect. clinical presentation combined with the characteristic imaging features of the disease can narrow differential diagnoses. imaging modalities most often used to evaluate these lesions include orbital ultrasonography (us), computed tomography (ct), and most importantly magnetic resonance imaging (mri)., we review the epidemiology, clinical manifestations, current treatment modalities, and the imaging features that differentiate pediatric ocular and orbital lesions. the incidence of retinoblastoma is approximately one case per 1500020000 live births, which amounts to 9000 new cases each year. there is no gender or racial predilection, and 90% of cases are diagnosed in patients under three years of age. biallelic mutations of the rb1 tumor suppressor gene likely predispose retinal progenitor cells to tumor growth. in the heritable form, the first mutation is constitutional, and the second is somatic, which causes bilateral disease in the majority of patients. in the nonheritable form, both allelic mutations are somatic, limiting disease to one eye with delayed presentation compared to those with the heritable form. very rarely, the heritable form of retinoblastoma can develop from primitive neuroectodermal cells in the suprasellar and pineal regions with resultant tri / tetralateral disease. the most common initial sign of retinoblastoma is leukocoria, where the light emanating through the pupil is white light reflecting off the tumor instead of red light reflecting off the retina. other signs of retinoblastoma may include decreased vision, strabismus, redness, pain, high pressure in the eye, cellulitic - like periocular inflammation, pseudohypopyon, and proptosis in late disease. young children rarely complain of changes in their vision making nonvisual presenting signs of retinoblastoma more commonly observed. on fundoscopic exam, four patterns of growth can be seen. in the endophytic growth pattern, tumors are well visualized and extend from the deep retinal layer into the vitreous with vessels coursing into the mass. with exophytic growth, tumors extend from the retina outward into the subretinal space, with vessels coursing over the tumor. this growth pattern can be associated with retinal detachment, and total tumor extent may be underestimated. the third pattern is the most common, representing a mix of exophytic and endophytic growth. the fourth pattern, diffuse infiltrating retinoblastoma, accounts for 1 - 2% of retinoblastomas and usually arises from the anterior retina in older children. the resultant pseudohypopyon and floating vitreal tumor cells can be easily mistaken for uveitis or endophthalmitis and has thus been termed a masquerade disease. the absence of pain, conjunctival hyperemia, synechia (anatomic adhesions), cataract, and vitreous fibrosis suggests retinoblastoma rather than inflammation. diffuse retinoblastomas start anteriorly and may enter the anterior chamber and fill the vitreous cavity but usually do not extend to the optic nerve. the diagnosis of retinoblastoma is made noninvasively by exam under anesthesia with ophthalmoscopy, orbital ultrasound, and fluorescein angiography. lumbar puncture and bone marrow biopsies are only performed in patients at high risk for having extraocular disease. typically, neoplastic cells spread through the optic pathways via the optic nerve and can breach the pia to extend into the subarachnoid space. finally, hematogenous metastases can spread to the lungs, bones, brain, and other viscera. historically, retinoblastoma was grouped into categories based on the reese - ellsworth classification system (groups i v). the international intraocular retinoblastoma classification system (iirc) separates retinoblastomas into groups (a e) based on prognosis, which is related to the extent of intraocular disease at diagnosis (supplemental table 1 will be available online at http://dx.doi.org/10.1155/2013/975908). more recently, the international retinoblastoma staging system (irss), proposed by a consensus of clinicians to separate retinoblastomas into stages based on management approach, has become popular. based on the irss classification, stage 0 eyes can be treated conservatively. stage i eyes are enucleated with complete histologic resection, and stage ii eyes are enucleated with residual microscopic tumor. stage iii eyes have regional extension, including local lymph nodes, while stage iv patients have metastatic disease (hematogenous, cns, multiple lesions). the tumor, node, and metastasis (tnm) classification system is generally used for extension of retinoblastoma beyond the eye. the vast majority of nondiffuse type retinoblastomas appears nodular with calcifications, and presence of these calcifications distinguishes retinoblastoma from other intraocular lesions. ct evaluation of retinoblastoma (figure 1(a)) typically demonstrates a hyperattenuating mass in the posterior globe with calcifications. on ultrasound, retinoblastomas are irregular masses that are more echogenic than vitreous and contain shadowing calcifications. orbital ultrasound can detect calcifications in up to 95% of cases and can confirm the clinical diagnosis of retinoblastoma. conventional 1.5 t mr has not been considered as sensitive for detection of calcifications, but higher field - strength mr units and newer susceptibility - weighted sequences have increased its sensitivity. found that when mr, ophthalmoscopy, and ultrasound were combined, none of the calcifications detected on ct were missed. mr evaluation avoids the ionizing radiation of ct and is more sensitive for detection of extraocular extension of disease, perineural spread into the optic nerve (figure 1), and involvement of the subarachnoid space ; therefore, ct is no longer the preferred modality. mr is the study of choice for known retinoblastoma cases with clinical symptoms concerning for extraocular spread of disease and for followup evaluations. retinoblastoma (figure 2) follows signal intensity of gray matter with tumor hyperintense to vitreous on t1-weighted images (t1wi), hypointense compared to vitreous on t2-weighted images (t2wi), and enhances on postcontrast t1wi. the areas of enhancement also demonstrate high signal on diffusion - weighted images (dwi) and low signal on apparent diffusion coefficient (adc) maps, which likely corresponds to cellular, viable tumor. when contrast enhanced mr is performed, the minimal required sequences are as follows : t2wi through both orbits (2 mm or thinner) ; t2, precontrast t1 and postcontrast t1-weighted sequences through each diseased eye and optic nerve using axial and sagittal oblique planes (2 mm or thinner slices) ; and axial t2 and post - contrast t1-weighted sequences through the brain. techniques to improve signal - to - noise ratio include using surface coils on a 1.5 t magnet or multichannel head coils on a 3 t magnet. the 3d steady state free precession sequences also provide high spatial resolution (slice thickness less than or equal to 1 mm) to aid in the detection of small lesions. fat saturation technique on postcontrast t1wi can help separate normal orbital fat from abnormal enhancement. if there is evidence of subarachnoid spread of disease, a complete spinal survey should be added to determine extent of spread through the neuroaxis. radiologic imaging is less sensitive and specific for determining the diffuse infiltrative pattern of disease, but this may show an anterior plaque without a discrete mass or calcifications. ophthalmic imaging modalities, including ultrawide field photography, angiography, and spectral domain optic coherence tomography, aid in the diagnosis of this subtype of retinoblastoma. enhancement is uniform with diffuse retinal thickening ; however, micronodules may be visualized via us or mr with rare extension posteriorly through the choroid or into the optic nerve. other diseases that cause leukocoria can be differentiated from retinoblastoma based on imaging characteristics and clinical presentation. retinopathy of prematurity can be bilateral and rarely calcified ; however, a history of prematurity can be elicited, and the characteristic vascular patterns can be seen on exam. lastly, retinal astrocytic hamartomas can calcify but are well circumscribed, lack hemorrhage or necrosis, and are associated with other findings related to tuberous sclerosis (ts) or neurofibromatosis 1 (nf1). the treatment of retinoblastoma is complex and involves a multidisciplinary team, including pediatric oncologists, ophthalmologists, diagnostic and interventional radiologists, radiation oncologists, ocular pathologists, and geneticists. the available treatment options include enucleation (eye removal), chemoreduction, selective intraarterial and systemic chemotherapy, laser photocoagulation, focal cryotherapy, transpupillary thermotherapy, plaque brachytherapy, and external - beam radiation therapy (ebrt). enucleation is the treatment of choice for advanced retinoblastoma with no potential for visual salvage. historically, chemotherapy was reserved for extraocular or metastatic disease with adjuvant chemotherapy after enucleation. discovery that patients who underwent ebrt are at an increased risk of developing secondary malignancies led to a paradigm shift in retinoblastoma treatment. now, systemic chemotherapy is used for chemoreduction, followed by laser coagulation, thermochemotherapy, cryotherapy, transpupillary thermotherapy, or plaque radiotherapy for treatments that spare the eye. studies have shown that for retinoblastomas in reese - ellsworth groups i iii, systemic chemotherapy in combination with local ophthalmic therapies (cryotherapy, laser photocoagulation, thermotherapy, and plaque radiation therapy) can avoid the need for enucleation or ebrt [1113 ]. some trials have demonstrated that treatment of large tumors with systemic chemotherapy in conjunction with localized therapies may be preferable, as they can provide vision and globe salvage with some benefits over enucleation. toxicities from chemotherapy include cytopenias (89%), neutropenic fever (28%), infection (9%), gastrointestinal symptoms, dehydration, and vincristine neurotoxicity (40%). more aggressive therapy is needed for reese - ellsworth groups iv and v, as advanced cases with diffuse vitreous seeding are extremely difficult to treat. subconjunctival carboplatin and intravitreal carboplatin have been used in cases of diffuse vitreal seeding in reese - ellsworth group vb eyes without evidence of seeding at 37 month followup. this treatment also has improved disease control as has higher doses of carboplatin with etoposide or vincristine and combining vincristine, etoposide, and carboplatin. cancer stem cells, expression of drug efflux protein pumps, mutations in protein kinases that alter cisplatin metabolism, and overexpression of hla - g have been identified in enucleated retinoblastomas that have failed chemotherapy and ebrt [1517 ]. cryotherapy is effective for small (<3 mm apical thickness and < 10 mm basal dimension) peripheral tumors, and a triple freeze - thaw technique is used with a tumor control rate of up to 90%. multiple sessions of focal laser photocoagulation can be used alone for tumors less than four disc diameters. when the aforementioned local treatments fail, brachytherapy is ideal for small, discrete, and accessible tumors. in a large study, plaques with radioactive ruthenium 106 or iodine 125 proton beam radiation therapy, electron beam therapy, and intensity - modulated radiation therapy are modalities of ebrt used to reduce the dose of radiation used. typically, a total dose of 4045 gy is delivered over 2025 treatments over 4 - 5 weeks. the risk of secondary malignancies in retinoblastoma patients has been reported with some modalities of treatment, especially ebrt. infusion of selective intraarterial chemotherapy (siac) is currently the new trend in retinoblastoma treatment. siac has been used for the primary treatment of unilateral and bilateral retinoblastoma in iirc groups c and d with reported cures after one and two cycles of chemotherapy without major adverse events [18, 19 ]. in patients with advanced retinoblastoma (reese - ellsworth group 5a and b) that failed prior intravenous chemotherapy, siac with simultaneous carboplatin, topotecan, and melphalan has resulted in eye - sparing treatment in 75% of patients at 24 months followup. recurrence rates were 35%, necessitating adjuvant local treatment ; however, patients were all alive without evidence of metastatic disease in followup. several patients had a decrease in the electroretinogram amplitude with treatment, likely secondary to chemotherapy, but retinal hemorrhages and optic nerve pallor were not noted in 14 month followup [1820 ]. central and partial retinal artery occlusion and choroidal atrophy has been reported in patients, but no cerebral ischemic events have been reported in studies [21, 22 ]. it has recently been reported that siac exposes patients to a significant amount of radiation during each siac procedure, with one group measuring 191.73 mgy for the treated eye and 35.33 mgy for the fellow eye using a method that may have underestimated the total ocular radiation received. following a modified protocol for iac with shorter fluoroscopy times and no subtraction angiography, radiation exposure can be reduced to 5.55 mgy in the treated eye and 1.68 mgy in the fellow eye using the as low as reasonably achievable (alara) principle of radiation safety. the incidence of secondary cancers in patients who have received siac has not yet been reported, but this data should be followed and compared to the complications of ebrt. currently, siac is considered an attractive option for both primary and secondary treatment of unilateral and bilateral retinoblastomas. the future of ocular drug delivery now is focused on localized sustainable drug delivery directly in the eye. transscleral depot reservoirs, liposomes, and nanoparticles are being investigated in preclinical models and may play a role in the future of treatment for intraocular malignancies like retinoblastoma. these treatments are being studied extensively for other retinal diseases with possible future applications in intraocular tumor treatment. medulloepithelioma is a rare congenital neuroepithelial tumor that arises from the nonpigmented ciliary epithelium of the ciliary body. it is slow growing and characterized as teratoid or nonteratoid and malignant or benign, based on histologic appearance. population - based information on incidence is not available ; however, most cases are found within the first decade of life and rarely late in adulthood. this rare tumor is commonly misdiagnosed and treated as glaucoma and uveitis. despite its slow growth, medulloepitheliomas can cause multiple secondary complications including secondary neovascular glaucoma, lens notching and subluxation, and neoplastic cyclitic membranes. reported medulloepithelioma cases describe a rapidly expanding ciliary body mass that masqueraded as chronic uveitis, cataract, and uncontrolled secondary glaucoma. clinically, it may appear as an amelanotic or lightly pigmented cystic mass in the ciliary body with erosion into the anterior chamber and iris root. on slit lamp exam, medulloepitheliomas are irregularly shaped with smooth surfaces and gray - pink color with conjunctival injection, sentinel episcleral vessels, intense anterior uveitis with fibrinous reaction, iris deposits, corneal stromal haze, and ectropion uvea. if complicated by neovascular glaucoma, these patients may need aggressive surgical and medical management. small tumors may be hidden by the iris, and larger tumors appear smooth and gray to pink in color. imaging can assist with determining extent of disease, and presence of extraocular spread of tumor with all imaging modalities typically demonstrates a solid mass with multiple characteristic cystic collections. ultrasound biomicroscopy can be very useful in distinguishing anterior segment masses by providing high resolution images. on b - mode ultrasound ct typically demonstrates a solid mass arising from the ciliary body with high sensitivity for detection of dystrophic calcifications that can be seen in up to 30% of the teratoid medulloepitheliomas. large tumors with calcifications that can not be localized to the ciliary body may mimic a retinoblastoma in patients younger than 6 years of age. on mri, medulloepitheliomas demonstrate moderate hyperintense signal on t1wi, hypointensity on t2 images, and demonstrate moderate to marked enhancement (figure 3) [4, 10 ]. once the diagnosis is favored based on location, clinical appearance, imaging, staging, and size of the tumor are evaluated. nodal metastases in the neck can occur with a predilection for the lymph nodes in the parotid gland. for small tumors, local excision via iridocyclectomy in conjunction with radiotherapy has been done with varying success [25, 28 ]. these cases often relapse, requiring secondary enucleation for local tumor recurrence or ocular inflammation and discomfort. enucleation, however, is considered the standard therapy once the diagnosis has been made [24, 29 ]. if medulloepithelioma is metastatic or involving other areas of the brain, a combination of chemotherapy and brachytherapy is initiated. multiple modalities of brachytherapy have been reported, including hyperfractionated radiotherapy of the craniospinal axis followed by a boost to the tumor site and consolidating intrathecal brachytherapy using yttrium 90 tagged with dota0-d - phe1-tyr3-octreotide (dotatoc). though typically arising from the ciliary body, medulloepitheliomas have on rare occasion been reported arising from the optic nerve. the clinical presentation includes unilateral proptosis, swollen eyelids, restricted ocular movements, pain, and poor visual acuity. after initial treatment with surgical excision, these cases may also relapse in the orbit, necessitating enucleation and exenteration. retinal astrocytic hamartomas are glial tumors of the retinal nerve fiber layer that arise from retinal astrocytes. they are cream - white, elevated, well - circumscribed lesions that may be multiple or solitary. there are two types of retinal astrocytic hamartomas : small, smooth, and flat noncalcified tumors that appear to be thickening of the nerve fiber layer or mulberry lesions, which are nodular large yellow - white calcified lesions. they can be found incidentally on exam, often in conjunction with tuberous sclerosis (ts) and rarely neurofibromatosis. the incidence of tuberous sclerosis is approximately 1 in 10,000 persons, and about half of the people with ts have an astrocytic hamartoma. if detected, work - up for ts should be performed, especially in patients with characteristic skin lesions and a history of seizures or mental retardation. b - scan ultrasound, fluorescein angiography, and mr can all aid in making the diagnosis, but imaging is not routinely used for the detection or characterization of retinal astrocytic hamartomas, as clinical diagnosis is usually sufficient. spectral domain optical coherence tomography can be used by ophthalmologists to evaluate the extent of the tumor and evaluate for macular edema or subretinal fluid.. they can spontaneously resolve but may become symptomatic by enlarging leaking, generating macular edema, accumulating lipid exudates, and forming serous retinal detachments [31, 33 ]. additionally, elevated intraocular pressure and glaucoma have been reported in association with retinal astrocytic hamartomas. vitreous seeding is a complication associated with inflammation and hemorrhage, which is managed with vitrectomy. in some cases, spontaneous exudative hamartomas resolve after four weeks. if macular edema persists after 6 weeks ; however, treatment is indicated, as delayed resorption of subretinal fluid can cause permanent visual impairment especially in young children. argon laser photocoagulation has been reported to cause visual stabilization, but choroidal neovascularization is a reported complication. rhabdomyosarcoma of the orbit represents the most common orbital malignancy in childhood, accounting for 10% of all rhabdomyosarcoma cases with mean age of 68 years of age [35, 36 ]. children with the following rare inherited diseases li - fraumeni syndrome, beckwith - widemann syndrome, neurofibromatosis type 2, noonan syndrome, and multiple endocrine neoplasia type 2a syndrome have an increased risk of this tumor. rhabdomyosarcoma is a soft - tissue sarcoma with two major subtypes in the orbit : the more aggressive, less common alveolar type and the less aggressive, more common embryonal type (89%). orbital rhabdomyosarcoma presents as a rapidly growing, painless mass that leads to proptosis, most commonly in the superomedial quadrant of the orbit for embryonal type and inferiorly for the alveolar type. anterior tumor involvement can involve the levator palpebrae superioris and lead to eyelid edema, hemorrhage, pain, isolated blepharoptosis, and chemosis. the rapid growth and aggressive nature of the tumor frequently result in invasion of the adjacent bone and soft tissue ; however, local lymph node metastases and intracranial invasion are relatively uncommon [35, 36 ]. evaluation for metastatic disease may include imaging of the orbits and neck with ct / mri, ct of the chest, lumbar puncture, bone scan, bilateral bone marrow aspiration, and core biopsies of the iliac crests with primary diagnosis made through open biopsy of the primary tumor. staging currently combines tnm staging and the clinical grouping classification for rhabdomyosarcoma. on imaging, orbital ct and mri are both helpful in evaluating extent of disease and are often complimentary. orbital rhabdomyosarcoma appears isoattenuating to muscle on ct and is usually seen as a moderate to markedly enhancing extraconal, homogeneous, and well - circumscribed mass with calcifications only occurring with bony destruction (figures 4(a) and 4(b)). other common features include eyelid thickening and bone thinning / destruction, which can be seen in up to 40% of patients. in contrast to ct, mri provides excellent spatial resolution, superior soft - tissue contrast, and lacks radiation ; however, evaluation of the bones is not as sensitive as ct [36, 39 ]. on mr imaging, tumor is isointense to muscle on t1wi, hyperintense to muscle on t2wi, and demonstrates moderate to marked enhancement postcontrast. the mass can distort / displace the globe and extraocular muscles but rarely invades these structures. invasion intracranially or into the adjacent paranasal sinuses (figures 4(c), 4(d), and 4(e)) is best depicted on comparison of pre- and postcontrast t1wi. nuclear medicine bone scintigraphy is currently used as part of the work - up for children with rhabdomyosarcoma and is most accurate in detecting osteoblastic metastases. some studies have shown that pet - ct may be better at detecting bone and lymph node metastases than conventional anatomic imaging (ct, us) [4143 ]. additionally, two recent trials have compared whole body mri (wbmri) to conventional imaging and pet - ct for the evaluation of distant metastases in the pediatric population. studied 26 patients with metastatic small cell neoplasms including rhabdomyosarcoma and found wbmri to have a sensitivity of 97.5% and specificity of 99.4%, while pet - ct had a sensitivity of 90% and specificity of 100%. found wbmri to have a sensitivity of 96% in 24 patients with metastatic lymphoma or sarcoma with 190 lesions detected by mri compared to 155 by pet - ct. newer diffusion - weighted techniques have shown utility in improving the diagnostic accuracy of wbmri in patients with lymphoma, but this technique has not been applied to patients with rhabdomyosarcoma. whether pet - ct and wbmri should be used routinely in staging, or followup remains unclear without a large prospective clinical trial specifically aimed at rhabdomyosarcoma ; however, it can be considered in patients with increased risk of distant metastases. the treatment of orbital rhabdomyosarcoma has changed drastically over the last 20 years from primary orbital exenteration to a more conservative approach combining systemic chemotherapy and radiation. patients with a higher risk of relapse based on the intergroup rhabdomyosarcoma study groups iii and iv studies also receive cyclophosphamide. if complete surgical resection is confirmed by pathology, radiation can be withheld. more recent studies have shown that local control can be achieved with reduced dose radiotherapy (45 gy), with a cumulative incidence of local failure of only 14%. recurrence is developed in 17% of patients at a median time of 18 months with local relapse rate of 92% and distant metastases rate of 8%. radiation is very effective in preventing and controlling local recurrence ; however, overall survival was not affected by radiotherapy treatment. the sequelae of radiation treatment in orbital rhabdomyosarcoma patients include, in order of frequency, reduced visual acuity, cataract, ptosis, orbital hypoplasia, dry eye, painful eye, retinal damage, maxillary hypoplasia, and corneal ulcers. therefore, radiotherapy should be used sparingly and can be avoided in a subset of patients. neuroblastoma is the most frequent extracranial solid tumor of childhood and arises from neural crest cells. the prevalence based on the seer registry from 1973 to 2002 is 0.9 per 100,000 persons. the median age of diagnosis was one year, with 42% of patients presenting at less than one year of age. the mean age at diagnosis of patients with orbital neuroblastoma metastases is approximately two years of age. twenty percent of all cases have orbital involvement, which can be the primary manifestation of the tumor [5153 ]. the most common clinical presentation of orbital neuroblastoma metastases in patients less than two years old is unilateral or bilateral proptosis and periorbital or eyelid ecchymosis (raccoon eyes). less common clinical findings include periorbital swelling, hemorrhage, strabismus, restricted ocular motility, ptosis, atrophy of the optic head, and ocular mobility disturbance. opsoclonus, characterized by rapid, multidirectional saccadic eye movements, is a paraneoplastic syndrome that is associated with neuroblastoma but not necessarily orbital involvement. primary thoracic neuroblastoma involving the sympathetic chain may present with horner 's syndrome (small pupil and ptotic eyelid). like langerhans cell histiocytosis, orbital neuroblastoma metastases tend to occur in the posterolateral orbital wall with ct and mri providing better diagnostic information over ultrasound. on ct (figures 5(a) and 5(b)), metastases can appear as either circumscribed or ill defined, are increased in attenuation compared to muscle, can contain small calcifications, and can invade adjacent structures including intracranially. on mr, neuroblastoma metastases appear low signal on t1wi, heterogeneous on t2wi due to hemorrhage or necrosis, and heterogeneously enhance postcontrast. tumor extension intracranially and into the adjacent soft tissues may be seen to better advantage on mr over ct (figure 5(c)). when multiple metastatic lesions are suspected, radioiodinated metaiodobenzylguanidine (mibg) scintigraphy can be used for diagnosis, staging, and monitoring therapy with high sensitivity and specificity. more recently, pet / ct has been shown to successfully stage and monitor disease with improved spatial resolution, improved detection of smaller lesions, and has the ability to provide anatomic detail for surgical planning. treatment of metastatic neuroblastoma is stratified based on clinical features (age at presentation, staging) and specific tumor biological markers that include histopathological analyses, chromosomal abnormalities, and quantification of expression of the mycn oncogene. the prognosis of disseminated neuroblastoma is better in infants (80% 5-year survival) when compared to children above one year of age (45% 5-year survival). survival and outcomes have improved substantially over the last 30 years with multimodality modern therapy, including chemotherapy, radiation therapy, surgery, myeloablative therapy with stem cell transplant, immunotherapy, and differentiation therapy [46, 52 ]. in addition, tumor cell vaccination and immunotherapy treatments are being tested in phase i / ii clinical trials. optic pathway gliomas can involve any portion of the visual pathway, including the hypothalamus, optic disc, nerve, chiasm, geniculate nucleus, and optic radiations. categorized as juvenile pilocytic astrocytomas, they account for 46% of all brain tumors in children, and the median age of diagnosis is 59 years [5, 53, 54 ]. approximately half of all patients with optic pathway gliomas have neurofibromatosis (nf1), an autosomal dominant mutation. tumor incidence among patients with nf1 ranges from 30 to 58%, and symptomatic lesions only occur in 15% of patients. histology typically shows low - grade gliomas (who grade i - ii) ; however, individual tumors can display a wide spectrum of disease progression. the vast majority of optic pathway gliomas is slow growing and can go unrecognized clinically for a long time. patients typically present with decreased visual acuity, which may worsen with growth of the glioma within the optic pathway nerves. other signs include optic disc edema, pallor, atrophy, relative afferent pupillary defect, decreased color vision, pupil dysfunction, visual field defects, ocular motility problems, and proptosis. if the tumor arises within the hypothalamus, endocrinopathies such as accelerated growth and precocious puberty may manifest. the appearance of optic pathway gliomas on ct and mr is characteristic and specific for the disease process ; however, mr is more sensitive for detection of smaller lesions. additional features include widening of the optic canal, variable contrast enhancement, and rarely eccentric enlargement of the nerve and cystic degeneration. mr imaging evaluates the intracranial disease better than ct and avoids radiation. tumors typically demonstrate iso- to hypointense signal on t1wi, hyperintense signal on t2wi, and variable enhancement on postcontrast images. posterior extension of the tumor can be seen as increased signal on post - contrast images and t2wi / flair hyperintensity, which would influence treatment options. optic pathway gliomas can be differentiated from optic nerve meningiomas, as meningiomas are dark on t2wi, originate from the meninges, and avidly enhance on post - contrast images. advanced mr techniques including magnetic resonance diffusion tensor imaging (mrdti), diffusion - weighted imaging (dwi), and dynamic contrast enhancement (dce) have been employed to further evaluate optic pathway gliomas. an early study in 2008 used dw and dce imaging to calculate the diffusivity and permeability of optic pathway gliomas and found that clinically aggressive gliomas had significantly higher permeability than clinically stable gliomas and may warrant closer followup. a separate group found that mrdti may offer increased sensitivity over conventional imaging in identifying abnormalities in the optic pathways of patients with nf1 and may be able to quantitatively assess the extent of white matter disease. further long - term data will be needed to determine whether these newer techniques will prove clinically useful in the general population. some gliomas enter a stage of stable or slow growth, and some have even spontaneously improved. tumors confined to the optic nerve at presentation rarely extend into the chiasm or develop extradural extension or metastases. given the slow growing nature of most of these tumors, active surveillance can be a reasonable option. in patients with progressive disease, chemotherapy is the mainstay of treatment, usually with carboplatin and vincristine. radiation therapy with fractionated gamma knife radiosurgery can be used after chemotherapy failure and retards or reverses progress in many cases. however, long term - data does not suggest that this specifically reduces mortality or vision loss. radiation treatment also exposes the patient to the potential side effects of radiation treatment, including dry eye, neovascular glaucoma, cataract, retinopathy, and optic neuropathy. surgery is also a therapeutic option, especially in patients with aggressive disease and no vision in the affected eye. a combined transcranial and orbital approach for en bloc resection of optic nerve gliomas with preservation of the annulus of zinn has been described to be effective for debulking a proptotic blind eye. the five - year overall survival was 96% and 20% for patients with low- and high - grade optic nerve gliomas, and these findings correlated with the tumor grade and not with age at diagnosis, receipt of radiation therapy, or extent of surgical resection. plexiform neurofibroma (pnf) is a hamartoma of neuroectodermal origin representing 1 - 2% of all orbital tumors and typically arises in the first decade of life. the lesion can involve any peripheral nerve but usually involves sensory nerves in the orbit or eyelid and can cause widening of the superior orbital fissure as well as dysplasia of the greater sphenoid wing. eyelid pnfs have a characteristic s shape due to thickening, fat deposition, and horizontal redundancy. orbital involvement can cause globe proptosis, bony expansion, and sphenoid dysplasia that can lead to temporal lobe herniation and pulsatile exophthalmos [57, 58 ]. the lesions feel soft and have been described as feeling like a bag of worms. irritation of the upper palpebral conjunctiva rubbing against the lower lashes can cause significant discomfort. routine ophthalmologic examination is necessary, as pnfs can lead to amblyopia from occlusion, anisometropia, and strabismus. risk of malignant transformation to a sarcoma can be found in up to 710% of pnfs, and risk of ipsilateral glaucoma can be seen in up to 50% of patients with pnfs [58, 59 ]. imaging with ct or mr can help determine extent of tumor involvement, amount of bony dysplasia, and can aid in surgical planning. pnfs appear as diffuse, irregular masses that cross multiple tissue planes with other features including thickening of the soft tissues, irregular intraconal fat, irregular nodularity of the optic nerve sheath, and thickening of the sclera / choroid. tumor can infiltrate into the orbit with involvement of the sensory nerves, lacrimal gland, and extraocular muscles. bony involvement can lead to varying degrees of sphenoid dysplasia, expansion of the middle cranial fossa, expansion of the anterior orbital rim, and expanded orbital foramina secondary to trigeminal nerve involvement with resultant exophthalmos and buphthalmos. mri has improved soft - tissue resolution over ct and may allow improved visualization of tumor extension into the adjacent soft - tissues (figure 7). the tumor appears hypointense on t1wi, hyperintense on t2wi, and has variable enhancement on postcontrast images. extent of brain herniation through defects in the sphenoid can be better demonstrated on mri. surgical debulking and frontalis suspension procedures can reduce the ptosis and allow for binocular vision. however, the condition is often progressive. leukemia is the most common malignancy of childhood in the usa, with acute lymphoblastic leukemia accounting for 80% of all cases and acute myeloid leukemia (aml) accounting for 20% of cases [66, 67 ]. in patients with aml, a rare solid tumor made of primitive granulocyte precursors may form within the orbit and is called a granulocytic sarcoma. this mass may present prior to or after the diagnosis of aml and can be a sign of relapse in treated patients [49, 61 ]. mean age of presentation is around 8 - 9 years with unilateral disease in 90% of cases. the most common manifestation is leukemic retinopathy, which presents with flame - shaped retinal hemorrhages, sometimes with white centers, in the nerve fiber layer. anterior chamber hyphemas, pseudohypopyons, and iris masses can also be presenting signs of intraocular leukemia. the less common orbital deposition of leukemic cells can present as a rapidly enlarging orbital mass, which can cause pain, eyelid swelling, ecchymosis, diplopia, and proptosis [49, 57 ]. enhancing depth imaging optical coherence tomography can be useful in quantifying the increase in choroidal thickness, which can improve after systemic chemotherapy. granulocytic sarcomas are somewhat irregular homogenous masses with lateral orbital predilection that tend to encase rather than invade the adjacent lacrimal gland and extraocular muscles. the mass is iso- to hypointense to muscle on t1-weighted sequences, heterogeneously iso- to hyperintense on t2-weighted sequences, and has homogenous enhancement on postcontrast sequences. treatment, usually systemic chemotherapy and bone marrow transplantation, is guided by the pediatric oncologist and customized based on specific genetic features of the malignancy. a leukemic infiltrate of the optic nerve can cause optic nerve elevation, and this is a medical emergency because of potential permanent loss of central vision when left untreated. the treatment is low - dose radiation therapy often combined with intrathecal chemotherapy as soon as possible. lymphoid hyperplasia accounts for 1040%, and non - hodgkin 's lymphoma accounts for 6090% of the lesions. lymphoproliferative disease can be categorized into reactive lymphoid hyperplasia, atypical lymphoid hyperplasia, and ocular adnexal lymphoma. isolated orbital lymphoma is usually a low grade b - cell lymphoma, a subtype of non - hodgkin 's lymphoma. these lesions are most commonly seen in the superotemporal quadrant with a predilection for the lacrimal gland ; however, they may present with diffuse extraocular muscle involvement that can mimic thyroid ophthalmopathy. patients typically present with gradual, painless progression of proptosis. patients with orbital lymphoproliferative lesions must have a systemic evaluation for lymphoma. in followup six months after presentation with orbital lymphoproliferative tumor, 16% of patients will develop systemic lymphoma. ois often involves the lacrimal gland and/or extraocular muscles and can often mimic lymphoproliferative disease with proptosis. differentiating lymphoproliferative disease from ois is difficult on ct and mr, as both diseases can show enlargement of the lacrimal glands or extraocular muscles. mr is more sensitive in discriminating between lymphoid disease and ois, as lymphoproliferative disease has been shown to have significantly more restricted diffusion than ois (figure 8) [65, 70 ]. lymphomas typically have adc values less than 1.0 10mm / sec, and ois cases typically have adc values greater than 1.0 10mm / sec ; however, overlap does exist. hyperplasia (figure 9) may appear more circumscribed, and lymphoma (figure 10) may appear more infiltrative. ois is often painful in nature due to acute inflammation and is treated with corticosteroids. proper handling of the specimen is critical in appropriate tissue processing and interpretation of findings by the ophthalmic pathologist. ultimately, a combination of clinical, radiologic, and histologic evaluation will have the best chance of correctly diagnosing this rare pediatric disease. dermoid cysts are the most common orbital cystic tumor of childhood and arise from ectoderm trapped in bony sutures during embryogenic migration or from failure of surface ectoderm to separate from the neural tube. epidermoid cysts present similarly but lack the dermal elements in the cyst wall [49, 57 ]. most dermoids and epidermoids present in the childhood and teen years as a slow growing, painless, subcutaneous mass near the superotemporal orbit and frontozygomatic suture [49, 57 ]. when growth is outward into the eyelid, cysts present in early childhood, and when they grow inward into the orbit they present later in life. the mass is usually nontender, slightly fluctuant to firm, and mimics a lacrimal gland tumor. deep orbital or intraconal dermoid cysts may present with proptosis, ocular motility disturbances, and orbital nerve compression. the inclusion cysts may rupture spontaneously or with trauma, resulting in an intense inflammatory response in the surrounding tissues that may mimic an orbital cellulitis. additionally, orbital fistulas or sinus tracts can be contiguous with the dermoid and also result in orbital cellulitis, which may be the presenting sign of an orbital dermoid. both dermoid and epidermoid cysts cause adjacent bony remodeling secondary to their slow growth, which is best seen on ct as an adjacent rim of dense bone (figure 11). superficial dermoids can be evaluated with us and demonstrate smooth contours, variable echogenicity, and no demonstrable internal vascularity. epidermoid cysts are well - circumscribed unilocular cysts that appear similar to cerebrospinal fluid on both mr and ct but can be clearly differentiated on mr dwi (figure 12) where they appear high in signal intensity. dermoid inclusion cysts have a similar well - circumscribed margin and unilocular appearance ; however, unlike epidermoid cysts, dermoids have characteristic ct attenuation closer to fat (figure 11) with lipid signal on mr that suppresses on fat - saturated images. dermoid inclusion cysts also have a discernible wall that can enhance on post - contrast images and can contain dystrophic calcifications best seen on ct. once diagnosed, management is based on the location of involvement and history of progression. if the lesion progresses and results in extraocular motor disturbances or compression of cranial nerves, this is an indication for treatment. traditional surgical approaches include incisions over the mass ; above, below, or through the brow ; parallel to superior orbital rim ; via lateral canthotomy and lateral orbitotomy. the upper blepharoplasty approach provides excellent scar camouflage and has been effective, especially in frontozygomatic dermoid cyst excision. cases have been reported in which incomplete surgical resection resulted in malignant transformation to invasive squamous cell carcinoma. langerhans cell histiocytosis (lch) is a disease characterized by abnormal proliferation of langerhans cells and was previously thought to encompasses three clinical syndromes : letterer - siwe disease, which involves the vital organs of infants with often fatal outcomes ; hand - schuller - christian disease, seen in young children with diabetes insipidus, osteolytic calvarial defects, and exophthalmos ; and eosinophilic granuloma, an indolent disease limited to the bones of older children or adults [49, 71 ]. lch is now thought to represent a spectrum of disease ranging from benign unifocal bone disease to more aggressive multisystem disease. eosinophilic granuloma, the most localized and benign form of lch, usually presents in children less than 4 years of age as unifocal bone disease with possible orbital involvement. lch has been reported to have a higher male predominance, commonly involves the superotemporal orbit, and manifests with proptosis, ptosis, erythema, and enlarging palpebral fissures. on ct, lch manifests as a soft - tissue lesion that replaces / destroys osseous structures, can be well - defined or diffusely homogeneous, and shows moderate to marked enhancement after contrast administration (figures 13(a) and 13(b)). the soft - tissue mass may extend into the orbit, temporal fossa, forehead, face, and epidural space. the mass replaces the normal bright signal of marrow with heterogeneous signal on t1wi, can be hyperintense or hypointense on t2wi, and demonstrates enhancement on t1-weighted post - contrast images (figures 13(c), 13(d), and 13(e)). if there is clinical concern for pituitary involvement, the pituitary stalk and gland can be evaluated with a concurrent brain mri to evaluate for abnormal thickening / enhancement or absence of the posterior pituitary bright spot. if multifocal bone disease is suspected, technetium-99 m bone scintigraphy, or fluorine-18 fluorodeoxyglucose pet / ct, in conjunction with radiographic skeletal survey, may help identify more remote extraorbital lesions that require attention. patients can be medically managed with systemic corticosteroids or chemotherapy, depending on the severity of the disease and location of involvement. these patients must be followed because they can develop juxtaneural or intracranial extension and can progress to multifocal disease [49, 72 ]. they are the most common vascular tumor of childhood in the orbit and are classified into preseptal, intraorbital (involving the postseptal orbit), and compound / mixed, involving both. most cases are diagnosed within the first weeks to months of life, after which the hemangioma begins a proliferative phase for up to 10 months. during this phase, the lesion may be complicated by hemorrhage, ulceration, cause amblyopia by obstructing the visual axis or inducing astigmatism, cause glaucoma by compression of the ocular outflow channels, stretch the optic nerve, and cause corneal ulceration. after the first year of life, the lesion stabilizes and follows a course of prolonged involution for up to 10 years [36, 57 ]. the number and size of vessels decrease during the involutional phase [36, 74 ]. when the hemangioma is superficial within the skin, it often has a characteristic strawberry color with deeper lesions appearing bluish. intraorbital hemangiomas can present with proptosis, and further imaging must be performed for full evaluation. multifocal hemangiomas can be seen in up to a third of patients with involvement of the viscera and skin. imaging is indicated to assess for the depth of the lesion and its relationship with adjacent structures for any lesions with atypical features on physical exam or presentation, or an associated underlying syndrome. us is useful as an inexpensive initial exam and typically demonstrates a well - circumscribed mass with a vessel density of greater than 5 vessels / cm with variable echogenicity. spectral waveforms show a high - flow system with low resistance ; however, no arteriovenous shunting should be identified. if further characterization is needed, mri offers more sensitive evaluation of deeper lesions and their relationship to adjacent structures while avoiding the ionizing radiation of ct. additionally, mr angiography (mra) can be used to assess flow characteristics within the vascular lesions. typical hemangiomas are well - circumscribed solid masses with arterial flow voids, intermediate signal on t1wi, increased signal on t2wi, marked enhancement on post - contrast images, and high flow on time - resolved mra (figure 14). during the involutional phase, the flow voids and enhancement decrease, and fibrofatty deposition can be identified as areas of increased signal on t1wi [36, 74 ]. ct findings are similar to mri with decreased soft tissue and may be useful in patients who can not tolerate sedation or have other contraindications to mri. if complications of the capillary hemangioma arise, intralesional corticosteroid injections into the eyelid can be safely performed but should be done with caution. injection pressures routinely exceed the systolic blood pressure during these procedures, making the complication of retrograde embolization possible. central retinal artery occlusion (crao) is a documented complication of steroid injection treatment for eyelid hemangioma. prolonged adrenal suppression after an injection of triamcinolone / betamethasone has been reported in several patients. additionally, intravenous propranolol, oral propranolol have also been shown to decrease the size of non vision - threatening lesions. currently, twice daily topical 0.25% timolol maleate gel is used, as it is successful in treating eyelid hemangiomas. venous - lymphatic malformations (vlms) encompass a spectrum of complex congenital lesions of the orbit that are the result of maldevelopment of lymphatic and vascular structures during embryologic life. vlms are composed of a mixture of venous and lymphatic vessels that vary in composition based on location. deep lesions tend to be more venous in nature, while superficial lesions contain more lymphatic components. they account for 4% of all expanding pediatric orbital masses and are usually evident by two years of age. periorbital malformations may cause major morbidity, including intralesional bleeding, intermittent swelling, blepharoptosis, fluctuating proptosis, pain, amblyopia, chemosis, astigmatism, and strabismus. superficial lesions are identified earlier and can extend to the forehead and cheek ; deeper lesions present later with restricted ocular motility, acute proptosis secondary to hemorrhage, or acute enlargement with concomitant upper respiratory tract infection. presentation due to slowly progressive enlargement is less common. the imaging characteristics of vlms reflect their gross appearance with the mass appearing irregular, lobulated, infiltrating with ill - defined margins (due to lack of a capsule), and involving both the pre- and postseptal as well as the intra- and extraconal portions of the orbit [36, 80 ]. macrocysts within the lesion can measure up to 2 cm with microcysts appearing solid. mr imaging best evaluates the various components of the malformation with lymphatic / proteinaceous fluid best seen on t1wi, blood products best seen on t1 fat - suppressed images, and nonhemorrhagic fluid best seen on t2wi. various ages of hemorrhage within the cysts produce fluid - fluid levels that are nearly pathognomonic for the diagnosis of a vlm. a lack of flow voids helps distinguish this lesion from hemangiomas (figure 15). ct can better delineate any associated bony changes of the orbit including widening of the orbital fissures and remodeling of the orbital walls but is less accurate than mri in delineating the anatomic location and characterizing the individual components of the lesion. vlms are associated with intracranial vascular anomalies in up to 70% of patients, and imaging of the brain should be performed concurrently. treatment of periorbital vlms requires an interdisciplinary team that includes interventional and diagnostic radiologists, craniofacial surgeons, and ophthalmologists. percutaneous sclerotherapy with 3% sodium tetradecyl sulphate (std) is an effective first - line therapy for macrocystic and microcystic vlm with negligible recurrence rates and improvement in vision and proptosis after treatment. these lesions have also been historically treated with intralesional injections of ok-432, a lyophilized mixture of group a streptococcus pyogenes. this treatment, however, generates a significant local inflammatory reaction, which can include bleeding of the lesion and an increase in size, which resolves over weeks. surgical management is often difficult and subtotal because of the diffuse infiltrating nature of the lesion. a coronal approach is used for subtotal excision of frontotemporal - orbit malformations, but tarsal incisions are used for isolated eyelid lesions. proptosis can be managed temporarily by tarsorrhaphy (suturing the eyelids partially closed) and definitively by expansion of the bony orbit. in some occasions, a wide assortment of intraocular neoplasms and orbital masses involves the pediatric orbit and can present with various clinical manifestations. given the complexity of their location and considerable morbidity that may be associated with biopsy at this site, a systematic and multidisciplinary approach is needed to help facilitate an accurate diagnosis. by understanding the clinical presentation and the characteristic imaging features of the disease, a narrow differential diagnosis can be formulated, and thus timely treatment can be initiated. the treatment of pediatric orbital and intraocular neoplasms, especially of retinoblastoma, has changed drastically over the last 10 years. during this same period, wider use of 3 t magnets with newer coils has improved signal quality of mr imaging, while new 3d pulse sequences now allow slice thicknesses of less than 1 mm. furthermore, dwi imaging has recently emerged as an important diagnostic tool used to differentiate malignant and benign neoplasms. as imaging hardware and advanced imaging techniques become more refined, diagnostic accuracy should continue to improve. advancements in drug delivery systems and therapies will hopefully translate into decreased morbidity and mortality in this young patient population. | while pediatric orbital tumors are most often managed in tertiary care centers, clinicians should be aware of the signs of intraocular and orbital neoplasms. in the pediatric population, a delay in diagnosis of orbital and intraocular lesions, even if benign, can lead to vision loss and deformity. intraocular lesions reviewed are retinoblastoma, medulloepithelioma, and retinal astrocytic hamartoma. orbital neoplasms reviewed are rhabdomyosarcoma, neuroblastoma metastases, optic pathway glioma, plexiform neurofibroma, leukemia, lymphoprolipherative disease, orbital inflammatory syndrome, dermoid and epidermoid inclusion cysts, and langerhans ' cell histiocytosis. vascular lesions reviewed are infantile hemangioma and venous lymphatic malformation. in conjunction with clinical examination, high - resolution ophthalmic imaging and radiologic imaging play an important role in making a diagnosis and differentiating between benign and likely malignant processes. the radiologic imaging characteristics of these lesions will be discussed to facilitate prompt diagnosis and treatment. the current treatment modalities and management of tumors will also be reviewed. |
a descriptive research design was employed in the present study to assess the problems faced by wives of alcoholics and coping strategies employed by them. a total of thirty alcoholic clients ' wives who accompanied their husbands ' who were seeking treatment in de - addiction and treatment center opd, pgimer, a tertiary care hospital in north india were enrolled for the study. the sample was chosen using total enumeration technique wherein all the wives who accompanied their husband 's during the data collection period and fulfilled the inclusion criteria were selected. the following inclusion criteria were used : the wives of alcoholics visiting ddtc opd with their husband and staying with the alcohol abusing husband for at least past 6 months. the wives of the clients who abused any other psychoactive substance or multidrug users were not included in the study. the following research tools were used in the study : it comprised items including the age, gender, educational status, occupational status, and other demographic information of wives of alcoholic clients. it is a 17-item structured questionnaire prepared by the researcher after intensive review on problems faced by the wives of alcoholics. the face validity of the tool was done by the experts in the field of nursing, psychiatry, and psychology. the problems faced were categorized into five major domains : emotional, financial, social, physical, and health related. each item of the questionnaire was to be responded by choosing appropriate option from a four - point scale ranging from 0 to 3 where 0 corresponded never, 1 corresponded as once or twice, 2 was sometimes, and 3 referred to often. the questionnaire yield scores in terms of problems in five domains, which was obtained by summing individual item scores in each domain. each item is rated on a four - point scale ranging from 0 to 3. the tool yields mean scores in three forms of coping, namely, engaged coping, tolerant coping, and withdrawal coping. engaged coping is coping by standing up to the problem (14 items), tolerant coping is inactive coping by putting up with the problem (9 items), and withdrawal coping is withdrawing from the problem and gaining independence (7 questions). the mean scores can be obtained by simply summing up the individual items score on each subscale. the tool was translated into hindi and retranslated into english after seeking validation from language experts. the data were collected by conducting the individual interview of each study subject using above - mentioned questionnaires. being largely a descriptive study, only a bare minimum analysis of the data using the (ibm, spss statistics for windows, version 19.0.) was done. a descriptive research design was employed in the present study to assess the problems faced by wives of alcoholics and coping strategies employed by them. a total of thirty alcoholic clients ' wives who accompanied their husbands ' who were seeking treatment in de - addiction and treatment center opd, pgimer, a tertiary care hospital in north india were enrolled for the study. the sample was chosen using total enumeration technique wherein all the wives who accompanied their husband 's during the data collection period and fulfilled the inclusion criteria were selected. the following inclusion criteria were used : the wives of alcoholics visiting ddtc opd with their husband and staying with the alcohol abusing husband for at least past 6 months. the wives of the clients who abused any other psychoactive substance or multidrug users were not included in the study. the following research tools were used in the study : it comprised items including the age, gender, educational status, occupational status, and other demographic information of wives of alcoholic clients. it is a 17-item structured questionnaire prepared by the researcher after intensive review on problems faced by the wives of alcoholics. the face validity of the tool was done by the experts in the field of nursing, psychiatry, and psychology. the problems faced were categorized into five major domains : emotional, financial, social, physical, and health related. each item of the questionnaire was to be responded by choosing appropriate option from a four - point scale ranging from 0 to 3 where 0 corresponded never, 1 corresponded as once or twice, 2 was sometimes, and 3 referred to often. the questionnaire yield scores in terms of problems in five domains, which was obtained by summing individual item scores in each domain. each item is rated on a four - point scale ranging from 0 to 3. the tool yields mean scores in three forms of coping, namely, engaged coping, tolerant coping, and withdrawal coping. engaged coping is coping by standing up to the problem (14 items), tolerant coping is inactive coping by putting up with the problem (9 items), and withdrawal coping is withdrawing from the problem and gaining independence (7 questions). the mean scores can be obtained by simply summing up the individual items score on each subscale. the tool was translated into hindi and retranslated into english after seeking validation from language experts. it comprised items including the age, gender, educational status, occupational status, and other demographic information of wives of alcoholic clients. it is a 17-item structured questionnaire prepared by the researcher after intensive review on problems faced by the wives of alcoholics. the face validity of the tool was done by the experts in the field of nursing, psychiatry, and psychology. the problems faced were categorized into five major domains : emotional, financial, social, physical, and health related. each item of the questionnaire was to be responded by choosing appropriate option from a four - point scale ranging from 0 to 3 where 0 corresponded never, 1 corresponded as once or twice, 2 was sometimes, and 3 referred to often. the questionnaire yield scores in terms of problems in five domains, which was obtained by summing individual item scores in each domain. each item is rated on a four - point scale ranging from 0 to 3. the tool yields mean scores in three forms of coping, namely, engaged coping, tolerant coping, and withdrawal coping. engaged coping is coping by standing up to the problem (14 items), tolerant coping is inactive coping by putting up with the problem (9 items), and withdrawal coping is withdrawing from the problem and gaining independence (7 questions). the mean scores can be obtained by simply summing up the individual items score on each subscale. the tool was translated into hindi and retranslated into english after seeking validation from language experts. the data were collected by conducting the individual interview of each study subject using above - mentioned questionnaires. being largely a descriptive study, only a bare minimum analysis of the data using the (ibm, spss statistics for windows, version 19.0.) was done. table 1 depicts the sociodemographic profile of the study participants. the majority of participants were in the age range of 2140 years. almost 43% of participants had education up to secondary level while 26% were educated up to graduate level. sociodemographic profile of study participants table 2 depicts the problems faced by the wives of alcoholic clients in terms of frequency distribution of rating done by them. there were 70% wives who often felt anxious owing to the drinking problem of their husbands. in addition, 50% of wives felt frustrated sometimes. despite such emotional problems, almost half of them never displaced their frustration on children and three - fourth of them never ignored their children. it was seen that only 7% of the wives reported that they often ignored their own physical health while 10% of them also reported sleep disturbances. there were 13% of wives who reported that their social visits get reduced often owing to their husband 's drinking and half of them reported feeling ashamed in society. with regard to the problems of physical violence, very few wives reported various forms of violence by their alcoholic partner. it was only 3% wives who reported that their alcoholic partner often uses weapon against them and physically harm their children. problems faced by wives of alcoholic clients table 3 depicts the mean scores, range, and mean percent scores on domains of problems faced by the wives of alcoholics. as shown in table 3, the mean percent scores were highest in emotional and social domain while lowest in the financial domain. mean score, standard deviation, range, and mean% score on domains of problems faced by the wives of alcoholics table 4 gives item - wise ratings on each item of scale to assess the coping strategies ' used by wives of alcoholics. 114 represent engaged coping, item 1523 represent tolerant coping, and item 2430 represent withdrawal coping. some of the often used engaged coping styles included actions such as sitting together and talking about drinking, which was reported to be used often by 93.4% wives. another 93% of them used pleading their partners for not drinking as engaged coping style. arguing is also considered to be another form of engaged coping which was used often by 70% wives. the ratings on the tolerant coping revealed that very few wives of alcoholics often used this coping strategy. it was only 3% of them who often gave money to their alcoholic partner, only 13% of them often considered the problem of alcoholism as a part of life that could not be changed. it was only 6% of them who used tolerant coping to an extent to make excuses for their partner. the third commonly employed coping strategy was that of withdrawal coping. almost one - fourth of the study wives reported using avoidance as coping strategy while another 23% reported that they tried getting on their own things as their coping mechanism. the wives of alcoholic clients are often subjected to various forms of physical, psychological, and emotional problems. the present study highlighted the problems faced by the wives of alcoholics into five major domains : emotional, health related, social, financial, and physical violence. in the present investigation, large number of wives reported anxiety and mental disturbance owing to the drinking problems of their husbands. anxiety, depression, and poor adjustment are commonly reported problems among the wives of alcoholics in literature. some other authors have also reported negative emotions such as anger, frustration, desperation, nervousness, fear, guilt, and at times hostility among wives of alcoholic clients. kuruvilla and rao, (2004) reported that impact of alcoholism can be so marked on the female partner that she herself start behaving like an addict. some of the authors have even reported the terms neurotic, psychologically maladjusted, and sadistic in context of wives of alcoholic clients. these negative emotional states further affect the self - esteem, self - concept, meaning in life, quality of life, and overall life satisfaction among them. the psychological problems faced by the wives of alcoholics often set in motion an array of physical problems as well. ignoring one 's own physical health and sleep disturbances are commonly reported. an empirical investigation supported a high prevalence of psychosomatic disorders among the wives of alcoholic clients as compared to that of nonalcoholics. there are differences in mean number of past illnesses as well as the number of current illnesses. social drinking has become far more acceptable in indian community, but the problem drinking is often viewed as stigmatic. thus, the family members of alcoholic participants often feel estranged and are looked on by others. in the present study, the violence by the alcoholic partner is most commonly reported problem in the wives of alcoholic clients. in initial phases, it often occurs when the client is under the effect of alcohol, and gradually it becomes a conditioned response. nemeth. explored the triggers causing acute violence among women using the telephonic interviews. they found that accusations of infidelity in context of alcohol or drug use were most common trigger. although in the present study, a substantially small fraction of wives reported being a victim of violence ; however, in literature, the prevalence of violence among the wives of alcoholics is high. there are studies reporting violence in distinct domains : physical, emotional, intellectual, and economic. the problem of alcoholism though looks such as a single unitary area of concern ; however, this single problem is so colossal that it somehow percolates each and every aspect of wives of alcoholic clients starting from interpersonal to social and to further intrapersonal realms of their life. in such situation, they are bound to use some conscious or unconscious efforts to minimize its impact on them as well as their children using various forms of coping. the literature gives various forms of active and passive actions on the part of wives of alcoholics which turns out adaptive for them. denial of the problem, attempt to eliminate the problem, disorganization, attempts to reorganize inspite of problem, efforts to escape the problems, reorganization of part of the family and recovery and reorganization of the whole family are commonly reported. kuruvilla and rao viewed coping among wives of alcoholics in ten distinct behavioral actions : discord, avoidance, indulgence, competition, antidrink assertion, sexual withdrawal, fearful withdrawal, taking special action, and marital breakdown. in the present study, the coping was seen in the three major forms : engaged coping, tolerant coping, and withdrawal coping. engaged coping is a form of coping in which the wife of alcoholic gets vigorously engaged with an alcoholic husband through active interaction. she tends to use various assertive, controlling, emotional, and supporting behaviors to change the husband 's drinking. the engaged coping itself is very tiring and drains the person emotionally ; however, this coping serves to maintain the self - esteem and meaning in the life as the wives employing such actions feel as if they are doing something for the welfare of partner, family, and self. it is like putting yourself out for him or giving money even if you know they will be spent on alcohol. the withdrawal coping involves avoidance of the drinker and active involvement in other self - regulating activities. it is also reported that tolerant coping and withdrawal coping are associated with poor drinking outcomes as well as poor family outcomes with high depression rates among nonalcoholic spouses. in the current study, this specific finding can be inspected in light of two facts : first, the shift from tolerant coping to engaged coping can be due to transition in social structure from dependent, submissive stereotype of female to an independent, autonomous female who is capable of doing for self - ad family. second, in the current study, all the study participants were the wives of alcoholic clients who were accompanying them for treatment which itself reflects an engagement of their part with relation to drinking. the coping strategy used is also a function of individual personality along with other situational determinants. the wives with a dependent - personality profile are more likely to employ tolerant and withdrawal coping styles while the ones who are high on self - esteem, assertiveness, resilience, and dominance would employ more of engaged coping. further, there are reports of association between the demographic variables of wives and coping styles employed. the other situational determinants of coping are the availability of social support and the financial independence. more of withdrawal coping is prevalent as women are more autonomous and have enough community resources to engage self away from the alcoholic partner while in indian set up, it is either more of engaged or tolerant coping styles. looking at the traditional indian society where females are seen as a weak gender, a dependent gender, there is more of tolerant coping. however, with changes in gender roles and growth of feminism, the engaged coping has turned high. moreover, in indian society, marital separation owing to drinking problem is still considered more stigmatic than staying in a conflicting discordant relation. the consequences of marital separation for the children are so overestimated that females do all they can to change their partner 's drinking problem for the sake of maintaining the marriage. many a times, in initial few years of problem, they begin with tolerant styles ; however, a hope to get things better leads to more of engaged coping. such styles when employed over years without any positive outcome ultimately compel the wives to engage in withdrawal coping. the alcoholism is though identified as a medical problem has large spectrum of psychosocial difficulties for the family members of alcoholics, specially their spouses. the problems faced by the wives of alcoholics range from physical to emotional to social domains. the wives of alcoholic clients might employ various coping strategies to curb the ill effects of their partner 's drinking. the present study findings are consistent to the available literature on same ; however, the results highlight the role of culture and changing gender implications on their coping styles. the study, however, did not explore the subjective distress and pain the partners of alcoholic clients go through their lives as pure descriptive and cross - sectional assessment were done. the study also did not look into the association between demographic variables and coping styles used. it is further recommended that such investigation can be taken up in a qualitative manner to subjectively understand and acknowledge the pain of being a wife of an alcoholic. such evidence can be further utilized in developing training and resilience - building programs for the wives of alcoholic clients. | background : alcoholism is considered as a major health as well as a social problem. often the family members of alcoholics suffer intense psychological, physical and social trauma due to the core drinking problem of the family member. most deeply affected are the wives of alcoholics.aim:the present descriptive study aimed to investigate the problems faced and coping strategies used by the wives of alcoholics.methodology:a total of 30 wives of alcoholic clients seeking treatment in de - addiction centre were interviewed for the same. the problems were identified using a non standardized 17 item structured questionnaire while coping in wives of alcoholics was assessed using standardized tool.results:the findings revealed the problems faced by alcoholics wives were in multiple domains viz. physical, psychological and social. while most highly reported were the emotional problems and least reported were the problems of physical violence. coping strategies used by wives of alcoholics were reported in three major styles : engaged, tolerant and withdrawal.conclusion and recommendations : the problems faced by alcoholics have often wedged the attention in society yet finding and applying effective interventions to reduce the pain and suffering of being a partner of alcoholic is still a challenge. |
(see related article by vanholder and glorieux. the intestine and the kidneys : a bad marriage can be hazardous. | inflammation is a multifactorial phenotype that in chronic kidney disease is associated with adverse patient outcomes. recently, alterations in gut microbiota composition and intestinal barrier have been associated with inflammation and oxidative stress in ckd patients. vanholder and glorieux recently critically reviewed [clin kidney j (2015) 8 (2) : 168 - 179 ] the current understanding of the role of gut microbiota in the production of uraemic toxins and the therapeutic implications. where do we stand now ? the basic mechanisms of the gut - kidney crosstalk must still be clarified. in addition, the efficacy and safety of therapeutic strategies to modulate the gut microbiota in order to decrease uraemic toxin production and inflammation in chronic kidney disease should be evaluated. finally, an impact of such strategies on hard outcomes should be demonstrated before incorporation into routine clinical practice. |
esophageal cancer accounts for 1% of all cancers and it is the seventh - most frequent cause of cancer - related deaths. the prognosis in this cancer is poor because in 50% of affected patients the diagnosis is made at an inoperable stage of the disease. local symptoms of esophageal cancer include dysphagia, odynophagia, cough, nausea, vomiting, regurgitation and retrosternal pain. dysphagia is a main, but not pathognomonic, symptom, as it may occur in several non - neoplastic diseases (eg, in achalasia). in esophageal cancer, surgery is a treatment of choice if the neoplasm is in operable stage. in inoperable stage irresectability of esophageal cancer is related to local progression, presence of distant metastases and concurrent severe conditions. the aim of palliative treatment is to maintain digestive tract patency and to relieve pain. the latter goal is achieved by pharmacotherapy. in palliative treatment to reduce dysphagia in patients with neoplastic esophageal obstruction, the endoscopic and non - endoscopic methods are applied. surgery is not useful for symptomatic treatment due to high perioperative mortality and frequent complications. in patients in quite good general condition however, in most patients with inoperable esophageal tumor, this method is not applicable due to complications and low efficacy. these 3 aforementioned methods are rarely applied in palliative treatment of esophageal cancer because of severe complications such as post - irradiation esophagitis, esophageal obstruction or tracheoesophageal fistula. endoscopic methods are : (1) tumor mass reduction with electrocoagulation, laser therapy, argon plasma coagulation, photodynamic therapy and injection therapy ; and (2) preservation of a proper diameter of esophagus lumen with the aid of dilation, implantation of esophageal endoprostheses, and use of a gastric feeding tube. within the endoscopic methods, only the use of endoprostheses yields long - term effects ; however, the other methods have high recurrence rates. a patient with primary esophageal cancer and life expectancy over 3 months should be qualified to palliative brachytherapy. in patients with life expectancy below 3 months, as well as with recurrence of dysphagia after brachytherapy, the main differences between them concern the material they are made from, their shape, type of net braid, flexibility, diameter, length, manner of drug releasing, degree of torsion after application and the presence of an anti - reflux valve. currently, self - expanding drug - coated stents are used most often because of better long - term effect of palliation in neoplastic dysphagia. no particular type of drug - coated self - expanding stents has been proven to be superior to others in the treatment of neoplastic dysphagia. the choice of therapeutic method should be based on technical capabilities of the medical centre, and experience and skills of the operator. patients with neoplastic dysphagia fulfilling criteria of inoperability were included into the study. in patients with dysphagia, the palliative treatment was introduced due to local progression of the lesion, presence of metastases or poor general condition. all patients had total esophageal obstruction. within years 20092010, a total of 46 patients (41 males and 5 females) were qualified to palliative implantation of coated self - expandable stent (cook evolution, cook ireland ltd.) in the gastrointestinal endoscopy laboratory of the wam medical university hospital in d. the mean age of the patients was 67 years (from 51 to 78). neoplastic tumor resulting in obstruction was localized in the following parts of esophagus : distal (within the distal 10 cm) in 24 patients, medial in 13 patients and proximal (up to 10 cm from the upper esophageal sphincter) in 9 patients. tracheoesophageal fistulas in tumor mass were detected in 3 patients by means of contrast radiological examination. in all patients evolution type coated, the evolution stent is an elastic self - expandable stent woven from a single nitinol wire. the procedures were conducted with sedation, in supine position, under fluoroscopic control. prior to stent implantation, the endoscopic examination evaluating the size and the extent of the esophageal lesion, anatomical localization in esophagus, as well as the distance from the upper and lower esophageal sphincter, was performed in every patient. the following types of endoscopes were used : gif q165 8.9 mm, gif xp180n 5.9 mm and gif hi80j 9 mm. in the cases of difficulty in passing the endoscope through an obstruction, balloon dilation (up to 20 mm, in accordance with the prosthesis dilatability) was carried out. during stent the length of the stent was adjusted so that it was 46 cm longer than the neoplastic lesion, protruding 2 cm both above and under the lesion margins. in the cases of tumor localization in the proximal esophagus, the patient was qualified for stent implantation provided there was a 2 centimeter margin from the upper esophageal sphincter free from the neoplastic infiltration. this condition is crucial for safe stent implantation without subsequent symptoms of pain, tracheal compression or feeling of a foreign body in the esophagus. in all cases, 24 hours after the implantation, radiological examination was performed to assess the stent location. all patients included in the study were discharged from hospital up to 48 hours from stent implantation. after the procedure, proton pump inhibitor (ppi) was chronically administered in all patients in order to reduce the symptoms and not irritate the inflamed mucous membrane of the esophagus. other drugs used by some of the patients included analgesics, received also before the implantation due to the basic disease. the results of esophageal cancer treatment with coated stent implantation are shown in table 2. pictures of lesion prior to and following stent implantation are presented in figures 13 (endoscopic images) and in figure 4 (x - ray images). in 4 patients of the study group, tracheoesophageal fistulas were found before stent implantation. in 3 cases they were consequences of the neoplasm, while 1 was iatrogenic due to prior esophageal dilation. endoscopic esophageal dilation prior to stent implantation was required in 21 patients. in all 4 cases, application of the coated stent provided entire sealing of fistulas, and in the subsequent follow - up no complications related to fistulas were observed. among the aforementioned complications, summarized in table 6 they accounted for 28% (5/18) of complications and occurred in less than 9% of patients (4/46). the second group comprises non - life threatening complications, which only required application of an additional procedure. those complications include stent malposition, chest pain, nausea, gastroesophageal reflux and stent occlusion by food material. this group accounted for 72% (13/18) of all complications, and they occurred in 17% (8/46) of patients. the stage of neoplastic disease, general patient condition and (in consequence) life expectancy, should be taken into account in choosing a method for palliative treatment of dysphagia caused by esophageal cancer. our study confirmed the usefulness of this method in palliative treatment of neoplastic dysphagia. in 44 of 46 patients the degree of dysphagia improved from stage 5/6 (inability to swallow any food or saliva) to stage 1 (ability to swallow solid food). satisfactory remission of dysphagia was not reached in 2 cases in which the tumor was localized in the area of the gastric cardia. in these cases, average time of survival in all the patients was 102 days. in our research, the percentage of patients in which any complications occurred as a result of esophageal stenting with coated nitinol prosthesis was 39%. severe complications such as perforation, respiratory tract compression, bleeding and death occurred in 11% of the patients under therapy. non - severe complications such as stent malposition, chest pain, nausea, gastroesophageal reflux and stent occlusion by food material occurred in 17% of the analyzed patients. in comparison with results from the literature, immediate complications occurring during stent implantation include perforation, aspiration pneumonia, fever, bleeding, stent malposition, respiratory failure and death. in our research these complications occurred in 11% (5/46) of the patients. in 2 cases, a perforation caused by balloon dilation of the esophagus occurred and in 1 case stent malposition, was verified in the next endoscopic investigation and the reposition was made with the aid of pincers. the 2 most severe complications occurred in 1 patient in poor general condition respiratory failure led to the patient s death. this patient had a left lung cavity tumor, infiltrating the bronchi and the esophagus, with metastases to the liver. due to the bronchus infiltration it was impossible to secure it with simultaneous bronchus stenting according to recommendations found in the literature. due to early complications (occurring in the first 7 days after the stent implantation) we observed 1 bleeding, 2 stent migrations and 4 patients complained of chest pain. the bleeding that occurred in patient with a gastric cardia tumor was caused by mechanical damage to the tumor mass and was controlled pharmacologically ; endoscopic intervention was unnecessary in this case. reported the occurrence of chest pain after esophageal self - expanding stent implantation in 30% of the patients. in other papers the frequency of this complication was estimated at from 5% to 50%. in our study all of these cases were successfully controlled with non - steroidal anti - inflammatory drugs within 48 hours after the stent implantation. late complications (occurring more than 1 week after the procedure) included : recurrent dysphagia, stent migration, fistulas, bleeding, symptoms of gastroesophageal reflux and neoplasm overgrowth. according to the literature, prosthesis migration occurs in approximately 515% of the cases, as an early, immediate or late complication. the most frequent re - intervention methods after stent migration are second stent implantation or stent reposition with the aid of a loop or pincers. in our research this complication occurred in 5% of the cases and concerned stent implantation in patients with tumor of the distal part of the esophagus. in 1 of those cases, for the correct placement of the prosthesis, it was enough to perform reposition with the aid of pincers. in the second case it was necessary to apply a second stent to obtain patency of the esophagus ; in our research this was an early complication. gastroesophageal reflux is a common complaint of patients with neoplasms located in the distal part of the esophagus, when the distal end of the prosthesis goes through the lower esophageal sphincter. as a preventive method, a prosthesis with an anti - reflux valve or pharmacological treatment may be applied. other studies, due to the lack of clear proof of efficacy of stents with an anti - reflux valve, do not recommend their application in patients with dysphagia caused by neoplastic stenosis of the distal part of the esophagus and cardia. bleeding most often occurs as a late complication ; the etiology of this complication is not fully agreed upon. the procedures in case of severe hemorrhage include blood transfusion and pharmacological treatment. in our study, bleeding as a late complication did not occur. in 1 case this lesion appeared in the fourth week of observation as a consequence of esophageal wall weakening by a pathological neoplastic mass that did not withstand the centrifugal force exerted by the stent. the fistula occurred in the area where the coated and uncoated parts of the stent are joined. the most common late complication, occurring 24 months after the stent implantation, is neoplasm infiltration at the ends of the prosthesis. both ends are affected with comparable frequency in this complication, which has been observed in 1020% of patients. in such a case, the method of choice is implantation of a second stent. in our observation, adhering to the rule that both ends of the prosthesis protrude by 23 cm of the neoplastic stenosis allowed avoidance of the infiltration of the prosthesis by the neoplastic mass. in our observation, in 2 cases the reoccurrence of dysphagia appeared as a result of stent occlusion with food material. it was a late complication in both cases, it resulted from violating the rules of proper food consumption, and it was easily treated by endoscopic stent cleaning. in patients with neoplastic esophageal stenosis, stenting with coated, self - expandable nitinol prostheses is a safe, effective and quick method of palliative dysphagia treatment. severe, possibly life - threatening, complications constituted 28% of all the complications and occurred in 9% of the patients. other complications, which were less severe, occurred in 17% of the observed patients and were not life - threatening. future research to enhance the quality of the available stents, as well as the introduction of new stent types (biodegradable, with radioactive coating, delivering drugs) will help to decrease of the number of complications and enhance the quality of life of patients in the terminal phase of the disease. | summarybackgroundesophageal cancer is the seventh - most frequent cause of cancer - related deaths and it is usually diagnosed at an inoperable stage. in palliative treatment, endoscopic and non - endoscopic methods are applied to reduce dysphagia in patients with neoplastic esophageal obstruction. because of severe complications, non - endoscopic treatment (surgery, radiotherapy, brachytherapy and chemotherapy) is applied rarely. within the endoscopic methods, only the use of endoprostheses yields long - term effects. the aim of this study was to evaluate the safety and efficacy of implantation of self - expandable esophageal stents in palliative treatment of dysphagia related to esophageal cancer.material/methodsa total number of 46 patients (41 males and 5 females) were qualified to palliative implantation of coated self - expandable stent. the mean age of the patients was 67 years (from 51 to 78 years). in all patients, evolution - type coated self - expandable stents were used. in all cases, 24 hours after the implantation, radiological examination was performed to assess the stent location.resultssevere, possibly life - threatening, complications constituted 28% of all the complications and occurred in 9% of the patients. less severe complications occurred in 17% of the observed patients and were not life-threatening.conclusionsin patients with neoplastic esophageal stenosis, stenting with coated, self - expandable nitinol prostheses is a safe, effective and fast method of palliative dysphagia treatment. |
swallowing is a series of coordinated processes in which food boluses move from the mouth to the stomach. the normal process of swallowing includes the oral preparatory phase in which food is chewed ; the oral phase in which food is moved to the rear of the oral cavity and swallowing starts ; the pharyngeal phase in which food is quickly moved through the pharynx to the esophagus ; and the esophageal phase in which food is moved down the esophagus to the stomach1. if problems exist in the nerves or muscles involved in this process, a person can not swallow food safely. thus, it is important to determine the causes of swallowing problems by stage and provide proper treatment to help patients with dysphagia recover their swallowing function. the pharyngeal phase in particular is involuntary, and since the airway and esophagus are closely located each other, it is very important that the pharyngeal muscles operate normally to prevent food boluses from entering the airway. if problems occur with coordination of the swallowing muscles in the pharyngeal stage, food can get through the airway and cause serious complications such as suffocation or aspiration pneumonia. dysphagia can be caused by various diseases that can affect the nerves or muscles ; swallowing problems in the pharyngeal phase in particular are frequently caused by damage to the neurological system such as stroke1. dysphagia affects a reported 4070% of acute stroke patients2, 3 and becomes a direct cause of malnutrition, dehydration, and pneumonia. in particular, since stroke patients are at high risk of aspiration or penetration, both of which involve the passage of food into the airway due to swallowing problems in the pharyngeal phase, it is critical that they obtain swallowing treatments as soon as dysphagia is discovered4. treatment strategies for dysphagia in the oral cavity and pharynx are largely divided into feeding techniques and swallowing therapy, the latter of which induces swallowing and enhances the pharyngeal phase. of these two strategies, swallowing therapy includes techniques to prolong pharyngeal swallowing, enhances pharyngeal transit time, and facilitates neuromuscular activities related to swallowing ; traditionally, it includes compensatory approaches such as posture changes and maneuvers that improve function by strengthening weak swallowing muscles1. neuromuscular electrical stimulation (nmes), which induces the functional recovery of swallowing using electrical stimulation on paralyzed cervical muscles, is frequently used in swallowing treatment. a non - invasive treatment, nmes has the advantage of being easier to apply than traditional treatment techniques such as compensatory approach and can be effectively used for patients with damaged cognitive function for whom compensatory treatment is difficult to apply5. nevertheless, the effectiveness of nmes in the rehabilitation of swallowing remains controversial. while there are reports that nmes is significantly more effective in treatment than tactile stimulation treatment or compensatory treatment techniques5, 6, there are also reports that nmes has no significant effect on the recovery of swallowing function7. in addition, in retrospective studies, its treatment effect was significant only in mild and moderate dysphasia8. to date, although domestic studies on dysphagia have mainly focused on its characteristics, only a few studies have compared the treatment effect of nmes using temperature - tactile stimulation, which is mainly used in clinical circumstances9. this study compared nmes and thermal tactile oral stimulation (ttos), a traditional swallowing recovery treatment, in patients with sub - acute dysphagia caused by stroke. subjects of the present study were 55 patients diagnosed with dysphagia caused by stroke in the rehabilitation departments of three general hospitals in seoul and inchon between september 2014 and january 2015 who agreed to participate in this study after understanding its contents. this study was approved by the institutional review board of n university and was conducted in accordance with the ethical standards of the declaration of helsinki. as the minimum number of samples calculated based on power analysis was 53 with a significance level ()= 0.05, effect size 0.5, and power of test (1-)= 0.95 on the standard of t - distribution, the number of samples of this study was appropriate. the standards of selection for the subjects of this study were as follows : 24 points on the korean mini - mental status exam. all participants were randomly assigned into the nmes group (n=27) or ttos group (n=28) using the table of random numbers. subject characteristics are presented in table 1table 1.patient characteristics prior to the studyvariablenmes (n=27)ttos (n=18)gender male1716female1012age (years)65.2 7.767.5 8.3duration of dysphagia (months)4.5 1.1 4.8 1.2vfs (score)26.1 13.125.5 11.5p<0.05, mean sd. nmes : neuromuscular electrical stimulation ; ttos : thermal tactile oral stimulation ; functional dysphagia scale based on videofluoroscopic studies (vfs). nmes : neuromuscular electrical stimulation ; ttos : thermal tactile oral stimulation ; functional dysphagia scale based on videofluoroscopic studies (vfs) the nmes group received 30 minutes of stimulation per day 5 days per week for 3 weeks by a swallowing therapist with vitalstim certification using vitalstim (ap2116 ; djo company, usa) for a total of 15 treatments. referring to freed., the electrodes were attached to the mylohyoid and thyrohyoid muscles, the frequency of vibration was set at 80 hz with a width of 300 ms, and the wave pattern was bi - phasic5. the electric current intensity started at 2.5 ma and, set at a comfortable level for the patients by increases in 2.5-ma increments, and had a maximum of 20.0 ma. the ttos group repeated the 30-minute stimulation on the anterior faucial arch with an ice stick to facilitate pharyngeal swallowing each day 5 days per week for 3 weeks. the treatment consisted of rubbing the anterior faucial arch up and down 5 times, inducing dry swallowing, and repeating this method for 30 minutes. swallowing recovery was verified by a medical doctor of rehabilitation medicine who did not participate in the study using a videofluoroscopic swallowing study (vfss) and functional dysphagia scale based on videofluoroscopic studies (vfs)10. for vfss, this study used multistar top (siemens, erlangen, germany) and analyzed video data with virtualdub v1.10.2 (virtualdub, korea) which is capable of analyzing 30 frames per second. vfs is a scale that is used to identify overall swallowing problems such as aspiration observed in vfss and consists of a total of 100 points. when vfs test was developed, its sensitivity was 8182% and specificity was 70.792%10. for the analysis, a preliminary homogeneity test was first conducted with an independent sample t - test or test, while a pre - post efficiency test was conducted using a paired - sample t - test. chicago, il, usa) was used for the analysis, and the significance level was 0.05. in the test on homogeneity of age, vfs and outbreak duration of the nmes and ttos groups with independent t - test and chi - square test, there was no significant difference in all items (table 1). the analysis of pre - post values of vfs of the nmes and ttos groups using a paired t - test revealed no significant difference between the two groups despite both having decreased mean vfs values after treatment (table 2table 2.vfs results of nmes and ttosvfsnmes (n=27)ttos (n=18)pre - test26.1 13.125.5 11.5post - test14.3 vfs : videofluoroscopic study ; nmes : neuromuscular electrical stimulation ; ttos : thermal tactile oral stimulation). p<0.05. vfs : videofluoroscopic study ; nmes : neuromuscular electrical stimulation ; ttos : thermal tactile oral stimulation the purpose of treating dysphagia in stroke patients is to reduce the risk of aspiration and enhance their ability to swallow food safely. both treatment methods tested here significantly enhanced swallowing function. multiple studies have reported that nmes enhanced swallowing function6, 9, 11, perhaps more effectively than ttos5, in the pharyngeal phase9 and enhanced function in the oral phase12. in particular, freed. recommended using nmes with complementary treatment and ttos since they have limited effect in strengthening the swallowing muscles and enhancing coordination5. as in these preceding studies, 3-week nmes treatment in this study effectively enhanced swallowing function. nmes is a treatment method that recovers muscle function by emitting minute electricity on the skin, enhances and the larynx lifting motion, and ultimately recovers swallowing function13. thus, it is expected that applying nmes to patients with sub - acute dysphagia caused by stroke can enhance their swallowing function. the second important discovery of this study was that the effect of nmes treatment on patients with sub - acute dysphagia did not have any significant difference from that of ttos. although treatments for dysphagia differ depending on its cause, complementary treatment, ttos, and electric stimulation treatment are performed. unlike complementary treatment and ttos, which are covered by health insurance, nmes is excluded from coverage, making it expensive. nevertheless, nmes treatment is not merely frequently conducted for sub - acute dysphagia but is performed by 72.3% of swallowing treatment experts14, 15. therefore, it is necessary to prescribe guidelines for swallowing treatment considering the economic difficulties of patients with dysphagia ; accordingly, future comparisons of the effectiveness and economic considerations of various swallowing treatments are required. first, the treatment period was only 3 weeks long, so future studies are required to investigate the effect of swallowing rehabilitation based on treatment duration. second, since the subjects were all diagnosed with sub - acute dysphagia, the study results can not be generalized for all types of dysphagia. thus, caution should be taken in the interpretation of the study results. in this study, both nmes and ttos significantly enhanced the swallowing function of patients with sub - acute dysphagia. to verify the effectiveness of nmes, future follow - up studies of patients with chronic dysphagia are required. | [purpose ] the effectiveness of neuromuscular electrical stimulation in the rehabilitation of swallowing remains controversial. this study compared the effectiveness of neuromuscular electrical stimulation and thermal tactile oral stimulation, a traditional swallowing recovery treatment, in patients with sub - acute dysphagia caused by stroke. [subjects and methods ] subjects of the present study were 55 patients diagnosed with dysphagia caused by stroke. this study had a nonequivalent control group pretest - posttest design. [results ] analysis of pre - post values of videofluoroscopic studies of the neuromuscular electrical stimulation and thermal tactile oral stimulation groups using a paired t - test showed no significant difference between the two groups despite both having decreased mean values of the videofluoroscopic studies after treatment. [conclusion ] this study s findings show that both neuromuscular electrical stimulation and thermal tactile oral stimulation significantly enhanced the swallowing function of patients with sub - acute dysphagia. |
native woody species often demonstrate inherited latitudinal variation in the timing of growth cessation and cold hardiness in response to the latitudinal gradient in temperature (pauley and perry 1954 ; howe. can an introduced species develop such a pattern in a century or two (weber and schmid 1998) ? development of clinal variation could be accelerated by multiple introductions of populations from different latitudes (novak and mack 2001), by hybridization between closely related species from different climates (hurka. 2003), or by epigenetic inheritance of cold hardiness (saxe. 2001). this question can be addressed by studies comparing clinal variation in native and introduced species. the diploid genus tamarix was introduced to north america in the mid-1800s to control erosion and to serve as a drought - tolerant ornamental flowering shrub or tree (robinson 1965). although there are now several tamarix species in the united states (usa), tamarix chinensis lour. and tamarix ramosissima ledeb. tamarix chinensis is native to china, korea, and japan at latitude 2342n and longitude 79110e, whereas t. ramosissima occurs more widely across temperate asia at latitude 3053n and longitude 42127e (baum 1978). although these two species are morphologically distinct in asia (baum 1978), north american specimens can not always be readily distinguished (crins 1989). hereafter, we refer to the complex of t. ramosissima, t. chinensis, and their hybrids as saltcedar. in a study of a single nuclear locus in saltcedar, gaskin and schaal (2002) found that the most common genotype in north america is a heterozygote containing one allele that in asia is found only in t. ramosissima and another allele that in asia is found only in t. chinensis. in other words, these north american heterozygotes have a hybrid genotype that has not been found in asia. although homozygotes for either of the two alleles are also common in north america, it is not possible using a single locus to determine whether they are true t. chinensis and t. ramosissima or cryptic hybrids. for this reason, there is a strong need for analysis of additional loci to characterize the taxonomic status of north american saltcedar. saltcedar is now the second most abundant riparian woody plant in the interior western usa (friedman. 2005), occupying 470 000650 000 ha (zavaleta 2000). because replacement of native cottonwood - willow (populus - salix) communities by saltcedar can be associated with degradation of habitat for vertebrates and increased water loss from evapotranspiration (shafroth. 2005), there is an intense interest in controlling its spread (hart. 2005). to inform such efforts, it is important to know what factors limit saltcedar distribution and to understand how that distribution would be altered by changing temperatures. although the cold hardiness of saltcedar is unknown, there is evidence that cold temperatures may limit its expansion in north america. in the us north of about 39n latitude, saltcedar is relatively scarce, individuals are small, and dieback is frequent (lesica and miles 2001 ; friedman. on the other hand, some populations of saltcedar in montana are growing rapidly (pearce and smith 2003 ; sexton. furthermore, growth chamber experiments comparing northern and southern saltcedar have demonstrated inherited temperature - dependent differences in root genotypic differences among t. chinensis, t. ramosissima, and their hybrids could cause variation in cold hardiness across north america. if a brief residence in north america has limited development of clinal variation in saltcedar, we might expect a stronger cline in a comparable native species. the native riparian tree plains cottonwood [populus deltoides marshall subsp. monilifera (aiton) eckenwalder ] is an important competitor of saltcedar ranging from northern texas to southern manitoba, saskatchewan, and alberta at latitude 3055n and longitude 96114w (van haverbeke 1990 ; friedman. populus deltoides is known to be cold hardy ; buds and stems collected in winter can survive chilling to 80c (sakai and weiser 1973). common - garden studies of cottonwood including p. deltoides have shown inherited latitudinal variation in the timing of fall growth cessation (howe. when grown in massachusetts, p. deltoides from 43 to 46n ceased growing an average of 1 month earlier than p. deltoides from 30 to 32n (pauley and perry 1954). northern cottonwood, therefore, may develop cold resistance earlier in the fall than southern cottonwood. we used a common - garden approach to compare cold hardiness in plains cottonwood and saltcedar collected along a latitudinal gradient in the central usa. we hypothesized that plains cottonwood is more cold tolerant than saltcedar, and that the physiological limits imposed by cold temperatures are consistent with the northern limit to saltcedar distribution in the usa. we expected to find strong latitudinal variation in cold hardiness in plains cottonwood, but not in saltcedar, because there has been little time for evolution of such variation in this introduced species. finally, we used microsatellite analysis in plains cottonwood and saltcedar to investigate genetic variation along the latitudinal gradient. in saltcedar, it was necessary to develop the microsatellite primers to perform the analysis (gaskin. this work is especially important in saltcedar, a widespread dominant tree in north america whose taxonomic status is still uncertain (gaskin and schaal 2002). we hoped to determine to what extent saltcedar in north america behaves as a single population as opposed to two or more isolated populations. we collected plains cottonwood and saltcedar from 15 sites along a latitudinal gradient from 29 to 48n in the central usa (table 1). in february and march of 2005, we collected samples from 25 (or more) distinct genetic individuals of each species at each site, except for the three southernmost sites where plains cottonwood was scarce or absent (table 1). the sampled populations occurred as bands 2200 m wide along the shore of a river or reservoir. we walked along the band and sampled the first 25 plants that had young, rapidly growing stems suitable for vegetative propagation. we planted the cuttings in pots (top diameter = 7 cm, depth = 25 cm) filled with fafard f2-sv growing medium with 25% perlite and no added fertilizer or rooting hormone. we rooted the cuttings under mist in a greenhouse in fort collins, co. on may 31, we moved the plants to a shadehouse in fort collins at latitude 40.58n and longitude 105.14w. the shadehouse is an outdoor space with no walls and a roof of widely spaced boards to reduce direct sun. also shown are the number of individuals collected at each location and the number tested for cold hardiness on april 17, 2006 we determined the change in cold hardiness over time by periodically testing plants from four species latitude combinations : northern and southern plains cottonwood and saltcedar. to conduct a test, we selected a single individual from each of the four species latitude combinations ; different individuals were selected for each test. we performed the test 17 times from september 13, 2005 to june 5, 2006. for the first eight tests, ending with january 23, 2006, the selected species latitude combinations were plains cottonwood from latitudes 33.06 and 47.60n and saltcedar from latitudes 29.18 and 47.60n ; for the final nine tests, beginning with february 6, 2006, we used plains cottonwood and saltcedar from latitudes 34.90 and 45.43n. the change in latitudes was necessary to provide sufficient stem material to perform the tests. we measured cold hardiness of the selected individuals using freeze - induced electrolyte leakage (burr. this method is based on the fact that freezing of stem tissues causes leakage of electrolytes, which can be quantified by measurement of electrical conductivity. to perform a test, we collected a 36-cm piece of current - year stem from each of the four selected individuals. we cut each piece into 1-cm samples and placed each sample in a vial (or test tube) with 1 ml of deionized water and a piece of lead shot to promote nucleation of ice crystals. the 36 samples from each selected individual were divided into six sets of six tubes (or vials). we placed one set (controls) in a refrigerated water bath (fall) or an ice water bath (spring). we placed the remaining five sets in a programmable temperature chamber (testequity model 115, thousand oaks, ca), held them at 2c (fall) or 4c (spring) overnight to ensure that all were frozen, and then exposed them to gradually declining temperatures (5c per hour). at five different temperatures, we removed a set of the samples and temporarily stored them at 4c until all were removed from the chamber. the five temperatures varied seasonally and were chosen to be close to the warmest lethal temperatures for all of the selected individuals. after adding 10 ml (vials) or 4 ml (tubes) of deionized water, we agitated samples for 20 h on a shaker table, measured the conductivity of each vial or tube using an amber science, conductivity meter model 1056 (amber science inc., eugene, or), boiled samples for 20 min, agitated again for 20 h and remeasured the conductivity. 1967) for a frozen 1-cm sample was where it is index of injury resulting from exposure to temperature t, lt is specific conductance of leachate from sample frozen at temperature t, lk is specific conductance of leachate from sample frozen at temperature t and then heat - killed, l0 is specific conductance of leachate from unfrozen control sample, and ld is specific conductance of leachate from unfrozen sample, heat killed. the index of injury is designed to correct for error introduced by variation between samples in the quantity of electrolytes available for leaching following injury (flint. for an individual plant on a given day, this parameter displayed a sigmoid (s - shaped) relationship with temperature. it approached a lower asymptote of 0 at warm temperatures that did not harm the sample, and approached an upper asymptote between 0 and 1 at cold temperatures that killed the sample. comparison to frozen stems held for 2 weeks at room temperature for direct observation of cold - induced mortality indicated that stem samples died when it reached a point midway between the low and high asymptotes. for each of the four individuals selected in a test, we determined the killing temperature using a nonlinear sigmoid regression of the form where t is temperature ; a, b, and c are estimated parameters, such that a is the upper asymptote and (ln(b))/c, the inflection point of the curve, is the killing temperature. we estimated these intervals for the nonlinear model following the format for linear models where an inverse prediction interval for a new value of the independent variable (here temperature, t) takes the form of a prediction interval for a new observation of the dependent variable (here index of injury, it) divided by the slope estimate (neter. 1996:167169). because the nonlinear functional form prohibited this simple algebraic manipulation, we estimated 95% prediction intervals for a new observation of it in the nonlinear model for an interval of values of t and determined the smallest and largest values of t that had 95% prediction intervals for it that included the estimated killing temperature. we measured the variation in cold hardiness over latitude by comparing all individuals with 35 cm of stem (cottonwood, n = 187 ; saltcedar, n = 192) on april 17, 2006. we cut a 35-cm stem piece from each individual, cut each piece into seven 5-cm samples and distributed the samples into zip - lock plastic bags. for each latitude, there were seven plastic bags, each containing one 5-cm sample from each of the selected individuals from that latitude. we placed one bag from each latitude (control) in an ice water bath and the remaining bags in the temperature chamber at 20c. we reduced the temperature to 3.3c in 15 min and held the chamber at that temperature for 14.5 h to ensure that all twigs were frozen. we then lowered the temperature 5c per hour to 71.1c and held this temperature for 11.5 h. we removed one bag from each latitude at 8.5, 20.3, 29.4, 41.9, 55.4, and 71.1c (at the end of the 11.5-h hold). we then placed samples upright in moist sand at room temperature for 2 weeks before determining survival by visual observation (calkins and swanson 1990). live samples had moist bright green inner bark, and often grew new roots and leaves. dead samples had brown green inner bark, which was often dry, and grew no roots or leaves. for a given species at a given latitude, there was a sigmoid relationship between temperature and percent survival similar to the sigmoid relationship observed in the conductivity trials. this allowed us to use an analogous approach designed for categorical (live or dead) data, in which we defined the killing temperature as the temperature at which half of stem samples were killed. for each species latitude combination, we used proc probit in sas (sas institute, inc., cary, nc) to calculate the killing temperature (n = 323 individuals, depending on species and latitude, table 1). finally, for each species, we performed a multivariate probit analysis on all individuals combined using temperature and latitude as independent variables. we assessed genetic similarity among plants using neighbor - joining analysis of microsatellite loci for each species. extraction of dnas, pcr amplications, and fragment analysis were performed as in gaskin. (2006), and for plains cottonwood we used the nine microsatellites : pmgc 61, pmgc 223, pmgc 667, pmgc 2060, pmgc 2088, pmgc 2105 and pmgc 2573 (from international populus genome consortium ssr resource 2007, http://www.ornl.gov/sci/ipgc/ssr_resource.htm) ; wpms14 (smulders. 2001) ; and ptr2 (dayanandan. 1998). for each species, we calculated chord distances (cavalli - sforza and edwards 1967) among latitudes and used these to prepare an unrooted dendrogram. the saltcedar dendrogram included 15 populations (369 individuals) from north america and two populations (12 individuals) from asia. the 12 individuals collected in asia (six t. ramosissima and six t. chinensis) were never introduced to the shadehouse or used for cold - hardiness testing, but were included in this analysis to explore genetic relatedness between north american and asian saltcedar. the plains cottonwood dendrogram included 13 populations (all 304 cottonwood individuals introduced to the shadehouse). all calculations were carried out using the programs seqboot, gendist, neighbor, and consense from the phylip ver. felsenstein 2004). analyses of molecular variance (amova) were carried out for both species using the distance method (weir and cockerham 1984 ; excoffier. 1992 ; weir 1996). as a dioecious species saltcedar has perfect flowers and has been categorized as self - compatible (brotherson and winkel 1986), but stevens (1989) in arizona, found no seeds produced by flowers enclosed in mesh bags to exclude pollinators. using some of our shadehouse individuals planted in a nearby garden, in fort collins, colorado, we also observed no seeds produced by bagged flowers even when we attempted to promote self - pollination using bees on a stick (a. blair, colorado state university, personal communication, 2007). both plains cottonwood and saltcedar were more resistant to cold temperatures in the winter than in the summer, but this seasonal cycle was more extreme in cottonwood (fig. 1). although saltcedar was slightly more cold hardy in the early fall, cottonwood hardened off more rapidly and deeply (fig. in early september, northern and southern individuals of both species were killed by temperatures ranging from 4 to 19c. by mid october, both northern and southern cottonwood survived cooling to 70c, the coldest temperature attainable in our temperature chamber. even when we extended the coldest treatment by holding the chamber at 70c for 13 h, we observed no cold damage to cottonwood during the winter (november through february, data not shown). in contrast, even in mid - winter saltcedar was killed at temperatures ranging from 33 to 47c. fall (a) and spring (b) temporal variation in killing temperature for twigs of northern and southern plains cottonwood (populus deltoides subsp. monilifera) and saltcedar (tamarix ramosissima, tamarix chinensis, and hybrids) grown in fort collins, colorado. saltcedar (sc) data are solid lines, and cottonwood (cw) data are dashed lines. different individuals were used on each sampling date. note that different latitudes were used in the spring and fall. daily minimum temperature data are from the christman field weather station (colorado climate center) about 1 km from the shadehouse. error bars are 95% confidence intervals for an individual sample. from september through january, there was latitudinal variation in cold hardiness of saltcedar (fig. during this period, the killing temperature for saltcedar from 29.18n latitude was 521c higher than that for saltcedar from 47.60n. latitudinal variation in saltcedar was not apparent in the time sequence of cold hardiness measurements from february to may (fig. this may be because of weaker latitudinal variation in the spring or because the latitudes tested in the spring were not as extreme as those tested in the fall (fig. 1). although latitudinal variation was not apparent in the spring at this coarse scale (fig. 1), the detailed data from april 17 showed latitudinal variation for saltcedar (fig. 2), and multivariate probit analysis demonstrated that this latitudinal effect was significant (p 53 and > 43c higher than those for cottonwood from 47.60n. from november 11 to march 13, however, cottonwood from all latitudes survived temperatures down to 70c, the coldest temperature attainable in our temperature chamber, which prevented observations of latitudinal variation during this period (fig. multivariate probit analysis of the detailed data set from plants collected on april 17 showed a significant effect (p < 0.0001) of latitude of origin on the killing temperature for cottonwood (fig. overwinter survival of whole saltcedar plants in the shadehouse was mostly below 0.4 and strongly correlated with latitude of origin (r = 0.58, p = 0.0009, fig. 3), which is consistent with the hypotheses that frost damage is an important source of mortality in saltcedar, and that southern plants are more susceptible to cold than northern plants. in contrast, overwinter survival of whole cottonwood plants in the shadehouse was mostly above 0.4 and uncorrelated to latitude (p = 0.51, fig. 3), suggesting that frost damage was relatively unimportant in plains cottonwood in the winter of 20052006. heavy winter mortality of southern saltcedar is inconsistent with the fact that temperatures from september 2005 through may 2006 were always above the killing temperatures we measured for twigs of these species (fig. 1), suggesting either that saltcedar roots are more sensitive to cold than stems, that prolonged exposure to cold is more damaging than the brief exposures in our freezing trials, or that our application of freeze - induced electrolyte leakage underestimated killing temperatures for saltcedar. monilifera) and saltcedar (tamarix ramosissima, tamarix chinensis, and hybrids) in the shadehouse as a function of latitude of origin. survival is the proportion of plants alive on june 1, 2006. survival was correlated to latitude in saltcedar (p = 0.0009, r = 0.58), but not in plains cottonwood (p = 0.51, r = 0.04). microsatellite analysis demonstrated that neither saltcedar nor cottonwood have strong barriers to gene flow in the central usa. fixation index (fst) was low for both species (0.049 for plains cottonwood and 0.075 for saltcedar), indicating that genetic variation within populations is large compared to variation between populations (table 3). the dendrogram for saltcedar shows a gradual north south genetic gradient with the eurasian parent populations as approximate end members (fig. northern saltcedar is most similar to t. ramosissima and southern saltcedar is most similar to t. chinensis. 4b). analysis of molecular variance (amova) calculated using the distance method for plains cottonwood (populus deltoides subsp. monilifera, 304 individuals) and saltcedar (tamarix ramosissima, tamarix chinensis, and hybrids, 369 individuals) collected along a latitudinal gradient in the central usa unrooted dendrogram of chord distances (cavalli - sforza and edwards 1967) inferred from neighbor - joining analysis of microsatellite loci data. bootstrap values above 50% (vertically oriented) are shown to the left of the respective nodes, and were derived from a consensus of 1000 trees. ultimate dendrogram branches are populations identified by latitude (table 1). (a) dendrogram of 15 us populations (369 plants) of saltcedar (tamarix chinensis, tamarix ramosissima, and hybrids) based on nine microsatellite loci (gaskin. populations of six t. chinensis from china and six t. ramosissima from asia were also included in the analysis for comparison. (b) dendrogram of 13 us populations (304 plants) of plains cottonwood (populus deltoides subsp. monilifera) based on nine microsatellite loci (international populus genome consortium ssr resource 2007, http://www.ornl.gov/sci/ipgc/ssr_resource.htm, smulders. all of our plains cottonwoods survived colder temperatures than are known to occur in the range of this species, suggesting that short - term exposure to extreme cold in mid - winter is not an important mortality factor. other studies have reported extreme cold hardiness in populus (sakai and weiser 1973). cold - related mortality is still possible in cottonwood when plants that are not completely hardened off encounter sudden extreme drops in temperature. in fact, plains cottonwood may be more susceptible to cold damage than saltcedar in early fall and late spring (fig. 1). saltcedar, even when completely hardened off, did not survive below 33 to 47c, which is within the temperature range of the northern great plains. in addition, there was heavy mortality in the shadehouse of southern saltcedar (but not cottonwood) during the winter of 20052006 (fig. whereas saltcedar grows to large size in the southern usa, northern stems are small in size and often older below ground than above (lesica and miles 2001), suggesting that winter die - back may be common in the north. finally, saltcedar is much more abundant in the south than in the north, and its occurrence is strongly correlated to mild winter temperatures (friedman. 2005). we conclude that winter cold is a significant factor influencing distribution of saltcedar in the usa. increases in winter low temperatures could promote northward spread of saltcedar in the future. we observed latitudinal variation in cold hardiness in both plains cottonwood and saltcedar. this variation was expected for the native cottonwood, which is known to exhibit inherited latitudinal variation in the timing of growth cessation (pauley and perry 1954 ; kaszkurewicz and fogg 1967 ; howe. 1995, 1999 ; dunlap and stettler 1996), but not for saltcedar, a woody species that has been present in north america for only about 150 years (robinson 1965). such latitudinal variation in an introduced species may be a result of multiple introductions of genotypically and phenotypically distinct individuals or populations, or of rapid evolution after introduction (maron. the dominance in the north american invasion of hybrids (t. ramosissima t. chinensis) that have not been found in eurasia (gaskin and schaal 2002), the absence of genetic isolation in the north american population (fig. 4), and the fact that north american tamarix are more similar to each other than to eurasian tamarix (fig. 4) support the hypothesis that the observed latitudinal gradient in north america evolved after introduction. hybridization involving t. ramosissima, t. chinensis and possibly other species may have accelerated this process by producing a population that was more heterogeneous with respect to cold hardiness than any of the originally introduced populations. an alternative explanation for the observed latitudinal gradient in saltcedar cold hardiness is a carryover effect. cuttings might have a chemical memory of the climate of the source plant that influences the phenology and cold hardiness of the clones grown in our colorado shadehouse (van zandt and mopper 2002 ; heide 2003). if a carryover effect exists, it could be expected to fade over time as the plants are influenced by the colorado climate. there is a need for multi - year common - garden studies of cold hardiness to investigate whether the observed latitudinal variation fades over time. development of clinal variation in saltcedar cold hardiness could be accelerated by maternal effects (galloway and etterson 2007). for example, in picea abies (norway spruce) temperature and photoperiod experienced by a tree during seed production can affect the cold hardiness of progeny (saxe. spread of introduced species across long environmental gradients is commonly attributed to phenotypic plasticity and multiple introductions (neuffer and hurka 1999 ; novak and mack 2001). the results of this and other studies, however, suggest that invasion can also be facilitated by rapid evolution of clinal variation (weber and schmid 1998 ; sexton. 2002 ; maron. our microsatellite data show a lack of strong genetic isolation among tamarix populations in the central usa, and a gradual trend from individuals that resemble asian t. chinensis in the south to individuals that resemble asian t. ramosissima in the north. this result argues against the possibility that the observed latitudinal variation in cold hardiness reflects multiple introductions of reproductively isolated taxa, and against the possibility that hybrid tamarix in north america are reproductively isolated from sympatric populations of either parent. our results are consistent with the possibility of adaptive radiation from a single, mostly hybrid population, and with the possibility of hybridization and backcrossing following introduction of t. ramosissima in the north and t. chinensis in the south. therefore, some of the latitudinal gradient in saltcedar cold hardiness may be a result of patterns of introduction as opposed to natural selection. future genetic work should focus first on analyzing additional asian samples of t. chinensis and t. ramosissima and other tamarix species to pinpoint the locations of origin and genotypes of material brought to north america, second on developing additional genetic loci to further quantify the genetic structure of the saltcedar population in north america, and third on characterization of specific genes related to cold hardiness (mckay and latta 2002). | to investigate the evolution of clinal variation in an invasive plant, we compared cold hardiness in the introduced saltcedar (tamarix ramosissima, tamarix chinensis, and hybrids) and the native plains cottonwood (populus deltoides subsp. monilifera). in a shadehouse in colorado (41n), we grew plants collected along a latitudinal gradient in the central united states (2948n). on 17 occasions between september 2005 and june 2006, we determined killing temperatures using freeze - induced electrolyte leakage and direct observation. in midwinter, cottonwood survived cooling to 70c, while saltcedar was killed at 33 to 47c. frost sensitivity, therefore, may limit northward expansion of saltcedar in north america. both species demonstrated inherited latitudinal variation in cold hardiness. for example, from september through january killing temperatures for saltcedar from 29.18n were 521c higher than those for saltcedar from 47.60n, and on september 26 and october 11, killing temperatures for cottonwood from 33.06n were > 43c higher than those for cottonwood from 47.60n. analysis of nine microsatellite loci showed that southern saltcedars are more closely related to t. chinensis while northern plants are more closely related to t. ramosissima. hybridization may have introduced the genetic variability necessary for rapid evolution of the cline in saltcedar cold hardiness. |
in 1962, luft,. made a suggestion of mitochondria as an intracellular organelle related to human diseases. they supported the idea with evidence of mitochondrial function abnormality observed in a hypermetabolic patient. later reports also showed respiratory chain dysfunctions in patients with encephalomyopathy confirming the role of mitochondria in human diseases.13 though sometimes the concept of mitochondrial disease is being used to indicate abnormal metabolic pathways within mitochondria, it generally implies an energy metabolic disease caused by abnormal respiratory chain reaction which is followed by decreased energy production with various clinical symptoms as a result. recently, mitochondria is drawing further attention as its role in the aging process and common chronic illness such as chronic heart failure, diabetes mellitus, and neurodegenative diseases become known more and more.46 mitochondrial respiratory chain consist of 5 enzyme complexes including more than 100 different protein units that are needed for oxydative phosphorylation and atp production.7 mitochondrial dna (mitochondrial dna, mtdna) encode for each unit of 4 enzyme complexes among total of 5. it codes for 7 units of complex i (nadh dehydrogenase), 1 of complex iii (cytochrome c reductase), 3 of complex iv (cytochrome c oxidase), and 2 of complex v (atp synthase). respiratory chain reaction produces atp through oxydative phosphorylation using proton concentration difference in the inner membrane of mitochondria.4 oxydative phosphorylation is precisely controlled adjusting to different physiologic circumstances. damage to the ability of oxydative phosphrylation caused by nuclear dna or mitochondrial dna (mtdna) mutations result in different types of mitochondrial diseases. therefore, diverse types of inheritance occur depending on the cause of the original mutation.48 two types of mutation are considered significant in mtdna mutation. if the amount of normal mtdna is enough to compensate the defect in a cell with heteroplasmy, that is coexisting state of mutated and normal mtdna, the damage in respiratory chain reaction can be prevented. however, when the ratio between normal and mutated mtdna is shifted more than certain level, dysfunction of respiratory chain reaction occurs. the threshold level to induce the dysfunction depends on the amount of energy required in a certain tissue. central nervous system, heart, muscle, liver, and kidneys are relatively more prone to manifest clinical symptoms due to their higher energy requirement. the inequable distribution of mtdna occurs during embryonic period can induce unevenness in the proportion of mutated and normal mtdna among different tissues in the same individual or among cells within the same tissue.7,9,10 also, clinical symptoms induced by specific mtdna manifest at a very wide spectrum of severity due to the diversity of mutated mtdna proportion that occur during meiosis and somatic cell division and due to the tissue - specific differences of energy requirement as well. however, subunits of respiratory chain complex are determined much more by nuclear dna than by mtdna. there have been several types of nuclear dna mutation identified till now. in those cases, they follow mendel s law of inheritance with varying phenotypes and not that of maternal inheritance.8,9 mitochondrial diseases can develop at different stages of life - from early embryonic period to adulthood. one of the most important characteristics of mitochondrial disease is the wide variety of clinical symptoms that originate from either single or multiple organs. this diversity comes from degree of heteroplasmy, types of mutations, difference in the threshold value of each tissue for biochemical manifestations, and coordination effect between nuclear and mitochondrial genes.11,12 there is no particular clinical feature that can describe mitochondrial disease. most patients complain a combination of several symptoms originating from different organs such as brain, nerve, muscle, endocrine glands, heart, eye, ear, intestine, kidney, and bone marrow, etc. tissues or organs such as muscle, brain, heart, liver, etc. that require when atypical symptoms appear in relatively common disease involving several organs, one can suspect mitochondrial disease.1214 syndromes such as melas (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke - like episodes), merrf (myoclonus epilepsy and ragged - red fibers), and kearns - sayre syndrome (retinitis pigmentosa, progressive external ophthalmoplegia, ataxia and heart conduction defects) represent mitochondrial diseases.1419 melas and merrf syndrome develop because of the mutation of trna gene while kearns - sayre syndrome develop from large deletion of mtdna genes.17,18 interestingly, clinical symptoms can be quite variable even when related with specific mutation. for example, a3243 g mutation of trna gene is related with progressive external ophthalmoplegia, diabetes mellitus, and melas. the distribution of mtdna mutations and their interactions with other nuclear genes are thought to play an important role, though. pediatric patients usually share mtdna deletion in many different tissues and suffer serious symptoms from various system dysfunctions such as anemia, pancreas failure, nephropathy, hepatic failure, diabetes mellitus, or other endocrinologic abnormalities. ptosis, oculomotor dysfunction, progressive paralysis of extraocular muscle accompanying musculoskeletal weakness indicate kearns - sayre syndrome.15,16 leber s hereditary optic neuropathy (lhon) is a genetic disease with maternal inheritance that causes blindness in young adults. over 90% of its patients show different point mutations in mtdna that are responsible for complex i structure.14,19 point mutation in genes that code atp synthase units cause neurogenic myopathy, ataxia, retinitis pigmentosa (narp), and leigh syndrome. high degree of mtdna mutation results in leigh syndrome which appear in pediatric age while low degree of the mutation causes narp syndrome which is less severe and appear at a later stage of life.20 mitochondrial neurogastrointestinal encephalomyopathy (mngie) syndrome is characterized by decrease in enzyme activities of mitochondrial respiratory chain and other abnormalities of mtdna.21 it is known to be related with mutations of thymidine phosphorylase gene that codes nuclear dna. some say that the inactive thymidine phosphorylase changes cellular thymidine pools necessary to maintain mtdna and that might be responsible for the pathophysiology of mngie syndrome. diagnostic approach should include patient and family history, serological examination, and neurological workup as in diagnosing other diseases and specific biochemical studies, muscle biopsy, and molecular genetic studies as well.22,23 the most useful basic test is to check serum lactate level. in cases when pyruvate oxidation in mitochondria is disturbed due to abnormalities in pyruvate dehydrogenase complex (pdhc), krebs cycle or electron transmission, excessive pyruvate can be either transformed into alanine or reduced to lactate resulting in increase of their blood level. the lactate : pyruvate ratio can be either maintained or increased depending on the degree of oxidation - reduction in tissue. since the increase of serum lactate level can be equivocal in patients with mitochonrial encephalopathy, it is helpful to collect samples from cerebrospinal fluid.24,25 there are some characteristic features of brain mri that are occasionally observed in mitochondrial disease patients.26 in leigh syndrome, one can see bilateral high signal lesions in basal ganglia and brain stem while in melas stroke - like lesions are seen usually in posterior parts of the brain, especially in occipital lobe. abnormal densities can be observed in central white matter in kearns - sayre syndrome and calcification of basal ganglia in cases of kearns - sayre syndrome and melas. confirmation of lactate peak in magnetic resonance spectroscopy can be useful in making diagnosis.27 in most cases, diagnostic approaches to mitochondrial diseases include biochemical assays that measure activities of enzymes in respiratory chain reaction, morphological observation using microscopic tools, and molecular genetic studies to examine mtdna or nuclear dna mutation. though there have been a great improvement in understanding the pathophysiology of mitochondrial disease, no definitely effective mode of treatment has been established yet.28,29 coenzyme q is reported to show two functions as an electron carrier in mitochondrial respiratory chain reaction and as well as a scavenger molecule. riboflavin, tocopherol (vitamin e), succinate, ascorbate (vitamin c), menadione, and nicotinamide have also been used to treat mitochondrial disease with deficiency of specific enzyme. however, gene therapy on defective gene itself is thought as the ultimate way of treating the disease after all.3033 mitochondrial disease is known to be rare. but this might just be due to diagnostic difficulties and the disease might be more common in reality. as the importance of diagnosing mitochondrial disease is widely accepted and many studies in various fields using different kinds of method are in progress, we believe that there will come a day when those efforts bear fruits not only in enabling a precise diagnosis but also in improving its treatment. | mitochondria contain the respiratory chain enzyme complexes that carry out oxidative phosphorylation and produce the main part of cellular energy in the form of atp. although several proteins related with signalling, assembling, transporting, and enzymatic function can be impaired in mitochondrial diseases, most frequently the activity of the respiratory chain protein complexes is primarily or secondarily affected, leading to impaired oxygen utilization and reduced energy production. mitochondrial diseases usually show a chronic, slowly progressive course and present with multiorgan involvement with varying onset between birth and late adulthood. neuromuscular system is frequently affected in mitochondrial diseases. although there is actually no specific therapy and cure for mitochondrial diseases, the understanding of the pathophysiology may further facilitate the diagnostic approach and open perspectives to future in mitochondrial diseases. |
electroporation, a nonthermal phenomenon, is used to enhance the permeability of biological cells and tissues [14 ]. here, an attempt has been made to study the electric field 's effect on tumor tissues thereby leading to the efficacy of electroporation. electroporation involves the rapid structural rearrangement of membrane, in response to an electrically applied electric field. a noticeable effect is a rapid increase in electrical conductivity attributed to the formation of pores in the bilayer lipid membrane. literatures have shown significant trend of progressive electrical changes according to the proliferative characteristics of breast epithelial cells. physiologists also further postulated that malignant transformation resulted from sustained depolarization and a failure of the cell to repolarize after cell division, making the area where cancer develops relatively depolarized when compared to their nondividing or resting counterparts. it leads to the rupturing of membrane wall which can be either reversible or irreversible. electroporation generally depend upon the magnitude and the duration of the voltage, and the field applied. the membrane potential vm is given as (1)vm=1.5ercos, where r is the cell radius and is the angle between the electric field e and the radius vector. a detailed study of electric field distribution is necessary for an effective understanding of the tissue 's behavior when subjected to electric field. in this study the behavior of tissue and the effect of electric field on them are noted in each case. literature has indicated that changes in the electrical properties of abnormal breast are more significant compared to the breast normal tissues. the surface potentials are sensitive to the presence of tumour, location and placement of the electrodes. the results can be used as a complement to experimental analysis, essential for effective manipulation of tissues for practical, real - life applications, such as electroporation - mediated gene therapy and enhancement of chemo - drug delivery (electrochemotherapy) [14 ]. for fast and accurate simulation results, we chose the maxwell 's fem software from ansoft corporation, usa. for this simulation study, a slightly modified version of the more detailed electrical model of a tumor tissue reported by surowiec. three - dimensional models of breast lobe with single tumor and normal cell, with two tumor cells and two normal cells, are simulated for both needle and plate electrode configurations. the maxwell simulator is an interactive package that uses finite element analysis (fea) to solve three - dimensional electrostatic problems. the normal and the tumor cell permittivity and conductivity parameters used for the model are shown in table 1 [9, 10 ]. a high voltage of the order of 1200 v / cm is applied at 1 khz frequency. the electric field across the tissue model for plate electrodes configuration is shown in figures 2 and 3 for normal and tumor cell tissues. the electric field intensity is more for the normal cell tissue than the tumor cell tissue. this could be due to change in membrane structure, composition, and minerals in the tumor cell compared to the normal cell. similar results were obtained also for needle electrode configuration (figure 4). from this electric field distribution values, the transmembrane potential is calculated for the applied voltage. also, from the 3d simulated model of different tissue model the capacitance value is noted and this value is applied to the electrical model using matlab. for this simulation study, a slightly modified version of the more detailed electrical model of a cell reported by schoenbach 's team [12, 13 ] is used. the entire breast lobe with tissues is assumed as a single cell, and simulation is done. here, the tissue is modeled as a homogenous conductive medium (cytoplasm) surrounded by a leaky dielectric membrane. in the above electrical model, the capacitance of the normal cell is replaced by the capacitance value obtained from the ansoft model of the cancer cell developed in this study. to this electrical model, a pulsed electric field of the order of 1200 v / cm is applied with a pulse width of 100 sec and for a time period of one second. the variation in voltage (y - axis) across each element with respect to time (x - axis) is shown in figures 610 for various tissue models studied using plate electrode configuration. figure 6 shows the voltage across various cell elements, such as nucleus, plasma, and conductive cytoplasm for tissue with a normal cell and a tumor cell. figure 7 shows the voltages for a tissue with two normal cells and figure 8 shows that of a tissue with two tumor cells (plate electrodes). there is noticeable difference between the voltages and their profiles for various elements between these two electrode configurations indicating the effect of electrode on the electroporation efficacy [14, 15 ]. figure 10 shows the influence of the electric field orientation on the transmembrane potential (tmp). the orientation is varied from 0 to 70 degrees, and the tmp is evaluated for the applied voltage between the electrodes. it can be inferred that the transmembrane potential tends to decrease with increase in orientation. also, the transmembrane potential of tumor tissue is less than that of the normal tissue. this could also be attributed to the altered cell membrane and other cell parameters of the tumor cell compared to the normal cell. table 2 shows the influence of the electric field orientation on the nuclear membrane potential (nmp). the orientation is varied from 0 to 70 degrees, and the nmp is evaluated for the applied voltage between the electrodes. also, the nmp of tumor tissue is less than that of the normal tissue. this could also be attributed to the altered cell membrane and other cell parameters of the tumor cell compared to the normal cell. a healthy cell membrane potential is strongly linked to the control of cell membrane transport and proliferation mechanisms as well as dna activity, protein synthesis, and aerobic energy production. since cancer cells can not maintain a normal membrane potential, they will have electronic dysfunctions that will impede repair and the reestablishment of normal metabolic functions. therefore, a key therapeutic method for cell repair and cancer treatment would be to reestablish a healthy membrane potential in the body 's cells. in our research, the electric field distribution in normal and tumor tissues was investigated using 3d finite element analysis for plane and needle electrode configurations. the tumor tissues shows lower intensities of electric field compared to the normal tissues, possibly due to the altered characteristics of membrane potential, its composition and minerals such as potassium, magnesium, sodium, and calcium. these results demonstrate the susceptibility of malignant cells to the electric field application and the relative robustness of the normal cells, illustrating the enhanced efficacy of the electrochemotherapy using lower drug doses. the field analysis results can be used for assessing effective treatment parameters of tumor tissues. the electrical characteristics of the membrane and the cytoplasm, such as the conductivity and permittivity of the membrane and the cytoplasm, as well as membrane thickness also govern the response due to electroporation in addition to the intensity and distribution of the electric field applied. our results indicate that electric field analyses could be used for selecting suitable parameters for effective treatment of tumor tissues, since these parameters need to be optimized for various tumors / tissues and cells. | an attractive alternative treatment for malignant tumors that are refractive to conventional therapies, such as surgery, radiation, and chemotherapy, is electrical - pulse - mediated drug delivery. electric field distribution of tissue / tumor is important for effective treatment of tissues. this paper deals with the electric field distribution study of a tissue model using maxwell 3d simulator. our results indicate that tumor tissue had lower electric field strength compared to normal cells, which makes them susceptible to electrical - pulse - mediated drug delivery. this difference could be due to the altered properties of tumor cells compared to normal cells, and our results corroborate this. |
deterioration of renal function with tacrolimus (fk506) therapy has been widely reported in adult patients with normal renal function who underwent liver transplantation [1, 2 ]. a striped pattern of medullary ray fibrosis (also called linear fibrosis) has been described in the kidneys of patients undergoing long - term treatment with the calcineurin inhibitors, cyclosporine, or tacrolimus [35 ]. calcineurin inhibitors can cause this pattern of injury in animals, possibly contributing to the relatively low availability of oxygen in the medullary rays [6, 7 ]. early diagnosis of acute tacrolimus nephrotoxicity in humans prior to fibrosis may better guide evaluation of impaired renal function and serve to justify modification of dosing of the agent. kim-1 is a type i transmembranous protein whose expression is undetectable in normal renal tissue but is markedly upregulated with injury of proximal tubule epithelial cells in rats and is upregulated in human biopsies with tubular injury [9, 10 ]. kim-1 is a receptor involved in phagocytosis and internalization of apoptotic bodies and necrotic debris in injured kidneys ; thus it involves tubular repairing during acute tubular injury. motivated by a case of acute tacrolimus renal injury in a patient status after liver transplant that was characterized by dominant expression of kim-1 in the proximal tubules of the medullary rays, we evaluated whether early proximal tubule injury could be identified by kim-1 expression in the medullary rays in acute nephrotoxicity from tacrolimus. in the initial case, frozen sections of the renal biopsy were cut for direct immunofluorescent stains of igg, iga, igm, c3, c1q, kappa, lambda, and albumin, using a dako autostainer (carpinteria, ca). the remaining renal tissue was divided into two parts and fixed with 10% formalin for light microscopy and 3% glutaraldehyde for electron microscopy, respectively. formalin fixed tissue was embedded, sectioned, and examined using hematoxylin - eosin (he), periodic acid schiff (pas), and masson 's trichrome for light microscopy. after fixation, tissue for electron microscopy was routinely postfixed in osmium tetroxide, embedded in resin, sectioned, and stained with uranyl acetate and lead citrate. slides for light microscopy were treated for 20 minutes using a heat - induced antigen retrieval protocol (target retrieval solution, dakocytomation, carpinteria, ca). a mouse monoclonal antibody (akg7), directed against the ectodomain of human kim-1, was used as the primary antibody in this study. joseph v. bonventre, renal division, brigham and women 's hospital, boston) was applied for one hour, peroxidase - labeled goat anti - mouse secondary antibody (env+ kit, dakocytomation) for 30 minutes, and the chromagen dab (3,3-diaminobenzidine, env+ kit, dakocytomation) for ten minutes to achieve a brown kim-1 stain in the proximal tubules. to extend our observation that kim-1 may be helpful in identifying acute tacrolimus nephrotoxicity, we evaluated 45 protocol renal transplant biopsies and 39 indicated renal transplant biopsies with acute tubular injury from patients maintained on tacrolimus treatment from 2005 to the end of 2007 (the study protocol was proven by the institute research board). in both protocol biopsies and indicated biopsies, any cases with significant inflammation (related to subclinical acute cellular rejection or acute cellular rejection) were excluded from the study because we wanted to focus on noninflammatory injury. the staining intensity scores of epithelial cells were graded from 0 to 3 + (0 : no staining ; + / [0.5 ] : focal weak fine granular staining ; 1 + : more widespread weak fine granular staining ; 2 + : moderate granular staining ; and 3 + : strong large granular staining). data among the three groups were compared using an anova test. a p value less than 0.05 was considered significantly different. a 45-year - old man, with liver failure due to hepatoma and alcoholic cirrhosis and with normal renal function, underwent orthotopic liver transplantation. he received a postmortal liver transplant and was on maintenance treatment with tacrolimus at 4 mg twice a day, mycophenolate mofetil 500 mg twice a day, and prednisone 20 mg daily. following liver transplantation his liver function returned to normal (table 1). a month following the liver transplantation, he presented with acute kidney injury with a serum creatinine of 3 mg / dl. his serum tacrolimus level was found to be acutely elevated at 28 ng / dl from a maintenance level of about 8 ng / dl. he underwent a kidney biopsy to identify the cause of his acute kidney injury. by light microscopy, nineteen normal glomeruli were present without thrombi, diffuse proliferation, or crescent formation noted in the two renal cortical tissues submitted. proximal tubules in medullary rays were mixed with distal nephron tubules and appeared not remarkable by routine light microscopy. when the tissue was stained for kim-1, however, the luminal surface of proximal tubules located in medullary rays (pars recta), but not around the glomeruli (pars convoluta), demonstrated positive expression of kim-1 (figure 1), suggestive of acute tubular injury from tacrolimus nephrotoxicity. staining of the glomeruli for igg, iga, igm, c1q, c3, kappa, and lambda was negative by immunofluorescence. electron microscopy revealed normal thickness of glomerular capillary loops with well - maintained foot processes of glomerular visceral epithelium. no immune complex deposits were ultrastructurally identified in the four glomeruli. based on these findings, the tacrolimus dose was reduced and his serum levels returned to therapeutic range. the patient 's serum creatinine fell to 1.4 mg / dl over the ensuing 11 days. a year after the liver transplantation, the patient 's liver function was normal and his serum creatinine was 1.0 mg / dl (table 1). this case motivated us to examine the kim-1 staining pattern in a total of 84 renal transplant biopsies in 82 patients who had been taking tacrolimus (from 2005 to the end of 2007, blindly evaluated by plz only). in 45 cases the biopsies were protocol biopsies and the remaining 39 were indicated biopsies due to elevation of serum creatinine. group 1 (n = 13) consisted of patients who showed no kim-1 staining in the biopsies (13 protocol biopsies, 0 indicated biopsies). group 2 (n = 28) included 22 indicated biopsies and 6 protocol biopsies in which kim-1 staining was present in most of cortical proximal tubules, both around glomeruli (pars convoluta, also called s1 segment) and in medullary rays (pars recta, also called s2 segment). group 3 (n = 43) consisted of 17 indicated renal biopsies and 26 protocol biopsies that revealed kim-1 staining only in the proximal tubules located in the medullary rays (pars recta). two patients in group 3 required repeat biopsies. in the analysis of 45 protocol biopsies and 39 indicated renal transplant biopsies from patients on tacrolimus, the patients with kim-1 staining in both s1 and s2 segments (group 2) had the highest kim-1 expression scores and serum creatinine levels (table 2). the serum levels of tacrolimus, however, were higher in group 3 where kim-1 staining was localized exclusively to the proximal tubules located in the medullary rays (pars recta) than in either group 1 (no kim-1 staining) or group 2 (kim-1 staining in both pars convoluta and pars recta). in 43 (51%) of 84 cases (including both indicated and protocol biopsies) and 17 (44%) out of 39 indicated biopsies, kim-1 protein expression was seen in proximal tubules of medullary rays (pars recta), suggesting that acute tacrolimus toxicity may be more common than what is currently recognized as a cause of renal injury. in addition, 32 (71%) of 45 protocol biopsies exhibited kim-1 positive staining (13% in group 2 and 58% in group 3), reflective of ongoing injury (presumably from medications or other etiologies such as immune challenge from recipients), even when serum creatinine levels remain in the normal range. acute nephrotoxicity has been attributed to hemodynamic changes characterized by renal vasoconstriction that is dose - related and reversible. on the other hand chronic pathologic changes include tubular atrophy, afferent arteriolar hyalinosis, and striped interstitial fibrosis (also called linear fibrosis) with mononuclear cell infiltration [1, 5 ]. therefore, early detection of acute tacrolimus nephrotoxicity may preserve kidney function through adequate modification in tacrolimus doses. it is often difficult to identify tacrolimus toxicity on a renal transplant biopsy especially if the patient is on a number of nephrotoxic drugs. in humans, some factors that can change the tacrolimus levels may include compliance of patients to take the medication, dehydration state (summer or winter), renal function to excrete the medications, and body weight of recipients. in addition, many factors may also accelerate the tacrolimus toxicity as each transplant recipient has only one graft (half of normal glomerular filtration rate), and transplant patients have different types of grafts (postmortal donor, donor pathology, living related / nonrelated donor) and their own existing health issues. serum tacrolimus levels and potentially tacrolimus toxicity are affected by other medications especially some of the antibiotics. as this study indicates, episodes of increased serum levels of tacrolimus can potentially cause acute injury to the renal allograft which may affect the long - term survival of the transplanted kidney. the specific injury caused by elevated tacrolimus levels can be identified by kim-1 staining of the proximal tubules in the medullary rays (pars recta) of the renal allograft biopsy. our data with kim-1 expression in medullary rays (pars recta) in protocol biopsies suggests that tacrolimus nephrotoxicity can be a subclinically insidious process in many patients, which may lead to chronic injury and linear fibrosis in the medullary rays when the drug is taken at maintenance doses. the proximal tubular injury in medullary rays (pars recta), highlighted by kim-1 expression, may be the precursor lesion of subsequent linear fibrosis characteristically found on renal biopsies of patients with chronic tacrolimus toxicity (figure 2). deterioration of renal function with tacrolimus (fk506) therapy has been widely reported in adult patients with normal renal function who underwent liver transplantation [1, 2 ]. a striped pattern of medullary ray fibrosis has been described in the kidneys of patients undergoing long - term treatment with the calcineurin inhibitors, cyclosporine, or tacrolimus [35 ]. calcineurin inhibitors can cause this pattern of injury in animals [6, 7 ], possibly contributing to the relatively low availability of oxygen in the medullary rays. there is currently no consistently recognized pathological pattern for early diagnosis of acute tacrolimus nephrotoxicity, although thrombotic microangiopathy and osmotic changes in renal tubules can be identified during prominent acute tacrolimus nephrotoxicity. early diagnosis of acute tacrolimus nephrotoxicity in humans prior to fibrosis may better guide evaluation of impaired renal function and serve to justify modification of dosing of the agent. kim-1 is a type i transmembranous protein whose expression is undetectable in normal renal tissue but is markedly upregulated with injury of proximal tubule epithelial cells in rats and humans [810 ]. kim-1 is a receptor involved in phagocytosis and internalization of apoptotic bodies and necrotic debris in injured kidneys. in our current case, the pars recta in medullary rays was hard to distinguish from the distal nephron tubules by light microscopy, which may result in assuming normal pars recta epithelia. kim-1 staining, however, was markedly positive in pars recta in medullary rays whereas the pars convoluta did not express this specific injury marker. this index case plus the finding that this specific pars recta staining is correlated with high systemic levels of tacrolimus suggests that kim-1 expression can highlight subtle tubular injury in medullary rays where vulnerable proximal tubules are located and identify the very early stages of tacrolimus toxicity. in summary, our initial case is a good self - control study to document acute nephrotoxicity of tacrolimus. this patient has normal renal function before liver transplantation and tacrolimus treatment but he was found to have acute renal failure when his serum tacrolimus level was accumulated following the liver transplantation. when we found acute tubular injury highlighted by kim-1 expression in the s2 segment of proximal tubules (vulnerable to calcineurin inhibitor toxicity), the treatment with tacrolimus was withdrawn, tacrolimus level was dropped to normal, and patient 's renal function returned to normal level again. with additional studies of kim-1 expression and its close association with the serum levels of tacrolimus in more transplant recipients, we conclude that kim-1 is a sensitive injury biomarker detecting the early acute tacrolimus nephrotoxicity in proximal tubules. kim-1 staining can be used to establish the cause of acute kidney injury from this drug by its specific and characteristic staining of the proximal tubules located in the medullary rays (pars recta) in the setting of sparing of the proximal tubules around the glomeruli (pars convoluta). kim-1 staining may also be an early marker for predicting the subsequent development of the chronic irreversible fibrosis that is known to be associated with tacrolimus therapy, as prolonged kim-1 presence in the injured kidneys may be associated with increased interstitial fibrosis in a recent study. recognition of this toxicity can motivate enhanced surveillance and potentially the modification of dosing well before changes in renal function and chronicity become apparent. | tacrolimus (fk506) is one of the principal immunosuppressive agents used after solid organ transplantations to prevent allograft rejection. chronic renal injury induced by tacrolimus is characterized by linear fibrosis in the medullary rays ; however, the early morphologic findings of acute tacrolimus nephrotoxicity are not well characterized. kidney injury molecule-1 (kim-1) is a specific injury biomarker that has been proven to be useful in the diagnosis of mild to severe acute tubular injury on renal biopsies. this study was motivated by a patient with acute kidney injury associated with elevated serum tacrolimus levels in whom kim-1 staining was present only in proximal tubules located in the medullary rays in the setting of otherwise normal light, immunofluorescent, and electron microscopy. we subsequently evaluated kim-1 expression in 45 protocol and 39 indicated renal transplant biopsies to determine whether higher serum levels of tacrolimus were associated with acute segment specific injury to the proximal tubule, as reflected by kim-1 staining in the proximal tubules of the cortical medullary rays. the data suggest that tacrolimus toxicity preferentially affects proximal tubules in medullary rays and that this targeted injury is a precursor lesion for the linear fibrosis seen in chronic tacrolimus toxicity. |
previous articles (mcbride., 1992, 1996 ; millar., 1996 ; goping., 1998) these include isolation of rat heart mitochondria, transcription - translation of plasmids encoding vdac and preornithine carbamyl transferase (poct), and import of s - labeled translation products into mitochondria in vitro. recombinant glutathione s - transferase (gst)human tom201 - 29 (formerly named gst-30htom20), lacking the nh2-terminal transmembrane segment of htom20, was expressed in topp2 cells and purified (schleiff., 1997). protein immobilized on glutathione - sepharose 4b was washed and suspended in 20 mm napo4, ph 7.4, 150 mm nacl, 1 mm dithiothreitol, 0.5 mm cacl2, and incubated with 5 g / ml thrombin for 18 h at 4c, generating htom201 - 29 with an extra gly residue at the nh2 terminus derived from the thrombin cleavage site. the mixture was passed through a mono s hr 5/5 column and protein was eluted with a linear gradient (buffer a, 10 mm mes, ph 5.0 ; buffer b, 10 mm 3-cyclohexylamino-1-propane sulfonic acid, ph 10, 500 mm nacl). peak fractions containing htom201 - 29 were resolved on a superdex 200 column in 10 mm hepes, ph 7.0, and 100 mm nacl. fractions containing the purified protein were dialyzed against the same buffer containing 5 mm dtt and the protein concentrated to 1.5 mg / ml. plasmid encoding gst - htom201 - 29 was manipulated by standard recombinant dna procedures to substitute cys at htom20 codon position 100 with ser and to introduce ser - cys after gly at the thrombin cleavage site. the thrombin cleavage product, htom201 - 29/n - gsc / c100s, was generated and purified as above. approximately 100 nm large unilamellar vesicles (luvs) (lipid composition : pc, phosphotidylcholine ; pe, phosphotidylethanolamine ; pi, phosphotidylinositol ; ps, phosphotidylserine ; pc / pe / pi / ps at molar ratios of 55:28:13:3 or pc / pe / pi / ps / pe - bmps at molar ratios of 54.5:27.5:13:3:1) were prepared in 170 mm sucrose, 20 mm tris acetate, ph 7.0, and 2 mm cacl2 (shahinian and silvius, 1995). luvs containing -maleimidopropionic acid n - hydroxysuccinimide ester of pe (pe - bmps) were incubated for 12 h at 4c with htom201 - 29/n - gsc / c100s (10-fold molar excess relative to pe - bmps ; coupling efficiency, 8595%) followed by two 30 min incubations with excess luvs generated in medium lacking sucrose (100 mm nacl, 20 mm tris acetate, ph 7.0, and 2 mm cacl2) to competitively remove unincorporated htom20. sucrose - loaded luvs containing the covalently attached cytosolic domain of htom20 were recovered by centrifugation at 50,000 g for 60 min in a beckman 75ti rotor. previous articles (mcbride., 1992, 1996 ; millar., 1996 ; goping., 1998) these include isolation of rat heart mitochondria, transcription - translation of plasmids encoding vdac and preornithine carbamyl transferase (poct), and import of s - labeled translation products into mitochondria in vitro. recombinant glutathione s - transferase (gst)human tom201 - 29 (formerly named gst-30htom20), lacking the nh2-terminal transmembrane segment of htom20, was expressed in topp2 cells and purified (schleiff., 1997). protein immobilized on glutathione - sepharose 4b was washed and suspended in 20 mm napo4, ph 7.4, 150 mm nacl, 1 mm dithiothreitol, 0.5 mm cacl2, and incubated with 5 g / ml thrombin for 18 h at 4c, generating htom201 - 29 with an extra gly residue at the nh2 terminus derived from the thrombin cleavage site. the mixture was passed through a mono s hr 5/5 column and protein was eluted with a linear gradient (buffer a, 10 mm mes, ph 5.0 ; buffer b, 10 mm 3-cyclohexylamino-1-propane sulfonic acid, ph 10, 500 mm nacl). peak fractions containing htom201 - 29 were resolved on a superdex 200 column in 10 mm hepes, ph 7.0, and 100 mm nacl. fractions containing the purified protein were dialyzed against the same buffer containing 5 mm dtt and the protein concentrated to 1.5 mg / ml. plasmid encoding gst - htom201 - 29 was manipulated by standard recombinant dna procedures to substitute cys at htom20 codon position 100 with ser and to introduce ser - cys after gly at the thrombin cleavage site. the thrombin cleavage product, htom201 - 29/n - gsc / c100s, was generated and purified as above. approximately 100 nm large unilamellar vesicles (luvs) (lipid composition : pc, phosphotidylcholine ; pe, phosphotidylethanolamine ; pi, phosphotidylinositol ; ps, phosphotidylserine ; pc / pe / pi / ps at molar ratios of 55:28:13:3 or pc / pe / pi / ps / pe - bmps at molar ratios of 54.5:27.5:13:3:1) were prepared in 170 mm sucrose, 20 mm tris acetate, ph 7.0, and 2 mm cacl2 (shahinian and silvius, 1995). luvs containing -maleimidopropionic acid n - hydroxysuccinimide ester of pe (pe - bmps) were incubated for 12 h at 4c with htom201 - 29/n - gsc / c100s (10-fold molar excess relative to pe - bmps ; coupling efficiency, 8595%) followed by two 30 min incubations with excess luvs generated in medium lacking sucrose (100 mm nacl, 20 mm tris acetate, ph 7.0, and 2 mm cacl2) to competitively remove unincorporated htom20. sucrose - loaded luvs containing the covalently attached cytosolic domain of htom20 were recovered by centrifugation at 50,000 g for 60 min in a beckman 75ti rotor. standard protein import was conducted by combining rat heart mitochondria with human vdac synthesized in reticulocyte lysate. in this system, the preprotein translocation pore can be jammed by partially importing a chimeric protein containing a matrix - targeting signal fused to dihydrofolate reductase (dhfr). unfolding of the dhfr moiety on the cytosolic side of the outer membrane is prevented by the high - affinity dhfr active site inhibitor, methotrexate (mtx ; eilers and schatz, 1986 ; vestweber., 1989). in the presence of mtx, excess podhfr (sheffield., 1990), a chimeric protein consisting of the matrix targeting signal of poct fused to dhfr and purified from expressing bacteria, blocked import and processing of poct (fig. 1 a, lower panel, lanes 3 and 4), whose processed form otherwise acquires resistance to external trypsin (fig. in addition to inhibition of poct import, podhfr / mtx inhibited outer membrane insertion of ytom70(1 - 29)dhfr (fig. 1 b), also designated pomd29, a chimeric protein comprised of the transmembrane signal - anchor domain of yeast tom70 fused to dhfr, whose insertion into the outer membrane of heart mitochondria in vitro has been documented previously (li and shore, 1992 ; mcbride., 1992). ytom70(1 - 29)dhfr is inserted into the outer membrane in the nin - ccyto orientation (li and shore, 1992 ; mcbride., 1992) and therefore, its import in the absence of competing podhfr was unaffected by mtx (not shown). in contrast to poct and ytom70(1 - 29)dhfr, import and membrane insertion of vdac in this system, assessed by the temperature - sensitive acquisition of resistance to alkaline extraction (fujiki., 1982 ; goping. 1 a, upper panel, compare lanes 7 and 8), was relatively unaffected by podhfr / mtx (fig. 1 a, upper panel, lanes 8 and 9). the slight reduction in vdac import at 5 min effected by podhfr / mtx may relate to the fact that preproteins like podhfr can stimulate recruitment of tom20 into the translocation complex, thereby competitively reducing the amount of free tom20 in the membrane that is available for interaction with vdac (rapaport., 1998). the failure of partially translocated podhfr / mtx to block membrane insertion of vdac suggested that vdac may bypass the requirement for the tom40 translocation pore during import. to address this question further, import of vdac was examined using isolated yeast mitochondria containing a temperature - sensitive mutant of tom40 (kassenbrock., 1995). in contrast to control mitochondria, temperature - sensitive tom40 mitochondria were incapable of importing the matrix preprotein form of cytochrome oxidase subunit va (cox va) at the nonpermissive temperature (37c), as judged by the failure of pcox va to be processed by the mitochondria at 37c (fig. 1 c, lane 4), while processing of pcox va was observed at the permissive temperature of 23c. in contrast to pcox va, membrane insertion of vdac occurred at both 23 and 37c (fig. 1 c). the slight decrease in membrane insertion of vdac at 37c compared with 23c was similar for both wild - type and temperature - sensitive tom40 mitochondria (fig. 1 c), suggesting that this difference was related to events other than the temperature - sensitive phenotype of tom40. the cytosolic domain of htom20, htom201 - 29, when included as a soluble entity in excess in the import reaction, inhibited import of poct (fig. 1 a, lower panel, compare lanes 8 and 10), presumably because it sequestered the preprotein through direct protein interaction (schleiff., 1997) and prevented transfer of the preprotein to the translocation machinery. htom201 - 29 can also physically interact with vdac (schleiff., 1997). in distinct contrast to poct, however, htom201 - 29 did not interfere with insertion of vdac into the outer membrane. 1 a, upper panel, compare lanes 8 and 10), suggesting that potential interactions between vdac and htom201 - 29 in the import reaction must be readily reversible. moreover, the difference in response of poct and vdac to htom201 - 29 in the import reaction suggested a potential fundamental difference in the import pathways of the two proteins. however, the results also imply that a complex of vdac and soluble htom201 - 29 can make contact with the mitochondrial surface in vitro, a suggestion that is compatible with the observed binding of the cytosolic domain of htom20 to lipid surfaces in vitro (schleiff and turnbull, 1998 ; fig. 2 a). to assess the possibility that htom20 can mediate direct insertion of vdac into a membrane lipid bilayer, synthetic luvs were created in which the cytosolic domain of htom20 was linked to the bilayer surface via covalent attachment to pe - pmbs (fig. 2 a). to that end, the protein was modified to contain a unique cys at the nh2 terminus of htom201 - 29 ; the other cys located at codon position 100 was converted to ser. these changes did not influence the ability of the receptor to interact with either vdac or poct in vitro (data not shown). the liposomes had a phospholipid composition similar to that of total mitochondrial outer membrane in rat liver (de kroon., 1997). under the conditions used for mitochondrial protein import reactions with vdac synthesized in reticulocyte lysate such liposomes were found to efficiently insert the protein, as determined by acquired resistance to extraction at alkaline ph or with urea (fig. moreover, the resulting import product was resistant to treatment with trypsin (lane 4), reflective of vdac in native membranes (colombini., 1996 ; mannella, 1997). luvs bearing the htom20 cytosolic domain did not translocate poct, as judged by the failure of poct to acquire resistance to trypsin (fig. 2 b, lower panel), nor did they insert ytom70(1 - 29)dhfr, as judged by its extractability from liposomes with 7 m urea (not shown). furthermore, vdac that associated with luvs lacking the htom20 cytosolic domain exhibited facile interliposomal transfer (fig as expected, vdac that was inserted into the luv lipid bilayer by the htom20 cytosolic domain did not transfer to subsequently added protein - free luvs. in contrast, poct that bound to luvs containing the htom20 cytosolic domain could subsequently transfer to protein - free luvs, but slower than poct that bound to luvs lacking htom20 (t1/2, 15 versus 1 min ; fig. this finding is consistent with the ability of htom20 to physically interact with poct (schleiff., 1997). moreover, the relatively slow dissociation of poct from the htom20 cytosolic domain explains the ability of excess htom201 - 29 to inhibit import of poct into mitochondria in vitro (fig. finally, vdac that had been inserted into luvs by the htom20 cytosolic domain was examined for its ability to transport a physiological substrate of this channel protein, atp (rostovtseva and colombini, 1997 ; lee., 1998). p]atp before the import reaction, and the subsequent release of atp was measured at various times after the initiation of the reaction. insertion of a single functional vdac channel into the vesicle would be predicted to release encapsulated atp. release of radioactive atp commenced immediately upon initiation of vdac insertion into liposomes (fig. egress of atp was dependent on functional vdac, inhibited by a known antagonist, nadh (zizi., 1994), and required the presence of the htom20 cytosolic domain on the liposome surface to integrate vdac into the lipid bilayer. in contrast, the control protein poct did not stimulate atp export from luvs alone or luvs with htom20 (fig. the first indication that a -barrel protein like vdac might not require a complex preprotein translocation machinery for insertion into a membrane lipid bilayer came with the observation that purified detergent - solubilized vdac can spontaneously integrate into planar lipid bilayers as a functional entity. moreover, in this system insertion is cooperative as a result of self - mediated stimulation (xu and colombini, 1996). although the lag period for this insertion was relatively long, the results suggest an inherent ability of the molecule to partition into a lipid bilayer, but presumably this is because the detergent - extracted entity is in a favorable state for lipid bilayer integration. however, in normal physiology, other considerations apply : the question of membrane specificity ; the problem of competing interactions of vdac with other proteins, specific or otherwise ; the necessity to maintain a conformation of soluble vdac after release from the ribosome that is compatible with subsequent membrane insertion ; and the requirement for a mechanism to catalyze vdac insertion upon contact with the mitochondrial outer membrane. in the import reaction documented here, the appropriate translocation - competent conformation for vdac may be supplied by chaperones / factors present in reticulocyte lysate (smith. the only other minimum requirement was provided by htom20 on the surface of the membrane. while it is impossible to rule out any involvement of the tom40 translocation pore, its contribution to vdac membrane insertion was not detected in the assays described here, whereas its influence on import of matrix poct and pcox va, and on membrane insertion of outer membrane tom70(1 - 29)dhfr was pronounced. in addition to its role as a receptor in directing newly synthesized vdac exclusively to the mitochondrial outer membrane within the context of a whole cell, our results suggest that htom20 is capable of catalyzing direct insertion of the protein into the lipid bilayer. the receptor may accomplish this simply by bringing vdac into close proximity to the bilayer and/or by triggering release of presumptive chaperones or other factors from vdac that otherwise maintain the protein water - soluble. in either scenario, vdac may spontaneously insert into the proximate bilayer. alternatively, or in addition, htom20 may play a direct role in guiding the conformational change that allows the transbilayer -barrel channel to form. soluble cytosolic domain of htom20 stimulates insertion of vdac into the outer membrane of rat heart mitochondria in vitro by a pathway that is independent of the preprotein translocation pore. (a) s - labeled transcription - translation products of human vdac and rat poct in reticulocyte lysate were subjected to standard protein import reactions in the presence of purified rat heart mitochondria for the indicated times at 4c (lanes 2 and 7) or 30c (lanes 1, 36, and 811) in the absence (lane 1) or presence (lanes 211) of mitochondria. also included in the reactions were 15 g purified podhfr (sheffield., 1990) and 2 mm mtx (lanes 4, 6, 9, and 11), or 15 g purified cytosolic domain of htom20, htom201 - 29 (lanes 5, 6, 10, and 11). at the end of the reactions, the mitochondria were either treated with trypsin (poct, lanes 711 ; mcbride., 1992) or extracted with 0.1 m naco3, ph 11.5 (alkali, vdac lanes 811 ; goping., 1998). the bar graph quantifies the radioactive bands from import reactions of vdac at 30 min, using a power macintosh 7200/120 and nih image v1.61 image analysis software. shown the bar numbers refer to the lane numbers in the vdac (30 min) fluorogram. (b) import (30 min) of [s]vdac, [s]poct, and [s]ytom70(1 - 29)dhfr (previously called pomd29 ; mcbride., alkaline - resistant vdac and ytom70(1 - 29)dhfr and processed poct were analyzed and quantified as in a. (c) same as a, except that import of [s]vdac or yeast [s]pcox va was conducted using mitochondria isolated (daum., 1982) from wild - type saccharomyces cerevisiae (strain d273 - 10b) or from a yeast strain (kky3.3) harboring a temperature sensitive mutation in tom40 (kassenbrock., 1995), and incubated at the nonpermissive (37c) or permissive (23c) temperatures for tom40 for 60 min before conducting import reactions. import was for 30 min at 4, 23, or 37c, as indicated. p, precursor form of cox va ; m, mature form of cox va. (a) schematic illustration of covalent coupling of cytosolic domain of htom20 (htom-201 - 29/n - gsc / c100s ; see materials and methods) to the pe - pmbs incorporated into preformed luvs. (b) standard protein import reactions contained sucrose - loaded luvs (diameter 100 nm ; 0.02 mm lipid ; 1.0 mol% pe - pmbs), with or without covalently attached htom20 (90 nm), and were incubated for 10 min at room temperature with [s]vdac or [s]poct. after a 20-fold dilution with reaction medium, the luvs were recovered by centrifugation at 170,000 g in an airfuge. recovery of sucrose - loaded luvs after centrifugation in all reactions was > 95%, as judged by incorporation of 0.1 mol% rhodamine - labeled pe and detection by fluorescence. the pellets were subjected to extraction with 0.1 m naco3, ph 11.5 (alkali ; goping. 1998), or with 8 m urea, 40 mm hepes, ph 7.0 (urea). alternatively, reactions were cooled to 4c and incubated with trypsin (1.0 g) for 20 min, followed by incubation for 20 min with 10 g soybean trypsin inhibitor before dilution and recovery of luvs. final liposomal pellets were subjected to 10% sds - page and the products were visualized by fluorography. (c) import reactions were conducted with [s]vdac or [s]poct in the presence of sucrose - loaded luvs (0.07 mm lipid) with or without attached cytosolic domain of htom20. after 10 min, a 10-fold molar excess of plain lipid vesicles lacking sucrose was added for the indicated time periods, the sucrose - loaded vesicles were isolated by centrifugation as described above, and the associated [s]vdac or [s]poct was quantified by scintillation counting (expressed as percent of total input). shown sucrose - loaded luvs with or without covalently attached htom20 and containing 1.8 mm [p]atp (20 ci / mol) were incubated in a standard protein import reaction (goping., 1998) with vdac or poct transcription - translation products in the presence or absence of 1 mm nadh. at the indicated times, 20 vol of import reaction medium was added, the luvs were collected by centrifugation, and radioactivity in the supernatant was determined as in fig. 2 b. shown are the average of the normalized results of three determinations with standard deviations (maximum radioactivity = 2,100 cpm). the range of total encapsulated atp released from luvs - tom20 by vdac at 15 min was 510%. | insertion of newly synthesized proteins into or across the mitochondrial outer membrane is initiated by import receptors at the surface of the organelle. typically, this interaction directs the precursor protein into a preprotein translocation pore, comprised of tom40. here, we show that a prominent -barrel channel protein spanning the outer membrane, human voltage- dependent anion - selective channel (vdac), bypasses the requirement for the tom40 translocation pore during biogenesis. insertion of vdac into the outer membrane is unaffected by plugging the translocation pore with a partially translocated matrix preprotein, and mitochondria containing a temperature - sensitive mutant of tom40 insert vdac at the nonpermissive temperature. synthetic liposomes harboring the cytosolic domain of the human import receptor tom20 efficiently insert newly synthesized vdac, resulting in transbilayer transport of atp. therefore, tom20 transforms newly synthesized cytosolic vdac into a transmembrane channel that is fully integrated into the lipid bilayer. |
heart rate, perhaps the most commonly measured vital sign in clinical practice, is a key determinant of myocardial metabolism and cardiac output. tachycardia, conventionally defined as an atrial and/or ventricular rate of > 100 beats per minute (bpm) has an arbitrary and debated definition. nevertheless, tachycardia can be of importance, since it can cause myocardial ischemia, hypotension, low cardiac output, peripheral hypoperfusion, severe symptoms (chest pain, weakness, syncope, lightheadedness), cardiomyopathy, cardiac arrest and death. tachycardias can be broadly classified as : sinus tachycardia (appropriate physiologically and inappropriate) ; postural orthostatic tachycardia syndrome (pots) ; supraventricular tachycardia (atrial tachycardia, av nodal reentrant tachycardia and av reentrant tachycardia) ; atrial flutter with rapid ventricular response ; atrial fibrillation with rapid ventricular response ; junctional tachycardia ; or ventricular tachycardia. sinus tachycardia (heart rate > 100 bpm) is the form encountered most commonly in clinical practice. the vast majority of sinus tachycardia is physiological and associated with catecholaminergic triggers (e.g. emotions, physical activity, and other stresses). the evaluation and management of persistent sinus tachycardia involves careful assessment of whether tachycardia is an appropriate response or not, the discussion of which is beyond the scope of this manuscript. a small percentage of patients can have persistent sinus tachycardia without any underlying illness or structural heart disease, and are classified as having inappropriate sinus tachycardia. inappropriate sinus tachycardia is under - recognized, can be associated with debilitating symptoms and poses significant management challenges. postural orthostatic tachycardia syndrome (pots), a neurally - mediated disorder (defined as orthostatic tachycardia of > 30 beats from baseline or a heart rate > 120 bpm with no significant blood pressure changes), can be associated with significant symptoms. supraventricular tachycardia (i.e. tachycardia requiring tissue above the his bundle to perpetuate) can be associated with severe symptoms, but is rarely life - threatening. ventricular tachyarrhythmias can be idiopathic (in the setting of a structurally normal heart) to life - threatening (in the setting of structural heart disease including cardiomyopathy). persistent tachycardia of any form can cause tachycardia - mediated cardiomyopathy (tmc), can precipitate heart failure and can result in death. if tmc is the direct consequence of tachycardia, it is referred to as tachycardia - induced cardiomyopathy or tmc is partially or completely reversible, when measured by heart failure symptoms and left ventricular ejection fraction, once the culprit tachycardia is treated adequately. atrial fibrillation with persistent rapid ventricular rates is the most common cause. sinus tachycardia and pots thyrotoxicosis resulting in persistent sinus tachycardia or atrial fibrillation and consequent high output heart failure does not usually cause tmc. the primary management strategy in tmc is focused on aggressive attempts to control tachycardia with the aim of improving heart failure symptoms and reversing left ventricular dysfunction. depending on the clinical condition of the patient and type of tachycardia, rate control and/or rhythm control strategies are usually employed. underlying disease conditions, if present, should be optimized as much as possible and as soon as possible. if successful rate control or tachycardia elimination can reverse heart failure symptoms and cardiomyopathy, tmc is confirmed. in patients with tmc, standard heart failure therapy (beta - blockers, angiotensin - converting enzyme inhibitors, and spironolactone) can attenuate neurohumoral response and affect favorable remodeling. beta - blockers, calcium - channel antagonists and/or digoxin are commonly utilized for rate control. the optimal rate control strategy in tmc is yet to be identified, although a combination of drugs is often needed for adequate rate control ; a beta - blocker combined with digoxin may have superior benefits. the requirements for adequate rate control in tmc remain uncertain. in permanent atrial fibrillation, lenient rate control (resting ventricular rate < 110 bpm) has been shown to have similar short - term outcomes to a strict rate control approach (resting heart rate < 80 bpm and exercise heart rate < 110 bpm). whether a lenient approach to rate control applies to patients at risk of developing tmc is unlikely but requires further evaluation. in patients with atrial fibrillation - mediated tmc, who are difficult to rate control and in whom a rhythm control strategy is not feasible or desired, av node ablation with pacemaker implantation provides an effective means of rate control. recent data, however, arguably point to a cardiac resynchronization therapy (crt) pacing approach. although rate control is important in atrial fibrillation - mediated tmc, rhythm control may be important as well, as irregularity of the rhythm may also result in development of cardiomyopathy and heart failure. further rate control in atrial fibrillation may be a misnomer, as the rate is never exactly as it would be in sinus rhythm. rhythm control strategies involve chronic or intermittent use of antiarrhythmic drugs, pharmacological or electrical cardioversion, and catheter ablation. a hemodynamically unstable patient with atrial fibrillation and rapid ventricular rates often needs emergent cardioversion. intravenous ibutilide, a class iii antiarrhythmic drug, can be effective for pharmacological cardioversion. the dose is 1 mg over 10 minutes, but carries a risk of qt prolongation and polymorphic ventricular tachycardia, and therefore requires several hours of telemetry monitoring following the dose. vernakalant, an atrium - specific k+ channel blocker, has been shown to be effective in restoring sinus rhythm, may not affect qt prolongation as much, and can be a safer option. it is critical in tmc patients to maintain sinus rhythm in the long - term. amiodarone, which blocks multiple cardiac ion channels, is most commonly used for this purpose and is superior to sotalol, another class iii antiarrhythmic drug. however, long - term use of amiodarone has the potential for extracardiac toxicity (hypo- and hyperthyroidism, abnormal liver enzymes, neuropathy, dermatitis, optic neuritis, and interstitial lung disease). close follow - up of thyroid and liver function every 6 months should be performed. an underutilized, but highly effective, drug is dofetilide, a pure class iii antiarrhythmic drug with no beta - blocking properties (unlike sotalol). no head - to - head comparison has been undertaken with amiodarone but, when used properly and with careful monitoring, this drug can be quite effective in maintaining sinus rhythm without substantial risk for qt prolongation and torsade de pointes. dofetilide requires initiation in the hospital with strict electrocardiographic supervision. dosing depends on the initial qtc, renal function and concomitant qt - prolonging drugs. catheter ablation has emerged as a promising therapy to maintain sinus rhythm in patients with both paroxysmal and persistent atrial fibrillation. in patients with atrial fibrillation and heart failure, catheter ablation of atrial fibrillation can improve quality of life and left ventricular function. in a systematic review of the efficacy of catheter ablation in atrial fibrillation patients with concomitant left ventricular dysfunction, sinus rhythm was maintained in 57% of patients following a single procedure. the success rate increased to 82% with more than one procedure and/or use of antiarrhythmic drug therapy. the mean increase in left ventricular ejection fraction was 13.3%, suggesting effectiveness of catheter ablation in this tmc population. whether or not rhythm control is superior to rate control in tmc patients with atrial fibrillation is not fully established. large randomized studies of atrial fibrillation patients (af - chf, affirm) have shown that rate control was equivalent to rhythm control for hard clinical endpoints for the patients who were selected to be enrolled. however, it is likely that the pathophysiology of atrial fibrillation - mediated tmc varies in the patient population studied in these trials, and these results may not apply to tmc patients. moreover, these studies compared rate control to antiarrhythmic drugs, mostly amiodarone, and the toxicity of antiarrhythmic drugs may offset benefits gained from maintaining sinus rhythm. in the real world, achieving and monitoring rate control is a challenge in the cardiomyopathy patient. in patients with drug - refractory atrial fibrillation and heart failure, pulmonary vein isolation has been shown to have better outcomes than av node ablation and crt pacing, suggesting the superiority of rhythm control. a recent randomized trial (aatac - af) compared catheter ablation with amiodarone for rhythm control of persistent atrial fibrillation in patients with heart failure and cardiomyopathy. a total of 203 patients were followed for 24 months and catheter ablation was shown to be far superior to amiodarone in freedom from atrial fibrillation (70% in the ablation arm vs. 34% in the amiodarone arm), quality of life, hospitalization rate, and mortality. left ventricular ejection fraction improved 9.67.4% in the ablation arm vs. 4.26.2% in the amiodarone arm (p<0.01) (nct00729911). for atrial flutter and supraventricular tachycardias (atrial tachycardia, av nodal reentry tachycardia, av reentrant tachycardias, permanent junctional reciprocating tachycardia), a curative strategy by catheter ablation should be pursued whenever possible with a goal of complete elimination of the tachycardia. similarly, early use of catheter ablation should be employed for tmc due to idiopathic ventricular tachycardias and/or frequent ventricular premature beats, as it can achieve a complete cure. in summary, our management approach for patients with suspected tmc is to pursue an aggressive rhythm control strategy whenever possible, with the goal of restoring and maintaining sinus rhythm. aggressive rate control should be pursued in situations where rhythm control is not feasible or desired. concomitant heart failure therapy with angiotensin - converting enzyme inhibitors and beta - blockers adds value. once pathologic tachycardia is controlled or eliminated, gradual recovery in left ventricular function and heart failure symptoms is the rule in a patient with tmc. a major factor affecting prognosis is tachycardia recurrence. in a study of 24 patients with tmc and heart failure, 5 patients had recurrent tachycardia after recovery in left ventricular function and all had rapid decline in ventricular function within 6 months of recurrence, suggesting that structural abnormalities at the ultrastructural level persist despite tachycardia resolution. thus, careful follow - up and monitoring for arrhythmia recurrence is necessary for these patients. sudden death has been reported in tmc patients even after recovery in ventricular function, highlighting the fact that tachycardia should be controlled before cardiomyopathy ensues. tachycardia, a common problem in clinical practice, can be secondary to physiological and/or pathological causes. one major adverse consequence of pathological tachycardia is development of cardiomyopathy with subsequent heart failure. early recognition is important, and an aggressive approach towards rate and rhythm control of the culprit tachycardia can result in resolution of symptoms and partial or complete recovery of left ventricular function close surveillance for arrhythmia recurrence during follow - up is warranted to avoid further decline in ventricular function. jude medical and abiomed, and a member of the speaker 's bureau at pfizer / bms. brian olshansky is a consultant at boston scientific, medtronic, daichi sankyo, biotronik, cardionomics, biocontrol, amarin, boehringer ingelheim, and on - x. | tachycardia, conventionally, but arbitrarily, defined as an atrial and/or ventricular rate of > 100 beats per minute, is encountered commonly and can be physiological or pathological in origin. various adverse consequences from tachycardia have been recognized, and an important one is the association between persistent tachycardia and cardiomyopathy. in this article, we provide an up - to - date review on the etiology of tachycardia, management strategies, and the prognosis of patients presenting with tachycardia and cardiomyopathy. |
current evidence suggests that although fetal exposure to smoking might increase the risk of type 2 diabetes in later life, lifestyle factors either during pregnancy or in adulthood may play a more important role. a familybased association study design might be helpful to detangle the relation among intrauterine exposure, lifestyle factors, and risk of diabetes in later life. |
|
the analysis of micronuclei (mn) in cultured human lymphocytes is, in principle, able to detect exposure to clastogens and aneuploidogens alike. there is, however, no clear evidence from human biomonitoring studies or animal experiments showing that in vivo exposure of resting lymphocytes to an aneuploidogen could actually be expressed as mn in cultured lymphocytes. in vitro, a pulse treatment of human lymphocytes with vinblastine, an aneuploidogen, did result in mn induction even if performed before mitogen stimulation, although a much more pronounced effect was obtained in actively dividing lymphocyte cultures. on the other hand, it is probable that a considerable portion of " spontaneous " mn contain whole chromosomes, their contribution increasing with age. it also seems that cytochalasin b, used for the identification of second cell cycle interphase cells in the mn assay, is able to slightly increase the level of mn with whole chromosomes. if mn harboring chromosome fragments represent a minority of the total mn frequency, there may be difficulties in detecting a weak effect in this fraction of mn against the background of mn with whole chromosomes. this would reduce the sensitivity of the assay in detecting clastogens, unless mn with whole chromosomes and chromosome fragments are distinguished from each other. that a problem may exist in sensitivity is suggested by the difficulty in demonstrating mn induction by smoking, an exposure capable of inducing chromosome aberrations. the sensitivity of the lymphocyte mn assay could be increased by detecting kinetochore or centromere in mn, or by automation, allowing more cells to be analyzed.imagesfigure 2. |
|
between october 1996 and february 1998, a prospective patient cohort of 32 consecutive patients underwent single - level alif. surgical intervention was planned only after the persistence of pain for more than 6 months despite conservative treatment. were body mass index between 20 and 35 and age between 18 and 65 years. positive provocative discomanometric evaluation with adjacent - level negative controls between l3 and s1 was mandatory. exclusion criteria were (inflammatory) diseases affecting the entire spine, pregnancy, smoking, and a history of pneumonia or pulmonary embolism. patients with diabetes mellitus, metabolic bone disease, loss of bone stock, active infection, or metastatic disease were also excluded. after approval by our institutional review board, we invited all 32 patients who underwent single - level fusion by telephone and regular mail to take part in this evaluation. twenty - five patients (78%) agreed to participate in the study and were seen in the clinic by an investigator (p.h.) standing anteroposterior and lateral radiographs of the spine were obtained as well as an upright magnetic resonance imaging (mri) of the lumbar spine to evaluate adjacent disc levels. radiographs were taken at the 10-year follow - up visit and consisted of standard standing anteroposterior and lateral images of the lumbar spine. an upright mri was made to analyze the disc quality and identify facet joint osteoarthritis (fjoa) at the adjacent level as possible confounder in remaining low - back pain. a 0.6-tesla fonar upright mri (fonar corporation, melville, ny) was used for this purpose. disc degeneration was classified according to pfirrmann into five groups.16 we pooled the data from facet joint degeneration into two groups, either grade 3 fjoa or fjoa less than grade 3. only grade 3 fjoa seems related to low back pain.17 the examination protocol included t1- and t2-weighted images in sagittal and transverse planes above, at, and below the fusion level. if the fusion was performed at the lumbosacral junction, the s1s2 level was not described. fusion assessment of the lumbar spine is difficult, especially in the presence of metal artifacts. absence of radiolucencies, screw breakage, and subsidence was used as a criterion for successful fusion. patients were asked preoperatively and again at 2, 4, and 10 years postoperatively to fill out visual analog scales (vas) for back and leg pain and the oswestry disability index questionnaires (odi, version 1.0 in dutch). vas scores were measured on a 100-point scale, with 0 being no pain at all and 100 being the worst pain imaginable. the odi is scored from none to total disability (0 to 100%) and rates the limitations of various activities of daily living such as personal care, walking, sitting, lifting, standing, sleeping, sex, and social life and traveling. we used the short form-36 general health instrument (sf-36).18 the sf-36 includes a multi - item scale to rate the quality of life divided into eight dimensions : physical function, physical role, bodily pain, general health, social function, emotional role, mental health, and vitality. each scale ranges from 0 (worst health state) to 100 (best health state). the sf-36 was not part of the preoperative evaluation, and therefore no relation to previous scores can be made. to be able to evaluate our 10-year follow - up results, we decided to compare the study population with three separate populations, the first being the general dutch (reference) population, used for validation purposes of the sf-36 in the netherlands.19 the second population is a group of patients with surgical low back pain from a general spine practice (ddd only).20 the third population is the group with multiple surgical low back pain diagnoses from the same study (herniated disc, central stenosis, ddd, spondylolisthesis, and lateral stenosis). a repeated - measure multivariate analysis of variance was used to identify changes over time. because of missing data, sensitivity analyses were performed to determine the robustness of the findings and to estimate the degree and direction of potential confounding. two methods for imputation were used : carry the last observation forward and imputing the individual preoperative values at each missing point. data from the radiographic measurements were analyzed, and paired tests were performed when appropriate. between october 1996 and february 1998, a prospective patient cohort of 32 consecutive patients underwent single - level alif. surgical intervention was planned only after the persistence of pain for more than 6 months despite conservative treatment. were body mass index between 20 and 35 and age between 18 and 65 years. positive provocative discomanometric evaluation with adjacent - level negative controls between l3 and s1 was mandatory. exclusion criteria were (inflammatory) diseases affecting the entire spine, pregnancy, smoking, and a history of pneumonia or pulmonary embolism. patients with diabetes mellitus, metabolic bone disease, loss of bone stock, active infection, or metastatic disease were also excluded. after approval by our institutional review board, we invited all 32 patients who underwent single - level fusion by telephone and regular mail to take part in this evaluation. twenty - five patients (78%) agreed to participate in the study and were seen in the clinic by an investigator (p.h.) standing anteroposterior and lateral radiographs of the spine were obtained as well as an upright magnetic resonance imaging (mri) of the lumbar spine to evaluate adjacent disc levels. radiographs were taken at the 10-year follow - up visit and consisted of standard standing anteroposterior and lateral images of the lumbar spine. an upright mri was made to analyze the disc quality and identify facet joint osteoarthritis (fjoa) at the adjacent level as possible confounder in remaining low - back pain. a 0.6-tesla fonar upright mri (fonar corporation, melville, ny) was used for this purpose. disc degeneration was classified according to pfirrmann into five groups.16 we pooled the data from facet joint degeneration into two groups, either grade 3 fjoa or fjoa less than grade 3. only grade 3 fjoa seems related to low back pain.17 the examination protocol included t1- and t2-weighted images in sagittal and transverse planes above, at, and below the fusion level. if the fusion was performed at the lumbosacral junction, the s1s2 level was not described. fusion assessment of the lumbar spine is difficult, especially in the presence of metal artifacts. absence of radiolucencies, screw breakage, and subsidence was used as a criterion for successful fusion. patients were asked preoperatively and again at 2, 4, and 10 years postoperatively to fill out visual analog scales (vas) for back and leg pain and the oswestry disability index questionnaires (odi, version 1.0 in dutch). vas scores were measured on a 100-point scale, with 0 being no pain at all and 100 being the worst pain imaginable. the odi is scored from none to total disability (0 to 100%) and rates the limitations of various activities of daily living such as personal care, walking, sitting, lifting, standing, sleeping, sex, and social life and traveling. just one question specifically rates the intensity of pain. to evaluate general health we used the short form-36 general health instrument (sf-36).18 the sf-36 includes a multi - item scale to rate the quality of life divided into eight dimensions : physical function, physical role, bodily pain, general health, social function, emotional role, mental health, and vitality. each scale ranges from 0 (worst health state) to 100 (best health state). the sf-36 was not part of the preoperative evaluation, and therefore no relation to previous scores can be made. to be able to evaluate our 10-year follow - up results, we decided to compare the study population with three separate populations, the first being the general dutch (reference) population, used for validation purposes of the sf-36 in the netherlands.19 the second population is a group of patients with surgical low back pain from a general spine practice (ddd only).20 the third population is the group with multiple surgical low back pain diagnoses from the same study (herniated disc, central stenosis, ddd, spondylolisthesis, and lateral stenosis). a repeated - measure multivariate analysis of variance was used to identify changes over time. because of missing data, sensitivity analyses were performed to determine the robustness of the findings and to estimate the degree and direction of potential confounding. two methods for imputation were used : carry the last observation forward and imputing the individual preoperative values at each missing point. data from the radiographic measurements were analyzed, and paired tests were performed when appropriate. one patient had died of unrelated causes (and was reported not to have complained about his low back pain after single - level fusion), and two patients were lost to follow - up. one patient had a full - time working schedule and refused to take time off to visit the clinic for evaluation. one additional patient had to be excluded from the database because the surgical level (l23) was above the area of interest. one patient had the translaminar screws (tls) removed at 4 years postoperatively due to recurrent low back pain and osteolysis around the tls. one patient had a combined adjacent segment decompression and tls removal at 1 year due to persistent lbp and slight neurogenic claudication complaints. subsequent intradiscal electrothermal annuloplasty and later an interspinous spacer (placed 5 years after the index procedure) did not result in relief of the persistent low back pain. one patient had a provocative discography and interspinous spacer placement two levels above the index level 8 years after the index procedure. the partial loss of 2-year good results at 4 years has not progressed at 10 years. there is no significant difference between the vas and odi scores at 48 months and at latest follow - up, summarized in figs. 1 and 2 for the vas, the preoperative score was 6.6 compared with 3.7 at 10-year follow - up. radiological evaluation revealed no radiolucencies around the cage, subsidence of the cage, or screw breakage. advanced disc degeneration was seen in 3/25 (12%) discs above the index level and 2/10 (20%) discs below the index level. fjoa grade 3 was seen in 2/25 (8%) above the index level, and in 1/10 (10%) below. all appeared to have developed in the course between the 4-year follow - up and this 10-year evaluation. no significant correlation was found between the data regarding asd (disc classification and fjoa) and either vas or odi scores. fjoa did not occur without disc degeneration. regarding the data for the sf-36 as well as the relation between sf-36 and odi scores, the results at this 10-year follow - up are favorable and are just slightly lower than the general dutch population19 (table 3). j clin epidemiol 1998;51:10551068, with permission from elsevier.19 reprinted from zanoli g, jnsson b, strmqvist b. acta orthop 2006;77:298306, with permission from informa healthcare.20 pf, physical function ; rp, physical role ; bp, bodily pain ; gh, general health ; vt, vitality ; sf, social function ; re, emotional role ; mh, mental health. visual analogue scale (vas) scores of the study population during the 10-year follow - up. fusion for low back pain is controversial because of contrasting outcomes in the literature.11 12 bono and lee presented a review of the literature regarding the trends and effects of spinal fusion for ddd.7 they concluded that spinal fusion has evolved from a more biological (less implants) to a more technical (more implants) procedure. their review stated that although an increased use of implants was noted over two decades, there is no significant beneficial effect on either fusion rate or clinical outcome. regarding alif, the fusion rate increased significantly, but there was no significant improvement in outcome. short- to intermediate - term follow - up showed favorable results for surgical treatment compared with nonoperative management.10 21 there are only limited data on long - term follow - up of spinal fusion. results are in favor of circumferential fusion compared with posterolateral fusion.18 our preference for additional tls instead of pedicle screw fixation (ps) is based on the provision of similar fixation with less invasive and less patient morbidity.22 23 24 surgical procedure time for tls in our hands is significantly less for tls compared with ps. also, during placement, in contrast to ps there is no interference with adjacent cranial facet joints that might account for residual or recurrent low back pain or influence the natural cause of fjoa. in our setting, the placement of two tls is more economical than a single - level ps system (27 versus 1690). long - term outcome of tls fixation of the lumbar spine is recently published. in this retrospective cohort study, the single most significant predictor of good outcome was reduced disc height (less than 80%). in our opinion, this can be explained by reduced motion at the intervertebral disc level, a situation comparable with placement of an interbody support.25 in our first report, the advantages of alif with a titanium box cage and supplementary posterior fusion are extensively discussed, including restoration of lordosis and disc height and the maintenance of correction over time. subsidence is absent in our previous report, and correction is maintained over a prolonged period of time. radiographic control at 10 years does not show any changes compared with 4-year follow - up at the fusion level, so correction of coronal and sagittal balance is stable 4 years after fusion. mri findings show degenerative disc changes (greater than pfirrmann grade 3) in three patients above and two patients below fusion level. fjoa grade 3 was seen twice above the index level and once below, both unilaterally. comparable to previous reports, fjoa did not occur in the absence of disc degeneration.26 27 in our study, fjoa occurred with discs grade 3 and 4. fjoa is a gradual process and might take a long time to develop.26 whether fjoa grade 3 is a clinically relevant entity in low back pain is subject to debate. this is due to the innervation of the facet joints, which comes from two different levels, and because of nonspecific evidence regarding facet joint infiltrations.28 we could not correlate these findings to the final results. modic type 1 changes are related to low back pain.17 29 30 toyone describes disc degeneration as a decreased signal from both nucleus and inner annulus, resulting in loss of differentiation between both.30 this description is comparable with pfirrmann grade 4 and has been used previously.16 17 31 correlation between mri - documented disc degeneration and symptomatic discogenic low back pain has been extensively discussed over the past years, concluding that there is a relation between modic type 1 changes and low back pain, but modic 1 changes may be present in asymptomatic individuals as well.31 32 33 34 the role of discography as gold standard is a continuing subject of discussion, especially regarding the recent suggestion of its role in subsequent segment degeneration (carragee, personal communication, issls miami, 2009). in our study population, the standard preoperative evaluation included both mri and provocative discography with obligatory adjacent segment negative control. however, we did not find a significant correlation between degenerative changes at the adjacent levels and relapse in symptoms (indicated by increased vas and odi scores). we tried to evaluate general function 10 years after spinal fusion by comparing sf-36 score with the scores from the general dutch reference population used to validate the dutch version of the sf-36.19 to evaluate our results, we compared these with a surgical low back pain population, a group described by zanoli consisting of a heterogenous group of surgical spine patients.20 the preoperative scores in that study were lowest in the ddd group in every domain of the sf-36. the ddd subgroup, used in table 3, gives an indication of preoperative sf-36 scores. scores and therefore functional capacity increase clearly after surgical treatment. reviewing our own observations, there has been extensive discussions about asd, the type of fusion promoting accelerated adjacent degeneration, and the impact of radiological adjacent disc degeneration on general outcome measures.22 23 24 35 diagnoses used to describe a pathological process at an adjacent segment include listhesis, instability, nucleus herniation, spinal stenosis, fjoa, spondylophyte formation, vertebral compression fracture, and scoliosis. these observations are all preceded by disc degeneration. a recent review by park illustrated the issue clearly and stated that a single explanation as to which factor is the key in adjacent degeneration is not identifiable.15 harrop concur with park in clearly stating that radiological degeneration of a segment adjacent to a fused lumbar or lumbosacral segment might not be symptomatic.36 they separate the (radiological) diagnosis of asd and adjacent segment disease. several factors are known to influence or promote (progressive) disc degeneration.25 normal loading, environmental influence (smoking), normal aging, and genetic influence are all factors that affect intervertebral discs at any level. although spinal fusion poses increased loads to the remaining mobile segments, this seems not to be of major importance in the development of asd.35 throckmorton and herkowitz raise serious doubts about the clinical significance of asd.37 38 the results of our study regarding asd are comparable to those of cheh, who concluded that younger age, shorter segment fusion, and lower instrumented vertebra were factors related to less asd.39 circumferential fusion, with any technique in their study, seemed not to influence the development of asd. our results do not support the contention that total disc replacement might prevent asd more efficiently compared with fusion in the lower lumbar area. reviewing harrop, alif has comparable asd rates in literature to total disc replacement.36 wai reported recently that even after long - term follow - up, the development of asd seems more related to constitutional factors than alif.40 whether total disc replacement will have a more favorable outcome than the study population at 10-year follow - up remains to be seen. no evidence exists that every degenerating lumbar disc is generating pain by itself.41 no evidence has been presented to date to solely correlate radiographic asd to functional lower scores. normalization of sagittal balance, and thus optimizing discal loads, may minimize symptomatic degeneration in part.10 20 30 31 single - level spinal fusion reduces pain and subsequent disability caused by the operated level, but it will not stop or reverse the degenerative process at adjacent levels. we believe that the results as presented justify the use of this surgical technique and implant with favorable long - term results. a stable situation is reached at 4-year follow - up, and good clinical results are maintained for a prolonged period of time. factors influencing partial loss of primary good functional results, such as patient - related (psychological) factors, are already discussed in the primary report and seem to be no significant influence on the long - term outcome. we conclude that single - level alif for symptomatic disc degeneration is a good alternative for nonoperative management with good long - term follow - up regarding asd as well as functional capacity. jacobs, none marina obradov - rajic, none marinus de kleuver, institutional support and fellowship support : synthes jacobs, none marina obradov - rajic, none marinus de kleuver, institutional support and fellowship support : synthes | we reviewed the records of a prospective consecutive cohort to evaluate the clinical performance of anterior lumbar interbody fusion with a titanium box cage and posterior fixation, with emphasis on long - term functional outcome. thirty - two patients with chronic low back pain underwent anterior lumbar interbody fusion and posterior fixation. radiological and functional results (visual analogue scale [vas ] and oswestry score) were evaluated. adjacent segment degeneration (asd) was evaluated radiologically and by magnetic resonance imaging (mri). twenty - five patients (78%) were available for follow - up. functional scores showed significant improvement in pain and function up to the 2-year follow - up observation. at 4 years, there was some deterioration of the clinical results. at 10-year follow - up, results remained stable compared with 4-year results. mri showed asd in 3/25 (12%) above and 2/10 (20%) below index level (compared with absent preoperatively). asd could not be related to clinical outcome in this study. anterior lumbar interbody fusion and posterior fixation is safe and effective. initial improvement in vas and oswestry scores is partly lost at the 4-year follow - up. good clinical results are maintained at 10-year follow - up and are not related to adjacent segment degeneration. |
painful legs and moving toes (plmt) is a rare syndrome characterized by spontaneous movements of a single or all digits and pain in one or both lower extremities123). the largest case series identified 76 patients during an 18-year period2), and only one pediatric case has been reported4). we report the first adolescent case of plmt in korea and review current literature on the plmt syndrome. a 16-year - old girl complained of tingling pain in her left leg and continuous involuntary movements of her ipsilateral great toe one month after a second untethering surgery. extension and flexion of her great toe, which occurred when awake and in the early stages of sleep, could not be suppressed voluntarily. walking, sitting, or straining did not exacerbate the pain. at birth, she had a sacral dimple at the s23 vertebral level. four years previously, she had a voiding difficulty and underwent untethering surgery to correct the lipomeningomyelocele at the s2 level of the conus medullaris. a nerve conduction velocity study (ncvs) showed polyradiculopathy at the left l5 level and below with axonal involvement. a needle electromyogram (emg) showed abnormal spontaneous activities of the left gastrocnemius medial head, abductor hallucis, and tibialis anterior / posterior. five months later, the voiding difficulty recurred, and a second untethering surgery was performed. cerebrospinal fluid (csf) analysis revealed a red blood cell count of 60,000/mm, a white blood cell count of 150/mm (polymorphonucleocytes 69%, lymphocytes 18%), a protein level of 274 mg / dl, and a glucose level of 39 mg / dl. since the complete blood count showed neutropenia (absolute neutrophil count=600/mm), teicoplanin was discontinued. one month postoperatively, the patient presented with left leg pain and involuntary movements of her left great toe. increased deep tendon reflex of both knees was observed with no other pathologic signs. magnetic resonance imaging of the lumbar spine showed reactive inflammatory changes in the operative scar and a decreased extent and degree of reactive meningeal enhancement compared to the previous study (fig. needle emg showed abnormal spontaneous activities of the left gastrocnemius medial head, abductor hallucis, and tibialis anterior / posterior with no significant interval change since the previous study. we prescribed gabapentin (100 mg three times a day) ; left leg pain and involuntary movements diminished within a day. complete relief from involuntary toe movements was achieved within four months of gabapentin treatment in the outpatient department. some variants of plmt syndrome include painless legs and moving toes, painful arms and moving fingers, painless arms and moving fingers, and painful mouth and moving tongue235). in the largest case series, the mean age of onset was 58 years (range, 2488 years)2). one pediatric case (an 11-year - old girl) was reported in 20134). in the republic of korea, there have only been a few adult cases of the plmt syndrome567). most patients ' primary complaint is pain, which is more distressing than involuntary movement23). although patients ' descriptions of their pain are diverse (e.g., tingling, numbness, aching, burning, etc.), all of them report that it is constant. some patients ' pain was exacerbated by certain situations, including physical positions (e.g., sitting, walking, bearing weight, or bending), diurnal variation (night or day), cold temperature, external pressure, and the valsalva maneuver. conversely, in other patients, the same situations have alleviated the pain2). voluntary and temporal suppression of symptoms by applying pressure to the sole of the foot has been reported3). in our patient, none of the aforementioned situations diminished or intensified the symptoms of involuntary movement. the involuntary movements tended to be constant, sometimes fluctuating in severity, and stereotypical to a particular individual2). reportedly, involuntary movements include flexion / extension, abduction / adduction, wriggling / dystonia / writhing, or irregular, random, rhythmic twitching, fanning, clawing, waving, etc.3). underlying disorders of the plmt syndrome have been reported at the level of the peripheral or central nervous system (e.g., peripheral neuropathy, radiculopathy, spinal cord lesions, trauma, myelitis, compressive myelopathy, wilson disease, parkinson disease, and hashimoto disease)123). recently, peripheral neuropathy was considered to be the most commonly identifiable cause of pain in 21 of 76 patients (28%) ; conversely, 32 (42%) had no identifiable cause of pain2). clinically, the plmt syndrome 's potential origin is within the peripheral nervous system ; however, the disorder 's evolution suggests that the central nervous system is involved in the persistence of pain, which mediates movement of the digits. this makes the condition very difficult to treat ; presumably, neuromodulation drives the movement of the digits via a generator at the spinal cord or brainstem2). recently, the findings of an ncvs were normal in 33 of 63 cases, and the remainder showed mild abnormalities, including chronic radiculopathy (14 cases), peripheral neuropathy (9 cases), cramps and fasciculations (4 cases), isolated fasciculations / fibrillations (5 cases), mononeuropathy (3 cases), and evidence of prior poliomyelitis (1 case). an emg showed irregular (not truly rhythmic) phasic bursts with various durations (range, 10 msec to 2 seconds), which were associated with cocontraction and digit or distal limb movements2). the bursts had broad frequencies (range, 1.5200 hz)23). in the pediatric case, ncvs and emg were unremarkable4). restless leg syndrome also has both discomfort and movements of lower limbs, but the pain of plmt is not relieved by movements. plmt does not involve skin change or altered temperature unlike complex regional pain syndrome2). epilepsia partialis continua is usually painless and accompanied by structural brain lesions and epileptic discharges on an eeg3). other movement disorders that need to be differentiated from plmt are chorea, pseudoathetosis, spinal segmental myoclonus, psychogenic movement disorder23). in a recent large case series, only one - third of patients responded to pharmacologic treatment for involuntary movements or pain2). in the pediatric case and our adolescent case, the difference may originate from the onset age or the duration between onset and treatment. however, we need more pediatric and adolescent cases to verify that. there were also some case reports that gabapentin was effective for pain and movements symptoms in adult plmt patients and the therapeutic effect started in 1 - 4 days68). there was no consensus for the duration of gabapentin therapy. in our case, we ceased gabapentin after 4 months. the plmt syndrome is rare but it should be considered during differential diagnosis of children and adolescents with pain in the limbs and involuntary movements in the toes. | painful legs and moving toes (plmt) syndrome is characterized by spontaneous movements of the digits and pain in one or both lower extremities. of the reported cases, a majority of the patients was female, and the mean age of onset was 58 years. only one pediatric case has been reported so far. herein, we report the first adolescent case of plmt in korea. a 16-year - old girl complained of tingling pain in the left leg and involuntary movement of the ipsilateral great toe one month after a second untethering surgery. three years ago, she had undergone untethering surgery to correct lipomeningomyelocele at the s2 level of the conus medullaris. at that time, she was diagnosed with polyradiculopathy at the left l5 level with axonal involvement. we diagnosed her with plmt syndrome and prescribed gabapentin. her symptoms diminished within a day. complete relief from involuntary movement of the toe was achieved within four months. plmt is a rare syndrome but it should be considered in the differential diagnosis of children and adolescents with limb pain and spontaneous movement in their toes. |
a 21-year - old man was referred to us with a 1-year history of low back pain. the pain evolved insidiously and progressed over time and was incompatible with comfortable everyday life. the pain was worse in the standing position and with flexion and extension and less in sitting and supine status. he remarked on bilateral back of thigh pain without radicular characteristics since 1 year previously. physical examination revealed no significant finding. in lumbar spine x - ray examination and computed tomography scans, we found bilateral multilevel (l3, l4, l5) spondylolysis without any slip or scoliosis (fig. 1). magnetic resonance imaging showed no sign of slip or disc degeneration in the affected area (fig. a 3-month course of conservative treatment with nonsteroidal anti - inflammatory drugs was suggested, along with physical therapy and lumbar soft corset. the patient was symptomless after treatment, but 4 months later he again complained of a similar problem. the pain became more and more severe so that conventional conservative therapy had minimal effect and even referral to pain clinics and injection of anesthetics were unsuccessful in achieving acceptable and permanent results. the severity of pain disabled the patient. to prove the origin of the pain, with the guidance of fluoroscopy, local anesthesia (i.e., lidocaine and bupivacaine) again, the pain was relieved for 2 days, which reinforced the theory that the source of patient 's pain was the spondylolysis. we were encouraged to perform a less invasive surgical technique for correction of defects. preoperative plain x - ray showing three - level bilateral spondylolysis : right oblique (a), lateral (b), flexion (c), and extension (d) views. this approach seemed to be wise because the instruments extended lateral to medial and a wide three - level exposure was necessary. a 6.5 45-mm multiaxial pedicle screw (uss-2 synthesis system) was inserted for the involved vertebrae under fluoroscopic guidance. then, we put a sublaminar hook in place and connected these two by a short appropriate rod (fig. 2). then, we interpositioned the iliac crest bone graft pieces between the two edges of lytic defects to facilitate fusion, and we tightened the nuts under compression. postoperatively, the patient remained neurologically intact and was allowed to sit and walk the day after surgery. he was pain - free 6 weeks after the procedure and discontinued using the brace. after a follow - up period of 2 years, there were signs of bony consolidation in five of all lytic defects (fig. postoperative plain x - ray about 2 years after surgery showing anteroposterior (a), lateral (b), flexion (c), and extension (d) views, and computed tomography scan (e). pars defects are not uncommon and commonly present with low back pain, which usually could be managed conservatively.12 13 when the source of the pain is the pars defect itself and hypermobility of the posterior column, direct repair of spondylolysis seems to be most effective and appears to be more logical than posterior spinal fusion to treat this disease in a small group of patients without disc degeneration or slip. however, several reconstructive methods have been introduced. in 1968, kimura14 only used bone graft and prescribed a cast and long rest for fusion. in 1970, buck1 used a screw across the pars, and nicol and scott15 used a wire surrounding lamina. in 1970, louis16 described a butterfly - shaped plate for temporary lumbosacral fixation. morscher created a screw - hook system that made it possible to repair the posterior arch and the bone graft under compression without the need for extensive dissection. this method required a special technique and, because of the weak instrument, needed a long - lasting brace. recently, songer and rovin18 used a sublaminar cable with the aid of pedicle screw. pedicle screw direct repair confers immediate stability to the lumbar spine with a combination of autologous bone graft to provide better fusion. existence of signs of disc degeneration or spondylolisthesis in imaging studies is a contraindication of this strategy. because there is no overload on neighboring levels, there would be no degeneration of an adjacent level. the complication rates due to various surgical technique or hardware failure have been reported to be 5.6 to 40% with buck 's technique, 14% with scott 's technique, and 44% with morscher 's technique.3 12 good to excellent clinical results were obtained in 60 to 90% of patients with buck 's operation, 80 to 90% with scott 's wiring technique, 75 to 90% with morscher 's hook - screw system, and 81 to 100% in the segmental pedicle hook - screw system.10 the new technique that is described by kakiuchi13 and offered here appears to have some advantages. first, the strength of system (screw and hook) avoids the need for postoperational immobilization, and the patient can return to daily activities soon after surgery. third, bone grafting is not hindered by the hardware, and compression of the graft against the pars defect is easily possible. fourth, hardware removal is not obligatory, because all adjacent segments remain free and no loss of segmental motion occurs as with fusion procedures. fifth, the risk of adjacent - level disc degeneration diminishes by keeping the segmental motion.3 however, by open placement of such a system, collateral damage of soft tissue may occur.9 19 various surgeons have searched for less invasive muscle - splitting lumbar techniques to reduce paraspinal tissues damage. roca concluded that pars direct repair is not suitable in patients older than 20 years old because of a low fusion rate. however, some authors reported good results in patients between 20 and 30 years of age.20 szypryt showed that spondylolysis in patients older than 25 years is associated with more disc degeneration relative to the normal population. indeed, the most common reason for pars direct repair was disc degeneration. almost all authors agree that disc or facet degenerative changes are contraindications for direct pars repair.10 14 22 if abnormal disc signal is detected in magnetic resonance images, arthrodesis should be considered instead of repair. our case was unique in that there were six spontaneous pars defects as three adjacent - level bilateral spondylolysis. we could not find any similar case of multilevel spondylolysis repaired by a hook - screw system so far. although a 2-year period of follow - up sounds short for achieving convincing results, it was convenient for finding signs of bony consolidation in direct repair places. we can leave the instruments in place because flexion - extension images are satisfactory and motion of the spine is well preserved and the patient is obviously pain - free. in conclusion, direct repair of pars interarticularis in multilevel spondylolysis by a hook - screw system appears to be an appropriate technique and superior to other treatment modalities. | we report a case of bilateral three - level lumbar spondylolysis that was directly repaired by use of hook - screw technique. the patient complained of low back pain for 2 years that progressively worsened and was exacerbated with standing and walking. he also mentioned bilateral sciatalgia. the neurological examination was normal. interestingly, we found bilateral lumbar spondylolysis in l3, l4, and l5 levels in imaging studies. after proving that spondylolysis was the source of the low back pain by local anesthetic agent injection, we used a direct technique for correction of spondylolysis by use of a hook - screw device plus decortications of lysis area and iliac crest autograft. we assessed the patient after surgery to evaluate pain recovery and fusion rate. the results were favorable and proved the efficacy of the hook - screw technique for treatment of symptomatic multilevel lumbar spondylolysis. |
ims - microscopy fusion is demonstrated through three different applications : (i) predicting ion distributions to a spatial resolution that exceeds that of the measured ion images (sharpening) ; (ii) predicting ion distributions in tissue areas that were not measured by ims (out - of - sample prediction) ; and (iii) discovery of biological patterns that are difficult to retrieve from the source modalities separately (enrichment). the results cover seven distinct case studies (supplementary table 1), each describing a multi - modal tissue imaging experiment with microscopy and maldi ims from the same or an adjacent tissue section. the sharpening of ion images provides a means of predicting molecular tissue content to a higher spatial resolution and introduces the general modeling procedure that underlies all our fusion applications. in case study 1, the tissue distribution of ion m / z 762.5 (identified as pe(16:0/22:6)) is measured through an ims experiment performed at 100 m spatial resolution (fig. 3b) is taken from the same tissue section stained with h&e after the ims acquisition. our two - phase fusion method (see online methods and supplementary figs. 1, 2, and 3) combines the information from both modalities, builds a model to capture any cross - modality relationships it can detect, and employs that model and the microscopy measurements to predict the distribution for all ions at 10 m resolution. the spatial prediction for ion m / z 762.5 additionally, we compare the 100 m measurement and the fusion - based 10 m prediction to an ion image for m / z 762.5 actually acquired at 10 m on an adjacent tissue section (fig. the ims acquisition parameters are identical for (a) and (d), except for increased laser power required to compensate for reduced signal intensities at 10 m pixel widths. an example by an alternative up - sampling approach, bilinear interpolation (supplementary fig. the online methods provide details on the model building and evaluation process (supplementary figs. 5 and 6). the ims - microscopy model obtained by pls regression between ims and microscopy - derived variables, contains a sub - model for each ims variable (supplementary fig. model performance is therefore specific to each ims variable, and needs to be evaluated to ascertain for which ion peaks good prediction (and useful fusion) is possible. this percentage score summarizes how well the measured ion distribution can be predicted using the given microscopy observations. a value of 100% indicates that the cross - modality relationships allow complete reconstruction of the measured intensity distribution using only variables from the other technology. a value close to 0% signifies that no cross - modality relationship could be found or modeled for this ion, and that fusion - driven prediction is not an option for it. most measured ion images can be predicted at least partially using microscopy, and in our examples we rely on fusion only for ions with a score above 75%. we additionally introduce the absolute residuals image and the 95% confidence interval image as measures of prediction performance in function of tissue location (supplementary fig. 6). while m / z 762.5 and 747.5 (a combination of three nominally isobaric lipids, supplementary fig. 9) exhibit a strong cross - modality relationship to h&e microscopy, m / z 766.5 (pe(18:0/20:4)) and 715.6 (pe - cer(d16:1/22:0)) from the same ims experiment are examples of ions for which no such relationships could be found and thus prediction is not recommended (supplementary figs. 7 and 8). the access to information from different technologies allows fusion to predict beyond hard constraints inherent to a particular sensor type. this advantage, for example, enables the image sharpening application to push beyond the physical limits of the ims laser by predicting at a spatial resolution below the wavelength of the laser. as an example, we apply the fusion procedure to a mouse brain sample on which both source modalities have been pushed to their current state - of - the - art in spatial resolution for the instrumentation used in this experiment (fig. / z 646.4 (nominal isobars cer(d18:1/24:1) and second c isotope of cerp(d18:1/18:0)) and 788.5 (nominal isobars ps(18:0/18:1) and pe(40:7)) were successfully predicted with 75% and 76% scores at 330 nm resolution (fig. 4c), using a 355 nm wavelength laser to acquire the source ims measurements. 4a), while the textural information was encoded at 330 nm resolution in an h&e stained microscopy image of an adjacent section (fig. additional results in the supplementary information demonstrate how fusion can predict to any spatial resolution between the native ims and microscopy resolutions (supplementary figs. it is also independent of the tissue type used or the molecule type measured (supplementary figs. 12 and 18), and the method is shown to operate with tissue stains other than h&e (supplementary figs. 1316, 17). fusion is shown to provide useful integration and prediction even for ion peaks that report multiple unresolved ion species (supplementary fig. the behavior of the method is verified against a gold standard of known cross - modal and modality - specific patterns (supplementary fig. this application of the fusion process develops the capability of predicting ion distributions in areas not measured by ims, using a model built from areas where data from both modalities are available. as an example, the ion distribution for m / z 10,516 is predicted in non - ims measured mouse brain areas (fig. first, an ims - microscopy model is built on a sub - area of the tissue where ims measurements (in the mw range of interest) are available at 100 m resolution and h&e - stained microscopy at 5 m resolution. subsequently, the model is used to predict both inside the ims - measured area as well as the area outside, where only microscopy is available. the predicted pattern for m / z 10,516 outside the modeled area was successfully confirmed via ims measurements external to this case study. although prediction at the native ims resolution of 100 m is possible (supplementary fig. 21), the availability of microscopy at 5 m resolution enables additional sharpening of the ion predictions to 5 m both inside and outside the modeled area (fig. 5). the discovery of cross - modality relationships enables the separation of a measured tissue signal into a part that can be predicted by the other technology and a part that is modality - specific. for measured signals with strong cross - modal support, this information can be used to filter technology - specific noise from genuine tissue signal. this process can substantially increase the signal - to - noise ratio of observations, and enables discovery of patterns that might otherwise be missed. each ion image measured by ims can be considered a superposition of noise variation on top of a biological or sample signal pattern. the fusion model tries to write each ion image as a linear combination of microscopy - derived patterns, and for ion images with strong cross - modal support, the model succeeds in reproducing most if not all of the biological or sample signal pattern that way. since the noise tends to be sensor - specific, it is highly unlikely that fusion finds a link to an identical pattern in the other technology. as a result, modality - specific noise variation will often not survive the modeling and prediction process, effectively de - noising the predictions. since the biological signal often reports an underlying tissue structure that can modulate measurements in both modalities, finding a relationship across technologies is not uncommon and when that happens the presence of real tissue variation in the predictions is more readily observed. it is not necessarily so that all technology - specific variation is noise, since a measurement might be reporting a biological feature that can only be detected by one of the sensors. however, that situation can be detected by a reduced reconstruction score and can even be spatially confined to a tissue sub - area using for example the absolute residuals image. for measured variables and tissue areas with strong cross - modal support, fusion enables enrichment of genuine tissue signal and removal of modality - specific noise. multi - modal enrichment can cause a feature to be discovered or recognized as biological or sample - based when in a single - modality analysis it would be mistaken for noise or go unnoticed. propagation through the fusion process into the predictions indicates that these features are corroborated by measurements in both modalities. from a microscopy viewpoint,, fusion provides an increased confidence in the genuine nature of these features, so that they may be recognized from faint signals in the noise. fusion separates features with support across technologies from those supported by only a single sensor type. it shows a localized intensity drop, which might be perceived as biological since it covers multiple pixels. however, in microscopy (acquired post - ims) there is no visual trace at this location and even the fusion process finds no cross - modal evidence to support this drop as a real tissue feature. although lack of cross - modal corroboration does not necessarily mean a feature is noise, since it can be a biological feature detectable by only one of the technologies, it does reduce confidence in it being a genuine tissue feature and suggests here an ims acquisition anomaly. fusion - based filtering can also be used as a global method for de - noising ion images with strong cross - modal support. as an example, an ion image for m / z 5,666 measured at 100 m resolution in mouse brain is fused with an h&e - stained microscopy image at 5 m resolution (supplementary fig. 20). a similar cleanup effect and increase in s / n is also observed in predictions for other ions from this data set (supplementary figs. the sharpening of ion images provides a means of predicting molecular tissue content to a higher spatial resolution and introduces the general modeling procedure that underlies all our fusion applications. in case study 1, the tissue distribution of ion m / z 762.5 (identified as pe(16:0/22:6)) is measured through an ims experiment performed at 100 m spatial resolution (fig. 3b) is taken from the same tissue section stained with h&e after the ims acquisition. our two - phase fusion method (see online methods and supplementary figs. 1, 2, and 3) combines the information from both modalities, builds a model to capture any cross - modality relationships it can detect, and employs that model and the microscopy measurements to predict the distribution for all ions at 10 m resolution. the spatial prediction for ion m / z 762.5 3c). additionally, we compare the 100 m measurement and the fusion - based 10 m prediction to an ion image for m / z 762.5 actually acquired at 10 m on an adjacent tissue section (fig. 3d). the ims acquisition parameters are identical for (a) and (d), except for increased laser power required to compensate for reduced signal intensities at 10 m pixel widths. an example by an alternative up - sampling approach, bilinear interpolation (supplementary fig. the online methods provide details on the model building and evaluation process (supplementary figs. 5 and 6). the ims - microscopy model obtained by pls regression between ims and microscopy - derived variables, contains a sub - model for each ims variable (supplementary fig. model performance is therefore specific to each ims variable, and needs to be evaluated to ascertain for which ion peaks good prediction (and useful fusion) is possible. this percentage score summarizes how well the measured ion distribution can be predicted using the given microscopy observations. a value of 100% indicates that the cross - modality relationships allow complete reconstruction of the measured intensity distribution using only variables from the other technology. a value close to 0% signifies that no cross - modality relationship could be found or modeled for this ion, and that fusion - driven prediction is not an option for it. most measured ion images can be predicted at least partially using microscopy, and in our examples we rely on fusion only for ions with a score above 75%. we additionally introduce the absolute residuals image and the 95% confidence interval image as measures of prediction performance in function of tissue location (supplementary fig. 6). while m / z 762.5 and 747.5 (a combination of three nominally isobaric lipids, supplementary fig. 9) exhibit a strong cross - modality relationship to h&e microscopy, m / z 766.5 (pe(18:0/20:4)) and 715.6 (pe - cer(d16:1/22:0)) from the same ims experiment are examples of ions for which no such relationships could be found and thus prediction is not recommended (supplementary figs. 7 and 8). the access to information from different technologies allows fusion to predict beyond hard constraints inherent to a particular sensor type. this advantage, for example, enables the image sharpening application to push beyond the physical limits of the ims laser by predicting at a spatial resolution below the wavelength of the laser. as an example, we apply the fusion procedure to a mouse brain sample on which both source modalities have been pushed to their current state - of - the - art in spatial resolution for the instrumentation used in this experiment (fig. / z 646.4 (nominal isobars cer(d18:1/24:1) and second c isotope of cerp(d18:1/18:0)) and 788.5 (nominal isobars ps(18:0/18:1) and pe(40:7)) were successfully predicted with 75% and 76% scores at 330 nm resolution (fig. 4c), using a 355 nm wavelength laser to acquire the source ims measurements. 4a), while the textural information was encoded at 330 nm resolution in an h&e stained microscopy image of an adjacent section (fig. additional results in the supplementary information demonstrate how fusion can predict to any spatial resolution between the native ims and microscopy resolutions (supplementary figs. it is also independent of the tissue type used or the molecule type measured (supplementary figs. 12 and 18), and the method is shown to operate with tissue stains other than h&e (supplementary figs. 1316, 17). fusion is shown to provide useful integration and prediction even for ion peaks that report multiple unresolved ion species (supplementary fig. finally, using a synthetic multi - modal data set, the behavior of the method is verified against a gold standard of known cross - modal and modality - specific patterns (supplementary fig. this application of the fusion process develops the capability of predicting ion distributions in areas not measured by ims, using a model built from areas where data from both modalities are available. as an example, the ion distribution for m / z 10,516 is predicted in non - ims measured mouse brain areas (fig. first, an ims - microscopy model is built on a sub - area of the tissue where ims measurements (in the mw range of interest) are available at 100 m resolution and h&e - stained microscopy at 5 m resolution. subsequently, the model is used to predict both inside the ims - measured area as well as the area outside, where only microscopy is available. the predicted pattern for m / z 10,516 outside the modeled area was successfully confirmed via ims measurements external to this case study. although prediction at the native ims resolution of 100 m is possible (supplementary fig. 21), the availability of microscopy at 5 m resolution enables additional sharpening of the ion predictions to 5 m both inside and outside the modeled area (fig. the discovery of cross - modality relationships enables the separation of a measured tissue signal into a part that can be predicted by the other technology and a part that is modality - specific. for measured signals with strong cross - modal support, this information can be used to filter technology - specific noise from genuine tissue signal. this process can substantially increase the signal - to - noise ratio of observations, and enables discovery of patterns that might otherwise be missed. each ion image measured by ims can be considered a superposition of noise variation on top of a biological or sample signal pattern. the fusion model tries to write each ion image as a linear combination of microscopy - derived patterns, and for ion images with strong cross - modal support, the model succeeds in reproducing most if not all of the biological or sample signal pattern that way. since the noise tends to be sensor - specific, it is highly unlikely that fusion finds a link to an identical pattern in the other technology. as a result, modality - specific noise variation will often not survive the modeling and prediction process, effectively de - noising the predictions. since the biological signal often reports an underlying tissue structure that can modulate measurements in both modalities, finding a relationship across technologies is not uncommon and when that happens the presence of real tissue variation in the predictions is more readily observed. it is not necessarily so that all technology - specific variation is noise, since a measurement might be reporting a biological feature that can only be detected by one of the sensors. however, that situation can be detected by a reduced reconstruction score and can even be spatially confined to a tissue sub - area using for example the absolute residuals image. for measured variables and tissue areas with strong cross - modal support, fusion enables enrichment of genuine tissue signal and removal of modality - specific noise. multi - modal enrichment can cause a feature to be discovered or recognized as biological or sample - based when in a single - modality analysis it would be mistaken for noise or go unnoticed. propagation through the fusion process into the predictions indicates that these features are corroborated by measurements in both modalities. from a microscopy viewpoint,, fusion provides an increased confidence in the genuine nature of these features, so that they may be recognized from faint signals in the noise. fusion separates features with support across technologies from those supported by only a single sensor type. it shows a localized intensity drop, which might be perceived as biological since it covers multiple pixels. however, in microscopy (acquired post - ims) there is no visual trace at this location and even the fusion process finds no cross - modal evidence to support this drop as a real tissue feature. although lack of cross - modal corroboration does not necessarily mean a feature is noise, since it can be a biological feature detectable by only one of the technologies, it does reduce confidence in it being a genuine tissue feature and suggests here an ims acquisition anomaly. fusion - based filtering can also be used as a global method for de - noising ion images with strong cross - modal support. as an example, an ion image for m / z 5,666 measured at 100 m resolution in mouse brain is fused with an h&e - stained microscopy image at 5 m resolution (supplementary fig. a similar cleanup effect and increase in s / n is also observed in predictions for other ions from this data set (supplementary figs. the image fusion process combines different image types, each measuring a different aspect of the content of a tissue sample, and predicts the tissue content in an integrated way as if all aspects were observed concurrently. modeling between technologies since this report examines ims - microscopy fusion, ims - derived variables (peak intensities) are designated response variables and microscopy - derived variables (e.g. hue, texture, entropy) are used as predictor variables. the resulting mathematical model attempts to approximate each ion peak distribution in the ims source as a linear combination of microscopy - derived patterns. since each ims variable has its own relationship to the microscopy patterns, the fusion model contains a sub - model for each variable (supplementary fig. 5) and predictive performance will be variable - specific. building the best possible model does not ensure a good prediction in all cases, since there may not be a cross - modality relationship to exploit for a particular peak, or the complexity of the relationship can not be described accurately using the present model. it is therefore imperative that the model - building step is followed by an evaluation step that assesses for each m / z its prediction reliability. the first indicator is the reconstruction score, which reports how close a prediction using microscopy measurements gets to the measured ion distribution, given the model. the second indicator is the absolute residuals image, which shows where in the tissue microscopy - driven prediction approximates the ims measurements well, and where it does not. a third indicator conveys prediction robustness as a function of location by calculating a 95% confidence interval (ci) image using bootstrapping (see online methods references 41 and 42). this ci - image highlights in which tissue areas the prediction is more robust and in which areas the prediction might be model - specific and less trustworthy. the prediction of molecular distributions in tissue areas for which no ims is available is a form of out - of - sample prediction (fig. 5). in molecular imaging studies where comprehensive measurement of the entire tissue sample is not practical or economical, or in studies where the number of samples is very large it can also provide an evidence - supported view into the probable content of tissue areas or samples that need to be saved for other analysis techniques, e.g. in multi - branched drug discovery workflows. anomaly detection, where the measured content of a diseased tissue sample is directly compared to the content predicted to be there on the basis of a model trained on normal tissue. in high - dimensional data sets, this would immediately highlight differences and provide a facile path to pathology - derived anomalies. however, it is important to keep the conditions for the (microscopy) measurements between these different areas as similar as possible and to keep the model from over - fitting on the training data. fusion - based predictions show an enrichment of patterns supported by multiple technologies and an attenuation of modality - specific patterns. the enrichment effect is inherently present in fusion - based predictions and can be used to increase confidence in observations by cross - modal corroboration (supplementary figs. the ability of fusion to aid in separating true signal variation from instrumental noise variation by integrating with another data source, has immediate value for increasing measurement sensitivity and s / n without the need to physically adjust the instrument. the modeling aspects that influence the reliability of fusion - driven predictions are addressed in the online methods. a subsequent section specifically highlights how the empirical nature of the image fusion method, namely mining for cross - modality relationships rather than pre - defining them, ensures broad applicability to imaging modalities and sensor types beyond the data sources illustrated here. we also shortly discuss how the fusion process enables bi - directional communication and corroboration between different data sources, and how fusion with ims can contribute to microscopy interpretation and the pathological recognition process. furthermore, to enable the readers to experiment on their own data sets, we provide a full implementation of the image fusion framework as a command line utility that can be downloaded at http://fusion.vueinnovations.com. this package includes an example ims - microscopy multi - modal data set. in conclusion, image fusion enables the creation of novel predictive imaging modalities that combine the advantages of different sensor types to deliver insights that can not be normally obtained from the separate technologies alone. the modeling of cross - modality relationships provides predictive paths to new biological understanding through the integration of observations from different measurement principles. it also allows these fused modalities to circumvent sensor - specific limitations (e.g. ims resolution via sharpening), to attenuate technology - specific noise sources (e.g. matrix artifact attenuation by biological signal enrichment), and to predict observations in the absence of measurements (e.g. prediction of ion intensity in non - ims measured areas). the predictive applications of image fusion can contribute in those cases where conducting a physical measurement is unpractical (e.g. measurement time, instrument stability), uneconomical (e.g. laser wear, detector deterioration), or even not feasible due to instrumental limitations (e.g. spatial resolution beyond laser capabilities, low s / n). multi - modal studies have become widespread and the complementarity between different technologies is well appreciated. this study shows that the fusion of microscopy and mass spectrometry can provide remarkable results, and lays the groundwork for more advanced modeling across technologies. these prediction methods can fulfill an instrumental role in realizing the full potential of multi - modal pattern discovery, particularly in the molecular mapping of tissue. | a new predictive imaging modality is created through the fusion of two distinct technologies : imaging mass spectrometry (ims) and microscopy. ims - generated molecular maps, rich in chemical information but having coarse spatial resolution, are combined with optical microscopy maps, which have relatively low chemical specificity but high spatial information. the resulting images combine the advantages of both technologies, enabling prediction of a molecular distribution both at high spatial resolution and with high chemical specificity. multivariate regression is used to model variables in one technology, using variables from the other technology. several applications demonstrate the remarkable potential of image fusion : (i) sharpening of ims images, which uses microscopy measurements to predict ion distributions at a spatial resolution that exceeds that of measured ion images by ten times or more ; (ii) prediction of ion distributions in tissue areas that were not measured by ims ; and (iii) enrichment of biological signals and attenuation of instrumental artifacts, revealing insights that are not easily extracted from either microscopy or ims separately. image fusion enables a new multi - modality paradigm for tissue exploration whereby mining relationships between different imaging sensors yields novel imaging modalities that combine and surpass what can be gleaned from the individual technologies alone. |
heart rate recovery (hrr) is the rate at which heart rate declines from the end of exercise to a predetermined time point during recovery, typically one minute after exercise [1, 2 ]. after submaximal exercise, the withdrawal from sympathetic activity typically takes place 30 seconds into recovery [2, 4 ]. in contrast, increased sympathetic activity following peak intensity exercise may continue for approximately one to three minutes, delaying hrr [2, 5, 6 ]. a slower hrr has been related with lower cardiovascular fitness, thereby indicating an increased risk of cardiovascular disease. therefore, hrr has been suggested as a noninvasive method for cardiovascular risk assessment in both children and adults [3, 8 ]. body fat is positively associated with risk for cardiovascular disease in children and adults. as hrr is an indirect measure of cardiovascular disease risk, studies in adults have shown that indices of obesity are strong predictors of hrr following exercise [3, 11 ]. dimkpa and oji showed that in healthy adults, obesity surrogates negatively correlated with hrr following submaximal intensity exercise. similarly, singh and colleagues demonstrated that overweight youth experienced a slower one - minute postexercise hrr than healthy weight youth after a maximal protocol followed by one - minute cool - down period. moreover, dangardt and colleagues suggested that children with obesity displayed a significantly lower vagal activity at rest compared to overweight and lean controls. though these studies related body fat and hrr, no research has investigated hrr from aerobic exercise in children with excessive adiposity (i.e., those classified as obese, not overweight) compared to lean controls. in addition, measuring hrr in children predisposed to excessive adiposity (e.g., individuals with prader - willi syndrome) can also reveal particular mechanisms that affect postexercise hrr response. prader - willi syndrome (pws) is the best characterized genetic cause of childhood obesity. pws is characterized by hypotonia, hyperphagia, abnormally high adiposity, hypogonadism, and lack of normal growth hormone production. past work investigating autonomic nervous system (ans) function in youth with pws presents equivocal results [1518 ] ; therefore, those with pws are a particularly unique comparison group to nonsyndromal children as hrr may be related to congenital adiposity and/or syndrome - related ans dysfunction. stinted hrr immediately following peak exercise reveals deficits in parasympathetic reactivation [2, 5, 6 ], while stinted hrr from submaximal exercise reveals deficiencies in either parasympathetic reactivation or sympathetic withdrawal [2, 4 ]. thus, studying hrr response from peak and submaximal exercise provides information about different ans regulatory mechanisms. this study investigated whether adiposity and pws influenced postexercise hrr from two different exercise intensities. sixteen (7 m and 9 f) children of normal weight (nw = body fat percentage 85th percentile for age and sex ; bmi z - score : 0.1 0.6 ; age : 9.4 1.1 y), 18 (12 m and 6 f) children with obesity (ob = body fat percentage > 95th percentile for age and sex ; bmi z - score : 2.0 0.5 ; age : 9.3 1.1 y), and 11 (8 m and 3 f) youth diagnosed with pws (bmi z - score : 1.7 0.7 ; age : 11.4 2.5 y) participated in this study. this study was approved by the institutional review boards from california state university, fullerton, children 's hospital of orange county, and the united states army medical research and materiel command. written informed assent and consent were obtained from all participants and parents prior to participation. children with diabetes mellitus type 2, confirmed pregnancy, or those unable to participate in moderate to vigorous physical activity were excluded from participation., all participants were measured for anthropometrics, body composition, resting heart rate (hr), and blood pressure (bp) ; subjects then completed a graded exercise test. during visit two participants were instructed not to engage in physical activity (i.e., sports games, bike rides, physical education, etc.) for a minimum of 24 hours before exercise testing. in addition, participants were provided with a standardized breakfast that contained no caffeine to consume two hours prior to visit arrival. this study was part of a larger research effort devoted to examining the physiological and hormonal responses to exercise in youth with pws. parents of participants completed a medical history questionnaire regarding their child 's health and participation in moderate to vigorous physical activity. pws youth underwent a full health screening by a physician to determine contraindications for exercise testing and participation in the study, as well as tanner stage determined by breast, genital, and pubic hair development. participants removed shoes before all measurements. body mass was measured using a digital scale (es200l, ohaus, pinewood, nj) while participants wore a t - shirt and shorts. height was measured after participants inhaled using a wall - mounted stadiometer (seca, on, canada). waist circumference was measured following nhanes guidelines at the top of the participant 's iliac crest at the end of exhalation. total body fat percentage was determined using a whole body dual energy x - ray absorptiometry (dxa) scan (ge healthcare, ge lunar corp., female participants who had their first menses were required to complete a pregnancy test prior to completing the dxa scan. resting hr, measured via telemetry (polar usa, lake success, ny), and resting bp, measured via aneroid sphygmomanometer (diagnostix 752, american diagnostic corporation, hauppage, ny), were recorded following five minutes of seated rest. participants completed the mcmaster protocol, a cycling protocol tailored to height and sex, on a cycle ergometer (corival pediatric, lode b.v. the test consisted of two - minute stages at incremental workloads until the participant reached volitional exhaustion, failed to sustain the desired workload, requested to stop, stood up on the bike pedals, or experienced fatigue - related symptoms. relative peak power output was computed by dividing the test termination load by the participant 's lean body mass obtained from the dxa scan. hrr was determined by computing a hrr value (hrrv) calculated as the difference between test termination hr and hr recorded after one minute after exercise. one - minute postexercise hrr is the most commonly used methodology to assess recovery heart rate in children [13, 6, 8 ]. participants completed a discontinuous submaximal test consisting of ten two - minute cycling intervals each separated by one minute of rest. the resistance setting was based on the hr obtained during the mcmaster protocol and chosen to elicit a hr 160 bpm throughout. this intensity was chosen based on a previous study that used a discontinuous protocol in youth of normal weight and obesity to assess counterregulatory hormonal responses to acute exercise. bp and hr were measured and recorded using the same procedures as visit one. one - way analysis of variance (anova) tests were initially conducted to determine group differences for participant characteristics and all exercise responses. anovas were then conducted to determine group differences for hrrv for each exercise intensity. in case of significant group differences, no sex differences were found between and within groups for hrr ; therefore, all children were analyzed together. as expected, ob and pws displayed a significantly greater total body mass, waist circumference, trunk body fat percentage, and total body fat percentage compared to nw. in contrast, nw had significantly greater lean mass percentage than their counterparts ; there was no difference in lean mass percentage between ob and pws (table 1). all groups had a similar absolute peak workload, peak sbp, and peak dbp, while youth with pws exhibited a lower relative peak power output (expressed per kg of lean body mass) and peak hr than nw or ob (see table 2), who had similar relative peak workloads and hr. absolute submaximal workload was also similar amongst groups ; however, pws had a lower relative power output than nw only during submaximal exercise (see table 3)ob children were not significantly different from either pws or nw. when expressed as a percentage of peak relative workload, all groups worked at a similar aerobic effort during submaximal exercise (table 3). all groups had significantly different mean submaximal exercise hr responses, with nw having the highest and pws having the lowest (see table 3). when expressed as a percentage of peak hr, the hr response during submaximal exercise was significantly lower in ob compared to nw ; pws was similar to both groups (table 3). ob also had a significantly higher sbp in response to submaximal exercise compared to nw, and pws had a similar response to both groups. for submaximal intensity exercise, youth with pws had a significantly lower hrrv compared to both nw and ob, who had similar hrrv (figure 1). the results of this study showed that the decline in heart rate following exercise was not dependent on excessive adiposity. the only difference observed was in youth with pws who displayed a significantly slower hrr following submaximal intensity exercise compared to other children. two possible mechanisms explain the lower hrr following submaximal exercise in pws : cardiovascular fitness and/or autonomic abnormality. children of normal weight and those with obesity but without pws had similar recovery responses following both peak and submaximal aerobic exercises. therefore, the results of this study contradicted the results of an earlier study by showing that increased adiposity did not affect postexercise hrr in children with nonsyndromic obesity. however, there was a key methodological difference between the previous study and the present study. the present study measured passive (i.e., no cool down, seated) hrr immediately following test termination. by doing so, postexercise hrr was not affected by continued, voluntary sympathetic activation (which occurs during active cool down) and better isolated true recovery rate. another factor that could have influenced the hrr results of this study is cardiovascular fitness. higher levels of cardiovascular fitness have been positively associated with a faster hrr following exercise [2731 ]. adults with high levels of physical activity have shown to either sustain or improve hrr over 20 years compared to adults with low levels of physical activity. in addition, hrr improved after exercise training and a hypocaloric diet in obese children. the fact that cardiovascular fitness is related to hrr may partially explain the results of this study. both participants with obesity and those of normal weight were similarly fit (i.e., peak wkg lbm, peak hr, and peak estimated vo2peak (13.9 1.0 versus 13.6 1.2 mlkg lbmmin)). in contrast, those with pws were significantly less fit compared to children without pws (i.e., lower peak hr, lower wkg lbmand lower estimated vo2peak (12.4 1.3 mlkg lbmmin)). previous work showed poor cardiovascular fitness and low physical activity level in pws [32, 33 ]. poor cardiovascular fitness in pws might be best explained by physiological characteristics inherent to the syndrome including hypotonia, reduced knee flexor and extensor muscle strength, and/or muscle fiber size deficiency and atrophy. therefore, the lower hrr after submaximal exercise in those with pws compared to the other children possibly indicates that the low cardiovascular fitness in those with pws was related to the slow hrr [28, 31, 36 ]. in addition, it is possible that hrr in pws may have also been influenced by altered ans function. a review by haqq. suggests that in obesity there is an increased sympathetic activity as well as reduced parasympathetic activity. this mechanism is not so clear in pws, although it appears that pws presents similarities with an autonomic disorder called familial dysautonomia where more sympathetic neurons are affected than parasympathetic neurons. richer and colleagues investigated a small cohort of children with pws and controls to determine possible differences in ans function. postganglionic sympathetic function was evaluated through quantitative sudomotor axon reflex testing (sweat volume), cardiovagal testing (hr response to deep breathing), and pupillary response (hr and bp responses and hr variability spectral analysis to head - up tilt). children with pws exhibited a trend towards lower total sweat volume, a smaller hr increase with head tilt - up, and lower low frequency power hr variability at rest and with head - up tilt compared to the controls indicating possible impaired sympathetic function. the results of the present study showed a lower peak hr in pws perhaps related to lower muscular work capacity or sympathetic stimulation. however, the lower hrr following submaximal exercise in those with pws compared to nonsyndromal children may indicate a delayed sympathetic withdrawal and impaired function as suggested by richer and colleagues. in terms of peak exercise responses, it is possible that the chosen protocol limited the capacity to fully assess ans function, and therefore no differences among groups were obtained. past studies suggested that after peak intensity exercise hrr is delayed due to sympathetic activity lasting one to three minutes into the recovery period. the present study measured hrr only during the first minute after exercise, and this is a limitation of the study design and results [2, 5 ]. in addition, the participants with pws were significantly older than nonsyndromal obese controls, which might explain the deterioration in ans function. seven youth with pws presented tanner stages i iii, while two youth presented stage iv and one stage v. in comparison, all nonsyndromal children presented tanner stages i through iii based on their self - report. follow - up analyses were done to determine differences among groups in hrr including only participants with tanner stages i through iii. youth with pws (n = 7) still presented a significantly slower hrr following submaximal intensity exercise compared to nw (n = 16). however, ob (n = 17) responded similarly to both groups following submaximal exercise. similar to the previous analyses, no group differences were observed following maximal intensity exercise. it is possible that those youth with pws in later stages of puberty experienced more ans deterioration, exacerbating the hrr differences with the nonsyndromal obese controls. regardless, youth with pws still showed a delayed recovery from submaximal intensity exercise compared with normal weight controls, indicating possible ans dysfunction. it is necessary for future studies to account for pubertal status as a screening criterion to better assess whether the differences in hrr are related to ans function. lastly, recording blood pressure at the end of the recovery period is another measurement that could have helped assess the ans function in response to exercise. overall, the results of this study suggest that ans dysfunction in youth with pws could influence hrr following submaximal intensity exercise. having participants with pws complete these protocols presented barriers. most of these limitations were related to the physiological (lower than normal muscle force capacity, lack of stamina, and lower than normal motor proficiency), psychological (mild to severe mental retardation and mental rigidity), and behavioral (attention deficit, temper tantrums, and inability to accept change) characteristics of pws [13, 14, 32, 33, 39 ]. even with these difficulties, it was verified that the submaximal effort was similar between those with and without pws by calculating the percentage of relative power output and heart rate compared to peak effort. the present study lacked comparison groups with low and high cardiovascular fitnesses, a comparison that would have isolated the effect of cardiovascular fitness on hrr. however, a study with such research design may not be feasible given that inherently pws presents poor cardiovascular fitness. as demonstrated by the similar recovery rate in children of normal weight and those with obesity, adiposity did not influence hrr following peak or submaximal exercise. youth with pws showed a low cardiovascular recovery capacity, suggesting that poor cardiovascular fitness and/or an altered ans function may impact hrr. | heart rate recovery (hrr) is an indicator of all - cause mortality in children and adults. we aimed to determine the effect of adiposity and prader - willi syndrome (pws), a congenital form of obesity, on hrr. sixteen children of normal weight (nw = body fat % 85th percentile, 9.4 1.1 y), 18 children with obesity (ob = body fat % > 95th percentile, 9.3 1.1 y), and 11 pws youth (regardless of body fat % ; 11.4 2.5 y) completed peak and submaximal bike tests on separate visits. hrr was recorded one minute following peak and submaximal exercises. all groups displayed similar hrr from peak exercise, while nw (54 16 beats) and ob (50 12 beats) exhibited a significantly faster hrr from submaximal exercise than pws (37 14 beats). these data suggest that excess adiposity does not influence hrr in children, but other factors such as low cardiovascular fitness and/or autonomic dysfunction might be more influential. |
adenovirus (ad) belongs to a family of nonenveloped icosahedral viruses containing a double - stranded dna genome, adenoviridae, and genus mastadenovirus. there are 53 human ad serotypes divided into seven subgroups (a to g) based on immunologic, biologic, and biochemical characteristics. among these, viruses in groups b1, c, and e cause respiratory infections, group b2 viruses infect the kidney and urinary tract ; group f viruses cause gastroenteritis ; and several group d serotypes are associated with epidemic keratoconjunctivitis. most people recover from ad infections by themselves, but people with immunodeficiency and small children are at higher risk of fatal adenovirus infection. studies showed that ad can evade host immune responses, such as inhibition of interferon functions by rna and e1a, and inhibition of intrinsic cellular apoptosis in infected cells. recently, several studies evaluated human adenoviruses which play an important role in the study of tumorigenesis, including oncogenic transformation of cells, immune evasion, angiogenesis, and metastasis [3, 4 ]. there are no antiviral drugs to treat adenoviral infections, so treatment is largely directed at the symptoms. the discovery of the ad yielded further evidence that viruses can sometimes interfere with each other during the growth and replication within a host animal. other researchers found that this interference can be mediated by interferon produced by the host animal. so interferon has become prominent in the treatment of a variety of cancers and infectious diseases, such as hepatitis c. recently, several studies demonstrated that rna interference (rnai) can also be used for treatment with viral infection in vitro, such as hepatitis b virus, coxsackievirus b3, and coxsackievirus a16 [68 ]. these findings indicate that those specific sirnas targeted viruses are not as effective as expected. rnai can also be triggered by micrornas (mirnas), which are short ~22 nucleotide rna sequences that bind complementary sequences in the 3 utr of multiple target mrnas, playing an important role in the development, proliferation, differentiation and apoptosis of organisms. for example, mir-125b, mirr-150, mir-382, and mir-223 have been reported to contribute to the maintenance of human immunodeficiency virus-1 (hiv-1) latency in resting cd4 t cells. epstein - barr virus and kaposi sarcoma herpes viruses (kshvs) have been reported to encode mirnas, but the functions of most of them are not known. mirnas have been reported to be used as a tool for gene specific therapeutics against viral infections. the potential use of mirnas as novel noninvasive biomarkers for diagnosis has been suggested in other studies [1214 ]. in this study, we used a strategy of initial screening by applied biosystems ' next generation sequencing system which is sequencing by oligonucleotide ligation and detection (solid) and validation by quantitative rt - pcr (qrt - pcr), to analyze the different mirna expression profiling in ad3 infected hep2 cells. human laryngeal epithelial (hep2) cells were cultivated in complete rpmi medium 1640 (invitrogen) supplemented with 10% fetal calf serum (fcs) at 37c in an atmosphere of 5% co2. when the hep2 cells were grown in 25-cm flasks reached to 70% confluence, they were infected with ad3 at a multiplicity of infection (m.o.i.) of 0.4 under 50% tissue culture infectious doses (tcid50), and maintained after infection at 37c in rpmi 1640 medium with 2% fcs. hep2 cells were infected with ad3 as described above. at 6 hours, 24 hours, 48 hours, and 72 hours post infection (p.i.), rna samples were prepared from ad3 infected hep2 cells and controlled hep2 cells using a mirvana mirna isolation kit (ambion) : 1010 cultured cells were washed in 1% pbs for three times, washed cells were mixed with 600 l lysis / binding solution and 1/10 volume of mirna homogenate additive thoroughly by vortexing and incubated on ice for 10 minutes an equal volume of acid / phenol / chloroform (ambion) was then added to the each aliquot. the solution was centrifuged for 5 minutes at 10,000 g at room temperature. for mirna isolation, the extraction was mixed thoroughly with 1/3 volume of 100% ethanol and passed through a column (ambion). the filtrate was then mixed thoroughly with 2/3 volume 100% ethanol and passed through the second column (ambion). the column was washed following the protocol, and mirnas were eluted in 100 l of elution buffer (95c). for total rna isolation, the extraction was mixed thoroughly with 1.25 volume of 100% ethanol and passed through a column (ambion). the column was washed following the protocol and total rna were eluted in 100 l of elution buffer (95c). mirna samples (100 ng) isolated from ad3 infected hep2 cells and control hep2 cells were processed into sequencing libraries using the small rna expression kit (applied biosystems). briefly, rna was ligated overnight with the adapters from the kit, reverse transcribed, rnase h - treated, and pcr - amplified before size selection on agarose gels to contain 1661 nt of inserted sequences. libraries were amplified onto beads using emulsion pcr, deposited on slides, and sequenced using the solid v 2 sequencing system (applied biosystems) at the state key lab of bioelectronics laboratory, southeast university of china. finally, solid data was first analyzed by solid system small rna analysis pipeline tool (rna2map). firstly, the parameters set for alignments were the maximum length (18 nt) and the tolerance of 3 mismatches when generating initial seeds locations. in the extension step the mirbase sequences (sanger) of human being was download from mirbase (http://www.mirbase.org/). acceptable sequences were compared to the mirbase database (release 14.0). to increase signal above noise, we conservatively selected only those alignments corresponding to beads sampled a minimum of 10 times in any of the libraries. to confirm the expression of mirnas by deep sequencing approach, stem - loop quantitative rt - pcr (qrt - pcr) briefly, cdna was synthesized from total rna by using amv reverse transcriptase (takara). the 20 l reactions were incubated for 15 minutes at 16c, 30 minutes at 42c, and 5 minutes at 85c, and then held at 4c. subsequently, the 20 l pcr reactions included 1 l rt - pcr product, 10 l premix ex taq (takara), and 1 l sybr green (invitrogen). the reactions were incubated in a 96-well optical plate at 95c for 10 minutes, followed by 40 cycles of 95c for 15 seconds, and 60c for 1 minute. q - pcr assay was performed in triplicate using an abi 7500 machine (applied biosystems). the expression levels of candidate mirnas were measured in terms of threshold cycle value (ct) and normalized to human small nuclear rna u6. the ratio of two groups of mirnas was calculated by using the equation 2, in which ct1(infected cells) = ct1 ctu6, ct2(control cells) = ct2 ctu6 and ct = ct1 ct2. we firstly used the z - test to determine the statistical significance of the differences between the two libraries. this approach is to look at the number of copies of a specifc mirna per cell as a fraction or proportion of the total number of mirna molecules in that cell. the same proportion (p) of specifc tags should be present in the mirna library of all sequenced tags (1)p = nspecific mirna / cellntotal mirna / cell = nspecific mirnantotal mirna. so the z - value for a specific mirna could be calculated as following : (2)z - value = ptestpcontrolp0(1p0)/ntest+p0(1p0)/ncontrol. the proportion p0, the expected proportion when the null hypothesis is true, is calculated as p0 = (ntest + ncontrol)/(ntest + ncontrol). the z statistic is approximately normally distributed and can be compared with critical z value for the two - sided significance level. a z - test was used to deal with the raw data by considering both the copies and fold change of mirnas. candidate mirnas should be fulfl three criteria : (1) mean fold change > 2, (2) having at least 10 copies by solid sequencing, and (3) z score > 1.96 or < 1.96 for p <.05. cytopathic effect (cpe) was first observed at 24 hours post infection and progressed to moderate and severe cpe at 72 hours and 96 hours, respectively. mirna extracted from cells after 72 hours of infection was used for solid deep sequencing. to search for the mirnas expression in ad3 infected hep2 cells and the control, we prepared these two mirna samples for sequencing by the solid system. 358,297 effective reads were obtained in ad3 infected cells and 479,414 effective reads in control cells. after filtrating reads contaminated by rrnaetc (rrna, trna, snrna, and snorna), repeat fractions, and degraded fractions, the remaining effective reads were mapped to the human precursor libraries. 37,800 and 78,143 reads were obtained from infected and control cells, respectively. in these reads, the most abundant size class was 22 nt in both of ad3 infected hep2 cells and the control. following was 23 nt (27.7% in ad3 infected hep2 cells and 26.3% in the control) (figure 1). compared to the mirbase (14.0), 492 precursor, mirna out of 734 known precursor mirnas were identified among the ad3 infected hep2 cells, and 540 precursor mirnas were identified among the control hep2 cells. chromosomes 19 and x contain more precursor mirnas (12%, and 11%, resp.). 314 mirnas (51%) were located in introns of protein - coding genes, 231 mirnas (38%) were located in intergenic regions, while only 43 mirnas (7%) were located in exons of noncoding rnas or utr of protein coding genes. interestedly, 23 mirnas (4%) were located in either an exon or an intron depending on alternative splicing of the host transcript (table 1). to study the differential expression profile of known mirnas between ad3 infected hep2 cells and the control, both the z - test and fold - change analysis there are 80 precursor mirnas to meet the three criteria described above, and could be selected as candidates. among these candidates, 44 precursor mirnas were shown upregulated expression in ad3 infected cells (table 2). 19 out of 44 upregulated precursor mirnas showed higher values (over 10). among this, mir-1975 and mir-1302 - 2 have the highest z values with 49.33 and 31.13, respectively. table 2 showed the ratio of mirnas expression level of ad3 infected cells versus control cells. among this, mir-1975 and mir-1302 - 2 have the higher ratio (7.47-fold and 7.31-fold). 36 precursor mirnas were shown downregulated expression in ad3 infected cells (table 3). among this table 3 showed the ratio of ad3 infected cells / control cells (expression level for precursor mirnas). among this mir-181b-2 and mir-1274b showed lowest change in ad3 infected cells (0.19 fold) compared with control cells. to confirm the differential expression of mirnas in ad3 infected hep2 cells, we performed some mirnas tests with stem - loop q - pcr assays in total rna isolated from ad3 infected hep2 cells and the control, respectively. the expression levels of candidate mirnas were measured in terms of threshold cycle value (ct) and normalized to human small nuclear rna u6. the results showed that there was general consistency between q - pcr assay and solid sequencing analysis. the seven upregulated mirnas in solid results showed increased ratios measured in q - pcr assays (figure 3). for example, mir-1974, mir-1975, and mir-7 showed increasing values of 2.51, 4.87 and 2.44 respectively measured in q - pcr assay, and increasing values of 2.95, 7.47 and 6.34 were obtained in solid sequencing (table 2). the seven downregulated mirnas in solid results showed decrease ratios measured in q - pcr assays (figure 3). for example, the results showed decreased expression levels in mir-27b, mir-125b, and mir-27a in ad3 infected hep2 cells with fold change of 0.74, 0.75, and 0.77 respectively (figure 3). while in solid sequencing analysis, these mirnas have shown decreased expression with fold change 0.43, 0.41 and 0.38, respectively (table 3). to further understand the mirnas expression in ad3 infected hep2 cells at 6 hours, 24 hours, 48 hours, and 72 hours post infection, we performed q - pcr experiments on mirnas chosen from figure 3. the ratio of mirnas in ad3 infected cells versus controls was calculated by using the equation 2. surprisingly, all of the mirnas shown in table 4 exhibited increased expression in ad3 infected cells at 6 hours post infection. however, at 48 hours p.i. and 72 hours p.i., mir-27b, mir-125b, and mir-181b showed downregulated expression in ad3 infected cells comparing controls (table 4). at 48 hours p.i. and 72 hours p.i., mir-1974 showed increased expression in ad3 infected cells with fold change 1.36 and 1.26 respectively. however, at 24 hours p.i., mir-1974 showed decreased expression in ad3 infected cells. table 4 showed that the mir-17 expression was upregulated at 6, 24, and 72 hours p.i. in but at 48 hours p.i., mir-17 showed downregulated expression in ad3 infected cells. as second - generation sequencing platforms have matured, all three major high - throughput sequencing systems illumina 's genome analyzer (solexa), life technologies ' abi solid, and roche 's 454 gs flx have been used to study mirna expression profiles associated with disease such as cancer, viral and metabolic diseases. compared with the microarray technology, deep sequencing can generate millions of small rna sequence reads from a given sample, giving possible to discover the novel mirnas or study the function of virus encoded mirnas by using bioinformatics and molecular biology tools. mirnas have recently been recognized as major regulators of gene expression in various viral infections. virus - encoded mirnas seem to evolve rapidly and regulate both the viral life cycle and the interaction between viruses and their hosts. in the present study, we have screened out some mirna candidates that have obvious differential expression from ad3 infected hep2 cells by solid deep sequencing system. this study identified 492 precursor mirnas in the ad3 infected cells and more precursor mirnas in control cells by mapping the human mirbase database. out of these almost 38% were located in intergenic regions, which usually contain their own mirna gene promoter and regulatory units. however, as much as 51% mirnas were located in introns, and only 7% were located in exons of noncoding rnas or utr of protein coding genes. these usually show a concurrent transcription and regulation expression profile originating from a common promoter with their host genes [1921 ]. some pre - mirnas existing in drosphila and c elegants have been reported to be spliced from the introns in which they reside without having to undergo the microprocessor machinery. these mirnas are called mirtrons [22, 23 ]. since our study identified 51% mirnas were located in introns, we think more mirtons could be discovered through bioinformatics and molecular biology tools. one of the mechanisms is that the virus must interfere with the host cell antiviral defense mechanisms to maximize escape and spread of the progeny virus during a virus infection. previous studies determine the changes in the host cell gene expression profiles upon infection with ad using dna microarray technique [24, 25 ]. for example, many transcriptions factor e2f - dependent host cell genes showed different expression during ad infection. 45% of the upregulated genes and 25% of the downregulated genes contained potential e2f binding sites. it is showen that e2f - dependent host cell genes are subjected to a selective regulation. previous research has reported that the expression of e2f1 is negatively regulated by two c - myc - regulated mirnas, mir-17 - 5p, and mir-20a. in our study, upregulated mir-17 may target with transcription factor e2f1, playing important role in cell differentiation, proliferation, and apoptosis. out of these, mir-17 has been reported to be overexpression in b - cell lymphoma samples. this suggests that during a virus infection, cellular apoptosis must delay long enough and the virus needs to establish optimal conditions for replication to ensure efficient production of progeny virus. our study may provide a useful clue for the biological function research into ad3 infected host cells. further investigation needs to clarify the roles of identified mirnas in the pathogenesis of ad3 infected host cells. solid sequencing provides a useful method for identification of the mirnas profiles in ad3 infected hep2 cells. 492 precursor mirnas were identified in the ad3 infected hep2 cells, and 540 precursor mirnas were identified in the control. a total of 44 mirnas demonstrated high expression and 36 mirnas showed lower expression in the ad3 infected cells than the control. further studies are required to identify the mirna target genes and the functions of the mirnas in the complex molecular network regulation during the virus infection host cells using bioinformatics tools. | adenovirus infection can cause various illnesses depending on the infecting serotype, such as gastroenteritis, conjunctivitis, cystitis, and rash illness, but the infection mechanism is still unknown. micrornas (mirna) have been reported to play essential roles in cell proliferation, cell differentiation, and pathogenesis of human diseases including viral infections. we analyzed the mirna expression profiles from adenovirus type 3 (ad3) infected human laryngeal epithelial (hep2) cells using a solid deep sequencing. 492 precursor mirnas were identified in the ad3 infected hep2 cells, and 540 precursor mirnas were identified in the control. a total of 44 mirnas demonstrated high expression and 36 mirnas showed lower expression in the ad3 infected cells than control. the biogenesis of mirnas has been analyzed, and some of the solid results were confirmed by quantitative pcr analysis. the present studies may provide a useful clue for the biological function research into ad3 infection. |
chinese food and soups contain monosodium glutamate (msg) as the main addictive ingredient. a sensitive individual may suffer from headache, giddiness, sweating, abdominal pain, and urticaria within a few hours of consumption of msg. angioedema may be delayed up to 816 h after the consumption of msg and it may persist for 24 h. this delayed life - threatening effect in the form of angioedema makes diagnosis difficult. a 23-year - old male was brought to the general hospital at mahad, with complaints of difficulty in speaking, inability to swallow saliva, and continuous spitting. he strongly rejected taking sips of water and was afraid of water like a hydrophobic patient. the posterior pharynx could not be visualized, even after repeated attempts with depression of the tongue with a spatula. the uvula was touching the base of the tongue [figure 1 ]. on arrival, swelling of the uvula and surrounding tissues, almost closing the entry to the pharynx, touching the base of floor of the mouth. his blood pressure was 120/80 mmhg ; pulse was 88 beats / min and regular. his extremities were warm, the electrocardiograph was within normal limits, and spo2 was 98% on ambient air. the patient said that he ate only chinese triple fried rice for dinner the previous night 10 hours earlier. within an hour of eating, he had giddiness, sweating, and itching all over the body which subsided without any medication. two hours earlier he had woken up due to difficulty in swallowing and speaking out a few words. he communicated with his family with hand gestures regarding his inability to speak and swallow. the hemoglobin was 14 mg / dl, white cell count 13,000 per cu mm (normal 500010,000), eosinophils 1% (normal 19), neutrophils 90.9%, random blood sugar 135 mg / dl (normal 70140), and serum ige 917.021 iu / ml (normal 3188). the patient was admitted and given intravenous crystalline solution of 40 mg methyl prednisolone and was monitored continuously for oxygen saturation. there was no improvement over half an hour, so 0.30 mg of adrenaline was administered as a deep intramuscular injection over the lateral side of the thigh. the patient no longer had drooling of saliva and was able to speak a few words. his throat looked angry around the uvula and surrounding. on account of raised leukocyte count with neutrophilia, the patient was treated with oral amoxycillin with clavulinate. at 16 h after the initiation of treatment, he started normal oral communication and was able to swallow liquid. on the following day, there was a gradual reduction in the size of the uvula and surrounding inflammation. 2 days from admission, the uvula and surrounding structures including the palate returned to normal and he could swallow solids [figure 2 ]. chinese food contains msg as the main additive ingredient and flavor enhancer. in a graded challenge, in addition to msg, many other food additives, including preservatives such as meta - bisulfate, soya sauce, coloring agents, such as, carmoisine, sunset yellow, tartrazine, scombroidosis, and seafood may stimulate allergic reactions. angioedema of the uvula after ingestion of msg can be fatal unless patients and physicians are aware of unusual reaction to msg. it is prepared by fermentation of carbohydrate sources, such as sugar beet molasses by acid hydrolysis, by the action of micrococcus glutamicus on a carbohydrate and subsequent partial neutralization, or by hydrolysis of vegetative proteins. large amount of msg is used in japanese, chinese, and south asian food preparation. even free glutamate that exists in tomatoes, mushrooms, and parmesan chinese is responsible for chinese restaurant syndrome. the exact etiology of the chinese restaurant syndrome is not known but, animal studies have shown neurotoxic and neuroexcitatory properties of msg in the hypothalamic region of the central nervous system. the delay of uvular swelling for > 8 h such as in our patient can be explained by the time taken for the synthesis and release of hormonal factors from the hypothalamic - pituitary region. a systematic review by obayashi and nagamura evaluating causal relationship between msg and headache was inconclusive and suggested the need of more blinded studies. however, consumption of msg in high concentration without solid food (as in soups) was found to be associated with higher incidence of headache and other symptoms. severe reaction to msg, a common active ingredient in chinese cooking may result in fatal outcome if not treated in time. delayed occurrence of serious symptoms are to be expected. | in india, eating chinese food has become very popular. we hereby report a case who presented with angioneurotic edema of the uvula and the surrounding structures, after eating chinese food, which resulted in severe difficulty in swallowing saliva and inability to speak. |
children <3 years of age attending two health centers, one public reference hospital (joao alves), and a private hospital in aracaju were invited to participate in our study during april and may 2002. these months correspond to the beginning of the rainy season, when most cases of bronchiolitis occur. the health centers provide 24-hour medical services for acute illnesses ; patients with severe health problems are referred to the public hospital. the small private hospital caters to self - referred and transferred patients (mostly from the public hospital). children with diagnoses of acute lower respiratory infections (alri) were recruited consecutively after informed parental consent. the diagnosis of alri was based on the presence of cough, tachypnea, chest indrawing, or wheeze of < 7 days duration and followed the world health organization s standard protocol for research on alri (14). nasopharyngeal secretions were collected by using sterile mucous traps (maesk medical a / s, bettina bay, denmark). immediately after collection, aspirates were mixed with phosphate - buffered saline, transferred into 2-ml cryotubes, and kept frozen at 80c until analyzed. hypoxia levels were measured by pulse oximetry before the use of oxygen, and children were treated according to local guidelines for the management of alri. detection of the hmpv genome was performed by reverse transcription polymerase chain reaction amplification (rt - pcr) of the matrix (m), fusion (f) and nucleocapsid (n) protein genes, as described previously (5). selected pcr products were cloned into a ta cloning vector (pgem - t, promega, uk), and the sequence was determined to confirm the identity of the virus detected by the pcr reaction. samples were defined as hmpv positive if at least two of the rt - pcr test results were positive, although in practice all positive samples had at least two positive pcrs. a total of 111 children (57 from the health centers, 25 from joao alvez hospital, and 29 from the private hospital) were recruited. fifty - three (48%) children were infected with rsv alone, 19 (17%) with hmpv alone, and 8 (7%) with both (co - infections). forty - six (88%) of the rsv cases were of group a and 6 (12%) group b. the incidence of alri increased during the 10 weeks of the study from no cases in the first 2 weeks, 4 cases in the next 2 weeks, and up to 25 cases in week 9 (figure 1). rsv and hmpv infections appeared to coincide in time during the period of the study. number of children with respiratory syncytial virus (rsv), human metapneumovirus (hmpv), and rsv / hmpv co - infection by study week (week 10 incomplete). eighteen (32%) of the 57 patients attending the health centers had hmpv compared to 1 (4%) of the 25 infants attending the reference hospital (p = 0.01). in contrast, rsv was significantly (p = 0.01) more frequently detected in patients attending the referral hospital (17 [68% ] of 25) than the health centers (23 [40% ] of 57). the age distribution of the infected infants is shown in figure 2. the greatest number of cases of rsv was observed in children < 12 months of age. hmpv infection appeared to be more frequent in children 624 months of age, although this finding was not statistically significant. figures are frequencies (%), unless otherwise specified. number of children with respiratory syncytial virus (rsv), human metapneumovirus (hmpv), and rsv / hmpv co - infection by age. all children had coughing ; 61 (55%) were wheezing, which was audible without auscultation ; and 34 (31%) had chest indrawing. the mean respiratory rate on consultation was higher in patients with rsv than in patients with hmpv infection (p = 0.03). similarly, wheezing was more often audible in children infected with rsv (59%) than in children with hmpv (47%) or rsv / hmpv co - infections (25%), although this finding did not reach statistical significance (chi square for trend, p = 0.07). eighteen (16%) children had severe hypoxia with po2 90%, and 44 (40%) had po2 < 94%. five (26%) of the 19 children with hmpv had po2 < 94% compared to 25 (47%) of the 53 with rsv and 5 (63%) of the 8 with rsv / hmpv co - infection (chi square for trend, p = 0.05). severe hypoxia (po2 < 90%), however, was less frequent in children with hmpv (1 [5% ] of 19) or rsv / hmpv co - infections (1 [13% ] of 8) than in children with rsv infection (14 [26% ] of 53 (chi square for trend, p = 0.04). the lower prevalence of hypoxia suggests that children with hmpv had milder illnesses, since only 5 (26%) of the 19 hmpv patients and 2 (25%) of the 8 patients with rsv / hmpv co - infections were admitted to hospital compared with 27 (51%) of the 53 with rsv infection, although this finding was not statistically significant. this study is the first to describe hmpv in latin america. to date, information on the clinical signs and symptoms and epidemiology of hmpv infection is limited. our study indicates that hmpv and rsv may have similar signs and symptoms and can present as a co - infection. the incidence of hmpv increased at the same time that the number of cases with rsv was increasing. hmpv, however, was more prevalent in children attending peripheral clinics than the referral hospital. similarly, children with hmpv were less likely to be hypoxic and had lower respiratory rates than those with rsv, which suggests that hmpv infection may result in milder clinical signs and symptoms. further studies, however, are necessary to explore if coinfected children are more or less likely to have a worse clinical outcome than children infected with only one virus. a recent report of hospitalized children in intensive care suggested that dual infections could be associated with increased severity (5). an alternative explanation to reconcile these findings is the possibility that different hmpv subgroups (2,9,10,13,16) produce clinical syndromes of varying severity. caution is necessary to interpret our findings as this was a cross - sectional study. virus in nasopharyngeal secretions does not prove that it is the cause of the respiratory symptoms, as we did not investigate the prevalence of the virus in asymptomatic children or the natural history of the infection. hmpv, however, has been associated with community - acquired respiratory illnesses (2,6,912) and severe alri in immunocompromised patients (17,18), and the virus was likely responsible for the clinical illness in our children. several studies have also described an association between hmpv and acute wheezing (35,8). although wheezing was a feature in 47% of the hmpv - infected children, a greater proportion (59%) of children infected with rsv had wheezing. the association between rsv infection and asthma is well studied. however, most children are exposed to rsv infections before the age of 2 years, and a combination of factors is likely required (19). the coincidental timing of rsv and hmpv might have led us to miss the true cause. the role of hmpv in alri and asthma merits further investigation. future studies should aim to establish the natural history and clinical outcome of these infections. | we describe the epidemiologic and clinical characteristics of 111 children attending clinics and hospitals in aracaju, northeast brazil, with acute respiratory infections attributable to human metapneumovirus (hmpv), respiratory syncytial virus (rsv), or both in may and june 2002. fifty - three (48%) children were infected with rsv alone, 19 (17%) with hmpv alone, and 8 (7%) had rsv / hmpv co - infections. |
placement of fixed orthodontic appliances usually colonizes streptococcus mutans, and enhances the risk of dental caries.[13 ] fluoride - releasing bonding materials for bonding the brackets showed almost no demineralization inhibiting effect. buyukilmaz and ogaard in an earlier study suggested the combined use of antimicrobials and fluoride to enhance the cariostatic effect of fluoride. a new fluoride releasing and antimicrobial bonding material clearfil protect bond self - etch primer (cpb) (kurrary medical inc. this two - step self - etch primer (sep) consists of a specially treated sodium fluoride to resist against demineralization. additionally, it contains 12-methacryloyloxydodecyl pyridinium bromide (mdpb) ; the antibacterial agent of this sep. recently, another self - etching primer has been developed for orthodontic practice (transbond plus self - etching primer, 3 m unitek, monrovia, ca, usa). this one - step sep combines the etching, priming, and bonding in one - step application and reduces the bonding time, increases the cost - effectiveness for the clinician and the patient, and not requiring a separate acid etching step and the need for rinsing. however, effective bonding of these two self - etching primers is controversial. and cal - neto and miguel reported that the sbs of brackets bonded with cpb, in comparison with conventional method (cm) (acid etching and priming) did not show any significant difference, while bishara. and tuncer. found that cpb had significantly higher sbs than cm. on the other hand, ulker., and holzmeier., stated that the sbs of brackets bonded with cpb was significantly lower than cm. dorminey., reported no significant difference in the bond strength between the brackets bonded with tp and cm, whereas aljubouri., and grubisa., observed significantly lower sbs in brackets bonded with tp and conversely, buyukilmaz., and bishara., reported significantly higher sbs values in brackets bonded with tp, in comparison with cm. based on the controversial results of the previous studies, the purpose of this study was to evaluate and compare the sbs and adhesive remnant index (ari) of brackets bonded with conventional acid etching and priming, transbond plus, and clearfil protect bond self - etch primers. in this prospective in vitro study accomplished in torabinejad dental research center of isfahan dental school, we examined 48 human maxillary premolars, extracted for orthodontic purposes. the selection criteria included intact buccal enamel, the absence of pretreatment with chemical agents and the absence of cracks and dental caries. after storage of the sample in thymol (0.1% wt / vol) for a week, they were rinsed with distilled water and then the roots of them were embedded into a self - cure acrylic resin (rapid repair, detrey dentsply ltd. the long axis of each tooth was aligned parallel to the cylindrical base with a jig. the teeth were cleaned and polished with a fluoride - free pumice (prophylaxis paste, golchai co., tehran, iran) using a low - speed handpiece for 10 seconds, and then, they were washed and air dried with an oil free air spray thoroughly. the samples were randomly divided into three groups of 16 teeth each. for bonding the samples with transbond xt adhesive resin (3 m unitek, monrovia, ca, usa) [figure 1 ], 0.018 stainless steel brackets (standard edge, orthoorganizer, ca, usa) were used. the bonding procedure was performed for each self - etch primer as follows : transbond xt adhesive resin the teeth were etched with 37% phosphoric acid (american orthodontics co., wi, usa) for 30 seconds. then, they were washed completely and dried for 10 seconds to chalky white appearance. after application of a thin layer of the transbond xt primer (3 m unitek, monrovia, ca, usa) [figure 2 ] on the etched enamel surface, the brackets were bonded with transbond xt adhesive resin and light cured with dr 's light (prestige dental products inc. first, the self - etching primer was applied using slight agitation for 20 seconds and dried with a mild air flow. after that, the adhesive system was cured for 10 seconds and the brackets were bonded with transbond xt adhesive resin similar to group 1. clearfil protect bond (self etching primer and bond) according to the manufacturer 's instruction, tp [figure 4 ] was applied to the teeth for 5 seconds and the brackets were bonded with transbond xt adhesive resin and light cured for 40 seconds. transbond plus (one step self etching primer) all the samples were stored in 37c distilled water for 24 hours and were thermocycled from 5c to 55c for 500 cycles. sbs of the sample was evaluated by a universal testing machine (zwick 2020, zwick gmbh and co., ulm, germany). the blade of machine was placed vertically between the base of bracket and the resin [figures 5 and 6 ] and started to apply force in and occluso - gingival direction with a crosshead speed of 1 mm / min. placing the blade of zwick machine vertically between the base of the bracket and the resin (lateral view) placing the blade of zwick machine vertically between the base of the bracket and the resin (frontal view) to determine the shear bond strength in mpa, the measured sbs in newton was divided by the bracket surface area 11.55 mm. the mode of failure was assessed with optical stereomicroscope (10 magnification, olympus szx9, olympus corporation, shinjuku- ku, japan). failures were scored, according to adhesive remnant index (ari) developed by artun and bergland. the following scale is used to quantify the amount of remaining adhesive on the teeth surfaces : o : no adhesive remains on the tooth ; 1 : less than 50% of adhesive remains on the tooth ; 2 : more than 50% of adhesive remains on the tooth ; 3 : all adhesive remains on tooth and the imprint of bracket base is visible on it. all statistical analyses were preformed with the statistical package for special science (spss 11.0, spss inc., descriptive statistics, including the mean, standard deviation, minimum, and maximum, were calculated for each of the three groups. after analysis the normal distribution of sbss of the samples with kolmogorov - smirnov test and test of homogeneity of variances, comparisons of the means of sbs in the three groups were carried out with one - way analysis of variance (anova). the kruskal - wallis test was used to determine significant differences in the ari values of the groups. for bonding the samples with transbond xt adhesive resin (3 m unitek, monrovia, ca, usa) [figure 1 ], 0.018 stainless steel brackets (standard edge, orthoorganizer, ca, usa) were used. the bonding procedure was performed for each self - etch primer as follows : transbond xt adhesive resin the teeth were etched with 37% phosphoric acid (american orthodontics co., wi, usa) for 30 seconds. then, they were washed completely and dried for 10 seconds to chalky white appearance. after application of a thin layer of the transbond xt primer (3 m unitek, monrovia, ca, usa) [figure 2 ] on the etched enamel surface, the brackets were bonded with transbond xt adhesive resin and light cured with dr 's light (prestige dental products inc. first, the self - etching primer was applied using slight agitation for 20 seconds and dried with a mild air flow., the adhesive system was cured for 10 seconds and the brackets were bonded with transbond xt adhesive resin similar to group 1. clearfil protect bond (self etching primer and bond) according to the manufacturer 's instruction, tp [figure 4 ] was applied to the teeth for 5 seconds and the brackets were bonded with transbond xt adhesive resin and light cured for 40 seconds. transbond plus (one step self etching primer) all the samples were stored in 37c distilled water for 24 hours and were thermocycled from 5c to 55c for 500 cycles. the teeth were etched with 37% phosphoric acid (american orthodontics co., wi, usa) for 30 seconds. then, they were washed completely and dried for 10 seconds to chalky white appearance. after application of a thin layer of the transbond xt primer (3 m unitek, monrovia, ca, usa) [figure 2 ] on the etched enamel surface, the brackets were bonded with transbond xt adhesive resin and light cured with dr 's light (prestige dental products inc. first, the self - etching primer was applied using slight agitation for 20 seconds and dried with a mild air flow. then, clearfil protect bond was applied and gently air flowed. after that, the adhesive system was cured for 10 seconds and the brackets were bonded with transbond xt adhesive resin similar to group 1. according to the manufacturer 's instruction, tp [figure 4 ] was applied to the teeth for 5 seconds and the brackets were bonded with transbond xt adhesive resin and light cured for 40 seconds. transbond plus (one step self etching primer) all the samples were stored in 37c distilled water for 24 hours and were thermocycled from 5c to 55c for 500 cycles. sbs of the sample was evaluated by a universal testing machine (zwick 2020, zwick gmbh and co., ulm, germany). the blade of machine was placed vertically between the base of bracket and the resin [figures 5 and 6 ] and started to apply force in and occluso - gingival direction with a crosshead speed of 1 mm / min. placing the blade of zwick machine vertically between the base of the bracket and the resin (lateral view) placing the blade of zwick machine vertically between the base of the bracket and the resin (frontal view) to determine the shear bond strength in mpa, the measured sbs in newton was divided by the bracket surface area 11.55 mm. the mode of failure was assessed with optical stereomicroscope (10 magnification, olympus szx9, olympus corporation, shinjuku- ku, japan). failures were scored, according to adhesive remnant index (ari) developed by artun and bergland. the following scale is used to quantify the amount of remaining adhesive on the teeth surfaces : o : no adhesive remains on the tooth ; 1 : less than 50% of adhesive remains on the tooth ; 2 : more than 50% of adhesive remains on the tooth ; 3 : all adhesive remains on tooth and the imprint of bracket base is visible on it. all statistical analyses were preformed with the statistical package for special science (spss 11.0, spss inc., chicago, illinois, usa). descriptive statistics, including the mean, standard deviation, minimum, and maximum, were calculated for each of the three groups. after analysis the normal distribution of sbss of the samples with kolmogorov - smirnov test and test of homogeneity of variances, comparisons of the means of sbs in the three groups were carried out with one - way analysis of variance (anova). the kruskal - wallis test was used to determine significant differences in the ari values of the groups. the results of the anova showed statistically significant difference in sbs among the three groups (p<0.001). the tukey 's hsd test indicated that the sbs of group cm (mean : 15.084.00 mpa) and group cpb (mean : 13.653.01 mpa) were significantly higher than group tp (mean : 9.772.57 mpa) (p<0.001), but there was no significant difference in sbs of group cm and group cpb (p=0.435). descriptive statistics of shear bond strength in study groups the distribution of the ari scores is shown in table 2. wallis test showed no significant difference in the ari scores of the groups (p=0.287). the potential risk of new enamel caries among patients with fixed appliances is estimated between 13 and 75%. patients oral hygiene status and diet during treatment are the significant factors for developing dental caries. mdpb in clearfil protect bond has revealed great antibacterial effect because it has the potential to destruct the cell membrane of bacteria. the specially treated sodium fluoride (naf) in cpb makes the enamel resistant to the acid generated by bacteria. in the current study the mean sbs of group cpb in comparison with the mean sbs of group cm did not show any significant difference, according to post hoc tukey 's test (p=0.435). the obtained result was consistent with the results of studies conducted by korbmacher. and cal - neto and miguel. in spite of the results of the present study, the higher sbs of brackets bonded with cpb, has been reported by bishara., and tuncer., conversely, ulker., and holzmeier., showed lower sbs of brackets bonded with cpb than conventional acid etching and priming however, according to our study cpb has fulfilled the requirement to bond orthodontic brackets, because it shows the sbs higher than the minimum recommended by reynold., and is not such greatly high that could damage the periodontium during debonding. self - etching systems have become an accepted bonding technique, since they combine the etching and priming steps and do not need a rinsing and drying step after etching ; so, diminishes chair time and are cost - effective for the clinician. according to the results of this study, one - step tp self - etching primer revealed lower sbs than cm and cpb (p<0.001). stated that the sbs of bonded brackets should be more than 68 mpa for adequate adhesion in orthodontics. thus, tp has the mean sbs, high enough to resist against accidental debonding during treatment. notwithstanding, higher mean sbs of brackets bonded with tp has been observed by buyukilmaz., and bishara., while arnold., and dorminey., reported that there was no significant difference in the mean sbs of brackets bonded with tp and cm. the contradictory results of the studies, conducted to evaluate and compare the mean sbs between brackets bonded with cm, cpb, and tp, could be related to difference in the conditions of the sample storage, operators techniques, duration of light curing, doing or not doing thermocycling, and the evaluation of the sbs with different methods.[2932 ] according to the results presented, in table 2, the ari scores of 1 and 2 are the most prevalent for all three groups and the kruskal the site of failure could be within the bracket - adhesive - enamel complex and the ari scores of 1 and 2 in this study indicate that in the most of the samples, the bond failure has occurred within adhesive and some adhesive remained on the enamel. this mode of failure in group cpb similar to the findings of other studies and dominant score of 1 and 2 for group tp is supported by the reports of the previous studies. the first opinion supports the bracket adhesive interface failure and believes that this mode of failure is safe for enamel and diminishes the risk for enamel crack and damage. our findings support this opinion. another opinion involves failure at the enamel adhesive resin interface and states that this mode of failure takes less time to remove the adhesive and polish the surface of enamel. this pattern of failure is supported by some authors, but we believe that failure close to enamel is not safe, and, the findings of the present study support our belief. cpb has enough sbs to use for bonding of orthodontic brackets and the pattern of debonding is safe for enamel.despite that brackets bonded with tp has a lower mean sbs than those bonded with cm, but the sbs of brackets bonded with tp is high enough for clinical practice. in addition, the mode of failure with tp is safe for enamel. cpb has enough sbs to use for bonding of orthodontic brackets and the pattern of debonding is safe for enamel. despite that brackets bonded with tp has a lower mean sbs than those bonded with cm, but the sbs of brackets bonded with tp is high enough for clinical practice. | background : the aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride - releasing self - etch primer (clearfil protect bond) and compare it with transbond plus self - etch primer and conventional acid etching and priming system.materials and methods : forty - eight extracted human premolars were divided randomly to three groups. in group 1, the teeth were bonded with conventional acid etching and priming method. in group 2, the teeth were bonded with clearfil protect bond self - etch primer, and transbond plus self - etch primer was used to bond the teeth in group 3. the samples were stored in 37c distilled water and thermocycled. then, the sbs of the sample was evaluated with zwick testing machine. descriptive statistics and the analysis of variances (anova) and tukey 's test and kruskal - wallis were used to analyze the data.results:the results of the anova showed that the mean of group 3 was significantly lower than that of other groups. most of the sample showed a pattern of failure within the adhesive resin.conclusion:the shear bond strength of clearfil protect bond and transbond plus self - etch primer was enough for bonding the orthodontic brackets. the mode of failure of bonded brackets with these two self - etch primers is safe for enamel. |
flagellate literally means to whip (someone), either as a religious discipline or for sexual gratification according to oxford dictionary. flagellate dermatitis or toxicoderma presents with very characteristic linear wheal like skin manifestations and is often associated with shiitake mushroom (lentinus edodes). we report a 40 year old lady who developed flagellate dermatitis following ingestion of a bun containing shiitake mushroom. a 40 year old lady complained of acute onset of unusual rashes on her neck, body and limbs for 2 days. she reported feeling itchy on her arms and kept scratching, but denied scratching her trunk. physical examination revealed extensive flagellate dermatitis on arms, trunk, legs, neck, forehead and some pinpoint petechiae on arms (figure 1). on further questioning, patient recalled eating portobello mushroom from an italian restaurant 5 days ago and a mushroom bun from a bakery shop 3 days ago, but could not recall taking shiitake mushroom. she recalled having itch when she ate mushroom in the past but no rash. figure 1linear grouped erythematous papules on lower limbs (a) and abdomen (b). linear grouped erythematous papules on lower limbs (a) and abdomen (b). her full blood counts, liver function tests, creatine kinase and creatinine were normal. the mushroom bun that she ate 3 days prior to the onset of rash contained shiitake mushroom. flagellate dermatitis typically presents with multiple intensely pruritic, erythematous linear plaques and papules on the trunk and extremities. such cutaneous reactions often occurred 48 hours following ingestion of under - cooked or raw shiitake mushroom. the average duration of involvement was 8.5 days and improvement was generally noticed within 2 to 14 days. people involved in cultivating and marketing shiitake mushrooms may develop allergic alveolitis on inhalation of mushroom spores and contact dermatitis upon contact with the mushroom. however, in shiitake dermatitis, skin prick and patch tests were mostly negative except for a few cases report by lipper. there was a suggestion of possibility of uva photodermatosis by hanada during which 47% of patients with shiitake dermatitis had reproducible skin lesions to uva on phototesting but not with uvb. acutely, the skin biopsy shows spongiosis, elongated rete ridges with infiltrates of degenerative epidermal cells, lymphocytes, eosinophils and dermal oedema with perivascular infiltrates of lymphocytes, neutrophils, and eosinophils. lentinan, a polysaccharide found in shiitake has been implicated by a direct toxic effect, leading to interleukin-1 secretion, causing vasodilation, haemorrhage and the eruption. heat may play a role in denaturing the toxin as flagellate dermatitis mostly only occurs in patients who consumed the under - cooked mushroom. flagellate dermatitis was also reported in patients treated with bleomycin, in dermatomyositis and hiv patients. in bleomycin - induced flagellate dermatitis, patients developed linear pruritic pigmented lesions between 1 day and 9 weeks after the administration and may recur upon rechallenge of the drug. it was reported to occur, in a dose dependent manner, in about 8 to 66% of patients treated with bleomycin. three cases of aids patient with kaposi 's sarcoma treated with relatively low dose of bleomycin were also reported to develop pruritic flagellate dermatitis. during the acute phase of bleomycin - induced flagellate dermatitis, the histological findings are similar to fixed drug eruption. this includes basal vaculolar alteration, pigmentary incontinence, dyskeratotic keratinocytes and perivascular dermal infiltrates of lymphocytes and eosinophils. ultrastructurally, there is increased contact time between melanocytes and keratinocytes from the decrease in epidermal turnover, with the melanocytes being arrested in a pigment - producing state. some authors suggested that since the skin lacks hydrolase which inactivates bleomycin, the local accumulation of bleomycin in skin could result in inflammatory reactions, similar to that of a fixed drug eruption. nevertheless, the dermatitis resolves with cessation of bleomycin but hyperpigmentation can persist up to eight months. previously, it was thought that this was class specific to bleomycin. in 2007, there was a case report of a patient developing flagellate erythema after three days treatment with docetaxel for metastatic breast cancer. rarely, patients with dermatomyositis present with centripetal flagellate erythema on the trunk and proximal extremities. such unusual eruptions have not been reported in other types of connective tissues disease except for adult onset still 's disease. the intensity of the flagellate dermatitis purportedly mirrors the disease severity of dermatomyositis and may indicate a more complicated course of disease in adult onset still 's disease. even less commonly, hiv patients with hypereosinophilic syndrome were also reported to present with unusual cutaneous manifestations of linear flagellate plaques. table 1characteristics of flagellate erythema found in different conditions.shiitake flagellate dermatitisbleomycin - induced flagellate erythemadermatomyositis associated flagellate erythemaadult onset still 's disease associated flagellate erythemahiv associated flagellate erythemaclinical featurespruritic erythematouslinear papules, sparingthe inaccessible areasto scratching on the backtriggered by under - cooked / raw shiitake mushroom, commonly 48 hrs after ingestionintense pruritus, usually no pigmentationhyperpigmented brownish linear streaksoccurs 1 day to 9 weeks post administration of bleomycin in a dose - dependant mannerpruritus maybe absent, pigmentation presentcentripetal reddish linear streaks with erythematous plaquesmirrors the disease severitypruritus present, usually no pigmentationpersistent plaques with linear pigmentation with or without coalescent erythematous plaquespresence could indicate a worse prognosis with increased risk of systemic complications and longer time to remissionpruritus and pigmentation may be presentlinear flagellate plaques accompanying fever and eosinophiliahiv patients with hypereosinophilic syndromehistologynon - specific (spongiosis, elongated rete ridges, eosinophils and lymphocytes infiltrates, dermal oedema)similar to fixed drug eruption in the acute phase post - inflammatory hyperpigmentation in late lesionsinterface dermatitisdyskeratotic cells in the epidermis and dermal infiltrates of neutrophilsmixed perivascular infiltrate with eosinophils, histiocytes, lymphocytes and eosinophils presence of flame bodiestreatmenttopical and oral corticosteroids, antihistamines self - limiting thoroughly cooked shiitake for future consumptiondiscontinue bleomycin short course of oral/ potent topical corticosteroids self - limitingtopical /oral corticosteroids and immunosuppresants (topical calcineurin inhibitors, hydroxychloroquine) responds well to conventional therapymain aim is to treat the underlying systemic disease oral corticosteroids and immunosuppressants (methothrexate, cyclosporin) may persist even after fever has subsidedoral and topical corticosteroids, puva pruritic erythematouslinear papules, sparingthe inaccessible areasto scratching on the back triggered by under - cooked / raw shiitake mushroom, commonly 48 hrs after ingestion intense pruritus, usually no pigmentation hyperpigmented brownish linear streaks occurs 1 day to 9 weeks post administration of bleomycin in a dose - dependant manner pruritus maybe absent, pigmentation present centripetal reddish linear streaks with erythematous plaques mirrors the disease severity pruritus present, usually no pigmentation persistent plaques with linear pigmentation with or without coalescent erythematous plaques presence could indicate a worse prognosis with increased risk of systemic complications and longer time to remission pruritus and pigmentation may be present linear flagellate plaques accompanying fever and eosinophilia hiv patients with hypereosinophilic syndrome. however, such eruptions are also characteristic of several diseases, each having their own distinguishing clinical features. shiitake mushroom is the second most cultivated mushroom in the world and was reported to have immunomodulatory effects. perhaps a wise move would be to consume the thoroughly cooked mushroom so that this delicious delicacy could be savoured without adverse effects. | japanese dermatologists were the first to describe the very characteristic flagellate dermatitis following consumption of undercooked or raw shiitake mushroom (lentinus edodes). these similar eruptions were also reported in patients treated with bleomycin, in dermatomyositis and adult onset still 's disease. we report a case where a 40 year old chinese female developed flagellate dermatitis following ingestion of a bun containing shiitake mushroom. |
following institutional review board approval, we retrospectively reviewed the medical records of all patients who underwent endovascular treatment for symptomatic atherosclerotic intracranial stenosis between january 2003 and december 2014 performed at king faisal specialist hospital and research center, jeddah, kingdom of saudi arabia. we excluded cases with other potential cause of stroke or tia such as cardioembolic events or vasospasm. patients demographic, timing of cerebral ischemic event, stroke risk factors, and location and severity of intracranial atherosclerosis were identified. hypertension, defined as receiving blood pressure medication for blood pressure more than 140/90, diabetes, cardiac disease, and hyperlipidaemia were all noted. brain and cerebrovascular imaging including ct, ct angiography (cta), mri, mr angiography (mra), and conventional cerebral digital subtraction angiography (dsa) were reviewed for all included patients. the intracranial stenosis was defined as the presence of 50 - 99% stenosis on cta, mra, or angiography. the stenosis was considered to be symptomatic when the brain imaging showed a relevant regional infarct ipsilateral and distal to the vascular territory of the stenotic vessel or if the patient s symptoms are attributed to that territory. the occurrence of adverse events was evaluated during the procedure, immediately post - procedure, before discharge, and at 30-days. adverse events were divided into minor strokes with new non - disabling neurological deficits, major stroke with persistent disabling deficits and death. the success of the stenting procedure was defined as no or less than 50% residual stenosis in the original disease segment. in addition, all patients received maximum medical treatment consisting of dual antiplatelet therapy plus lipid lowering agents. these are in addition to blood pressure control and glycemic control in patients with hypertension and diabetes. six months then annual follow up radiological imaging including ct, cta, mri, mra or angiography of the treated lesion were reviewed. target lesion related stroke at 12 months from the procedure was also determined when available. descriptive statistical tests were used as appropriate to summarize the variables as means or proportions. the failed procedures in 3 patients were due to technical difficulty caused by vascular tortuosity or vasospasm. the mean age at procedure was 58.3 years, with a range between 39 to 79 years. hypertension and diabetes were most common as the hypertension found in 74% patients and the diabetes 68% (table 1). case illustration of anterior circulation stenting, a 54-year - old male (patient # 20) presented with left hemiparesis due to right ica 80% stenosis at the supraclinoid segment ; arrows shows a) the segment of severe stenosis at the supraclinoid segment of the internal carotid artery, b) resolution of the stenosis after the stent placement, c - d) the patient underwent percutaneous angioplasty and stent placement with ferrous stent with good resolution of the stenotic part. f - female, m - male, tia - transient ischemic attacks, mca - middle cerebral artery, ica - internal carotid artery, ga - general anesthesia, la - local anesthesia, na - not applicable, loc - level of consciousness, tpa - tissue plasminogen activator case illustration of posterior circulation stenting, a 69-year - old male (patient # 22) presented with recurrent vertebrobasilar insufficiency due to near occlusion of mid basilar artery, a - d) he underwent percutaneous angioplasty ; arrows shows the segment of near occlusion at the mid basilar artery. and e - f) showed good patency of the basilar artery after stent placement with taxus liberte. one patient was non - compliant to the antiplatelet medications and was on inconsistent intake of aspirin. the events were major stroke in 5 patients (22.7%) and 3 other patients had minor events in the form of recurrent tia and minor strokes. one patient had recurrent posterior circulation tia with no evidence of stroke in the posterior circulation, however this patient had 2 stenotic lesions one involving left internal carotid artery (ica) extra cranially with secondary documented multiple strokes distal to this territory, and another lesion involving the left vertebral artery intracranially. both lesions were stented at the same time with no complications and with successful recanalization. all 22 procedures were carried out by a single neurointerventionist and summarized in table 2. stent success defined as less than 50 % stenosis involving a segment no longer than the original lesion was achieved in 17 of the 19 patients ; the procedure was terminated in 3 patients due to vascular tortuosity or spasm. stent placement success rate was 100 % with good flow and recanalization in all interventions. four patients (17.4%) developed postoperative complications early in the form of major stroke. one of the patients who suffered a stroke died after one month due to respiratory complications. the rest of patients were discharged home with no stroke representing 77.2% of treated patients. excellent outcomes were documented in 11 patients with a minimum follow up of 6 months. all patients with anterior circulation intracranial stenting had no post procedural complications and all 4 patients with complications had posterior circulation stenting. one patient was non - compliant to the antiplatelet medications and was on inconsistent intake of aspirin. the events were major stroke in 5 patients (22.7%) and 3 other patients had minor events in the form of recurrent tia and minor strokes. one patient had recurrent posterior circulation tia with no evidence of stroke in the posterior circulation, however this patient had 2 stenotic lesions one involving left internal carotid artery (ica) extra cranially with secondary documented multiple strokes distal to this territory, and another lesion involving the left vertebral artery intracranially. both lesions were stented at the same time with no complications and with successful recanalization. all 22 procedures were carried out by a single neurointerventionist and summarized in table 2. stent success defined as less than 50 % stenosis involving a segment no longer than the original lesion was achieved in 17 of the 19 patients ; the procedure was terminated in 3 patients due to vascular tortuosity or spasm. stent placement success rate was 100 % with good flow and recanalization in all interventions. four patients (17.4%) developed postoperative complications early in the form of major stroke. one of the patients who suffered a stroke died after one month due to respiratory complications. the rest of patients were discharged home with no stroke representing 77.2% of treated patients. excellent outcomes were documented in 11 patients with a minimum follow up of 6 months. all patients with anterior circulation intracranial stenting had no post procedural complications and all 4 patients with complications had posterior circulation stenting. intracranial arterial stenosis is a worldwide disease, responsible for 6 - 10% of ischemic strokes in whites, 6 - 29% of ischemic strokes in blacks, 11% of ischemic strokes in hispanics, and 22 - 26% of ischemic strokes in asians.6 once thought to be uncommon, it is now known that intracranial atherosclerotic disease is almost as common as extracranial carotid atherosclerotic disease in some populations.7 patients with symptomatic intracranial severe stenosis have a risk of up to 14% of suffering future intracranial ischemic insults in the subsequent 2 years despite maximum medical therapy.8 the annual risk for subsequent stroke may exceed 20% in high - risk groups. groups with the highest risk of recurrent stroke are those with high - grade (> or = 70%) stenosis, those with recent symptom onset, women, those with vertebrobasilar disease with history of diabetes mellitus, and patients who fail anti - thrombotic therapy.6 the mechanism of stroke in these patients may be related to thromboembolism owing to unstable plaque, hemodynamic factors leading to flow reduction beyond the stenosis, or synergistic effects of the two.6 for patients who present within days to weeks after their qualifying event, percutaneous transluminal angioplasty and stenting (ptas) was introduced as a potential mean for secondary stroke prevention.9 preliminary studies showed that angioplasty and stenting reduced the risk of stroke in patients with severe stenosis of intracranial arteries.6,10,11 however, the endovascular approach was evaluated in a phase 3 randomized controlled trial which was stopped after 451 patients were randomized. the sammpris trial randomized patients with severe stenosis affecting major intracranial artery to undergo aggressive medical management alone versus aggressive medical management plus angioplasty and stenting (with wingspan stent). the trial outcome of 30-day stroke or death was significantly higher in the endovascular arm (14.7%) compared to the medical arm (5.8%) leading to the early stoppage of the trial.6 while some practitioners strongly advocate the use of angioplasty alone, i.e., without a stent, most favor the use of angioplasty with stenting. the addition of stenting to the angioplasty procedure results in a substantially greater overall improvement in the final luminal diameter. while many technically successful pta procedures leave behind 50% residual stenosis or more, after a ptas procedure the residual stenosis is typically 10% or less.9 three types of stents have been used in the intracranial circulation. balloon - expandable bare - metal stents or balloon mounted coronary stents : these stents were not designed for the intracranial use. when deployed, these balloon - expandable stents often distort the regional anatomy and sometimes exert significant trauma particularly within tortuous vascular segments. their use was associated with high rates of morbidity and mortality reaching 30% due to technical factors mentioned. recently, an intracranial balloon - expandable stents were tested in a randomized controlled trial (vissit trial) in patients with symptomatic intracranial stenosis. the trial was stopped prematurely due to higher rates of 30-day and one - year stroke or tia in the stenting arm.12 2. drug - eluting balloon expandable stents : these were a major breakthrough in preventing the risk of isr but they are associated with subacute and late stent thrombosis.6,10,13 also, prolonged use of aspirin and plavix is required with drug eluting stents. self expanding stents : based on the european asian wingspan study and the approval of wingspan stent by the food and drug administration (fda), these stents are the currently indicated stents for intracranial use to treat patients with symptomatic intracranial atherosclerotic disease who failed medical treatment. it is currently in the united states under the fda humanitarian device exemption for patients with severe symptomatic intracranial atherosclerotic stenosis who failed maximum medical therapy. in our series this was one of the points raised by the critics of this trial.14 complication rates are highly variable and we recommend that this procedure be used in highly specialized centers with the capability to manage pre, intra- and post procedure issues. this is retrospective case series which may introduce biases related to documentations and missing information. in addition, these are cases done in a single center which may limit the generalizability of the results.. there are no reports describing the volume or outcome of intracranial stenting from local centers over a long period demonstrating the real - life experience of performing these specialized procedures. there remains a number of areas for future research regarding intracranial stenting. the optimal time and stent choice for patients with symptomatic intracranial stenosis any differences between the anterior versus posterior circulation in natural history and prognosis could be instructive toward defining high risk groups for future events despite maximum medical therapy. in conclusion, the endovascular treatment for symptomatic intracranial stenosis remains in the development phase in light of the recent evidence. however, in the small subset of patients who are refractory to maximum medical treatment, stenting is an option to be considered with appropriate patient selection and good experience of the interventionist. | objectives : to present our local experience with intracranial angioplasty and stenting used for the treatment of symptomatic intracranial stenosis to assess its safety, efficacy, and outcome.methods:this is a retrospective review of all the patients with symptomatic intracranial atherosclerotic disease who underwent endovascular treatment in king faisal specialist hospital and research center, jeddah, kingdom of saudi arabia from january 2003 to december 2014. clinical, procedural, and outcome variables were gathered.results:we identified 22 patients who were referred for stenting of symptomatic intracranial atherosclerotic stenosis. in all but 3, the stents were deployed successfully (86% procedural success rate). the procedure was carried out under conscious sedation in 32%. excellent flow was restored immediately in all successfully - stented cases. post procedural strokes occurred in 4 patients (17.4%). one non - neurological death was identified in a patient who suffered a major post procedural stroke (4.3%).conclusion : intracranial atherosclerotic disease is not uncommon in our population. angioplasty and stenting might be a valid option for the treatment of patients with recurrent symptoms despite optimal medical treatment. |
mineral trioxide aggregate (mta) is a biocompatible material with high sealing ability which has been used for various purposes in endodontics, including root end filling, sealing of perforations, treatment of teeth with open apices, and as a pulp capping agent [13 ]. the color of original mta (grey mta or gmta) was grey and it had a potential of tooth discoloration. because of this disadvantage, white mta (wmta) introduced in order to this problem be solved. asgary. showed that the major differences in chemical component between wmta and gmta are concentrations of al2o3, mgo, and feo. found that there were no significant differences in pulp responses to both types of mta when used as a pulp capping agent in dog 's teeth. holland. also found that the mechanisms of action of wmta and gmta are similar. however, matt. found that gmta has significantly less leakage than wmta when used as an apical barrier. although wmta was developed to solve the problem of tooth discoloration produced by gmta, several studies have reported tooth discoloration after using both kinds of mta [915 ]. this effect limits mta application in treatment of perforations, pulp capping, pulpotomy, and as an apical barrier in aesthetically sensitive areas. bonding to dentin is one of the most significant advances in the past fifty years. the success of this kind of bonding has depended more on creative chemistry than etching with some materials such as phosphoric acid. many generations of dentin bonding agents (dbas) have been produced. with new advances in new material 's technology, bonding to dentin has been reported to be favorable. the purpose of this study was to evaluate the effect of the application of dba before usage of mta to prevent tooth discoloration. fifty freshly extracted single - rooted human maxillary central and lateral incisors were used in this study. the teeth were clinically and radiographically examined to be free of caries, cracks, restoration, and calcification. external surfaces of the teeth were cleaned with curettes and stored in a physiologic saline solution until usage. the pulp tissue was removed by using barbed broaches (dentsply maillefer, tulsa, okla, usa). working length was determined visually with stainless steel hand files (dentsply maillefer, tulsa, okla, usa) trough the canal until the tip was seen at apical foramen and working length calculated by subtracting 1 mm from this length. each canal was prepared by using k - files (dentsply maillefer, tulsa, okla, usa) and gates - glidden drills (dentsply maillefer, tulsa, okla, usa) in a step back manner. irrigation was carried out by using 2.5% naocl. after drying root canal with paper points, master gutta - percha was placed at canal and confirmed radiographically, and teeth were obturated using gutta - percha (arya dent, tehran, iran) and ah - plus sealer (dentsply, konstanz, germany) by lateral condensation technique. then the extruded cones were cut off 3 mm below the orifice and compacted vertically. teeth were randomly divided into five groups. in groups wmta and gmta, 3 mm of white and grey mta (mta angelus, londrina, pr, brazil) plug was placed in root canal below the orifice, respectively. in groups dba + wmta and dba + gmta, two layers of dba (clearfil se bond, kurary, okayama, japan) was applied in access cavity and light cured for 40 seconds and then 3 mm of wmta and gmta was placed in root canal below the orifice, respectively. after complete cleaning of the access cavity, a moistened cotton pellet was placed in access cavity and coronal access was sealed with coltozol (coltene, altstatten, switzerland) for 24 hours. after that, temporary filling was removed and the teeth were restored with resin composite (z100, 3 m, usa). the last 10 teeth served as control, with no dba and mta and restored with resin composite. at the baseline, color measurement of all teeth was recorded with a colorimeter (minolta cr-300 ; minolta, osaka, japan). measurements were repeated 3 times for each specimen, and the mean values of data were calculated. the teeth were kept in artificial saliva for 6 months, whereas artificial saliva was replenished each two weeks. at this point, color readings were made using the colorimeter in the manner described for baseline readings. the calculation of the color variation e between the 2 color measurements is as follows : (1)e=[(l)2+(a)2+(b)2]1/2.l refers to the lightness coordinate with value ranging from zero (black) to 100 (white). the values a and b are chromaticity coordinates in the red - green axis and the yellow - blue axis, respectively. preliminary analysis with kolmogorof - smirnov test was used to confirm the normal distribution of the data. the results were analyzed by t - test, with the significance level defined as = 0.05. all teeth showed discoloration after 6 months. the mean discoloration after 6 months is shown in figure 1. the mean tooth discoloration in wmta group was significantly more than dba + wmta and control groups. there was no significant difference between dba + wmta group and control group in mean discoloration. the teeth in gmta group also showed significantly more discoloration than dba + gmta and control groups. there was no significant difference between gmta group and wmta group in mean tooth discoloration, as well as for dba + gmta and dba + wmta groups. mta has been recognized as a bioactive material that is hard tissue conductive, hard tissue inductive, and biocompatible, so the applications of this material have been rapidly expanding in dentistry. despite such good characteristic, mta has some drawbacks including discoloration potential, difficult handling properties, long setting time, high cost, and absence of a known solvent. our study revealed that when gmta was placed below the root canal orifice, the crown of teeth, especially in the cervical area, showed significant tooth discoloration after 6 months. this result was coinciding with other studies that showed tooth discoloration after using gmta [9, 10, 13 ]. due to the potential discoloration of teeth treated with gmta, the manufacturer introduced a new formula of mta with an off - white color. however, this study showed that the application of wmta may also cause tooth discoloration. this can be attributed to the fact that although the concentration of carborundum (al2o3), periclase (mgo), and feo has been lowered in wmta compared to gmta, these metal oxides are still present in wmta and can cause tooth discoloration. jacobovitz and de lima used wmta for the treatment of inflammatory internal root resorption. they observed grey discoloration of teeth after 20 months. boutsioukis. which examined the efficiency of two techniques for removal of wmta from root canals also reported dark discoloration of most mta fillings. application of two layers of dba before using mta may prevent tooth discoloration produced by both wmta and gmta. this can be related to the sealing ability of dba that seals dentinal tubules in access cavity and below the orifice before mta application. this process makes a surface that prevents any contamination and remaining mta powder in the access cavity during insertion. remaining powder has a potential to degrade and make colorant material such as feo. according to the results of this study, it can be recommended to seal dentinal tubules by dba before using both mtas to prevent further tooth discoloration. since dba may interfere with proper sealing ability of mta or have a possible interference with the release of calcium via dentin tubules, it is advisable to conduct other studies to evaluate the effect of dba on these properties of mta. | objective. determination of the effect of dentin bonding agent (dba) on the prevention of tooth discoloration produced by mineral trioxide aggregate (mta). methods. 50 teeth were endodontically treated and after removal of 3 mm of obturating materials were divided into five groups. in white mta (wmta) and grey mta (gmta) groups, these materials were placed in root canal below the orifice. in dba + wmta and dba + gmta groups, dbas were applied in the access cavity. then, 3 mm of wmta and gmta was placed. the last 10 teeth served as control. all of teeth were restored and color measurement was recorded for each specimen at this time and 6 months later. results. the mean tooth discoloration in wmta and gmta groups was significantly more than dba + wmta and dba + gmta groups, respectively. there was no significant difference between dba + wmta and dba + gmta groups and control group. conclusion. application of dba before mta may prevent tooth discoloration. |
protein kinase ck2 is a pleiotropic, ubiquitous and intrinsically active eukaryotic ser / thr protein kinase that is overexpressed in various cancer types. in humans, ck2 forms a heterotetrameric complex (2/2) consisting of two catalytic subunits (ck2 or) attached to a dimer of regulatory subunits (ck2 or 2). the unique molecular architecture of the ck2 holoenzyme could be exploited in the design of inhibitors that do not target the atp site and thus provide a more specific mode of action, prompting the discovery of various non - atp - competitive inhibitors against ck2. in particular, significant efforts have been devoted to the development of compounds that disrupt the transient, hetero - oligomeric protein protein interaction (ppi) between ck2 and ck2. given that the function of proteins critically depend on a correct oligomerization state, and the importance of ck2 in modulating the catalytic activity and substrate specificity of ck2, disruption of the constitutive, homodimeric ppi within ck2 represents an alternative approach to interfere with ck2 function. developing small molecule inhibitors to disrupt ppis is a challenging task due to the typically extended and flat topology of contact surfaces, often devoid of the well - defined deep clefts that are characteristic of many enzyme active sites. the difficulty is compounded by the fact that the interacting surfaces of protein partners are frequently segmented. however, recent successes in the development of ppi inhibitors have shown that ppis are amenable to targeting by small molecules. while the majority of the ppi inhibitors disrupt transient, hetero - oligomeric ppis, only a comparatively few cases of small - molecule ppi inhibitors that target constitutive, homo - oligomeric interfaces have been reported. considering that achieving small - molecule inhibition of transient, hetero - oligomeric ppis is already an inherently challenging effort, the search for inhibitors that disrupt the constitutive oligomeric interfaces within a protein is a potentially more difficult undertaking, in part due to the typically higher affinity, larger interfaces, and greater hydrophobic character of constitutive ppis. interestingly, the hydrophobicity and the structural plasticity of constitutive interfaces can enable small - molecule binding to form structurally defined complexes. thus far, small - molecule oligomeric disruptors (e.g., spd304, bio8898, 6-hydroxydopa) were discovered using a combinatorial library or high - throughput library screen and targeted approach, with further studies revealing their allosteric mode of inhibition. only one recent study employed a fragment - based functional screen to identify compounds whose inhibitory basis was disruption of the dimeric architecture of a viral protease, rather than binding to the active site. in contrast to traditional high - throughput screening, the use of a smaller compound library in a fragment - based screen offers the advantage of a more efficient and rapid exploration of weaker binding, but ligand - efficient chemical moieties. here, a biophysical fragment - screening cascade was performed to specifically identify and validate fragments that are able to disrupt the ck2 dimer interface. this approach involved the sequential application of fluorescence - based thermal shift to screen for preliminary hits, ligand - observed nmr assays for validation of fragment binding, and native mass spectrometry (ms) to confirm the ability of fragments to induce dimeric disruption. an orthogonal biophysical assay using homodissociation isothermal titration calorimetry (itc) activity relationships (sar) governing dimerization affinity in a ck2 mutant and confirm the dimer - disrupting nature of the fragments. the first screening technique is a fluorescence - based thermal shift (fts) assay, which monitors protein thermal denaturation by using an extrinsic, environmentally sensitive probe, for which the fluorescence increases upon binding to the unfolded protein. as a protein is incrementally heated, it unfolds and exposes its hydrophobic core. unfolded protein provides more nonpolar regions for protein - dye interaction, causing a rise in the fluorescence intensity. fragments that bind to and stabilize or destabilize the protein will increase or lower the melting temperature (tm), respectively. the difference between the tm of the protein - fragment complex and the tm of the apo protein represents the thermal shift (tm). as fluorescence - based thermal shift assay is the first screening technique, its ability to inform whether small molecules that induced the disruption of constitutive oligomeric interfaces would produce thermal destabilization, corresponding to a loss of stabilizing subunit interactions, when incubated with the protein target was first evaluated (figure 1a). two eukaryotic macromolecular targets, rad52 and tnf- were selected for validation studies, as small molecules that disrupt the constitutive oligomeric interfaces in both proteins have been characterized. binding of 6-hydroxydopa to rad52 induced an undecameric - to - dimeric transition (figure 1b). no melting curve could be observed for rad52, indicating that it has an extremely high thermal stability (tm > 99.0 c), which is in agreement with published data demonstrating the especially high melting temperature of a similar rad52 construct, rad52 (figure 1c). in the presence of 6-hydroxydopa, rad52 displayed an observable melting transition, registering a tm of 85.0 c (figure 1c). spd304, discovered from a combinatorial library screen, was observed to eject a monomer of native trimeric tnf- by complexing with a dimer of tnf- (figure 1d). similarly, the apparent tm of tnf- decreased from 65 c (putatively assigned due to the broad melt curve, which prevents precise tm determination) to 61.0 c in the presence of spd304 (figure 1e). the melting temperature (tm) of both proteins decreased in the presence of the small - molecule oligomeric disruptor, supporting the use of negative thermal shifts to identify molecules that cause a dehomooligomeric transition. use of fluorescence - based thermal shift assay to detect small molecules capable of inducing dehomooliogomerization. (a) hypothetical scheme illustrating whether small - molecule (triangle) disruption of a homodimeric assembly (black) to a monomeric state (red) is translated to a negative thermal shift. (b) schematic showing the undecameric - to - dimeric transition of rad52 induced by 6-hydroxydopa (green). (c) rad52 alone (blue) did not produce a melting transition, indicating that its tm was more than 99 c. in the presence of 6-hydroxydopa, rad52 registered a tm of 85.0 c (red). (d) spd304 (blue) causes the dissociation of native trimeric tnf- (purple) into a spd304bound dimer (pink) and monomer (yellow). (e) the melting curve of native trimeric tnf- (purple) showed that it had a putative tm of 65 c. in the presence of spd304, (f) distribution of thermal shift values induced by fragments in ck2 from the fluorescence - based thermal shift screen. in light of these results, 800 fragments were screened at 5 mm against ck2. a histogram depicting the distribution of tm induced by the fragments is shown in figure 1f. most of the fragments induced ck2 destabilization as shown by the left - skewed distribution of tm values. the maximum stabilizing and destabilizing tm from the screen was + 0.8 c and 6.0 c, respectively. while no fragments induced significant positive thermal shifts, it was interesting to note that several fragments significantly lowered the melting temperature of ck2. fragments which induced a tm < 1.5 c for the negatively shifting fragments were selected for follow - up studies. ligands that increase the tm of a protein are predominantly pursued for subsequent validation and optimization, as they cause stabilization of the protein ligand complex. in contrast, it is commonly believed that fragments that cause negative thermal shifts signify preferential fragment binding to the unfolded form of the protein, and are subsequently excluded from further analysis. however, this does not necessarily hold true for all protein systems, as seen in the validation studies using rad52 and tnf- and their disruptors. to our knowledge, only one fragment - based study selected both thermally stabilizing and destabilizing fragments against homodimeric mycobacterium tuberculosis bioa (an aminotransferase that uses a pyridoxal 5-phosphate cofactor) for follow - up studies, although no rationale was given for considering thermally destabilizing fragments. only one out of the 12 destabilizing fragments from the original screen against bioa produced a structure by cocrystallization. subsequent sar - by - catalog of fragment hits resulted in the crystallographic and thermodynamic characterization of a series of inhibitors. this study has shown that thermally destabilizing fragments can be inhibitors and that caution should be applied before rejecting negatively shifting fragments for further evaluation. furthermore, it has been suggested that thermally destabilizing fragments may have an additional value in promoting a more rapid degradation of the target protein. both spd304 and 6-hydroxydopa, which promoted subunit disassembly by binding to a non - native form of their protein target, lowered the melting temperature of their protein complexes. the disruption of stabilizing subunit interactions between protomers in an oligomeric protein by any ligands could be expected to decrease the protein s stability, which would be reflected by a lowering of its melting temperature. essentially, any interpretation of fts results must take into consideration that the fts assay depends on fluorescent dye binding. changes in the tm are a reflection of changes in the fluorescent dye binding. a ligand that binds to and stabilizes a protein would slow both its denaturation and exposure of its hydrophobic region, causing a delayed rise in the fluorescence intensity to result in an increase of the tm. on the contrary, a ligand that disrupts constitutive hydrophobic interfaces in an oligomeric protein would allow the fluorescent dye access to hydrophobic environments for binding, leading to an earlier increase in the fluorescence intensity to produce a decrease in the tm. structural analyses of both rad52 and tnf- revealed that oligomerization is largely mediated by hydrophobic interactions between the subunits. by causing earlier and greater exposure of hydrophobic areas upon subunit dissociation, spd304 and 6-hydroxydopa stabilized non - native forms of their protein complex that bind the dye with higher propensity than the native form, thereby resulting in an early rise in the fluorescence intensity to eventuate in negative thermal shifts. on the basis of this reasoning, coupled with the hydrophobically driven nature of ck2 dimerization, a possible model that fits our results is that thermally destabilizing fragments are causing monomerization of ck2. a model to describe fragment - induced negative thermal shift of ck2 is presented in figure 2. alternatively, there is also a possibility that a small proportion of ck2 monomer could be present that provides a rapid route for unfolding. furthermore, in the vein of a mechanism resembling the effect of bio8898 on cd40, thermally destabilizing fragments could also bind to and distort the ck2 dimer interface without completely causing subunit dissociation. in the absence of additional experimental evidence, it is difficult to speculate whether dimer distortion translates to a negative thermal shift. however, subsequent orthogonal assays using native ms and homodissociation itc would help clarify the most probable molecular mechanism. model of fragment binding to ck2 (2) to rationalize negative thermal shift. fragment - induced monomerization of 2 results in the formation of a species (denoted with an asterisk) with a higher hydrophobic character that promotes earlier binding of the fluorescent dye, thereby resulting in negative thermal shift. the thermal shift screen can be applied to proteins that experience either reversible or irreversible denaturation. a reversible two - state equilibrium between the structured native state and the unfolded state can be used to describe protein unfolding, with the assumption that only these two states exist. on a sufficiently short time scale, it has been experimentally and computationally shown that the unfolding process is pseudoreversible, as it is possible to generate reasonable plots of the apparently irreversible denaturation process using the vant hoff equation, which relates changes in the equilibrium constant to temperature. over the entire time course of a thermal shift experiment, the exposure of hydrophobic cores during protein unfolding would ultimately lead to the formation of irreversible aggregates. therefore, a majority of large multidomain proteins will eventually undergo partially or completely irreversible denaturation. using proteins that undergo irreversible thermal protein denaturation, such as e. coli aspartate transcarbamoylase and the core protein of the lac repressor, it has been shown that the denaturation process obeys equilibrium thermodynamics as characterized by the vant hoff equation, thus resembling a reversible process. furthermore, the data obtained from simulating an irreversible denaturation process were similar to that of a completely reversible denaturation model. therefore, thermal shift screening could be applied to oligomeric proteins regardless whether they undergo reversible or irreversible denaturation. as fragments enable sampling of a larger chemical space, fragment libraries tend to be smaller than a high - throughput screen library. thermal shift screening is rarely rate limiting, but could be achieved more rapidly with the use of a higher temperature ramp rate. in general, the magnitude of thermal shift is not strongly dependent on the temperature ramp rate when a heating rate between 18 c min is applied. this is supported by a study in which thermal shifts produced by screening different concentrations of known ligands against nine proteins did not change significantly despite the use of ramp rates spanning 18 c min. it was further recommended that a heating rate of up to 4 c min could be used with minimal impact on ligand detection for most proteins. two nmr approaches could be employed to validate fragment binding to the protein target : ligand - observed and protein - observed nmr. ligand - observed nmr assays are more popular as there is no requirement to produce isotopically labeled proteins. as there is no upper limit on the protein size, ligand - observed methods furthermore, the assays are straightforward, rapid, and have relatively low protein consumption by enabling the acquisition of multiple nmr assays on the same sample. the principles and applications of ligand - based nmr methods have been extensively reviewed. briefly, ligand - observed nmr assays depend on monitoring differences in the properties of the ligand spectra (e.g., magnetization transfer or relaxation) upon interaction with the macromolecular target. experiments based on direct or indirect magnetization transfer (saturation transfer difference [std ] and water ligand observed via gradient spectroscopy [waterlogsy ]) and differential relaxation (carr purcell meiboom gill [cpmg ]) are commonly used in fragment - based campaigns. performing three orthogonal nmr assays, each with their own advantages and disadvantages, lowers the chances of false positives and negatives originating from artifacts of a single nmr experiment. all the 60 destabilizing fragment hits identified from the thermal shift screen were validated for binding to ck2 using a panel of three ligand - observed h nmr assays (std, waterlogsy and cpmg). the nmr screen validated 45 of the 60 destabilizing hits, representing a 75% validation rate, thus giving a good confidence of the binding event (supplementary figure s1). among the destabilizing hits, 40 fragments showed binding in all three nmr experiments, a further 5 fragments showed binding in at least two nmr experiments (supplementary figure s1). no correlation between the degree of binding observed in the nmr experiments and the magnitude of tm values was observed (supplementary table s1). the magnitude of thermal shift is a combined function of the enthalpy change of protein unfolding, enthalpy change of ligand binding and ligand affinity. the magnitude of thermal shift of a set of compounds will correlate to their binding affinities only when the compounds possess similar binding enthalpies. this has been demonstrated by a study in which the rank order of affinity and binding constants of a series of chemically and structurally distinct -site amyloid precursor protein - cleaving enzyme 1 (bace1) inhibitors obtained using fts and itc were found to correlate well, particularly because the ligands had similar binding enthalpies. had the binding enthalpies of the bace1 inhibitors been very different, the affinity ranking based on the thermal shift values would be inaccurate. this implies that the tm value associated with fragment binding does not necessarily correlate with its binding affinity. as the ck2 fragment hits are chemically and structurally different, it is possible that they have different binding enthalpies. this means that fragments with the same binding affinity, but with different binding enthalpies will generate different tm values. hence, the extent of thermal destabilization can not be used as a measure of its binding affinity, and, by extension, its degree of binding in nmr assays. mass spectrometry (nanoesi ms) provides rapid, sensitive, label - free and accurate detection of noncovalent assemblies, such as protein oligomers or protein ligand complexes, in the gas phase. various studies have shown that gas - phase proteins retain folded conformations and possess structural features that approximate to those in the solution state, thus providing a simulacrum of solution - phase conditions. the high separation efficiency of ms is especially relevant for examination of the oligomeric populations of proteins in the gas phase. for similar protein species, it has been shown that there is good agreement of the oligomeric distribution obtained using gas - phase and solution - phase methods, although the caveat that similar oligomeric forms may have different efficiency of ionization, transmission and detection must be recognized. nevertheless, adopting a native ms approach enables us to address the presence and degree of oligomeric state perturbation by thermally destabilizing fragments, which could serve as an indication of the dimer - disrupting potency of fragments. native ms was used to study the effect on the oligomerization state of ck2 of the 40 destabilizing fragment hits that were shown to bind to ck2 in all three ligand - observed nmr assays. native mass spectra of 16 m ck2 in the presence of 5% (v / v) dmso were acquired under non - denaturing conditions by nanoesi ck2 produced two well - resolved narrow charge state distributions corresponding to monomeric ck2 (observed mass = 22 962 17 da ; calculated mass = 22 945 da) and dimeric ck2 (observed mass = 45 938 17 da ; calculated mass = 45 890 da), with lowly charged ions to signify that they retain folded, native - like structures (figure 3). the predominant species is dimeric ck2, which is consistent with published structural data. native mass spectra of 16 m ck2, acquired in 0.5 m ammonium acetate ph 8.0, in the presence of validated thermally destabilizing fragments (2 mm). the percentage of ck2 monomerization induced by a fragment is indicated in orange text below the compound number. the observed mass and identity of each species are indicated beside the symbols. only one charge state of each species is indicated in the spectra. in the presence of 2 mm fragment, native ms showed that 18 out of the 40 compounds induced a higher population of monomeric ck2 by promoting the disassembly of dimeric ck2 to different extents (1871% monomerization) (figure 3). 1 and 2 had the greatest effects on dimer disruption, inducing 71% and 67% monomerization of ck2, respectively. both 1 and 2 possess the 5-substituted pyrazole core, suggesting the importance of this chemical scaffold in mediating dimer disruption. furthermore, native ms experiments showed 3 and 4, bearing the pyrazole scaffold, to cause 49% and 24% monomerization of ck2, respectively. apart from pyrazole - based fragments, compounds with quinoline (57) and naphthol (811) cores were also well represented (supplementary figure s2). there was no correlation between extent of monomerization and thermal shift, as the magnitude of thermal shift induced by a fragment is not necessarily proportional to its affinity for the protein. ablation of the zinc finger, by mutation of the zinc - coordinating cysteine residues, resulted in dimerization - defective ck2. the observed mass of monomeric ck2 (22 962 da) is in close agreement with the theoretical mass of monomeric ck2 with one zn bound (22 945 da), showing that fragments do not cause monomerization by metal sequestration. importantly, the narrow charge state distribution observed for monomeric ck2 signifies that the destabilizing fragments were able to cause dimeric disruption of ck2 without denaturing the protein. furthermore, the clear observation of an enrichment in the monomeric species shows that ck2 is converted to the monomer at the fragment concentration used. this argues against the possibility that fragments were merely distorting the ck2 dimer interface without inducing dissociation (reminiscent of the effect of bio8898 on cd40), as an increase in the intensity of the monomeric species would not be expected. however, it is possible that the fragments could be both distorting and weakening the ck2 dimer interface to the extent of causing dissociation. information about binding stoichiometry could not be extracted from the native mass spectra, as only non - complexed monomeric and dimeric ck2 were detectable. this is not unusual given that the fragments may be potentially mediating the disruption of dimeric ck2 by mainly engaging in hydrophobic interactions with residues at the dimer interface. the hydrophobic effect does not apply for proteins in the gaseous phase, and protein ligand complexes bound primarily by hydrophobic interactions tend to dissociate in the gas phase. four highly conserved cysteine residues (cys109, cys114, cys137 and cys140) in a ck2 protomer are involved in zinc coordination to form a zinc - binding motif that constitutes the dimerization domain. the dimerization of ck2 is largely driven by hydrophobic interactions, with the / core composed of nonpolar residues (pro110, val112, leu124, val143, and the hydrophobic moieties of tyr113 and tyr144) (supplementary figure s3). salt - bridge and hydrogen - bonding interactions (arg111 and asp142, backbone carbonyl and amino groups of pro110 and thr145, and val143 and val112, respectively) also serve to stabilize the dimer (supplementary figure s3). dimerization of ck2 results in the burial of 1766 per protomer, a value consistent with that expected of a permanent ppi, establishing ck2 as an obligate dimer. a homodissociation itc assay was developed in order to provide an orthogonal, solution - phase approach of confirming the mechanism of fragment - induced dimer - disruption and examine structure activity relationships governing dimerization affinity. in homodissociation itc, a concentrated solution of oligomer is titrated into a buffer cell using a series of small - volume injections. the initial few injections lead to huge dilutions of the protein concentration, and therefore promote oligomeric dissociation. each injection typically yields an endothermic heat pulse, which progressively decreases in intensity over the entire course of titration due to an increase in the protein concentration in the cell disfavoring dissociation. the oligomer dissociation constant is determined by fitting the data to a dissociation model, operating with the assumption that the monomer dimer equilibrium is reversible under the experimental conditions. given the weak affinity expected for fragment binding, a strategy of directed mutagenesis was adopted to systematically reduce the strength of the dimeric ck2 interface (supplementary figure s3 and supplementary figure s4). being core hydrophobic residues that significantly contribute to the stabilization of the dimer interface, pro110 and val143 were mutated to aspartate to attenuate hydrophobic interactions and introduce electrostatic repulsion to weaken subunit association. / v143d was shown to exist in a monomer dimer equilibrium with a kd of 90 m in the presence of the vehicle control, dmso (figure 4a). thermally destabilizing fragments decreased the dimerization affinity in ck2 p110d / v143d in homodissociation itc experiments. (a) homodissociation isotherm of ck2 p110d / v143d in 5% (v / v) dmso. (b) homodissociation isotherms of 4 and its analogues (4a and 4b). (c) the top and bottom panels of each itc profile illustrate the raw calorimetric data and the integrated heats per injection, respectively. generally, all the 18 fragments that induced monomerization of ck2 dimer in native ms experiments decreased the dimerization affinity of the double mutant, suggesting that they disrupted the dimeric interaction in ck2 p110d / v143d (supplementary table s2). this was also supported by the appearance of the dissociation isotherms, wherein the intensities of the endothermic heat pulses increased and the dilution isotherms became more attenuated in the presence of fragments, indicating greater dimer dissociation (supplementary figure s5). there is no correlation between the magnitude of thermal shift, or the degree of monomerization obtained from native ms experiments and the dimerization affinity (supplementary table s1). this could be attributed to the use of a mutant construct with different interfacial properties from that of wild - type ck2. out of all the 18 fragments tested, 2 was the most potent in mediating dimerization disruption (kd = 1010 m). surprisingly, 1 only caused a modest weakening of dimerization affinity (kd = 200 m), despite inducing the greatest extent of monomerization in the native ms assay. this suggests that the binding site of 1 could have been affected by the double mutation, and that 2 might be binding to a different region of ck2 from 1. further screening of structural analogues of 4 and 16, available from our in - house compound collection, resulted in the identification of more potent dimer - disrupting compounds. the effects of functional group substitutions on 4 (kd = 460 m) (figure 4b) and 16 (kd = 230 m) (figure 4c) were explored, with the kd values reflecting the apparent affinity for dimer formation, and not the affinity of compound binding. changing the chloro group in 4 to a hydroxyl group preserved a similar dimer - disrupting potency (4a, kd = 410 m) (figure 4b). by combining the observation that 4a was able to hinder dimerization of the double mutant with the fact that 1 demonstrated the greatest monomerizing effect in native ms, we examined whether 4b, with the 3-bromo and 5-phenyl groups in 1 replaced with phenolic groups, would have a greater potency toward effecting dimeric disruption. indeed, 4b caused a significant decrease in the dimerization affinity (kd = 1,200 m) (figure 4b), suggesting that polar interactions and hydrophobic or aromatic stacking interactions contribute to weakening dimeric association in the ck2 double mutant. replacing the methylene linker in 16 with an nh group caused approximately 2fold increase in dimer - disrupting effect (16a, kd = 490 m), suggesting a role for hydrogen bonding interactions in effecting subunit disassembly (figure 4c). incorporation of functional groups at different positions on the phenyl ring, however, had different effects. addition of an ester group at the para position of the phenyl ring resulted in a decrease in dimer - disrupting potency (16b, kd = 230 m). substitutions at the meta position of the phenyl ring of 16a were generally more favorable for dimer disruption than para substitutions as shown by the lower dimerization affinity induced by 16c (kd = 690 m) and 16d (kd = 350 m) than 16b (figure 4c). the sar studies have demonstrated that the ck2 p110d / v143d mutant could potentially serve as a surrogate protein for the development of fragments into more potent compounds that disrupt the ck2 interface. in addition, the other ck2 mutant proteins provide a range of weaker homodimeric interfaces (i.e., ck2 p110d / r111d, ck2 p110d / v112d / v143d) (supplementary figure s3c) that could be useful for the systematic screening and development of compounds that destabilize the homodimeric interface of wild - type ck2. having established that thermally destabilizing fragments drive the dimeric - to - monomeric transition of ck2, what could be the potential consequences of such an effect ? despite being able to interact with ck2 to form the heterotetramer, the ck2 p110d / v143d mutant decreased the catalytic activity of ck2, highlighting that the modulation of ck2 catalytic activity by ck2 is highly dependent on a proper dimeric architecture of ck2. cell studies have shown that a dimerization - incompetent ck2, generated by mutating two conserved cysteine residues of the zinc finger to serine, was defective in forming the 2/2 heterotetramer and experienced faster degradation. together, these studies suggest that dimer - disrupting fragments could promote ck2 degradation and an attenuation of ck2 catalytic activity through favoring the formation of the ck2 monomer. in summary, this study demonstrated the application of a fragment - based approach to specifically identify small molecules with the ability to induce disruption of the ck2 dimer. orthogonal biophysical experiments involving native ms and homodissociation itc support a mechanism that is consistent with fragment - induced dimeric disruption. future work in obtaining cocrystal structures of ck2 with the destabilizing fragments would help to elucidate the structural determinants of dimeric disruption and enable structure - guided optimization of compounds. the approach described in this study could potentially be applied to discover small molecules to disrupt other therapeutically relevant and challenging homo - oligomeric proteins as a means of modulating protein function. bacterial expression vectors encoding sequences for homo sapiens ck2 and ck2 mutants (all encoded within pgex-6p-1) were transformed into e. coli bl21(de3). a freshly transformed colony was inoculated into lb broth supplemented with ampicillin and grown overnight at 37 c. after inoculation of overnight culture, lb cultures were grown at 37 c, induced with 0.3 mm iptg after reaching an optical density of 0.6 (= 600 nm) and allowed overnight expression at 18 c. harvested cell pellets were suspended and sonicated in cold lysis buffer a (50 mm tris cellular debris was removed by centrifugation (20 000 rpm, 30 min, 4 c) and ck2 was purified using glutathione sepharose 4b beads (ge healthcare). the beads were washed with 20 column volumes of cold buffer a and incubated with 3c protease at 4 c overnight to cleave the gst tag. the digested protein solution was loaded onto a hitrap q column (ge healthcare) and fractionated over a 01000 mm nacl gradient buffered with 50 mm tris hcl ph 8.5 and 2 mm -mercaptoethanol. ck2-containing fractions, analyzed by sds page, were concentrated and loaded onto a superdex 200 26/60 column (ge healthcare) equilibrated with cold buffer b (50 mm tris mutagenesis of homo sapiens ck2 to generate the p110d, p110d / r111d, p110d / v143d and p110d / v112d / v143d mutants was performed using the q5 site - directed mutagenesis kit (new england biolabs) according to the instruction manual. vectors of mutant clones were sequenced (dna sequencing facility, university of cambridge) to verify correct incorporation of mutation. the expression vector encoding homo sapiens rad52 (cloned into pet28) was transformed into e. coli bl21-codonplus(de3)-ripl. fresh transformants were inoculated into lb broth supplemented with kanamycin and chloramphenicol, and grown overnight at 37 c. after inoculation of overnight culture, lb cultures were grown at 37 c, induced with 1 mm iptg after reaching an optical density of 0.6 (= 600 nm) and allowed expression at 30 c for 4 h. cell pellets were suspended and sonicated in buffer a (50 mm tris debris was removed by centrifugation (20 000 rpm, 30 min, 4 c) and rad52 was purified using ni the beads were washed with buffer a supplemented with 20 mm imidazole, and eluted with buffer a supplemented with 300 mm imidazole. the eluted protein solution was concentrated and loaded onto a superdex 200 26/60 column (ge healthcare) equilibrated with buffer b (50 mm tris fractions containing rad52 were combined and loaded onto a hitrap heparin hp (ge healthcare) and washed with buffer b. rad52 was eluted using a 2001000 mm kcl gradient over 20 column volumes. all proteins produced in - house were assessed for their identity, purity, monodispersity and oligomeric state using a combination of sds page, amino acid analysis, dynamic light scattering and native mass spectrometry (supplementary figure s6). the thermal shift assay was performed on a lightcycler 480 real - time pcr system (roche) in 96-well white plates (roche). for rad52, each well contained 40 l of 2 m rad52 and 2.5 sypro orange in 50 mm tris hcl ph 7.5, 200 mm kcl, with 6-hydroxydopa (santa cruz biotechnology) added to a final concentration of 2.5 mm in 5% (v / v) dmso. for tnf- (gibco), each well contained 40 l of 10 m tnf- and 5 sypro orange in 50 mm tris hcl ph 8.5, 200 mm nacl, with spd304 (cambridge bioscience) added to a final concentration of 200 m in 5% (v / v) dmso. for ck2, each well contained 40 l of 6 m ck2 and 5 sypro orange in 50 mm tris fragments were tested at a final concentration of 5 mm in 5% (v / v) dmso. each plate was sealed with an optically clear foil and centrifuged for 1 min at 1000 rpm before performing the assay. the fluorescence intensity was measured with ex = 480 nm and em = 580 nm. the melting temperature (tm) was obtained by determining the minimum of the first derivative curve of the melt curve. the thermal shift (tm) was determined by computing the difference between the tm of the protein in the presence of compound and that of the protein in the presence of 5% (v / v) dmso. ligand - observed h nmr experiments were performed at 278 k on a 700 mhz bruker nmr spectrometer fitted with a 5 mm triple txi cryoprobe. samples were made up to 200 l in 3 mm capillaries with trimethylsilylpropionic acid - d4 (tsp) for calibration. negative control (no protein) experiments were performed for each compound tested. all binding experiments were carried out using 20 m ck2 in 50 mm tris hcl ph 8.5, 50 mm nacl, 20 m tsp, 10% (v / v) d2o and 0.01% (v / v) tween20. fragments were tested at 2 mm in a final concentration of 24% (v / v) dmso - d6 in binding experiments. spectra were recorded on a synapt hd mass spectrometer (waters) modified for studying high masses. ck2 was exchanged into 0.5 m ammonium acetate solution ph 8.0 using micro bio - spin 6 chromatography columns (bio - rad). two mm of a fragment was incubated with 16 m ck2 for 30 min before analysis. 2.5 l of protein solution was electrosprayed from a borosilicate emitter (thermo scientific). typical conditions were capillary voltage 1.61.8 kv, cone voltage 6080 v, collision voltage 1020 v, with backing pressure 34 mbar and source temperature of 20 c. the concentration of ck2 p110d / v143d was selected such that the heats of dissociation afforded a good signal window and that baseline is reach in the presence of the vehicle control, indicating no further dissociation. the syringe solution consisted of 600 m ck2 p110d / v143d incubated with 5 mm fragment in 50 mm tris the cell solution consisted of 50 mm tris hcl ph 8.5, 50500 mm nacl. both the syringe and cell solutions contained dmso at a final concentration of 58% (v / v). the titration consisted of 19 injections of 2 l of the syringe solution every 120 s. each fragment protein mixture was subjected to a single titration. errors for quoted kd values represent errors of the curve fit from a single experiment. data were fitted and analyzed using the dissociation model in the microcal peaq itc software (malvern). | identifying small molecules that induce the disruption of constitutive protein protein interfaces is a challenging objective. here, a targeted biophysical screening cascade was employed to specifically identify small molecules that could disrupt the constitutive, homodimeric protein protein interface within ck2. this approach could potentially be applied to achieve subunit disassembly of other homo - oligomeric proteins as a means of modulating protein function. |
difficulty in speech discrimination, particularly in challenging auditory situations such as noisy places and/or when attempting to trace fast speech, is the most common complaint among the elderly. this difficulty is often attributed to reduced peripheral hearing sensitivity in the elderly (1,2). there is evidence that speech perception in noisy situations is difficult even for normal peripheral hearing sensitivity in the elderly (3). speech discrimination in noise depends on auditory and extra - auditory factors (4). spatial hearing, auditory input representation in different regions of the central auditory system, and spectrotemporal cues for speech processing such as f0 (the number of human vocal cord vibrations that are affected by age and gender) are known as auditory elements for speech perception in noise (5). cognitive system functions (as an internal element) and physical environmental characteristics (as external elements) are known as extra - auditory participating factors for speech perception in noise. attention and memory are the most important cognitive elements that result from bottom - up and top - down mechanisms (6). therefore, auditory cognitive system interactions are the basis of target signal and background noise segregation in the auditory system (712). the physical characteristics of a communicative environment are the other extra - auditory elements that influence target stimulus detection in the presence of competing background noise (13). the signal - to - noise ratio (snr) is the most effective physical characteristic factor for speech perception in noise, and it is defined as the target stimulus power compared with the background noise power, measured in decibels (db) (3). several studies have supported the effect of aging on perceptual abilities. a comparison of these potencies in older and younger people revealed that older people required a 34 db higher snr than younger people to have the same proper perception under similar noise conditions. it appears that age - related changes in auditory cognitive system functions are responsible for the requirement of an enhanced snr in the elderly (1416). most of the studies on the speech discrimination abilities of the elderly focused on their hearing impaired abilities, clarifying the causes of decreasing perceptual ability. 17) ascribed elderly speech difficulties in noise to a deficit in central auditory processing. clark. (1) and fostick. (2) attributed elderly speech difficulty in noise to peripheral hearing sensitivity loss, known as presbycusis. wong. (7) found that the speech discrimination ability of the elderly declined more than younger people at a similar snr. anderson. (11,15) and sung hee. (18) noted that in the elderly, a decreased speech perception in noise ability was the result of chemical changes in the central nervous system neurotransmitters. parthasarathy. (19), souza. (1), kamal. ((11), bidelman. (21), and getzmann (22) attributed the elderly decreased speech in noise discrimination ability to temporal synchronization changes in sub - cortical auditory structures. walton (23) also reported prefrontal and hippocampus atrophy in the brains of the elderly. gordon - salant (24) found that a decreased discriminative ability in spectro temporal processing slows the central nervous system of the elderly. according to zekveld. (26), denise and schwartz (27), and sohoglu. (28), attention and working memory declines are the causes of decreased discriminative skills in the elderly. wong. (29) studied the role of auditory - cognitive system interactions in speech discrimination and noted inadequate results for higher snr requirements in the elderly compared with younger people under similar noise conditions. as noted above, the majority of related studies evaluated the effects of auditory cognitive elements on speech perception in noise of the elderly. because of the important role of the magnitude of snr on perceptual abilities, it appears that more studies should evaluate auditory and extra - auditory element interactions. although it is well known that decreased hearing sensitivity and/or cognitive system dysfunction has a negative effect on the perceptual abilities of the elderly, the importance of physical environmental characteristics such as snr has received less consideration. in this newly designed study, we investigated the role of the snr magnitude as an extra - auditory effect element for the speech in noise perception ability of the elderly. this study was performed on 25 elderly people (16 women and 9 men) aged 6574 years with a mean age of 67.9 (2.45 sd) years. all individuals had normal hearing thresholds at 2502000 hz and were selected from three cultural centers in tehran from october to december 2014. safety and morality aspects of the research were approved by iran university of medical sciences. our study was conducted on right - handed elders with a high school diploma, monolingual with good competency in persian as their native language, with no history of ear diseases, head trauma or accident, head surgery, depression, epilepsy, or neurological drug intake. to ensure normal hearing thresholds at low - mid frequencies, pure - tone audiometry was accomplished in a double - walled, sound treated audiometric booth, using a two channel calibrated clinical audiometer (interacoustic ac40) and a supra - aural headphone (telephonics tdh-49p). pure tone thresholds were obtained at six octave band frequencies from 2508000 hz, using a 10 db up and 5 db down regimen according to the hughson westlake method (3). in this phase, the participants had hearing thresholds of25 db hl in both ears at 2502000hz. the mean pt average was 13.64 db and 14.88 db in the right and left ear, respectively. the mean high frequencies (38kh) hearing thresholds were 48 db and 52 db in the right and left ear, respectively. in the speech perception in the noise test (spin), each participant was instructed as follows. this simple test was designed to assess the ability to recognize normal words in the presence of noise. spin was performed using four persian, monosyllabic, phonetically - balanced, phoneme - balanced lists (n=25) based on 29 persian language phonemes (6 vowels and 23 consonants) (31). participants responded by repeating the heard words and an adequate response time was given to them. competing white noise was delivered at three snrs ipsilaterally : 0, + 5, and + 10db (32). word discrimination scores were calculated based on correct repeated words by each snr and for each ear. cognitive screening was performed using persian mini - mental state examination (mmse) test. analysis of variance (anova) was conducted to compare word recognition scores at silence and three snrs. pearson correlations was used for the age - relationship study with word recognition scores in silence and at 0, + 5, and + 10dbs. statistical analysis was performed using spss.18 software (chicago, il, usa). analysis of variance (anova) was conducted to compare word recognition scores at silence and three snrs. pearson correlations was used for the age - relationship study with word recognition scores in silence and at 0, + 5, and + 10dbs. the kolmogorov smirnov test indicated that data were normally distributed among all spin test scores (p>0.086). there was a significant difference among word discrimination scores in silence and all snrs for both ears (tables 1 and 2). the 0, + 5, and + 10db snrs were 0.030, 0.024, and 0.023 in the right ear and 0.034, 0.019, and 0.017 in the left ear, respectively (p0.30) (table 4). wds : word discrimination scores (wds), snr : signal to noise ratio wds : word discrimination scores (sds), snr : signal to noise ratio wds : word discrimination score (wds), snr : signal to noise ratio pearson correlation is significant at the < 0.05 level (2-tailed) wds : word discrimination score (wds) snr : signal to noise ratios the main finding of this study was the significant difference between word discrimination scores in silence and at 0, + 5, and + 10db snrs in both ears. we found that the word discrimination ability in the elderly was significantly reduced in noisy conditions, and this is in agreement with martin and jerger (33), pichora - fuller (17), gordon - salant (23), walton (24), and doberva. (34) who all believed that speech perception disability by the elderly is related to non - peripheral auditory factors. with regards to the participants ' normal auditory sensitivity at 2502000 hz and remarkable decreased word discrimination at higher noise levels, it appears that the ability of the elderly to discriminate word in noise is considerably dependent on the snr magnitude as an extra - auditory element. moreover, comparison of word discrimination scores in silence and at 0 db snr revealed that the perceptual ability of the elderly was considerably reduced at equal signal and noise levels. the remarkable difference between word discrimination scores for each pair of snrs (0 and + 5, 0 and + 10, and + 5 and + 10db) showed that decreasing the signal level and increasing the competing noise amount extremely reduced the perceptual ability of the elderly. it appears that when increasing the background noise, elderly people need compensatory strategies for adequate speech sound perception. no significant correlation was found between age and word discrimination scores in silence and at 0, + 5, and + 10db snrs. (29) who found that the ability of speech discrimination in noise was not only related to the auditory system function, but also to the compensatory interaction of the auditory cognitive systems. therefore, one can say there is an assistive factor in the central nervous system of the elderly that prevents further speech in noise discrimination deterioration at higher ages. it appears that increased activity in general cortical cognitive regions such as the prefrontal area acts as an assistive factor to compensate for the sensory representation deficit in other cortical areas. this enhanced prefrontal activity following attention has been supported by behavioral - neurophysiologic studies (15 - 21). the ability of speech perception in the elderly affects peripheral / central auditory, cognitive, and environmental elements. peripheral age - related hearing loss effects on elderly perceptual abilities is caused by a reduced auditory input transition from the cochlea to the higher auditory centers. central auditory system dysfunction resulted from processing declines at the brainstem and in higher auditory regions (15,21). conversely, cognitive system dysfunction reduces the working memory and attention capacity of the elderly. physical environmental characteristic deterioration reduces the speech sound transportation from the speaker to the listener (37). mid frequencies, the participants ' speech perception dropped considerably even at equal signal and noise levels. it appears that reparative strategies such as prosodic rhythm tracing at the phoneme level can help reduce speech sounds transition and processing compensation. increasing the background noise and decreasing moreover, the effect of auditory training to improve perceptual ability through neural plasticity in the central nervous system of the elderly is supported in various studies. it appears that acetylcholine levels increase following auditory training and is responsible for exhibitory - inhibitory mechanism interactions resulting in speech representation improvements at sub - cortical and cortical levels (40). therefore, simple stimuli based auditory training and/or memory auditory based cognitive training (impact : improvement in memory with plasticity - based adaptive cognitive training) (45) is the best strategy to improve brain plasticity in the elderly and improve their speech in noise perception (4144). recent findings are only reliable in the frame of this research because of our small sample size. we could not eliminate the effect of peripheral high frequency loss of speech in noise perception in the elderly. a study of the snr effect on hearing impaired elders perceptual abilities and the effect of negative snrs on speech perception in noise is recommended to evaluate auditory / extra - auditory element interactions. this study revealed considerably reduced speech perception ability in the presence of background noise in normal, low moreover, decreasing the signal level and increasing the competing noise significantly reduced the perceptual abilities of the elderly. it appears that the snr has an important critical role for proper speech perception in noise for the elderly, even those who have normal peripheral auditory cognitive function systems. according to recent findings, elderly people may need adaptive strategies such as auditory training to facilitate speech perception in the presence of background noise. we would like to sincerely thank the eshragh, andishe, bahman cultural centers for their extensive cooperation. this study was supported by a grant (contract number 4723/260/90/d/ on 2009/1/12) from the rehabilitation research center of iran university of medical sciences, whose financial support is much appreciated. kobra esfandiyari for sample selection and we also thank all the participants in this research. | background : speech perception ability depends on auditory and extra - auditory elements. the signal- to - noise ratio (snr) is an extra - auditory element that has an effect on the ability to normally follow speech and maintain a conversation. speech in noise perception difficulty is a common complaint of the elderly. in this study, the importance of snr magnitude as an extra - auditory effect on speech perception in noise was examined in the elderly. methods : the speech perception in noise test (spin) was conducted on 25 elderly participants who had bilateral low mid frequency normal hearing thresholds at three snrs in the presence of ipsilateral white noise. these participants were selected by available sampling method. cognitive screening was done using the persian mini mental state examination (mmse) test. results : independent t- test, annova and pearson correlation index were used for statistical analysis. there was a significant difference in word discrimination scores at silence and at three snrs in both ears (p0.047). moreover, there was a significant difference in word discrimination scores for paired snrs (0 and + 5, 0 and + 10, and + 5 and + 10 (p0.04)). no significant correlation was found between age and word recognition scores at silence and at three snrs in both ears (p0.386). conclusion : our results revealed that decreasing the signal level and increasing the competing noise considerably reduced the speech perception ability in normal hearing at low mid thresholds in the elderly. these results support the critical role of snrs for speech perception ability in the elderly. furthermore, our results revealed that normal hearing elderly participants required compensatory strategies to maintain normal speech perception in challenging acoustic situations. |
stent thrombosis is one of the most fatal complications of percutaneous coronary intervention (pci). even with optimal medical treatment after drug eluting stent or bare metal stent (bms) insertion, about 0.5 - 1% of patients experience acute, subacute, late, or very late stent thrombosis with a mortality rate as high as 45%.1)2) lesion - related risk factors for stent thrombosis include bifurcation lesions, longer lesions, and under deployment of the stent ; patient - related risk factors include diabetes, renal failure, resistance to aspirin or clopidogrel, left ventricular dysfunction (low ejection fraction), younger age, and premature antiplatelet therapy discontinuation.1)2) malignancy is considered a prothrombogenic condition, with increased risk for both venous and arterial thrombosis, including native coronary artery thrombosis and myocardial infarction.3) recently, we experienced two confirmed cases of acute stent thrombosis in patients with underlying malignancy. here a 56-year - old male was admitted to our center with an abnormal finding on low dose screening chest ct scan which demonstrated an atelectasis and abrupt narrowing in the right upper lobar bronchus (fig. bronchoscopic biopsy revealed a squamous cell carcinoma obstructing the right upper bronchus and [f]fluorodeoxyglucose positron emission tomography demonstrated hypermetabolism in the bronchus and right lower paratracheal lymph node. he had a past medical history of hypertension and unstable angina, which had been treated by plain balloon angioplasty 8 years previously. he was taking aspirin 100 mg daily, diltiazem 90 mg daily, isosorbide mononitrate 20 mg twice daily, and candesartan 16 mg daily, but still complained of intermittent chest pain on exertion (ccs class ii). a myocardial perfusion scan showed reversible perfusion defects in the apex and the apical anterior wall suggesting left anterior descending artery (lad) territory ischemia. echocardiography showed basal inferior wall akinesia and basal inferolateral wall hypokinesia with a normal left ventricular ejection fraction (ef). the patient was treated with aspirin 300 mg and clopidogrel 600 mg in preparation for coronary angiography (cag). cag revealed 3-vessel disease with an nearly occluded proximal lad, 75% stenosis in the proximal left circumflex artery (lcx) and diffuse 50% stenosis in the right coronary artery (rca) (fig. we performed pci for the proximal lad and the proximal lcx using bmss (coroflex blue, b. braun corporation, melsungen, germany ; 3.019 mm and 2.7513 mm in lad and driver, medtronic cardiovascular, minneapolis, mn, usa ; 3.030 mm in lcx) (fig. twenty minutes after completion of the procedure, the patient developed an urticarial rash on his trunk, diaphoresis, chest pain, hypotension, and bradycardia. the symptoms persisted and an electrocardiogram (ecg) showed st - segment elevations in v 4, v 5, and v 6 (fig. 1d). emergent angiography with support of an intra - aortic balloon pumping demonstrated thrombotic total occlusion of the lcx stent and some thrombi in lad stent (fig. the stent was reopened with aspiration thrombectomy and additional ballooning, accompanied by intravenous abciximab infusion. the patient made a good recovery and was asymptomatic when discharged with aspirin 100 mg and clopidogrel 75 mg daily. he returned within the month for neo - adjuvant chemotherapy and video assisted thoracic surgery. fifteen days later, he was re - admitted for neo - adjuvant chemotherapy (paclitaxel+carboplatin). after 10 minutes of paclitaxel infusion, he developed diaphoresis, dyspnea and chest pain with hypotension. an ecg showed st - segment elevation of about 4 mm in v 2-v 4. abciximab was administered and aspiration thrombectomy and balloon angioplasty were performed, resulting in restoration of thrombolysis in myocardial infarction grade 3 flow. the patient again showed a good recovery and was asymptomatic when discharged with triple anti - platelet therapy due to the recurrent episode of stent thrombosis (aspirin 100 mg and clopidogrel 75 mg daily, cilostazol 100 mg twice daily). at 42 days post - pci, the patient underwent right upper lobectomy without any further adverse events. a 68-year - old male presented with a three - day history of fever and abdominal pain. his past medical history included hypertension and 3-vessel coronary artery disease, which had been treated by pci 13 years previously. the patient had been taking aspirin 100 mg daily along with an angiotensin converting enzyme inhibitor and a beta - blocker since the pci. a ct scan of the abdomen revealed a pericolic abscess with pneumoretroperitoneum at the right perirenal space and a pancreatic tail mass invading into the left kidney (fig. 2a), the spleen, and the descending colon. an acute perforated appendicitis or diverticulitis was suspected and the patient underwent emergent laparotomy. surgical findings included an intra - abdominal abscess with severe adhesions and multiple seeding nodules on the rectal shelf and the omentum. pathology confirmed metastatic adenocarcinoma originating from the pancreas. at postoperative day 22, despite resolution of the intra - abdominal infection, the patient developed pulmonary edema with respiratory failure and shock requiring mechanical ventilation. his ecg showed no change but cardiac enzymes were elevated (peak troponin i was 0.219 ng / ml). echocardiography showed regional wall motion abnormality in the rca territory and left ventricular dysfunction (ef 42%). a 3.523 mm genous stent (orbusneich, hong kong) was deployed in the proximal lad (fig. 2c) and a 2.7518 mm xience stent (abbot vascular, abbot laboratories, abbot park, il, usa) was inserted in the posterolateral branch. twenty minutes after pci, the patient developed ventricular fibrillation with pulseless ventricular tachycardia (fig. 2d), which was initially unresponsive to electrical cardioversion and anti - arrhythmic drugs. we instituted extracorporeal membrane oxygenation (ecmo) and on repeat angiography we discovered a total occlusion of the proximal lad stent with an extensive thrombus (fig. the patient had also developed a new thrombus in the distal rca that had not been seen during the previous angiography (fig. a 3.023 mm xience stent was placed in the distal rca lesion because there was significant residual stenosis after plain balloon angioplasty. once the total occlusion of the proximal lad was reopened, the patient 's ventricular tachycardia was converted to sinus rhythm. four days later, he was weaned from ecmo support and started showing gradual recovery from pulmonary edema and cardiogenic shock. a 56-year - old male was admitted to our center with an abnormal finding on low dose screening chest ct scan which demonstrated an atelectasis and abrupt narrowing in the right upper lobar bronchus (fig. bronchoscopic biopsy revealed a squamous cell carcinoma obstructing the right upper bronchus and [f]fluorodeoxyglucose positron emission tomography demonstrated hypermetabolism in the bronchus and right lower paratracheal lymph node. he had a past medical history of hypertension and unstable angina, which had been treated by plain balloon angioplasty 8 years previously. he was taking aspirin 100 mg daily, diltiazem 90 mg daily, isosorbide mononitrate 20 mg twice daily, and candesartan 16 mg daily, but still complained of intermittent chest pain on exertion (ccs class ii). a myocardial perfusion scan showed reversible perfusion defects in the apex and the apical anterior wall suggesting left anterior descending artery (lad) territory ischemia. echocardiography showed basal inferior wall akinesia and basal inferolateral wall hypokinesia with a normal left ventricular ejection fraction (ef). the patient was treated with aspirin 300 mg and clopidogrel 600 mg in preparation for coronary angiography (cag). cag revealed 3-vessel disease with an nearly occluded proximal lad, 75% stenosis in the proximal left circumflex artery (lcx) and diffuse 50% stenosis in the right coronary artery (rca) (fig. we performed pci for the proximal lad and the proximal lcx using bmss (coroflex blue, b. braun corporation, melsungen, germany ; 3.019 mm and 2.7513 mm in lad and driver, medtronic cardiovascular, minneapolis, mn, usa ; 3.030 mm in lcx) (fig. twenty minutes after completion of the procedure, the patient developed an urticarial rash on his trunk, diaphoresis, chest pain, hypotension, and bradycardia. the symptoms persisted and an electrocardiogram (ecg) showed st - segment elevations in v 4, v 5, and v 6 (fig. 1d). emergent angiography with support of an intra - aortic balloon pumping demonstrated thrombotic total occlusion of the lcx stent and some thrombi in lad stent (fig. the stent was reopened with aspiration thrombectomy and additional ballooning, accompanied by intravenous abciximab infusion. the patient made a good recovery and was asymptomatic when discharged with aspirin 100 mg and clopidogrel 75 mg daily. he returned within the month for neo - adjuvant chemotherapy and video assisted thoracic surgery. fifteen days later, he was re - admitted for neo - adjuvant chemotherapy (paclitaxel+carboplatin). after 10 minutes of paclitaxel infusion, he developed diaphoresis, dyspnea and chest pain with hypotension. an ecg showed st - segment elevation of about 4 mm in v 2-v 4. abciximab was administered and aspiration thrombectomy and balloon angioplasty were performed, resulting in restoration of thrombolysis in myocardial infarction grade 3 flow. the patient again showed a good recovery and was asymptomatic when discharged with triple anti - platelet therapy due to the recurrent episode of stent thrombosis (aspirin 100 mg and clopidogrel 75 mg daily, cilostazol 100 mg twice daily). at 42 days post - pci, the patient underwent right upper lobectomy without any further adverse events. a 68-year - old male presented with a three - day history of fever and abdominal pain. his past medical history included hypertension and 3-vessel coronary artery disease, which had been treated by pci 13 years previously. the patient had been taking aspirin 100 mg daily along with an angiotensin converting enzyme inhibitor and a beta - blocker since the pci. a ct scan of the abdomen revealed a pericolic abscess with pneumoretroperitoneum at the right perirenal space and a pancreatic tail mass invading into the left kidney (fig. 2a), the spleen, and the descending colon. an acute perforated appendicitis or diverticulitis was suspected and the patient underwent emergent laparotomy. surgical findings included an intra - abdominal abscess with severe adhesions and multiple seeding nodules on the rectal shelf and the omentum. pathology confirmed metastatic adenocarcinoma originating from the pancreas. at postoperative day 22, despite resolution of the intra - abdominal infection, the patient developed pulmonary edema with respiratory failure and shock requiring mechanical ventilation. his ecg showed no change but cardiac enzymes were elevated (peak troponin i was 0.219 ng / ml). echocardiography showed regional wall motion abnormality in the rca territory and left ventricular dysfunction (ef 42%). a 3.523 mm genous stent (orbusneich, hong kong) was deployed in the proximal lad (fig. 2c) and a 2.7518 mm xience stent (abbot vascular, abbot laboratories, abbot park, il, usa) was inserted in the posterolateral branch. twenty minutes after pci, the patient developed ventricular fibrillation with pulseless ventricular tachycardia (fig. 2d), which was initially unresponsive to electrical cardioversion and anti - arrhythmic drugs. we instituted extracorporeal membrane oxygenation (ecmo) and on repeat angiography we discovered a total occlusion of the proximal lad stent with an extensive thrombus (fig. the patient had also developed a new thrombus in the distal rca that had not been seen during the previous angiography (fig. a 3.023 mm xience stent was placed in the distal rca lesion because there was significant residual stenosis after plain balloon angioplasty. once the total occlusion of the proximal lad was reopened, the patient 's ventricular tachycardia was converted to sinus rhythm. four days later, he was weaned from ecmo support and started showing gradual recovery from pulmonary edema and cardiogenic shock. we have described 2 patients with acute coronary stent thrombosis, presenting with cardiogenic shock or cardiac arrest accompanied with lethal arrhythmia in the presence of concomitant malignancy. in the first case, acute and subacute stent thrombosis occurred sequentially in the same patient. episodes of acute hemodynamic instability, the first due to suspicious anaphylactic shock caused by radio - contrast dye and the second occurring during infusion of paclitaxel, were antecedent to the acute and subacute stent thromboses. although acute hemodynamic instability is frequently encountered in acute coronary syndrome (acs), acute stent thrombosis is very rare. in the second case, the patient had mild left ventricular dysfunction (ef 42%) as a risk factor for stent thrombosis.1)2) however, in this case, the thrombosis occurred not only in the stent but also in an untreated native coronary artery segment. in our experience, both of these cases is known to be a prothrombotic condition,3) we think that the patients ' concomitant malignancy were one of the precipitating factors to their acute stent thromboses. malignancy is a well - known risk factor for deep vein thrombosis, pulmonary embolism and even arterial thromboembolism.3)4) there are several reports on cases of acs, myocardial infarction and stent thrombosis in patients with malignancy. tumor - produced procoagulants, inflammatory cytokines, decreased inhibitors of coagulation, impaired fibrinolysis, and general responses of the host to the tumor (i.e. acute phase reactant, angiogenesis, inflammation) may all contribute to this prothrombotic tendency.5) in addition, anti - cancer therapy such as surgery, chemotherapy, radiotherapy, and hormone therapy,6) along with hemodynamic compromise (i.e., stasis) may amplify the prothrombotic tendency in patients with cancer. acs and myocardial infarction have also been reported during infusion of various chemotherapeutic agents, including 5-fu,7) capecitabine,8) gemcitabine,9) and paclitaxel.10) even though the main mechanism of acute coronary syndrome with these chemotherapeutic agents is unclear, some authors have proposed coronary vasospasm or endothelial dysfunction as a cause.7)9) however, there has been no report on recurrent stent thrombosis in a patient or on simultaneous thromboses in stent and native coronary artery to the best of our knowledge. although there is currently no statistically proven causal relationship between malignancy and stent thrombosis or acs, increasing numbers of case reports imply that malignancy may be one of the precipitating factors of stent thrombosis. meanwhile, we believe that we need rigorous precautions in the treatment of pa - tients with coronary artery disease and malignancy, especially with regards to deciding how and whether to revascularize, as well as which anti - platelet agents to select (i.e. triple anti - platelet therapy11) instead of newly developed agents such as ticagrelor12) and prasugrel13)). | there have been a growing numbers of patients diagnosed with malignancy and coronary artery disease simultaneously or serially. in the era of percutaneous coronary intervention (pci), stent thrombosis has been a rare but challenging problem. recently, we experienced two unique cases of acute stent thrombosis in patients with malignancy. the first case showed acute and subacute stent thrombosis after pci. the second case revealed simultaneous thromboses in stent and non - treated native coronary artery. we believe that we need rigorous precautions in the treatment of patients with coronary artery disease and malignancy, especially with regards to deciding how and whether to revascularize, as well as which anti - platelet agents to select. |
the ability to differentiate force plays an important role not only in daily life activity (e.g., grasping a fragile object), but also in sports, where the appropriate sense of force often determines the accuracy task. when developing strategies to prepare athletes for effort, measures to improve movement control are worth considering. therefore, the kinesthetic differentiation (kd) also known as force sense (tension or effort) within training and rehabilitation process becomes more and more stressed. as proprioceptive sensations, the kinesthetic differentiation is defined as the ability of an individual to use different levels of muscular force (perception of muscular force). this skill allows an individual to adapt muscle tension to stabilize the joints, and it is responsible for the economy and precision of motor tasks. adjusting kinesthetic differentiation takes place in the nervous system, and it is mostly based on the afferent information coming from golgi tendon organs (gto) and muscle spindles. apart from these two receptors, an important role of force differentiation is also played by pressure - sensitive skin receptors (mechanoreceptors in the skin), which effectively complement proprioceptive information. the perception of the muscular force (kinesthetic differentiation) is commonly assessed by using force production tests. these tests involve using a reference force, usually determined as a percentage of a maximal voluntary isometric contraction (mvc), and attempting to replicate a percentage of mvc for instance, 25%, 50% or 75%. the difference between the target force and the force produced is used to quantify the accuracy of kd and is referred to as a force production error (fpe). force matching is usually conducted without visual feedback and can occur in the same limb or in the contra lateral limb. in this investigation, the grip strength by means of electronic hand dynamometer was conducted to evaluate kd, since it is a valid tool of measurement for cognitive function. jones and hunter indicate that the use of 50% of maximum force as the target force generates a smaller error at the attempts to the model force. furthermore, healthy individuals can reliably distinguish load changes of 5%10% in an active lifting movement. several factors influencing kinesthetic differentiation have been investigated (e.g., age, cryotherapy, warm - up exercises, muscle fatigue). however to our knowledge, no one investigated how swedish massage influences kinesthetic differentiation. among many physiotherapy procedures, swedish massage is one of the common treatments that is used in order to ensure optimal start readiness of athletes. swedish massage (in europe also known as classic massage) applied to the subjects of this study is defined as a mechanical manipulation of body tissues with rhythmical pressure and includes various combinations of stroking, rubbing, kneading, tapotement, and vibration. is interesting to note that the therapeutic effects of the swedish massage are overestimated and underestimation equally often. authors usually unanimously list the beneficial after massage effects, such as : (a) reduction of muscle tone ; (b) improvement in the flow of nerve impulses at synapses ; (c) improvement in reaction time and neuromuscular coordination ; (d) stimulation of nerve conduction ; improvement in muscular trophic (provision of nutrients, disposal of metabolic waste products) ; and (e) three- to five - fold increase in muscle readiness to work and in their ability to contract and relax. in light of the above assumptions, the idea of applying massage prior to literature suggests that such procedure is designed to complement the warm - up and improve the physical properties of selected muscle groups and joints, thus to prepare an athlete for training and competition. previous studies on massage have mainly been focused on the assessment of endurance, maximal force, and reaction time skills. nevertheless, there are not enough reports on the effects of massage on the kinesthetic differentiation. this issue needs further exploration, taking into account the concept of a reflex - nervous activity of the massage and the role of this ability in the structure of motor skills. from the perspective of this paper, the impact of the classical massage on the nervous and muscular systems seems particularly interesting, because these systems determine the ability of kinesthetic differentiation. thus, the main objective of the study was to assess the impact of the classical massage on kinesthetic differentiation under static conditions. the study group consisted of 30 purposely selected healthy students from the academy of physical education in katowice. it was a homogeneous sampling in terms of age between 2025 (17 females, age : 21.90.78 years, height : 167.46.59 cm, body mass : 59.74.51 kg, and bmi : 21.31.46 and 13 males, age : 22.51.33 years, height : 180.84.88 cm, body mass : 8012.57 kg, and bmi : 24.53.15). individuals were excluded from the investigation if they had any neurological or orthopedic disorders, cardiovascular disease, sensory disturbances, as well as any contraindications against massage. the experimental methodology was approved by the research ethics board at the academy of physical education in katowice and in accordance with the ethical standards of the helsinki declaration. all data collection was performed in the human motor behavior laboratory at the academy of physical education in katowice. the kinesthetic differentiation test consisted in the assessment of hand grip force for both dominant and nondominant hand. the first three trials were done for 100% of the participants capabilities, which allowed the researchers to assess the participants maximal isometric voluntary contraction force (fmax), then five trials were done trying to use 50% of the maximum force, and in the last five trials, the participants tried to use only 50% of their previous force (1/2 of 50%). the result was the difference of force recorded in relation to the norm (1/2 of the maximum result and 1/2 of 50% of force result). the absolute force production error (fpe) expressed in percentage (accuracy of kinesthetic differentiation) was calculated according to the formula : (1)fpe = (|model score|) / model 100% analysis took into account the mean values of forces expressed in kilograms. it was the mean value of isometric force measured for 6 s, the first second of the measurement was rejected in order to eliminate any possible delay. the average of three trials was used in the analysis of the maximum hand grip force (fmax). the average of five trials was considered in the analysis of kinesthetic differentiation of 50% and 25%. each trial lasted for 6 s (the first second of the measurement was rejected in order to eliminate any possible delay) and there were 30 s breaks between them. reference values were calculated in the kinesthetic differentiation test (50% of maximum force and 1/2 of 50% force) and on this basis, the percentage value of the absolute force production error was computed for 50% (fpe_50%) and 25% (fpe_25%). instructions for the participants were as follows : for the first three trials tighten your hand with 100% of your capabilities.for the five consecutive trials tighten your hand with half the value (i.e., 50% of your capabilities).for the five consecutive trials tighten your hand with half the previous value (i.e., 1/2 of 50% force). for the five consecutive trials tighten your hand with half the value (i.e., 50% of your capabilities). for the five consecutive trials tighten your hand with half the previous value (i.e., 1/2 of 50% force). the first measurement showed the natural kinesthetic differentiation of a participant, while the second one was preceded by a 15-min swedish massage. dh = dominant hand, ndh = nondominant hand, fmax = maximal force. during the measurement, the participants were sitting in a chair, with the forearm of the examined limb in a neutral position and the flexion at the elbow joint of approximately 90 (figure 2). this is the standard position to assess the hand grip force, proposed by the american society of hand therapists (asht), supported by the research results of other scientists. during the measurements, the participants were blindfolded and did not receive any feedback on the course of trial or their scores. irvington, ny, usa) with hercules 2000 software, jamar handy (orthopartner ag, seon, south korea) was used for measurement (see figure 3) massage prior to the second measurement was performed on the hand and forearm of the dominant limb. applied massage strokes were based on the methodology proposed by podgorski. during the massage, the participants were sitting with the forearm resting on the table in front of them. the massage included the following proportions of different techniques : 10% of stroking (1.5 min), 30% of rubbing (4.5 min), 40% of kneading (6 min), 10% of tapping (1.5 min), 5% of vibration (45 s), 5% of final stroking (45 s) (see table 1). the massage was performed on the dorsal and palmar side of the hand, as well as the front and back side of the forearm. a metronome with a frequency of 1 hz was used in order to standardize the pace of the massage. techniques and strokes applied during the classical massage results obtained in the study were analyzed based on the commonly applied methods of statistical analysis, using statistica 10 software package (statsoft, inc. the basic parameters of descriptive statistics were calculated, such as : arithmetic mean, standard deviation, skewness, and kurtosis of distributions. normality of distribution of the variables was checked with the shapiro - wilk test. in order to compare the impact of massage on the kinesthetic differentiation for the dominant and non - dominant limbs, two - way analysis of variance 2 2 anova for repeated measures post - hoc analysis, the bonferroni test for multiple pairwise comparisons, was applied to determine the level of statistical significance of differences. in order to correlate maximal force tests and kinesthetic differentiation tests, the average value of maximum force (fmax dh) for the dominant hand (dh), after the massage, decreased by 0.49 kg. there was no statistical significance after the application of massage f(1.29) = 5.5, p =.46. the average value of maximum force (fmax ndh) for the nondominant hand (ndh), after the massage, decreased by 1.3 kg. the dependencies for the dominant and nondominant hand are shown in figure 4 average values of maximal force (fmax) in dominant (dh) and nondominant (ndh) hand before and after massage. for the dominant hand, after the massage, the percentage value of error in the assessment of 50% of maximum force (fpe_50% dh) increased by 1.63%. there was no statistically significant difference found f(1.29) = 3.2, p =.57. the percentage value of error in the assessment of 25% of maximum force (fpe_25% dh) after the massage decreased by 2.2%. percentage value of force production error (fpe) in dominant hand (dh) estimated for 50% and 25% of maximal force before and after massage. kd = kinesthetic differentiation. in the nondominant hand, after the massage, the percentage value of error in the assessment of 50% of maximum force (fpe_50% ndh) increased by 3.27%. the percentage value of error in the assessment of 25% of maximum force (fpe_25% ndh) after the massage increased by 0.62%. percentage value of force production error (fpe) in nondominant hand (ndh) estimated for 50% and 25% of maximal force before and after massage. correlations of maximal grip strength force (fmax) between pre- and postmassage were significant both for dominant (r = 0.92, p =.01), and nondominant hand (r = 0.94, p =.01). correlation between pre- and postmassage for maximal grip strength (fmax) for dominant hand (dh). correlation between pre- and postmassage for maximal grip strength (fmax) for nondominant hand (ndh). for kinesthetic differentiation tests, correlation reveal significant relationship between pre- and post - massage of 50% force production error (r = 0.67, p =.01) for dh and (r = 0.71, p =.01) for ndh. for the pre- and postmassage of 25% force production error, the correlations were insignificant both for dominant (r = 0.06, p =.72), and nondominant hand (r = 0.22, p =.25). correlation between pre- and postmassage for kinesthetic differentiation expressed as force production error of 50% for dominant hand (dh). correlation between pre- and postmassage for kinesthetic differentiation expressed as force production error of 50% for nondominant hand (ndh). the present study indicates that the swedish massage of the hand and the forearm does not affect the kinesthetic differentiation, manifesting itself in the sense of hand grip force. it could be assumed that some differences in this area would be noted as a result of mechanical influence on the chosen analyzers of the nervous system (muscle spindles, golgi tendon organs, and pressure - sensitive skin receptors). magiera and walaszek suggest that, by stimulating different kinds of receptors, a massage induces the stimulation of certain areas of the cerebral cortex, which translates into faster and more efficient implementation of operations by organs. this process is associated with a central (general) impact of the swedish massage. the influence of the swedish massage on the kinesthetic receptors has not been examined yet. numerous scientific reports have updated the current state of knowledge on the subject and discovered new dependencies, often in opposition to the information contained in the published books. some studies suggest that massage, similar to stretching, causes a decrease in the activation of motor units and reduces muscle tone, which can translate into motor efficiency in motor tasks requiring a high level of force. this phenomenon is explained by, among other factors, a decrease in the number of potential actin - myosin bridges in elongated muscles. this relationship has been shown in several publications that have demonstrated that massage has a negative impact on the scores in speed and explosive power tests. however, some researchers have not noticed any changes in this area after the treatment, compared with the control group. there is no complete agreement with regard to the impact of massage on the sphere of human motor skills. in the face of insufficient evidence and conflicting research results, it is difficult to draw unequivocal conclusions. however, also it is difficult to give an unequivocal assessment, as it is usually subjective and qualitative. some researchers observed a sedative impact of a massage on the tension of massaged muscles by reducing neuromuscular excitability, measured with changes in hoffman reflex amplitudes (so - called h - reflex). interestingly, the inhibitory effect of massage on alpha motor neurons maintained only during the treatment. after its completion, the excitability of motor units quickly returned to their previous levels, which suggests that the change would not be recorded in the results of posttreatment measurements. therefore, some researchers believe that the possible differences in the muscle tone after the massage should not be explained by the reduced activity of alpha motor neurons, but the change in the structure of the muscle (fiber elongation, reduction in soft tissue adhesion). nevertheless, the impact of massage on the neurological aspects of muscle tension needs further examination. the present study also evaluated the influence of the swedish massage on the maximum force of isometric contraction during the hand grip test. it has been found that the massage did not affect the mean values of maximum force, which had been concluded also by hemmings., jnhagen., and mckechnie., who did not find any influence of massage on the results of force tests. yet, some authors claim that massage by mechanical pressure exerted on the soft tissues increases their deformability and causes stretching of the shortened muscle fibers, which in turn results in a decrease of the muscles potential force. the process is explained by the lower number of possible actin - myosin connections in the elongated muscle. there is also the neurological factor hypothesis, which blames the reduced activation of muscle fibers or a change in their reflex sensitivity for a decrease in force after the massage., hunter., and arroyo - morales., among others. however, a comparison of the above results with the findings of the present study is problematic, since the said researchers had taken into account the manifestations of force under dynamic conditions, tested larger muscle groups and used different massage protocols. it was not assessed whether the pauses between measurements were sufficient to eliminate fatigue, which could have affected the results. only subjective preferences of the subjects were taken into account when setting the grip span of dynamometer. since the efficiency of hand grip is determined by the grip span, it is suggested to base the adjustment of dynamometer also on the hand size, which will make the measurements more objective. assuming that, massage contributes to a decline in muscle force, the results of the present study may have been affected by the hawthorne effect (observer effect). the participants of the experiment could expect that after the massage, their hand grip would be stronger, making them more motivated to achieve higher results, which could have eliminated the negative impact of the treatment. in future studies, subjective feelings of the participants should be taken into account with regard to the impact of massage on the psychological sphere. the results could have also been affected by the therapist s experience and training, since they imply particular pressure force, choice of techniques, and professional skills. moreover, it is important to note that the message applied aimed neither at sedation, nor stimulation of muscles, but it rather combined existing techniques. in addition, the results of the present experiment should be interpreted only with reference to young and fit individuals, as no other subjects were examined. correlations before and after massage intervention revealed that there is strong relationship for maximum grip strength and for kinesthetic differentiation tests as a cognitive functional, only when subjects were asked to differentiate force at the 50% level of maximal grip strength. however, the anova did not showed any significant differences after 15-min swedish massage intervention. the 25% force differentiation test showed that force production error (fpe_25%) demonstrated high individual variability and indicated that this test should be conducted with particular caution in the future. the results of this investigation suggest that massage does not improve the examined parameters ; therefore, it does not constitute a significant component of preparation to a physical activity. on the other hand, massage does not affect the kinesthetic differentiation and it can be safely used before activities which demand high movement precision. the applied swedish massage does not significantly affect the kinesthetic differentiation and the values of maximum force in this particular studied group. | background : swedish massage is one of the common treatments to provide optimal start and readiness of athletes. the ability of kinesthetic differentiation (kd) is crucial in sport performance. this skill allows to adapt demanded muscle forces to optimize the motor tasks, and it is responsible for the precision. in the literature, there is no evidence how swedish massage influences the kinesthetic differentiation.purpose:the objective of the study was to evaluate the impact of swedish massage on the kinesthetic differentiation and muscle strength of hand grip.methods:thirty participants took part in this investigation (17 women and 13 men). the assessment consisted of kd tests conducted on the dominant (dh) and nondominant hand (ndh) after 15 minutes of hand and forearm swedish massage. the procedure consisted of 13 trials for each extremity. the first three were done for 100% of the participants capabilities (fmax), the next five trials were done using 50% of maximum force (50% of fmax), and in the last five trials, the participants tried to use only 50% of their previous force (1/2 of 50%). finally, the absolute force production error (fpe) was calculated for 50% (fpe_50%) and 25% (fpe_25%).results : the two - way repeated measure analysis of variance anova did not reveal any statistically significant changes in maximal strength grip and kd between pre- and postmassage intervention in both dh and ndh hand. correlations showed strong relationship between pre- and postmassage for maximum force (r = 0.92, p =.01 for dh, and r = 0.94, p =.01 for ndh), and only for the fpe_50% (r = 0.67, p =.01 for dh, and r = 0.71, p =.01 for ndh).conclusions : the results obtained indicated that the application of the swedish massage did not affect the kinesthetic differentiation in this particular young adult group. |
peripheral arterial disease and venous disease often coexist and they have common risk factors. if virchow s triad is accepted as a basis for the development of venous thrombosis, peripheral vascular disease has a number of characteristics which are likely to promote venous thrombosis. first, compared to normal subjects, blood flow increased to a lesser extent in patients with peripheral arterial disease during exercise and reactive hyperemia. second, there is an increased concentration of metabolites such as complement c3 and c5, free oxygen radicals and lipid peroxides produced in relation to distal tissue ischaemia which, at least in vitro, upregulate the procoagulant properties of the vascular endothelium. with the use of color duplex ultrasound scanning, veins may be identified and their dimensions may be measured. by analyzing the spectrum of the doppler signal, the velocity can be estimated. to find out how peripheral arterial disease influences deep venous flow in the lower limbs, we undertook a prospective controlled study examining velocity flow in the popliteal vein with color duplex ultrasound scanning. thirty - one subjects who had chronic peripheral arterial disease (24 men and 7 women), were recruited for the study : 19 complained of claudication alone, 18 suffered from rest pain and 21 had gangrene. twenty - three control subjects (16 men and 7 women) without peripheral arterial disease of similar age who were awaiting general surgical procedures were also invited to take part in the study. the presence or absence of peripheral arterial disease was confirmed by the history of the disease and measurement of the ankle - brachial index (abi). patients with deep venous thrombosis, chronic venous insufficiency as well as incompressibility of the leg arteries detected while measuring the abi were excluded. the equipment used was a diasonics ultrasound, coupled with 4mhz transmitted frequency for doppler measurements. venous blood flow velocity was estimated by the ultrasound scanner as time averaged peak velocity. the popliteal vein was chosen as the target for the ultrasound measurements because the anatomical position makes it an easy target for ultrasound examination. in all patients and control subjects a mean of three measurements of the venous flow velocity was recorded, and the average was calculated, at rest. then, a 20 cm wide femoral blood pressure cuff was placed around the thigh and inflated 50 mmhg above the systolic blood pressure for 5 minutes. after the cuff was released, the maximum venous flow velocity were recorded during 60 seconds. this test is flow mediated dilatation or reactive hyperemia. written informed consent was obtained from all participants. statistical analysis. measurements form the patient and control groups were compared with the mann - whitney test. linear correlation analysis was used, and the result was expressed as pearson s correlation coefficient to determine the relationship between paired variables. resting popliteal venous flow velocity did not show a significant difference between subjects with peripheral arterial disease 9.5015.616 cm / sec (3.121.6 95%ci 7.83311.169) and controls 9.2707.858 cm / sec (1.845.7 95%ci 7.30711.233) ; p=0.621, but in limbs with an abi less than 0.9 venous flow velocity was significantly higher 16.55719.656 (2.952.5 95%ci 1.62234.736) than in limbs with an abi of 0.9 or more 12.6735.792 (3.124.7 95%ci 9.4615.81) ; p=0.001. venous flow velocity appeared to be greater among younger subjects, and decreased in elderly subjects (p=0.042) (figure 1) interestingly, resting venous flow velocity appeared to be greater among subjects without dyslipidemia 10.0428.26 cm / sec versus 9.63510.177 in those with dyslipidemia, although this difference did not quite reach statistical significance (p=0.057). furthermore, among patients with peripheral arterial disease there was a negative correlation between dyslipidemia and resting popliteal vein flow velocity (p=0.049). during reactive hyperemia venous flow velocity increased in all subjects, but to a significantly lesser extent in subjects with peripheral arterial disease : 9.5325.665 (7.0719.643 95%ci 2.321.1) versus controls 10.5594.696 (2.711.953 95%ci 10.55918.1) p=0.007. the degree of this velocity showed significant positive correlation with ankle - brachial index (p=0.001). venous flow in reactive hyperemia conditions was not statistically influenced in diabetic subjects and in those with dyslipidemia (p=0.251 versus p=0.908). this study documents the change in venous flow in peripheral arterial disease there are conflicting reports regarding the relationship between deep venous disease and peripheral arterial disease in the lower limbs. we chose the popliteal vein as a representative area for both anatomic and technical reasons. our observations indicate that the deep veins of the lower limb constrict in response to ischemia and the deep venous flow increased. the degree of this constriction is related to the severity of the peripheral arterial disease. during reactive hyperemia, when the hypoxia was augmented by the preceding arterial occlusion, the venous flow increased. healthy endothelium produces a wide range of factors that regulate vascular tone, adhesion of circulating blood cells to the vessel wall, thrombus formation, smooth muscle cell proliferation, and vessel wall inflammation, which is the key mechanism of the thrombosis process. one of the most important functions of the endothelium is its effect on the vascular tone. consequently, some humoral factor related to tissue ischemia must be involved in producing this venoconstriction. perhaps there are change in the endothelial production of nitric oxide or endothelins, which may be responsible for the contraction of the vascular smooth muscle. venous flow velocity decreases with age, which may be attributable in part to decreased nitric oxide release and to diminished smooth muscle cell responsiveness in older subjects. we also observed an increase in resting venous flow velocity among subjects with peripheral vascular disease that was dependent on the severity of the disease. the correlation between ankle - brachial index and venous flow velocity was significant in subjects with peripheral arterial disease. during reactive hyperemia venous flow velocity increases to a lesser extent in subjects with peripheral arterial disease as compared to subjects. reduced venous flow has long been considered to be an important factor in the development of venous thrombosis. it is likely that increased venous flow velocity, resulting from venoconstriction, has an important protective role for the development of deep venous thrombosis. as the activity of the coagulation system is also increased, it is surprising that deep vein thrombosis does not have a higher incidence. future studies as well as investigation of blood coagulation are necessary to show the link bretween peripheral arterial disease and the venous disorder. | aimthis prospective study was undertaken to determine how peripheral atherosclerotic disease influences the flow in the deep veins of the leg.material and methodthirty one subjects with peripheral atherosclerotic disease and 23 age matched control subjects were studied. the popliteal vein flow velocity was measured at rest and during reactive hyperemia by means of color duplex ultrasound scanning. patient age, ankle - brachial index (abi) and the presence of risk factors for venous thrombosis were also recorded.resultsthere was a negative correlation between the ankle - brachial index and venous flow velocity among subjects with peripheral arterial disease (p=0.001). there was a negative correlation between dyslipidemia and resting venous flow velocity (p=0.049). during reactive hyperemia, venous flow velocity increased less in subjects with peripheral arterial disease than it did in control subjects (p=0.007). the subjects with dyslipidemia showed no changes in venous flow velocity in reactive hyperemia measurements (p=0.908).conclusionincreasing the venous flow velocity in peripheral arterial disease, may confer some protection against the deep venous thrombosis. |
it is also called otospongiosis as it is characterised by replacement of the normal ivory - like enchondral bone by spongy vascular bone. patients typically present in the 2nd- 4th decades of life with conductive hearing loss (chl), sensorineural hearing loss (snhl) or mixed hearing loss (mhl) and/or tinnitus. the disease is more common in women and commonly bilateral (85 %). retrofenestral otosclerosis rarely occurs without fenestral involvement ; hence these manifestations are considered to be a continuum rather than two separate entities [14 ]. the more common fenestral type of otosclerosis involves the lateral wall of the bony labyrinth. histologically, demineralised foci of spongy new bone typically occur in the region of the embryonic fissula ante fenestram, which is a cleft of fibrocartilagenous tissue between the inner and middle ear, just anterior to the oval window (fig. 1). the promontory, round window niche and tympanic segment of the facial nerve canal can also be involved [13 ]. the disease gradually extends to involve the entire footplate of the stapes and may subsequently involve the cochlea. heaped - up bony plaques formed in the healing phase typically cause narrowing of the oval and round windows. involvement of the annular ligament leads to mechanical fixation of the stapedo - vestibular joint, which is responsible for the typical chl / audiometric air - bone gap (carhart s notch) [15 ]. complete obliteration of the oval window may occur in 2 % cases (fig. otosclerosis can sometimes present as isolated round window involvement without pericochlear or oval window involvement.fig. 1axial (a) and coronal (b) hrct images of the right temporal bone in an adult patient with right - sided chl. a hypodense demineralised plaque (arrow) is noted in the region of the fissula ante fenestram in keeping with fenestral otosclerosisfig. 2axial hrct images of the right (a) and left (b) temporal bone in an adult patient with bilateral chl. hypodense demineralised plaques (arrows) are noted in bilateral fissula ante fenestram regions in keeping with bilateral fenestral otosclerosisfig. 3axial (a, b) and coronal (c, d) hrct images of the right and left temporal bone in an adult patient with bilateral severe chl. heaped - up bony otosclerotic plaques are noted causing severe bilateral oval window narrowing (arrows) axial (a) and coronal (b) hrct images of the right temporal bone in an adult patient with right - sided chl. a hypodense demineralised plaque (arrow) is noted in the region of the fissula ante fenestram in keeping with fenestral otosclerosis axial hrct images of the right (a) and left (b) temporal bone in an adult patient with bilateral chl. hypodense demineralised plaques (arrows) are noted in bilateral fissula ante fenestram regions in keeping with bilateral fenestral otosclerosis axial (a, b) and coronal (c, d) hrct images of the right and left temporal bone in an adult patient with bilateral severe chl. heaped - up bony otosclerotic plaques are noted causing severe bilateral oval window narrowing (arrows) the classical clinical findings include progressive chl up to about 5060 db, absent stapedial reflexes, a normal tympanic membrane and no evidence of middle ear inflammation [15 ]. the treatment of fenestral otosclerosis is primarily surgical with stapedectomy and stapes prosthesis insertion [15 ]. high - resolution ct (hrct) of the temporal bone is the modality of choice for the preoperative evaluation of otosclerosis. typically, very thin axial sections are obtained on a multidetector ct scanner, followed by axial and coronal reformats, respectively in the plane of and perpendicular to the lateral semicircular canal. if needed, additional reformats can be made, for example along the plane of the stapedial suprastructure. all studies are performed without contrast and the entire petrous temporal bone is included in the sections. demineralised hypodense fenestral otosclerotic foci are best seen on axial hrct because of the anteroposterior orientation of the oval window and stapes crura. fenestral otosclerotic foci as small as 1 mm in size can be diagnosed on hrct [15 ]. some authors have mentioned a correlation between the size of the fenestral otosclerotic focus and the air - bone gap. apart from assessing the size and location of plaques and the narrowing of the oval window, the radiologist must evaluate the status of the round window, facial nerve canal, jugular bulb, middle ear cavity, ossicular chain and inner ear. obliteration of the round window by the otosclerotic process may reduce the efficacy of stapedectomy and must be mentioned in the report (fig. 4) [13 ]. other or associated causes of chl and snhl must be ruled out prior to surgery. these include congenital ossicular fusion, ossicular discontinuity (fig. 5), inflammatory middle ear disease (fig. 6) and inner ear pathology such as acoustic neuroma and labyrinthitis ossificans. table 1 describes a recommended checklist for reporting preoperative hrct of the temporal bone with clinical and surgical relevance of each of the points.fig. 4axial hrct images of the right (a) and left (b) temporal bone in a patient with bilateral fenestral otosclerosis. otosclerotic plaques are noted causing bilateral round window narrowing (arrows), right more than leftfig. 5a axial hrct image of the right temporal bone in an adult patient with progressive right - sided chl and remote history of ipsilateral head injury. a hypodense demineralised otosclerotic plaque (arrow) is noted in the fissula ante fenestram. b axial hrct image of the same patient as (a) at a slightly higher level. there is also evidence of malleo - incudal dislocation (arrow)fig. 6axial (a) and coronal (b) hrct images of the left temporal bone in an adult patient with left - sided chl and previous history of left - sided otitis media. the soft - tissue density noted in the attic (asterisk) causing blunting of the scutum (arrow) is in favour of a cholesteatoma. in addition, a tiny hypodense fenestral otosclerotic focus (arrowheads) is noted anterior to the oval windowtable 1reporting checklist for preoperative hrct of the temporal bone in otosclerosisreporting pointsclinical and surgical relevance1.size and location of plaquessize and location of plaques may correlate with severity of chl / air - bone gap2.status of oval windowcomplete obliteration may require surgical drilling prior to prosthesis insertion3.status of round windowobliteration may result in a poor result after stapedectomy4.facial nerve canalfloppy facial nerve may complicate oval window surgery or render this impossible5.concurrent middle ear pathologyinflammatory disease must be treated prior to surgery6.ossicular chain integrityossicular fixation, fusion and fracture may compound chl7.sinus plate and jugular bulbdehiscent jugular bulb may complicate surgery8.inner ear pathologycongenital cochlear and inner ear anomalies may preclude surgery9.opposite eardisease is bilateral in 80 - 85 % cases, even in absence of symptoms axial hrct images of the right (a) and left (b) temporal bone in a patient with bilateral fenestral otosclerosis. otosclerotic plaques are noted causing bilateral round window narrowing (arrows), right more than left a axial hrct image of the right temporal bone in an adult patient with progressive right - sided chl and remote history of ipsilateral head injury. a hypodense demineralised otosclerotic plaque (arrow) is noted in the fissula ante fenestram. b axial hrct image of the same patient as (a) at a slightly higher level. there is also evidence of malleo - incudal dislocation (arrow) axial (a) and coronal (b) hrct images of the left temporal bone in an adult patient with left - sided chl and previous history of left - sided otitis media. the soft - tissue density noted in the attic (asterisk) causing blunting of the scutum (arrow) is in favour of a cholesteatoma. in addition, a tiny hypodense fenestral otosclerotic focus (arrowheads) is noted anterior to the oval window reporting checklist for preoperative hrct of the temporal bone in otosclerosis false - negative ct findings may occur in some cases of fenestral otosclerosis in the sclerotic phase when there are no irregularities of the bone contour. the cochlear cleft is a small non - osseous space in the otic capsule in the region of the fissula ante fenestram. it is a normal variant, commonly seen in children, and its incidence decreases with age. an inexperienced reader may mistake a cochlear cleft for a demineralised focus in the region of the fissula ante fenestram (fig. tympanosclerois with post - inflammatory fixation of the stapes footplate may present clinically with identical chl, especially with a healed tympanic membrane. this may cause a diagnostic dilemma in certain cases, although, this can be differentiated on ct by observing signs of inflammation in the middle ear and an underpneumatised mastoid [2, 3].fig. 7axial (a) and coronal (b) hrct images of the right temporal bone in a child with suspected left snhl. the small lucency seen around the cochlea (arrow) on both the axial and coronal images is in keeping with a cochlear cleft (normal variant) axial (a) and coronal (b) hrct images of the right temporal bone in a child with suspected left snhl. the small lucency seen around the cochlea (arrow) on both the axial and coronal images is in keeping with a cochlear cleft (normal variant) stapedectomy is commonly combined with insertion of a stapes prosthesis in order to restore ossicular chain continuity. the use of a radiodense stapes prosthesis helps radiological evaluation on hrct (fig. the common causes for recurrent chl, vertigo and snhl after stapes surgery include complete displacement of the prosthesis (fig. 9), prosthesis displacement into the vestibule (fig. 10), perilymphatic fistula, and development of reparative granulomas and labyrinthitis (fig. 11) hrct helps to evaluate the position of the prosthesis and rule out common complications. mri can rule out fibrotic changes in the labyrinth while ossifications are diagnosed exclusively by ct [2, 3, 810 ]. repeat surgery may be mandatory for treatment of a dislocated prosthesis or closure of a perilymph fistula [810].fig. 8axial (a) and coronal (b) hrct images of the right temporal bone in a patient with stapedectomy. the radiodense stapes prosthesis is well positioned with its distal end against the oval windowfig. 9axial (a) and coronal (b) hrct images of the left temporal bone in a patient with persistent chl, post stapedectomy. the stapes prosthesis (arrow) is dislocated posteriorly in relation to the oval window (arrowhead) with complete loss of contactfig. 10para - axial hrct image of the left temporal bone in a patient with severe vertigo, post stapedectomy. 11para - coronal (a) and para - axial (b) hrct images of the left temporal bone in a patient with persistent vertigo and left - sided snhl after left stapedectomy. however a small sclerotic focus is seen within the vestibule (arrowheads) in keeping with labyrinthitis ossificans. a small fenestral otosclerotic focus (dashed arrow) is seen in the para - axial view axial (a) and coronal (b) hrct images of the right temporal bone in a patient with stapedectomy. the radiodense stapes prosthesis is well positioned with its distal end against the oval window axial (a) and coronal (b) hrct images of the left temporal bone in a patient with persistent chl, post stapedectomy. the stapes prosthesis (arrow) is dislocated posteriorly in relation to the oval window (arrowhead) with complete loss of contact para - axial hrct image of the left temporal bone in a patient with severe vertigo, post stapedectomy. the stapes prosthesis is dislocated and lies partly within the vestibule (arrow) para - coronal (a) and para - axial (b) hrct images of the left temporal bone in a patient with persistent vertigo and left - sided snhl after left stapedectomy. however a small sclerotic focus is seen within the vestibule (arrowheads) in keeping with labyrinthitis ossificans. a small fenestral otosclerotic focus (dashed arrow) the more common fenestral type of otosclerosis involves the lateral wall of the bony labyrinth. histologically, demineralised foci of spongy new bone typically occur in the region of the embryonic fissula ante fenestram, which is a cleft of fibrocartilagenous tissue between the inner and middle ear, just anterior to the oval window (fig. 1). the promontory, round window niche and tympanic segment of the facial nerve canal can also be involved [13 ]. the disease gradually extends to involve the entire footplate of the stapes and may subsequently involve the cochlea. heaped - up bony plaques formed in the healing phase typically cause narrowing of the oval and round windows. involvement of the annular ligament leads to mechanical fixation of the stapedo - vestibular joint, which is responsible for the typical chl / audiometric air - bone gap (carhart s notch) [15 ]. complete obliteration of the oval window may occur in 2 % cases (fig. otosclerosis can sometimes present as isolated round window involvement without pericochlear or oval window involvement.fig. 1axial (a) and coronal (b) hrct images of the right temporal bone in an adult patient with right - sided chl. a hypodense demineralised plaque (arrow) is noted in the region of the fissula ante fenestram in keeping with fenestral otosclerosisfig. 2axial hrct images of the right (a) and left (b) temporal bone in an adult patient with bilateral chl. hypodense demineralised plaques (arrows) are noted in bilateral fissula ante fenestram regions in keeping with bilateral fenestral otosclerosisfig. 3axial (a, b) and coronal (c, d) hrct images of the right and left temporal bone in an adult patient with bilateral severe chl. heaped - up bony otosclerotic plaques are noted causing severe bilateral oval window narrowing (arrows) axial (a) and coronal (b) hrct images of the right temporal bone in an adult patient with right - sided chl. a hypodense demineralised plaque (arrow) is noted in the region of the fissula ante fenestram in keeping with fenestral otosclerosis axial hrct images of the right (a) and left (b) temporal bone in an adult patient with bilateral chl. hypodense demineralised plaques (arrows) are noted in bilateral fissula ante fenestram regions in keeping with bilateral fenestral otosclerosis axial (a, b) and coronal (c, d) hrct images of the right and left temporal bone in an adult patient with bilateral severe chl. heaped - up bony otosclerotic plaques are noted causing severe bilateral oval window narrowing (arrows) the classical clinical findings include progressive chl up to about 5060 db, absent stapedial reflexes, a normal tympanic membrane and no evidence of middle ear inflammation [15 ]. the treatment of fenestral otosclerosis is primarily surgical with stapedectomy and stapes prosthesis insertion [15 ]. high - resolution ct (hrct) of the temporal bone is the modality of choice for the preoperative evaluation of otosclerosis. typically, very thin axial sections are obtained on a multidetector ct scanner, followed by axial and coronal reformats, respectively in the plane of and perpendicular to the lateral semicircular canal. if needed, additional reformats can be made, for example along the plane of the stapedial suprastructure. all studies are performed without contrast and the entire petrous temporal bone is included in the sections. demineralised hypodense fenestral otosclerotic foci are best seen on axial hrct because of the anteroposterior orientation of the oval window and stapes crura. fenestral otosclerotic foci as small as 1 mm in size can be diagnosed on hrct [15 ]. some authors have mentioned a correlation between the size of the fenestral otosclerotic focus and the air - bone gap. apart from assessing the size and location of plaques and the narrowing of the oval window, the radiologist must evaluate the status of the round window, facial nerve canal, jugular bulb, middle ear cavity, ossicular chain and inner ear. obliteration of the round window by the otosclerotic process may reduce the efficacy of stapedectomy and must be mentioned in the report (fig. 4) [13 ]. other or associated causes of chl and snhl must be ruled out prior to surgery. these include congenital ossicular fusion, ossicular discontinuity (fig. 5), inflammatory middle ear disease (fig. 6) and inner ear pathology such as acoustic neuroma and labyrinthitis ossificans. table 1 describes a recommended checklist for reporting preoperative hrct of the temporal bone with clinical and surgical relevance of each of the points.fig. 4axial hrct images of the right (a) and left (b) temporal bone in a patient with bilateral fenestral otosclerosis. otosclerotic plaques are noted causing bilateral round window narrowing (arrows), right more than leftfig. 5a axial hrct image of the right temporal bone in an adult patient with progressive right - sided chl and remote history of ipsilateral head injury. a hypodense demineralised otosclerotic plaque (arrow) is noted in the fissula ante fenestram. b axial hrct image of the same patient as (a) at a slightly higher level. there is also evidence of malleo - incudal dislocation (arrow)fig. 6axial (a) and coronal (b) hrct images of the left temporal bone in an adult patient with left - sided chl and previous history of left - sided otitis media. the soft - tissue density noted in the attic (asterisk) causing blunting of the scutum (arrow) is in favour of a cholesteatoma. in addition, a tiny hypodense fenestral otosclerotic focus (arrowheads) is noted anterior to the oval windowtable 1reporting checklist for preoperative hrct of the temporal bone in otosclerosisreporting pointsclinical and surgical relevance1.size and location of plaquessize and location of plaques may correlate with severity of chl / air - bone gap2.status of oval windowcomplete obliteration may require surgical drilling prior to prosthesis insertion3.status of round windowobliteration may result in a poor result after stapedectomy4.facial nerve canalfloppy facial nerve may complicate oval window surgery or render this impossible5.concurrent middle ear pathologyinflammatory disease must be treated prior to surgery6.ossicular chain integrityossicular fixation, fusion and fracture may compound chl7.sinus plate and jugular bulbdehiscent jugular bulb may complicate surgery8.inner ear pathologycongenital cochlear and inner ear anomalies may preclude surgery9.opposite eardisease is bilateral in 80 - 85 % cases, even in absence of symptoms axial hrct images of the right (a) and left (b) temporal bone in a patient with bilateral fenestral otosclerosis. otosclerotic plaques are noted causing bilateral round window narrowing (arrows), right more than left a axial hrct image of the right temporal bone in an adult patient with progressive right - sided chl and remote history of ipsilateral head injury. a hypodense demineralised otosclerotic plaque (arrow) is noted in the fissula ante fenestram. b axial hrct image of the same patient as (a) at a slightly higher level. there is also evidence of malleo - incudal dislocation (arrow) axial (a) and coronal (b) hrct images of the left temporal bone in an adult patient with left - sided chl and previous history of left - sided otitis media. the soft - tissue density noted in the attic (asterisk) causing blunting of the scutum (arrow) is in favour of a cholesteatoma. in addition, a tiny hypodense fenestral otosclerotic focus (arrowheads) is noted anterior to the oval window reporting checklist for preoperative hrct of the temporal bone in otosclerosis false - negative ct findings may occur in some cases of fenestral otosclerosis in the sclerotic phase when there are no irregularities of the bone contour. the cochlear cleft is a small non - osseous space in the otic capsule in the region of the fissula ante fenestram. it is a normal variant, commonly seen in children, and its incidence decreases with age. an inexperienced reader may mistake a cochlear cleft for a demineralised focus in the region of the fissula ante fenestram (fig. tympanosclerois with post - inflammatory fixation of the stapes footplate may present clinically with identical chl, especially with a healed tympanic membrane. this may cause a diagnostic dilemma in certain cases, although, this can be differentiated on ct by observing signs of inflammation in the middle ear and an underpneumatised mastoid [2, 3].fig. 7axial (a) and coronal (b) hrct images of the right temporal bone in a child with suspected left snhl. the small lucency seen around the cochlea (arrow) on both the axial and coronal images is in keeping with a cochlear cleft (normal variant) axial (a) and coronal (b) hrct images of the right temporal bone in a child with suspected left snhl. the small lucency seen around the cochlea (arrow) on both the axial and coronal images is in keeping with a cochlear cleft (normal variant) stapedectomy is commonly combined with insertion of a stapes prosthesis in order to restore ossicular chain continuity. the use of a radiodense stapes prosthesis helps radiological evaluation on hrct (fig. the common causes for recurrent chl, vertigo and snhl after stapes surgery include complete displacement of the prosthesis (fig. 9), prosthesis displacement into the vestibule (fig. 10), perilymphatic fistula, and development of reparative granulomas and labyrinthitis (fig. 11) hrct helps to evaluate the position of the prosthesis and rule out common complications. mri can rule out fibrotic changes in the labyrinth while ossifications are diagnosed exclusively by ct [2, 3, 810 ]. repeat surgery may be mandatory for treatment of a dislocated prosthesis or closure of a perilymph fistula [810].fig. 8axial (a) and coronal (b) hrct images of the right temporal bone in a patient with stapedectomy. the radiodense stapes prosthesis is well positioned with its distal end against the oval windowfig. 9axial (a) and coronal (b) hrct images of the left temporal bone in a patient with persistent chl, post stapedectomy. the stapes prosthesis (arrow) is dislocated posteriorly in relation to the oval window (arrowhead) with complete loss of contactfig. 10para - axial hrct image of the left temporal bone in a patient with severe vertigo, post stapedectomy. 11para - coronal (a) and para - axial (b) hrct images of the left temporal bone in a patient with persistent vertigo and left - sided snhl after left stapedectomy. however a small sclerotic focus is seen within the vestibule (arrowheads) in keeping with labyrinthitis ossificans. a small fenestral otosclerotic focus (dashed arrow) is seen in the para - axial view axial (a) and coronal (b) hrct images of the right temporal bone in a patient with stapedectomy. the radiodense stapes prosthesis is well positioned with its distal end against the oval window axial (a) and coronal (b) hrct images of the left temporal bone in a patient with persistent chl, post stapedectomy. the stapes prosthesis (arrow) is dislocated posteriorly in relation to the oval window (arrowhead) with complete loss of contact para - axial hrct image of the left temporal bone in a patient with severe vertigo, post stapedectomy. the stapes prosthesis is dislocated and lies partly within the vestibule (arrow) para - coronal (a) and para - axial (b) hrct images of the left temporal bone in a patient with persistent vertigo and left - sided snhl after left stapedectomy. however a small sclerotic focus is seen within the vestibule (arrowheads) in keeping with labyrinthitis ossificans. a small fenestral otosclerotic focus (dashed arrow) retrofenestral or cochlear otosclerosis is much less common ; however, it is nearly always associated with fenestral otosclerosis. histologically, foci of demineralised spongy vascular bone are seen in the cochlear capsule, which may extend around the vestibule, semicircular canals and internal auditory canal. the promontory may show a pink hue when seen through the tympanic membrane, called the schwartze sign. direct injury to the cochlea and spiral ligament due to the lytic process or release of proteolytic enzymes is implicated as a possible cause for the snhl [14 ]. the classical imaging appearance of cochlear otosclerosis on hrct is a distinctive pericochlear hypodense double ring (which is also known as the 4th ring of valvassori) (fig. a ct grading of otosclerosis has been proposed by symons / fanning and is described in table 2. some authors mention that the severity of cochlear disease correlates with early onset as well as increasing severity of snhl. at times a ring of pericochlear and perilabyrinthine intermediate signal on t1-weighted images and mild - moderate post - gadolinium enhancement has been reported in cochlear otosclerosis, more so in the active phase (fig. the hrct appearance of cochlear otosclerosis is rarely mimicked by various diseases that demineralise the otic capsule, including osteogenesis imperfecta (fig. however the clinical manifestations and involvement of other bones suffice to differentiate these pathological conditions from cochlear otosclerosis [24, 11, 13].fig. 12axial hrct images of the right (a) and left (b) temporal bone in an adult patient with severe bilateral snhl. double ring (arrow) is in keeping with bilateral cochlear otosclerosistable 2ct grading of otosclerosis (symons / fanning 2005)ct grading of otosclerosislocation of plaquesgrade 1solely fenestralgrade 2patchy localised cochlear disease (+ / fenestral involvement) to basal turn (grade 2a) to middle turn (grade 2b) around lateral aspect of basal, middle, apical turns (grade 2c)grade 3diffuse confluent cochlear involvement (+ / fenestral involvement)fig. 13coronal contrast - enhanced mr image in a patient with left - sided snhl. bilateral pericochlear ring - like enhancement (arrow) 14a axial ciss mr image of the skull base in an adult patient with left - sided snhl. a small hypointense filling defect is seen in the left internal auditory canal (arrowhead), which may be suggestive of an acoustic neuroma. b axial contrast - enhanced mr image of the same patient as (a), at the same level. the previously noted filling defect in the left internal auditory canal shows post - contrast enhancement, which indicates a small acoustic neuroma (arrowhead). there is also a suggestion of enhancement in the left pericochlear region and in the region of the left fissula ante fenestram (arrow), which suggests associated otosclerosis is presentfig. 15axial hrct images of the right (a) and left (b) temporal bone in a young adult with known osteogenesis imperfecta tarda and bilateral snhl. 16axial hrct of the skull base in an adult patient with known paget s disease. the hypodense appearance of bilateral otic capsules (arrows) may mimic otosclerosis ; however the diffuse skull base involvement indicates the true pathology axial hrct images of the right (a) and left (b) temporal bone in an adult patient with severe bilateral snhl. the bilateral pericochlear hypodense double ring (arrow) is in keeping with bilateral cochlear otosclerosis ct grading of otosclerosis (symons / fanning 2005) coronal contrast - enhanced mr image in a patient with left - sided snhl. bilateral pericochlear ring - like enhancement (arrow) is suggestive of bilateral cochlear otosclerosis, which was further proven by hrct a axial ciss mr image of the skull base in an adult patient with left - sided snhl. a small hypointense filling defect is seen in the left internal auditory canal (arrowhead), which may be suggestive of an acoustic neuroma. b axial contrast - enhanced mr image of the same patient as (a), at the same level. the previously noted filling defect in the left internal auditory canal shows post - contrast enhancement, which indicates a small acoustic neuroma (arrowhead). there is also a suggestion of enhancement in the left pericochlear region and in the region of the left fissula ante fenestram (arrow), which suggests associated otosclerosis is present axial hrct images of the right (a) and left (b) temporal bone in a young adult with known osteogenesis imperfecta tarda and bilateral snhl. bilateral pericochlear ring - like hypodensity (arrows) closely mimics cochlear otosclerosis axial hrct of the skull base in an adult patient with known paget s disease. the hypodense appearance of bilateral otic capsules (arrows) may mimic otosclerosis ; however the diffuse skull base involvement indicates the true pathology new bone formation (membranous labyrinth ossification) is unusual with cochlear otosclerosis and is invariably limited to the basal turn of the cochlea [2, 14, 15 ]. 17a axial hrct of the right temporal bone in a patient with known bilateral cochlear otosclerosis. there is almost complete obliteration of the basal turn of the right cochlea (arrow) by the otosclerotic process. b axial mri of the temporal bones in the same patient as (17a) at the level of the cochlea. there is significant obliteration of the fluid space in the basal turn of the right cochlea (arrow). the normal fluid space in the basal turn of the left cochlea (arrowhead) is shown for comparison a axial hrct of the right temporal bone in a patient with known bilateral cochlear otosclerosis. there is almost complete obliteration of the basal turn of the right cochlea (arrow) by the otosclerotic process. b axial mri of the temporal bones in the same patient as (17a) at the level of the cochlea. there is significant obliteration of the fluid space in the basal turn of the right cochlea (arrow). the normal fluid space in the basal turn of the left cochlea (arrowhead) is shown for comparison patients with cochlear otosclerosis are usually treated medically using fluorides [2, 3, 5, 11, 16 ]. fluoride therapy may limit the growth of active otosclerotic foci and thereby prevent progression of snhl. however patients with bilateral profound snhl may derive significant benefit from ci [24, 14, 15 ]. there is high risk of partial insertion and misplacement of electrode arrays requiring revision surgery. this is ascribed to the ossification of the scala tympani in the basal turn of the cochlea [14, 15 ]. retrofenestral or cochlear otosclerosis is much less common ; however, it is nearly always associated with fenestral otosclerosis. histologically, foci of demineralised spongy vascular bone are seen in the cochlear capsule, which may extend around the vestibule, semicircular canals and internal auditory canal. the promontory may show a pink hue when seen through the tympanic membrane, called the schwartze sign. direct injury to the cochlea and spiral ligament due to the lytic process or release of proteolytic enzymes is implicated as a possible cause for the snhl [14 ]. the classical imaging appearance of cochlear otosclerosis on hrct is a distinctive pericochlear hypodense double ring (which is also known as the 4th ring of valvassori) (fig. a ct grading of otosclerosis has been proposed by symons / fanning and is described in table 2. some authors mention that the severity of cochlear disease correlates with early onset as well as increasing severity of snhl. at times a ring of pericochlear and perilabyrinthine intermediate signal on t1-weighted images and mild - moderate post - gadolinium enhancement has been reported in cochlear otosclerosis, more so in the active phase (fig. the hrct appearance of cochlear otosclerosis is rarely mimicked by various diseases that demineralise the otic capsule, including osteogenesis imperfecta (fig. however the clinical manifestations and involvement of other bones suffice to differentiate these pathological conditions from cochlear otosclerosis [24, 11, 13].fig. 12axial hrct images of the right (a) and left (b) temporal bone in an adult patient with severe bilateral snhl. double ring (arrow) is in keeping with bilateral cochlear otosclerosistable 2ct grading of otosclerosis (symons / fanning 2005)ct grading of otosclerosislocation of plaquesgrade 1solely fenestralgrade 2patchy localised cochlear disease (+ / fenestral involvement) to basal turn (grade 2a) to middle turn (grade 2b) around lateral aspect of basal, middle, apical turns (grade 2c)grade 3diffuse confluent cochlear involvement (+ / fenestral involvement)fig. 13coronal contrast - enhanced mr image in a patient with left - sided snhl. bilateral pericochlear ring - like enhancement (arrow) 14a axial ciss mr image of the skull base in an adult patient with left - sided snhl. a small hypointense filling defect is seen in the left internal auditory canal (arrowhead), which may be suggestive of an acoustic neuroma. b axial contrast - enhanced mr image of the same patient as (a), at the same level. the previously noted filling defect in the left internal auditory canal shows post - contrast enhancement, which indicates a small acoustic neuroma (arrowhead). there is also a suggestion of enhancement in the left pericochlear region and in the region of the left fissula ante fenestram (arrow), which suggests associated otosclerosis is presentfig. 15axial hrct images of the right (a) and left (b) temporal bone in a young adult with known osteogenesis imperfecta tarda and bilateral snhl. 16axial hrct of the skull base in an adult patient with known paget s disease. the hypodense appearance of bilateral otic capsules (arrows) may mimic otosclerosis ; however the diffuse skull base involvement indicates the true pathology axial hrct images of the right (a) and left (b) temporal bone in an adult patient with severe bilateral snhl. the bilateral pericochlear hypodense double ring (arrow) is in keeping with bilateral cochlear otosclerosis ct grading of otosclerosis (symons / fanning 2005) coronal contrast - enhanced mr image in a patient with left - sided snhl. bilateral pericochlear ring - like enhancement (arrow) is suggestive of bilateral cochlear otosclerosis, which was further proven by hrct a axial ciss mr image of the skull base in an adult patient with left - sided snhl. a small hypointense filling defect is seen in the left internal auditory canal (arrowhead), which may be suggestive of an acoustic neuroma. b axial contrast - enhanced mr image of the same patient as (a), at the same level. the previously noted filling defect in the left internal auditory canal shows post - contrast enhancement, which indicates a small acoustic neuroma (arrowhead). there is also a suggestion of enhancement in the left pericochlear region and in the region of the left fissula ante fenestram (arrow), which suggests associated otosclerosis is present axial hrct images of the right (a) and left (b) temporal bone in a young adult with known osteogenesis imperfecta tarda and bilateral snhl. bilateral pericochlear ring - like hypodensity (arrows) closely mimics cochlear otosclerosis axial hrct of the skull base in an adult patient with known paget s disease. the hypodense appearance of bilateral otic capsules (arrows) may mimic otosclerosis ; however the diffuse skull base involvement indicates the true pathology new bone formation (membranous labyrinth ossification) is unusual with cochlear otosclerosis and is invariably limited to the basal turn of the cochlea [2, 14, 15 ]. 17a axial hrct of the right temporal bone in a patient with known bilateral cochlear otosclerosis. there is almost complete obliteration of the basal turn of the right cochlea (arrow) by the otosclerotic process. b axial mri of the temporal bones in the same patient as (17a) at the level of the cochlea. there is significant obliteration of the fluid space in the basal turn of the right cochlea (arrow). the normal fluid space in the basal turn of the left cochlea (arrowhead) is shown for comparison a axial hrct of the right temporal bone in a patient with known bilateral cochlear otosclerosis. there is almost complete obliteration of the basal turn of the right cochlea (arrow) by the otosclerotic process. b axial mri of the temporal bones in the same patient as (17a) at the level of the cochlea. there is significant obliteration of the fluid space in the basal turn of the right cochlea (arrow). the normal fluid space in the basal turn of the left cochlea (arrowhead) is shown for comparison patients with cochlear otosclerosis are usually treated medically using fluorides [2, 3, 5, 11, 16 ]. fluoride therapy may limit the growth of active otosclerotic foci and thereby prevent progression of snhl. however patients with bilateral profound snhl may derive significant benefit from ci [24, 14, 15 ]. there is high risk of partial insertion and misplacement of electrode arrays requiring revision surgery. this is ascribed to the ossification of the scala tympani in the basal turn of the cochlea [14, 15 ]. this article aims to serve as a concise review of the pathology and common imaging appearances of otosclerosis, imaging mimics and certain uncommon postoperative appearances and complications associated with otosclerosis. | otosclerosis is an otodystrophy of the otic capsule and is a cause of conductive, mixed or sensorineural hearing loss in the 2nd to 4th decades of life. otosclerosis is categorised into two types, fenestral and retrofenestral. imaging plays an important role in the diagnosis and management of otosclerosis. high - resolution ct (hrct) of the temporal bone using 1-mm (or less) thick sections is the modality of choice for assessment of the labyrinthine windows and cochlear capsules. mri has limited application in the evaluation of the labyrinthine capsules but is useful for assessment of the cochlear lumen prior to cochlear implantation in patients with profound hearing loss. the treatment of fenestral otosclerosis is primarily surgical with stapedectomy and prosthesis insertion. patients with retrofenestral otosclerosis and profound hearing loss are treated medically using fluorides, but may derive significant benefit from cochlear implantation. this pictorial review aims to acquaint the reader with the pathology and clinical features of otosclerosis, the classical imaging appearances on ct and mri, a radiological checklist for preoperative ct evaluation of otosclerosis, imaging mimics and a few examples of post - stapedectomy imaging and complications.teaching points otosclerosis causes conductive, sensorineural and mixed hearing loss in adults. hrct of the temporal bone is the diagnostic imaging modality of choice. stapedectomy is used to treat fenestral otosclerosis. fluorides and cochlear implantation are used to treat retrofenestral otosclerosis. |
the pathogenic events taking place on the surface of medical devices are primarily associated with the presence of microorganisms and their biofilms [1, 2 ]. a biofilm is an intricate community of microorganisms embedded in a polysaccharide matrix, capable of attaching onto different kinds of surfaces developing a hard - to - eradicate infection. the adhesion of bacteria onto a surface (biological or artificial) depends on biophysical properties, such as wettability and/or electrostatic forces, and the production of specific factors such as polysaccharide intercellular adhesins that create links between the bacteria themselves and bacteria surface. microorganisms reach the implanted medical devices during or immediately after orthopedic surgery, thus leading to further complications. among postoperative problems, infections caused by s. aureus arise from the worst prognosis the ability of this microorganism to adhere to foreign bodies forming biofilms. strategies have been developed to prevent biofilm formation after surgery by surface modification of biomaterials which in turn should modify the bacterial adherence or the load and release of broad - spectrum antibiotics from the biomaterials, thus eliminating the incipient colonization [7, 8 ]. when antibiotics are used, they can be embedded, absorbed into the material structure, or adsorbed on to the biomaterial surface [7, 8 ]. the antibiotic release from the biomaterial must be sufficient to maintain the local concentration above the minimal inhibitory concentration (mic) value during a sufficient period of time [912 ]. several studies aimed at the prevention of colonization and biofilm formation in biomaterials for implants have been reported. while postoperative osteomyelitis is still an important problem in orthopedic and dental clinical practice, studies on already formed biofilm treatments are much more limited. biomorphic silicon carbide (biosic) is a ceramic material obtained from natural resources with good mechanical properties, high biocompatibility, and osteoconductivity [1517 ]. biosics have a smart hierarchical porous microstructure (pore size distribution, pore orientation, and total porosity) widely determined by the material used as wood cellulosic preform. in addition, the molten silicon infiltration, characteristic of its manufacturing process, produces a material with a close to the bone young 's modulus [18, 19 ]. on this basis, biosic has been proposed as a candidate material for the production of bone substitutes able to prevent the loss of bone characteristic of other implants made with materials of greater strength and a porous microstructure adequate to load and release antibiotics. in a previous paper we have demonstrated the capacity of biosic from sapelli wood to load and release vancomycin, inhibiting bacterial adherence and preventing biofilm formation. the present work aims at extending this previous study to get an insight into new utilities of biosics as bone replacement materials. to the best of our knowledge the suitability of biomorphic silicon carbides to treat already formed biofilms has not been verified yet. we have included biosics from a variety of precursors and therefore different surface and microstructural characteristics, in order to establish any possible differences in its behavior, when the use of these antibiotic loaded biosics for preventing or treating s. aureus biofilms is intended. disks of biosic (6 mm 2 mm) from wood precursors with different microstructures were obtained, pine (pinus pinaster), oak (quercus robur), and sapelli (entandrophragma cylindricum), as previously reported by gonzlez and coworkers. the wood was dried at 60c during 24 hours, followed by pyrolysis at 1000c in nitrogen atmosphere. the carbon preform obtained was then infiltrated with molten silicon in vacuum at 1550c for 30 minutes. the material density was determined, in triplicate, using a helium - air pycnometer (quantachrome mod. the pore size distribution was evaluated by mercury intrusion porosimetry (micromeritics autopore iv 9500, norcross, ga, usa) using a 3 ml penetrometer for solids. the specific surface area was evaluated by adsorption of nitrogen using the brunauer - emmett - teller (bet) method. samples were exposed to n2 gas at 77 k and 0.010.98 relative pressure using an automatic surface area analyzer (micromeritics asap 2000, usa). biosic disks morphology was characterized by scanning electron microscopy (sem philips xl 30). vancomycin solutions (42.5 and 85 mg / ml) were prepared by direct dissolution of vancomycin hydrochloride (fagron bach : 06l2101) in ultrapure water. fixed volumes of each solution (30 l) were added on to the disks. dried drug - loaded disks were transferred to vials containing 1 ml of phosphate buffer saline (pbs) ph 7.4 at 37c and maintained under mechanical shaking. the vancomycin concentration was evaluated spectrophotometrically at 280 nm (agilent 8453, germany). staphylococcus aureus atcc 292135 was purchased from the spanish collection of type cultures (cect), cultured in brain infusion broth (liofilchem, italy) overnight at 37c in atmospheric conditions, adjusted to 0.5 mcfarland units, and used to inoculate mueller - hinton agar (mha) plates. immediately, dried vancomycin loaded disks were centered on the inoculated mha plates, incubated for 24 hours aerobically at 37c, and then the inhibition halos were measured. once the halos were measured, the disks were transferred to freshly inoculated mha plates, as reported before. we have analyzed the release of vancomycin from the three types of samples in different media in order to compare the behavior of different biosics in loading and releasing antibiotics and to confirm their utility in preventing s. aureus growth and also treating already formed s. aureus biofilm. biofilms of s. aureus were induced on cellulose nitrate membrane filters according to that described by other authors with some protocol modifications [21, 22 ]. aliquots (15 l) of an overnight culture of s. aureus grown in brain heart infusion broth (0.5 mcfarland) were seeded onto cellulose nitrate membrane filters (13.0 mm diameter, 0.22 m pore diameter ; millipore, usa) previously situated on mha plates. seeded membrane filters on mha plates were incubated for 1 day at 37c in atmospheric conditions. biosic - vancomycin disks (dose = 2.54 mg) were placed in the center of the membranes containing the biofilm and incubated at 37c. unloaded biosic disks (control1) and sterile paper disks impregnated with 20 l of a standard vancomycin solution used in microbiological studies (control2) (1.5 mg / ml) were used as controls. after incubation for 24 or 48 hours, the dried biosic - vancomycin disks and controls were carefully removed, and the treated biofilms were then washed with 5 ml of phosphate buffer saline (pbs) (ph 7.4) to eliminate nonadherent cells, finally transferred to a vial containing 5 ml of pbs (ph 7.4), and vigorously vortexed for 1 minute to suspend adhered cells. aliquots (50 l) of each dilution were seeded onto mha plates, and the colony forming units (cfus) were counted after 48 hours of incubation at 37c in atmospheric conditions. this protocol minimized residual activity of the antibiotic. alternatively, induced biofilms, treated with loaded biosics, and controls were directly studied after gold coating using sem (zeiss evo ls 15, germany). statistical significant differences between treatments were evaluated by analysis of variance (anova) and fisher 's least significant difference (lsd) using statgraphics x64 software. trees are classified into two main groups, softwoods and hardwoods. for the study we have included three wood materials, one softwood, pine, and two hardwoods, oak and sapelli. morphological characterization of biosic from those different precursors was carried out by sem micrographs of the transverse surface of material pieces (figure 1). the major difference between the anatomy of hardwoods and softwoods is the lack of vessels in softwood which are substituted in this type of tree by smaller tracheids (550 m) to conduct the fluid in the trunk. this anatomical peculiarity is the origin of the variations in mechanical properties between softwood and hardwood. as it can be seen, the variations in the internal structures and distribution of vessels, fibers, and rays of the precursors can be still detected after the infiltration of molten silicon. pine biosic shows a roughness surface with small external pores while oak and sapelli biosics present open external pores bigger than 100 m. mercury intrusion porosimetry results corroborate those observations (figure 2 and table 1) and also point out differences between the hardwoods selected. pine wood gives the material with the highest porosity (46.97% 5.43) characterized by numerous interconnected mesopores in the range 110 microns (figure 2(a)). oak wood results in the biosic of the lowest total porosity (27.85% 2.99) and density and the highest specific surface characterized by a bimodal pore distribution including the presence of an important number of macropores (figure 2(b)) (mean diameter 141 35 m). sapelli biosic results (figure 2(c)) are characteristic of a high porous material (40.72% 1.06) with a bimodal pore size distribution with macropores (mean diameter 88 31 m) and mesopores (mean diameter 3.1 1.6 m). the agreement between the sapelli biosic outcomes is consistent with our previous results in this material pointing out the robustness in biosic production process. those variations in the biosic surfaces, microstructures, and porosities should result in important variations in behavior with regard to their osteointegration and vascularization properties and also in their capacity to load and release antibiotics. the microstructural characteristics and wettability properties of the biosics allowed all of them to be loaded with a known amount of drug by simply adding the vancomycin solution on to the disks which completely penetrates and maintains within the materials by capillarity. when the loaded disks were immersed in 3 ml phosphate buffer ph 7.4 in order to simulate the release process, a rapid delivery occurred during the first 90 minutes followed by a slower rate after for all the materials. figure 3 shows the profiles for the first hours (a critical period after surgery). the high hydrosolubility of vancomycin (> 100 mg / ml) justifies the rapid initial delivery that should correspond to the adsorbed antibiotic on external surface, and the drug molecules with shorter diffusion pathway cause the release of vancomycin from the disks which continues for days. the vancomycin release kinetics was analyzed using the higuchi model (table 2) that can accurately describe the release of water soluble drugs incorporated in porous solid matrices and allow materials to be compared. the good fit of release profiles to this model during the first stage indicates a characteristic diffusion mechanism of the drug through the full medium pores in the biosic disks. differences in total porosity justify the slower release of vancomycin and lower values of kh (higuchi dissolution constant) observed for loaded oak disks. for longer periods, the differences in the antibiotic release profiles in pbs medium from different materials can no longer be observed. the results do not show statistically significant differences between materials for amount drug released at 6 hours. the amount of antibiotic released during the first six hours would exceed the minimum inhibitory concentration 90% of staphylococcus aureus set to 1 g / ml even dipping disks in 1 liter of dissolution, whatever the type of wood precursor used. the marked differences in vancomycin release profiles in liquid medium are reflected in the pattern of the inhibition halos of s. aureus generated by loaded biosic disks (1.27 mg) in cultures on agar (figure 4(a)). no statistical differences were found between the inhibition halo sizes of the three porous structures at the beginning of the experiment. the drug release rate is a critical factor that determines the time while the device system manages to overcome the minimum inhibitory concentration and therefore generate a measurable inhibition halo. presumably, the amount of vancomycin transferred to the agar medium should depend also on the number of water molecules available to dissolve the drug and the external surface characteristics of the material. the lowest external surface of oak biosic and its big open pores in contact with the agar medium contribute to explain the prolonged effect against bacteria found for this material. loaded sapelli, pine, and oak biosics show no bacterial growth inhibitory effect after 3, 4, and 5 days of incubation, respectively. it is possible to improve antibacterial activity against s. aureus by increasing the loaded vancomycin dose to 2.54 mg (figure 4(b)) achieving 4, 5, and 8 days for sapelli, pine, and oak biosics respectively. table 3 shows the number of the cfus counted after 24 and 48 hours of treatment of s. aureus biofilms previously formed with the different loaded biosic systems (dose = 2.54 mg) and controls. it is interesting to note that control2 (standard solution of vancomycin), included as control at just 24 hours of treatment obtained a number of cfus lower than those of control1 (unloaded biosic) but significantly higher than cfu after loaded biosic treatments. the sustained vancomycin release from all biosics significantly reduces s. aureus biofilms indicating that the surface roughness and porous structure of the material could favor the penetration and the slow diffusion of drug through the glycocalyx matrix formed by bacterial population, improving biofilm treatments. the cfus of s. aureus on oak biosic at 24 and 48 h were slightly higher than for pine and sapelli biosics. however, results on agar (figure 4(b)) showed a longer antibacterial effect on oak biosic (8 days for loaded oak biosic with 2.54 mg of vancomycin). this longer release should be enough to eradicate the infection and could explain the higher cfus at 24 and 48 h. as an example, sem micrographs of the s. aureus induced biofilms together with the biofilms before and after 48 h of treatment with the oak loaded and unloaded biosics (figure 5). as we can see, the amount of bacteria after 48 h in contact with the unloaded biosic (control1) (figure 5(b)) is similar to the nontreated biofilms (figure 5(a)) and clearly higher than biofilm treatments with loaded biosic disks (figure 5(c)) whose surface appearance becomes clean as the original cellulose nitrate membrane. wood is a natural material of complex hierarchical structure as a result of the orientation and alignment of cells that may serve as hierarchical template to generate novel biomorphic ceramics with meso- and macrostructures depending on the precursor selected. the morphology and arrangement of the different cells may vary widely between the different kinds of wood, with large vessel cells dominating in hardwood and tracheids dominating in softwood. the diameter of the vessels and tracheids (named as pores) varies between 5 and 50 m in softwood and between 1 and 300 m in hardwood. while pine wood produces ceramics with a homogeneous porous structure characterized by the presence of pores of small size, probably difficult to be colonized by cells, sapelli and oak produce ceramics with interesting porous structures which can be used as implants. the procedure in this work for producing biosics from different natural resources allows systems with variable porosity, specific surface, and roughness to be obtained. the characteristic cells of softwood and hardwood with a preferential orientation in the axial direction offer the possibility of transforming the bioorganic wood structure into an inorganic ceramic material with tailored physical and mechanical properties. their surface characteristics and internal microstructure make them interesting candidates as potential vectors of therapeutic molecules. local administration of antibiotics through those porous systems would favor therapeutic success, achieving a high dose of drug at the implant site and simultaneously reducing the adverse effects of systemic administration. the vancomycin release study in pbs for all materials shows a quick antibiotic delivery during the first hours after implantation, characteristic of a high water soluble drug followed by a slow but prolonged release for a number of days. the high initial drug release could act as an attack dose in response to the high risk of infection during the initial shock, and the later controlled drug release keeps antibiotic concentration above the minimum inhibitory concentration (mic), obtaining an extended antimicrobial therapeutic effect, preventing biofilm formation, and inhibiting the occurrence of latent infections. differences in drug release kinetics were found regarding the precursor materials, oak biosic having lowest porosity and the slower antibiotic release rate. as a consequence, loaded oak biosic ceramics extend residual antimicrobial activity longer than pine and sapelli when drug elution was tested on solid medium such as agar. an increase in the loaded dose, from 1.27 mg to 2.54 mg, vancomycin, improves the effectiveness of the treatment, which in the case of the biosic from oak extends the prevention of biofilm formation for a week in solid medium. the amount of water molecules and the drug concentration gradient at the prosthesis interface should also affect the antibacterial activity of loaded biosics. considering the physiological conditions in a bone - implant interface after surgery, where an inflammatory process is present and the inevitable antibiotic clearance due to blood and lymphatic stream has taken place, we could expect the drug release to be higher in vivo than the one observed on agar. however, even with this slow drug release, obtained inhibition halos suggest the therapeutic potential of these systems. after surgery a competition between cells and bacteria for the implant colonization the release of vancomycin locally from implants would favor osteoblast colonization while avoiding bacterial adhesion to the surface and therefore preventing the formation of biofilm. the formation of this organized structure confers resistance to antibiotics, hampers the therapeutic success of treatments, and can lead to severe complications, such as destruction of local tissues, patient disability and morbidity, and sometimes death. the biofilm hinders the penetration of drugs throughout [22, 28, 29 ]. in this situation the antibiotic has poor activity against biofilm - embedded bacteria promoting resistances as a consequence of the continuing exposure to low drug concentrations. the high molecular weight of vancomycin, the possible inhibition reactions with exopolysaccharides of the matrix, and others factors could be responsible for the slow diffusion of this drug through biofilms. as a result, the mic90 of vancomycin is sharply increased in bacteria biofilms from 1 to 8 g / ml. our results indicate that vancomycin released from the biosics was enough to treat s. aureus biofilms, progressively decreasing the number of viable bacterial cells embedded on the structured matrices. the rough structure of the scaffolds facilitates the antibiotic penetration through. on this basis, vancomycin loaded biosics could be considered potential candidates to produce implants for the substitution of infected prostheses in chronic infections reducing the risk of relapse. there are statistically significant differences in surface characteristics, density, and microstructure between biosics from different origins. despite their variations, oak biosic with the highest specific surface, the lowest total porosity, and the biggest open pores shows a slow vancomycin release rate that promotes an antibacterial effect for more than a week for materials including 2.54 mg of drug. differences between materials in preventing s aureus biofilms are not found for already formed s. aureus biofilm treatments. the internal structure and surface properties of all the systems seem to facilitate the therapeutic activity of the antibiotic on the preformed biofilm, reducing the viable amount of bacterial colonies with time, by maintaining drug release over mic for a long period of time. the use of biosic loaded systems is a promising strategy not only to prevent postsurgical periprosthetic infections but also to treat already present infections. | the present work is aimed at getting a new insight into biomorphic silicon carbides (biosics) as bone replacement materials. biosics from a variety of precursors were produced, characterized, and loaded with a broad - spectrum antibiotic. the capacity of loaded biosics for preventing and/or treating preformed s. aureus biofilms has been studied. the differences in precursor characteristics are maintained after the ceramic production process. all biosics allow the loading process by capillarity, giving loaded materials with drug release profiles dependent on their microstructure. the amount of antibiotic released in liquid medium during the first six hours depends on biosic porosity, but it could exceed the minimum inhibitory concentration of staphylococcus aureus, for all the materials studied, thus preventing the proliferation of bacteria. differences in the external surface and the number and size of open external pores of biosics contribute towards the variations in the effect against bacteria when experiments are carried out using solid media. the internal structure and surface properties of all the systems seem to facilitate the therapeutic activity of the antibiotic on the preformed biofilms, reducing the number of viable bacteria present in the biofilm compared to controls. |
a life in science is not a journey you take alone. at all stages, mentors are key. no one in my family had ever been to university, undertaken a ph.d. it was a female high school teacher who encouraged me to set my sights high and apply to oxford university for undergraduate studies, and it was the sister of a school friend who first showed me by example that it was possible to have a career in research. at oxford i attended lectures by john gurdon on frog development and became fascinated by developmental biology. chris graham had just joined the faculty in the department of zoology and gave some lectures on new approaches to studying the mammalian embryo. i joined richard gardner 's lab in the marshall laboratory of reproductive physiology at the university of cambridge for my ph.d. in 1972. richard had made a big impact with his studies on lineage development in the early mouse embryo, performed by injecting cells into blastocysts, and i became his first graduate student. the marshall lab at that time was really at the center of new developments in technologies to study mammalian development and reproduction, and it was a very exciting and challenging place to work. matt kaufman was developing parthenogenesis in mice, and richard gardner and martin johnson were making interspecies chimeras to follow cell fate in situ. all this was carried out in a very collegial environment where a shy new graduate student was able to mingle and learn from the experts. so when i am asked how students should choose a lab for their graduate studies, i tell them to find an area of science that fascinates them and find a leading lab working in the area, but also to make sure that they will be in a collegial working environment where people are ready and willing to talk and share expertise. after my ph.d. and postdoc in cambridge and oxford, i married a canadian, whom i met through a college rowing team in cambridge, and moved to canada. this was a leap into the unknown. moving to canada without a job was probably a dangerous way to start a marriage and definitely not the best way to start my academic career. however, i rapidly obtained my first faculty appointment and over the years have built and sustained my research program in the canadian system (and remained happily married !). success was not without its challenges, especially in the early years, and the importance of mentors comes to the fore again. richard gardner introduced me to verne chapman in buffalo and tom wegmann in the university of alberta, both of whom were inspiring scientists and fantastic mentors. they went out of their way to forge collaborations with me and to get me invited to meetings, grant panels, etc. this enabled me to expand my network of contacts and allowed my science to thrive and make an impact. verne and tom both died too young, but their selflessness in promoting me has been my touchstone as i try to guide the careers of people around me. so far this look back at some of the role models and mentors in my career has largely focused on men, but men who were completely gender - blind in their support of good science. but developmental biology in general and mammalian development in particular have always had a very high quotient of successful women at all levels, who provide role models for aspiring young scientists. there is no question that this preponderance of females makes it easier for a woman to feel that this is an area of research where she can be accepted and made welcome. a positive feedback loop is thus set up, and the field continues to recruit strong females to its ranks. joining the research profession is challenging and tough, and it is important to have support networks where problems can be shared and worked through. i have always tried to give back to the community of science that has been so good to me and am continuing this path in my current endeavor as head of one of canada 's biggest and most successful hospital - based research institutes at the hospital for sick children. it is a very challenging opportunity to try to make a difference for a broad range of scientists and clinician - scientists and to have real impact on major problems in children 's health and, of course, one more challenge in terms of being able to balance science, administration, outside commitments, and family. i was told the other day that i should write a book on how to be a successful scientist and leader who gets things done. of course, that immediately made me think of all the things i have not managed to get done ! in the end, nobody can do it all, but i have a few small pieces of advice in lieu of an entire book. first, compartmentalize your activities as much as possible and try not to let one activity take over the time set aside for the other. we are extraordinarily privileged to work in this era of great scientific discovery and to be able to contribute in whatever way we can. i can go anywhere in the world and immediately have a point of contact and common values with people there. i strongly believe that science has a major role to play in promoting harmony and peace across the world. educating world citizens in common cause to pursue knowledge and apply it to human welfare | a career in science is a journey of wonder and discovery. to succeed in science requires curiosity, perseverance, a good dose of luck, and wise guidance from those who have taken the journey ahead of you. we also need to use our science skills to contribute to public debate on complex issues of the day. |
the transcriptome of medullary stromal cells of patients suffering from primary myelofibrosis was studied by agilent oligo microarray technology. the primary myelofibrosis is a chronic myeloproliferative syndrome. to invest the role of bone marrow stroma in the pathophysiology of this disease, we isolated primary cultured of bone marrow stromal cells from these patients. the osteo - medullary biopsies for the diagnosis of the disease were implanted in dmem medium with 10% fetal calf serum. stromal cells during their proliferation adhere to plastic and they were trypsinized between each passage (35 passages) when cultures came to confluence. a cytometric control was carried out on the cells prior to performing molecular biology experiments. cd105, cd73 and cd90 marker positivity was verified to validate the mesenchymal cell phenotype. the negativity of the cd45 marker was also carried out to prove the absence of residual hematopoietic cells in culture. each culture of mesenchymal stromal cell is isolated from the bone marrow of an individual. in total, the bone marrow samples were studied individually from 6 healthy donors (6 controls : gsm1084994, gsm1084995, gsm1084996, gsm1084997, gsm1084998, gsm1084999) and from 6 patients with primary myelofibrosis (6 pmf : gsm1085000, gsm1085001, gsm1085002, gsm1085003, gsm1085004, gsm1085005). concerning the enrollment of control samples : subjects are negative for alcohol abuse and hcv, hbv and hiv virus infections. the choice of control subjects was conditioned by access to bone marrow from subjects having a hip prosthesis surgery : indeed the subjects have an average age similar to that of patients with primary myelofibrosis (between 60 and 80 years). each sample was treated individually for the extraction of nucleic acids and the achievement of microarrays. rna was isolated using rna extraction protocols (nucleospin rna ii, macherey - nagel) on the miltenyi plateform. rna samples were quality - checked via the agilent 2100 bioanalyzer (agilent technologies). total rna sample (1 g) rna samples were amplified and labeled using the agilent quick amp labeling kit / low rna input linear amp kit (agilent technologies). the hybridization procedure was performed using agilent gene expression hybridization kit (agilent technologies). briefly, 1.65 g cy3-labeled fragmented crna in hybridization buffer was hybridized overnight (17 h, 65 c) to agilent whole human genome oligo microarrays 4 44k using agilent 's in hybridization chamber. the fluorescence signals were detected using agilent 's microarray scanner system (agilent technologies). the agilent feature extraction software (fes) v9.1 was used to read out and process the microarray image files. the signal intensities from single experiment raw data lists are normalized by dividing the intensities values by their median. normalized data were accessible on public database : (geo submission number gse44426, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse44426), online on jan. 10, 2015),. | primary myelofibrosis (pmf) is a clonal myeloproliferative neoplasm whose severity and treatment complexity are attributed to the presence of bone marrow (bm) fibrosis and alterations of stroma impairing the production of normal blood cells. despite the recently discovered mutations including the jak2v617f mutation in about half of patients, the primitive event responsible for the clonal proliferation is still unknown. in the highly inflammatory context of pmf, the presence of fibrosis associated with a neoangiogenesis and an osteosclerosis concomitant to the myeloproliferation and to the increase number of circulating hematopoietic progenitors suggests that the crosstalk between hematopoietic and stromal cells is deregulated in the pmf bm microenvironmental niches. within these niches, mesenchymal stromal cells (bm - msc) play a hematopoietic supportive role in the production of growth factors and extracellular matrix which regulate the proliferation, differentiation, adhesion and migration of hematopoietic stem / progenitor cells. a transcriptome analysis of bm - msc in pmf patients will help to characterize their molecular alterations and to understand their involvement in the hematopoietic stem / progenitor cell deregulation that features pmf. |
the fact that the majority of pre - mrnas are spliced while they are still being transcribed has led to the proposal that local chromatin structure and histone modifications may play direct roles in regulating splicing. indeed, several studies have shown that specific histone modifications can affect the association of splicing factors with chromatin and the efficiency of the splicing process [2 - 4 ]. a link between nucleosome positioning and exon - intron boundaries was first proposed in 1991, long before the functional link between splicing and transcription was established. recent advances in the computational prediction and experimental verification of nucleosome positioning, based on underlying dna sequence features [6 - 8 ], in combination with recently published high - resolution genome - wide maps of nucleosome positions and histone modifications in several organisms, have now enabled genome - wide comparisons of nucleosome positioning, histone modifications, and intron - exon architecture, revealing surprising correlations between these features and throwing light on the question of how chromatin features may help the splicing machinery to distinguish between exons and introns. recent high - throughput transcriptome analyses have detected alternative splicing in approximately 95% of multi - exon human genes [13 - 15 ] and also extensively in mice, plants, flies, and yeast. alternative splicing is often regulated by trans - acting factors that are differentially expressed in different tissues or metabolic states and bind specific sequence or structural motifs on the pre - mrna, resulting in alternative splicing [22 - 24 ]. it has long been a goal of the splicing field to crack the splicing code : to identify the pre - mrna sequence features that can explain and predict not only the exact sites of constitutive splicing but also the features that determine tissue - specific alternative splicing patterns. previous work has successfully identified pre - mrna - encoded features that define the precise boundaries of certain classes of constitutively spliced exons [26 - 28 ] and additional splicing enhancers and silencers, some of which have been shown to correlate with exon inclusion levels in specific tissues. however, it has been suggested that pre - mrna - encoded information alone is not sufficient to explain the recognition of short exons in a desert of long introns or the modulation of this process in alternative splicing. the idea that local chromatin structure may add an additional regulatory layer to splicing, particularly to alternative splicing, is currently gaining momentum, and both correlative evidence and functional evidence are emerging [30 - 35 ]. additional insights into the role of rna sequence come from the recent demonstration that by taking hundreds of rna features into account, a splicing code based on pre - mrna features is able to qualitatively predict tissue - specific alternative splicing for thousands of vertebrate exons. here, recent advances and current ideas on how chromatin and pre - mrna sequence contribute to constitutive and alternative splicing are reviewed in 2009 and 2010, several groups [37 - 42 ] used bioinformatic approaches to uncover patterns from published genome - wide maps of nucleosome positioning in human t cells and in caenorhabditis elegans, derived from deep sequencing of micrococcal nuclease - digested chromatin. these recent bioinformatic analyses [37 - 42 ] now show that nucleosomes sit preferentially on exon sequences whereas introns are relatively depleted of nucleosomes (figure 1). this remarkable arrangement was observed in several metazoan species and was found to be independent of transcriptional activity, suggesting that the arrangement is an inherent property of chromatin [37 - 39,41 ]. strikingly, the average length observed for metazoan exons (140 - 150 base pairs) corresponds neatly with the length of dna required to wrap a single nucleosome (147 base pairs). further correlations to the splicing process were observed by several authors (e.g., exons flanked by weak splice sites or by long introns have a higher tendency to be bound by nucleosomes), raising the idea that nucleosomes may help the splicing machinery by marking exons that may otherwise be difficult to recognize (reviewed in [30 - 32 ]). the positions of core rna splicing signals (red boxes), dna sequence properties (yellow profile), and nucleosome occupancy (blue profile) on human exon / intron boundaries are drawn approximately to scale according to the distance from the exon end. core rna splicing signals include the 5 splice site (ss) (position -2 to + 4), which has a variable sequence in higher eukaryotes and a human consensus of agguaag. the branch site (bs) has a variable position at -20 to -30, directly 5 of the polypyrimidine tract (ppt), and a variable sequence, with a human consensus of cuaac. the ppt (position -5 to -20 or -30) is variable in length (in humans typically 10 - 25 pyrimidines) and strongly favors uracil. the 3 ss (position -3 to + 1) has a variable sequence, and a human consensus of cagg. each of the core splice signals on the pre - mrna is recognized specifically by a protein or ribonucleoprotein component of the splicing machinery [25 - 27 ]. not shown are the numerous additional splicing regulatory elements, which reside in introns and exons and add specificity to constitutive and tissue - specific splicing. nucleosome occupancy (blue profile) : the average relative nucleosome occupancy across the exon / intron junctions is shown to scale for human activated t cells (adapted from). the vertical scale represents approximately 1.5-fold higher enrichment on exons compared with introns. note the more profound depletion at the 3 intron end. the extent of depletion at this site was found to correlate positively with the strength of the ppt. dna sequence properties (yellow profile) : the density of pentamer sequences that disfavor nucleosome binding was calculated for constitutive exon / intron junctions in and is drawn approximately to scale. the maximum value on the vertical scale represents approximately 70% of sequences containing a nucleosome - disfavoring pentamer, and the minimum is approximately 40%. guanine and cytosine (gc) content (not shown) may also play a role in nucleosome positioning. exons have a higher gc content than surrounding intron regions, and this has been proposed to contribute to the observed increased nucleosome occupancy over exons relative to introns. however, there is some disagreement on this point in the literature (for a discussion, see). by analysis of chromatin immunoprecipitation (chip) combined with high - throughput sequencing (chip - seq) and chip followed by microarray analysis (chip - chip) data sets, several studies have examined correlations between histone modifications and exon - intron boundaries and have reported conflicting results. several authors conclude that specific histone modifications are enriched on exons compared with introns, suggesting an active marking mechanism, whereas others argue that these apparent enrichments are due mostly to nucleosome positioning, which is independent of modification status. it has been suggested that these discrepancies may be due mainly to difficulties of normalization of chip data for nucleosome occupancy, compounded by the fact that occupancy studies and modification studies were performed with different techniques (micrococcal nuclease digestion versus chip). it is also possible that gene - specific differences exist but go undetected in global analyses. to what extent can we understand the preference of nucleosomes for exonic sequences in terms of known pre - mrna splicing signals ? figure 1 summarizes the rna, dna, and chromatin features at exon - intron boundaries. the preference of nucleosomes for exons appears to be a consequence not only of the higher guanine and cytosine content of exons but also of a high density of sequences that repel nucleosomes exactly at the intron - exon boundary and a depletion of these sequences within the exon itself relative to the adjacent intron (figure 1). particularly interesting is the polypyrimidine tract (ppt), typically a long (10 - 20 nucleotides) run of uracil bases at the 3 intron end in the pre - mrna, that is specifically recognized by spliceosome components (figure 1). at the dna level, the ppt corresponds to poly t, one of the strongest nucleosome - repelling sequences identified by kaplan.. thus, it is clear that splicing signal sequences play a role both at the rna level, for recognition by rna - binding proteins of the splicing machinery, and at the dna level, in determining the positions of nucleosomes. is nucleosome positioning thus merely a coincidence of the rna sequence or does it have a causal role in splicing ? experimental evidence beyond correlation is currently lacking but several possible roles have been proposed (summarized in figure 2). the nascent pre - mrna molecule is shown in black, and the exon is shown as a thicker line. the large subunit of rna polymerase ii (pol ii) is shown in green, transcribing from left to right. the c - terminal domain (ctd) of pol ii dna is shown in blue, with exon - encoding sequences (thicker lines) wrapped around nucleosomes (light blue). red arrows show different points at which the splicing machinery has been shown or proposed to operate. (1) rna sequences (shown in figure 1) are bound directly by the splicing machinery via protein - rna interactions or ribonucleoprotein - rna interactions. core signals shown in figure 1 operate on all exons, whereas additional tissue - specific signals act in conjunction with tissue - specific splicing factors to ensure alternative splicing. (2) the ctd is phosphorylated at different residues upon initiation, elongation, and termination and serves as a binding platform for other proteins. the ctd may affect pre - mrna processing directly by recruiting splicing factors or indirectly by recruiting nucleosome remodelers and histone modifiers. (3) when pol ii transcribes through a nucleosome, core histones are transferred behind the transcribing polymerase via a transient dna loop. unassembled dna or dna in linker sequences presents an opportunity for splicing regulators to bind directly to dna sequences. (4a, 4b) histone tail modifications can recruit regulators of alternative splicing to chromatin. these may be on reassembled nucleosomes behind pol ii (4a) or on nucleosomes in front of pol ii (4b). speed bumps, slowing down the polymerase immediately as it begins transcribing the exon upon which the nucleosome is positioned. such a mechanism may affect any of steps 1 to 4 by modulating the time available for interactions of trans - acting factors with the exon (at the dna, rna, or chromatin level) emerging behind the polymerase. the models proposed so far fall into one of two non - mutually exclusive classes - the recruitment models and the kinetic coupling models - and are summarized in figure 2. recruitment models favor the idea that nucleosome positioning or nucleosome modifications on exons guide the splicing machinery to the right place (figure 2), whereas kinetic coupling proposes that the presence of a nucleosome in the path of the polymerase decreases the speed of transcription and thus allows more time for splicing to occur (figure 2, arrow 5). in favor of such speed bump models, single - molecule in vitro experiments have shown that the speed of rna polymerase ii (pol ii) transcription is modulated by nucleosomal barriers. on the other hand, a recent in vivo study of pol ii transcription rates measured similar speeds on exonic and intronic sequences and showed that although splicing does indeed occur cotranscriptionally, it lags substantially behind the transcription process, being approximately twice as slow. this raises the question of how much the chromatin features ahead of the polymerase can influence splicing events that take place far behind it (figure 2). however, this study was limited to a small number of genes, and it is not known whether they contain exons that are regulated in a chromatin or pol ii elongation - dependent manner (or both). if nucleosome positions do affect splicing, then how could such a system permit the vast amount of flexibility observed in alternative splicing ? several authors have proposed that nucleosome remodelers, a relaxation of nucleosome positioning at alternatively spliced exons, or tissue - specific histone modifications may account for tissue - specific differences in nucleosome positioning or properties and thus facilitate alternative splicing [30 - 32,39 ]. in support of this idea, ectopic recruitment of heterochromatin modifications to the vicinity of an alternative exon was found to reduce pol ii speed and to affect the splicing of that exon. furthermore, investigation of the fibroblast growth factor receptor 2 (fgfr2) locus revealed cell line - specific enrichment of histone h3 lysine 36 trimethylation (h3k36me3), which was shown to be required to promote the exclusion of one exon of the gene. an adaptor protein recruits the proteins required for specific exclusion of this exon to the sites of h3k36 methylation, demonstrating a direct mechanistic link between cell type - specific chromatin modification and exon exclusion. interestingly, the h3k36me3 enrichments were broadly spread across the fgfr2 locus and were not limited to the excluded exon, suggesting that nucleosome positioning does not play the major role here ; it is the h3k36me3 modification that serves to recruit the necessary factors to the general vicinity of an alternatively spliced exon in the appropriate cell type, although sequence features of the pre - mrna itself determine which exon is to be excluded. although it remains unclear to what extent alternative nucleosome positions play a role in alternative splicing, a recent study demonstrates that pre - mrna sequence features are an essential component and perhaps contain sufficient information for many alternative splicing events. the authors examined the splicing patterns of over 3000 alternative exons in 27 mouse tissues and extracted over 1000 rna sequence features, including known and novel motifs and structural features. from this the authors compiled 200 features that were diagnostic and qualitatively predictive for tissue - specific alternative splicing. the predictive power of the code was tested by cross - validation and comparison with experimental data. depending on the exon type, the code was able to correctly predict alternative splicing in central nervous system and muscle for 65 - 95% of test exons. importantly, the code is combinatorial, and the authors conclude that large numbers of sequence features are required to ensure tissue - specific splicing. although this study focuses on the idea that these are pre - mrna sequence features, it is also possible that several of the newly identified features may work at the dna level or at both rna and dna levels as is the case for the ppt (figure 1). in the future, it will be essential to determine the relative contributions of rna sequence features, nucleosome positioning, and histone modifications to constitutive and alternative splicing. the data so far correlating nucleosome positioning to exon - intron architecture have been limited to few cell types. it will be important to see whether nucleosome positions are indeed different in different tissues, as has been proposed via thermodynamic competition with tissue - specific transcription factors and observed for regulatory regions of specific loci. if this is also the case on a genome - wide scale, then do alternative nucleosome positions correlate with alternatively spliced exons ? furthermore, it would be extremely interesting to investigate whether any of the rna sequence features that are predictive for alternative splicing could play an additional role at the dna level (e.g., as nucleosome positioning or repelling sequences or as binding sites for site - specific dna binding proteins that may compete with nucleosomes in a tissue - specific manner). finally, it will be essential to go beyond global correlations and to determine cause and effect for specific loci. to unravel the relative contributions of rna sequence, dna sequence, and chromatin architecture, it will be essential to overcome the inherent difficulty in such experiments (i.e., that any change in dna sequence changes the rna sequence). thus, it will be essential to devise strategies by which nucleosome positions can be modulated without affecting the underlying dna sequence (e.g., by manipulating levels of remodelers or competing transcription factors). | recent genome - wide studies have revealed a remarkable correspondence between nucleosome positions and exon - intron boundaries, and several studies have implicated specific histone modifications in regulating alternative splicing. in addition, recent progress in cracking the splicing code shows that sequence motifs carried on the nascent rna molecule itself are sufficient to accurately predict tissue - specific alternative splicing patterns. together, these studies shed light on the complex interplay between rna sequence, dna sequence, and chromatin properties in regulating splicing. |
apoptosis, a distinct form of cell death, is at the heart of both mechanical and molecular mechanisms of cardiomyocyte loss during ischemia. after mi, there is heightened apoptosis in the peri - infarct and noninfarcted myocardium, and this coincides with increased left ventricular diameter and decreased cardiac function. to this effect, therapies that inhibit apoptosis in mi have been shown to improve cardiac function [2, 3 ]. micrornas (mir) are small noncoding ribonucleic acids (rnas) measuring 1825 nucleotides that are involved in posttranscription regulation of gene expression [4, 5 ]. mir-208a is a cardiac specific microrna coded for in an intron of myosin heavy chain 6 (myh6) gene and regulates cardiac conduction, stress response, and gene expression [69 ]. several researches have shown that its inhibition or deletion is associated with downregulation of cardiac fibrosis and hypertrophy in response to various stress stimuli [68 ]. it has also been shown to be dysregulated in several cardiac diseases including myocardial infarction and dilated cardiomyopathy, in which it is associated with adverse outcomes [10, 11 ]. however, no study as yet has been done to investigate its role in cardiomyocyte apoptosis despite these cardiac pathologies being associated with increased myocyte apoptosis. we therefore investigated the effect of mir-208a on cardiomyocyte apoptosis and apoptosis related genes and if its silencing has any therapeutic benefit in myocardial infarction. we report that mir-208a upregulation alters apoptosis genes ' expression and promotes cardiomyocyte apoptosis, while its silencing attenuates apoptosis and improves cardiac function after mi. to the best of our knowledge, our study is the first to explore the antiapoptotic effects of mir-208a silencing and the therapeutic benefits of mir-208a antagomir in myocardial infarction. cardiomyocytes were transfected with 0.2 nmols / ml of mir-208a agomir for gain of function or 0.4 nmols / ml of mir-208a antagomir for loss of function, by directly adding the agomir or antagomir formulation to the cell culture medium according to manufacturer 's instructions (ribobio co. ltd., silencing, cardiomyocyte cells were transfected with bax sirna (5-aacagaucaugaagacagggg-3) using ribofectamine reagent according to manufacturer 's instructions (ribobio co. ltd., after 48 hours, the different treatment groups underwent simulated ischemia for 12 hours by placing the cardiomyocytes in a hypoxia chamber with 5% co2 and 95% n2 at 37c in glucose - free dmem medium. myocytes were harvested, fixed, and assayed for apoptosis according to previously described protocol. microarray profiling was done on custom - made array chips by a service provider (ribobio co., guangzhou, china). rna was isolated from cultured control or mir-208a agomir transfected cardiomyocytes, 72 hours after transfection. differential gene expression between controls and agomir transfected cardiomyocytes was analyzed using permutation analysis of differential expression. gene clustering was performed with cluster 3.0 and heat map images generated in java tree view. gene ontology analysis was done using david online tool [14, 15 ], and apoptosis pathway analysis was done using ingenuity pathway analysis (http://www.ingenuity.com/). all experiments were conducted according to the guide for the care and use of laboratory animals and approved by the animal care and utilization committee of union hospital, tongji medical college, huazhong university of science and technology, wuhan, china. the investigation conformed to the guide for the care and use of laboratory animals, published by the us national institute of health (2011). adult male c57bl/6 mice, 8-week - old, were purchased from wuhan university animal research center. mice were anesthetized by an intraperitoneal injection of pentobarbital sodium (50 mg / kg), orally intubated, and connected to a rodent ventilator, and ecg monitoring was done using rm6240 data acquisition system sampling at 1 khz. a left thoracotomy was performed by a horizontal incision at the third intercostal space and myocardial infarction induced by ligation of the left anterior descending coronary artery (lad) according to previously described protocol and then randomly assigned to antagomir group (n = 6) or control group (n = 7). sham group mice (n = 7) had the same procedure done but without ligation of the lad. starting within 2 hours after mi, each antagomir group mouse received a total of 300 nmols of mir-208a antagomir given over 3 consecutive days (days 0, 1, and 2) using 0.2 mls of normal saline as vehicle, by low pressure tail vein injection, while control and sham group mice each received 0.2 mls of vehicle only by the same method over the same period of time. echocardiography was performed at 7 and 28 days, and thereafter animals were euthanized and hearts harvested for further analysis. at 28 days, animals were euthanized and hearts harvested, cut transversely into blocks, and fixed in 4% paraformaldehyde. these were then embedded in oct compound (bhd, uk) and then transversely cut into 5 m thick cryosections for histological analysis. two cryosections from each of the blocks were stained with masson 's trichrome for assessment of fibrosis and infarct size. the infarct size was measured as the sum of the epicardial and endocardial scar length, divided by the sum of lv epicardial and endocardial circumferences. for assessment of fibrosis, we randomly selected 4 fields per slide in the peri - infarct zone (piz) or 5 fields per slide in the noninfarct zone (niz) and calculated collagen volume fraction (cvf) as the ratio of blue stained (collagen) area to the total tissue area. the collagen - rich border zone of vessels and the scar were excluded from the analysis. cardiomyocyte hypertrophy was assessed by capturing cardiomyocyte images over 5 different fields per slide (40x objective). using image - pro plus software version 6, we obtained mean cardiomyocyte cross - sectional areas, which were compared between groups. at 28 days after mi or after 12 hours of simulated cardiomyocyte ischemia, tissues or cells, respectively, were fixed with 4% paraformaldehyde, and apoptosis assay was done by tunel method according to previously described protocol. total rna was extracted from cells and tissue samples using trizol reagent (invitrogen, usa) according to the manufacturer 's protocol. cdna was synthesized from 2 g of total rna with takara 's reverse transcription kit (takara, china), according to manufacturer 's instructions in a 25 l volume including 2 g total rna, and reverse transcription primer for mrna genes, or random primers for u6 rrna and mir-208a specific primers (bulge - loop mirna qpcr primers from ribobio, china). real - time pcr was carried out with the reagents of a sybr green i mix (takara, china) in a 20 l reaction volume (10 l sybr green i mix, 200 mm forward and reverse primer, and 2 l cdna template) on an mj opticon monitor chromo4 instrument (bio - rad, usa) using the following protocol : 95c for 20 s ; 40 cycles of 95c for 10 s, 60c for 20 s, and 70c for 1 s. normalization for mir-208a was done using u6 while bax expression was normalized using gapdh. the following primer sets were used for bax and gapdh : bax : forward : tgtttgctgatggcaacttc reverse : gatggttctgatcagctcgg gapdh : forward : 5-gctggcgctgagtacgtcgtggagt-3 reverse : 5-cacagtcttctgggtggcagtgatgg-3data analyses were performed using the 2 method. forward : tgtttgctgatggcaacttc reverse : gatggttctgatcagctcgg forward : tgtttgctgatggcaacttc reverse : gatggttctgatcagctcgg forward : 5-gctggcgctgagtacgtcgtggagt-3 reverse : 5-cacagtcttctgggtggcagtgatgg-3 forward : 5-gctggcgctgagtacgtcgtggagt-3 reverse : 5-cacagtcttctgggtggcagtgatgg-3 to assess if therapeutic silencing of mir-208a improves cardiac function in mi, 2-dimensional transthoracic echocardiography studies were performed on 4 - 5 mice from each group, lightly anesthetized with pentobarbital sodium (25 mg / kg), on days 7 and 28, using a ge voluson ultrasound system equipped with an 11.5 mhz high frequency probe. cardiac imaging was done in a parasternal short - axis view at the level of the papillary muscles to record m - mode and determine fractional shortening (fs) and ejection fraction (ef) which are measures of cardiac function. groups were compared using independent student 's t - test or one - way anova with the tukey or games - howell post hoc tests as appropriate. statistical significance was defined as a p value < 0.05 and values are presented as mean sem. expression of mir-208a in vivo and in vitro was analyzed using quantitative rt - pcr. we found that 0.4 nmol / ml of mir-208a antagomir significantly downregulated mir-208a expression in cultured cardiomyocytes (figure 1(a)). similarly, mir-208a agomir upregulated mir-208a expression in neonatal cardiomyocytes 48 hours after transfection (figure 1(b)). to silence mir-208a, 300 nmols of mir-208a antagomir per mouse was administered after mi, and this significantly downregulated mir-208a expression at 28 days after mi (figure 1(c)). apoptosis, a distinct form of cell death, is a contributor to cardiac dysfunction, remodeling, and heart failure following mi [17, 18 ]. simulated ischemia of neonatal cardiomyocytes following transfection with mir-208a agomir or antagomir showed that mir-208a upregulation significantly increases apoptosis while its silencing blunts apoptosis during ischemia (figures 2(a) and 2(b)). to gain insight into the effect of mir-208a on apoptosis related genes, we employed custom - built microarrays (ribobio co., guangzhou, china). hierarchical clustering and heat map visualization of the differentially expressed genes are shown in figure 3(a). cluster analysis of the differentially expressed genes revealed that eight apoptosis related genes were upregulated, while twelve apoptosis related genes were downregulated (table 1). a closer inspection of the dysregulated genes showed that mir-208a tended to downregulate genes favoring the extrinsic apoptosis pathway, while upregulating those that favor the intrinsic pathway of apoptosis. analysis of differentially expressed apoptosis genes highlighted bax, casp8, and hras1 as involved in the canonical apoptosis pathways (figure 3(b)). if bax was essential for mir-208a induced apoptosis, we used sirna to silence bax gene. bax sirna attenuated the proapoptotic effect of mir-208a agomir (figure 2(c)), suggesting that mir-208a functions to promote apoptosis at least in part by upregulating bax. apoptosis has been observed to occur in the peri - infarct and noninfarcted myocardium and is a contributor to cardiac dysfunction, remodeling, and heart failure following mi [17, 18 ]. to investigate the antiapoptotic effects of mir-208a silencing in an mi setting, we treated mice with 300 nmols of mir-208a antagomir. antagomir attenuated peri - infarct apoptosis at 28 days, a finding that is novel and may have therapeutic significance (figures 4(a) and 4(b)). in the noninfarct area, however, the difference in apoptosis between antagomir and control group hearts only showed a trend towards reduction but did not reach statistical significance (figure 4(c)). qpcr showed that mir-208a silencing in mi also decreased bax levels at 28 days (figure 4(d)). a comparison of infarct area sizes between control and antagomir groups showed a trend towards reduction in infarct size by antagomir, but this did not reach statistical significance (figure 4(e)). at one month after mi, antagomir treatment significantly decreased cardiomyocyte hypertrophy (figures 5(a) and 5(b)), a known pathological response associated with heart failure and sudden death [19, 20 ]. moreover, mir-208a antagomir also decreased percentage fibrosis at day 28 (figures 5(c), 5(d), and 5(e)). increased fibrosis is known to reduce cardiac contractility and to contribute to reduction of cardiac function after mi, and thus its reduction by antagomir is potentially beneficial. the above results were consistent with previous reports which showed that mir-208a silencing or knockout attenuates cardiac fibrosis and hypertrophy in response to cardiac stress [6, 7 ]. aiming to see any beneficial effects of long term silencing of mir-208a on cardiac function after mi, mice received a total of 300 nmols of mir-208a antagomir, and echo was done at 7 and 28 days. antagomir treatment significantly attenuated cardiac dysfunction after mi (table 2 and figures 5(f) and 5(g)). the current study investigated the role of mir-208a in apoptosis during cardiomyocyte ischemia and the therapeutic potential of mir-208a antagomir in myocardial infarction. here we reveal for the first time that mir-208a promotes myocyte apoptosis during ischemia and further show that therapeutic administration of mir-208a antagomir attenuates cardiomyocyte apoptosis, hypertrophy, and fibrosis, coupled with improvement in cardiac function after mi. following myocardial infarction, nonischemic myocyte apoptosis ensues resulting in further myocardial loss and ventricular dysfunction [2, 19, 20 ]. because apoptosis plays a critical role in both mechanical and molecular mechanisms of cardiac dysfunction and remodeling after mi our finding that mir-208a antagomir mitigates ischemia induced apoptosis opens a window for its possible therapeutic application in mi. despite noting no difference in infarct size between the groups, the observed decrease in apoptosis levels could still be a contributor to improved contractile performance, as other studies have shown. interestingly, some researchers have shown that cardiac mir-208a in human mi is persistently upregulated, with the highest levels observed in patients who died within 24 hours. thus, targeted silencing of mir-208a in human mi may be a potentially viable and beneficial therapeutic option. although mir-208a has been shown to be proproliferative under certain conditions, we demonstrated that it is proapoptotic in the ischemic setting [22, 23 ]. it is not uncommon for micrornas or other genes to have opposite effects under different conditions. for example, mir-494 has been shown to have both antiapoptosis and proapoptosis effects under different circumstances. similarly, p21 (waf 1), a target of mir-208a, has also been reported to be both anti- and proapoptosis depending on prevailing conditions. to investigate the genetic basis of mir-208a induced apoptosis, we employed custom - built microarrays, which provided an insight into the mir-208a regulated genes associated with apoptosis. there was a noted trend towards downregulation of genes involved in the extrinsic apoptosis pathway and upregulation of those in the intrinsic apoptosis pathway. among those upregulated was bax, an essential member in the intrinsic pathway, which was also highlighted by pathway analysis of the differentially expressed apoptosis genes (figure 3(a)). in mi, bax was also shown to be downregulated by mir-208a silencing and may thus be playing a role in mir-208a mediated myocyte apoptosis during ischemia. bax functions by controlling access of upstream apoptotic signals to the mitochondria and together with bak is essential for intrinsic pathway mediated apoptosis [17, 26 ]. given that micrornas can upregulate gene expression by binding to the promoter regions and target sites in the mrna or indirectly by downregulating repressors [2729 ], we scanned the bax promoter regions and mrna for any mir-208a binding sites. results revealed no predicted mir-208a binding sites both in the gene promoter regions and in mrna, suggesting that mir-208a may be acting indirectly to alter bax expression. our findings only open a window and more studies will be needed to further decipher the mechanisms involved in mir-208a mediated apoptosis. upon histological examination, we observed significantly reduced myocyte hypertrophy in the noninfarcted area of the lv following antagomir treatment. given that heightened cardiomyocyte hypertrophy in the noninfarcted region is associated with remodeling and cardiac dysfunction, the noted decrease in myocyte hypertrophy may be a contributor to the observed improvement in cardiac function. moreover, antagomir therapy attenuated fibrosis, a known contributor to post - mi cardiac dysfunction. studies have shown that mir-208a functions via upregulation of endoglin to increase myocardial fibrosis, and its silencing downregulates endoglin and reduces type 1 collagen synthesis [31, 32 ]. the observed decrease in fibrosis provides yet another possible mechanism by which mir-208a antagomir may contribute to improving cardiac function after mi. using 2d echocardiography, we demonstrated improved cardiac function at 28 days after mi in animals therapeutically treated with mir-208a antagomir. the observed improvement in cardiac function is likely due to a combination of factors including decrease in apoptosis, hypertrophy, and fibrosis. to the best of our knowledge, our study is the first to demonstrate that antagomir based mir-208a silencing can attenuate cardiomyocyte apoptosis during ischemia and improve cardiac function after mi. we believe that this will provide a basis for development of therapies targeting mir-208a in mi. | aims. mir-208a is associated with adverse outcomes in several cardiac pathologies known to have increased apoptosis, including myocardial infarction (mi). we investigated if mir-208a has proapoptotic effects on ischemic cardiomyocytes and if its silencing has therapeutic benefits in mi. methods and results. the effect of mir-208a on apoptosis during ischemia was studied in cultured neonatal mice myocytes transfected with agomir or antagomir. differential gene expression was assessed using microarrays. mi was induced in male c57bl/6 mice randomly assigned to antagomir (n = 6) or control group (n = 7), while sham group (n = 7) had sham operation done. antagomir group received mir208a antagomir, while control and sham group mice received vehicle only. at 7 and 28 days, echocardiography was done and thereafter hearts were harvested for analysis of apoptosis by tunel method, fibrosis using masson 's trichrome, and hypertrophy using hematoxylin and eosin. mir-208a altered apoptosis genes expression and increased apoptosis in ischemic cardiomyocytes. therapeutic inhibition of mir-208a decreased cardiac fibrosis, hypertrophy, and apoptosis and significantly improved cardiac function 28 days after mi. conclusion. mir-208a alters apoptosis genes expression and promotes apoptosis in ischemic cardiomyocytes, and its silencing attenuates apoptosis, fibrosis, and hypertrophy after mi, with significant improvement in cardiac function. |
brachytherapy has been a time tested and indispensable modality of treatment for a variety of cancers for more than a century. time and again it has been proven that brachytherapy independently improves survival [1, 2 ] and exclusion of brachytherapy from the management of some cancers can be detrimental [2, 3 ]. the data on decline of brachytherapy use needs to be interpreted with caution as sometimes the data from registry or population database could be misleading due to changes in coding and reporting patterns. apart from established indications [4, 5 ], brachytherapy has expanded wings to novel and innovative indications like brain, liver, penile, lung, and intra - thoracic brachytherapy [6, 7, 8, 9 ]. brachytherapy planning has also evolved from point based prescription to volume based and from x - ray based to magnetic resonance imaging (mri) based planning [10, 11 ]. with the evolution in brachytherapy practice, it is important to know the current change in practice as well as attitude of practicing medical physicians as well as other professionals actively involved in the field. while such surveys are available from the western world [11, 12, 13 ], one is lacking from india. available survey also does not address the specific question appropriately and have missing information on the use of interstitial brachytherapy. the burden of cancer in india is different from other parts of the world ; having higher incidence of oral cavity cancers and cancers of uterine cervix. the increasing trend towards early detection of cancers may further necessitate increased use of brachytherapy in quest of shorter duration of treatment and organ preservation. the limited availability of brachytherapy facilities as well as advanced planning system poses different challenges and hurdles in brachytherapy training and practice in india. hence, the needs, perspectives, and practices are quite different from the western world. attendees of aiims - ibs (4 annual meeting of indian brachytherapy society) meeting are particularly those who are interested and actively involved in the brachytherapy practice, and their opinion may reflect the prevailing scenario of brachytherapy practice. we intended to study the patterns and attitudes of brachytherapy practice though this post - conference descriptive online cross - sectional survey. the aiims - ibs was held at new delhi, india from 14 - 16 march, 2014. the scientific program was designed with the objectives of acquainting the post - graduate students and practicing physicians with : 1) indications and techniques of brachytherapy for various malignancy sites ; 2) generate awareness about innovations and advances in brachytherapy ; 3) expose the attendees to experience of interstitial brachytherapy for difficult sites ; 4) motivate the students and physicians for further refining their practice of brachytherapy. the conference included dedicated sessions on brachytherapy in urologic, gastro - intestinal, breast, gynecologic, thoracic, head and neck, soft tissue sarcomas, and cutaneous malignancies. lectures were delivered by renowned experts on interstitial brachytherapy for less common sites like brain, lung, liver, and bone. innovative topics among others included organ sparing spacer techniques and integration of systemic therapy with brachytherapy. other sessions included panel discussion, debates, oral and poster presentations, and video sessions highlighting brachytherapy procedures, plenary talks and interactive sessions of attendees with professors. this descriptive cross sectional study was carried out immediately after the conference. a web based 19-point questionnaire (table 1) was designed and e - mailed to the attendees. the e - mail contained a brief purpose of the survey and the survey included in the mail itself, and also a web link to access the questionnaire. e - mail and name were used to avoid duplicate submissions. the questionnaire consisted of demographic details (items 1 - 3), current brachytherapy practice (items 4 - 5), perception towards education, and change of brachytherapy practice (items 6 - 11) ; satisfaction level for present meeting (item 12 - 13), attitude towards attending and suggestions for improvement of brachytherapy meetings (item 14 - 19). items 1 - 16 were single or multiple choice questions and items 17 - 19 were descriptive answer type questions. respondents were given the option of concealing their identity and their identity was kept confidential. mann - whitney u test was used to assess the correlation of likert - scale responses (item numbers 12 - 13). p value (2-tailed) of < 0.05 was taken significant for all statistical analysis. we used satisfaction index (si) as suggested by guilbert. : si = [{ (a 1) + (b 2) + (c 4) + (d 5) } 20]/n ct computed tomography, mri magnetic resonance imaging, aiims - ibs 4 annual meeting of indian brachytherapy society where, a - d are total responses for the co - efficient 1, 2, 4, 5, respectively, and n total number of participants. satisfaction index was used for items 12 - 13 and the co - efficient 1, 2, 4, 5, respectively, correspond to strongly disagree, disagree, agree, and strongly agree. of a total of 202 attendees, 90 responded to the survey yielding a response rate of 44.5%. seventy - two percent of the respondents belonged to an academic institute (institute having radiation oncology teaching programme) while 28% belonged to non - academic / private institutes. 28.9% were post - graduate students, 13.3% were post graduate registrars, and rests of them were faculties. eighty - nine percent respondents used high - dose - rate, 14% pulsed - dose - rate, and 13% low - dose - rate brachytherapy facility. orthogonal x - rays, computed tomography (ct), and mri was used for brachytherapy planning by 56%, 69%, and 14%, respectively. thirty - six percent of the respondents strongly agreed to fact that the scientific content of the meeting pertained to the needs of the brachytherapy education ; while 56% agreed and 8% disagreed to this (mann - whitney ; p = 0.006). seventeen percent strongly agreed and 50% agreed to the notion that the scientific programme of the present meeting was comparable to the international conferences. at the same time, 33% disagreed to this notion (mann - whitney ; p = 0.023). satisfaction index to scientific content of the present meeting was 80% and si as compared to international brachytherapy meeting was 75%. ninety - six percent felt that initiative should be taken to start national and international fellowships for promotion of training in brachytherapy. ninety - seven percent desired to attend future national / international workshops / conferences on brachytherapy and 98% felt the need to include live workshops, hands on demonstrations, and video presentations in the scientific programme. descriptive analysis of participant 's response (n = 90) [items 6 - 11 ] the most liked presentation / session was debate (can intensity modulated radiotherapy replace interstitial brachytherapy in carcinoma cervix ?) followed (in that order) by video presentation session, lectures on interstitial brachytherapy for brain tumors, and interstitial brachytherapy for pediatric and soft tissue sarcomas. respondents were inclined towards changing their brachytherapy practices like use of ablative brachytherapy for liver, lung, and penile malignancies. participants also felt the need to start multi - institutional collaboration for trials on brachytherapy, initiate brachytherapy tumor boards in concert with surgical oncologists, and also involve residents by focusing on brachytherapy based thesis and phd projects. the respondents also felt the needs of the following for better educational experience from the brachytherapy dedicated conferences / workshops : hands on training and demonstration for limited groupslive pre - conference brachytherapy procedure workshopsvideo presentations on common as well as difficult brachytherapy proceduresquiz for the post - graduate residentsdebate topics and panel discussionsorgan specific / site wise workshops and symposiumscontouring sessions for image based brachytherapyradiobiology and physics topics pertaining to clinical and basic brachytherapy principlesinteractive / brain storming sessions with post - graduate students hands on training and demonstration for limited groups live pre - conference brachytherapy procedure workshops video presentations on common as well as difficult brachytherapy procedures quiz for the post - graduate residents debate topics and panel discussions organ specific / site wise workshops and symposiums contouring sessions for image based brachytherapy radiobiology and physics topics pertaining to clinical and basic brachytherapy principles interactive / brain storming sessions with post - graduate students teaching and training programmes are integral part of physician 's learning and helps in updating knowledge of the subject. scientific meetings having well designed programmes can bridge gaps in understanding of the subject and also update the knowledge regarding various aspects viz. clinical, biological, and technological advancements. it can further promote learning by motivating the physicians and also by encouraging self - directed learning in the long run. donald kirkpatrick published four level training evaluation models in 1959 and subsequently updated their work in 1994. the accepted levels of evaluation are : reaction, learning, behavior, and results. of these although, learning is best assessed by pre - post intervention test, this can also be reliably done with a retrospective questionnaire as has been used by us in this study. we intended to analyze the reaction as well learning, attitudes and practices of brachytherapy, and gain feedback from attendees in order to further improve future brachytherapy meetings. the majority of attendees belonged to academic institutes (70%), 30% of respondents were residents and this reflects the inquisitiveness of younger generation towards learning nuances of brachytherapy. fifty - three percent use orthogonal x - ray based treatment planning and this is corroborative with 43% members in united states. computed tomography and mri based brachytherapy planning in our study as compared to study by viswanathan. the discrepancy could be because of the different time points of survey and also overrepresentation of academic / teaching institutes in our study. brachytherapy is in true sense a multidisciplinary field and its practice has a learning curve. acquisition of skills, advancement of knowledge over time as well as clinical experience acquired with more number of cases can affect the ultimate outcome of the patients, and this has been proven by le fur. and liu. hence, it is important to infuse the interest of brachytherapy in the beginning of the radiation oncology teaching programme. while brachytherapy has been placed as a mandatory subject in the curriculum of postgraduate teaching / training program of radiation oncology in india, a structured brachytherapy curriculum with defined goal is lacking. a written and designed program directive was available to only 54% of the training residents in the study by gaudet.. in the same study, main barriers to brachytherapy education were lack of written guidance (55%), clinical workload (49%), and lack of time (37%). the barriers to practicing brachytherapy are mainly lack of infrastructure and inadequate training rather than insufficient patient numbers or absence of scientific evidence favoring brachytherapy. acquisition of skill in brachytherapy is a time taking process and it is disturbing to note physicians discontinuing practice of brachytherapy owing to reassignment and lack of a local program, and this could be as high as 49%, as noted in the canadian survey by rose.. the authors also noted that the common sites discontinued were head and neck cancers, cervical cancers, and endometrial cancers, and ironically scientific evidence for the use of brachytherapy in these sites are time - proven and robust. in another study by fumagalli., 82% of the residents felt that insufficient teaching has been imparted to them during residency and only 50% performed one brachytherapy treatment during residency. the interest of brachytherapy among residents in training is guided mainly by requirement of the accreditation council as well as the benefit of knowledge of brachytherapy in staff recruitment. found a decreasing trend in the mean number of brachytherapy procedures performed by residents (80.8 in 2006 - 2007 to 71.0 in 2010 - 2011) and also a decrease in the average number of interstitial procedures by 25%. the trend in decline of brachytherapy training experience should be an alert to the community of brachytherapy and avenues must be created to increase the interest as well as provide more opportunities for training.. suggested introduction of a formal credentialing and certification process in brachytherapy, and this was supported by 80% and 81% of practicing radiation oncologists and residents, respectively. although, a final solution of this issue may lie in bringing changes in the residency programs to better suit the needs of brachytherapy teaching, educational activities like conferences may be the initial motivating step. ninety - two percent in our survey felt that this conference has changed the way they perceive brachytherapy and 70% were likely to change their practice patterns after this meeting. eighty - four percent felt that regulatory authorities should approve comprehensive radiotherapy centres only if they have brachytherapy facilities, and this might improve the availability and indirectly the scope of skill development. brachytherapy has emerged as a competitive option to external beam therapy / surgery in many clinical situations [26, 27, 28, 29 ]. while modern external beam radiotherapy techniques can give an aesthetically appealing dose distribution, it can not match the dose conformity achieved with brachytherapy. ninety - two percent of the attendees committed to prefer brachytherapy to intensity modulated radiotherapy or stereotactic ablative radiotherapy in clinically relevant situations. novel and innovative indications of brachytherapy has also brought a state of dilemma in some of the physician 's mind, particularly those not adequately trained in brachytherapy. debates on cutting and controversial issues may be the best form to discuss and prove the most suited form of radiation modality, and it also leaves more impact on young mind of the residents. this is also supported by the results of our study ; most liked presentation in our study was debate comparing role of brachytherapy versus modern external beam radiotherapy techniques in the management of cervical cancer. this form of discussion should be encouraged at future brachytherapy meetings. with the technical advancement, use of phantom simulator for prostate and gynecological brachytherapy has been described by thaker. and de almeida.. other modes of teaching like video presentation, hands on training, and live demonstration might be very useful to attendees of the brachytherapy meeting. ninety - eight percent of the respondents in our survey also felt the need to include the same in brachytherapy meetings. satisfaction index for the scientific content of the present meeting as well as it 's comparison with international meetings were 80% and 75%, respectively. although use of si index for brachytherapy meetings is lacking, singh. used si index to evaluate their continued medical education program and found their program to have an index of 85 - 87% for various satisfaction endpoints. the current si index of our study reflects the effectiveness of the present scientific deliberations as well as scope for future improvement in the planning, conduct and content of the national brachytherapy meetings. overall, the meeting shows an impressive impact on the attendees in terms of gaining new knowledge, change in perception and attitudes towards brachytherapy as well as in terms of motivation for further educational activities. our study highlights the needs and demands of the practicing physicians and residents pertaining to brachytherapy. the views of the attendees reflect the need for courses directed towards practical skill development of brachytherapy. our study provides the program objectives to be kept in mind in the design and conduct of brachytherapy educational activity. hands on training and practical demonstration of brachytherapy procedures would stimulate interest as well as help in development of skill and confidence. the opinion of the attendees of the meeting might not be a true representation of the entire radiotherapy community interested in brachytherapy although a more approprate way of doing a survey is to include individuals from each single institution practicing brachytherapy, the hurdles of doing the above in reality are tremendous. there is no national database of the practicing radiation oncologists and membership to societies is also not universal. functioning brachytherapy facilities are limited in number and all institutions might not be accessible to these surveys. surveys of a specific community (like attendees of brachytherapy / workshop meeting) might be a quick and informative way to capture scenario and patterns of practice. surveyed the attendees of 7 american brachytherapy society prostate brachytherapy school and accepted the bias inherent to such surveys. a further follow up survey from these respondents would be able to assess the change in behavior and long term impact on the practice patterns arising out of this educational activity. nevertheless, this remains the only survey from india pertaining to brachytherapy attitudes and practices. the practice patterns reported in our study may be very useful for comparison with the internationally reported literature and may also provide insights in formulation and conduct future nationwide surveys. challenges and hurdles faced by us in brachytherapy teaching, training and education may not be unique to our country and in fact would be shared by many of the other countries where brachytherapy practice is sparse, diverse, and not standardized like ours. this is reflected by the absence of such surveys from other parts of the world except usa and canada. the results of our study would encourage other countries to take up these surveys and understand the knowledge, attitudes, and practices specific to them as well as common to ours. this may further yield solutions and ideas, which could be applicable in a wider sense. in summary, the survey highlights the attitude, perception, and practices of brachytherapy in india. majority use high dose rate brachytherapy facility and ct scan is the commonest imaging modality used for brachytherapy planning. results of our study would provide invaluable inputs in the design of not only brachytherapy teaching programs in institutes but also help in the design and conduct of training and educational programs pertaining to brachytherapy both in and outside india. the study was presented in abstract form as poster presentation (po 53) at the 36 annual meeting of the american brachytherapy society at florida, usa (april 9 - 11, 2015) ; brachytherapy 2015 : 14 (supplement 1) ; s-102 - 103. | purposewe performed a survey amongst attendees of the 4th annual meeting of indian brachytherapy society to study the patterns of brachytherapy practice and attitude towards brachytherapy use.material and methodsa 19-point questionnaire was designed and e - mailed to the attendees immediately after the conference. descriptive analysis of the responses were done and satisfaction index was used as a tool for evaluation of the program effectiveness. binomial test was used to assess the difference between distributions of responses and mann - whitney u test was used to assess the correlation between responses. p value (2-tailed) of < 0.05 was taken significant for all statistical analysis.resultsof a total of 202 attendees, 90 responded to the survey (response rate : 44.5%). seventy - two percent belonged to an academic institute while 28% belonged to non - academic institutes. eighty - six percent were radiation oncologists and 10% were medical physicists. eighty - nine percent respondents used high - dose - rate, 14% pulse - dose - rate, and 13% used low - dose - rate brachytherapy facility. orthogonal x - rays, computed tomography, and magnetic resonance imaging was used for brachytherapy planning by 56%, 69%, and 14%, respectively. ninety - three percent of them thought that lack of training is a hurdle in practicing brachytherapy and 92% opined that brachytherapy dedicated meetings can change their perception about brachytherapy. seventy percent respondents admitted to make some changes in their practice patterns after attending this meeting. ninety - seven percent of them would like to attend future meetings and 98% felt the need to include live workshops, hands on demonstrations, and video presentations in the scientific programme.conclusionsthe survey highlights a positive attitude towards increasing brachytherapy use, and may serve as an important guiding tool in designing teaching and training programmes ; thus overcoming the hurdles in successful and widespread use of a quality brachytherapy programme at radiotherapy centers. |
the hiv / aids epidemic has become the world 's most destructive epidemics recorded in history. the number of people living with hiv worldwide was estimated to be 33.4 million. sub - sahara africa accounts for 22.4 million and remains the region most heavily affected by hiv with an adult prevalence rate of over 15% in some countries. the majority of those infected in sub - saharan africa are unaware of their status. the first reported case of aids in zimbabwe occurred in 1985. by early 1990s around 10% of the adult population this figure rose dramatically in the first half of the 1990s, peaking and stabilizing at 29% between 1995 and 1997. although survey results do indeed indicate a fall in zimbabwe 's adult hiv prevalence, a rise in the number of people dying from aids is thought to have played a role in the decline, as well as an increase in the number of people (hiv positive or otherwise) who might have migrated to other countries. nonetheless, there is evidence that zimbabwe 's hiv prevalence has genuinely fallen and that changes in sexual behaviour have played a role in achieving this. it is thought that an increased awareness of hiv and aids has influenced these changes. condom use has increased, a number of young people are delaying first sex, and many people have reduced their number of sexual partners. in many cases, people changed their behaviour after witnessing the effects of the epidemic first hand, through the death of friends or relatives, and this was helped by hiv / aids prevention programmes like home - based care. the data shows that overall hiv prevalence among pregnant women who attended antenatal clinics decreased from 23% in 2001 to 11% towards the end of 2009. economic epidemiology, which is a field at the intersection of epidemiology and economics, can influence hiv / aids policy decisions. its main aim is to incorporate principles of individual behaviour, incentives for healthy behaviour, resource optimization, resource allocation, and simple economics into epidemiological models and conversely the dynamics of infectious diseases into health economics. economic epidemiological modelling can provide a key input in decision making since it has systematic and quantifiable assessments for different intervention strategies. economic evaluation concepts need to be employed to ensure that any new resources for the epidemic will have the maximum possible effect on the epidemic. one of the concepts involved is cost information which is a measure of both cost and cost - effectiveness. for efficient allocation of hiv / aids resources, decision makers must understand better the impact and cost - effectiveness of hiv / aids prevention and treatment programs. therefore, cost - effectiveness should be considered when designing strategies for prevention, care, and support for hiv / aids. there is very little compiled information on the relative cost and likely impact of each intervention in different settings either individually or in combination. while there have been some reviews of hiv / aids prevention strategies with cost - effectiveness analyses (see, for instance, [912 ]) very few have combined mathematical epidemiology and economic modelling in assessing the cost - effectiveness of prevention and treatment strategies. many mathematical models that incorporate a number of strategies to combat the epidemic have been developed [4, 1315 ] and the references cited therein. however, resources to be used to implement and maintain these strategies must be measured, valued, and costed. it is also important to know the health benefits, like number of infections averted, number of deaths averted, life years gained, and the cost of achieving these benefits. strategies developed to control the spread of hiv include different forms of behavioural change and communication, voluntary counselling and testing, promotion of male and female condoms, harm reduction strategies among drug users [4, 1315 ], and the references cited therein. in poor resource settings, the model of care of people living with hiv / aids (plwha) has shifted from hospital care to community home - based care (chbc) because of shortage of space in hospitals and lack of resources. these programs are run through resources that have to be allocated with other care programs and social needs in mind. the question that arises is how best can we allocate the few available resources and at the same time derive maximum benefit from each of the prevention and care programs ? this question can only be answered by a combination of a mathematical model that incorporates prevention and care programs with economic modelling on resource allocation. the model and its equations are given in appendix b while the description of state variables and parameters is given in appendix a. this paper ensures that economic epidemiology principles take the centre stage in analysing the cost - effectiveness of the prevention strategies and treatment. while some strategies are very cost - effective in the short term, they may be costly and unsustainable if implemented over a long period of time. other strategies are costly in the short term ; their long - term benefits may reduce the costs due to their impact in controlling the epidemic. therefore, the aim of the paper is to compare the costs and benefits of the different types of strategies with particular reference to the hiv / aids epidemic in zimbabwe. we use this epidemiological model to track the economic costs which account for the economic consequences of the epidemic. the model assesses the impact of four strategies : voluntary counselling and testing (vct), vct combined with hospitalisation, vct combined with chbc, and a combination of the three strategies. the results presented in showed that a combination of all the intervention strategies gives the best result followed by the vct and hospitalisation, vct and chbc, and vct alone. the thrust of this paper is to compare the cost - effectiveness of these strategies and verify whether their impact in the given order is cost - effective. the total health benefits and costs of the three strategies are analysed to determine how combinations of various factors affect the cost - effectiveness of the strategies. this helps to quantify years of perfect health gained, measured as quality - adjusted life years (qalys), and the burden of the disease analysis on the human population measured in terms of disability - adjusted life years (dalys) lost, that is, years of perfect health lost. to determine whether the added effectiveness in the different interventions is worth the added cost, cost - effectiveness ratio will be calculated in the form of the incremental cost - effectiveness ratio (icer). in epidemiological modelling, the main goal is to deduce conditions necessary and/or sufficient for disease elimination and/or eradication. to achieve this we use the basic reproduction number r0. it has a threshold value of 1, below which the generation of secondary cases is insufficient to maintain the infection within the human community. if r0 > 1, each infected individual produces more than one new infected individual and hence the disease is able to invade the susceptible population. in the presence of an intervention strategy, we have an effective reproduction number, re, which has to be compared with r0. from the epidemiological model in, re is a sum of four terms representing the contributions of the unidentified infective individuals, the screened and identified infected individuals, the aids individuals, and plwha under community home - based care. the different interventions are represented by different effective reproduction numbers which are as follows : no interventions, r0, screening and counselling only, res, screening and counselling coupled with hospitalization, resh, screening and counselling coupled with chbc, reshb, and finally screening and counselling, hospitalization, and home - based care represented by re and this is shown in appendix c. it was shown that (1)re < resh < reshb < res < r0, showing that the most effective intervention is using a combination of all the suggested interventions followed by voluntary counselling and screening accompanied by hospitalization and voluntary counselling and screening alone is the least effective intervention., the model was fitted to the current prevalence data on zimbabwe from the unaids / who reports and epidemiological fact sheets [23, 24 ] and, using the least squares curve fitting in matlab, the lower and upper bounds of specific parameters to be estimated were specified and they are given in table 9. zimbabwe 's population was estimated to be 10.156 million in 1990, with a life expectancy of 59 years by the united states bureau of the census. the estimated adult hiv prevalence was from the age group 1549 and this was used to estimate the initial population of adults aged between 15 and 49 in 1990. the following initial conditions (2)(s(0),i(0),is(0),a(0),h(0),hb(0)) = (4519960,550000,50000,100000,3640,36400), corresponding to an initial prevalence of 14%, were used. the same data was used to estimate the annual number of new infections generated and the mortality rate. the incidence and mortality were evaluated from the following expressions : (3)incidence=em(1a+2h+3hb) (i+(1p)(1is+2a+3(1)hb)n)s, mortality=(1a+2h+3hb)n. it was shown that if more identified infective individuals join the chbc, that is, increasing 1, the rate of seeking care and treatment from chbc, the prevalence of the disease decreases such that doubling 1 reduces the prevalence by 1.3%, from 8.2% to 6.9%, and a four - time increase in 1 will reduce the prevalence by 3%. however, increasing the rate of seeking care and treatment from chbc of discharged aids individuals from the hospital, 2, increases the prevalence of infection implying that recruitment of discharged individuals from hospitals into chbc has a negative impact if the individuals remain a potential source of infection. this means that reducing the infectivity of individuals in chbc should remain the main focus of the care program for effective disease control. it was also shown that if more people withdraw from risky sexual behaviour and the effectiveness of chbc is increased, that is, increasing p and, respectively, the prevalence of hiv decreases. since intervention strategies are designed to change the course of an epidemic, that is, reducing the number of new infections and preventing deaths, the number of primary infected individuals before any intervention was estimated to be 4.9819 10 per year. the annual number of deaths on average when there is no intervention was 1.3755 10. these estimates were done by using a fourth order runge - kutta scheme in matlab. these are used to estimate the burden of disease and help in the public health planning policy. the economic impact is assessed in terms of cost and cost - effectiveness of the different intervention strategies. this involves cost measures for each strategy and the different economic evaluation methods which will be discussed in the next sections. since voluntary counselling and screening is the common strategy which is in place, in our cost - effectiveness analysis, we take vct as the existing strategy in addition to the no intervention basis. in measuring costs, we identify the resources to be used, quantify them, and place a monetary value on them. we calculate and compare the costs of interventions per health outcome achieved to meet social objectives, that is, maximization of total population health. no monetary value is assigned to outcomes but rather results are presented in the form of cost per health outcome, like costs per hiv infection averted and cost per life saved. costs of all resource inputs and existing infrastructure are indirect and intangible costs including the pain of suffering (morbidity) to the patients and their families which are difficult to measure since they do not have a market value. morbidity and mortality (death) costs are captured in the calculation of the cost - effectiveness ratio. since costs fluctuate with time, in economic analysis there is discounting of the costs for the particular period and this discount rate is normally between 3% and 5%., all future costs and effectiveness values must be discounted into their net present value. although standards vary from country to country internationally, many studies use a 5% discount rate. we assume that one way of showing change of behaviour, which is represented in the epidemiological model by the proportion of individuals who withdraw from risky sexual behaviour, p, is by the use of condoms. a proportion i, i = 1,2, 3,4, 5 from the sexually active population of susceptible, unidentified infective, screened infective, symptomatic individuals with aids and those in chbc, respectively, are assumed to use condoms. thus, the cost of condoms, cc, is proportional to the total number of sexually active individuals at any given time. the cost of screening, cs, is associated with the fraction of infected individuals who choose to be screened and counselled and the proportion of the individuals with clinical aids who will be screened from both the unidentified infective individuals i and the screened and counselled is moving into the aids class. screening is performed in primary care clinics and nongovernmental organisations (ngos) centers or at chbc centers for anyone who requires the service. we assumed that individuals can go for screening twice a year at cost of $ 10 per test. the costs, cah, of treating those who would have developed clinical aids and are hospitalized are determined by the proportion of the individuals who will be hospitalized having developed clinical symptoms of aids. these costs include the overhead costs of medicines for treating opportunistic infections like tuberculosis, cost of antiretroviral therapy, cost of hospital bed, and palliative care. since we do not have any data on the management of the aids patients admitted in the hospitals and those who seek treatment from home - based care institutions, we make estimates based on costs from literature. costs for home - based care, supply of structured arv treatment, and other medical treatments are chb. the costs of running home - based institutions and other related administrative issues, training peer educators, and printing booklets and other related materials are taken to be cr. all the costs are annual cost to prevent and/or treat an individual in a particular disease stage. therefore, the total cost rate function, c(t), (in us $ per unit time) at time t, is given by (4)c(t)=cc[1s(t)+2i(t)+3is(t)+4a(t)+5hb ] + cs[i(t)+1i(t)+2is(t) ] + caha(t)+chbhb(t)+cr. the total costs, ctc, are the cumulative costs spread over 19 years, from 1990 to 2009. the total discounted economic costs are calculated using a discount rate of 5% which is very consistent with contemporary standards in developing countries. the total discounted economic costs per person, direct costs of treatment, and prevention costs over the period of 19 years are given by (5)ctc=019c(t)ertdt, where r is the discount rate. one of the health outcomes (health benefits) is the quality - adjusted life years (qalys). it is a reflection of the valuation that a year of life with hiv infection is less desirable than a year of life without hiv infection and a year of life with asymptomatic hiv infection is more desirable than a year of life with symptomatic hiv infection. therefore, individuals who benefit from an intervention program that moves them from a lesser health state to an improved health state for some period of time will have gained and enjoyed better health. health benefits are measured by the duration of life years gained as a result of an intervention. using the epidemiological model in appendix b, the summation method was used to calculate the qalys using the appropriate weights from the literature. to make a decision on which intervention to choose, we first calculate a cost - effectiveness ratio (cer) in the form of incremental cost - effectiveness ratio (icer). the effectiveness of an intervention is measured in terms of qalys or just infections averted. this depends on the epidemiological and demographical factors and the capacity to implement the strategy. the icer is more relevant when there is more than one intervention strategy to be considered because it helps policy makers to decide whether to remain with an existing intervention or adopt a new intervention. the interventions considered in this paper depend on vct and therefore we consider vct combined with hospitalization and vct combined with community home - based care. finally we analyse the combined interventions, that is, all the three applied together. to determine the cost - effectiveness of each suggested strategy, we take vct as the existing intervention and then calculate the incremental cost - effective ratio (icer) since all the other proposed strategies rely on vct. at this point, it is understood that a number of people are aware of the vct programs and therefore we use the icer as our measure to determine cost - effectiveness of the interventions. we calculate the total discounted qalys lived by the population in a particular disease stage using the following equation : (6)q(t)=019j=0j=3 i=0i=5qivij(t)ertdt, where qi are the qaly adjustment for a year of life in a particular disease stage vi and number of interventions j. no intervention, vct only, vct and hospitalization, vct and chbc, and all interventions are represented by j = 0,1, 2,3, respectively. this means that if j = 1, it implies vct only, if j = 2, that means either vct and chbc or vct and hospitalization, and finally if j = 3, we have vct, hospitalization, and chbc. the values of qi vary from 0.171 in the hospitalized class to 1 (representing perfect health in the susceptible class). the total discounted costs and qalys gained are determined for single or / and combined interventions as well as for no intervention at all. the difference in the total discounted costs and qalys accrued in the population with and without interventions is also considered. input data was obtained from the numerical simulations of the epidemiological model which was fitted to the hiv prevalence data for zimbabwe. the economic parameter values are given in table 1 and the epidemiological model parameters are in table 9. the general dynamics of the epidemic based on the information in table 9 is shown in figure 1. for example, the change in the population of individuals taken into chbc, hospitalized, with aids, and those who are screened can be tracked annually for the purposes of estimating the burden of disease and public health planning. in figure 1(a) the epidemic remains within the population at low levels with most of the infected turning to home - based care facilities. the number of the identified and screened infective individuals increases and then declines as more of them join the community home - based care. however, in the long run, as shown in figure 1(b), the population will have more susceptible individuals remaining compared to the other groups of the population. the costs of each strategy can also be tracked over the number of years once the number of individuals in each epidemiological class can be tracked annually. figure 2(b) shows the change in the costs for each strategy over the 19 years (figure 2(a)) and 30 years (figure 2(b)). figure 2 shows that costs are saved as a result of infections being averted and this is indicated by the costs decreasing with time annually. in the long run the cost of implementing the combined strategies is cheaper than vct and hospitalization. to evaluate the number of infections and deaths averted, we consider two scenarios ; firstly we consider a situation where there is no behavior change, that is, m = 0, and secondly we consider a situation where there is behavior change, that is, m 0. we assume that mortality due to aids drives behaviour change as people endeavor to avoid getting infected. the number of infections and deaths averted is calculated as the difference between the infections or deaths when there is no intervention and when there is an intervention singly or in combination. for the given parameter values in table 9, when there is no change of behaviour, the infections (49 632) and deaths (1.76 million) are more than when there is behaviour change, so that they are 42 849 and 1.38 million, respectively, per year with no intervention. this shows that mortality due to aids influences people 's behaviour resulting in the reduction of transmission. all the interventions, individually or in combination, reduce the number of deaths due to the disease. we note that the greatest number of infections and deaths averted is from the implementation of all intervention strategies and the least is from an intervention with vct only. the implementation of vct and chbc prevents more infections and deaths than vct and hospitalization. therefore, the strategy with vct and chbc is both cheaper and effective in reducing the number of infections compared to the strategy with vct and hospitalization as can be seen by the costs of infections or deaths averted. depending on the availability of funds for the intervention strategies, implementing all the suggested strategies will depend on their cost - effectiveness. these results are used in the determination of the cost - effectiveness of the interventions. taking vct as the existing intervention, the icers for the vct plus hospitalization, vct plus chbc, and all are calculated and shown in table 2. this helps us to determine the cost - effectiveness of each suggested strategy by determining the increase in cost for each strategy used instead of vct only. the total discounted costs and infections averted per year for each strategy are presented as a point on the cost - effectiveness plane in figure 3. from the icer analysis in table 3 and figure 3, all the programs are potentially efficient as they all increase the infections averted but at a higher cost. a decision to choose a strategy which represents good value for money is often difficult to make but the cost - effectiveness graph in figure 3 becomes handy. the icer represents the gradient of the line connecting the program outcome to vct on the cost - effectiveness graph. the program which has the lowest gradient or with flatter slope is the most cost - effective. this implies that implementing all the intervention strategies will be the most cost - effective strategy since the incremental cost, $ 31 798, per infection averted, is the lowest followed by vct and chbc ($ 45919 per infection averted) with vct and hospitalization having the largest incremental cost over vct. it is the relative costs, not total cost of the strategy, that are most important. we see that while implementation of the intervention strategy all costs more, it is its incremental cost to vct compared to the other strategies which matters. discounted qalys per year and cumulative qalys for 19 years and 30 years are calculated. figure 4 shows the trend of the discounted qalys per year and cumulative discounted qalys for the various single or combined intervention strategies to control the hiv / aids epidemic. the discounted qalys per year decrease as the epidemic is decreasing with time as shown in figures 4(a) and 4(b). the cumulative discounted qalys show that implementing strategy all brings in more health benefits, followed by vct plus hospitalization with vct giving the least number of qalys. the cumulative discounted qalys also decrease with time as shown in figure 4(d). to determine the cost - effectiveness of the strategies, we calculated the icers taking vct as the existing strategy. table 3 shows annual cost outcomes and the discounted qalys per year for all the strategies. the icer taking vct as the existing strategy was calculated and this helps policy makers to decide whether to remain with vct only or choose vct with the other combinations. strategy all is the most cost - effective since its incremental cost is $ 35.40 per qaly gained followed by vct plus chbc and $ 50.75 per qaly gained with vct plus hospitalization being the least cost - effective with $ 62.43. the discounted qalys and the discounted costs for each strategy are represented by a point on the cost - effectiveness plane in figure 5. it can be seen, from figure 5, that all the strategies are potentially efficient being in the feasible plane of the cost - effectiveness plane where the strategies may be implemented. the icer is represented in the cost - effectiveness graph by the slope of the lines joining the different strategies to vct which is the existing strategy. from the graph in figure 5, the line joining vct to all has the lowest gradient followed by vct to vct plus chbc with vct plus hospitalization having the highest gradient. therefore, strategy all is the most cost - effective strategy compared to the other two. this implies that implementing a combination of vct, hospitalization, and chbc gives better value for money. however, the decision to choose an efficient strategy from other efficient strategies depends on the maximum amount policy makers are willing to pay for the qalys. the ranking of the interventions is re < resh < reshb < res < r0, which slightly differ with the result, re < reshb < resh < res < r0, which was obtained from the analysis of the reproduction numbers of the epidemiological model. while vct plus hospitalization is more effective than vct plus chbc in the epidemiological model, it is not cost - effective. therefore, interventions implemented concurrently are cost - effective as shown by the effective reproduction number re in the epidemiological model. we examine the sensitivity of the rankings of the strategies to the variation of some of the key parameters. we varied the proportion, p, of individuals who withdraw from risky sexual behaviours. we also varied the efficacy,, of home - based care since the introduction of home - based care is the novel part of the model. we also test the transmission contact rate,, since all these strategies aim at reducing the number of infections which are all dependent on. we varied all these parameters from 20% to 95%. we test the sensitivity of these parameters on the cost - savings and qaly - savings associated with the intervention strategies. the results varying the proportion p, showing the costs and qalys, are shown in tables 4 and 5, respectively. if more people withdraw from risky sexual behaviour, the costs for all the interventions are reduced. for example, if the proportion increases from 20% to 50% for the combined strategy, all, the costs are reduced by about 10.5%. the reduction will be about 13.7% if p changes from 20% to 95%. this implies that there is need for more educational campaigns to encourage people to refrain from risky sexual behaviour. health benefits from the strategies increase with an increase in the number of sexually active people practicing safe sex. the benefits increase by about 6.4% for a change in p from 20% to 95%. the parameter, home - based care efficacy, only affects the interventions which include home - based care. the more efficient the home - based care programmes are, the less the expenses they incur. an increase of efficacy from 20% to 75% gives a reduction in cost of 1.7%. a reduction of 2.4% in costs is obtained for an increase from 20% to 95% in efficacy. thus, there is an inverse relationship between the cost and the efficacy of chbc. an increase in the efficacy of the community home - based care programs leads to an increase in the health benefits as shown in table 6. in both vct plus chbc and all there is an increase in the number of discounted qalys as the efficacy of the chbc increases. in table 7, a decrease of the contact rate from 95% to 20% will result in a decrease in cost of 55.3%. on the other hand, if we begin with a situation, where the contact rate is low, an increase from 20% to 95% will result in an increase in cost of 123.6%. this shows that the transmission contact rate,, has the greatest impact in the changes in both costs and health benefits accrued. health benefits, measured in discounted qalys, have an inverse relationship with the transmission rate. in all the intervention strategies, a decrease in the contact rate results in an increase in the discounted qalys. for example, for the strategy all, a reduction in contact rate from 95% to 20% will result in an increase in the discounted qalys of 35.9% as shown in table 8. in this paper we evaluated the costs and benefits of hiv / aids intervention strategies using an interdisciplinary approach which weaves together the techniques of an epidemic transmission model, economics, and cost - effectiveness analysis. the intervention strategies considered are voluntary counselling and testing (vct), vct combined with hospitalization, vct combined with community home - based care (chbc), and finally vct combined with hospitalization and chbc (all). however, since vct is the basis for all the intervention strategies suggested, this boils down to comparing chbc and hospitalization singly or in combination. the interventions ' costs and benefits were evaluated singly or in combination or when they are implemented concurrently. the main objectives were to find the most cost - effective strategy and compare the results with the epidemiological results in. our study results indicated that implementing all the strategies concurrently is the most cost - effective followed by vct plus chbc followed by vct plus hospitalization. while vct and h has slightly more health benefits and more effective in reducing the number of infections, its icer is more than that of vct and chbc. our results are also consistent with the epidemiological model results which also had more or less the same ranking of the strategies. they however differ in the fact that the vct plus hospitalization is more effective in the epidemiological model but costly than vct and chbc. while the epidemiological model used the model reproduction number to determine the impact and ranking of the strategies, the economic model used the cost - effectiveness analysis concepts to determine the same results. data from the disease progression of the epidemiological model was used to determine the cost and benefits of the various strategies. our results also show that behaviour change, modelled by the parameters p and m, that accompanied the strategies, influences both the cost - effectiveness of an intervention strategy and dynamics of the epidemic. both parameters are to do with behaviour as m indicates how individuals respond to the deaths of relatives, friends, and neighbours. this will then lead to the individual withdrawing from risky sexual activities, thus increasing the proportion p of the sexual active individuals withdrawing from risky sexual behaviour. if there is no change of behaviour, our results show that the intervention strategies are more costly and reduce the number of qalys whereas if there is behaviour change the costs are reduced and the qalys increased. the transmission contact rate,, is the most sensitive parameter which affects the epidemic size and the cost - effectiveness of the strategies. the results showed that a decrease of from 95% to 20% will result in a decrease in cost by 55.3% and a corresponding increase in qalys of 35.9% for the all strategy. the increase in effectiveness of chbc measured by efficacy will also reduce the cost and increase the health benefits measured by the qalys. for example, we assumed that aids individuals discharged from hospitals are the only ones who go to community home - based care ; yet it seems possible that the majority of aids individuals will access chbc rather than going to the hospital. secondly we assumed that an individual in chbc is not admitted in the hospital. as a result of these assumptions our costs are bound to be affected since if more people living with hiv / aids (plwha) are admitted in hospitals this will increase the costs although it is likely to increase the qalys. thirdly our estimates on the costs involved in the home - based care programs need to be verified within the particular setting and this will require us to revisit our results which indicate that vct and chbc are more cost - effective than vct and h. lastly it is also important to note that data on risk sexual behaviour are not certain since they depend on self - reports which are difficult to verify. as pointed out in the type of data may be related to age and this requires a further study. decisions to implement a particular strategy are not only dependent on cost - effectiveness criteria but also dependent on other factors such as, what the policy maker is willing to pay and considers to be for money. political commitment and infrastructure are some of the factors which must be taken into consideration. however, despite these limitations evidence on the cost - effectiveness presented in this study can help to inform decision makers which intervention strategies they can implement. as klein. noted, this study shows that interdisciplinary collaborations can help in improving the accuracy of predictions of the course and cost of the epidemic and help policy makers in implementing the correct strategies. | the model of care of people living with hiv / aids (plwha) has shifted from hospital care to community home - based care (chbc) because of shortage of space in hospitals and lack of resources. we evaluate the costs and benefits of home - based care and other hiv / aids intervention strategies in zimbabwe, using an interdisciplinary approach which weaves together the techniques of an epidemic transmission model and economic evaluation concepts. the intervention strategies considered are voluntary counselling and testing (vct), vct combined with hospitalization (h), vct combined with chbc, and all the interventions implemented concurrently. the results of the study indicate that implementing all the strategies concurrently is the most cost - effective, a result which also agrees with the epidemiological model. our results also show that the effectiveness of a strategy in the epidemiological model does not necessarily imply cost - effectiveness of the strategy and behaviour change, modelled by the parameters p and m, that accompanied the strategies, influencing both the cost - effectiveness of an intervention strategy and dynamics of the epidemic. this study shows that interdisciplinary collaborations can help in improving the accuracy of predictions of the course and cost of the epidemic and help policy makers in implementing the correct strategies. |
transesophageal echocardiography (0), illustrating multiple round, oval, irregular, and well - demarcated masses on the anterior leaflet of the tricuspid valve http://jthc.tums.ac.ir/index.php/jthc/article/view/698/417 transesophageal echocardiography (139), demonstrating multiple round, oval masses with a small stalk on the anterior leaflet of the tricuspid valve http://jthc.tums.ac.ir/index.php/jthc/article/view/698/418 | abstracta 56-year - old man was admitted to our hospital for coronary artery bypass graft surgery. preoperative transthoracic echocardiography revealed thickening of the anterior leaflet of the tricuspid valve, and transesophageal echocardiography showed oval and irregular - shaped masses, featuring well - demarcated borders and a homogenous texture, attached to the atrial side of the anterior leaflet of the tricuspid valve with a small, tiny, mobile stalk. in the operating room, this mass was resected and gross anatomical examination showed multiple finger - like fronds attached to the stalk. when it was placed in saline, the mass revealed typical sea anemone, suggestive of papillary fibroelastoma. although echocardiography had been previously conducted for routine preoperative evaluation, this incidental finding significantly changed the surgical plan. |
periacetabular osteolysis is a major complication following total hip arthroplasty and can be a cause of component loosening and periprosthetic fractures 123). although osteolysis through polyethylene wear particles can increase the morbidity and compromise revision surgery, patients often remain clinically asymptomatic until extensive osteolysis has occurred and if clinical symptoms develop45), revision surgery can be troublesome and cause component loosening and extensive bone loss 6). in addition, even though there may be a considerable amount of osteolysis, well - fixed and stable prosthesis can remain asymptomatic until a periprosthetic fracture occur. for these reasons, the ability to accurately assess and visualize the position and volume of periacetabular bone defects is paramount for clinical observation and medical treatment, as well as preoperative planning of revision surgery, and periodic radiographic follow - ups are essential 478). plain radiographs in the diagnosis of osteolysis are the most widely used technique due to low - cost and easy access. however, it is generally accepted that plain radiographs are not sufficiently sensitive for the reliable detection of the presence or extent of periprosthetic osteolysis because the measurement of lesion size and location is often incorrect, and thus, the amount of bone loss can be underestimated 910111213). metal artifact - reducing software, including the current three - dimensional computed tomography (3d - ct) system has been found to provide a sensitive and accurate way to measure the location, and volume of osteolysis1012). some previous studies involving two - dimensional radiograph measurements of polyethylene wear and computerized tomography demonstrated that there was a correlation between the size of the osteolytic lesion and the amount of polyethylene wear141516), while other studies involving 3d - ct studies reported that there was no correlation or poor correlation101112). until now, there have been many studies about sequential analysis of periacetabular osteolysis with 3d - ct after primary total hip arthroplasty. however, there has been no research about the accuracy of ct based on measuring the in vivo real osteolytic volume and the polyethylene wear at the time of revision surgery. in this study, we evaluated the reliabilities of measurement of polyethylene linear and volumetric wear in plain radiographs, and the volume of acetabular osteolytic lesions on 3d - ct for comparing to the intraoperative real osteolytic volume. twenty - three patients who had undergone revision surgery due to periacetabular osteolysis from january 2006 to november 2011 at inha university hospital (incheon, korea) were enrolled. all patients received primary cementless total hip arthroplasty between may 1994 and july 2005 at the same hospital. three patients have mild symptom including pain, limitation of motion, but other patients had a relatively well functioning total hip arthroplasty and follow - up regularly at our hospital and met the following inclusion criteria : (1) there was evidence of periacetabular osteolysis on plain radiographs ; (2) there was no evidence of acetabular cup loosening ; and (3) all patients received revision surgery due to severe osteolysis on 3d - ct. in this study, all patients were selected with inclusion criteria, not randomly. we have defined severe osteolysis as the fixation of an implant which has been compromised by the lytic processes immediately before implant loosening develops. the mean age of patients at the time of surgery was 55.2 years (range, 45 - 65 years ; standard deviation [sd ], 13.607) with a male / female ratio of 17:6. the mean time interval between the primary total hip arthroplasty and revision surgery was 13.3 years (sd, 4.151). the reasons for primary surgery were osteoarthritis in 10 hips, osteonecrosis of the femoral head in 7 hips, post - traumatic arthritis in 3 hips, sequelae of pyogenic arthritis in 2 hips, and sequelae of tuberculosis arthritis in 1 hip. we used cementless acetabular cups (duraloc ; depuy, warsaw, in, usa) and standardized polyethylene liners (enduron, depuy), and extensive porous coated femoral stems (aml, depuy) (fig. to measure the polyethylene wear accurately, the anteroposteror views of the bilateral hip joint taken immediately (fig. 1b) and annually afterward were imaged on a computer using a powerlook 2001xl flat bed imaging scanner (umax data systems, taipei, taiwan). the images were analyzed applying a computer assisted vector wear analysis program (university of chicago, orthopedic surgery, hip analysis program version 4.0) developed by martell and berdia 17) at the chicago university(fig., the polyethylene wear was measured at annually. for checking accuracy of our technique, generally, the ct appearances of focal osteolysis were round, oval, and multilobular osteolytic lesions with discrete, smooth, or irregular margins. they were filled with soft tissue mass, which tended to displace the adjacent soft tissue rather than to infiltrate it. high - resolution spiral ct scans (ct scanner, mdct, 16 channel somatom sensation 16 ; siemens, berlin, germany) were used to identify and measure the volume of acetabular osteolytic lesions and the mean time interval between primary surgery and ct scan was 11.6 years (range, 6.4 - 16.3 years ; sd, 3.952) (fig. scans of the hip were made from the top of the sacroiliac joint (6 cm proximal to the acetabular component) to the distal end of the femoral components for checking osteolysis of acetabular component and distal femoral component. osteolysis was defined as a demarcated nonlinear lytic lesion measuring greater than 3 mm in diameter. in this study, we use the 16-channel multidetect helical 3d - ct which is possible to obtain an image 356356 mm field of view by 2 mm thickness and 0.0 mm gap. and we obtain the resolution of the image by using the 120 kvp tube voltage and 101 mas tube current (table 1). osteolytic images obtained in the axial plane were reconstructed to a 3d osteolytic volume using 3d software (rapidia 2.8 ; infinite, seoul, korea) (fig. 1f). a medium bone algorithm which is a bone kernel with a mid - range edge enhancement algorithm, was used to correct for image degradation caused by hip prosthesis. to check reproducibility, after the previous acetabular cup was removed, all osteolytic lesions were curretted. the morcellized allo - cancellous bone (femoral head, proximal tibia, distal femur) the last - sized reamer compressed the impacted bone, turning in reverse orientation. the acetabular cup, 2 - 4 mm larger than last - sized reamer, was press - fitted and more than 2 additional screw fixations were done to obtain stability. intraoperative real osteolytic volume was calculated as the sum of the volumetric increments of the acetabular cup and the impacted cancellous bone volume was in a proportion of 1.6 g / cm. although original cortical bone density was 1.8 g / cm, cortical bone density in the course of the press is difficult. linear regression was performed to calculate the correlation between (1) the radiographic linear and volumetric wear rate measured by a computer assisted vector wear analysis program ; (2) periacetabular osteolysis measured by ct ; and (3) intraoperative real osteolytic volume was calculated as the sum of the volumetric increments of the acetabular cup and the impacted allo - cancellous bone volume. mann - whitney u test and pearson 's correlation coefficient analysis was used to determine if there was a significant relationship between each measurement. all data analysis was performed with use of spss statistical software (version 8.0 ; spss inc., the mean annual linear wear rate was 0.45 mm / year and using our technique, the mean accuracy was 4.88%10.9%. the mean pelvic osteolytic volume of the 23 patients on 3d - ct scans was 30.469 cm (range, 13.432 - 93.098 cm). the mean weight of allograft bone was 52.5 g (range, 0 - 140 g) and the equivalent mean volume was 32.812 cm (range, 0 - 113.04 cm). the mean volumetric increment of cup size was 47.4 mm (mean primary cup size, 55.6 mm ; range, 48 - 64 mm ; mean revised cup size, 59.1 mm ; range, 50 - 66 mm). the mean sum of impacted bone volume and the volumetric increment of the cup was 33.286 cm. a weak correlation was found between the mean linear wear rate of polyethylene liners measured on plain radiographs and osteolytic volumes measured on 3d - ct with no statistically significance (r=0.18, p=0.938) (fig. the correlation between the mean linear and volumetric wear rate of polyethylene liners was weak with no statistically significance (r=0.206, p=0.359) (fig. a strong and significant relationship was found between osteolytic volume measured on 3d - ct and the sum of the volumetric increments of acetabular cups and impacted allo - cancellous bone volume with a statistical significance (r= 0.773, p<0.001) (fig. the realationship between sum of the volumetric increments of acetabular cup and impacted allocancellous bone volume and osteolytic volume were measured on 3d - ct. in most of the cases, revised cups were larger than previous cups and we considered that the volumetric increments of acetabular cup might influence the measurement of the osteolysis. hence, we calculated the new calibration parameters (sum of the volumetric increments of acetabular cup and impacted allocancellous bone volume). this new parameter yielded a strong correlation with osteolytic volume measured on 3d - ct (r=0.773, p<0.001). c (osteolytic volume measured on 3d - ct)c ' (grafted allo - cancellous bone volume)+/2 (a - b) (volumetric increments of acetabular cup) to correspond to this equation [/2(a - b)c - c ' ], periacetabular osteolysis should occur enough to encircle the cup and medial migration of the cup should not occur. in this study, the goal of this study was to assess whether 3d - ct is useful for the evaluation of osteolysis, not to determine the prevalence of osteolysis in patients who have undergone total hip arthroplasty. although we still consider plain radiography to be the most practical and important method of the postoperative evaluation of total hip arthroplasty, but radiologically we think that 3d - ct is more useful tool for evaluation of osteolysis in total hip arthroplasty. because plain radiographs can not detect all periacetabular osteolytic lesions and are a poor predictor of lesion size but, 3d - ct scan provided more accurate information about presence, location, and extent of osteolysis than did plain radiography. in order to treat osteolysis, a worn polyethylene liner should be replaced with a new one, or a bone grafting should be performed through an opening of a cup when there is osteolysis around the screw. in the current study, we used a treatment protocol in which all cups were removed, because there were three symptomatic patients and all most patients with severe osteolysis of a stage immediately before loosening of implants. in addition, young patients need reoperation in the future because the cup was removed was replaced with ceramic on ceramic articulation. in the current study, it is substantially higher than several other published studies (looney.11), 3 cm ; puri.12), 4.9 cm ; egawa.18), 19 cm ; howie.19), 10.9 cm). unlike previous studies which evaluated prospective patients who did not receive revision surgery, this current study included patients who received revision surgery due to severe acetabular osteolysis. the mean linear wear of polyethylene (6.01 mm) was also higher than other studies (egawa.18), 1.86 mm) for the same reason. further, this current study used cementless cups that induced more polyethylene wear and did not demonstrate biochemical defensive effects of cement on osteolysis compare to cemented cups. devane.20) proposed that cemented cups reduce the production of wear particle debris with its cushioning effect, so polyethylene wear could be decreased with the use of cemented cups. egawa.18) and howie.19) reported that polyethylene wear was closely associated with osteolysis and recommended that ct was essential when there was polyethylene wear on plain radiographs such as eccentric positioning of the femoral head, even if there was no evidence of osteolysis. however, puri.12) described that polyethylene wear on radiographs did n't imply osteolysis. martell.21) reported that 3d analysis detected approximately 10% more wear than two - dimensional analysis did, but, because of the poor quality of the lateral radiographs, its repeatability was four times worse. however, mccalden.22) reported that this technique (martell 's hip analysis suite) had been used extensively in the literature to assess in vivo polye - thylene wear. in general, it is known that the amount of an actual osteolysis is greater than the periactabular osteolysis measured by plain radiographs, and that there is a high correlation between the wear of a polyethylene liner and the amount of an osteolysis. in this study, however, there is a low correlation between the wear of a polyethylene liner observed in plain radiographs and the amount of an osteolysis, which demonstrates that there is a limitation in predicting the amount of an osteolysis by plain radiographs. there were some limitations in that we assumed the real osteolyic volume as the sum of the volumetric increments of acetabular cups and impacted allocancellous bone volume. first, filling defect could have occurred when the allo - cancellous bone was impacted into the deficient cavity. second, grafted allo - cancellous bone could have been depleted during acetabular reaming and spilled into the pelvic cavity through a deficient medial wall ; if so, we may have overestimated the real osteolytic volume. third, grafted bone volume could be different depending on how much was pressed into the allo - cancellous bone. to overcome this limitation, all operations were performed by one skilled senior surgeon using one kind of implant, where subjects were relative young patients (mean age, 58.2 years) with solid bone density. lastly, this current study did not include the biologic and genetic factors, nor activity levels that may influence osteolysis. however, we included the severe osteolytic subjects need to performed revision surgery and the aims of the study were to evaluate the accuracy of 3d - ct at revision surgery, not the sequence of osteolysis. also, concerning the loss of bone which occurs during the process of removing an acetabular cup, bone defects develop in the wall of anterior and posterior acetabular when the cup is fixed well. this kind of bone defects requires an increased amount of bone graft during an operation, thereby exceeding the amount resulting from the actual osteolysis. in the current study, concerning the massive osteolysis which requires a revision operation, it was easier to extract the cup with no bone adhering to the cup than in the cases in which the cup is fixed well, and the extracted amount was less. when an increased amount was extracted, we measured by deducting the amount obtained by a bone curettage from the amount of osteolysis of a bone graft. the correlation between the osteolytic volume measured on 3d - ct and impacted allo - cancellous bone volume was not significant (r=0.329, p=0.246). of course, there can be a difference between the amount of a bone graft and that measured by 3d - ct. the reason is because the amount of a bone being condensed in the ratios which we propose can differ according to the size of bone morsels in a heterograft and the force of power which influences. however, the difference is not considered to be great if an expert surgeon compresses a purely cancellous bone with a fixed force without mixing cancellous and cortical bones. these prerequisites verify our results ; the mean osteolytic volume was substantially higher than that of several other published studies and there was no medial migration of cups in our study. it is of significance in ascertaining the accuracy of measuring the amount of a bone graft by ct, by comparing the amounts of osteolysis measured by ct and in vivo, similar to the study in which the amounts of osteolysis were compared by ct and in cadavers, instead of intending to use before and after operations by predicting the amounts of an actual bone graft. there was a strong relationship and a statistical significant relationship between the osteolytic volume measured on 3d - ct and the sum of the volumetric increments of acetabular cups and impacted allocancellous bone volumes. additionally, 3d - ct is considered as a useful method for identifying and measuring periacetabular osteolysis. | purposethis study was performed to determine the usefulness of three - dimensional computed tomography (3d - ct) in measuring periacetabular osteolysis by comparing the real volume of osteolysis in revision surgery.materials and methodstwnety - three patients who had undergone revision surgery due to periacetabular osteolysis but not included septic osteolysis and implant loosening. the mean age of patients at the time of surgery was 55.2 years. and the mean time interval between the primary total hip arthroplasty and revision surgery was 13.3 years. we measured the polyethylene wear in plain radiographs using computer assisted vector wear analysis program, the volume of acetabular osteolytic lesions in high - resolution spiral ct scans using rapidia 3d software version 2.8 algorithms before the revision surgery were performed. intraoperative real osteolytic volume was calculated as the sum of the volumetric increments of the acetabular cup and impacted allo - cancellous bone volume.resultsstrong correlation was found between the volume of acetabular osteolytic lesions measured on 3d - ct and intraoperative real osteolytic volume which was calculated as the sum of the volumetric increments of the acetabular cup and impacted allo - cancellous bone volume.conclusion3d-ct is considered a useful method for assessing and measuring the volume of periacetabular osteolysis before revision surgery. |
cereal seeds must meet several quality criteria, in particular good germinative potency (85% after 8 days) and sanitary state (absence of claviceps purpurea). more generally, low contamination from fungi such as fusarium, septoria, or alternaria is advisable to obtain good performance after seeding. moreover, fungal contamination of seeds can lead to mycotoxins production such as aflatoxin b1, b2, g1, g2, m1, ochratoxin a, zearalenone, and fumonisin. it is thus common practice to treat seeds with antifungal molecules, but this leads to evident environmental problems and even to concern about safe disposal of seed packaging. alternative solutions will likely become widely spread in the future and must be investigated. among them, ozone is wellknown for its efficiency as a surface disinfection agent, especially as it leaves no toxic residue once converted into oxygen. stability of pure gaseous ozone is about 3 days at 20c and falls to about half an hour in practical conditions. as a potent oxidative agent, it is efficient against both gram or gram+ bacteria, fungi, viruses, protozoa, and also bacterial or fungal spores. apart from its use in water sanitation, it has also been proposed to lower pathogen microbial contamination on diverse plant seeds or bulbs (triticum sp., brassica sp., zea mays, hordeum sp., phaseolus sp., helianthus sp.,) [1, 4, 5 ]. a decisive advantage of ozone is its low toxicity on seed germs which allows to preserve excellent germination performance. several methods can be used to assess ozone disinfection efficiency. apart from direct surface visual inspection, one can also wash a seed lot and microscopically inspect the solution collected therefrom to identify foreign bodies (sclerotes, spores,). one can also incubate seeds over an ad hoc culture medium for a period of 5 to 7 days in suitable temperature and lighting conditions and observe colony development [6, 7 ]. we used such an approach to assess ozone surface disinfection performance on triticum aestivum (common wheat) seeds. however it appeared to us that a more thorough scrutiny of the results was necessary. while colonies numbering did not point to a strong effect of ozonation we thus used self - organizing maps (soms) to analyze surface colony area. soms are a particular kind of artificial neural networks that learn to classify input vectors (here pixel rgb intensity data) according to how they are grouped in the input space. they differ from competitive layers in that neighboring neurons in the self - organizing map learn to recognize neighboring sections of the input space. thus, soms learn both the distribution (as do competitive layers) and topology of the input vectors they are trained on. soms have been used successfully to perform segmentation of complex images, in particular from diverse food products such as cookies, fried chips, or potatoes [912 ]. in the present case, this allowed to discriminate quickly and easily between different fungi species while dodging the necessity to remove image background beforehand. this approach showed a significant inhibition of fusarium growth after ozone treatment, while seeds retained a germinating capacity over 95%. ozonation thus is qualified as an efficient treatment for seed surface disinfection, while som use allows to fine tune image analysis of fungi colonies. a particular sample from cv louisart (moisture 14, 3%) was selected for its known huge contamination by fusarium. ozone was produced by corona discharge using a benchtop generator (c - lasky series ozone generator c - l010-dt, airtree technology europe co., germany), with a maximal production of 2 g / h when fed with atmospheric air. seed samples (60 g each) were placed in a cylindrical vessel (15 cm in diameter). they were exposed for a known time to ozone treatment by percolating gas flow (5 l / min, 0,8 mg the vessel was shaken every minute during operation to ensure homogeneous contact between gas and grain surface. petri dishes filled with malt agar (biokar diagnostics, france) were used for fungi detection. for each assay, a total of 300 seeds were settled in 30 petri dishes. in a particular petri dish a seed was settled in the center, and nine others were settled equally spaced on the periphery (figure 1). control samples were used, that is, untreated seeds and seeds commercially treated with celest (fludioxonil, syngenta crop protection nv, belgium). colonies were counted and inspected both macroscopically and microscopically to identify fungi species, as detailed in previously published methods [6, 7 ]. most displayed growth of a single fungal species and were counted one for that species. petri dishes were then positioned over a sky blue background in a lighting cabinet (gti minimatcher, gti graphic technology, newburgh, usa) equipped with two 6500k daylight - balanced fluorescent lamps. a digital camera (nikon coolpix 4500) was used to take images (figure 1) in jpeg format (640 480 pixels). images (8 bit) were then imported into matlab 2011 software (the mathworks, inc., three bidimensional soms (hexagonal networks) of 5 10 neurons each were created using the matlab neuron network toolbox. the networks were limited to two dimensions only to match the flat shapes of the clusters of rgb values from the two fungi colonies types (alternaria sp. and fusarium sp.) and of the image background. these soms were trained using three composite images created by sampling a representative set of regions from colonies of alternaria sp., from fusarium sp. colonies, or from the image background (figure 2). this allowed to account for the whole complex set of color shades present in the colonies. over training iterations, the som progressively unfolded to match the shapes and topologies of the color pixel distributions (figure 3). the trained soms were then used to perform segmentation of images (figure 4). for each pixel presented to a som, a single winning neuron would respond as being closest to these particular pixel rgb coordinates. euclidean distance between the winning neuron and pixel coordinates was then computed and used to decide whether the considered pixel was part of an alternaria colony, of a fusarium colony, or of none of them (thus being background). in either colonies, ratio of the number of pixels to the total pixel number of a petri dish would finally provide an estimation of colony surface percentage. seed - germinative capacity was evaluated by testing 400 seeds for each treatment, placed into four essay boxes (100 seeds each). essay boxes are 21 cm long, 12 cm broad, and 8 cm high, with a cover to guard against water evaporation. this substratum is then disposed in the bottom of the boxes, with a constant height of 2 cm (about 820 g per box). in each box, 100 equally spaced small holes are perforated through the sand by way of a nailed plank (nails protrudes 1 cm). each hole then receives a seed, and covered boxes are first incubated for 7 days at 6 - 7c in a refrigerated cabinet. they then stay for 8 days at 22c in a temperature - regulated cabinet lighted with 12 neon tubes (philips tl - d58w/54 - 765), with a cycle of 12 day hours and 12 night hours. triticum aestivum seeds, variety of louisart, were exposed to ozone treatment for different durations and then incubated over petri dishes for 7 days. the only significant effect was a higher number of healthy seeds when treated with celest. however, no significant effect could be seen for either alternaria or fusarium counts. a more thorough inspection of petri dishes however hinted at the existence of an effect of ozone treatment on colony surface. to test this, we measured colony surface by way of image analysis through a som methodology. as shown in figure 6, seed treatment with celest led to significantly smaller fusarium colonies (about threefold) ; no significant effect was observed on alternaria colonies. seed treatment with ozone also led to significantly smaller fusarium colonies (about threefold). however, a significant effect was observed on alternaria colonies, with surfaces about twofold greater after treatment. figure 7 shows the linear negative correlation between the surfaces of fusarium and alternaria colonies, for seeds treated with ozone. we see that reduced fusarium surface results in increased alternaria surface, with a correlation coefficient of 0.71. all seeds retained the same germinative capacity than control, that is, over 95%, with the exception of seeds treated with ozone for more than 10 minutes in our experimental conditions, where germinative capacity was lowered to 90%. the use of som to operate segmentation of fungi colonies on petri dishes images proved to be very efficient, as was already the case in earlier studies [912 ]. we were able to obtain fast and easy image treatment, with very good segmentation between fusarium sp. and alternaria sp. colonies. whole colony surfaces were selected, due to the som taking into account the whole range of color shades for the two types of fungi colonies. as previously described [1, 13 ], we observed an effect of gaseous ozone treatment to reduce fungi seed contamination without germinative impairment, except for prolonged ozone treatment. however, our som method to measure surface occupation by colonies allowed to obtain more precise and detailed data, which led to better understanding of treatment effects. first, a simple count of colonies number showed no significant decrease except for celest control. by colony surface analysis, we also observed a decrease of both fusarium and alternaria growth after celest treatment. ozone treatment had a different effect, effective on fusarium only : it led to a decrease in fusarium surface occupation (the number of fusarium colonies is not decreased, but colonies are smaller) and to an increase in alternaria surface occupation. thus, reduced growth of fusarium allows alternaria to occupy more surface on petri dishes. alternaria could be less susceptible to ozone toxicity, due to a more efficient spore resistance. also, alternaria could be settled deeper into seed tegument and thus less exposed to ozone attack. from this, we conclude that ozone is a more selective disinfectant than celest, acting efficiently on fusarium. enhanced growth of alternaria is attributed to lower competition after fusarium was killed by ozone treatment. it would be of interest to use this method to obtain detailed data about seed disinfection for a greater variety of fungi contaminants. there is still to test its limits in case of colonies presenting closely matching color shades. | we submitted to ozone treatment triticum aestivum (common wheat) seeds severely contaminated by fungi. fungi colonies developed when seeds were placed over malt agar medium in petri dishes ; fusarium sp. and alternaria sp. were identified. however, conventional colonies counting did not allow a clear assessment of the effect of ozone disinfection. we thus used self - organizing maps (soms) to perform an image analysis of colonies surface area that clearly showed a significant disinfection effect on fusarium sp. |
obesity is a growing problem in the united states over the past 20 years with the prevalence remaining high despite new regulations and interventions implemented by the u.s. department of health and human services, the centers for disease control and prevention (cdc), the institute of medicine, and the u.s. results from the 20112012 national health and nutrition examination survey (nhanes) estimated that 34% of u.s. adults are overweight, 35% are obese, and 6% are extremely obese (fryar and ogden, 2014). obese women are a vulnerable population who face not only economic hardships and social isolation, but medical comorbidities as well. they are at increased risk of heart disease, diabetes, hypertension, stroke, hyperlipidemia, osteoarthritis, sleep apnea, and certain cancers such as endometrial, breast, and colon cancer. among these, endometrial cancer has the highest association with obesity with up to a 9-fold increased risk of mortality in women with body mass index (bmi) > 40 compared to women of normal weight (rr 6.25, p 40 kg / m have a 60% higher death rates from all cancer compared to women of normal weight. furthermore, they predicted the proportion of deaths from cancer that is attributable to overweight and obesity in u.s. adults aged 50 or older may be as high as 20% in women (calle., 2003). appropriately, obesity has become a pivotal issue in women 's health (acog committee opinion, 2005). the american society of clinical oncology (asco) recently released a policy statement (ligibel., 2014) identifying 4 priorities to address the obesity cancer link including : 1) increasing providers ' and patients ' core knowledge about the role of energy balance in cancer risk and prevention ; 2) developing clinical guidance and resources to help providers educate their patients ; 3) research promotion ; and 4) improving access to evidence - based obesity treatment services for cancer patients and survivors. the asco policy statement also highlights that a cancer diagnosis may serve as a teachable moment to discuss risk - reducing or health - protective behaviors. a survey of u.s. gynecologic oncology providers affirmed this window of opportunity, stating that 85% agreed or strongly agreed on the importance of addressing obesity with cancer survivors (jernigan., 2013). historically, oncologists have played a limited role in weight loss management for their patients, as the direct implications of obesity on treatment options may not have been fully realized in the past. however with time, the growing obesity epidemic has pushed not only the upper limits of bmi values, but also the number of safe management options we can offer our patients. for many obese women with cah or endometrial cancer, robotic surgery has provided a feasible surgical approach, but for others with extreme obesity (bmi 40 kg / m), the risks of surgery may outweigh the benefits, and alternative treatment options such as radiation, chemotherapy and/or hormonal therapy should be discussed. while our findings provide insight to women 's knowledge regarding obesity - related risks as they pertain to medical comorbidities, endometrial cancer, and peri - operative risks, this study is not without limitations. we acknowledge our small sample size and the potential for selection and recall bias that is inherent to any survey study. time constraints in the clinic and uneasiness with the topic are potential reasons more patients were not enrolled or were not enrolled more quickly over our 4-year study period. furthermore, physicians were not blinded and the amount of discussion time spent in the pre - operative visit regarding obesity - related risks could have directly influenced providers ' decisions to enroll eligible patients into this survey study. despite these limitations, we also recognize that potential selection biases would likely favor inclusion of more knowledgeable patients, suggesting that 36% may be an underestimation of women 's awareness of obesity - related peri - operative risks. regardless, our findings are in congruence with prior published reports and provide evidence that pre - operative counseling for obese women with newly diagnosed cah or endometrial cancer should incorporate more focused education about obesity - related risks. our knowledge of the link between obesity and cancer risk and survival outcomes continues to expand and gain momentum. obesity is a multifactorial disease that warrants a concerted action at both the individual and societal levels, beginning first with improved patient awareness and education. these discussions should not only address the link between obesity and cancer, but also should incorporate the impact of weight on surgical management and specific obesity - related peri - operative risks. gynecologic oncologists are in a pivotal position to positively impact survival outcomes by recognizing and seizing teachable moments about obesity and lifestyle modifications throughout our lifelong relationship with our cancer patients. this publication was supported by the washington university institute of clinical and translational sciences (icts) grant ul1 tr000448 from the national center for advancing translational sciences. the content is solely the responsibility of the authors and does not necessarily represent the official views of the national institute of health. bradley evanoff is the pi for the clinical and translational science award that supports all washington university itcs and clinical research training center activities. | objectivesthe aim of this study is to evaluate knowledge of obesity - related peri - operative risks in women newly diagnosed with complex atypical hyperplasia and endometrial cancer.methodswe conducted a cross sectional study of patients newly diagnosed with complex a typical hyperplasia or endometrial cancer who underwent preoperative counseling between 2011 and 2014, using a 17-item questionnaire. obesity was defined as body mass index (bmi) of 30 kg / m2 or greater. bivariate analysis was conducted using pearson 's chi - square or fisher 's exact tests where appropriate and mann whitney u for continuous variables.resultsof 98 patients recruited, mean age was 58 years, 87% were obese, 83% white, and 51% had grade 1 endometrioid adenocarcinomas. sixty - four percent of obese women reported that their physicians had discussed surgical risks related to obesity. however, 17% of obese and 42% of non - obese patients responded that they were unsure of the peri - operative risks associated with obesity. there was a substantial lack of understanding among obese patients regarding their increased risks of respiratory problems (29%), thromboembolism (29%), heart attack (35%), or longer operating time (35%) and hospital stay (47%). however, obese patients were more aware of wound infection risks associated with obesity compared to their non - obese counterparts (72% vs. 31%, p = 0.004).conclusionspre - operative counseling for obese women with newly diagnosed endometrial cancer should incorporate more focused education about obesity - related risks. they report being knowledgeable about the risks associated with their surgery ; however, more than a quarter are unaware of the impact obesity has on respiratory problems, thromboembolism, wound infection, heart attack or longer operating time and hospital stay. |
due to the shortage of deceased donor organs, living donor liver transplantation (ldlt) has become an established treatment modality for patients with acute and chronic liver disease. the first successful pediatric ldlt, using a left lateral section graft from a mother to her son, was performed in brisbane, australia in 1989. recent reports have strongly suggested that laparoscopic approach can be the gold standard for lesions in the left lateral section. laparoscopic living donor left lateral sectionectomy was first described in 2002, indicating that this technique was feasible for pediatric ldlt. subsequently, laparoscopic procurement of left lateral sections was shown to be safe and reproducible, resulting in grafts similar to those obtained with open surgery. in 2006, laparoscopy - assisted right lobe donor hepatectomy was reported. laparoscopic donor nephrectomy has become the standard method of procuring kidneys for living donor renal transplantation because it is associated with lower rates of donor morbidity without having any deleterious effects on long - term renal function in recipients. to date, however, only a small number of centers have performed laparoscopic donor hepatectomy because the procedure can be performed only by surgical teams with extensive expertise in performing both minimally invasive surgery on the liver and liver transplantation with partial and living donor liver grafts.12345678 herein, we describe the details of laparoscopic living donor hepatectomy including total laparoscopic surgery and laparoscopy - assisted surgery. laparoscopic living donor left lateral sectionectomy in pediatric ldlt is introduced because total laparoscopic living donor right hepatectomy is not clearly reported until now. the donor was placed supine in the 30 reversed trendelenburg position, with the surgeon standing between the donor 's legs. five trocars were usually inserted, with the middle trocar used as the primary working device (fig. the liver was inspected with a 30 laparoscope and partially resected for a frozen biopsy to confirm the degree of steatosis. the left triangular and falciform ligament were divided with a harmonic scalpel (ultracision, ethicon endosurgery, cincinnati, oh) to free the left lateral sector and the round ligament, used as a supporter, was divided after complete dissection of the left side hepatoduodenal ligament. the left hepatic artery and portal vein were identified and taped using an atraumatic grasper (direct drive laparoscopic grasper, applied medical resources, rancho santa margarita, ca, us) and monopolar dissector. some small branches going to the caudate lobe were clipped and divided to get sufficient lengths of the left hepatic artery and portal vein. the deep hepatic parenchyma were divided along the right side of the round and falciform ligament, using a laparoscopic ultrasonic aspirator (cusa exel, valleylab corp., co, us) with a long tip (fig. the glissonian pedicles of segment 4 were ligated using a knot pusher (knot guide 5 mm, mgb endoscopy corp., seoul, korea) or were clipped and divided for hemostasis and biliostasis. when the liver division reached the left hepatic vein, the left lateral sector was surrounded by a cotton tape which was passed under the left hepatic vein, portal vein and hepatic artery for a liver " hanging - over " maneuver. the left bile duct was exposed after complete division of the remnant hepatic parenchyma and was cut just above the hem - o - lock clip (weck closure system, research triangle park, nc, us), which was clipped onto the proposed target level of the left hepatic duct. after the recipient was ready to receive the graft, a 10 cm - sized suprapubic incision was made and a 12 mm trocar was inserted for procurement. after infusion of 5000 u heparin, the proximal end of the left hepatic artery was clipped and divided using a hem - o - lock clip, and both ends of left portal vein were clipped and divided. a unilateral linear stapler (endo ta 30 mm, us surgical, norwalk, ct, us) was used to cut the left hepatic vein. the graft was placed into the endo - bag and retrieved through the suprapubic incision site. the graft was flushed on the back table with 1 l of 4 htk solution (odyssey pharmaceuticals, east hanover, nj, us) through the left portal vein. the suprapubic wound was then closed and co2 gas was re - insufflated to check the control of hemostasis and biliostasis on the liver cut surface. two closed - suction drains were inserted to prevent fluid collection around the liver cut surface. these procedures and results 3. soubrane. reported that 16 successive donor underwent a laparoscopic liver resection from 2001 to 2005.3 they were compared with 14 other donors who underwent a standard open liver resection during a first period (1998 - 2004). laparoscopic harvesting was successfully performed in 15 of 16 cases in an intention - to - treat basis. one conversion was required to ensure the quality of the laparoscopic repair of a left portal vein injury occurring during the pedicle dissection. as compared with open liver resection, the operation time was longer in laparoscopic resection group (32067 vs. 24455 minutes, p 5 mm in diameter) were isolated and divided using hem - o - lock clips (fig. after the parenchymal dissection was completed, the right hepatic duct was isolated and divided. the bile duct stump was sutured with 6 - 0 prolene sutures. after the recipient was ready to receive the graft, 5000 u heparin was infused and the right hepatic artery and portal vein with the right hepatic vein were divided after application of a vascular clamp. after graft procurement, it was flushed on the back table with 2 l of 4 htk solution (odyssey pharmaceuticals, east hanover, nj, us) through the portal vein. on the back table, after removing the hem - o - lock clips, the mhv tributaries were anastomosed to a cryopreserved deceased - donor vessel graft. also the remnant liver was fixed to the falciform ligament with a non - absorbable suture. two closed - suction drains were inserted to prevent fluid collection around the liver cut surface. adult ldlt often requires a right hepatic lobectomy to provide sufficient graft size for the recipient. despite open donor right hepatectomy (odrh) being well described and characterized as a safe procedure, it is associated with complications in 38% of donors, according the largest review of living donor complications. over the past two decades, laparoscopic surgery has been utilized for an increasing number of surgical procedures with the aim of reducing postoperative pain, recovery time, and surgical morbidity. although there have been numerous reports comparing laparosopic with open hepatic resection, to date, there exists only a single report comparing laparoscopy - assisted with open living donor right hepatectomy by baker.7 in that report, the authors performed a retrospective, comparative analysis of 33 cases laparoscopy - assisted donor right hepatectomy (ladrh), which were performed between january 2006 and may 2008, to the most recent 33 cases of odrh (april 2004 to july 2007) performed at their institution, evaluating donor complications, costs, and recipient outcomes. two cases in the ladrh group were converted to open donation at the surgeon 's discretion in the interest of donor safety. the outcomes for these 2 donors are reported as ladrh, according to intention - to - treat principles. ladrh was performed as described previously by koffron.6 donor demographics for ladrh and odrh including age, gender, and body mass index (bmi) were similar. donor operative times were shorter for ladrh (ladrh 265 minutes, odrh 316 ; p 5 mm in diameter) were isolated and divided using hem - o - lock clips (fig. after the parenchymal dissection was completed, the right hepatic duct was isolated and divided. the bile duct stump was sutured with 6 - 0 prolene sutures. after the recipient was ready to receive the graft, 5000 u heparin was infused and the right hepatic artery and portal vein with the right hepatic vein were divided after application of a vascular clamp. after graft procurement, it was flushed on the back table with 2 l of 4 htk solution (odyssey pharmaceuticals, east hanover, nj, us) through the portal vein. on the back table, after removing the hem - o - lock clips, the mhv tributaries were anastomosed to a cryopreserved deceased - donor vessel graft. also the remnant liver was fixed to the falciform ligament with a non - absorbable suture. two closed - suction drains were inserted to prevent fluid collection around the liver cut surface. adult ldlt often requires a right hepatic lobectomy to provide sufficient graft size for the recipient. despite open donor right hepatectomy (odrh) being well described and characterized as a safe procedure, it is associated with complications in 38% of donors, according the largest review of living donor complications. over the past two decades, laparoscopic surgery has been utilized for an increasing number of surgical procedures with the aim of reducing postoperative pain, recovery time, and surgical morbidity. although there have been numerous reports comparing laparosopic with open hepatic resection, to date, there exists only a single report comparing laparoscopy - assisted with open living donor right hepatectomy by baker.7 in that report, the authors performed a retrospective, comparative analysis of 33 cases laparoscopy - assisted donor right hepatectomy (ladrh), which were performed between january 2006 and may 2008, to the most recent 33 cases of odrh (april 2004 to july 2007) performed at their institution, evaluating donor complications, costs, and recipient outcomes. two cases in the ladrh group were converted to open donation at the surgeon 's discretion in the interest of donor safety. the outcomes for these 2 donors are reported as ladrh, according to intention - to - treat principles. ladrh was performed as described previously by koffron.6 donor demographics for ladrh and odrh including age, gender, and body mass index (bmi) were similar. donor operative times were shorter for ladrh (ladrh 265 minutes, odrh 316 ; p<0.001) even after adjusting for bmi. additionally, total hospitalization costs were equivalent (ladrh $ 1.11, odrh $ 1.00 ; p=0.19). higher operative supply costs for ladrh were balanced by higher time - based operative costs for odrh resulting in no significant differences in total operative costs. finally, there were no differences in graft size, recipient patient or graft survival, or recipient vascular or biliary complications. baker.7 concluded that ladrh can be performed as safely as odrh with reduced operative times, a trend toward reduced blood loss, and comparable complication rates, length of stay, and hospital and surgical costs. furthermore, ladrh provided equitable grafts for the recipient with equal patient and graft survival and complication rates (table 3). we believe that the potential benefits of a smaller incision superimposed on shorter recovery time may change the landscape for living liver donors leading to an increased willingness to donate as has been demonstrated for kidney transplantation. further study enrolling larger amount of cases and including assessment of patient - reported health status and satisfaction, is necessary to determine if these benefits are being realized. | shortage of deceased donor organs led to establishment of living donor liver transplantation. recent reports have strongly suggested that laparoscopic approach should be the gold standard for lesions in the left lateral section. laparoscopic living donor left lateral sectionectomy was first described in 2002. subsequently, laparoscopic procurement of left lateral sections was shown to be safe and reproducible, resulting in grafts similar to those obtained with open surgery. in 2006, laparoscopy - assisted right lobe donor hepatectomy was reported. to date, however, only a small number of liver transplant centers have performed laparoscopic donor hepatectomy because the procedure can be performed only by surgical teams with extensive expertise in performing both minimally invasive surgery on the liver and liver transplantation with partial and living donor liver grafts. herein, we describe the details of laparoscopic living donor hepatectomy including total laparoscopic surgery and laparoscopy - assisted surgery. |
c57bl/6 (b6) mice and their ly-5.2 congenic variant (b6.ly-5.2) were purchased from the national cancer institute animal facility (frederick, md). i / ii deficient mice on a b6 background (12th backcross, ci / ii) were purchased from taconic farms. the b6 thy-1 congenic variant strain, b6.plthy-1 cy, as well as the mice genetically deficient in the cd4 gene 18, which were used as class ii recipients, and the natural h-2k and h-2 i - a coisogenic variants of b6 mice, b6.ch-2 (bm1) and b6.ch-2 (bm12), respectively, which were used as stimulators in the mlr, were purchased from the jackson laboratory. female mice, between 7 and 10 wk of age, were used in all experiments. the allele - specific anti - ly5.1 (104 - 2.1) and anti - ly5.2 (a20 - 7.1) mabs (19 ; obtained from dr. u. hammerling, memorial sloan - kettering cancer center) were produced as ascitic fluid, purified, and conjugated to fitc or biotin in our laboratory. anti - cd4conjugated microbeads, the vs+ and rs+ separation columns, and the supermacs separation device were purchased from miltenyi biotec and were used per the manufacturer 's instructions. all other antibodies and reagents, as well as the cytotoxic elimination of cd8 cells by mab + c and separation of the resulting population into cd8 and cd8 by panning, were described previously 9. cd4 populations from each subset were then purified to > 99% purity, either by flow cytometry (fcm) using a mo - flo sorter (cytomation), or by two sequential immunomagnetic bead sorting steps using the vs+ separation columns and anti - cd4conjugated microbeads (miltenyi biotec), as indicated. for the cell sorting, cells were stained with mabs against cd4, cd11c, and mhc class ii, and were sorted to obtain a cd4 class ii cd11c fraction. upon reanalysis, these cells contained 99% purity, either by flow cytometry (fcm) using a mo - flo sorter (cytomation), or by two sequential immunomagnetic bead sorting steps using the vs+ separation columns and anti - cd4conjugated microbeads (miltenyi biotec), as indicated. for the cell sorting, cells were stained with mabs against cd4, cd11c, and mhc class ii, and were sorted to obtain a cd4 class ii cd11c fraction. upon reanalysis, these cells contained 99%) from b6.ly-5.2 mice, as described in materials and methods. the key separation step was achieved by panning, and, in our hands, this was found to be the most reliable method of separating these two functionally nonoverlapping subsets. by fcm, 1 of this paper, data not shown, and figure 1 in reference 9) : both subsets were cd8cd4tcr- by fcm, but the cd8cd4 cells contained more cd69 cells and expressed higher levels of cd24 and somewhat lower levels of cd44 than cd8cd4 thymocytes (not shown). however, as shown previously 9, most of these molecules are expressed by both subsets in at least partly overlapping fashion. we observed that the most consistent difference in the phenotype of these two subsets was in the level of expression of cd45rb : the levels observed on cd8cd4 cells were more than twice higher than those on cd8cd4 thymocytes (mean fluorescence intensity [mfi ] 151 and 341, respectively ; fig. this feature correlates very well with the difference in functional responsiveness of the two subsets and the function of cd45 : the former subset is functionally mature, whereas the latter can not respond with the full spectrum of functional activities 12. to further confirm the identity of the above purified cell populations,, only the cd8cd4 thymocytes can give long - term (> 1 mo) repopulation of the peripheral lymphoid organs, whereas the cd8cd4 cells disappear 34 wk after transfer 9. results shown in table confirmed this finding, and demonstrated that the cd8cd4 thymocyte subset isolated in this study was phenotypically and functionally indistinguishable from the previously described cells 912. moreover, results of this experiment demonstrate that the cross - contamination and outgrowth of the contaminating cells between the two subsets isolated as described in materials and methods was negligible or nonexistent, as the putative progeny of the cross - contaminating cd8cd4 cells was not detectable 45 mo after injection of purified cd8cd4 cells. cd8cd4 thymocytes from the same cellular preparation were also injected into the thymi of control class ii cd4 recipients, which express wild - type levels of the mhc class ii molecules (but lack cd4 t cells, thus facilitating the detection of cd4 progeny of the injected cells), or of the cii recipients, which genetically lacked these molecules (and consequently only had very low cd4 numbers, owing to a severe defect in cd4 t cell positive selection). in both types of recipient, injected immature cd8cd4 thymocytes yielded long - lived progeny that populated the peripheral lymphoid organs (table, exp. 1). therefore, class ii molecules appeared not to be necessary either for the terminal differentiation of cd4 thymocytes or for their survival in the periphery. again, a caveat to this conclusion was the long time course of our experiment, which was conducive for the outgrowth of a minor population of contaminating cd8 cd4 thymocytes. although the results shown in table strongly argue against this possibility, we performed another control experiment in which we deliberately spiked the transferred cd8cd4 cells with thy-1 congenic (thy-1.1) cd8cd4 thymocytes. when we added 1% cd8cd4 thymocytes to the sorted > 99% pure cd8cd4 thymocytes, we could not detect the progeny of the admixed thy-1.1 cells (table). the progeny of 10% contaminating cells was detectable, but these cells showed no selective proliferative advantage : their representation remained at or below the 10% level among the transferred thymocytes even after 5 mo in vivo (table). therefore, the above results can not be accounted for by the contaminating mature thymocytes. another possibility was that we transferred a substantial number of class ii cells with our thymocytes. however, cells transferred in exp. 2 (table) were sorted to exclude class ii and cd11c cells, and, after sorting, contained no cells positive for class ii, for the dendritic cell (dc) marker cd11c, or the macrophage (m) marker cd11b (99% pure cd4ly-5.2 donor - derived cells from the recipient mice, stimulated them with allogeneic cells in vitro, and measured the il-2 release in response to such stimulation (table). cd4 cells of donor origin produced il-2 at levels comparable to those produced by unmanipulated peripheral cd4 cells, establishing that these cells were functional and immunocompetent. the fact that donor - derived cd4ly5 - 2 cells responded vigorously to mhc class ii disparate i - a stimulators, but not to the class i disparate k stimulators (table, exp. 2) clearly demonstrated that their precursors must have been appropriately positively selected on mhc class ii molecules before the point of transfer. similar results were obtained with the donor - derived cd4 t cells recovered from the ci / ii recipients (data not shown). the primary objective of this study was to investigate the dependence of the final phase of intrathymic maturation on mhc class ii molecules. mhc contact must be maintained throughout several discrete stages in t cell development, but none of these has addressed the importance of this contact for terminal maturation of sp cells. as pointed out in our previous publications 912, the cd8cd4 cells in our studies differ significantly from the cells called cd8cd4 232425 : theirs correspond to the cd8cd4 cells, which bear levels of cd8 lower than those on double - positive (dp) thymocytes but clearly detectable by fcm. the cd8cd4 cells studied here belong to the cd4 lineage and score within the cd4 sp population by fcm : their cd8 levels are undetectable by fcm (for a full phenotypic difference between our cd8cd4 cells and the cd8 cd4 cells of the other authors, see reference 9). our data resolve the class ii dependence of the last phase of intrathymic maturation of sp cd4 thymocytes unambiguously : no mhc class ii this conclusion is further supported by the recent data of hare. in the reaggregation organ culture system 26, showing that thymocytes at or past the cd69 dp stage no longer require contact with class ii molecules to become functional cd4 sp thymocytes. at present, we can only speculate on the nature of the final maturation signal. among the obvious contenders are the cytokines, the costimulatory molecules, and/or the matrix integrin interactions, some of which are currently being investigated. survival and peripheral homeostasis of t cells were not the key subjects of this study. perhaps surprisingly, the peripheral progeny of intrathymically transferred cd8cd4 cells was able to survive for > 5 mo in the absence of mhc class ii molecules (albeit the numbers were 5060% of those in class ii mice 5 mo after the transfer). this survival was not due to the outgrowth of contaminating mature cd8cd4 thymocytes (table) nor to the contaminating class ii cells (which were undetectable in the inoculum). we conclude that mhc class ii molecules are not necessary for the long - term survival of at least some cd4 t cells, but are required for their optimal expansion and homeostasis, since both the percentages and the absolute numbers of cd4 t cells were about twofold higher in the presence of class ii molecules. the issue of whether mhc molecules are required and necessary for the survival of peripheral t cells has recently gained much attention. although it appears that mhc class i molecules are necessary for the survival of cd8 cells 27282930, the consensus is more tenuous in the case of cd4 cells 22313233. 31 using the transfer of fetal thymic lobes into cii mice, concluded that class ii molecules are not essential for survival but affect the half - life of cd4 cells. 22 reported on a model of retroviral reconstitution of class ii expression in cii mice, and found that the half - life in reconstituted mice that expressed no class ii in the periphery was similar to that of takeda. these authors concluded that the lack of class ii molecules curtailed (but did not abolish) the survival of cd4 cells, and showed that the lack of class i molecules did not further pronounce this curtailment. in these experiments, the uneven expression of intrathymically injected and retrovirus - driven class ii molecules could have caused a situation in which class ii molecules were not expressed in all the intrathymic compartments relevant to the t cell longevity. this could have resulted in a paucity of intrathymic signals that regulate the half - life of t cells, thus reducing the numbers of long - lived cells or their half - life. by contrast, the study of brocker 32 argued for an absolutely essential role of class ii on peripheral apcs in the survival of cd4 t cells, based on the results of transplantation of the apc - depleted class ii thymi into cii mice bearing no transgenes or expressing an mhc class ii transgene on dcs alone. in these experiments, good repopulation and intrathymic differentiation of cd4 t cells were observed, but no extrathymic cd4 t cells were detected unless the dcs expressed the class ii transgene. 33 showed that cd4 t cells bearing a tcr transgene required self class ii molecules for long - term survival in the periphery. finally, viret. showed that the cd4 t cell repertoire is incompletely maintained when a single peptide is present on the majority of mhc class ii molecules 34. our data certainly agree with all of the above studies in that class ii molecules are required for optimal cd4 expansion and the filling up of the peripheral compartment. 31, also clearly show that a substantial proportion of peripheral cd4 t cells do not require mhc class ii molecules. 34 are also compatible with this notion, since these authors saw a reduction, but not disappearance, of cd4 t cells in mice unable to exchange the class ii associated invariant chain peptides for other peptides, owing to a lack of h-2m. however, the period of observation in these experiments was rather short. in distinction to the studies of kirberg 33, we used polyclonal t cells, and it is quite possible that only some cells from the original inoculum have survived, reflecting the requirement of some, but not all, cells for the particular mhc class ii ligand. it is possible that in our system, we have selected for only those cells that do not require class ii for peripheral survival, and we are testing this possibility at present. we are also investigating whether these cells express a diverse repertoire, as suggested by their vigorous response to alloantigens (table). at face value, however, these differences can be reconciled if class ii molecules, expressed on hematopoietic cells rather than being essential for cd4 t cell survival, are necessary for the export of selected cd4 cells from the thymus. if this is the case, both studies would have to be reinterpreted slightly. in our study, then, the transferred cd8cd4 cells either would already have received class ii mediated signals before transfer, or would have been contaminated with sufficient numbers of class ii cells to provide this signal after transfer. we believe that the latter possibility is highly unlikely, for two reasons. first, the magnetic bead separation retains most dcs and m on the columns nonspecifically, and since the largest theoretical contamination of the inoculum with cd4 cells was in the range of 600800 cells (see fig. 1), even assuming all of these cells were mhc class ii, this number appears too small to permit substantial proliferation and export of maturing thymocytes. second, the presence of class ii, cd11c, or cd11b cells was undetectable among fcm - sorted inoculated thymocytes (see legend to table). in the experiments of brocker 32, the class ii dcs would provide their essential export signal intrathymically (indeed, dcs are well known to reside in the thymus), and would also help the cd4 expansion in the periphery. the first function would be absolutely critical, and its lack would mean that no cd4 t cells could be detected in cii mice grafted with class ii epithelium. finally, with regard to cd4 t cell homeostasis, our study demonstrated that the proliferation of the injected thymocytes can occur in the absence of class ii molecules, as well as in the absence of class i apcs. interestingly, this proliferation was particularly pronounced in ci / ii mice, paralleling the findings of rooke. 22. at present, it is unclear whether the sp thymocytes in our study proliferated intrathymically 1011 or whether the proliferation occurred in the periphery, and additional studies will be needed to address this issue. | the majority (70%) of postselection cd4 + single - positive (sp) thymocytes are cd8locd4hi. these cells express very low levels of cd8, undetectable by flow cytofluorimetric (fcm) analysis, but sufficiently high to allow purification by panning. unlike the fully mature cd8cd4hi thymocytes, which account for the remaining 30% of the sp cd4 + thymocytes, cd8locd4hi cells are functionally immature and short - lived unless they receive an unidentified maturation signal from the thymus. in this study, we tested the hypothesis that this signal is provided by a t cell receptor (tcr)major histocompatibility complex (mhc) class ii interaction. using intrathymic transfer, we show that the immature cd8locd4hi cells could complete their intrathymic maturation and populate the peripheral lymphoid organs in the absence of mhc class ii (and class i) molecules. furthermore, in mice devoid of class ii (and class i) molecules, the progeny of cd8locd4hi cells was long - lived and functionally reactive to allogeneic class ii molecules, although their numbers in the spleen and the mesenteric lymph node were 4050% lower than those in class ii+ mice 5 mo after transfer. control experiments demonstrated that the surviving cells did not originate from the contaminating mature thymocytes. these results demonstrate that the final maturation, proliferation, and peripheral survival (up to 5 mo) of at least some postselection cd4 + sp cells do not require the tcr mhc class ii interaction. they also indicate that the tcr mhc class ii interaction(s) required for the intrathymic development of long - lived cd4 + sp cells occurs before the cd4hi sp stage of development. |
benign prostatic hyperplasia (bph) is a prevalent disorder among older men and has received more attention as the average human lifespan has increased. in korea, the prevalence of clinical prostatic hyperplasia was reported to range from 10.6% to 31% in men over 50 years of age, with an age - related increase. the metabolic syndrome (ms) is a clinical constellation of metabolic abnormalities associated with an increased risk of cardiovascular disease. the major disorders in ms, which is characterized by insulin resistance and hyperinsulinemia, are localized in muscle, fat tissue, and the liver. the components of this syndrome are type ii diabetes mellitus, hypertension, obesity, and dyslipidemia. these components are proposed as risk factors for the development of prostatic hyperplasia. in korea, several studies have reported that men with ms had larger prostate volumes [6 - 8 ]. so far, however, there are insufficient data on the association of ms with prostate volume in young korean men. we therefore investigated the possible association of ms with prostate volume in men under the age of 60. from january 2006 to september 2010, a total of 1,506 men aged between 30 and 60 years underwent prostate evaluation as a special option during routine health checkups in the health promotion center in our institution. all men completed the international prostate symptom score (ipss) questionnaire, a digital rectal examination, transrectal ultrasonography (trusg), and anthropometric measurements, such as height, weight, and waist circumference. body mass index was calculated by dividing weight (kg) by the surface area (m) of the patients. the volume of the prostate was calculated by elliptical volume measurement (/6 x transverse x anteroposterior x cephalocaudal diameter), and benign prostate enlargement (bpe) was defined as trusg - measured prostate volume over 20 ml. blood samples were drawn from fasting patients to determine fasting blood sugar, high - density lipoprotein (hdl) cholesterol, and triglyceride. self - reported information on medical history, major co - morbidities, lifestyle, and psychosocial factors as well as symptoms of urological conditions was also collected. additionally, we collected information on prostate - related medical or surgical treatment history. we excluded 149 men who had a history of prostatitis, high prostate - specific antigen (psa) (4 ng / ml), or abnormal findings on the digital rectal exam or trusg. in this study, ms was defined by using a previously published modification of the national cholesterol education program expert panel on detection, evalution, and treatment of high blood cholesterol in adults guidelines as the presence of 3 or more of the following 5 characteristics : 1) waist circumference greater than 90 cm or body mass index (bmi) higher than 25 kg / m ; 2) systolic blood pressure 130 mmhg or greater or diastolic blood pressure 85 mmhg or greater, or antihypertensive medication use ; 3) fasting blood sugar greater than 110 mg / dl or self - reported diabetes medication use ; 4) triglyceride greater than 150 mg / dl ; 5) hdl cholesterol less than 45 mg / dl or lipid medication use. as described above, the diagnosis of metabolic syndrome, including treated hypertension, diabetes mellitus, and hyperlipidemia, was provided by the patient 's medical history. in the entry for obesity, bmi and waist circumference were applied in the asia - pacific perspective. all statistical analysis was performed by using spss ver. 13.0 (spss inc., we divided the study population into two groups : the ms group and the non - ms group. we compared the ipss, voiding symptom subscore, storage symptom subscore, quality of life (qol), and prostate- related parameters between the two groups. statistical analysis including student 's t - test, pearson 's correlation coefficient, and logistic regression analysis was performed. student 's t - test was used to describe the difference in prostate volume and voiding - related symptom score. pearson 's correlation coefficient was used to test the linearity of the relationships between metabolic components and prostate volume. we used logistic regression analysis to determine the risk factors of bpe. in all comparisons of values, p - values of less than 0.05 from january 2006 to september 2010, a total of 1,506 men aged between 30 and 60 years underwent prostate evaluation as a special option during routine health checkups in the health promotion center in our institution. all men completed the international prostate symptom score (ipss) questionnaire, a digital rectal examination, transrectal ultrasonography (trusg), and anthropometric measurements, such as height, weight, and waist circumference. body mass index was calculated by dividing weight (kg) by the surface area (m) of the patients. the volume of the prostate was calculated by elliptical volume measurement (/6 x transverse x anteroposterior x cephalocaudal diameter), and benign prostate enlargement (bpe) was defined as trusg - measured prostate volume over 20 ml. blood samples were drawn from fasting patients to determine fasting blood sugar, high - density lipoprotein (hdl) cholesterol, and triglyceride. self - reported information on medical history, major co - morbidities, lifestyle, and psychosocial factors as well as symptoms of urological conditions was also collected. additionally, we collected information on prostate - related medical or surgical treatment history. we excluded 149 men who had a history of prostatitis, high prostate - specific antigen (psa) (4 ng / ml), or abnormal findings on the digital rectal exam or trusg. in this study, ms was defined by using a previously published modification of the national cholesterol education program expert panel on detection, evalution, and treatment of high blood cholesterol in adults guidelines as the presence of 3 or more of the following 5 characteristics : 1) waist circumference greater than 90 cm or body mass index (bmi) higher than 25 kg / m ; 2) systolic blood pressure 130 mmhg or greater or diastolic blood pressure 85 mmhg or greater, or antihypertensive medication use ; 3) fasting blood sugar greater than 110 mg / dl or self - reported diabetes medication use ; 4) triglyceride greater than 150 mg / dl ; 5) hdl cholesterol less than 45 mg / dl or lipid medication use. as described above, the diagnosis of metabolic syndrome, including treated hypertension, diabetes mellitus, and hyperlipidemia, was provided by the patient 's medical history. in the entry for obesity, bmi and waist circumference all statistical analysis was performed by using spss ver. 13.0 (spss inc., we divided the study population into two groups : the ms group and the non - ms group. we compared the ipss, voiding symptom subscore, storage symptom subscore, quality of life (qol), and prostate- related parameters between the two groups. statistical analysis including student 's t - test, pearson 's correlation coefficient, and logistic regression analysis was performed. student 's t - test was used to describe the difference in prostate volume and voiding - related symptom score. pearson 's correlation coefficient was used to test the linearity of the relationships between metabolic components and prostate volume. we used logistic regression analysis to determine the risk factors of bpe. in all comparisons of values, p - values of less than 0.05 the age distribution of the patients was as follows : 389, 481, and 487 men were in their 30s (28.7%), 40s (35.4%), and 50s (35.9%), respectively. the median total prostate volume and transitional zone volume were 19.95.1 and 8.22.9, respectively. the descriptive data, including the voiding - related symptom score, qol, psa, and all anthropometric parameters in the men, are listed in table 1. the mean total prostate volume and transitional zone volume of the ms group were larger than those of the non - ms group (20.65.4 vs. 19.75.0, p=0.004, and 8.82.9 vs. 8.02.9, p 90 cm) is an important risk factor for prostatic hyperplasia (> 20 ml). in our study, total prostate volume and transitional zone volume in the ms group were significantly larger than in the non - ms group. also, in the subgroup analysis by age decades, significant differences in the prevalence of bpe were noted. prostate volumes in the ms groups were significantly larger than in the non - ms groups in all age subgroups. the presence of diabetes and obesity were also significant risk factors for bpe as measured by trusg. although the clinical significance was unclear, statistical significance in prostate volume was found even in men with metabolic syndrome from as early an age as their thirties. this study was conducted in a single institution and may have been subject to selection bias. further large - scale studies in the general population will be necessary to confirm our results. diabetes and obesity were identified as significant risk factors for benign prostate enlargement in young males under the age of 60. | purposethis study was designed to evaluate the association of metabolic syndrome and benign prostate enlargement in young korean males. we analyzed the clinical data associated with metabolic syndrome and prostate volume in the study population.materials and methodswe retrospectively analyzed the clinical data obtained from 1,506 young men under the age of 60 who visited the health promotion center in our institution for routine checkups. the patients were interviewed with a questionnaire including the international prostate symptom score (ipss) and were evaluated by medical history, blood chemistry, digital rectal examination, and prostate volume via transrectal ultrasonography. the presence of metabolic syndrome was determined according to the modified national cholesterol education program expert panel on detection, evalution, and treatment of high blood cholesterol in adults criteria. we divided the subjects into two groups : those with metabolic syndrome and those without. logistic regression analysis was carried out to determine which metabolic components were associated with an increased risk of benign prostate enlargement.resultssignificant differences in prostate volume were noted between the groups. the prostate volumes were significantly larger in the metabolic syndrome group than in the non - metabolic syndrome group in all subgroups divided by age (in decades). however, no significant differences in ipss or voiding or storage subscore were noted. in the multivariate regression analysis, only diabetes and obesity were identified as risk factors for benign prostate enlargement among the metabolic components.conclusionsmetabolic syndrome and prostate volume were significantly related, even in young males. diabetes and obesity were identified as significant risk factors for benign prostate enlargement in young males under the age of 60. |
a.t., a 43-year - old nigerian lady, presented to the eye clinic of the university college hospital, ibadan with gradual blurring of vision in both eyes for 4 years. ocular examination showed unaided visual acuity of 6/12 ou corrected to 6/9 in both eyes. dilated fundoscopy showed a well circumscribed cystic fovea lesion with a fluid level and an atrophic center in the right eye, while the left eye showed a scar in the macula (fig. 1 and fig. the patient was prescribed with spectacles, counseled and placed on close observation with amslers grid for the development of choroidal neovascular membrane that will require urgent treatment. this is probably the first case of best macular dystrophy to be reported in ibadan, nigeria and possibly sub - saharan africa to the best of the author 's knowledge. it has also been reported in caucasians and asians, the other cases seen in african americans were associated with sickle cell trait. the pathophysiology of best 's disease is explained by abnormality in the retinal pigment epithelium (rpe) with resultant abnormal ionic transport leading to the accumulation of lipofuscin in the rpe cells and sub - rpe space in the macular area. the vitelliruptive stage may herald visual deterioration which becomes worse in the atrophic stage due to the presence of choroidal neovascular membrane. our patient presented with the early stages of the disease, hence the good visual acuity. the patient will be under observation and follow - up so as to detect changes amenable to treatment. choroidal neovascular membrane (cnvm) from best 's disease has been reported to respond well to intravitreal antivegf [7, 8 ]. fundus flourescein angiography is essential in confirming the presence of cnvm and should be done when patient presents with sudden deterioration in vision. if a cnvm develops, then a corresponding area of hyperfluorescence with leakage will be found. since the disease is an autosomal dominant disorder, other family members will benefit from regular fundus examinations, and amslers grid is a valuable tool for monitoring central vision. an electrophysiologic test such as electrooculogram (eog) is specific for confirming the presence of the disease in relatives even in the absence of clinical signs and symptoms. a severe decrease occurs in light response, reflected by an arden (light - peak / dark - trough) ratio of 1.11.5 (the normal arden ratio is 1.8). the full - field electroretinogram (erg) result is normal in best 's disease. a focal erg or multifocal erg, concentrating on macular function, reveals abnormal function corresponding to the area of anatomical disruption. the pathophysiology of best 's disease is explained by abnormality in the retinal pigment epithelium (rpe) with resultant abnormal ionic transport leading to the accumulation of lipofuscin in the rpe cells and sub - rpe space in the macular area. the vitelliruptive stage may herald visual deterioration which becomes worse in the atrophic stage due to the presence of choroidal neovascular membrane. our patient presented with the early stages of the disease, hence the good visual acuity. the patient will be under observation and follow - up so as to detect changes amenable to treatment. choroidal neovascular membrane (cnvm) from best 's disease has been reported to respond well to intravitreal antivegf [7, 8 ]. fundus flourescein angiography is essential in confirming the presence of cnvm and should be done when patient presents with sudden deterioration in vision. if a cnvm develops, then a corresponding area of hyperfluorescence with leakage will be found. since the disease is an autosomal dominant disorder, other family members will benefit from regular fundus examinations, and amslers grid is a valuable tool for monitoring central vision. an electrophysiologic test such as electrooculogram (eog) is specific for confirming the presence of the disease in relatives even in the absence of clinical signs and symptoms. a severe decrease occurs in light response, reflected by an arden (light - peak / dark - trough) ratio of 1.11.5 (the normal arden ratio is 1.8). the full - field electroretinogram (erg) result is normal in best 's disease. a focal erg or multifocal erg, concentrating on macular function, reveals abnormal function corresponding to the area of anatomical disruption. this is a report of best macular dystrophy in ibadan, sub - saharan africa. | best macular dystrophy is reported to be rare in africans. it is a hereditary disease that starts in childhood and progresses through some stages before visual symptoms occur. this case report presents a 43-year - old nigerian with the disease and stresses the importance of regular eye exams of patients and relatives to detect changes such as choroidal neovascular membrane amenable to treatment. |
the vulnerability of elderly hospital patients is characterised by simultaneously occurring somatic, psychological, and social problems, which may result in problems in cognitive functioning, mood, behaviour, activities of daily life, and, consequently, in declining quality of life. first, the choices of nursing interventions are substantially influenced by the patient 's cognitive abilities. the patient 's cognitive abilities determine the provision of nursing care to a large extent as they influence communication, the support to be given in daily life activities, the recognition and treatment of other nursing problems (e.g., pain, behavioural problems), and discharge policy [13 ]. the nurse 's approach to individual patients is also largely influenced by the type of cognitive problem. in case of memory problems, for example, information is repeated or written down ; in case of problems in sustaining attention, a quiet environment is offered ; and in case of executive problems, information is kept simple. for example, memory problems are often the first sign of alzheimer 's disease, whereas loss of awareness may indicate frontotemporal dementia, and hallucinations suggest delirium and dementia with lewy bodies. cognitive functioning is a term used to address the wide area of human information processing. the concept of cognitive functioning is operationalized by breaking it down into several cognitive domains. however, there is no uniform way to classify the cognitive domains ; different authors organise the cognitive domains in different ways [46 ]. cognitive decline may occur due to age - related factors, depression, delirium, dementia, and in combination with serious somatic health problems. recognition of delirium is most important because of its high incidence rate and reversible character, for example, by means of the confusion assessment method (cam ;) and the delirium observation scale (dos ;). however, comprehensive cognitive assessment still needs to be carried out as other types of brain dysfunction might occur, such as dementia or brain injury. a diagnosis is then based on medical history, neurological assessment, neuropsychological assessment, neuroimaging, complaints of patient, and behavioural symptoms. direct observation of the patient 's cognitively mediated abilities complements cognitive assessment [2, 9 ]. daily observation of the patient covers 24 hours a day and may last for several days. it is based on informal interactions between the patient and nurse, for example, when taking a bath, having breakfast, during transfers, or when interacting with other patients. the patient 's cooperation is not required, and observation can be conducted even when patients are too ill to undergo neuropsychological testing. unlike testing, which assesses cognitive abilities under optimal experimental conditions, direct observation assesses a person 's cognitive abilities in daily life. results of daily observation are therefore of high ecological validity as they are linked to the natural setting of daily life and do not depend on one specific test moment [9, 10 ]. observation may improve the reliability of cognitive assessment if serial observations are recorded on several consecutive days. furthermore, observation fits very well into the nursing practice, because information is directly accessible during patient care encounters. one problem with direct observation is its standardisation. yet, well - validated observation scales are rather scarce, although some good examples exist in geriatrics, for example, for depression, pain, agitation, dementia, and as mentioned above, for delirium. we searched the literature for direct observation scales for cognition abilities, excluding, however, delirium screening instruments. we found instruments which assess cognitive functioning in a limited way (not divided into subscales of cognitive domains : e.g., the old), facilitate just one or two cognitive domains (e.g., the nosger), or are too specific for nurses (the a - one). furthermore, many of them also involved issues such as mood or behavioural problems (e.g., moses and nosger). we therefore concluded that there is no valid observation scale available for nurses to comprehensively assess cognitive functioning in relation to possible dementia or brain injury. in daily practice, this means that individual nurses observe cognitive functioning in patients in a nonmethodological way. this undermines the reliability and validity of the information obtained, as demonstrated in two studies on dutch geriatric hospital wards [3, 19 ]. the nurses in these studies assessed different cognitive domains per patient, aimed at different goals. the aim of this study was to develop an observation scale with an acceptable level of content validity which assesses elderly patients ' cognitive abilities in a comprehensive manner, including a wide range of cognitive domains. the resulting nurses observation scale for cognitive abilities (nosca) had to fulfil certain preconditions : it should be suitable for observation of the population of geriatric patients admitted in acute care hospitals ; it should structure around - the - clock observations by nurses and possibly include all interactions naturally occurring between patient and nurse (e.g., bathing, meal times or transfers, small talk, informing, educating) ; it should serve goals important in daily practice, that is, it should enable tailoring to individual (nursing) care plans, contribute to the diagnostic process, or facilitate further neuropsychological examination. the works by haynes, polit and beck, streiner and norman, and foreman. on the development of (cognitive) measurement scales constituted the point of departure for our study. they all underpin the necessity to explicitly decide on the aim and context of the measurement instrument to be developed. content validity concerns the conceptualisation of the content and the degree to which the scale represents the concept. content validity is the degree to which an instrument has an appropriate number of items for the construct being measured. as no uniform way to classify cognitive domains was found in the literature, a panel of experts was required to evaluate the content validity of the scale developed. we obtained a written judgment from the experts concerning the nosca construct and items by means of the delphi technique. in several rounds during which experts ' preferences were integrated, consensus was achieved concerning the nosca construct : the cognitive domains (phase 1) and items (phase 2). in phase 3 we proceeded from the definition of cognitive function as cited by a nursing protocol found in the literature, which was based on the work of lezak : cognitive functioning encompasses the processes by which an individual perceives, registers, stores, retrieves and uses information. as the scale had to have a firm theoretical basis and no consensus was found in the geriatric, psychiatric, or neuropsychological field, we selected the more general health - based international classification of functioning (icf). the icf includes a classification system of functions, in which chapter 1 states the mental functions. some of these mental functions relate to cognitive functions. to enhance reliability, items had to be written for observable patient activities or behaviour, noticeable for all observers, so that bias in the observer 's interpretation would be minimised. as the patient 's cognitive functioning varies depending on the moment of the day, type of activity, or interaction with others, we preferred more than one observation. the observation should take place twice a day during two consecutive days in order to obtain sufficiently reliable outcome and should also account for inter - daily variation. to improve reliability, it was required that the scale be completed at the end of every shift. the multidisciplinary panel consisted of 16 experts and was composed of geriatric nurses (2x), advanced nurses in geriatrics (5x), one nurse lecturer in geriatrics, geriatricians (3x), neuropsychologists (4x), and one occupational therapist (see table 2). all of them had many years of clinical practice experience with elderly people and were in some way experts in assessing cognitive functioning. of the advanced nurses, two had additional experience in developing a measurement instrument for assessing elderly people, two nurses were familiar with the icf, and four of them had published (internationally) on cognitive functioning. three out of the four neuropsychologists had experience in developing a measurement instrument and had published in international journals. the geriatricians were selected because of their clinical expertise and the research they had conducted. of the originally invited experts, only one refused because the delphi rounds would be too time - consuming. all the experts received information about the objective of the observation scale, the setting, and the theoretical framework. phase 1 : domains includedin this phase, the construction of the scale was established by means of the 1st and 2nd delphi rounds. the aim was to determine the cognitive domains to be included in the scale. in the 1st delphi round, nine of the cognitive domains mentioned in chapter 1 of the icf this information also included the icf definition of the cognitive domain and 19 icf subdomains. furthermore, all functions as described in this chapter were presented, so experts were able to judge the representativeness of the nine domains proposed. the experts were requested to respond on the following : the relevance of the icf domain (also including the formulation of the icf label and icf definition) and the relevance of the subdomain (also including the formulation of the icf label and icf definition), representing all important cognitive domains. it was required that at least 70% of the experts agree that a proposed cognitive domain should be included. suggestions from individual experts to rephrase or alter certain parts or to include new (sub)domains were presented to the panel in the second round. in this phase, the construction of the scale was established by means of the 1st and 2nd delphi rounds. the aim was to determine the cognitive domains to be included in the scale. in the 1st delphi round, nine of the cognitive domains mentioned in chapter 1 of the icf this information also included the icf definition of the cognitive domain and 19 icf subdomains. furthermore, all functions as described in this chapter were presented, so experts were able to judge the representativeness of the nine domains proposed. the experts were requested to respond on the following : the relevance of the icf domain (also including the formulation of the icf label and icf definition) and the relevance of the subdomain (also including the formulation of the icf label and icf definition), representing all important cognitive domains. it was required that at least 70% of the experts agree that a proposed cognitive domain should be included. suggestions from individual experts to rephrase or alter certain parts or to include new (sub)domains were presented to the panel in the second round. phase 2 : item selectionin this phase, the items of the scale were determined by means of the 3rd and 4th delphi rounds. central in this phase was the question as to whether an item was relevant to a domain or subdomain and whether the items sufficiently represented the domain. the items presented to the panel were mainly derived from other observation scales (see table 1). all the items were reformulated using the same sentence structure, for example, the patient is able to locate his / her own bed. furthermore, we placed the items into matching domains and subdomains. in the 3rd round, we presented the panel with the 173 items, divided across the domains and subdomains. the experts were requested to respond on the following : the relevance of the item and the priority of the item, representing all important items. then, the items approved were checked for interdependency. when it turned out that too many items were approved, we selected the best observable behaviour or activity. subsequently, the approved items were checked again in order to assess whether they differentiated from items in the other cognitive domains. if they did not, we selected the items which seemed to be most appropriate for certain domains. finally, the suggestions made by the experts concerning the rephrasing of items or inclusion of new items were incorporated.in the 4th delphi round, items which were still under discussion, newly suggested, or located in another domain or subdomain were reevaluated by the experts. in this phase, the items of the scale were determined by means of the 3rd and 4th delphi rounds. central in this phase was the question as to whether an item was relevant to a domain or subdomain and whether the items sufficiently represented the domain. the items presented to the panel were mainly derived from other observation scales (see table 1). all the items were reformulated using the same sentence structure, for example, the patient is able to locate his / her own bed. furthermore, we placed the items into matching domains and subdomains. in the 3rd round, we presented the panel with the 173 items, divided across the domains and subdomains. the experts were requested to respond on the following : the relevance of the item and the priority of the item, representing all important items. then, the items approved were checked for interdependency. when it turned out that too many items were approved, we selected the best observable behaviour or activity. subsequently, the approved items were checked again in order to assess whether they differentiated from items in the other cognitive domains. if they did not, we selected the items which seemed to be most appropriate for certain domains. finally, the suggestions made by the experts concerning the rephrasing of items or inclusion of new items were incorporated. in the 4th delphi round, items which were still under discussion, newly suggested, or located in another domain or subdomain were reevaluated by the experts. phase 3 : pretestin this phase, the feasibility of the observation scale was tested in a small study. over a period of two weeks, nurses from one geriatric ward were asked to complete the observation scale on the basis of their observation of a single patient during their shift. the nurses were asked for comments on the instructions and on the observation scale. some of these comments were subsequently processed. after seven nurses had provided their comments, no further suggestions for adjustments were made. in this phase, the feasibility of the observation scale was tested in a small study. over a period of two weeks, nurses from one geriatric ward were asked to complete the observation scale on the basis of their observation of a single patient during their shift. the nurses were asked for comments on the instructions and on the observation scale. some of these comments were subsequently processed. after seven nurses had provided their comments, no further suggestions for adjustments were made. phase 1 : domains includedin the first two delphi rounds, the response from the 16 panel members was 100%. table 3 presents an overview of the panel 's acceptance of the domains and subdomains and the suggestions they made. after the 1st delphi round, all nine proposed domains were accepted (> 80% agreement), as well as 16 out of the 19 proposed subdomains. the response on the consciousness domain showed insufficient consensus : although 81% of the experts saw this domain as part of the cognitive function scale, several experts also suggested rephrasing because consciousness is only a prerequisite for cognitive functioning and should therefore have another position in the observation scale compared to the other cognitive domains. after the 2nd delphi round, five out of the nine newly suggested subdomains were accepted by the panel (> 80% agreement), see table 3. there was 81% agreement that consciousness should have a distinct place in the observation scale. next, as suggested by experts in the first round, the subdomain of content of thoughts was added to the 2nd round, and although 81% of the panel agreed to include this subdomain, 64% wished to rephrase the items concerned. the panel was therefore consulted by email on the question of whether or not these two subdomains should be included. thirteen out of the 16 experts responded, and it was concluded that the subdomain of dividing attention should not be included (56% agreed). it was also concluded that the subdomain of content of thoughts should be reformulated (85% agreed).in sum, after two delphi rounds and one follow - up email, the panel reached consensus on the construct of cognitive function by means of 8 domains and 17 subdomains (see table 4). furthermore, the domain of consciousness (consisting of two subdomains) was considered a prerequisite for cognitive functioning, which should therefore be assessed beforehand. in the first two delphi rounds, the response from the 16 panel members was 100%. table 3 presents an overview of the panel 's acceptance of the domains and subdomains and the suggestions they made. after the 1st delphi round, all nine proposed domains were accepted (> 80% agreement), as well as 16 out of the 19 proposed subdomains. the response on the consciousness domain showed insufficient consensus : although 81% of the experts saw this domain as part of the cognitive function scale, several experts also suggested rephrasing because consciousness is only a prerequisite for cognitive functioning and should therefore have another position in the observation scale compared to the other cognitive domains. after the 2nd delphi round, five out of the nine newly suggested subdomains were accepted by the panel (> 80% agreement), see table 3. there was 81% agreement that consciousness should have a distinct place in the observation scale. next, as suggested by experts in the first round, the subdomain of content of thoughts was added to the 2nd round, and although 81% of the panel agreed to include this subdomain, 64% wished to rephrase the items concerned. the panel was therefore consulted by email on the question of whether or not these two subdomains should be included. thirteen out of the 16 experts responded, and it was concluded that the subdomain of dividing attention should not be included (56% agreed). it was also concluded that the subdomain of content of thoughts should be reformulated (85% agreed). in sum, after two delphi rounds and one follow - up email, the panel reached consensus on the construct of cognitive function by means of 8 domains and 17 subdomains (see table 4). furthermore, the domain of consciousness (consisting of two subdomains) was considered a prerequisite for cognitive functioning, which should therefore be assessed beforehand. phase 2 : item selectionin the 3rd and 4th delphi rounds, 15 and 16 out of the 16 panel members responded, respectively. after the 3rd round, it turned out that 58 of the 173 items were deemed to be relevant (> 70% agreement). 16 items were excluded, which left us with a selection of 42 items. although these 42 items were accepted for the observation scale, the experts suggested rephrasing of seven items and relocating one item to another domain. all in all, in the 4th round, 45 items were presented to the panel of which eleven were to be judged again on relevance, rephrasing, and representativeness. after the 4th round, the panel accepted nine out of the eleven items as being relevant to the new observation scale and well - formulated (> 70% agreement). in the 3rd and 4th delphi rounds, 15 and 16 out of the 16 panel members responded, respectively. after the 3rd round, it turned out that 58 of the 173 items were deemed to be relevant (> 70% agreement). 16 items were excluded, which left us with a selection of 42 items. although these 42 items were accepted for the observation scale, the experts suggested rephrasing of seven items and relocating one item to another domain. all in all, in the 4th round, 45 items were presented to the panel of which eleven were to be judged again on relevance, rephrasing, and representativeness. after the 4th round, the panel accepted nine out of the eleven items as being relevant to the new observation scale and well - formulated (> 70% agreement). in sum, after the 3rd and 4th rounds, the observation scale consisted of 39 items, divided across 8 domains and 17 subdomains, preceded by 4 items for the domain of consciousness as a condition for cognitive functioning (see table 5). please read the following information about the nosca aim : with this observation list, nurses can gain an impression of whether a patient has cognitive problems and if so, in which domains.these observations will be used to (a) contribute to the diagnostics at the multidisciplinary meeting and (b) to help determine the nursing interventions (approach form, information, family education). instructions : before starting your shift, read the nosca items so that you can make targeted observations and if necessary, induce behaviour (e.g., start a conversation, read a text, get dressed, etc.).create the most optimal conditions for the patient (glasses on, hearing aid working).make observations over a period of two consecutive days, in the day shifts and evening shifts. research has shown that more than four observation periods do not lead to better information.record the observations per shift, so that the report is as reliable as possible. filling in the form : put a circle around the correct answer in accordance with your observations during one shift. repeatedly means that the behaviour occurred repeatedly during your shift.put a circle around the question mark ? if the behaviour could not be observed because the situation did not arise (e.g., because the patient did not read anything). also put a circle around the question mark ? if the patient could not display certain behaviour (e.g., the patient could not put on his / her clothes in the correct order, because he / she can not dress independently due to a physical disability). calculate the average score per subscale, representing a cognitive domain, and note it on the summary sheet (range 03 points). the nosca overall score is calculated by the sum of the eight domains (range 024 points).norm values of the subscales : lower scores indicate less cognitive abilities : 3 means that no problems were observed;2 means that problems sometimes arose;1 means that problems usually arose;0 means that problems arose repeatedly. aim : with this observation list, nurses can gain an impression of whether a patient has cognitive problems and if so, in which domains.these observations will be used to (a) contribute to the diagnostics at the multidisciplinary meeting and (b) to help determine the nursing interventions (approach form, information, family education). instructions : before starting your shift, read the nosca items so that you can make targeted observations and if necessary, induce behaviour (e.g., start a conversation, read a text, get dressed, etc.).create the most optimal conditions for the patient (glasses on, hearing aid working).make observations over a period of two consecutive days, in the day shifts and evening shifts. research has shown that more than four observation periods do not lead to better information.record the observations per shift, so that the report is as reliable as possible. filling in the form : put a circle around the correct answer in accordance with your observations during one shift. repeatedly means that the behaviour occurred repeatedly during your shift.put a circle around the question mark ? if the behaviour could not be observed because the situation did not arise (e.g., because the patient did not read anything) if the patient could not display certain behaviour (e.g., the patient could not put on his / her clothes in the correct order, because he / she can not dress independently due to a physical disability). calculate the average score per subscale, representing a cognitive domain, and note it on the summary sheet (range 03 points). the nosca overall score is calculated by the sum of the eight domains (range 024 points).norm values of the subscales : lower scores indicate less cognitive abilities : 3 means that no problems were observed;2 means that problems sometimes arose;1 means that problems usually arose;0 means that problems arose repeatedly. with this observation list, nurses can gain an impression of whether a patient has cognitive problems and if so, in which domains.these observations will be used to (a) contribute to the diagnostics at the multidisciplinary meeting and (b) to help determine the nursing interventions (approach form, information, family education). with this observation list, nurses can gain an impression of whether a patient has cognitive problems and if so, in which domains. these observations will be used to (a) contribute to the diagnostics at the multidisciplinary meeting and (b) to help determine the nursing interventions (approach form, information, family education). before starting your shift, read the nosca items so that you can make targeted observations and if necessary, induce behaviour (e.g., start a conversation, read a text, get dressed, etc.).create the most optimal conditions for the patient (glasses on, hearing aid working).make observations over a period of two consecutive days, in the day shifts and evening shifts. research has shown that more than four observation periods do not lead to better information.record the observations per shift, so that the report is as reliable as possible. before starting your shift, read the nosca items so that you can make targeted observations and if necessary, induce behaviour (e.g., start a conversation, read a text, get dressed, etc.). create the most optimal conditions for the patient (glasses on, hearing aid working). make observations over a period of two consecutive days, in the day shifts and evening shifts. research has shown that more than four observation periods do not lead to better information. record the observations per shift, so that the report is as reliable as possible. put a circle around the correct answer in accordance with your observations during one shift. repeatedly means that the behaviour occurred repeatedly during your shift.put a circle around the question mark ? if the behaviour could not be observed because the situation did not arise (e.g., because the patient did not read anything) if the patient could not display certain behaviour (e.g., the patient could not put on his / her clothes in the correct order, because he / she can not dress independently due to a physical disability). put a circle around the correct answer in accordance with your observations during one shift. if the behaviour could not be observed because the situation did not arise (e.g., because the patient did not read anything) if the patient could not display certain behaviour (e.g., the patient could not put on his / her clothes in the correct order, because he / she can not dress independently due to a physical disability). the observations over four shifts lead to one conclusion. calculate the average score per subscale, representing a cognitive domain, and the nosca overall score is calculated by the sum of the eight domains (range 024 points).norm values of the subscales : lower scores indicate less cognitive abilities : 3 means that no problems were observed;2 means that problems sometimes arose;1 means that problems usually arose;0 means that problems arose repeatedly. the observations over four shifts lead to one conclusion. calculate the average score per subscale, representing a cognitive domain, and the nosca overall score is calculated by the sum of the eight domains (range 024 points). norm values of the subscales : lower scores indicate less cognitive abilities : 3 means that no problems were observed;2 means that problems sometimes arose;1 means that problems usually arose;0 means that problems arose repeatedly. 3 means that no problems were observed ; 2 means that problems sometimes arose ; 1 means that problems usually arose ; 0 means that problems arose repeatedly. phase 3 : pretestthe feasibility of the concept of the observation scale was tested seven times consecutively. five times improvements were made for the sake of clarity ; the last two tests showed no need for adjustments. in general, nurses had no difficulties filling in the form and it took them only a few minutes per patient per shift. the instructions were changed several times, and the layout of the items was improved, resulting in a more concise and clear text. five times improvements were made for the sake of clarity ; the last two tests showed no need for adjustments. in general, nurses had no difficulties filling in the form and it took them only a few minutes per patient per shift. the instructions were changed several times, and the layout of the items was improved, resulting in a more concise and clear text. the object of this study was to develop an observation scale in which cognitive abilities are assessed in a comprehensive manner, and which has an acceptable level of content validity. we succeeded in designing the nurses ' observation scale cognitive abilities (nosca), in which cognitive functioning is classified into eight domains, 17 subdomains, and 39 items, preceded by 4 items on the domain of consciousness. the content validity of the nosca, as a measurement of the degree to which the scale represents the concept of cognitive functioning, is high for two reasons. first, the minimum agreement between the panel members was 70%, and often higher on certain domains and items. second, after the fourth delphi round, consensus was reached that no domains or items were lacking. in the preceding delphi rounds, the panel had made suggestions for including new domains and items, and some were accepted in the next delphi round. the strength of our procedure was that the panel members represented four disciplines (nursing, neuropsychology, geriatrics and speech, therapy). thus, the quality of the panel was enhanced because each discipline with its specific focus and knowledge of the concept of cognitive functioning provided specific input for the observation scale. an equally strong point of the nosca and its development is that the scale is based on the icf 's theoretical framework. although the icf is not a cognitive concept but a general classification of functioning, it proved to be very suitable for the purpose of our study and probably will increase acceptability in the field. the method we used had only one drawback : in designing the nosca, we were required, due to lack of consensus on the concept of cognitive functioning in the literature, to develop consensus by means of the delphi technique. the disadvantage of this technique is that consensus depends on the current state of the art in the professional disciplines and that, through the years, the state of art will further develop. particularly as a result of the new technique of neuroimaging, it is expected that the knowledge of brain functions will increase in the coming years, and consequently the observation scale may have to be revised after some time. now that the content validity has been described internal consistency, interrater reliability, and intrarater reliability will be examined, as well as construct validity. for the latter, results of the nosca will be related to clinical diagnoses, severity of dementia, and results of neuropsychological tests. discriminant validity will be studied by comparing the results of the nosca with scores on depression. expecting positive results on the psychometric qualities, we are convinced that the implications of the nosca for the nursing practice will prove important. furthermore, behavioural observation within a clinical environment provides invaluable information regarding underlying cognitive function. the value of observation of daily behaviour for assessing cognitive functioning was the reason for miller. to develop the batch (after we had finished our literature search). this is an assessment tool to record observations of patients ' daily functioning under subheading that reflect cognitive domains. they were interested in an observation scale for patients in a psychiatric setting (mean age 50 years) who refuse or can not undertake cognitive assessments. the batch may well be interesting if more data are collected on validity, reliability, distinction between the subscale scores and if the scale were to be applied in a geriatric patient group. for geriatric patients, several methods for assessing their cognitive functioning need to be combined, and daily observation of cognitive functioning remains important because of its high ecological value. we expect that the nosca will be useful at hospital medical and surgical wards as well, because the items all cover behaviour which is easy to observe, and thus the scoring does not require specific geriatric expertise or knowledge. in other settings, such as home care and homes for the elderly, it will also be useful in assessing cognitive functioning. for these different settings, separate validation studies will be required. for the time being, we recommend that nurses closely observe elderly patients and report cognitive functioning and dysfunctioning, and associated behaviour. improving these systematic observations will enhance the ability of nurses to truly tailor their interventions to the patients ' abilities. the nosca is a promising tool that will help nurses to perform the challenging observations of cognitive functioning, and thereby improve the quality of care provided to the fast growing number of older patients. this research received no specific grant from any funding agency in public, commercial, or not - for - profit sectors. | background. to assess a patient 's cognitive functioning is an important issue because nurses tailor their nursing interventions to the patient 's cognitive abilities. although some observation scales exist concerning one or more cognitive domains, so far, no scale has been available which assesses cognitive functioning in a comprehensive way. objectives. to develop an observation scale with an accepted level of content validity and which assesses elderly patients ' cognitive functioning in a comprehensive way. methods. delphi technique, a multidisciplinary panel developed the scale by consensus through four delphi rounds (> 70% agreement). the international classification of functioning / icf was used as theoretical framework. results. after the first two delphi rounds, the panel reached consensus about 8 cognitive domains and 17 sub domains. after two other rounds, 39 items were selected, divided over 8 domains and 17 sub domains. discussion. the nurses ' observation scale cognitive abilities (nosca) was successfully designed. the content validity of the scale is high because the scale sufficiently represents the concept of cognitive functioning : the experts reached a consensus of 70% or higher on all domains and items included ; and no domains or items were lacking. as a next step, the psychometric qualities of the nosca will have to be tested. |
storage and biochemical analyses of post - mortem human brain samples and transmission studies to mice were performed with written informed consent from patients with capacity to give consent. where patients were unable to give informed consent, assent was obtained from their relatives in accordance with uk legislation and codes of practice. samples were stored and used in accordance with the human tissue authority codes of practice and in line with the requirements of the human tissue authority licence held by ucl institute of neurology. this study was performed with approval from the medical research advisory committee of the government of papua new guinea, the national hospital for neurology and neurosurgery and the ucl institute of neurology joint research ethics committee (now national research ethics service committee, london queen square) - rec references : 03/n036, 03/n038 and 03/n133. work with mice was performed under approval and licence granted by the uk home office (animals (scientific procedures) act 1986) ; project licence number 70/6454 which conformed to university college london institutional and arrive guidelines (www.nc3rs.org.uk/arrive/). the 759bp human prp orf was amplified by pcr with pfu polymerase from genomic dna prepared from the brain of a patient with the 127v polymorphism on the 129 m allele, using forward primer 5-gtcgaccagtcattatggcgaacctt-3 and reverse primer 5-ctcgagaagaccttcctcatcccact-3. restriction sites sal i and xho i (underlined) were introduced in the forward and reverse primers respectively for cloning. the blunt ended pcr fragment generated by pfu polymerase was subcloned into sma i digested psp72 vector and sequenced to ensure that no spurious alterations had been introduced by the pcr and to confirm the presence of valine-127 and methionine-129 polymorphisms matching the patient dna template. the amplified human prp orf with the confirmed polymorphisms was then isolated by sal i and xho i digestion. subsequent subcloning into the sal i site of the cosmid vector shacostt, packaging and preparation of high quality dna of the not i transgene insert was as previously reported. microinjection of the purified not i dna fragment was carried out according to standard protocol into single cell eggs of prnp null mice which had been backcrossed onto an fvb / n genetic background. genotyping was performed by pcr and prp expression levels estimated by western blot analysis as previously reported. two homozygous lines were established for variant huprp vm described as tg(huprp vm / vm prnp)-183 (vm tg183) and tg(huprp vm / vm prnp)-190 (vm tg190), with transgene expression levels of 2 and 1 respectively, that of pooled 10% (w / v) normal human brain homogenate (table 1). fvb - congenic versions of tg35 mice homozygous for huprp gm and tg152 mice homozygous for huprp gv were used as wild type human prp - expressing controls, designated tg(huprp gm / gm prnp)-35c (gm tg35c) and tg(huprp gv / gv prnp)-152c (gv tg152c) respectively. the prnp codon 127 - 129 genotypes and relative expression levels of wild type and variant prp in the parental transgenic lines and in the f1 crosses are shown in table 1. inocula were prepared, using disposable equipment for each inoculum, in a microbiological containment level 3 laboratory and inoculations performed within a class 1 microbiological safety cabinet as described previously. ten mice per group of control gm tg35c and gv tg152c lines and 15 per group of newly generated vm tg183, vm tg190 lines and their respective crosses with tg35c and tg152c, were inoculated (see below) with human brain homogenates from neuropathologically confirmed patients comprising, four kuru cases, eight sporadic cjd cases, four iatrogenic cjd cases and two cases of vcjd. the genotype of each mouse was confirmed by pcr of ear punch dna prior to inclusion and all mice were uniquely identified by sub - cutaneous transponders. disposable cages were used and all cage lids and water bottles were also uniquely identified by transponder and remained with each cage of mice throughout the incubation period. mice (female, aged 6 - 8 weeks) were randomly assigned to experimental groups and anaesthetised with a mixture of halothane and o2, and intracerebrally inoculated into the right parietal lobe with 30 l of a 1% (w / v) brain homogenate prepared in dulbecco s phosphate buffered saline lacking ca or mg ions (d - pbs). all mice were thereafter examined daily for early indicators of clinical prion disease including piloerection, sustained erect ears, intermittent generalised tremor, unsustained hunched posture, rigid tail, mild loss of coordination, and clasping hind legs when lifted by the tail. definite diagnosis of clinical prion disease (triggering experimental end point) was reached if mice exhibited any two early indicator signs in addition to one confirmatory sign, or any two confirmatory signs. the confirmatory signs included ataxia, impairment of righting reflex, dragging of hind limbs, sustained hunched posture, or significant abnormal breathing. mice were killed (by co2 asphyxiation) if they exhibited any signs of distress or once a diagnosis of prion disease was established. at post - mortem brains from inoculated mice were removed, divided sagittally with half frozen and half fixed in 10% buffered formol saline. fixed brain was immersed in 98% formic acid for 1 hour and paraffin wax embedded. serial sections of 4 m thickness were pre - treated by boiling for 10 min in a low ionic strength buffer (2.1 mm tris, 1.3 mm edta, 1.1 mm sodium citrate, ph 7.8) before exposure to 98% formic acid for 5 min. abnormal prp accumulation was examined using anti - prp monoclonal antibody icsm 35 (d - gen ltd, london) on a ventana automated immunohistochemical staining machine (ventana medical systems inc., tucson, arizona) using proprietary secondary detection reagents (ventana medical systems inc) before development with 33 diaminobenzedine tetrachloride as the chromogen. preparation of brain homogenates (10% (w / v) in d - pbs), proteinase k digestion (75 g / ml for 1 h at 37c) and subsequent immunoblotting was performed as described previously. blots were probed with anti - prp monoclonal antibody icsm 35 (d - gen ltd, london) in conjunction with an anti - mouse igg - alkaline phosphatase conjugate and development in chemiluminescent substrate (cdp - star ; tropix inc). storage and biochemical analyses of post - mortem human brain samples and transmission studies to mice were performed with written informed consent from patients with capacity to give consent. where patients were unable to give informed consent, assent was obtained from their relatives in accordance with uk legislation and codes of practice. samples were stored and used in accordance with the human tissue authority codes of practice and in line with the requirements of the human tissue authority licence held by ucl institute of neurology. this study was performed with approval from the medical research advisory committee of the government of papua new guinea, the national hospital for neurology and neurosurgery and the ucl institute of neurology joint research ethics committee (now national research ethics service committee, london queen square) - rec references : 03/n036, 03/n038 and 03/n133. work with mice was performed under approval and licence granted by the uk home office (animals (scientific procedures) act 1986) ; project licence number 70/6454 which conformed to university college london institutional and arrive guidelines (www.nc3rs.org.uk/arrive/). the 759bp human prp orf was amplified by pcr with pfu polymerase from genomic dna prepared from the brain of a patient with the 127v polymorphism on the 129 m allele, using forward primer 5-gtcgaccagtcattatggcgaacctt-3 and reverse primer 5-ctcgagaagaccttcctcatcccact-3. restriction sites sal i and xho i (underlined) were introduced in the forward and reverse primers respectively for cloning. the blunt ended pcr fragment generated by pfu polymerase was subcloned into sma i digested psp72 vector and sequenced to ensure that no spurious alterations had been introduced by the pcr and to confirm the presence of valine-127 and methionine-129 polymorphisms matching the patient dna template. the amplified human prp orf with the confirmed polymorphisms was then isolated by sal i and xho i digestion. subsequent subcloning into the sal i site of the cosmid vector shacostt, packaging and preparation of high quality dna of the not i transgene insert was as previously reported. microinjection of the purified not i dna fragment was carried out according to standard protocol into single cell eggs of prnp null mice which had been backcrossed onto an fvb / n genetic background. genotyping was performed by pcr and prp expression levels estimated by western blot analysis as previously reported. two homozygous lines were established for variant huprp vm described as tg(huprp vm / vm prnp)-183 (vm tg183) and tg(huprp vm / vm prnp)-190 (vm tg190), with transgene expression levels of 2 and 1 respectively, that of pooled 10% (w / v) normal human brain homogenate (table 1). fvb - congenic versions of tg35 mice homozygous for huprp gm and tg152 mice homozygous for huprp gv were used as wild type human prp - expressing controls, designated tg(huprp gm / gm prnp)-35c (gm tg35c) and tg(huprp gv / gv prnp)-152c (gv tg152c) respectively. the prnp codon 127 - 129 genotypes and relative expression levels of wild type and variant prp in the parental transgenic lines and in the f1 crosses are shown in table 1. inocula were prepared, using disposable equipment for each inoculum, in a microbiological containment level 3 laboratory and inoculations performed within a class 1 microbiological safety cabinet as described previously. ten mice per group of control gm tg35c and gv tg152c lines and 15 per group of newly generated vm tg183, vm tg190 lines and their respective crosses with tg35c and tg152c, were inoculated (see below) with human brain homogenates from neuropathologically confirmed patients comprising, four kuru cases, eight sporadic cjd cases, four iatrogenic cjd cases and two cases of vcjd. the genotype of each mouse was confirmed by pcr of ear punch dna prior to inclusion and all mice were uniquely identified by sub - cutaneous transponders. disposable cages were used and all cage lids and water bottles were also uniquely identified by transponder and remained with each cage of mice throughout the incubation period. mice (female, aged 6 - 8 weeks) were randomly assigned to experimental groups and anaesthetised with a mixture of halothane and o2, and intracerebrally inoculated into the right parietal lobe with 30 l of a 1% (w / v) brain homogenate prepared in dulbecco s phosphate buffered saline lacking ca or mg ions (d - pbs). all mice were thereafter examined daily for early indicators of clinical prion disease including piloerection, sustained erect ears, intermittent generalised tremor, unsustained hunched posture, rigid tail, mild loss of coordination, and clasping hind legs when lifted by the tail. definite diagnosis of clinical prion disease (triggering experimental end point) was reached if mice exhibited any two early indicator signs in addition to one confirmatory sign, or any two confirmatory signs. the confirmatory signs included ataxia, impairment of righting reflex, dragging of hind limbs, sustained hunched posture, or significant abnormal breathing. mice were killed (by co2 asphyxiation) if they exhibited any signs of distress or once a diagnosis of prion disease was established. at post - mortem brains from inoculated mice were removed, divided sagittally with half frozen and half fixed in 10% buffered formol saline. fixed brain was immersed in 98% formic acid for 1 hour and paraffin wax embedded. serial sections of 4 m thickness were pre - treated by boiling for 10 min in a low ionic strength buffer (2.1 mm tris, 1.3 mm edta, 1.1 mm sodium citrate, ph 7.8) before exposure to 98% formic acid for 5 min. abnormal prp accumulation was examined using anti - prp monoclonal antibody icsm 35 (d - gen ltd, london) on a ventana automated immunohistochemical staining machine (ventana medical systems inc., tucson, arizona) using proprietary secondary detection reagents (ventana medical systems inc) before development with 33 diaminobenzedine tetrachloride as the chromogen. preparation of brain homogenates (10% (w / v) in d - pbs), proteinase k digestion (75 g / ml for 1 h at 37c) and subsequent immunoblotting was performed as described previously. blots were probed with anti - prp monoclonal antibody icsm 35 (d - gen ltd, london) in conjunction with an anti - mouse igg - alkaline phosphatase conjugate and development in chemiluminescent substrate (cdp - star ; tropix inc). the provenance of each brain sample is designated above each lane and molecular markers are indicated on the left. the prnp codon 127 (g, glycine, v, valine) or codon 129 (m, methionine, v, valine) genotypes of the transgenic mice are designated below. transgenic mouse brains were analysed by enhanced chemiluminescence without proteinase - k digestion and equal amounts of total protein loaded in each well and probed with anti - prp monoclonal antibody icsm 35. wild type human prp expression levels of gm / gm tg35c and gv / gv tg152c mice are 2- and 6-fold higher respectively, than seen in 10 % (w / v) pooled human brain homogenate. homozygous vm tg183 and tg190 mice have 2-fold higher or equivalent prp expression levels respectively compared to 10 % (w / v) pooled human brain homogenate. all mice were intracerebrally challenged with the same vcjd prion isolates (i342 and i7042). abnormal prp deposition in fixed post - mortem brain from affected mice was detected using anti - prp monoclonal antibody icsm 35. (a - b) homozygous tg35c mice (expressing gm / gm wild type prp only) show intense and widespread prp plaque deposits. magnified areas show (ai) hippocampus, (bi) frontal cortex and (aii and bii) thalamus. in contrast, heterozygous gm / vm tg35c / tg183 mice expressing equivalent levels of gm and vm prp (c - d) show only weak prp deposition in the corpus callosum (ci and di) with no abnormal prp deposition detected in other brain areas, for example, in the thalamus (cii and dii). heterozygous gm / vm tg35c / tg190 mice which express a lower level of vm prp relative to wild type gm prp (e - f) show greater levels of prp deposition than seen in tg35c / tg183 mice following challenge with the same vcjd prion isolates, (ei, eii and fi) corpus callosum ; (fii) pons. scale bar, upper panels (a - f) 2 mm ; magnified panels, 100 m. mice were intracerebrally challenged with kuru, classical and variant cjd prions. following prolonged (> 600 days) post inoculation periods, abnormal prp deposition in fixed post - mortem brain (a - d) vm / vm tg183 mice with 2-fold overexpression of vm prp. (e - h) vm / vm tg190 mice expressing endogenous levels of vm prp. red square boxes in the main panels (a - h) define the area of magnified images of hippocampus (i) and thalamus (ii) shown in the lower panels. scale bar, a - h, 2 mm ; magnified panels i and ii, 100 m. the lack of detection of abnormal prp deposition in brain indicates that the mice are not subclinically infected with prions. gm / gm tg35c mice or gv / gv tg152c mice are homozygous for wild type human prp alleles and are fully susceptible to kuru and classical cjd prions. vm / vm tg183 or vm / vm tg190 transgenic mice are homozygous for the variant vm allele found only in humans from the kuru - exposed population of papua new guinea and are entirely resistant to infection with kuru and classical cjd prions. the levels of prp expression in the brain of these homozygous transgenic mice relative to a pooled human brain homogenate are 1 (tg190 mice) 2 (tg35c and tg183 mice) and 6 (tg152c mice). generation of f1 mice through inter - breeding the various homozygous lines produces different combinations of the various human prp alleles leading to differences in the relative expression levels of the various prion proteins in brain. the prp expression ratios from the two prp alleles in the crosses are shown in parentheses above the cartoon mice. full, intermediate or low susceptibility of the mice to infection with kuru and classical cjd prions is indicated by three, two or one diagonal red bar, respectively, drawn across the mice. mice with no red bar are entirely resistant to infection with kuru and classical cjd prions. mice were intracerebrally challenged with kuru and classical cjd prions and abnormal prp deposition in fixed post - mortem brain from affected mice was examined using anti - prp monoclonal antibody icsm 35. red square boxes labelled i and ii in panels a - f mark brain areas that are magnified and displayed below ; (i) cortex and (ii) thalamus. (a - b) wild type gv / gv tg152c mice. (c - d) heterozygous gv / vm tg152c / tg183 mice. (e - f) heterozygous gv / vm tg152c/190 mice scale bar, a - f, 2 mm ; magnified panels i and ii, 100 m. the detection of abnormal prp deposition in brain indicates that the mice are infected with prions. | mammalian prions, transmissible agents causing lethal neurodegenerative diseases, are composed of assemblies of misfolded cellular prion protein (prp) 1. a novel prp variant, g127v, was under positive evolutionary selection during the epidemic of kuru, an acquired prion disease epidemic of the fore population in papua new guinea, and appeared to provide strong protection against disease in the heterozygous state2. we have now investigated the protective role of this variant and its interaction with the common worldwide m129v prp polymorphism ; v127 was seen exclusively on a m129 prnp allele. here we demonstrate that transgenic mice expressing both variant and wild type human prp are completely resistant to both kuru and classical cjd prions (which are closely similar) but can be infected with variant cjd prions, a human prion strain resulting from exposure to bse prions to which the fore were not exposed. remarkably however, mice expressing only prp v127 were completely resistant to all prion strains demonstrating a different molecular mechanism to m129v, which provides its relative protection against classical cjd and kuru in the heterozygous state. indeed this single amino acid substitution (gv) at a residue invariant in vertebrate evolution is as protective as deletion of the protein. further study in transgenic mice expressing different ratios of variant and wild type prp indicates that not only is prp v127 completely refractory to prion conversion, but acts as a potent dose - dependent inhibitor of wild type prion propagation. |
thermoplastic obturation techniques have the potential to produce a complete filling of root canal space, including irregularities and lateral canals. several techniques have been proposed to obtain optimal adherence of gutta - percha (gp) to root canal walls to minimize microbial leakage and to ensure treatment success. since the introduction of the warm vertical condensation technique by schilder, in 1967, a number of clinical placement techniques involving warm gp have been developed. however, there are no reports comparing different brands of thermoplasticized gp with respect to their chemical composition and thermal behavior. heating gp is known to result in changes to the molecular structure (phases) and polymer volume of the compound. this physical property manifests itself as an increase in volume of material that can be compacted into a root canal cavity. gp is a trans-1, 4-polyisoprene polymer obtained from the coagulation of latex produced by trees of the family sapotaceae and is primarily derived from palaquium gutta bail. the crystalline phase appears in two forms : 1) the alpha () phase and 2) the beta () phase. during thermal manipulation, the structure of the compound transforms into the crystalline structure of the polymer from the -form to the -form and from the -form to the amorphous phase. the forms (and) differ only in the molecular repeat distance and single - bond form. some studies have demonstrated the thermal properties of dental gp and have shown that changes in the crystalline form may lead to irreversible volumetric change. the purpose of the present study was to determine the chemical composition (organic and inorganic components), as confirmed by x - ray diffraction and energy dispersive x - ray microanalysis (edx), of thermafil, microseal (cone and microflow), obtura and obtura flow. in addition, their thermal properties in response to temperature variations were studied via differential scanning calorimetry (dsc) to determine the temperature at which gp changes from the - to the -form and from the -form to the amorphous phase. finally, analyses were conducted to ascertain whether there is a significant correlation between chemical composition and thermal behavior. five gp brands were analyzed three times each before the expiration dates established by the manufacturer. these brands consisted of three thermoplastic gp systems, as listed : thermafil (th) (dentsply mailleffer, tulsa, ok, usa) ; obtura (ob) (obtura corporation, penton, missouri, usa) ; obtura flow (of) (obtura corporation, penton, missouri, usa) ; microseal cone (mc) and microseal microflow (mf) (analytic endodontics, glendora, ca, usa). the chemical components of the gp brands were determined in accordance with the procedures described by friedman. and modified by gurgel - filho. 1 g of commercial gp points was dissolved in 10 ml of chloroform for 24 hours ; the resulting solution was then centrifuged for 15 min at 6000 rpm. this allowed for separation of the solid phase (inorganic components : zinc oxide and metal sulfates) from the supernatant (organic components : gp, resins and waxes) remaining in solution. gp, insoluble in acetone, was coagulated by the addition of this solvent and weighed after total solvent evaporation. the mass of soluble material in acetone (wax / resin) was determined after solvent evaporation using a microbalance (xp56 microbalance, mettler - toledo int inc, brazil). the organic fraction (gp and wax / resin) was determined by use of the procedure described by gurgel - filho. barium sulfate content was determined by sulfur percentage (elemental microanalysis) using equation 1. zinc oxide content was calculated using equation 2 when the specimen contained sulfur or using equation 3 when it did not. equation 1 : baso4% = s% (baso4 molar mass)/(s atomic mass) = s% 7.28equation 2 : zno% = 100% - (gp polymer% + wax / resin% + baso4 %) equation 3 : zno% = 100% - (gp polymer% + wax / resin%) equation 1 : baso4% = s% (baso4 molar mass)/(s atomic mass) = s% 7.28 equation 2 : zno% = 100% - (gp polymer% + wax / resin% + baso4 %) equation 3 : zno% = 100% - (gp polymer% + wax / resin%) energy dispersive x - ray microanalysis (edx) was applied to qualitatively establish the presence of chemical elements in the samples. the analyses were made in sections, with all specimens mounted on aluminum stubs and carbon coated using a dsm-940a scanning electron microscope (carl zeiss, jena, germany) and a link system 3.34 series 300 with si (li) detector. the x - ray diffraction analysis was a philips mdr pro (eindhoven, holland) with 40 kv and 20 ma using a copper tube. quantitative determination of carbon, hydrogen, nitrogen and sulfur chemical elements in the samples was carried out in a chns / o carlo erba, model 1110 microanalyzer (carlo erba, rodano, italy) with combustion at 1000c, in atmospheric oxygen. a thermal conductivity detector was used and all of the analyses were repeated three times for all materials. the thermal analyses of all samples were carried out by differential scanning calorimetry (dsc) (shimadzu dsc-50, shimadzu corporation, japan) and the calibration of each was verified using a calcium oxalate standard. for each material, duplicate samples between 40 and 50 mg were analysed using 25 mg alumina as the reference material. all specimens were heated from room temperature to 70c at a rate of 1c / min, with the endothermic peaks being recorded for each material. this was followed by rapid heating up to 130c, rapid cooling to room temperature and heating up again back to 70c, at a rate of 1c / min. simultaneously, thermogravimetric analysis (tga) (shimadzu tga-050, shimadzu corporation, japan) was performed to determine the amount of weight lost (organic fraction) during the heating cycles. this analysis was made to confirm the results obtained by quantitative chemical analyses of the organic fraction. the data collected for each sample were entered into a spreadsheet and analyzed statistically using spss 12.0 for windows (spss inc., chicago, ill, usa). the anova test was used to test the null hypothesis that there is no difference between the compositions of all gp brands analyzed. the chemical components of the gp brands were determined in accordance with the procedures described by friedman. and modified by gurgel - filho. 1 g of commercial gp points was dissolved in 10 ml of chloroform for 24 hours ; the resulting solution was then centrifuged for 15 min at 6000 rpm. this allowed for separation of the solid phase (inorganic components : zinc oxide and metal sulfates) from the supernatant (organic components : gp, resins and waxes) remaining in solution. gp, insoluble in acetone, was coagulated by the addition of this solvent and weighed after total solvent evaporation. the mass of soluble material in acetone (wax / resin) was determined after solvent evaporation using a microbalance (xp56 microbalance, mettler - toledo int inc, brazil). the organic fraction (gp and wax / resin) barium sulfate content was determined by sulfur percentage (elemental microanalysis) using equation 1. zinc oxide content was calculated using equation 2 when the specimen contained sulfur or using equation 3 when it did not. equation 1 : baso4% = s% (baso4 molar mass)/(s atomic mass) = s% 7.28equation 2 : zno% = 100% - (gp polymer% + wax / resin% + baso4 %) equation 3 : zno% = 100% - (gp polymer% + wax / resin%) equation 1 : baso4% = s% (baso4 molar mass)/(s atomic mass) = s% 7.28 equation 2 : zno% = 100% - (gp polymer% + wax / resin% + baso4 %) equation 3 : zno% = 100% - (gp polymer% + wax / resin%) energy dispersive x - ray microanalysis (edx) was applied to qualitatively establish the presence of chemical elements in the samples. the analyses were made in sections, with all specimens mounted on aluminum stubs and carbon coated using a dsm-940a scanning electron microscope (carl zeiss, jena, germany) and a link system 3.34 series 300 with si (li) detector. the apparatus used for the x - ray diffraction analysis was a philips mdr pro (eindhoven, holland) with 40 kv and 20 ma using a copper tube. quantitative determination of carbon, hydrogen, nitrogen and sulfur chemical elements in the samples was carried out in a chns / o carlo erba, model 1110 microanalyzer (carlo erba, rodano, italy) with combustion at 1000c, in atmospheric oxygen. a thermal conductivity detector was used and all of the analyses were repeated three times for all materials. the thermal analyses of all samples were carried out by differential scanning calorimetry (dsc) (shimadzu dsc-50, shimadzu corporation, japan) and the calibration of each was verified using a calcium oxalate standard. for each material, duplicate samples between 40 and 50 mg were analysed using 25 mg alumina as the reference material. all specimens were heated from room temperature to 70c at a rate of 1c / min, with the endothermic peaks being recorded for each material. this was followed by rapid heating up to 130c, rapid cooling to room temperature and heating up again back to 70c, at a rate of 1c / min. simultaneously, thermogravimetric analysis (tga) (shimadzu tga-050, shimadzu corporation, japan) was performed to determine the amount of weight lost (organic fraction) during the heating cycles. this analysis was made to confirm the results obtained by quantitative chemical analyses of the organic fraction. the data collected for each sample were entered into a spreadsheet and analyzed statistically using spss 12.0 for windows (spss inc., chicago, ill, usa). the anova test was used to test the null hypothesis that there is no difference between the compositions of all gp brands analyzed. a heterogeneous concentration of compounds in the gp brands was noted, as is illustrated in table 1. the microseal cone showed the highest percentage of gp (p = 0.0001), followed by obtura, microseal microflow (p = 0.0022), thermafil and obtura flow (p = 0.0022). thermafil, obtura flow and microseal microflow showed high concentrations of wax and resins (p = 0.0022) in their compositions when compared with the remaining groups. with regard to the percentages of organic compounds, it was noted that microseal (cone and microflow) showed the highest percentages (p = 0.0125). these results appear in an inverted position when the analyses were made with the other remaining organic compounds. mean and standard deviation of percentage weights from chemical assay of all gp brands analyzed the results obtained from x - ray diffraction and elemental microanalysis are presented in table 2. x - ray diagrams and edx microanalysis qualitatively confirmed the chemical components of gp brands. the presence of barium and sulfur were noted for all specimens. quantitative analysis was carried out via elemental microanalysis. zno and baso4 were detected in all specimens analyzed (x) all products showed thermal behavior typical of -phase gp, with two endothermic peaks during the first run. dental gp transitions occurred when the gp was heated from 50.7c to 53.4c (- to -phase) and from 60.6c to 62.9 (- to amorphous - phase), depending on the specific compound. after replication, all specimens analyzed showed similar thermal behavior (dsc and tga), presented in table 3. tga showed that none of the materials had measurable weight loss under the experimental conditions (from ambient temperature up to 130). temperatures (c) at which endothermic peaks occurred (dsc analysis) and percentage of weight loss (tga) a heterogeneous concentration of compounds in the gp brands was noted, as is illustrated in table 1. the microseal cone showed the highest percentage of gp (p = 0.0001), followed by obtura, microseal microflow (p = 0.0022), thermafil and obtura flow (p = 0.0022). thermafil, obtura flow and microseal microflow showed high concentrations of wax and resins (p = 0.0022) in their compositions when compared with the remaining groups. with regard to the percentages of organic compounds, it was noted that microseal (cone and microflow) showed the highest percentages (p = 0.0125). these results appear in an inverted position when the analyses were made with the other remaining organic compounds. the results obtained from x - ray diffraction and elemental microanalysis are presented in table 2. x - ray diagrams and edx microanalysis qualitatively confirmed the chemical components of gp brands. all products showed thermal behavior typical of -phase gp, with two endothermic peaks during the first run. dental gp transitions occurred when the gp was heated from 50.7c to 53.4c (- to -phase) and from 60.6c to 62.9 (- to amorphous - phase), depending on the specific compound. after replication, all specimens analyzed showed similar thermal behavior (dsc and tga), presented in table 3. tga showed that none of the materials had measurable weight loss under the experimental conditions (from ambient temperature up to 130). temperatures (c) at which endothermic peaks occurred (dsc analysis) and percentage of weight loss (tga) the thermafil, obtura and microseal gp systems were used in this study due to their widespread clinical use in root canal systems and their excellent filling properties even in oval - shaped root canals. the constituents of these materials were identified by qualitative chemical analysis (x - ray diffraction and edx) and their relative percentages were determined by elemental microanalysis and chemical composition, using a slow dissolution process due to the low dissolving rate of gp. any resins and/or waxes present in the materials x - ray and elemental microanalyses provided an overview of the elemental composition of the gp brands. elemental microanalysis is the most popular technique for quantifying sulfur and has been described by several authors in the literature. despite the relevance and importance of the x - ray, microanalysis and diffraction techniques in the screening of some chemical elements and compounds present in gp brands, there are some limitations to the use of these techniques for quantitative analysis. for rigorous quantitative x - ray microanalysis, the atomic number of the analyzed element must be greater than 11. thus, important elements such as hydrogen, carbon, nitrogen and oxygen could not be correctly quantified. in addition, the element concentration has to be greater than 5% and the specimen must be homogeneous in the volume sampled. assumptions concerning the relative contents of elements present in the material were made based on the results and zinc was found to be universally present in large amounts. these results indicate that zinc oxide is the main ingredient in these brands, which is in accordance with many studies. despite the differences in chemical compositions of the materials analyzed, this fact leads us to believe that gutta - percha percentages above 15% of the chemical composition probably determine the thermal behavior of the sample. in the present study, all specimens showed two typical major endothermic peaks in the first dsc run [table 3 ], indicating that they are a -form material. these results are in line with the data obtained by schilder. and maniglia - ferreira. ; however, during the second run, no peaks occurred at a temperature higher than 53.7c, which contradicts the findings of combe. dsc allows for an appraisal of the estimated thermal range required to plasticize gp between 40c and 60c. in endodontic therapy, dental gp is plasticized by a heat carrier (system b, obtura ii, thermafil and microseal microflow) or by thermomechanical compaction (microseal cone), which heats to a temperature higher than the maximum allowed to avoid partial degradation (100c), according to the merck index and maniglia - ferreira. the low fusion temperature of the tested materials is due to the high percentage of organic compounds in their composition (gp and wax / resins). the high quantities of wax and resins found in th, obf and mf can jeopardize the longevity of the endodontic treatment, as they are easily degraded, damaging the dimensional stability of the obturation material. our dsc results, which are similar to those of schilder., indicated that gp in the -phase begins its transition to -phase when heated from 51c to 53c, and the -phase material begins its transition to an amorphous phase when heated between 60c and 62c. our results suggest that after the material has cooled off and is heated up again, beginning a new heating cycle, the amorphous gp finds itself crystallized into the -phase and is therefore, not able to return to the -phase. alternatively, its chemical structure may have changed in such a way that it became a cis-1, 4 polyisoprene, as only one endothermic peak appeared, which often occurs when the material has been submitted to too many thermal cycles. a typical heating cycle of up to 130c caused changes in the behavior of the material due to the decrease in molar mass, which indicated polymer degradation by the backbone cleavage of polyisoprene. combe. also noted that fewer endothermic peaks were present during reheating of the polymer. it is thought that this new heating cycle breaks the chain of covalent bonded atoms, changing its molecular structure and causing such behavior. this covalent bonding along with natural physical entanglement of the long chains, produces unique and interesting properties in the bulk specimen. the nature and amount of inorganic components in dental gp strongly influence its clinical (i.e. brittleness, stiffness, tensile strength, radiopacity, flow, plasticity, elongation and inherent tension force) and thermal behavior and also allows for good control of its mechanical properties. according to marciano the existence of discrepancies among the thermomechanical behaviors of fresh and thermally treated samples, demonstrates the importance of the thermodynamic properties of dental gp. as a consequence, the results of this study show that this parameter is important in clinical applications and suggest that the high percentage of organic components found in dental gp may influence its degradation, although no correlation was identified between thermal behavior and chemical composition. the concentration of wax and resins should not surpass 2% of the chemical composition, therefore all tested materials showed excessive percentages of waxes and resins. in the 2008 study, maniglia - ferreira. demonstrated advanced degradation of the gp polymer present in their formulations, which could have occurred due to excessive heating during the manufacturing process. in practice, the endodontist can develop a continuously tapering conical form in the root canal preparation with a regular dentine wall, allowing for the use of gp cones with the ideal composition and avoiding preparations with a high percentage of inorganic elements, which make the cones rigid. such a strategy would facilitate the performance of the three - dimensional root canal system obturation with thermoplastic techniques. to date, the ideal composition has not been determined and/or identified ; however, it has been noted clinically that when dental gp with excessive percentages of organic compounds are used, they become loose and can easily be deformed during their intra canal adaptation. in contrast, high percentages of inorganic compounds (higher than 85%) make the thermo plasticization of the obturation material more difficult. further studies in this area are essential, as the supply of natural gp is in decline. results of the present study showed that : (i) mc presented the highest percentage of gp, followed by the mf, ob, obf and th ; (ii) all tested materials showed excessive percentages of waxes and resins ; (iii) no correlation was observed between chemical composition and thermal behavior ; (iv) all the products showed thermal behavior typical of - phase gp and (iv) heating dental gp to 130c causes physical changes. | objective : the aim of this study was determine the chemical composition and thermal behavior of thermafil (th), microseal cone (mc), microseal microflow (mf), obtura (ob) and obtura flow (of). in addition, their thermal behavior in response to temperature variations was studied by differential scanning calorimetry (dsc) to determine the temperature at which gutta - percha switches from the beta to alpha form, and from the alpha to the amorphous phase.materials and methods : the organic and inorganic fractions were separated by dissolution in chloroform. gutta - percha (gp) was precipitated with acetone. the inorganic fraction was analyzed via elemental microanalysis. energy dispersive x - ray microanalysis and x - ray diffraction were used to identify the chemical elements and compounds (baso4 and zno). thermal analysis was conducted using dsc.results:the organic and inorganic fractions ranged from 21.3% and 26.9% of weights, respectively. mc and mf showed the highest percentages of organic compounds (p = 0.0125). all specimens exhibited two crystalline transformations when heated from ambient temperature to 130c. mc presented the highest percentage of gp.conclusions:no correlation was observed between chemical composition and thermal behavior. each of the products showed thermal behavior that is typical of beta - phase gutta - percha. |
noonan syndrome is an autosomal dominant, multisystem disorder with heart defects, cerebrovascular abnormalities, short stature with delayed puberty, cryptorchidism, and delayed language1). autoimmune thyroiditis has been reported in some literatures however thyroiditis with hypothyroidism is even less frequent in noonan syndrome3). the pericardial effusion can be due to various conditions such as malignancies, infections, metabolic processes, trauma, connective tissue diseases, and endocrinologic disorder, such as hypothyroidism4). pericardial effusion is rare in hypothyroid patients with a reported incidence of 3% to 6% ; cardiac tamponade in these patients is even more infrequent5). herein, we report a case of 16-year - old male, who had hashimoto thyroiditis with an unusual presentation of cardiac tamponade in noonan syndrome. a 16-year - old male visited our clinic for evaluation of mild respiratory discomfort. on past history, he had been normally sized at birth but had pulmonary valve stenosis, for which he underwent percutaneous transluminal pulmonary valvuloplasty at 1 year of age. also, at the age of 3 years, he had unilateral gonadal agenesis with suspected cryptorchidism, but exploratory laparotomy failed to reveal a second testicle. on examination, his height was 136.2 cm (150.0 iu / ml) and extremely low t3 (< 0.1 ng / ml) and free t4 (0.27 ng / dl). considering these findings, additional studies were performed where the autoantibodies were elevated with an antimicrosome antibody of 320.1 iu / ml (reference, 034 iu / ml) and antithyroglobulin antibody of 1,700 iu / ml (reference, 0115 iu / ml). the ultrasonogram of thyroid revealed diffuse hypoechogenicity of thyroid gland with internal striation. also, the thyroid scan (tc-99 m pertechnetate) was consistent with hypothyroidism and ectopic thyroid was not found. the patient was treated with l - thyroxine at 0.15 mg daily. in wards, he had mild tachypnea with a respiration rate of 2529/min and his blood pressure was 7075 mmhg (systolic) and 3035 mmhg (diastolic). cardiac tamponade was suspected and he underwent aseptic pericardiostomy with a pigtail catheter (8 fr) under simultaneous sonographic and radiographic guidance, which yielded up to 360 ml of serous, yellowish clear pericardial fluid. pericardial fluid revealed a white blood cell count of 88/mm (neutrophil 47%, lymphocyte 33%, and monocyte 20%), a protein level of 2.7 g / dl, and an albumin level of 2.3 g / dl. transthoracic echocardiography showed no pericardial effusion after 3 days of closed pericardiostomy, at which point the catheter was removed. additionally, abdominal computed tomography revealed an undescended right testis in the right inguinal area and he underwent right orchiectomy after 3 months. ptpn11 mutation testing was performed and the sequence analysis did not identify the mutation in the ptpn11 gene coding region. over a 6-month follow - up period, levels of thyroid - stimulating hormone and free t4 normalized on l - thyroxine medication. 6 months after the pericardial drainage, the cardiothoracic ratio was normal and there was no evidence of the cardiomegaly. noonan syndrome is an autosomal dominant disorder characterized by certain facial features, short stature and congenital heart defects. it is reported at an incidence of between 1 in every 1,000 to 2,500 newborns6). although it is an inherited disorder, the patient can be a newly diagnosed noonan syndrome without history of disorder in other family members. the mutation in the ptpn11, sos1, raf1, kras, nras, and braf genes are reported to cause the noonan syndrome6). among these mutations, ptpn11 gene mutations account for about 50%, sos1 gene mutation for 10%15%, raf1 gene mutation for 5%10% of noonan syndrome. kras, nras, and braf genes account for relatively small percentage of noonan syndrome6). our patient, who had typical clinical characteristics of noonan syndrome, underwent ptpn11 mutation testing, however it did not identify the mutation in the ptpn11 gene coding region. the negative ptpn11 gene mutation could not rule out the diagnosis of noonan syndrome in our case. according to scoring system of noonan syndrome, the scoring system for diagnosis of noonan syndrome was developed by van der burgt.7) in 1997 which are made of 6 major features and 6 minor features. in this system, noonan syndrome can be diagnosed with typical facial feature plus 1 major or 2 minor characteristics or suggestive facial feature plus 2 major or 3 minor signs. our patient had typical facial features with 4 major criteria of pulmonary valve stenosis, short stature (below 3rd percentile), mental retardation and cryptorchidism which are definitive for noonan syndrome. the most common congenital heart defect is pulmonary valve stenosis (50%62%) and hypertrophic obstructive cardiomyopathy with asymmetrical septal hypertrophy is also reported in 20%8). the growth hormone levels are in normal range and somatomedin levels are sometimes elevated8). cryptochidism (undescended testicle) are also very common in noonan syndrome (77%) as our patient also had exploratory laparotomy at age of 3 without success and had right orchiectomy at age of 16 years8). hashimoto thyroiditis is an autoimmune disease in which the thyroid gland is attacked by cell- and antibody - mediated immune processes. the cause of autoimmune thyroiditis is unknown, but factors that may predispose to the condition include genetics, high iodine consumption, and age9). thyroid antibodies are found more commonly in noonan syndrome, but, hypothyroidism is not more common in noonan syndrome compare to general population1011). pericardial effusion can be caused by isolated clinical problems or manifestations of various systemic diseases such as hypothyroidism12). although mild pericardial effusion is more common in patients with hypothyroidism, moderate - to - severe pericardial effusion associated with cardiac tamponade is extremely rare. pericardial effusion develops due to increased capillary permeability that can decrease leakage of albumin, leading to protein rich fluids in the pericardium13). cardiac tamponade is a life threatening condition which requires immediate pericardiocentesis and/or pericardiostomy. with oral l - thyroxine replacement, mild pericardial effusion can be resolved within 212 months12). however, in patients with hemodynamic compromise with cardiac tamponade, pericardial fluid drainage should be urgently performed. our patient who was diagnosed to noonan syndrome, had severe hypothyroidism with diagnosis of hashimoto thyroiditis. he was started oral l - thyroxine replacement immediately after the diagnosis of hypothyroidism was made, however, pericardial effusion has been aggravated and led to cardiac tamponade which required pericardial fluid drainage. consequently, massive pericardial effusion has improved after pericardiostomy and has not recurred after the treatment of hypothyroidism which can rule out the other causes and support that the main cause of the massive pericardial effusion is hypothyroidism. in conclusion, adolescent patients with noonan syndrome and hashimoto thyroiditis presenting with cardiac tamponade have not been reported previously. in patient with cardiomegaly, thorough physical examination is essential and clinicians should be aware of the possibility of concurrent autoimmune conditions in patients with noonan syndrome. also, appropriate clinical and laboratory evaluations should be performed, considering that pericardial effusion or cardiac tamponade can be the first symptom of autoimmune disease. | noonan syndrome is an autosomal dominant, multisystem disorder. autoimmune thyroiditis with hypothyroidism is an infrequent feature in patients with noonan syndrome. a 16-year - old boy was admitted because of chest discomfort and dyspnea ; an echocardiogram revealed pericardial effusion. additional investigations led to a diagnosis of severe hypothyroidism due to hashimoto thyroiditis. the patient was treated with l - thyroxine at 0.15 mg daily. however, during admission, he developed symptoms of cardiac tamponade. closed pericardiostomy was performed, after which the patient 's chest discomfort improved, and his vital signs stabilized. herein, we report a case of an adolescent with noonan syndrome, who was diagnosed with hashimoto thyroiditis with an unusual presentation of cardiac tamponade. |
the fontan procedure, which functionally separates pulmonary and systemic circulation, is the most common approach to singleventricle palliation. as a result of this procedure, cyanosis and ventricular volume overload are alleviated at the expense of elevated systemic venous pressure and limited stroke volume augmentation. consequences include decreased aerobic capacity and a wide variety of endorgan injury that can manifest in both common and esoteric diagnoses such as liver fibrosis and proteinlosing enteropathy.1, 2, 3 it follows that the fontan circulation is associated with premature morbidity and mortality.4 there is marked variation, however, in the timing, specific manifestations, and extent of clinical deterioration between individual patients. effective noninvasive strategies to identify fontan patients at the highest risk for nearterm adverse outcomes could advance efforts to prevent hospitalization and death in this young, highrisk, poorly understood population. both cardiac and noncardiac fibrosis are common and precede adverse outcomes in adulthood5, 6, 7 ; therefore, markers of fibrosis may prove useful in identifying risk among patients with a fontan circulation. galectin3 is a lectin, a carbohydratebinding protein, with affinity for galactosides, with a wide array of biological effects that include inflammation, cell cycle modulation and cell activation, attraction, and adhesion.8, 9, 10 reports suggest that it is a mediator of cell growth and behavior and of cancer metastasis.11 importantly, galectin3 is also involved in both cardiac and noncardiac fibrosis.10, 12, 13, 14, 15 it remains to be defined whether galectin3 plays an important causal role in the development or maintenance of fibrosis in human disease and whether it may serve as a specific therapeutic target. it is clear, however, that circulating galectin3 levels are elevated in various diseases such as heart failure and alcoholic liver cirrhosis,16, 17, 18 that the presence of high galectin3 predicts incident heart failure and kidney disease in the general population,17, 19 and that high galectin3 is associated with adverse outcomes in adults with noncongenital heart failure.17, 20, 21, 22, 23, 24, 25, 26 given the extensive multiorgan effects and fibrosis seen in singleventricle fontan patients, we hypothesized that galectin3 would be elevated. we enrolled outpatients aged 18 years who had previously undergone a fontan procedure and who consented to participate between february 2012 and june 2014 at boston children 's hospital or brigham and women 's hospital. we excluded patients who underwent subsequent 2ventricle repair or cardiac transplantation prior to enrollment. age and sexmatched comparison group samples, selected based on the distribution of fontan participants by sex and 10year age group rather than matched to individual fontan participants, were identified ; these samples were collected from nonsmokers without diabetes mellitus or known cardiovascular disease who were recruited for this purpose using postings on the boston children 's hospital website. the study was approved by the boston children 's hospital institutional review board, and informed consent was obtained from all participants ; there was a formal reliance agreement between the institutional review boards of brigham and women 's hospital and boston children 's hospital. demographic data, underlying cardiac diagnosis and prior interventions, medication use, and medical comorbidities were extracted from medical records. available clinical laboratory testing and cardiac imaging results within 2 years of sample collection and invasive hemodynamic data within 5 years of collection were also obtained. data on qualitative systemic ventricular function and valve regurgitation severity were extracted from clinical reports. nonelective cardiovascular hospitalization was defined as an overnight admission for heart failure, arrhythmia or symptoms of arrhythmia, thrombotic or embolic events, cerebral hemorrhage, or a specific fontanrelated reason (ie, ascites, proteinlosing enteropathy, plastic bronchitis). blood collected via peripheral venipuncture in an edta tube was processed to plasma within 30 minutes of collection and frozen at 80c. characteristics of this assay have been described previously.18 there was no association between galectin3 concentration and time between blood draw and assay (=0.0016 ng / ml per day, p=0.60). other laboratory testing was performed on fresh processed samples by a clinical laboratory improvement amendments certified laboratory (laboratory corporation of america). the 2sided unpaired student t test or wilcoxon rank sum test, as appropriate, was used to compare continuous variables. the fisher exact test was used to analyze categorical variables between groups stratified by galectin3 level. galectin3 was normally distributed in the control group (shapiro wilk, p=0.37) but not in the fontan group (shapiro wilk, p 14.3 ng / ml). continuous variables are presented as meansd, with addition of median (25th to 75th percentiles) for nonnormally distributed variables. galectin3 was natural log transformed for statistical analyses of galectin3 as a continuous variable, but we have reported untransformed meansd for ease of interpretation. pearson 's product moment correlation coefficients were computed to assess the relationship between logtransformed galectin3 and continuous clinical characteristics including other laboratory tests. the logrank test was used to perform univariate survival analysis, stratified by galectin3 level. cox regression, with galectin3 level as the independent variable, was performed to individually adjust for specified covariates ; a multivariable model was developed that considered all variables significantly (p 14.3 ng / ml). continuous variables are presented as meansd, with addition of median (25th to 75th percentiles) for nonnormally distributed variables. galectin3 was natural log transformed for statistical analyses of galectin3 as a continuous variable, but we have reported untransformed meansd for ease of interpretation. pearson 's product moment correlation coefficients were computed to assess the relationship between logtransformed galectin3 and continuous clinical characteristics including other laboratory tests. the logrank test was used to perform univariate survival analysis, stratified by galectin3 level. cox regression, with galectin3 level as the independent variable, was performed to individually adjust for specified covariates ; a multivariable model was developed that considered all variables significantly (p 40 years, respectively (p 14.3 ng / ml. a kaplan meier plot of risk in each group from time of blood draw is listed below the graph ; hash marks designate censored observations. number of participants at risk in each group is listed below the xaxis. a small subset of participants (3 of 51 and 2 of 19 in the normal and elevated galectin3 groups, respectively) had no followup time. having any of the comorbidities listed (current or prior tobacco use, systemic hypertension, obstructive sleep apnea, dyslipidemia, history of subacute bacterial endocarditis, or asthma) tended to be associated with a higher risk of the combined outcome, although the association was not statistically significant (hr 2.5, 95% ci 0.9 to 7.4, p=0.09). high galectin3 remained a significant predictor of outcome after excluding participants with a chronic comorbidity (hr 6.1, 95% ci 1.7 to 21.6, p=0.005 ; n=58) or adjusting for presence of a chronic comorbidity (hr 5.8, 95% ci 2.0 to 16.4, p=0.001 ; hr for having a comorbidity 2.3, 95% ci 0.8 to 6.9, p=0.13). there was no statistically significant difference in galectin3 level between the 5 patients who died and those who survived (14.44.7 versus 12.95.0 ng / ml ; 11.9 [iqr 11.0 to 19.2 ] versus 11.7 [iqr 9.7 to 14.5 ] ; p=0.37). death occurred during followup in 10.5% of the patients with high galectin3 compared with 5.9% of those with normal galectin3. in the context of a small number of events, high galectin3 was not a statistically significant predictor of death in survival analysis (hr 2.0, 95% ci 0.4 to 11.8, p=0.46). there were 15 events : 12 nonelective hospitalizations (2 patients subsequently died) and 3 deaths without preceding nonelective hospitalization. of the 12 incident nonelective cardiovascular hospitalizations, 6 were related to heart failure or other volume retention including ascites, 4 were for arrhythmia (3 atrial flutter, 1 atrial fibrillation), 1 was for hemoptysis related to pulmonary collateral vessels, and 1 was for presyncope related to hypotension. two of the hospitalized patients later died : 1 had presumed sudden cardiac arrest, and the other had a sinus pause followed by pulseless electrical activity after an elective cardioversion for atrial flutter, could not be resuscitated, and died after prolonged support with extracorporeal membrane oxygenation. two experienced sudden death without autopsy, and the third died as the result of sepsis due to recurrent cellulitis in the context of chronic volume retention and severe edema. of note, this patient did not have an active infection at the time of baseline blood draw and died about 1 year after enrollment. higher galectin3 was associated with greater hazard for the combined outcome (hazard ratio [hr ] 2.32, 95% ci 1.35 to 3.97 ; per 1 sd increase in logtransformed galectin3, p=0.002). fontan patients with high galectin3 levels were at increased risk for the combined outcome (hr 6.0, 95% ci 2.1 to 16.8 ; p 14.3 ng / ml. a kaplan meier plot of risk in each group from time of blood draw is listed below the graph ; hash marks designate censored observations. number of participants at risk in each group is listed below the xaxis. a small subset of participants (3 of 51 and 2 of 19 in the normal and elevated galectin3 groups, respectively) had no followup time. having any of the comorbidities listed (current or prior tobacco use, systemic hypertension, obstructive sleep apnea, dyslipidemia, history of subacute bacterial endocarditis, or asthma) tended to be associated with a higher risk of the combined outcome, although the association was not statistically significant (hr 2.5, 95% ci 0.9 to 7.4, p=0.09). high galectin3 remained a significant predictor of outcome after excluding participants with a chronic comorbidity (hr 6.1, 95% ci 1.7 to 21.6, p=0.005 ; n=58) or adjusting for presence of a chronic comorbidity (hr 5.8, 95% ci 2.0 to 16.4, p=0.001 ; hr for having a comorbidity 2.3, 95% ci 0.8 to 6.9, p=0.13). there was no statistically significant difference in galectin3 level between the 5 patients who died and those who survived (14.44.7 versus 12.95.0 ng / ml ; 11.9 [iqr 11.0 to 19.2 ] versus 11.7 [iqr 9.7 to 14.5 ] ; p=0.37). death occurred during followup in 10.5% of the patients with high galectin3 compared with 5.9% of those with normal galectin3. in the context of a small number of events, high galectin3 was not a statistically significant predictor of death in survival analysis (hr 2.0, 95% ci 0.4 to 11.8, p=0.46). these data suggest that among patients with a fontan circulation, galectin3 (1) is elevated compared with age and sexmatched controls, (2) increases with age and is associated with elevated markers of inflammation and worse kidney function but is not significantly related to congenital anatomy or fontan type, and (3) is associated with adverse outcomes. prior research on circulating biomarkers in the fontan circulation has focused on catecholamines and natriuretic peptides28, 29, 30, 31 ; studies have not demonstrated any single circulating biomarker to be strongly associated with mortality or other specific longitudinal outcomes.31, 32, 33 this makes the strong, independent association between high galectin3 level and adverse outcomes especially noteworthy. the small number of specific types of adverse event, such as arrhythmic death, precludes extensive exploration to determine whether galectin3 is associated with a particular subset of adverse outcomes we did, however, observe a strong association between clinical ascites and high galectin3 level. the pattern of medication use, more common use of loop and potassiumsparing diuretics, further supports a relationship between galectin3 and clinical volume retention. although it may be that galectin3 simply reflects disease severity in these patients (eg, a marker of cumulative fibrosis or ongoing inflammation), there are several mechanisms by which elevated galectin3 may have a causal role in fontan deterioration. a study reported, for example, that galectin3 knockout mice demonstrated less peritoneal inflammation in response to intraperitoneal thioglycollate broth injection.34 recurrent ascites is a common issue for adult fontan patients ; often it is not readily explained by hemodynamic findings, and the cause is unknown. if so, compounds under development to inhibit the actions of galectin3 might be a promising therapy for this challenging clinical syndrome. the relationship between galectin3 and hscrp, a nonspecific marker of inflammation, is also noteworthy. prior studies have also reported a positive association between galectin3 and hscrp, although the strength of association has generally been weaker than seen in our study (r0.13 to 0.25).24, 25, 35 further investigation is warranted regarding why these patients develop an inflammatory response, the typical pattern of immune activation, and the role of inflammation in the diverse causes of premature fontan failure and subsequent death. higher galectin3 was also associated with lower egfr, as has been reported in prior studies of other groups of patients. this may be because high galectin3 plays a causal role in progressive kidney disease, because fontan dysfunction is independently associated with both low egfr and high galectin3, or because galectin3 handling is affected by kidney disease.19, 36 because very few patients had low egfr (n=2, < 60 ml / min per 1.73 m), the last reason is unlikely to explain our findings. galectin3 was higher in fontan patients than in an age and sexmatched comparison group, although the absolute values were lower in both groups compared with those reported in most prior studies, including those in the general adult population and in acquired heart failure. median galectin3, for example, was 13.1 ng / ml in men and 14.3 ng / ml in women in a sample of 3353 community participants in the framingham heart study with an average age of 59 years.17 christenson and colleagues reported 20.3 ng / ml as the 95th percentile for galectin3 in a diverse populationbased sample of 1092 ostensibly healthy participants aged 55 to 80 years.18 the younger age of our sample likely explains the lower values. although reference values for other age groups are not yet available, we observed that galectin3 increased with age in fontan participants ; this pattern has also been reported in the general population and in acquired heart failure.17 there was an association between use of thyroid replacement medication and high galectin3. this association may be spurious related to the low absolute number of patients on thyroid medication, or it may be related to an independent relationship between thyroid disease and galectin337, 38 or to amiodarone toxicity. the lack of relationship between underlying congenital diagnosis, ventricular morphology, or fontan type may be related to the relatively low sample size. results from analyses of incomplete data related to clinical practice patterns (ie, catheterization and btype natriuretic peptide results) are particularly susceptible to unmeasured confounding and bias. furthermore, although there was no statistically significant association between galectin3 and hemodynamic variables, this study may have been underpowered to detect even a clinically relevant association. the small number of events precluded comprehensive multivariable adjustment, and our findings may be attributable to confounders such as chronic kidney disease. the age and sexmatched comparison group represents a convenience sample and may not derive from an equivalent atrisk population such as the fontan participants. we did not measure other established or promising biomarkers for prediction of outcomes in acquired heart failure, such as nterminal btype natriuretic peptide or st2.39, 40 a multimarker approach with pathophysiologically complementary biomarkers may provide additional information, as it may in patients with acute coronary syndrome or heart failure.41, 42 we also did not measure galectin3 longitudinally, and it is possible that a change in levels over time could improve the prognostic value compared with a single measurement and may even serve as a surrogate marker of response to therapy. the current results hint that galectin3 may be a useful clinical predictor in fontan patients ; however, further study is required not only to validate the robustness of our findings but also to demonstrate that galectin3 provides information beyond that available from alternative biomarkers and other clinical variables. in addition, the relationship between age and galectin3 suggests that a given absolute level of galectin3 may have different implications for younger and older patients. the lack of relationship between underlying congenital diagnosis, ventricular morphology, or fontan type may be related to the relatively low sample size. results from analyses of incomplete data related to clinical practice patterns (ie, catheterization and btype natriuretic peptide results) are particularly susceptible to unmeasured confounding and bias. furthermore, although there was no statistically significant association between galectin3 and hemodynamic variables, this study may have been underpowered to detect even a clinically relevant association. the small number of events precluded comprehensive multivariable adjustment, and our findings may be attributable to confounders such as chronic kidney disease. the age and sexmatched comparison group represents a convenience sample and may not derive from an equivalent atrisk population such as the fontan participants. we did not measure other established or promising biomarkers for prediction of outcomes in acquired heart failure, such as nterminal btype natriuretic peptide or st2.39, 40 a multimarker approach with pathophysiologically complementary biomarkers may provide additional information, as it may in patients with acute coronary syndrome or heart failure.41, 42 we also did not measure galectin3 longitudinally, and it is possible that a change in levels over time could improve the prognostic value compared with a single measurement and may even serve as a surrogate marker of response to therapy. the current results hint that galectin3 may be a useful clinical predictor in fontan patients ; however, further study is required not only to validate the robustness of our findings but also to demonstrate that galectin3 provides information beyond that available from alternative biomarkers and other clinical variables. in addition, the relationship between age and galectin3 suggests that a given absolute level of galectin3 may have different implications for younger and older patients. plasma galectin3 concentration is elevated in patients with a fontan circulation. in these patients, high galectin3 is associated with an increased incidence of adverse outcomes, incident nonelective cardiovascular hospitalization or death. this work was conducted with support from harvard catalyst | the harvard clinical and translational science center (national center for research resources and the national center for advancing translational sciences, national institutes of health award ul1 tr001102) and financial contributions from harvard university and its affiliated academic healthcare centers. the content is solely the responsibility of the authors and does not necessarily represent the official views of harvard catalyst, harvard university and its affiliated academic healthcare centers, or the national institutes of health. opotowsky, landzberg, wu, valente, and singh are supported by the dunlevie family fund. | backgroundgalectin3 may play a role in cardiac and noncardiac fibrosis, and elevated circulating levels of this protein predict adverse outcomes in patients with heart failure who do not have congenital heart disease. we investigated galectin3 in adults with singleventricle fontan circulation, patients who are prone to premature clinical deterioration in the context of extensive multiorgan fibrosis.methods and resultswe measured plasma galectin3 concentrations in 70 ambulatory adult fontan patients and 21 age and sexmatched control participants. galectin3 level was significantly higher in the fontan group (11.85 ng / ml, interquartile range 9.9 to 15.0 ng / ml) versus the control group (9.4 ng / ml, interquartile range 8.2 to 10.8 ng / ml ; p 2 sd above the control group mean value) had a higher risk of nonelective hospitalization or death (hazard ratio 6.0, 95% ci 2.1 to 16.8, p<0.001). this relationship persisted after individual adjustment for covariates including age, new york heart association functional class, creactive protein, and estimated glomerular filtration rate and after multivariable adjustment for independently predictive covariates (hazard ratio 9.2, 95% ci 2.4 to 35.2, p=0.001).conclusionsgalectin3 concentrations are elevated among adults with a fontan circulation, and elevated galectin3 is associated with an increased risk of nonelective cardiovascular hospitalization or death. |
the insulin - like growth factor 2 gene (igf2) is an imprinted gene, paternally expressed and encodes for the insulin - like growth factor ii peptide [1, 2 ]. in mice the igf2 gene has five promoters, from which three main transcripts, a placenta specific transcript and a newly described mesoderm - specific transcript, originate. described multiple imprinted sense and antisense transcripts from the igf2 locus. the igf2as gene located within igf2 we recently found that igf2as transcripts are located in the cytoplasm and associated with polysomes indicating a protein coding function. to further elucidate the function of igf2as this mouse has a 5 kb deletion within the igf2 gene comprising dmr1, an adjacent repeat sequence mostly embedded in exon u2 of the placenta specific igf2 p0 transcript and igf2as transcripts. the maternal transmission of the dmr1-u2 deletion results in loss of igf2 imprinting in heart, kidney, and lung without affecting h19 gene expression. the authors conclude that their result demonstrates that dmr1 plays a role in igf2 imprinting regulation and gene expression independent of h19. in that study, paternal transmission of the dmr1-u2 deletion was associated with intrauterine growth restriction (iugr) manifested by mutants birth weight being 71% that of normal mice. later, constncia. reported that the 5 kb dmr1-u2 deletion abolishes expression of the igf2 p0 transcript in the labyrinthine trophoblast of the placenta where it is specifically expressed. noteworthy, placental growth deficiency in dmr1-u2 placentas resembled that of igf2-null mice lacking igf - ii peptide in all placental layers and the fetus which was unexpected since p0 transcripts constitute about 10% of total igf2 transcripts in placenta. however, the lower birth weight of mutant dmr1-u2 pups was compensated during the first three months of life. they could also demonstrate with inert hydrophilic molecules that passive permeability of the mutant placenta was reduced compared to the wild type. however, they showed that the mutant placenta actively transferred more than wild - type placenta indicating compensatory effects to the passive permeability and the smaller placenta size. the permeability of the mouse placenta to hydrophilic solutes was further studied in dmr1-u2 mice versus wild - type mice. in their study they found that the permeability for hydrophilic solutes was significantly reduced in the dmr1-u2 knockout placenta at e19. stereological analysis showed a reduction in surface area and an increase in thickness of the exchange barrier in the dmr1-u2 knockout labyrinthine layer of the placenta. this suggests that labyrinthine p0 igf2 expression has a function in the development of normal diffusional exchange characteristics of the mouse placenta influencing fetal growth. further investigated the placental nutrient supply and the fetal demand in the dmr1-u2 deletion mouse model (igf2 p0) and an igf2-null mouse model. could further show by using igf2 p0 and igf2-null mice models that placental nutrient transfer occurs in response to fetal nutrient demands and involves igf2 mediation. additional evidence for the placental adaption was provided by showing lower expression of the transplacental calcium transfer protein calbindin - d9k in igf2 p0 at e17 but not at e19 compared to that of wild types. more recently, it was shown that adult igf2 p0 mice but not igf2-null mice exhibited behavioral phenotypes. these mice were exposed to a wide range of emotion - related behaviors tests and igf2 p0 mice showed increased reactivity to acute anxiety - including stimuli. it was further found that anxiety associated genes in the hippocampus of these mice were altered. these long - term behavioral effects were attributed to the imbalance between fetal demand and placental supply of nutrients during gestation. in this study, we performed an expression analysis of igf2 and igf2as transcripts in dmr1-u2 and wild - type placentas from different development stages. the expression of these genes is studied in wild type placentas and in dmr1-u2 placentas which are lacking igf2 p0 and igf2as expression. we also followed the expression patterns of this sense / antisense pair in different tissues during development and measured igf2/igf2as expression in differentiating c2c12 cells for functional characterization of the putative protein coding igf2as gene. the cells were grown to 100% confluence and changed into a differentiation medium (dulbecco 's modified eagle 's medium supplemented with 2% horse serum and 1% penicillin - streptomycin solution). the differentiation media were replaced daily during a period of 6 days. at each time point, the cells of three culture flasks were harvested separately, rna isolated, and used for quantification by real - time pcr. the experiments were carried out in strict accordance with swiss federal law on animal protection of 16 december 2005 (tierschutzgesetz tschg, sr 455), art. 32, absatz 1 ; ordinance on animal protection of 23 april 2008 (tierschutzverordnung tschv, sr 455.1). brain, muscle and liver tissues were collected from wild - type c57bl/6 fetuses at e18 (embryonic day 1 (e1) = day of plug), from newborn and adult mice. dmr1-u2 transgenic male mice carrying the mutation on the paternal allele were donated from m.r. mice resulting from these crossings were sacrificed at e12, e14, e16, and e19 and placentas were collected. the primers used for this pcr test are shown in table 1. from the crosses between male carriers of the dmr1-u2 deletion and c57bl/6 females, three mutant placentas and three wild - type littermates rna extraction was performed using trizol reagent according to manufacturer 's protocol (invitrogen). the cdna was synthesized by reverse transcription of 1 g total rna using the quantitect reverse transcription kit according to the manufacturer 's protocol (qiagen). each sample was quantified in triplicates for all igf2 variants (v1, v2, v3, and pm) and the igf2as transcript by qpcr using taqman probes or conjugated minor groove binder (mgb) probes to measure igf2as transcription (table 2) (figure 1). the ct values of the target were normalized by subtracting the mean of the ct values from actb and gapdh. the relative quantifications were calculated relative to the first value which was set to 1 in each respective figure. the calculations were performed for each of three samples measured in triplicate, averaged, and had the standard deviations calculated. the normalized data was analyzed by using two - tailed student 's t - test. we found relatively high igf2 and igf2as gene expression in fetal and newborn liver and muscle tissue samples and a significant downregulation of these genes in adult tissues (figures 2(a) and 2(b)). all three igf2 variants followed similar pattern of expression at fetal, newborn, and adult stages of development. in muscle, we found comparable expression levels of igf2as transcripts in fetus and newborn whereas the expression of igf2 variants increased in newborn (figure 2(a)). igf2as and igf2 variants were significantly downregulated in adult tissues (figures 2(a) and 2(b)). igf2as levels were not detectable after 40 qpcr cycles in adult muscle tissue. in liver, the level of igf2as and igf2 expressions is similar in fetus and newborn, except for variant 3 which significantly increased in newborn (figure 2(b)). transcripts originating from the pm promoter were expressed at very low levels (data not shown). in brain we found significantly higher expression of igf2 variant 2 and igf2as in embryos compared to fetus with a continuous down - regulation towards the adult stage (figure 2(c)). igf2 variants and igf2as followed this pattern, except variant 3 (figure 2(c)). we used c2c12 myoblast cells differentiation to monitor the sense / antisense igf2/igf2as gene pair for potential interactions between the two partially complementary transcripts. cells were differentiated by adding horse serum and the gene pair quantified at 0 h up to 144 h corresponding to 6 days (figure 3). igf2 variants 1 and 2 as well as pm transcripts were expressed at very low levels (data not shown). however, at 144 h igf2 variant 1 peaked for unknown reason (data not shown). interestingly, igf2as gene expression did not follow the increasing expressions trend of igf2 variant 3 during differentiation of c2c12 cells. igf2as and igf2 expression increased significantly between 24 h and 48 h coinciding with the start of myotube formation. we measured igf2 and igf2as expressions in placentas of dmr1-u2 mice and their wild - type litter mates (figure 4). we found no differences in the expression of igf2 variants 13 between mutant and wild - type placentas except for igf2 variant 3 at e16, which was more highly expressed in the knockout placentas (figure 4(c)). igf2as expression levels in wild - type placenta significantly increased from e16 to e19 (figure 5). the expression levels of igf2 p0 in wild - type placenta were constant during e12 to e16 and augmented significantly from e16 to e19 (figure 5). in dmr1-u2 the aim of this study was to further contribute to ascertaining the function of igf2as. we studied igf2 and igf2as gene expression in different tissues during development, in differentiating c2c12 cells, and in placenta of a dmr1-u2 deletion mouse model. all igf2 variants and igf2as followed a similar expression pattern in different tissues during development indicating a common regulation. in brain, we found a more continuous downregulation of igf2 and igf2as transcription compared to distinct downregulation of these genes in adult liver and muscle. most relevant is, however, that we did not find any consistent evidence for an interaction between igf2 and igf2as transcripts although they are both present in the cytoplasm and contain complementary nucleotide sequences. additionally, we observed that the lack of igf2as transcripts in placenta did not produce significant changes in igf2 variants expression levels compared to wild type with the exception for igf2 variant 3 at e16. igf2 variant 3 does not contain complementary sequences which could directly interact with igf2as transcripts to form double - stranded rna molecules. in addition variant 3 expression at e12, e14, and e19 was not different compared to wild - type mice and thus the interpretation of this event remains elusive. the comparison of igf2 and igf2as expression between dmr1-u2 and wild - type mice argues against the hypothesis that igf2as transcripts have a role in igf2 gene regulation. the increase of igf2 variant 3 at e16 in mutant mice may have compensatory effect on igf2 protein content in labyrinthine trophoblast challenging the notion that the dmr1-u2 phenotype is solely caused by the lack of p0 transcripts [7, 10 ]. during c2c12 differentiation, we observed different expression patterns for igf2 variant 3 and igf2as expressions arguing against an interaction between the two genes. noteworthy is the increased expression of igf2 variant 3 and igf2as transcripts between 24 h and 48 h of differentiation when myotubes start to form. the knockout mouse carrying the dmr1-u2 deletion was extensively studied in regard to placental nutrient supply and fetal demand [6, 7, 911 ]. here, we argue that the previously observed effects of the placenta specific igf2 p0 transcript may be confounded with the effects of the putative protein - coding igf2as gene. our alternative or additional explanation for the observed dmr1-u2 deletion effects is therefore the lack of a functional igf2as gene. igf2as is an imprinted and paternally expressed gene and therefore the iugr phenotype described in dmr1-u2 mice agrees with common functions of paternally expressed genes. assuming that the lack of a functional igf2as gene contributes to the phenotype of iugr, expressed as smaller placentas and lower birth weight, it might have similar functions as the igf2 gene. interestingly, the recently described long - term behavioral effects found in dmr1-u2 mice could also be, at least in part, due to the absence of igf2as function. we think that the presented results indicate that previous studies have to be interpreted in the light of potential igf2as gene effects. in summary, igf2as is most expressed during prenatal development followed by a pronounced downregulation after birth in most tissues similar to the igf2 gene. in brain, we found also highest igf2as expression in early development with a gradual downregulation from embryo brains to adult brains. | insulin - like growth factor antisense gene (igf2as) expression was investigated in different mouse tissues during development, in differentiating c2c12 cells and in a dmr1-u2 knockout mouse model. the expression levels of igf2as were high in fetal and newborn liver and muscle tissues compared to adults. the igf2as gene was also expressed in placenta and in brain. the expression data suggests that the igf2as gene plays a role in early development of the mouse and in placenta. there was no consistent evidence for an interaction between igf2 and igf2as transcripts. furthermore, in knockout placentas lacking igf2as transcription, igf2 expression was comparable to that in wild type. these results indicate that igf2as does not regulate igf2 sense transcripts. in previous studies, it was suggested that the dmr1-u2 knockout mouse showing intrauterine growth restriction was caused by the absence of placenta - specific igf2 p0 transcription. we conclude that the dmr1-u2 deletion phenotype should be reconsidered in the light of a functional igf2as gene. |
dual malignancy in young adults is a rare entity. of all well - differentiated thyroid carcinoma patients, 5% are familial. majority familial thyroid cancer are nonmedullary familial thyroid cancer, and have been shown to be present in familial cancer syndromes such as familial adenomatous polyposis, cowden syndrome, carney complex, pendred syndrome, and werner syndrome. herein, we report a rare case of a 17-year - old female patient diagnosed with papillary carcinoma of thyroid (ptc) with an antecedent history of dysgerminoma of the right ovary. to our knowledge, no association has been reported between dysgerminoma of the ovary with carcinoma thyroid in literature. a 17-year - old female, following right lobectomy of the thyroid gland, with a histopathological report of ptc was referred to the department of surgical oncology at sri aurobindo medical college and post graduate institute in indore, madhya pradesh in india for further management in 2014. examination of the neck revealed a scar from a previous surgery, with no palpable neck nodes. blood investigations revealed serum t3 1.19 ng / ml (0.8 - 2 ng / ml), serum t4 of 5.88 ug / dl (5.1 - 14.1 ug / dl), serum tsh of 6.04 uiu / ml (0.27 - 4.20 uiu / ml), serum level of lactate dehydrogenase (ldh) 157 iu / l (140 - 280 previous history revealed hysterectomy with right salpingo - oophorectomy performed 3 years back during evaluation of primary amenorrhea with right ovarian mass [figure 1 ]. gross examination revealed 1300 g right ovarian mass with fallopian tube with didelphys of rudimentary uterus. microscopy confirmed the diagnosis of dysgerminoma of the right ovary stage i a [figure 2a ]. the patient had taken chemotherapy bleomycin, etoposide, and cisplatinum (bep) regime, i.e., bleomycin iv per week x9 ; dose at 20 u / m, etoposide 100 mg / m days 1 - 5 q3wk x3, cisplatin 20 mg / m days 1 - 5 q3wk x3 at a 4 week interval in the adjuvant setting. magnetic resonance imaging (mri) of the neck and the pelvis was performed before completion ; thyroidectomy revealed postoperative changes with irregular nodular soft tissue in the region of the right lobe of thyroid with subcentimeter lymph node in bilateral deep upper cervical region [figure 3a ] and left ovary was normal in appearance, measuring 2.9 cm 4.7 cm [figure 3b ]. completion thyroidectomy with bilateral central neck node dissection was performed that was negative for residual malignant disease. radioactive iodine scan (i) performed 1 year after completion thyroidectomy did not reveal any residual disease. cect abdomen showing mass replacing the right ovary with nonvisualization of the uterus (a) microphotograph showing islands of large polygonal tumor cells surrounded by lymphoid cells. the tumor cells possess clear cytoplasm and centrally placed nuclei with vesicular chromatin and prominent nucleoli. (h&e 400) and (b) microphotograph showing tumor cells arranged in papillary fronds having vesicular coffee bean nuclei. (h&e 100) (a) mri of the neck showing postoperative changes in the neck with irregular nodular soft tissue in the region of the right lobe of thyroid with subcentimeter lymph node in bilateral deep upper cervical region and (b) mri of the pelvis showing normal - appearing left ovary with absent right ovary and uterus two or more histologically different malignancies identified within the first 6 months of the first malignancy is defined as synchronous and if the second tumor is identified beyond 6 months, it is defined as metachronous. both the tumors should be malignant and neither should be metastasis of each other and both the tumors should be morphologically and microscopically distinct from each other. in our case, there were two distinct pathologies of dysgerminoma of the ovary and ptc, both anatomically and histologically different entities with a gap of 3 years between both [figure 2a and b ]. dysgerminomas account for 1 - 5% of all ovarian malignancies in the first two decades of life. of the cases, 80% are reported in females in the second decade of life with complaints of delayed menarche and primary amenorrhea, which were the presenting complaints of our patient as well, 3 years back. whose contralateral ovary has been preserved, some diseases can develop in 5 - 10% of the retained gonads over the next 2 years. the possibility of developing dysgerminoma in the contralateral ovary was ruled out with mri of the pelvis that reported a normal left ovary and sr ldh 157 histopathology report following right lobectomy of the thyroid revealed ptc, following which, completion thyroidectomy with central neck dissection (cnd) has been performed. a large retrospective study evaluating second primary malignancy in thyroid cancer patients found second primary malignancy in 0.45% of cases, out of which only 0.067% cases had thyroid cancer as the second primary malignancy and all had a history of exposure to radiation. the association between carcinoma thyroid, cancer of breast, kidney, salivary glands, brain, central nervous system, scrotum, and leukemia has been reported. but association between dysgerminoma and carcinoma thyroid has not been reported in literature to the best of our knowledge. despite a thorough pubmed search, we were unable to find a previous reported case of metachronous papillary carcinoma thyroid following dysgerminoma of the ovary. metachronous malignancy with the index tumor of ovarian cancer has been reported, but the case of index tumor of dysgerminoma of the ovary with a second primary tumor diagnosed as ptc is unusual. the case of dual primary malignancy has not been documented in literature ; we present this case due to the rarity in presentation. sc contributed in the conception of the work, conducting the study, writing and approval of the final version of the manuscript, and agreed for all aspects of the work. smd contributed in the conception of the work and approval of the final version of the manuscript, and agreed for all aspects of the work. dym contributed in revising the draft and approval of the final version of the manuscript, and agreed for all aspects of the work. ss contributed in the conception of the work, revising the draft, and agreed for all aspects of the work. | dual malignancy is rare in adolescents. dual malignancy with the second malignancy of thyroid is rare. no association has been reported between dysgerminoma of ovary and carcinoma thyroid in medical literature. despite a thorough pubmed search (key words papillary carcinoma of thyroid, metachronous, dysgerminoma ovary), we were unable to find a previous reported case of metachronous papillary carcinoma of thyroid (ptc) following dysgerminoma of the ovary. after surgery, the patient is being regularly followed up for recurrence / development of new primary. we report this unusual and rare case in a 17-year - old female patient. |
chronic viral hepatitis c is one of the most serious chronic infections affecting 170 million people worldwide. in europe the prevalence of hepatitis c virus (hcv) infection is also relatively high in latvia. antibodies are found in 2.4% of the population, with hcv - rna prevalence of 1.7% of general population. the outcome of hcv infection varies from spontaneous viral clearance, symptom free - hcv carrier state to chronic hepatitis, cirrhosis, and hepatocellular carcinoma. some individuals have rapidly progressive liver disease while others remain in good health for many years. there are a lot of factors such as viral kinetics, immune mechanisms, environmental factors, and patient - related factors which may be responsible for the various hcv - related outcomes. risk factors for infection include intravenous and intranasal drug use, nonsterile tattooing, manicure and pedicure procedures, as well as virus transmission vertically from mother to child, and during sexual intercourse. dialysis patients appear to be at increased risk of infection as do alcoholics [1, 3 ]. in developing and transitional economy countries, the nosocomial transmission of new hepatitis c virus (hcv) infections is a major problem due to reuse of contaminated or inadequately sterilized syringes and needles used in medical, paramedical, and dental procedures ; an estimated 2.34.7 million new infections occur each year. current standard of care treatment involves combination therapy with hopes of effective virus eradication resulting in a sustained virological response (svr) and thereby stopping the progression of disease. with the combination of pegylated alpha interferon and ribavirin, they induce inflammatory responses that can lead to tissue injury and serve as antiviral effectors as well. cytokine synthesis is regulated by genetic mechanisms resulting in differences between individuals in their ability to produce cytokines. this individual variability may be due to single - nucleotide polymorphisms within the coding regions of cytokine genes. cytokine genes are polymorphic, and some of these variants modify the production of the specific cytokines thereby affecting the host immune response. in hcv infection, secretion of inappropriate amounts of cytokines may be associated with developments of chronic disease or resistance to interferon (ifn) treatment. interleukin-28b (il-28b), named also as interferon -3, has been shown to be involved in the control of hcv infection, and the genetic polymorphism of the encoding il-28b gene may determine the clearance of hcv. the il-28b gene on human chromosome 19q was discovered in 2003, using the genomic screening process in which the entire human genome was scanned for putative genes [5, 6 ]. the aim of this study was to detect il-28b gene polymorphism in chronic hepatitis c patients in latvia and to analyze therapy results in patients with different il-28b gene polymorphisms. this is the first study carried out in latvia, in the baltic states and likely in eastern europe for the detection of interleukin 28b gene polymorphism and how it impacts on hepatitis c treatment. all chronic viral hepatitis c patients who came to infectology center of latvia for a hepatologist 's consultation were tested. patients had to sign the informed patients ' consent prior to testing. in order to detect il-28b gene polymorphism rs12979860 genotype frequency we used molecular biology methods : classical dna separation from blood samples by phenol, amplification by pcr, and standard sequencing by big dye (applied biosystems). 142 patients were treated with the standard of care therapy - pegylated interferon in combination with ribavirin. all patients were divided into 3 subgroups : cc, ct / tc, and tt. different patient factors, laboratory tests, viral kinetics, and treatment response were analyzed. in terms of therapy result patients responders achieved sustained virological response and were hcv - rna negative at the end of therapy and 24 weeks after stopping treatment. nonresponders were hcv - rna positive at week 12 (null responders), at the end of therapy (partial responders) or at week 24 after stopping therapy (relapsers). interrupters stopped therapy due to financial reason (there is 75% drug reimbursement for chronic hepatitis c treatment, 25% of treatment expenses are covered by patient) or due to unknown reason. hcv - rna was measured using polymerase chain reaction (pcr), amplicor, version 2.0 ; roche, usa. viral load for genotype 1 patients was measured at baseline and at week 12 on treatment. liver biopsy was performed for 126 (88.7%) patients, and morphological assessment was done using knodell 's hai index. there were not statistically significant differences between groups with regard to fibrosis stage and hai index. comparison between groups was performed using pearson chi - square test or fisher 's exact test. study was approved by the independent ethics committee for clinical investigation of drugs and pharmaceutical products in latvia. there were 53 patients (33%) with cc genotype, 84 patients (53%) with ct (83 patients) or tc (1 patient) genotype, and 22 patients (14%) with tt genotype among chronic viral hepatitis c patients in latvia (figure 1). 142 patients were treated with the standard of care therapy - pegylated interferon in combination with ribavirin table 1. all included patients were caucasians, a majority of them male (59%) and genotype 1 (61%) patients. 34 patients (74%) in cc genotype subgroup achieved svr versus 50 patients (52%) in non - cc subgroup41 patient in ct / tc and 9 patients in tt subgroups. there were 4 patients (8.7%) nonresponders in cc subgroup (all were relapsers : 3 of them with hcv genotype 1, 1 patient hcv genotype 2) versus 35 patients (36.5%) in non - cc subgroups (7 patients null responders, hcv genotype 1, 13 patients partial responders : 11 patients hcv genotype 1, 2 patients hcv genotype 3, and 15 patients relapsers, hcv genotype 1) ; the differences were statistically significant, p = 0.002, pearson chi - square test (figure 2). there was statistically significant difference also in patients with genotype 1 hcv infection svr which was achieved in 16 patients (16/19, 84%) in cc subgroup versus 30 patients (30/63, 47.6%) in non - cc subgroups, p = 0.007, fisher 's exact test (table 2). the last two decades have seen major advances in hcv treatment options and patient management. however, the standard of care treatment (peg interferon plus ribavirin) is effective in less than half of chronically infected hcv genotype 1 treatment nave patients, regardless of the type or dose of peg interferon used [810 ]. there are many factors influencing therapy result ; sometimes it is hard to understand which of them is the most essential. during recent years there are publications of interleukin 28b gene polymorphism as a strong predictor of svr in patients treated with pegylated interferon and ribavirin. according to thompson. data, published in 2010, il-28b gene polymorphism between caucasians is distributed as follows : cc 37%, ct 51%, and tt 12%. in latvia majority of people are caucasians. these results are similar to our data : cc33%, ct 53%, and tt 14%. svr rates achieved in thompson 's study are 69% of patients in cc group, 33% in ct group, and 27% in tt group. in our study this difference is probably because of different patient profile : we included all genotype patients (61% were 1st genotype), but in thompson 's study there were only 1st genotype patients included, and it is already known that svr rates are better in patients with 2nd and 3rd genotypes. have published data in cemed where cc genotype in hcv patients was noted with significantly lower frequency than in healthy controls (79/281, 28.11% versus 54/104, 51.92%), suggesting a protective role of this variant. also patients treated with pegylated interferon and ribavirin with cc genotype achieved svr at significantly higher rates, than those with tt genotype (25/46, 54.34% versus 7/24, 29.16%). if we analyze only hcv genotype 1 patients, our data shows slightly better results in comparison with thompson and par studies. in cc subgroup svr was achieved in 69% (thompson), 54.34% (par), and 84% in our study. in addition, in our study we analyzed other different treatment efficacy factors, including number of missed treatment doses. we have to stress that chronic viral hepatitis c patients are paying 25% of treatment costs themselves in latvia, and 75% is covered by sick fund. actually they are highly motivated to use assigned medicine. in terms of the higher svr on cc genotype patients from the study cohort when compared with thompson. ' 2010 study, this cohort had younger patients with lower bmi 's, but with higher advanced fibrosis and steatosis rate. besides that, fibrosis stage was higher in nonresponders group, in comparison to responders group, p = 0.029, mann - whitney u - test. these factors influence svr rates in hepatitis c patients and could have played a role as well in the difference from virologic responses. our study is the first study in latvia and baltics done on interleukin b28 gene polymorphism with findings similar to other studies involving caucasian patients. while the most prevalent genotype of il-28b in latvia is ct, the most favorable response to treatment and svr is seen in genotype cc patients. | introduction. with the standard treatment of chronic hepatitis c, sustained virological response (svr) can be achieved only in half of all patients. interleukin-28b appears to be involved in the control of hcv infection, and the genetic polymorphism of the encoding il-28b gene may determine the efficacy of clearance of hcv. the aim of this paper was to detect il-28b gene polymorphism in latvia and to analyze therapy results. this is the first study on il-28b gene polymorphism in latvia. material and methods. there were 159 chronic viral hepatitis c patients included in the study. in order to detect il-28b gene polymorphism, we used molecular biology techniques and methods : classical dna separation, amplification by pcr, and standard sequencing. genotype was defined as cc, ct, tc, or tt type. 142 patients were treated with the standard of care treatment. results were analyzed according to il-28b polymorphism. results. there were 53 patients (33%) with cc genotype, 84 patients (53%) with ct / tc genotype, and 22 patients (14%) with tt genotype. 34 patients (74%) in cc genotype subgroup achieved svr versus 50 patients (52%) in non - cc subgroups. in patients with genotype 1, svr was achieved in 16 patients (84%) in cc subgroup versus 30 patients (47.6%) in non - cc subgroups, p = 0.007. conclusions. the most common genotype of il28b in latvia is ct / tc, with an incidence of 53%. patients with cc genotype achieved svr more often than ct or tt subgroups. il28b gene polymorphism therefore is a strong predictor of treatment result. |
peri - implant bone resorption has been implicated in the success / failure of osseointegrated implants. research on the maintenance of osseointegration under forces transmitted by occlusal load is as important as the study of the initial process of bone formation in different implant surfaces. 2002), in a literature review of the contributing factors to early peri - implant bone loss, pointed to occlusal overload as the most likely cause of this problem. occlusal overload beyond the threshold of bone homeostasis leads to progressive marginal bone resorption, and eventual osseointegration failure. in order to correlate the forces transmitted by occlusal overload to the degree of bone remodeling in the tissues surrounding osseointegrated implants, the mechanostat theory proposed by frost (1990) may be used to determine the maximum tension bearable by bone. in his theory, frost proposes that bone mechanical adaptation is governed by a mechanical strain threshold, which he called the minimum effective strain (mes). if local strains within the bone are above mes, the adaptative response occurs, but if they are below that threshold, bone remains stable. several methods of investigation and biomechanical analyses have been developed for the study of implant supported prostheses. according to spiekermann,. (1995), in vitro techniques such as finite element analysis and strain - gauge testing can be used to measure bone strain. the use of such methods requires previous knowledge of the density and modulus of elasticity of bone. however, according to katz (1995), bone is not homogenous and its physical properties vary greatly according to species, age, gender, type of bone (e.g. femoral, mandibular, cortical, cancellous), and even according to the bone site from where the sample is taken. (2000) measured the modulus of elasticity of trabecular bone, with and without cortical plates, and concluded that human mandibular trabecular bone presents a significantly higher modulus of elasticity in the anterior mandibular region, and that the absence of cortical plates decreases bone modulus of elasticity. (1996), studying the modulus of elasticity of small bone specimens from four dry adult human mandibles, found that elastic properties varied with both site and orientation of the specimen, reflecting the complexity of the mandibular bone structure. fresh mandibular specimens are inadequate for in vitro biomechanical studies, as they show great variability for modulus of elasticity and density and anisotropy. moreover, fresh mandibular specimens have a natural viscosity that hinders the attachment of strain gauges. because of these characteristics, the application of artificial test materials for in vitro biomechanical research has been reported in the literature and mathematical models have been developed to simulate the bone remodeling process under mechanical stimulus in implant supported prosthesis. in vitro studies require isotropic specimens with elastic characteristics similar to those found in the target mandibular region. the homogeneity of polyurethane (pu) could favor its use in biomechanical studies of force distribution on implant supported prostheses aimed at establishing correlations between strains generated in the periimplant region and physiological strains as proposed by frost 's theory. based on these grounds, the purpose of this study was to validate the use of an experimental polyurethane model in in vitro biomechanical studies of implant - supported prostheses. forty - five barbell - shaped, polyurethane (axson ; cergy, france) test specimens (18 mm in length and 3.0 mm in diameter) were used in this study. a 2-part male / female stainless steel (1010/20) polyurethane specimens were obtained by mixing 2 reagents, a and b (a : polyol - catalyst and b : diisocyanate - base). a / b ratio was previously determined in each group. the mixture, still in its viscous form, was injected into the mold with a hypodermic syringe. as soon as hardening was complete, specimens were removed from the mold, according to the manufacturer 's instructions. specimens were initially divided into 3 groups of 15 specimens each according to the ratio of polyurethane reagents (a / b, with a : polyol and b : diisocyanate). following destructive tension testing, some specimens were excluded due to the fact that they failed under considerably low forces, what was attributed to the internal bubbles observed under visual analysis, which could have weakened them. as a result, tension testing was performed for the measurement of the modulus of elasticity in each specimen. each one of the specimens was fixed to a kratos universal testing machine (model k - 2000 mp ; kratos equipamentos industriais ltda., so paulo, sp, brazil), where a 500 kgf load cell pulled the specimen at a crosshead speed of 1.0 mm / min until rupture occurred (figure 1). the modulus of elasticity was then calculated based on the generated tension and the linear deformation of the specimen. generated tension was calculated as follows : polyurethane bell - shaped specimen positioned for tension tests where : t = tension [pa ] ; so = original cross section [m ]. deformation was calculated as follows : where : = deformation [nondimensional ] ; lo = reference initial length (load zero) [m ] ; l = reference length for load p [m ]. finally, the modulus of elasticity was calculated as follows : where : = modulus of elasticity [pa ]. the values of p and l were calculated according to the elastic deformation of the specimen, represented in figure 2 by the curve of generated tension versus linear deformation during the tension test. area i corresponds to specimen accommodation, area ii to elastic deformation, area iii to plastic deformation and area iv corresponds to fracture of the specimen. tension x deformation curve of polyurethane specimen subjected to tension test anova was performed to determine statistically significant differences among groups, and the tukey 's test (p0.05) was used to show differences among groups. forty - five barbell - shaped, polyurethane (axson ; cergy, france) test specimens (18 mm in length and 3.0 mm in diameter) were used in this study. a 2-part male / female stainless steel (1010/20) polyurethane specimens were obtained by mixing 2 reagents, a and b (a : polyol - catalyst and b : diisocyanate - base). a / b ratio was previously determined in each group. the mixture, still in its viscous form, was injected into the mold with a hypodermic syringe. as soon as hardening was complete, specimens were removed from the mold, according to the manufacturer 's instructions. specimens were initially divided into 3 groups of 15 specimens each according to the ratio of polyurethane reagents (a / b, with a : polyol and b : diisocyanate). following destructive tension testing, some specimens were excluded due to the fact that they failed under considerably low forces, what was attributed to the internal bubbles observed under visual analysis, which could have weakened them. as a result, tension testing was performed for the measurement of the modulus of elasticity in each specimen. each one of the specimens was fixed to a kratos universal testing machine (model k - 2000 mp ; kratos equipamentos industriais ltda., so paulo, sp, brazil), where a 500 kgf load cell pulled the specimen at a crosshead speed of 1.0 mm / min until rupture occurred (figure 1). the modulus of elasticity was then calculated based on the generated tension and the linear deformation of the specimen. generated tension was calculated as follows : polyurethane bell - shaped specimen positioned for tension tests where : t = tension [pa ] ; so = original cross section [m ]. deformation was calculated as follows : where : = deformation [nondimensional ] ; lo = reference initial length (load zero) [m ] ; l = reference length for load p [m ]. finally, the modulus of elasticity was calculated as follows : where : = modulus of elasticity [pa ]. the values of p and l were calculated according to the elastic deformation of the specimen, represented in figure 2 by the curve of generated tension versus linear deformation during the tension test. area i corresponds to specimen accommodation, area ii to elastic deformation, area iii to plastic deformation and area iv corresponds to fracture of the specimen. tension x deformation curve of polyurethane specimen subjected to tension test anova was performed to determine statistically significant differences among groups, and the tukey 's test (p0.05) was used to show differences among groups. figure 3 shows the modulus of elasticity (mpa) of each specimen, means and standard deviation for each group. maximum and minimum tension forces (fmax / fmin) were 323.59 n/110.97 n for pu-1 ; 384.77 n/233.87 n for pu-2 ; and 384.91 n/263.86 n for pu-3. mean modulus of elasticity values and standard deviation for groups pu-1, pu-2 and pu-3. there was statistically significant difference between groups 1 and 2, as well as between groups 1 and 3 (p0.05). using pu to build test specimens presented difficulties related to material viscosity, bubble formation, the time length of the process and the heterogeneity found in some reagent mixtures. the greatest difficulties were encountered in pu-1 as it was more prone to bubble formation than the other groups. in addition, the altered reagent proportion caused some of the specimens of this group to be rubbery. on the other hand, polymerization time was shorter for pu-1 than for the other groups, indicating a greater amount of catalyst in its composition. these facts together contributed to the lowest mean modulus of elasticity 192.98 mpa (sd=57.20) seen in pu- 1, as compared to pu-2 and pu-3. the best handling conditions were found in pu-2 whose polymerization time was adequate and similar to that in pu-1, whereas the modulus of elasticity was higher 347.90 mpa (sd=109.54) than in pu-1. pu-3 showed the longest curing time, probably because this group had the smallest amount of catalyst in the mixture, which contributed for difficulties to build the specimens. the tests in pu-3 showed mean modulus of elasticity and standard deviation values of 304.64 mpa (sd=25.48). the broad variance of measured values of modulus of elasticity in group pu2 compared to groups pu 1 and pu 3 can be explained by the low concentration of base (diisocyanate -pu1) and low concentration of catalyst (polyol - pu-3) resulting in a more brittle material. anova showed difference among groups and the tukey 's test showed no statistically significant difference between pu-2 and pu-3. therefore, the increase in the b reagent concentration can not be said to be directly proportional to the increase in modulus of elasticity. the modulus of elasticity is extremely important to the validation of the material used in the building of experimental models as the comparison between the values obtained with those reported in the literature for mandibular bone is the basis for building reproducible, easy - to - handle models of isotropic characteristics. (2000) found different modulus of elasticity in different mandibular regions, which ranged from 47 to 2.283 mpa. (2000) reported modulus of elasticity values ranging from 24.9 to 240.0 mpa, with a mean value of 96.2 mpa (sd=40.6) in the mandibular trabecular bone with its cortical plates. without cortical plates, elasticity ranged from 3.5 to 125.6 mpa, with a mean value of 56.0 mpa (sd=29.6). (1996), observed that the modulus of elasticity of the mandible varied with bone site and orientation, and that the mandibular bone presented anisotropic characteristics, reflecting the complexity of its structure. in their study, these authors obtained the following modulus of elasticity values : 16.9 gpa (sd=2.7) ; 15.4 gpa (sd=4.9) and 13.9 gpa (sd=3.4) in the lower, medium and upper incisal regions, respectively ; 19.4 gpa (sd=2.5), 18.8 gpa (sd=3.5) and 12.6 gpa (sd=4.2) in the lower, medium and upper premolar region, respectively. scwartz - dabney and dechow (2002), also noted a great variation in modulus of elasticity according to the mandibular region, confirming the bone heterogeneity seen by katz (1995) and o'mahony,. (2000). by comparing the modulus of elasticity values observed in this study to those reported in the literature for mandibular bone, where modulus of elasticity is known to be greatly variable, the mean modulus of elasticity values reported here are consistent with those found in the literature. according to the highest value of modulus of elasticity found in group pu 2 and based on handling conditions, where the group pu-3 showed the longest curing time what contributed for difficulties to build the specimens, pu-2 was the group chosen for the building of the experimental model. altering the reagents ratio also resulted in excessively rubbery specimens. the reagent ratio suggested by the manufacturer (1:1) proved to be the most adequate for obtaining the target modulus of elasticity. thus, the use of this material in further experimental studies was considered adequate. based on the results obtained under the proposed conditions, it seems valid to conclude that : modulus of elasticity values varied according to reagent concentration in the test groups studied. however, the increase in concentration of reagent b was not directly proportional to the increase in modulus of elasticity ; the 1:1 concentration for reagents a and b (pu-2) showed the best mechanical and handling characteristics, and should be the concentration of choice for building of experimental models to be used in upcoming biomechanical studies of implant - supported prostheses in the mandibular region. | objectivesthe complexity and heterogeneity of human bone, as well as ethical issues, frequently hinder the development of clinical trials. the purpose of this in vitro study was to determine the modulus of elasticity of a polyurethane isotropic experimental model via tension tests, comparing the results to those reported in the literature for mandibular bone, in order to validate the use of such a model in lieu of mandibular bone in biomechanical studies.material and methodsforty - five polyurethane test specimens were divided into 3 groups of 15 specimens each, according to the ratio (a / b) of polyurethane reagents (pu-1 : 1/0.5, pu-2 : 1/1, pu-3 : 1/1.5).resultstension tests were performed in each experimental group and the modulus of elasticity values found were 192.98 mpa (sd=57.20) for pu-1, 347.90 mpa (sd=109.54) for pu-2 and 304.64 mpa (sd=25.48) for pu-3.conclusionthe concentration of choice for building the experimental model was 1/1. |
during childhood, anemia is one of the most frequently seen intractable health concern that has both social and economic implications all around the world. who estimates that almost one - third of the world s population is anemic, most of which are due to iron deficiency (1). iron deficiency anemia (ida) compromises 90% of all anemia cases in the world (2). it usually occurs as a result of insufficient dietary intake of iron as well as gastrointestinal tract losses and infections (3). ida is the most encountered form of malnutrition in the world with a prevalence of 43% (4). american academy of pediatrics (aap) recommends pis from 4 mo old up to 1 year of age, especially in developing countries (5). although ida is usually a concern of developing countries, there is no national data or a study describing the prevalence of pis usage or ida among children in north cyprus. meanwhile, thalassemia is another common reason of anemia, being the most frequent inherited genetic disease worldwide, and especially one of the major causes of anemia in the mediterranean area, the middle east, central asia, india and the far east (6). thalassemia is an autosomal recessively inherited hemoglobinopathy which affects the synthesis of globin chain of hemoglobin. it has three forms based on which globin chain is affected ;, and. thalassemia is the major type seen in mediterranean region including cyprus and it is more prevalent in malaria - endemic areas. in this type ; globin chain synthesis is either decreased or absent leading to three forms of the disease as major, minor or intermediate (7). carrier frequency varies from 3% to 17% in different populations (8). over 9000 thalassemic children are born every year and treatment are very expensive (9). therefore, strategies for prevention and management of thalassemia had been initiated in 1976 (5). there were only two published studies on thalassemia in north cyprus up to date conducted in 1946 and 1973 demonstrating frequency of thalassemia trait as 18.2% and 15% respectively in north cyprus (10, 11). the main approach for taking thalassemia under control is screening programs, especially in countries with a high number of carriers like cyprus. as a government policy pre - marital screening is mandatory since 1980 in north cyprus (5), and as a result no new baby with thalassemia major has been delivered since 2001. although thalassemia is a major public health problem in cyprus ; no studies have been carried out to investigate the recent prevalence of carrier status in north cyprus since 1970s. the objective of this study was to investigate the prevalence of ida and thalassemia trait in north cyprus among healthy infants being followed up by near east university hospital, department of pediatrics. in addition, it was aimed to determine the compliance to pis recommendation and its effect on the prevalence of ida. the participants were chosen among the children whose complete blood count and ferritin levels were checked between apr 2011 and jul 2013 as part of healthy infant follow - up procedure in the department of pediatrics, near east university hospital, north cyprus. the enrollment criteria were as follows ; to be in regular follow - up in near east university university hospital, department of pediatrics.the presence of complete blood count and ferritin levels documented between 1018 mo of age. information on birth data (birth weight, height and percentiles), breastfeeding status, duration of breastfeeding, usage and duration of pis, weight and height at 1 year of age and percentiles, parental education status and parental thalassemia carrier status had been achieved from hospital database or by phone calls in demand. to be in regular follow - up in near east university university hospital, department of pediatrics. the presence of complete blood count and ferritin levels documented between 1018 mo of age. information on birth data (birth weight, height and percentiles), breastfeeding status, duration of breastfeeding, usage and duration of pis, weight and height at 1 year of age and percentiles, parental education status and parental thalassemia carrier status had been achieved from hospital database or by phone calls in demand. complete blood count (cbc), ferritin and if present hemoglobin electrophoresis results had been obtained from hospital database program. diagnosis of ida and thalassemia trait are as follows : anemia was defined as hemoglobin level below 10.5 gr / dl whereas mean corpuscular volume (mcv) below 70fl has been used to indicate microcytic anemia (12, 13). within the microcytic anemia group ; if ferritin level was below 15mg / ml and mentzer index (mcv / rbc) was above 13, this was considered as ida, while high rbc level, normal rdw value and mentzer index smaller than 13 was considered as thalassemia trait (12). statistical analyses were performed by means of spss 17 (chicago, il, usa) software. groups were compared by means of students t test. a p value of 0.05). comparison of breastfeeding, pis and growth between iron deficiency anemia and non - anemic group are summarized in table 3. comparison of breastfeeding, prophylactic iron supplementation, duration and growth between iron deficiency anemia and others cyprus had been the region with the highest prevalence of beta thalassemia since the 19th century (14,15). a frequency of 7.9% which shows a 50% decline in the prevalence of thalassemia trait compared to the study results of 1973. in addition, the frequency of ida was found to be 14.6% which is lower than other developing countries. the importance of aap recommendation of pis for the prevention of ida in early childhood. moreover, there were no significant differences between infants with and without anemia based on weight and height at birth and 1 year of age, duration of breastfeeding and compliance to pis. the first epidemiologic study on thalassemia in cyprus demonstrating a thalassemia carrier status of 18.2% (10). thereafter, the second study, among turkish and greek cypriots showing a frequency of thalassemia trait of 15% (11). a study performed 25 yr later in 1998 revealed cyprus as the region with the highest frequency of thalassemia trait worldwide (14, 15). this decrease since 1946 is most probably due to the strict adherence to the pre - marital thalassemia trait screening policy. malaria is the leading cause of the increase in thalassemia frequency in malaria endemic regions and eradication of malaria in cyprus in 1948 might have a role on the deceasing frequency in each generation (14, 15). moreover, current prenatal diagnostic techniques such as chorionic villus sampling and dna analysis might have contributed to this decrease (5). after national screening law came into force in north cyprus in 1980, the rate of thalassemia major births decreased dramatically and eventually no new thalassemia major case has been delivered since 2001 (5). national screening programs have also been established in italy, greece and the uk. when compared to these countries, cyprus has the lowest prevalence of thalassemia major births (16). for prevention of ida the recommendation of aap is to initiate pis at the age of 4 mo continuing at least for 8 mo till the age of 1yr (17). our institution s routine healthy infant follow - up protocol includes the recommendation of pis from 4 mo to 12 mo of age. complete blood count and serum ferritin level are checked in - between the age of 1218 mo to evaluate the presence of ida and thalassemia trait, as well (18). the frequency of ida among infants in our study group was found to be 14.6%. the frequency of ida between ages 05 in turkey is around 50% according to a national study (13). compliance to pis was found to be 43% and mean duration of usage was 12 mo, while the frequency of ida between 1223 mo was reported as 16.3% (19). accordingly, compliance to pis in north cyprus was 85.3% and mean duration of the prophylactic supplementation was 8 mo. rate and duration of compliance to pis was also higher than turkey, supporting the finding of lower frequency of ida. although uk has low ida prevalence, frequency of ida in inner cities approached to those in developing countries (20). frequency of ida in infants aged 624 mo of low socioeconomic families, especially of the ethnic minorities, changed between 2540% (21). frequency of ida in infants from high socioeconomic level families was 5% whereas 20% in those of low socioeconomic level (21). social status was determined by educational level of parents demonstrating no significant difference between ida and non - anemic groups. a study carried out in cuba among infants of 623 mo of age concluded that prevalence of ida was 23.8% and 28.5% in urban and rural regions, respectively (22). another study which collected data from several european cities (athens, bilbao, budapest, dublin, madrid, naples, porto, rostol, santiago, umea and vienna) used levels of hb, ferritin, mcv, transferrin saturation and transferrin receptor and found out that infants aged 12 mo have frequency of iron deficiency and ida as 7.2% and 2.3%, respectively (23). in iceland and norway, the frequency of ida at 12 mo of age was reported as 2.7% and 10%, respectively (23). when compared to developed countries, ida frequency in north cyprus was higher. the prevalence of ida in low socioeconomic countries is much higher (24). in sub - saharan africa, ida in 1023 mo aged infants changed between 59 and 99.4% throughout 20012006. in armenia and egypt, it was above 50% in 2005 and in india it was around 76% in 1999. in latin america and caribbean countries, therefore, based on the results of our preliminary study, frequency of ida in north cyprus seems to be between developed and developing countries. although thalassemia has been a major public health problem in cyprus since the mid-1900 s, no studies investigating the rate of in frequency of thalassemia trait status have been carried out in north cyprus during the last five decades. likewise ; there are no reports on the frequency of ida among infants in north cyprus. although preliminary with a small sample size, this is the first study evaluating ida frequency and adherence to pis during infancy. thalassemia trait frequency was 7.9% among infants demonstrating a decline of more than 50% since 1946 in north cyprus. this result confirms the success of strict adherence to pre - marital screening policy conducted since 1980. in addition, prevalence of ida was relatively low in this region compared to other developing countries, supporting the beneficial effect of pis on prevention of ida. ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors. | background : iron deficiency anemia (ida) is an important health problem all around the world especially in developing countries. in the mediterranean countries another prevelant reason of anemia is thalassemia. certain strategies had been established as a government policy to reduce prevalence in north cyprus, such as pre - marital screening of thalassemia. the prevalence of thalassemia trait has not been evaluated since then. the aim of this study was to detect the prevalence of ida, thalassemia trait in infants under regular follow - up and to evaluate the compliance to prophylactic iron supplementation (pis) and its effect on ida.methods:healthy children admitted to department of pediatrics, near east university hospital, in 20112013 were included. data of anthropometric measurements, parental thalassemia trait status, duration of pis usage, complete blood count, ferritin levels and hemoglobin electrophoresis were collected from hospital database program. anemic children were grouped as ida, thalassemia trait, both ida and thalassemia trait and others.results:eghty-nine infants with a mean age 13.522.09 mo were included. compliance with pis recommendation was 85.3% and, the mean duration of iron usage was 6.443.18 mo. ida and thalassemia trait were found to be 11.2% and 4.5% respectively, while 3.4% of the infants had both ida and thalassemia trait.conclusion:prevalence of thalassemia trait was 7.9% demonstrating approximately a 50% decline within 5 decades. this result confirms the success of premarital screening policy in north cyprus. in addition, prevalence of ida was relatively low being 14.6% supporting the beneficial effect of pis on prevention of ida. |
the necessity of oxygen comes from its role in aerobic respiration, a process of extracting energy from food that is approximately 19 times more efficient than its anaerobic counterpart. in eukaryotes, aerobic respiration is carried out in the mitochondria (descendant of an aerobically respiring bacterium) by a series of electron transfer reactions that are coupled to the generation of a proton gradient. this proton gradient is used to generate the cellular fuel adenosine triphosphate (atp). the residual energy of the spent electrons is consumed in the reduction of molecular oxygen (o2) to water (h2o). aerobic respiration can not occur without this last step, but the reliance on oxygen as the final electron acceptor poses a continual threat of oxidative damage to aerobically respiring organisms. the threat posed by oxygen comes largely from its conversion to the free radical superoxide (o2) rather than water. detoxification of superoxide and other ros is performed by antioxidants, which convert ros to less reactive molecules. the antioxidant enzyme superoxide dismutase (sod) converts superoxide to water and hydrogen peroxide (h2o2), which is another ros and a potent oxidising agent (see figure 1). under normal conditions, antioxidants help to prevent oxidative damage by using electrons to reduce ros, thus inhibiting ros from oxidising other molecules. numerous studies have found that high ros levels are damaging to dna, rna, proteins, and lipids [36 ]. additionally, oxidative (ros) damage is thought to be one of the major causes of ageing, according to the free - radical theory of ageing. however, the free - radical theory seems to conflict with recent findings regarding the role of ros in redox signalling, findings that have unveiled an additional mechanism for oxidative toxicity besides simply macromolecular damage. ros are now known to do more than indiscriminately damage macromolecules ; they function as important signalling molecules (reviewed by d'autraux and toledano). for instance, superoxide and h2o2 are part of a second messenger system involved in controlling subcellular redox states ; modulating protein activation and turnover ; regulating gene expression ; and mediating extracellular signalling. for this crucial messaging system to function, the levels of superoxide / h2o2 must be maintained at concentrations far below the level of toxicity. consistent with this idea, recent studies have found that mitochondria produce superoxide / h2o2 at levels much lower than those previously estimated [1012 ]. redox hypothesis as an alternative to the free - radical theory of ageing that accommodates recent discoveries in redox signalling. this hypothesis states that changes to redox state, rather than oxidative damage, cause aging and age - related diseases. the redox state of a cell, cellular compartment, or molecular system is a measure of the availability of chemically reactive electrons. in the reducing state, such electrons are more abundant whereas in the oxidising state they are less abundant. with regards to oxidative stress, the redox hypothesis suggests that an increase in ros levels can be deleterious if the resulting oxidative shift in redox state causes a disruption to redox signalling. to date much of what has been discovered in redox biology has resulted from work in e. coli, s. cerevisiae, mammals, and plants. while unicellular organisms such as e. coli and s. cerevisiae offer obvious advantages as model organisms due to their relative simplicity, short generation times, ease of culturing and maintenance, and so forth, they can not be used to study systems / mechanisms unique to multicellularity in general, and animals in particular. although not to the same extent, c. elegans offers similar advantages to working with the simple unicellular systems above, with the addition of being a multicellular, metazoan system allowing for much more of what is discovered in this organism to be extrapolated to research in other animals, including humans. this article seeks to scope out the redox proteins / systems of c. elegans as a resource for future work on redox signalling and oxidative stress within this model organism. in addition, this article will briefly explain the function of each protein family and how it relates to redox signalling and oxidative stress, with specific mention of what has been discovered in c. elegans. the majority of available reactive electrons in a biological redox system are found in cysteines (as in the abundant tripeptide glutathione). cysteine is an amino acid with a thiol (sulfur) group that is easily oxidized. when oxidised, two thiols in close proximity to one another can bond to form a disulfide. formation of disulfides is important in protein folding and maintaining protein structure, however, a small fraction of thiols have another function : redox - sensitive switches (see figure 2) [1418 ]. these redox - sensitive thiol switches are generally found at the surface or in the active sites of proteins. change from a thiol state to a disulfide can alter a protein 's shape and function. the propensity for a redox - sensitive switch to be in one state or the other (thiol or disulfide) is dependent on the redox state of the cellular compartment and/or redox system to which it belongs. therefore, the activity and conformation of a large number of proteins can be altered by changes in redox state. methionine also contains a redox active sulfur and is used in redox signalling, but this occurs to a lesser extent and is not discussed in this article. the most important oxidants that participate in signalling - related modification of cysteine residues are hydrogen peroxide (h2o2), a reactive oxygen species, and nitric oxide (no), a reactive nitrogen species. the focus of this article will be h2o2 as the signalling role of no has been reviewed extensively. although a potent oxidant, the signalling role of h2o2 is primarily limited to redox - sensitive cysteine and methionine residues [2224 ]. the fact that much of the cellular h2o2 is formed via the dismutation of superoxide (o2) by sod enzymes means that the amount of superoxide produced directly contributes to the levels of h2o2 in a cell or cellular compartment. superoxide is primarily generated by nadph oxidase (nox), coenzyme q10 [9, 26 ], and complex i and iii of the mitochondrial electron transport chain. the difference in redox states between organelles results from differences in the ratio between h2o2 and other thiol oxidants and various disulfide reductants / antioxidants. because the redox state can alter protein conformation and reactivity, it can be used to activate or inactivate protein function. for example, the redox state of two different cellular compartments regulates dna binding of the nuclear factor erythroid 2-related factor 2 (nrf-2) transcription factor. nrf-2 is activated in the cytoplasm by an oxidative signal that results in translocation to the nucleus. however, in order to bind to dna in the nucleus, a redox - sensitive cysteine must be reduced. this demonstrates specificity in redox signalling between different cellular compartments, for which the redox state of the compartment must be appropriate to its role (see figure 3). two central thiol / disulfide couples work in the reduction of protein disulfides as counterparts to h2o2 and other oxidising agents to control redox state : the glutathione / glutathione disulfide (gsh / gssg) couple (mediated through glutaredoxins) and the active site dithiol / disulfide of thioredoxins (trxred / trxox ; see figure 4). glutathione and thioredoxins each interact with a different subset of proteins thus forming distinct redox systems. the redox state of one of these systems may differ from the other even in the same cellular compartment [27, 3034 ]. as well as glutathione and thioredoxin working as reducers of protein disulfides, a third thiol / disulfide couple, cysteine / cystine, has also been proposed by jones. as a possible oxidiser of protein dithiols used in redox regulation and signalling. changes to the ratios of these three redox couples have been observed in various disease states, and it is possible that a gradual loss of redox state homeostasis over time contributes to ageing and age - related diseases. the redox state of the various redox systems in a cell or cellular compartment must normally reside within a narrow range, not only to maintain the constitutive signals resulting from the homeostatic redox state itself, but also to allow for meaningful thresholds, where a change in redox state outside the typical range of a cellular compartment can be used to signal a change in metabolism, environment, or stress. in addition to global signals at the level of an entire organelle, generation of h2o2 with no measureable effect on overall redox state of the various redox systems in a cell or cellular compartment may still have a very real effect on proteins in close proximity to the site of generation, resulting in a transient local signal an example of modulation of signalling by transient local changes rather than a global shift in redox state is altered protein phosphorylation resulting, for example, from the inactivation of protein tyrosine phosphatases [37, 38 ], map kinase phosphatases, and pten. within the redox hypothesis paradigm, much of the toxicity of oxidative stress could result from an oxidative shift in redox state within one or more cellular compartments. this shift would likely disrupt transient redox signalling as well as perturb the regular function of redox regulated proteins within these compartments. the end result could still be pathological oxidative damage to cellular components even though the cause could be indirect. thioredoxin (trx) was first discovered in escherichia coli as a hydrogen donor for ribonucleotide reductase [41, 42 ]. since the initial characterisation, trx proteins have been recognized as more general disulfide reductases that are found in all phylogenetic domains of life. trx proteins have a distinct structure that encompasses the active site dithiol known as the thioredoxin fold. this domain is also found in a variety of related proteins including glutaredoxin, protein disulfide isomerase, peroxiredoxin, and glutathione s - transferase. the characteristic cgpc active site dithiol motif can be oxidised to a disulfide to release electrons that are used to reduce redox - sensitive disulfides within a wide range of target proteins. trx proteins were long thought to be primarily involved in restoration of redox - sensitive disulfides to their reduced state after being oxidised by ros. in particular, ros scavengers such as peroxiredoxin require the activity of trx proteins for their regeneration. however, the role of trx as a disulfide reductase is now known to be important for immune signalling, regulating transcription factors, and modulating cellular signalling. sequence comparisons and phylogenetic analysis revealed that c. elegans possesses twenty proteins closely related in sequence and length to trx proteins in yeast, humans and fruit flies. seven of these twenty proteins contain the characteristic cgpc active site sequence required for trx activity. five of these cgpc containing proteins, trx-1, trx-2, trx-4, y45e10.a, and y55f3ar.2, are closely related to proteins of known trx activity in s. cerevisiae, h. sapiens, and d. melanogaster. human cytosolic thioredoxin 1 (trxn1) has roles in the activation of transcription factors activator protein-1 (ap-1) and nuclear factor kappa b (nfb) [49, 50 ], as well as in immune signalling [45, 51 ]. although orthology is unclear between human trxn1 and c. elegans trx proteins (figure 5), both human trxn1 and c. elegans trx-1 are cytoplasmic. trx-1 is expressed in intestinal cells as well as the asj pair of neurons and modulates adult lifespan extension induced by dietary restriction. human mitochondrial trxn2, for which there is likely orthology with c. elegans trx-2, is part of a mitochondria - dependent superoxide / trxn2/apoptosis signal - regulating kinase 1 (ask-1) apoptosis signalling pathway. in c. elegans interactions of trx-1 and trx-2 with exonuclease 3 (exo-3) and c. elegans p53-like protein (cep-1), appear to play a role in neural structure and function as well as ageing. for example, trx-1 modulates the activity of the insulin - like neuropeptide daf-28 in asj sensory neurons in the head during c. elegans dauer formation. this function was retained even after the redox activity of the protein was disrupted by replacing the two cys residues of its active site with two ser residues. in regard to thioredoxin - like (trxl) proteins, the close relationship found between y45e10.a and y55f3ar.2 and the thioredoxin - like proteins of humans (txnl1) and d. melanogaster (txl) suggests possible orthology. the other two c. elegans homologs containing the cgpc sequence, trx-3 and trx-5, were found as part a clade containing nucleoredoxin (nxn) and related proteins. humans possess a single nxn, which contains a cppc active site, and two nucleoredoxin - like proteins (nxnl1 and nxnl2). nxn (reviewed in) has been shown to function as a redox regulator of gene expression and a negative regulator of toll - like receptor signalling. six out of the nine c. elegans proteins within the nxn clade contain the cppc nxn active site sequence, suggesting a possible expansion of the nxn subfamily. proteins within this nxn clade are also closely related to the 16-kilodalton class of thioredoxins described in the parasitic nematode brugia malayi. reduced glutathione (gsh) is a tripeptide consisting of glycine, cysteine and glutamic acid. gsh synthesis is performed in a two - step atp - dependent process. in the rate - limiting first step gamma - glutamylcysteine synthetase (gcs ; see table 1) synthesises gamma - glutamylcysteine from l - glutamate and cysteine. in the second - step glutathione synthetase (gss ; see table 2) adds glycine to the c - terminal of gamma - glutamylcysteine. these enzymes are highly conserved in eukaryotes (tables 1 and 2) and even in prokaryotes (not shown). glutathione plays an essential role in antioxidant defence as a source of electrons for antioxidant enzymes such as glutaredoxins and peroxidases. the high (millimolar) concentrations of glutathione in the cell ensure an abundance of electrons for these antioxidant systems and thus provide a robust buffer against oxidative shifts in redox state. glutathione s - transferases (gsts) can form mixed disulfides between glutathione and redox - sensitive cysteine thiols of proteins. this activity can be used to regulate protein activity and under oxidizing conditions can prevent irreversible oxidation of thiols to sulfinic (so2h) and sulfonic acid (so3h) oxoforms [65, 66 ]. gst can also conjugate glutathione to xenobiotic compounds as part of a detoxification response and to a fatty acid in the synthesis of prostaglandin hormone [68, 69 ]. the ratio of reduced glutathione to glutathione disulfide within a cellular compartment, that is, [gsh]/[gssg ], determines its redox state. high [gsh]/[gssg ] ratios such as those found in the mitochondria, cytoplasm, and nucleus ensure that the majority of redox - sensitive protein switches within these compartments are in the reduced (sh) state. maintenance of the proper [gsh]/[gssg ] ratio ensures redox homeostasis, whereas changes to this ratio provide a simple means to adjust the redox state between compartments as well as within compartments under different physiological conditions. for example, changes in redox state have been found to trigger responses associated with defence against particular biotic or abiotic stressors. in plants, changes to the cellular glutathione pool havebeen shown to elicit pathogen resistance responses [79, 80 ]. these examples demonstrate that global changes to protein activity and widespread changes to signalling can be achieved quite readily by simply changing the redox set point within a cellular compartment. when oxidised, the reduced (thiol) states of glutathione and trx enzymes are restored by glutathione disuflide reductase (gsr) and trx reductase (trxr), respectively, using electrons obtained from nadph (figure 4). gsr is absent from d. melanogaster and has been substituted by a novel glutaredoxin - thioredoxin reductase fusion protein (trxr-1). s. cerevisiae possess proteins with trxr enzymatic activity, however, these proteins are evolutionarily unrelated to the animal forms and are thus not represented on the phylogenetic tree. interestingly, trxr-1 is the only selenocysteine containing protein in c. elegans, and both trxr-1 and gsr-1 are essential for proper moulting. the third clade of this protein family is composed of dihydrolipoamide dehydrogenase (dld) orthologs. dld is similar in structure to both trxr and gsr, however, its functions are quite different. dld is a component of various protein complexes located within the mitochondrial matrix, including pyruvate dehydrogenase, alpha - ketoglutarate dehydrogenase, and the branched chain amino acid - dehydrogenase complexes as well as the glycine cleavage system. in these complexes dld the pyruvate dehydrogenase and branched chain amino acid - dehydrogenase complexes (2-oxo acid dehydrogenase complexes) are thought to play a role in redox regulation via the reduction of thioredoxins. in addition, the alpha - ketoglutarate dehydrogenase complex has been found to be a generator of h2o2 [86, 87 ]. glutaredoxin (glrx) uses electrons extracted from gsh to reduce redox - sensitive disulfides of a variety of proteins, thereby modulating enzyme activity. glrx can also carry out oxidative cysteine glutathionylation of proteins resulting in protein - glutathione mixed disulfides, and the reverse reaction, deglutathionylation (i.e., the reduction of the mixed disulfides), restoring the protein to its unmodified form. glrx enzymes come in two forms : a monothiol form that contains a single cysteine in the active site and a dithiol form that contains two cysteines in the active site. these two forms differ in function and can be seen as distinct clades in the phylogenetic tree (figure 7). the reduction of protein disulfides as well as the oxidative formation of protein - glutathione - mixed disulfides are both catalysed via dithiol mechanisms, whereas reductive deglutathionylation is performed by a monothiol mechanism. one of the glrx clades contains only monothiol proteins with the cgfs active site sequences, whereas the other clade contains mostly dithiols with a variety of active site sequences, as well as a few proteins with a single cysteine active site. the mammalian glrx3 (picot), likely ortholog of c. elegans glrx-3, has been characterised as an iron - sulfur binding protein possibly regulated by ros and reactive nitrogen species. human glrx1 has a number of roles including the regulation of redox signal transduction and protein translocation, caspase-3 signalling in tumor necrosis factor--induced cell death, and angiotensinii redox signalling via glutathionylation of ras. c. elegans glrx-10 is closely related to human glrx1, both of which are nested within a subclade of dithiol glrx enzymes, all of which except glrx2 contain the cpyc active site sequence. f10d7.3 is somewhat similar to grx6p and grx7p from s. cerevisiae, although the difference in size and active site makes orthology unlikely. glrx-21, glrx-22, and zc334.7 were found to group closely with s. cerevisiae grx8p, but again differences in size (particularly the larger size of zc334.7) and the sequence of their dithiol active sites makes orthology unlikely. to date very little work on glrx proteins has been performed in c. elegans. worth mentioning, however, is a paper published in 2010 which found that glrx-21 functions in the prevention of selenium - induced oxidative stress. the protein disulfide isomerase (pdi) protein family is composed of a large and diverse group of enzymes, most of which contain at least one trx - like domain with a cxxc active site motif. pdi enzymes reside in the endoplasmic reticulum (er) where their usual function is to catalyse protein folding. the active site cysteines of pdi are used in thiol - disulfide exchange between cysteine residues of the substrate proteins. this pdi thiol - disulfide exchange enables proteins to rapidly aquire the correct configuration of structural disulfide bonds required to achieve their native structure. pdi functions in four different chemical reactions : (1) the oxidation of protein disulfides, using gssg as the electron acceptor ; (2) the reduction of protein disulfides, using gsh or nadph as the electron donor ; (3) the deglutathionylation of mixed disulfides ; (4) the isomerization (rearrangement) of intra - molecular disulfides. these functions of pdi proteins require the more oxidised redox state of the er [70, 97 ]. in addition to passively relying on a more oxidised redox state, it has also been suggested that some pdi proteins may play a role in redox regulation. in c. elegans, analysed and compared the activities of pdi-1, pdi-2, and pdi-3 and found that all three displayed thiol - disulfide exchange activity, but that each showed a difference in reactivity towards various protein substrates. rnai knockdown of the pdi-2 and pdi-3 genes results in an unflolded protein response, which suggests pdi-2 and pdi-3 are indeed required for proper protein folding. additionally, winter. studied pdi-1, pdi-2, and pdi-3 and found that pdi activity is required for embryonic development and proper formation of the extracellular matrix. comparision of pdi sequences and phylogentic analysis revealed a number of unnamed proteins with likely othology to known human pdis, as well as a few small gene expansion events both in c. elegans and human. the end result is 19 proteins in both c. elegans and human, but only 8 in d. melanogaster and 4 in s. cerevisiae (see figure 8). human p4hb (pdi / pdia1), pdia3 (erp57), and pdia4 (erp72)the probable orthologs of c. elegans pdi-2 (or pdi-1), pdi-3, and c14b9.2, respectively all react readily with peptide dithiols in vitro to form disulfides. c. elegans pdi-1 is peculiar in that the n - terminal active sites of all of its closely related homologs contain the characteristic pdi sequence cghc, whereas in c. elegans the glycine has been replaced by a valine (cvhc). the similarity of c. elegans pdi-1 to human p4hb in size and sequence would suggest an orthologs relationship between these two proteins. however, human p4hb can be found as the beta subunit of prolyl 4-hydroxylase (p4h),a complex which hydroxylatesprolinetohydroxyproline in the production ofcollagen. in c. elegans, the beta subunit of the p4h complex is pdi-2 [102, 103 ], making pdi-2 the more likely ortholog of p4hb, despite pdi-2 being ~100 amino acids shorter than c. elegans pdi-1 and human p4hb. regarding the other pdi homologs, ko and chow found that the dpy-11 protein of c. elegans that is a possible ortholog of human tmx1, is necessary for body and sensory organ morphogenesis, which they argue is due to its role in substrate modification in the hypodermis. in terms of redox signalling, human p4hb has been found to work antagonistically with trxn1 in the regulation of nuclear factor kappa - light - chain - enhancer of activated b cells (nf-b)-dependent gene expression : trxn1 actives the nf-b pathway, whereas p4hb expression suppresses nf-b activity in a dose - dependent manner. other possible pdi orthologous relationships involving c. elegans include human tmx3, d. melanogaster cg5027, and c. elegans zk973.11 ; human txndc12 (erp18) and c. elegans y57a101.23 ; d. melanogaster cg4670 and c. elegans f47b7.2 ; human pdia6 (p5), c. elegans tag-320 and c. elegans y49e10.4 (see table 3). although, whether any of these proteins participate in redox signalling remains to be investigated. the nadph oxidase (nox) system was first described as a system used by mammalian phagocytes in the production of superoxide as a response to infection by microorganisms. the core enzyme of this microbial defence system is nox2, which under the regulation of its p22phox, p47phox, p40phox, p67phox, and rac subunits catalyses the formation of large amounts of superoxide, which in turn is converted to additional reactive oxygen species. a total of seven nox homologues exist in mammals, including nox1 through 5 and the dual oxidases duox-1 and duox-2. most of these homologs generate much lower of levels of ros than nox2 and are found in a much wider range of cell types. lambeth presents a case for the importance of nox proteins in the generation of ros signals, but this hypothesis has not yet been rigorously tested. most important to a discussion of nox activity in c. elegans is the function of duox, as the only two nox homologs in c. elegans, duox-2 and bli-3, are related to the duox proteins of humans and d. melanogaster (figure 9). duox serves a dual role in both the generation of superoxide and catalysis of reactions in the extracellular matrix using h2o2. the subunits used to regulate nox2 are not used in the regulation of duox enzymes. additionally, blastp searches do not reveal homology to any of the nox2 regulating subunits in c. elegans. it is important to note the duox has not been implicated in ros signalling, and there is evidence to suggest that in mammals they instead play a role in the biosynthesis of thyroid hormones in the extracellular matrix. in c. elegans, the duox homolog bli-3 functions in tyrosine cross - linking in the extracellular matrix [108, 109 ]. further research may yet reveal additional mechanisms for the duox homologs in c. elegans. an alternative view is that these enzymes generate h2o2 for use in redox signalling. in this regard a signalling role for sod goes well beyond the popular view that sod is responsible for the complete removal of superoxide from cellular compartments for the sole purpose of preventing oxidative damage. much of the recent research on sod enzymes has focused on their possible role in the ageing process, in experiments designed to test the free - radical theory of ageing. in some cases, decreasing levels of sod have been shown to shorten the lifespan of yeast [111114 ], fruit flies, and mice, but this is not uniformly the case. in fact, an analysis of the entire sod gene family in c. elegans revealed that both increasing and decreasing expression of the sod genes had little effect on lifespan. when sod gene expression is experimentally increased, lifespan is either unaltered or decreased [117120 ]. a report from y. honda and s. honda showed that increased expression of sod-1 and sod-2 extended the lifespan of c. elegans, but that this was not due to decreased oxidative damage. while results are inconsistent between species and are not even consistent between experiments on a single species, it is clear that the view of sod as an eliminator of ros that would otherwise limit lifespan is much too simplistic. two distinct classes of sod enzymes exist within eukaryotes : copper / zincsod (cu / zn sod), found in the cytosol or extracellular matrix ; manganese sod (mn sod), found in the mitochondria. phylogenetic analysis clearly shows two main clades corresponding to mn and cu / zn enzymes (figure 10). unlike the other three species in the analysis, each of which has only a single mn sod, there has been a duplication of the gene in c. elegans, sod-2 and sod-3. the same is true of the human cu / zn sod-1, in that human and the other two species have a single gene that corresponds to a pair of genes in c. elegans, sod-1 and sod-5. the last sod gene in c. elegans, sod-4, corresponds to a single gene in each of human and d. melanogaster. it is an extracellular cu / zn sod, with a possible function is daf-2 signalling. the glutathione peroxidases (gpx) were first characterised as a family of proteins that reduce h2o2 to h2o using gsh as the electron donor. humans and c. elegans both contain a large number of gpx proteins (8 and 7, resp.) compared to yeast (3 proteins) and d. melanogaster (only 2 proteins). most of these appear to have arisen independently by gene duplications within the two taxonomic lineages (figure 11). while five of the eight humans gpx contain a selenocysteine in their active site, not a single selenocysteine is found in any of the c. elegans gpx homologs. despite the relatedness of c. elegans proteins with proteins of known gpx activity, vanfleteren was unable to detect any gpx activity in c. elegans tissue. however, the in vitro assay used in this article only included gsh as a reducing substrate. use of gsh appears to be limited to gpx enzymes that contain selenocysteine ; the cysteine - containing gpx homologs of c. elegans likely use a peroxiredoxin - like mechanism with thioredoxin as their reducing substrate. for example, faltin. found that ros signalling used in the early stage shoot organogenesis of plants is regulated by the gpx homolog phgpx. in mammals, ros regulation of lipopolysaccharide (lps) signalling is modulated by gpx1, while gpx1 deficiency is found to enhance proinflammatory cytokine - induced redox signalling. conversely, high levels of catalase and gpx activity have been found to diminish h2o2 signalling in human alveolar macrophages. the c. elegans protein f26e4.12, a homolog of human gpx4 and plant phgpx, regulates the peptide transporter pept-1. peroxiredoxins (prdx) are found as homodimers in which the active site cysteines align in close proximity and form intermolecular dithiols / disulfides. prdx disulfides function in the reduction of h2o2 to h2o for both antioxidant defence and mediation of ros signalling [133, 134 ]. active site disulfides formed in the reduction of h2o2 are reduced back to dithiols by the thioredoxin redox system. prdx comes in three forms : typical 2-cys, atypical 2-cys, and 1-cys. phylogenetic analysis showed that c. elegans have two typical 2-cys prdx, 1-cys prdx, but does not possess an atypical 2-cys prdx homolog (figure 12). human prdx1 and prdx2, two of the typical 2-cys prdx homologs to c. elegans prdx-2, might participate in both intra- and extracellular signalling cascades by regulating levels of h2o2. the human mitochondrial typical 2-cys prdx3, which is closely related to c. elegans prdx-3, participates in the regulation of apoptotic signalling. what is known is that prdx-2 is necessary for normal growth and egg production in c. elegans, which isermann. interestingly, loss of prdx-2 actually increases resistance to some oxidative stress causing agents but results in a decrease in lifespan. phylogenetic analysis shows a lineage specific expansion from one catalase to three in c. elegans (figure 13). c. elegans ctl-1 is required for the extended adult lifespans of daf-2, age-1, and clk-1 mutants. ctl-2 is found in the peroxisomes of c. elegans and a lack of this protein has been found to cause a progeric phenotype and adversely affect development / egg laying. the ctl-1 and ctl-2 genes are both negatively regulated by daf-2-mediated insulin signalling. as such, daf-2 signalling might result in an increase in the levels of h2o2, and thus a more oxidizing state. reactive oxygen species are thought to play a role in many diseases of ageing, including parkinson 's disease, alzheimer 's disease, heart failure, and myocardial infarction. important to this understanding is a clear description of the protein families that contribute to the generation and metabolism of ros. most of the known protein families that participate in redox biology are discussed in this article, but it is likely that additional, undescribed families of redox proteins remain to be discovered. it is striking that of the protein families that have been compared in this study, most show clear relationships between sequences, with no extreme examples of species - specific family expansion. s. cerevisiae frequently, and d. melanogaster sometimes, had smaller gene families than the other two species. in addition to oxidative damage, higher ros levels disrupt the regular function of redox regulators and their downstream effectors. it is, therefore, likely that at least some, if not many, of the toxic effects associated with oxidative stress are the result of disruption to redox signalling. continued research into the various functions of the c. elegans redox proteins discussed in this article will help to achieve a better understanding of redox signalling, oxidative stress, and the relationship between these two biological phenomena. c. elegans and h. sapiens exhibited fairly conserved gene family structure, indicating that c. elegans will provide a medically relevant model of redox signalling. | oxidative stress is a toxic state caused by an imbalance between the production and elimination of reactive oxygen species (ros). ros cause oxidative damage to cellular components such as proteins, lipids, and nucleic acids. while the role of ros in cellular damage is frequently all that is noted, ros are also important in redox signalling. the redox hypothesis " has been proposed to emphasize a dual role of ros. this hypothesis suggests that the primary effect of changes to the redox state is modified cellular signalling rather than simply oxidative damage. in extreme cases, alteration of redox signalling can contribute to the toxicity of ros, as well as to ageing and age - related diseases. the nematode species caenorhabditis elegans provides an excellent model for the study of oxidative stress and redox signalling in animals. we use protein sequences from central redox systems in homo sapiens, drosophila melanogaster, and saccharomyces cerevisiae to query genbank for homologous proteins in c. elegans. we then use maximum likelihood phylogenetic analysis to compare protein families between c. elegans and the other organisms to facilitate future research into the genetics of redox biology. |
the chemical industry is nowadays dependent on fossil resources such as oil, coal, and gas.1 however, a longterm outlook predicts biomass to become a main carbon source for chemical manufacture. therefore, numerous investigations are now focused on the efficient valorization of biomass. given that carbohydrates represent most of the biomassderived organic compounds,2 great attention noteworthy, the main source of saccharides are polysaccharides, such as cellulose, starch, hemicelluloses, inulin, and so on. the strategy of platform chemicals3 considers first the depolymerization of such biopolymers to release the monomers4 and, second, upgrading of these monomers.1b, 5 remarkably, numerous recent investigations have elaborated protocols for the synthesis of fuels along with commodity and fine chemicals based on monosaccharides.1b, 5, 6 biopolymers are sources of several aldoses and 2ketoses, but seven monosaccharides significantly predominate, namely, dglucose, dfructose, dxylose, larabinose, dribose, dmannose, and dgalactose (figure 1). dglucose clearly prevails as the major building block of plant biomass.2a from a synthetic point of view, it would be interesting to extend the list of readily available monosaccharides. isomerization is a wellknown carbonefficient way to produce rare monosaccharides based on abundant ones (figure 1). moreover, valuable compounds can be produced on the basis of the products of isomerization (figure 2). for instance, dxylose can be converted into dxylulose and further into furfural under much milder conditions than those typically used for furfural production.7 together with 5hydroxymethylfurfural (hmf), furfural is a biomassderived platform chemical of great interest. dtagatose is a very promising ketose that can be applied as a lowcalorie sweetener and in cosmetic and pharmaceutical formulations. currently, dtagatose is produced from dgalactose catalyzed by larabinose isomerase.8 formulae of aldoses available from biomass, epimeric aldoses, and ketoses. furthermore, epimerization of biomassderived monosaccharides at the c2 position gives rise to rare monosaccharides with interesting properties. for example, dlyxose, darabinose, and dtalose can be used as starting materials for the synthesis of antitumor agents.9 the d epimers of saccharides dominate in nature with the exception of larabinose, which is available from hemicelluloses. consequently, larabinose can be used as a substrate for the synthesis of rare lmonosaccharides. for instance, epimerization of larabinose enables synthesis of lribose, which is in high demand in medical chemistry for the synthesis of potent agents against the hepatitis b virus as well as the epstein barr virus.10 considering that epimerases are only active on sugars substituted with phosphate or nucleotide groups, efficient chemocatalytic systems for the direct epimerization of monosaccharides are of upmost importance.11 in addition to isomerization into 2ketoses and c2 epimerization processes, the synthesis of other isomers is potentially of industrial relevance. for example, catalytic activity of ti zeolite was reported for the isomerization of dglucose into lsorbose with 73 % enantiomeric purity.12 lsorbose is an important intermediate for the production of vitamin c. currently, lsorbose is manufactured from dglucose by means of a complex multistep biotechnological process.2a isomerization of glucose into fructose is an important example of an isomerization process implemented on an industrial scale.2a, 13 though fructose is present in nature as a monomer of inulin or levan, the biotechnological production of fructose by glucose isomerization appears to be more economically attractive. currently, fructose is produced mostly as a part of high fructose syrups (hfss) employed as sweeteners. the manufacture of hfss is a multistep process that includes : (1) enzymatic hydrolysis of starch to release glucose ; (2) isomerization of glucose in the presence of immobilized dxylose ketoisomerase ; (3) chromatographic enrichment to produce hfs90 containing 90 % fructose and 10 % glucose.2a, 13, 14 the immobilization of dxylose isomerase together with the elaboration of the respective separation technology has enabled the continuous commercial production of fructose since the launch of this process in 1967.15 today, dxylose ketoisomerase remains one of the largest biocatalytic processes13 owing to the high demand for sweet hfss. in 2006, the annual worldwide production of fructose was estimated by lichtenthaler to be approximately 60 000 metric tons.2a recently, research interest in fructose has increased, because it is regarded as a key intermediate for the valorization of cellulosic biomass. it was demonstrated that fructose can be readily converted into hmf16 and further into valuable products such as fuels and monomers for biomassbased polymers.1b, 5, 6, 16d, 17 in this context, the enzymatic production of fructose appears to be expensive owing to the high cost and the low stability of the enzymes, the need for highly pure glucose, and the use of buffer solutions. this has propelled extensive research with the aim to develop suitable chemocatalysts for the isomerization of glucose into fructose. in this review the first and the second sections of this review are focused on the isomerization of aldoses into c2 ketoses in the presence of basic and lewis acidic catalysts, respectively. this direction of research was previously reviewed by zakrzewska.18 in what follows, monosaccharides mentioned without specifying epimeric configuration refer to the d enantiomers. bases were the first chemocatalysts that were uncovered for the isomerization of carbohydrates as long ago as 1885. this basecatalyzed isomerization is also named after the discoverers of this reaction, that is, the lobry de bruyn the isomerization of an aldose results in the formation of a ketose and an epimeric aldose, but the isomeric ketose is usually formed in higher amount (figure 3). isomerization of aldoses catalyzed by bases via the enediol anion.19 early investigations mainly involved the use of soluble alkalis, such as sodium hydroxide or calcium hydroxide, operating at high ph values and room temperature.19, 20 under these conditions, the reaction suffers from a low rate of isomerization and the formation of numerous acidic byproducts. the formation of acidic compounds is also catalyzed by bases, which promote the isomerization of saccharides into oligomeric acidic products, saccharinic acids, or lactic acid.21 this leads to low carbon efficiency as well as neutralization of the basic catalyst by acidic byproducts. additionally, dehydration and condensation of the byproducts result in a strong darkening of the reaction solution. this strong coloration is indicated as one of the reasons why alkali catalysts are regarded as inappropriate for fructose production in the food industry.13 later on, the utilization of organic bases, for example, triethylamine, was shown to improve the selectivity.20a amines have been confirmed to be efficient catalysts for the isomerization ; moreover, the degradation of saccharides in the presence of amines is much slower than that over inorganic bases. in 2001, angyal summarized the main results on the isomerization of saccharides over soluble bases.22 table 1 presents an overview of literature data on isomerization over base catalysts. though isomerization in the presence of soluble bases does not result in a high yield of a product, the yield can be significantly improved by adding borates, boronates,26, 27 or aluminates.28, 35 for instance, mendicino reported an 85 % yield of fructose by glucose isomerization in the presence of borates and naoh.26 the yield increases owing to in situ complexation of fructose under basic conditions. numerous patents have appeared on the isomerization of glucose promoted by complexation of fructose, and this highlights the great commercial interest in such an approach. for instance, good yields of ketoses have been reported in the presence of aluminate resins to facilitate a 72 % yield of fructose36 and in the presence of poly(arylboric acid) resins and naoh to give fructose in 57 % yield.27 a combination of amines with boric acid gives rise to dfructose and dtagatose with yields up to 63 and 52 %, respectively.37 more recently, despax. revisited sodium aluminate as a catalyst for glucose isomerization into fructose.29 fructose yields of 40 and 49 % are reported for aqueous and organic solvents, respectively. [a ] conversion (x), selectivity (s), and yield (y) are given for fructose formation ; n.d.=not determined. [b ] mass ratio : initial mass of glucose divided by mass of catalyst. [e ] magnet base catalyst : tetramethylguanidine (tmg) immobilized onto silicon dioxide coated magnetic iron oxide. the reason for the improved yield of fructose in the presence of complexing anions has been discussed in literature. enhanced yields are explained by complexation of fructose with an anion, for example, borate or aluminate.36 it is well known that borates form more stable complexes with ketoses than with aldoses.38 in situ complexation of fructose enables higher yields owing to a decrease in the ketose concentration, which results in a shift in the glucose fructose equilibrium towards fructose, and owing to the prevention of fructose degradation as a result of the increased stability of the obtained complexes relative to that of pure fructose. current investigations mainly focus on elaborating chemocatalytic processes to substitute the biotechnological process for the isomerization of glucose into fructose. in this respect, materials such as hydrotalcites,30, 31, 32, 33, 39 immobilized amines,34 zeolites in alkalineexchange form,30, 40 mesoporous ordered molecular sieves of the m41s family,41 zirconium carbonate,42 and anionexchanged resins43 have been reported as efficient solid base catalysts. in the interest of productivity, the experiments are conducted at elevated temperatures, though saccharides, especially ketoses, are not stable under harsh conditions.34, 44 therefore, isomerization is usually performed at temperatures not exceeding 110120 c. owing to good solubility, water is a solvent of choice for saccharides, though polar organic solvents, such as dmf,31, 32, 39b dmso,29 dmso / ethylene glycol,29 and dmso / propylene glycol,29 have also been utilized. interestingly, a solvent can potentially influence the kinetics of isomerization over a solid base, analogously to what was uncovered for glucose isomerization in the presence of naoh. thus, the isomerization rate is 2.4 times higher for a water / ethanol (30:70) mixture than for pure water. this can be explained by the greater ionization constant of glucose in the water / ethanol mixture (ionization of glucose as a step of the isomerization mechanism is discussed below).45 the kinetics of isomerization in the presence of solid bases resembles that over soluble bases. thermodynamics predict a fructose yield of approximately 50 % based on glucose (not taking into account mannose).46 in the presence of epimerases under physiological conditions, the equilibrium of glucose / fructose / mannose corresponds to 41:41:18.47 el khadem. have investigated the isomerization of hexoses in the presence of koh as a catalyst, and they report different compositions of the final mixture when starting from an aldose, an epimeric aldose, or an isomeric ketose. for instance, the distributions of obtained monosaccharides upon starting from glucose, mannose, and fructose are shown in table 2. very similar results are reported for glucose isomerization in the presence of other soluble and solid catalysts, that is, the yield of fructose does not usually exceed 35 %.24, 30, 31, 32, 33, 34, 39a, 39c, 41, 42, 44, 48 composition of glucose / fructose / mannose mixtures obtained starting from different isomers in the presence of koh.49 cationexchanged zeolites demonstrate high activity and selectivity for the isomerization of glucose30, 39a as well as disaccharides such as lactose, cellobiose, and maltose.40 shukla. at the same time, degradation of the saccharides over zeolites is much slower than that over soluble naoh. thus, the disaccharides degrade as much as 5562 % in the presence of naoh, but the substrate decomposes by only 1013 % over zeolites under the same reaction conditions.40 the catalytic activity decreases in a row : naa > nax > nay, that is, lower si / al ratios provide higher concentrations of basic sites and greater activity.30, 40 considering the exchanged cation, the following series of activity is observed for the isomerization of glucose : ca alcl3>sncl4.57 insight into the structure of the active species for crcl3 has been provided by choudhary. through the use of computational methods and extended xray absorption fine structure (exafs). they note that a partially hydrolyzed [cr(h2o)5(oh) ] cation is responsible for the isomerization of glucose into fructose.81 interestingly, the crcontaining metal organic framework mil101 demonstrates comparatively low catalytic activity for isomerization.85 tang. have demonstrated that [al(oh)2aq ] are the active centers for isomerization in the presence of aluminum salts in water.57 analogously to catalysis by sn, isomerization of glucose over soluble lewis acids proceeds by c2c1 hydride shift as a ratelimiting step.57, 81 choudhary. have performed a comparative study and have identified a similar reaction mechanism for the isomerization of glucose over solid (sn) and soluble (alcl3 and crcl3) lewis acids.81 it is suggested that an oh group on the metal center assists in the deprotonation step57, 68b, 81, 86 (figure 11). mechanism of glucose isomerization into fructose in the presence of soluble lewis acids.57, 68b, 81 an advantage of isomerization in the presence of lewis acids is compatibility of these catalysts with brnsted acids. for example, glucose can be isomerized over a lewis acid to obtain fructose, and subsequent dehydration of fructose catalyzed by h yields hmf.6j, 16d analogously, a onepot process starting from xylose to yield furfural has been reported.7 interestingly, both solid and soluble lewis acids have been proposed for such onepot reactions. crcl3,81 alcl3,87 and lanthanide salts88 have been intensively studied for the onepot conversion of glucose into hmf. a number of reports consider combinations of brnsted acids with solid lewis acids including sn,7 nb2o5 n h2o,89 crbased heteropoly acid ionic crystal,90 ti phosphates,91 and dealuminated zeolite.92 nevertheless, there are some concerns regarding the longterm stability of zeolites in hot water in the presence of brnsted acids and salts.93 epimerization of aldoses at the c2 atom (figure 1) has received much less attention than their isomerization into ketoses. in fact, to date only a few chemocatalytic systems have been uncovered for selective epimerization. as mentioned in sections 2 and 3, epimerization takes place in the presence of basic catalysts, as well as lewis acids (table 4). however, in both cases, formation of ketoses predominates (tables 1, 23). if catalyzed by a base, isomerization takes place via an enediol intermediate, as shown in figure 3. prevailing formation of ketoses over epimeric aldoses has been explained by de wit in terms of entropy of activation. thus, glucose isomerization into fructose requires little reorganization of the intermediate, whereas formation of mannose takes place through rotation around the c2c3 bond (figure 3).19 the rotation is connected with substantial reorganization of the water shell, and thus, mannose is formed more slowly than fructose.19 literature data on the catalytic epimerization of aldoses. [a ] all results are for reactions performed in aqueous media. [b ] conversion (x), selectivity (s), and yield (y) are given for c2 epimeric aldose. [c ] mass ratio : initial mass of substrate divided by mass of catalyst. [d ] molar ratio of initial substrate amount to amount of metal ions. the calciumcatalyzed epimerization was discovered by kusin in 1936.94 much later, this process was revisited and investigated by yanagihara.95, 101 and angyal.102 it has been suggested that, under alkaline conditions, glucose forms complexes with selected cations, such as ca, la, and nd.95, 101, 102 angyal supposes a rare tetradentate coordination of glucose to the metal center.102 the epimerization catalyzed by metal ions proceeds through rearrangement of the carbon chain, as shown in figure 12 a. the bond of c3 migrates from c2 to c1 to give rise to an inverted configuration at c2. the cacatalyzed epimerization requires a threo configuration at c3 and c4, which limits the substrate scope of this reaction. more details on this epimerization can be found in a literature survey reported by angyal.22 in addition, aldoses can be epimerized by reaction systems containing a nickel complex with diamine ligands.103 this epimerization proceeds through formation of a ternary nickel / amine / saccharide complex intermediate103b through the carbon shift illustrated in figure 12 a.104 the reaction system proves to be feasible for epimerization of a variety of aldose substrates, which was recently comprehensively reviewed by osanai.104 herein, we would like to point out an interesting peculiarity of nicatalyzed epimerization. however, only nickel complexes with hydrophobic ligands (i.e., with alkyl chain lengths > c10) exhibit catalytic activity in aqueous media, whereas complexes with hydrophilic ligands are completely inactive. it has been shown that ni complexes bearing hydrophobic ligands agglomerate in water to form metallomicelles.96 the hydrophobic environment of these metallomicelles plays a crucial role in catalysis, in line with the recently uncovered high importance of hydrophobic pores of sn (section 3). mechanism of glucose epimerization into mannose by a) carbon shift and b) two successive hydride shifts. epimerization through the formation of molecular complexes with ca or ni / amines exhibits a number of advantages, including very mild reaction conditions. indeed, the reaction can be completed at 65 c in 1015 min.22, 104 additionally, epimerization proceeds by complexation, and the yield of the product is limited by the thermodynamics of the complexes, not the saccharides. consequently, the use of an excess amount of the complexing agent enables thermodynamically predicted yields to be surpassed. for instance, the thermodynamic equilibrium of mannose / glucose is approximately 28:72, but mannose yields above 50 % have been reported in the presence of ca(oh)2 102 and ni / amine.103a at the same time, it should be noted that epimerization by molecular complexes utilizes an equimolar or higher amount of the complexing metal with respect to the substrate concentration. if lower amounts of ca(oh)2 are used, isomerization yielding a ketose predominates in the obtained alkaline medium.22 brunner and opitz have reported a significant decrease in the catalytic activity of ni / amine upon using substoichiometric quantities of catalysts. thus, mannose yields drop from 47 % for a glucose / nickel molar ratio of 1:1 to 10 % for a glucose / nickel molar ratio of 10:1.105 in this respect, discovery of an efficient molybdenum catalyst by blik in the 1970s has attracted much attention. the epimerization takes place under mild reaction conditions, that is, the reaction equilibrium in 1020 wt % aqueous solution of a substrate is usually reached after 26 h at 7090 c by utilizing 0.10.2 % molybdic acid.106 the reaction is very sensitive to the ph of the solution, and the highest epimerization rate is obtained in the ph range of 1.5 to 3.5. the epimerization follows the carbonshift mechanism (figure 12 a) through coordination of a substrate toward a mo dimer. interestingly, the epimerization of aldoses by carbon shift is sometimes referred to as the blik mechanism or the blik reaction. a wide scope of substrates can be epimerized in the presence of molybdenum catalysts, though some limitations for substrates have been reported. the substrate should have a carbon chain length of at least four carbon atoms with hydroxy groups at c2, c3, and c4. importantly, the blik reaction was very quickly scaled up to a pilot plant running in bratislava. a large number of publications and patents focusing on blik epimerization highlight the great commercial importance of this process. given that the early literature was thoroughly reviewed by petru.,106 herein, we concentrate on more recent publications. have performed a computational study explaining the dependence of the rate of epimerization on the ph. they have found that under optimized conditions (ph 1.53.5), the concentration of the dimeric mo species is maximal.107 ju. have recently reported the high catalytic activity of molybdenumbased polyoxometalates for the epimerization of glucose. the catalytic activity of h3pmo12o40, ag3pmo12o40, and sn0.75pmo12o40 has been demonstrated.99 a onepot process combining hydrolysis of starch and glucose / mannose epimerization has been performed by hricovniov. an equilibrium mixture of glucose and mannose was obtained.108 numerous efforts have been made to produce solid catalysts containing molybdenum(vi) species to perform epimerization continuously. for instance, immobilization of molybdate species on ionexchange resins has been performed.109 kckritz. have studied the longterm stability of immobilized molybdates with 800 h on stream. a slow decrease in catalytic activity has been observed mostly because of leaching of the active species into the liquid phase.110 additionally, heptamolybdate exchanged on quaternary ammonia modified sba15type mesoporous silica exhibits good activity and stability.111 takagaki. epimerization of cellobiose, which leads to an equilibrium mixture of glucose and mannose.100 noteworthy, some authors have reported the reduction of mo species during epimerization.99, 110 nevertheless, the catalyst can be reoxidized upon treatment with dilute h2o2 solution.110, 112 lewis acids catalyze epimerization, but the selectivity for epimeric aldose is low compared to that of the ketose (table 3). suggest that glucose epimerization into mannose over sn takes place by two consecutive hydrogen shifts (figure 12 b).76 notably, this mechanism occurs over the open sites of sn, that is : (1) if no salt is added to the reaction mixture to exchange the protons of the silanol groups with cations ; (2) water or methanol is used as the solvent ; (3) fructose is produced as the major product. computational studies confirm that the energetically favored formation of mannose proceeds over the open sites of sn through two hydride suggest the formation of lyxose during isomerization of xylose to proceed through a similar pathway with the same intermediate for xylulose and lyxose formation.68c in fact, sn can be used as a selective catalyst for preferential epimerization if used in combination with salts. report the selective aqueousphase epimerization of glucose, mannose, xylose, and arabinose catalyzed by sn+sodium borate { with molecular formula na2[b4o5(oh)4] 8 h2o}.98, 114 the epimerization takes place through carbon shift (figure 12 a). under the same reaction conditions without sodium borate, formation of ketoses dominates over epimerization. it is suggested that complexation of the borate anion with saccharides leads to a change in the reaction mechanism. saccharide complexes confined in the pores of sn has been confirmed by means of solidstate nmr spectroscopy.98 calculations performed by using density functional theory suggest that a glucose complex with tetrahedral borate inhibits competitive isomerization.115 more recently, bermejodeval. have demonstrated that epimerization of glucose into mannose through carbon shift also takes place over naexchanged sn.76 the postsynthetic exchange of the protons of the silanol groups with na leads to the prevailing formation of mannose in both water and methanol as solvents. this effect has also been suggested by rai., who used a computational approach. if the silanol group adjacent to a sn metal center does not participate in the transition state, carbon shift is predicted to become a more energetically favorable mechanism (figure 8 right).74 nevertheless, sodiumexchanged sn is unstable and leaching of na into solution is observed during the course of the reaction.76 summarizing the recently published literature on the isomerization of monosaccharides, a few breakthroughs can be highlighted. first, the catalytic performance of solid bases appears to be outstanding compared to that of soluble bases, especially in terms of selectivity for ketoses. though the catalytic activity of basic catalysts for isomerization has been known for more than a century, the application of basic catalysts on a commercial level has been hindered mostly because of low selectivity. the good catalytic performance of solid bases is indicative of the high potential of these materials. second, the discovery of lewis acids with high catalytic activity in the aqueous phase has significantly broadened the range of catalysts for the transformation of monosaccharides. the superior catalytic performance of sn zeolite is a fascinating example of a chemocatalyzed reaction occurring through a concerted mechanism, analogously to enzymatic catalysis. so far, catalytic systems for the isomerization of dglucose into dfructose (sn), lsorbose (ti), and dmannose (sn+sodium borate) have been uncovered. we are convinced that ongoing intensive work in this area will result in new interesting catalytic systems for the isomerization of monosaccharides in the near future. as an outlook the longterm stability of catalysts for isomerization is of great interest, as porous catalysts are expected to be influenced by hot water. therefore, investigation of the catalytic isomerization processes under continuous conditions will be informative in terms of catalytic activity and selectivity as a function of time on stream. additionally, the majority of investigations currently report on isomerization leading to equilibrium mixtures of isomers. however, efficient recovery of individual substances from these mixtures is crucial, as recovery and purification processes can be limiting factors for process economy, even if catalysis is very efficient. finally, insight into the structure of the active species as well as the isomerization mechanisms and reaction networks will facilitate the establishment of structure activity relationships. we believe that addressing these challenges will accelerate the implementation of newly discovered catalytic processes on a commercial level. irina delidovich received her diploma in chemistry in 2008 from the novosibirsk state university. in 2011 degree from the boreskov institute of catalysis (bic) under the supervision of professor oxana taran. during her stay at bic (20062012), she worked on the aldol addition and selective oxidation of carbohydrates. since 2012, she has been conducting studies on the conversion of cellulosic biomass in the research group of prof. her scientific interests include the synthesis and characterization of solid catalysts as well as catalytic transformations of saccharides. regina palkovits is a full professor for heterogeneous catalysis & chemical technology at rwth aachen university. she graduated in chemical engineering from the technical university dortmund and carried out her ph.d., she returned as a group leader to the maxplanckinstitut fr kohlenforschung, and since 2010, she has been a professor at rwth aachen university. | abstractselected aldohexoses (dglucose, dmannose, and dgalactose) and aldopentoses (dxylose, larabinose, and dribose) are readily available components of biopolymers. isomerization reactions of these substances are very attractive as carbonefficient processes to broaden the portfolio of abundant monosaccharides. this review focuses on the chemocatalytic isomerization of aldoses into the corresponding ketoses as well as epimerization of aldoses at c2. recent advances in the fields of catalysis by bases and lewis acids are considered. the emphasis is laid on newly uncovered catalytic systems and mechanisms of carbohydrate transformations. |
under the new naming system the salmonella enterica serovar gallinarum is divided into biovar gallinarum (s. gallinarum) and pullorum (s. pullorum), which are identified to cause fowl typhoid and pullorum disease in poultry, respectively. while fowl typhoid is a disease of mature birds, pullorum causes mortality of embryos and chicks. infection with these pathogens is responsible for considerable economic losses in poultry production (1, 2). among diseases of poultry, salmonellosis is of great concern and has been responsible for serious economic losses of poultry producers (3). s. gallinarum and s. pullorum are non - motile, host adapted avian pathogens belonging to salmonella serogroup d (4, 5). s. gallinarum and s. pullorum are very similar from the point of view of their antigenic structure ; however they are responsible for distinctly different diseases in chicken (2, 6). some countries are considered free of s. gallinarum and s. pullorum ; however, infections are still sometimes reported, and are a matter of concern for the poultry industry (4, 6). salmonella control efforts are complicated due to their sporadic and uneven distribution (7). specific characterization of salmonella isolates is therefore extremely important in order to attribute an isolate to a previously known epidemic outbreak (5). although conventional kaufmann white scheme is still the only reliable method for serotyping of salmonella, it can not differentiate between closely related biotypes, such as s. gallinarum and s. pullorum (4, 5). however, biochemical characteristics take approximately five to seven days and are very time - consuming. recently, biochemical methods have been complemented by dna - based molecular techniques, because of their sensitivity and specificity. such methods include restriction fragment length polymorphism (rflp), which is sometimes associated with pcr (pcr - rflp), ribotyping, pulse field gel electrophoresis (pfge) and variable number tandem repeat (vntr) (8 - 10). pcr- rflp is considered as a rapid test with good reproducibility for molecular typing in bacterial epidemiological studies (11). many researchers have focused on flagellin genes for salmonella subtyping because most of them possess the two structural genes (flic and fljb) that contain a hypervariable central region and a conserved flanking dna region. the hypervariable central region of salmonella flagellin genes makes it possible to differentiate the salmonella isolates by the pcr- rflp technique. many studies used part i of the gene that encodes flagellin (flic) to differentiate serotypes. most salmonella strains have two structural genes (flic and flib) that encode flagellins. non - motile strains generally exhibit these structural genes, but are unable to build up a functional flagellum (13, 14). s. gallinarum and s. pullorum have been reported to possess phase 1 flagellin c gene (flic) (13 - 15). there are no data from epidemiological studies of s. gallinarum and s. pullorum isolates based on molecular typing in iran. thus these data could be helpful in this regard and also for the rapid detection of these bacteria. the aim of the present study was to differentiate s. gallinarum and s. pullorum isolated in iran, based on the pcr - rflp method and the hinp1i enzyme. s. gallinarum (n = 10) and s. pullorum (n = 3) isolates used in this study were from clinical samples of chickens kept at the microbiology department of razi vaccine and serum research institute of karaj (rvsri). s. gallinarum (atcc 9184) and s. pullorum (atcc 9120) were used as positive controls and s. enteritidis (atcc 13076) was used as a negative control. all isolates were cultured on macconkey agar (merck, germany) for 24 hours at 37c. briefly, for each isolate, a loopful of an overnight pure culture of bacteria was transferred into 1 ml of tris - edta (te) buffer 1x, boiled at 95c for 10 minutes then centrifuged at 17900 g (10 minutes, 4c), followed by addition of 1 l proteinase k (fermentase, inc., the netherlands) to the supernatant. specific primers, ctggtgatgacggtaatggt (flicf : 866 - 885) and cagaaagtttcgcactctcg (flic r : 1063 - 1044), were used for the amplification of flagellin gene phase 1 (flic) (13, 14). a reaction mixture containing, 5 l of ultra - pure water (gibco, germany), 9 l of primix (ampliqon, denmark), 2 l of dna and 1 l of each primer, was prepared. the thermocycler was programmed with 1 cycle of 94 c for 5 minutes, 35 three - step cycles ; denaturation at 94c for 1 minute, annealing at 58c for 1 minute, extension at 72c for 1 minute, and a final cycle at 72c for 10 minutes. the pcr products were electrophoresed on 1% agarose gel for 1 hour at 60 v (16). the digestion solution was prepared with 10 l of the pcr product, 2 l of hinp1i buffer (10x), 1 l of hinp1l enzyme (fermentas inc. the netherlands) and 17 l of ultra - pure water (gibco, germany). after incubation at 37c for 16 hours, rflps were determined by electrophoresis of the digested dna on 2% agarose gel for 2.5 hours at 60 v (16). sizes of the products were analyzed and compared with the 100 bp plus dna ladder (fermentas inc. s. gallinarum (n = 10) and s. pullorum (n = 3) isolates used in this study were from clinical samples of chickens kept at the microbiology department of razi vaccine and serum research institute of karaj (rvsri). s. gallinarum (atcc 9184) and s. pullorum (atcc 9120) were used as positive controls and s. enteritidis (atcc 13076) was used as a negative control. all isolates were cultured on macconkey agar (merck, germany) for 24 hours at 37c. bacterial dna was prepared as described by paiva. (13) with some modifications. briefly, for each isolate, a loopful of an overnight pure culture of bacteria was transferred into 1 ml of tris - edta (te) buffer 1x, boiled at 95c for 10 minutes then centrifuged at 17900 g (10 minutes, 4c), followed by addition of 1 l proteinase k (fermentase, inc., the netherlands) to the supernatant. specific primers, ctggtgatgacggtaatggt (flicf : 866 - 885) and cagaaagtttcgcactctcg (flic r : 1063 - 1044), were used for the amplification of flagellin gene phase 1 (flic) (13, 14). a reaction mixture containing, 5 l of ultra - pure water (gibco, germany), 9 l of primix (ampliqon, denmark), 2 l of dna and 1 l of each primer, was prepared. the thermocycler was programmed with 1 cycle of 94 c for 5 minutes, 35 three - step cycles ; denaturation at 94c for 1 minute, annealing at 58c for 1 minute, extension at 72c for 1 minute, and a final cycle at 72c for 10 minutes. the pcr products were electrophoresed on 1% agarose gel for 1 hour at 60 v (16). the digestion solution was prepared with 10 l of the pcr product, 2 l of hinp1i buffer (10x), 1 l of hinp1l enzyme (fermentas inc. the netherlands) and 17 l of ultra - pure water (gibco, germany). after incubation at 37c for 16 hours, rflps were determined by electrophoresis of the digested dna on 2% agarose gel for 2.5 hours at 60 v (16). sizes of the products were analyzed and compared with the 100 bp plus dna ladder (fermentas inc. in this study, the 197 bp fragment of the flic gene was amplified from 10 s. gallinarum and three s. pullorum and no variation in gene size was detected according to gel electrophoresis (figure 1). sp : lanes 1 to 3 ; sg : lanes 4 to 12, nc : negative control (s. enteritidis). digestion of s. gallinarum amplicons with hinp1i yielded two bands, of 82 and 115 bp, while no change in s. pullorum amplicons was observed, since no digestion occurred (figure 2). m : 100 bp marker plus dna ladder (fermentas inc.) ; lane 1 : s. pullorum positive control ; lane 2 : s. gallinarum positive control ; lanes 3, 4, 5, 7,8,10 and 12 : s. gallinarum isolates ; lanes 6, 9, and 11 : s. pullorum isolates. in this study, the 197 bp fragment of the flic gene was amplified from 10 s. gallinarum and three s. pullorum and no variation in gene size was detected according to gel electrophoresis (figure 1). sp : lanes 1 to 3 ; sg : lanes 4 to 12, nc : negative control (s. enteritidis). digestion of s. gallinarum amplicons with hinp1i yielded two bands, of 82 and 115 bp, while no change in s. pullorum amplicons was observed, since no digestion occurred (figure 2). m : 100 bp marker plus dna ladder (fermentas inc.) ; lane 1 : s. pullorum positive control ; lane 2 : s. gallinarum positive control ; lanes 3, 4, 5, 7,8,10 and 12 : s. gallinarum isolates ; lanes 6, 9, and 11 : s. pullorum isolates. s. gallinarum and s. pullorum have been known as important bacterial pathogens in chicken (2, 6). these serovars can not be distinguished by conventional serological methods and biochemical tests are currently complemented by molecular techniques based on flic and flib genes that encode flagellins (13). there has not been any research on molecular typing of s. gallinarum and s. pullorum in iran. in the study of hong., the pcr- rflp flagella typing scheme was successfully applied for serotype identification of 112 salmonella isolates obtained from poultry and poultry environments (17). also, our methods were successful in differentiating these two biotypes by pcr- rflp. they showed that pcr - rflp with hinp1i was successful in differentiating the two biotypes. these results suggested that the variable regions of flic could be used as a genetic marker and allow differentiation of these biotypes from each other and pcr - rflp with hinp1i for these biotypes is a valuable tool for identification of non - motile serotypes of salmonella (14). our study was done on ten s. gallinarum and three s. pullorum and the same result was obtained using hinp1i enzyme. in another study, practical application of restriction patterns of flic gene using a mixture of endonucleases (taqi and scai) to differentiate s. gallinarum and s. pullorum was performed. according to their results this method with the used enzymes was not useful to differentiate s. gallinarum from s. pullorum (15) but in our study a different enzyme, hinp1i, could differentiate these two biotypes. in the kisiela. the results obtained from our research and theirs showed that fimh and flic gene with restriction enzyme scai and hinp 1i could differentiate s. gallinarum from s. pullorum. in another investigation done by paiva. pcr amplicons (197 bp) of 14 s. pullorum and 22 s. gallinarum that had various results on biochemical tests, were digested with the hinp1i enzyme and the same results were obtained. in our research the bacterial isolates had different results for biochemical tests but the same pattern for pcr - rflp (13). a study done by menghistu. (8) on s. gallinarum showed three patterns in 12 s. gallinarum isolates by pcr - rflp using the restriction enzyme alui. our results showed that the hinp1i enzyme could be the same as alui in such investigation to identify s. gallinarum from s. pullorum. in the present study, we were able to demonstrate that the use of flic gene restriction patterns is a useful method for allowing the differentiation between s. gallinarum and s. pullorum isolated in iran ; including those with atypical biochemical behavior. therefore, our results support that this method may be adopted to differentiate s. gallinarum from s. pullorum. several sequences of the gene encoding phase 1 flagellin (flic) are available (19, 20). the distal parts of the flic alleles are conserved regions, making this gene in any serotype suitable for easy amplification, whereas the central region of the flic gene is hyper variable, making it a target for differentiation among salmonella serotypes (14, 15). s. gallinarum and s. pullorum flic gene represent allelic variants and differ only in two codons, including 316 and 339, which shows that the hinp1i enzyme recognizes one cleavage site in s. gallinarum (codon 316), but not in s. pullorum (14, 21). in the present study by using the applied technique since s. gallinarum and s. pullorum are important in industry, thus the accurate identification of them with molecular technique can be effective in this area. our literature review in iran showed that there is n't any publication in this field. also our results demonstrated that pcr - rflp with flic gene and hinp1i endonuclease could be effective in detecting s. gallinarum and s. pullorum. the result indicated that there was no limitation in this technique for differentiation of these biotypes. | background : salmonella spp. is the major bacterial pathogen in poultry and is responsible for significant economic losses of the poultry industry in many parts of the world. among salmonella spp., salmonella gallinarum and salmonella. pullorum are the most common causative agents of chicken salmonellosis resulting in high mortality and morbidity.objectives:the aim of this study was to identify s. gallinarum and s. pullorum by using the polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) method.materials and methods : in this study, 13 samples of salmonella, isolated from local poultry, were obtained from razi type culture collection (rtcc). for the pcr - rflp method based on the flic gene, extracted dna was used as a template for amplifying of the flic gene (197bp) using specific primers. pcr products were subjected to digestion using hinp1i restriction endonuclease.results:for the pcr, 197 bp flic fragment was amplified from all 13 isolates. ten out of 13 were s. gallinarum and the other three were s. pullorum. as part of the pcr - rflp, two fragments were obtained (82 bp and 115 bp) for all s. gallinarum, whereas no digestion was observed in s. pullorum, and 197 bp fragment was seen.conclusions:pcr-rflp with flic gene and hinp1i endonuclease were successfully applied to differentiate the two biotypes. the results suggested that this technique could be effective in detecting s. gallinarum and s. pullorum. |
the growing number of aged people in western countries carries with it an increase in age - related disorders. among these, alzheimer s disease (ad) is the most serious because of its epidemiologic, economic, and social impact. for instance, in italy, families are the main source of care, providing daily assistance to persons with dementia. data from the italian statistical institute1 report that the majority of patients with dementia (80%) live at home, where informal care (unpaid and not professionally trained) is given in about 70% of cases by female relatives, whose burden and stress become heavier as the disease progresses. within the family context, the challenges faced by caregivers contribute heavily to the psychologic, physical, and financial burden.2 in caregivers, this is often associated with clinically significant anxiety (10%35%) and depression (10%34%).3 the role of chronic distress may also contribute to worsening the physical health status of caregivers, by increasing their vulnerability to develop diseases and reducing life expectancy itself.4,5 these findings are also confirmed by data from a study of a large sample of us caregivers,6 which indicate a high prevalence of hypertension among caregivers, associated with an increased risk of cardiovascular disease. the caregiver s condition should be seen as a paradigm of the general adaptation syndrome.7 in this framework, stress may be viewed as a general and nonspecific biological response of the whole body. this response appears when requests from the environment exceed the subject s resources. in this perspective, a great deal of attention has been given to the study of coping strategies adopted by the subject when having to face distressing situations.811 coping may be defined as a process of adaptation to stressful situations, which includes the allocation of cognitive and behavioral resources in response to specific internal and/or external demands that are deemed to exceed the subject s normal requests.12 although there is some disagreement about how coping strategies may be categorized,10 coping may be classified into three broad main types, ie, task - focused, emotion - focused, and avoidance - focused strategies.9,13 task - focused coping seeks to actively perform a task that will remove the problem or make the problem better ; typically, if the frequency of task - focused coping increases, the distress decreases.13,14 emotion - focused coping seeks to regulate distressing emotions and can include emotional expression, fantasizing, and reflecting on positive or negative thoughts.15 avoidance - focused coping involves avoiding the adverse situation, and includes social diversion.14 several studies have shown that emotion - focused and avoidance - focused coping strategies may be dysfunctional, since they divert from understanding or managing requests, with the consequence of increased physiologic and psychologic distress.9,1416 as far as the role of coping strategies in ad caregivers is concerned, some studies have highlighted the role of effective coping in reinforcing cohesion and improving relationships within the family context.1720 other studies have pointed out the negative impact of caregiving on health status and psychologic conditions.11,2123 it has also been shown that in ad caregivers there is an association between coping styles and stress levels.10,11,24,25 in particular, dysfunctional coping, mainly underlying avoidance strategies, would be associated with the development of burnout and high levels of sadness. on the other hand, effective and adaptive coping strategies may play a protective role in reducing the caregiver s distress.26 these findings receive further support from other studies showing that an approach based upon task - focused strategies may help to reduce physiologic stress.27 finally, a longitudinal study reported that emotion - focused coping strategies could prevent the development of high levels of anxiety11 and depression.28,29 the aim of the present study is to describe the relationships between psychologic distress and coping strategies adopted by a group of caregivers of persons with ad. to this end, we evaluated the burden and anxiety experienced by caregivers, the relationship between distress and sociodemographic and clinical variables, the type and effectiveness of the coping strategies adopted by caregivers, and the relationships between coping strategies and both burden and anxiety. the study involved a sample of 86 caregivers of corresponding patients with ad (national institute of neurological and communicative disorders and stroke and the alzheimer s disease and related disorders association [nincds - adrda ] criteria),30 seen consecutively at the memory clinic of the neurological unit of aorn cardarelli hospital in naples. inclusion criteria were being a relative of the patient and having constant, daily contact with the patient. conversely, persons not fulfilling such criteria, namely professional caregivers, were not considered for inclusion in the study. all subjects gave their informed consent to the study, which was carried out according to the declaration of helsinki and approved by the local ethics committee. autonomy in activities of daily living in all the patients was assessed using the barthel index.31 the barthel index is a 10-item self - report and the total possible score ranges from 0 to 100, with lower scores indicating increased disability.31 all caregivers underwent a semistructured interview, the aim of which was to evaluate burden and anxiety by means of the caregiver burden inventory (cbi)32 and the state - trait anxiety inventory (stai y-1 and y-2).33 coping strategies were evaluated by the coping inventory for stressful situations (ciss).34 the cbi consists of five sections evaluating the impact of caregiving on the caregiver : time - dependence burden, which gives a measure of flexibility with time and caregiver s time restriction ; developmental burden, which evaluates the impact of failing to catch opportunities and pursue goals ; physical burden, a measure of the physical consequences of caregiving (eg, fatigue and somatic complaints) ; social burden, which assesses the impact on interpersonal and social relationships within the family and working environment ; and emotional burden, which evaluates feelings of shame and embarrassment with respect to the patient. each dimension consists of five items, and the score for each item ranges from 0 (factor with a minimum value) to 4 (factor with a maximum value), giving a total that ranges from 0 to 20 for each dimension with the exception of the physical burden, which has four items and a correction factor of 1.25 must be applied. the total score ranges from 0 to 100, and the scores grow proportional to the severity of the problem perceived by the caregiver.32 the stai is a validated tool to evaluate anxiety. it includes two dimensions, ie, state anxiety (y-1), which evaluates the emotional state of an individual in a particular situation, and trait anxiety (y-2), which refers to a relatively stable characteristic of personality. it is based on a 4-point likert scale and consists of 40 questions on a self - report basis. the total score of each dimension ranges from 20 to 80, but the significant scores are equal or greater to the 95th percentile.33 the ciss is a 48-item self - report and has been developed to describe cognitive styles and behavioral resources in response to a specific stressor. it assesses three coping strategies : task - oriented coping (16 items), which refers to purposeful efforts aimed at solving and/or restructuring the problem in an attempt to improve the situation ; emotion - oriented coping (16 items), which refers to self - oriented reactions including emotional responses, self - preoccupation, and fantasizing ; and avoidance - oriented coping (16 items), which refers to activities and cognitive changes aimed at avoiding the stressful situation by distracting oneself with other situations or tasks, or via social diversion as a means of alleviating stress. each item ranges from 1 to 5 (1 rates as not at all and 5 rates as very much). subjects are asked to think about a variety of stressful and upsetting situations and the rating scales are used to indicate how often the respondent engages in the behaviors presented, which is how the range of 15 is used. the total score for each dimension ranges from 16 to 80.34 descriptive statistics comparison on the cbi and ciss was evaluated by friedman s analysis of variance with the post hoc (nemenyi) test. the effects of independent variables such as age, sex, and family ties on cbi and ciss scores were checked by means of multiple regression analyses, with the significance level corrected by the number of independent variables. correlation analyses were performed using a partial correlation matrix with significance level corrected by the number of comparisons. the dimensions of burden in their relationships with coping strategies were explored by means of a factor analysis. computation was supported by the statistical packages statview 5.0 and medcalc 12.7, running on pc. the study involved a sample of 86 caregivers of corresponding patients with ad (national institute of neurological and communicative disorders and stroke and the alzheimer s disease and related disorders association [nincds - adrda ] criteria),30 seen consecutively at the memory clinic of the neurological unit of aorn cardarelli hospital in naples. inclusion criteria were being a relative of the patient and having constant, daily contact with the patient. conversely, persons not fulfilling such criteria, namely professional caregivers, were not considered for inclusion in the study. all subjects gave their informed consent to the study, which was carried out according to the declaration of helsinki and approved by the local ethics committee. autonomy in activities of daily living in all the patients was assessed using the barthel index.31 the barthel index is a 10-item self - report and the total possible score ranges from 0 to 100, with lower scores indicating increased disability.31 all caregivers underwent a semistructured interview, the aim of which was to evaluate burden and anxiety by means of the caregiver burden inventory (cbi)32 and the state - trait anxiety inventory (stai y-1 and y-2).33 coping strategies were evaluated by the coping inventory for stressful situations (ciss).34 the cbi consists of five sections evaluating the impact of caregiving on the caregiver : time - dependence burden, which gives a measure of flexibility with time and caregiver s time restriction ; developmental burden, which evaluates the impact of failing to catch opportunities and pursue goals ; physical burden, a measure of the physical consequences of caregiving (eg, fatigue and somatic complaints) ; social burden, which assesses the impact on interpersonal and social relationships within the family and working environment ; and emotional burden, which evaluates feelings of shame and embarrassment with respect to the patient. each dimension consists of five items, and the score for each item ranges from 0 (factor with a minimum value) to 4 (factor with a maximum value), giving a total that ranges from 0 to 20 for each dimension with the exception of the physical burden, which has four items and a correction factor of 1.25 must be applied. the total score ranges from 0 to 100, and the scores grow proportional to the severity of the problem perceived by the caregiver.32 the stai is a validated tool to evaluate anxiety. it includes two dimensions, ie, state anxiety (y-1), which evaluates the emotional state of an individual in a particular situation, and trait anxiety (y-2), which refers to a relatively stable characteristic of personality. it is based on a 4-point likert scale and consists of 40 questions on a self - report basis. the total score of each dimension ranges from 20 to 80, but the significant scores are equal or greater to the 95th percentile.33 the ciss is a 48-item self - report and has been developed to describe cognitive styles and behavioral resources in response to a specific stressor. it assesses three coping strategies : task - oriented coping (16 items), which refers to purposeful efforts aimed at solving and/or restructuring the problem in an attempt to improve the situation ; emotion - oriented coping (16 items), which refers to self - oriented reactions including emotional responses, self - preoccupation, and fantasizing ; and avoidance - oriented coping (16 items), which refers to activities and cognitive changes aimed at avoiding the stressful situation by distracting oneself with other situations or tasks, or via social diversion as a means of alleviating stress. each item ranges from 1 to 5 (1 rates as not at all and 5 rates as very much). subjects are asked to think about a variety of stressful and upsetting situations and the rating scales are used to indicate how often the respondent engages in the behaviors presented, which is how the range of 15 is used. descriptive statistics were used to summarize variables. within each group, comparison on the cbi and ciss was evaluated by friedman s analysis of variance with the post hoc (nemenyi) test. the effects of independent variables such as age, sex, and family ties on cbi and ciss scores were checked by means of multiple regression analyses, with the significance level corrected by the number of independent variables. correlation analyses were performed using a partial correlation matrix with significance level corrected by the number of comparisons. the dimensions of burden in their relationships with coping strategies were explored by means of a factor analysis. computation was supported by the statistical packages statview 5.0 and medcalc 12.7, running on pc. the sample of 86 caregivers included 37 men and 49 women, with a mean age of 57.512.3 years and a mean education (years of schooling) of 12.04.3. the family ties of caregivers were : spouse in 37, offspring in 39, and other in the remaining ten persons. the 86 subjects with dementia consisted of 34 men and 52 women with a mean age of 72.68.15 years. according to the clinical dementia rating,35 the staging of dementia was mild in eleven, moderate in 29, moderately severe in 29, and severe in the remaining eleven subjects. friedman s analysis of variance on the five cbi sections was significant [f(4.34)=45.611 ; p 1). the principal component analysis had a bartlett s chi - square value of 306.213 (p<0.0001). the factorial matrix after rotation showed that factor 1 loaded on all cbi items plus the emotion - focused. factor 2 loaded on task - focused and avoidance - focused scores (table 4). the aim of this study was to contribute to giving a picture of the caregiving phenomenon of persons with ad. in particular, we intended to better define the relationships between the characteristics of caregivers distress (burden and anxiety) and the types of coping strategies adopted in facing the disease on a daily basis. in our sample, the majority of caregivers were women, without significant differences between the number of spouses and sons. this is consistent with findings already reported in the literature.36,37 a first result is that the global burden in our sample is extremely high when compared with those reported in other studies.25,38 among the burden dimensions, time dependence seems to be the more important. further, ad caregivers experience feelings of failure about their personal expectations and opportunities typical of the phase of life they are living (developmental burden). on the other hand, relatively little impact comes from negative feelings toward the patient and their illness (emotional burden). these results are consistent with data from italian surveys carried out using the same burden assessment tool.25,39 the global burden was shown to be heavier in women and older caregivers of ad patients. however, a more analytical evaluation highlights that time dependence and physical burden are greater in older caregivers, whereas developmental and emotional burden predominate in women caregivers. this suggests that women probably organize the time they devote to caregiving better, but this carries with it a negative impact on the emotional dimension and lifestyle. further, the lack of any effect of the type of family tie is consistent with the view that the burden is heavily perceived by relatives regardless of the role they play inside the family group. in ad caregivers, the burden was highly influenced by the severity of dementia, both overall and in most of the cbi sections. the last finding may be somewhat unexpected, given the parallelism usually reported between duration and grading of dementia. a possible interpretation of this discrepancy is that the severity of dementia, independent of the time it takes to reach a given stage, plays the main role in determining the burden. further, the influence of severity of dementia on burden seems to preserve the emotional dimension, thus suggesting that negative feelings toward the patient do not belong to the typical profile of an ad caregiver. the ad caregiver burden correlated strongly with trait (but not state) anxiety symptoms. a possible interpretation is that trait anxiety is a risk factor that leads to a greater burden for the caregiver. however, such an interpretation is less plausible if we consider the lack of any correlation between anxiety and emotional burden and, conversely, the strong correlations with developmental, physical, and social burden. consequently, a more plausible interpretation would be that the burden induces stable anxiety in caregivers which, in turn, amplifies the perceived burden.40,41 interesting data come from an evaluation of coping strategies. the ad caregivers exhibit strategies that are mainly task - focused ; they seem to be more prone to go toward the patient, both in the behavioral and emotional sense. this finding is consistent with previous studies,11,25 in which caregivers preferred to actively perform tasks in response to persistent requests. emotion - focused strategies are clearly influenced by sex, because they are mainly adopted by women, and strongly related to burden, trait anxiety and, to a lesser extent, dementia severity. taken together, these results point to female caregivers who are required by cultural context to play the role of persons who take care.42 the same role is not usually played by men, with the result that they receive more endorsement by the community. conversely, women often have to pay the cost in terms of their unfulfilled expectations, which implies their physical and psychologic resources become exhausted.43,44 the factorial matrix after rotation showed that factor 1 loaded on all cbi items plus the ciss emotion. this finding indicates that the reliance on emotion - focused strategies leads caregivers to higher level of distress, whereas successful caregiving seems related to task - focused and avoidance - focused strategies. although many studies point to task - focused strategies as a positive attitude,20,25,45 the effectiveness of avoidance behaviors is still unclear.20,46 several reasons may account for these discrepancies, eg, the numerosity and characteristics of both patients and caregivers and the setting of patients (ie, hospital, rehabilitation ward, outpatients). further, a potent source of distortion could stem from the type of tools adopted to assess coping strategies, since many of these instruments do not specifically address problems of caregivers of patients with dementia. finally, an agreement about the classification of coping strategies is still lacking.10 on the whole, our data confirm that dysfunctional strategies, without acceptance - based coping styles, are associated with anxiety and depression.40 from the clinical standpoint, the results of our study would encourage paying attention to caregiver burden, distress, and coping strategies and to consider their assessment, by means of validated tools, as part of diagnostic procedures. from the clinical management point of view, our results would support the development of psychologic interventions for carers with a view to modifying coping styles. these interventions should be carried out from the perspective of cognitive reframing for family carers of persons with dementia, in order to reduce psychologic morbidity and subjective stress.47 our study is not free from criticism. one limitation is the lack of assessment of behavioral and psychologic symptoms associated with dementia, given their role in determining caregivers burden and distress. however, in contrast with other forms of dementia, such as frontotemporal lobe degeneration, the behavioral and psychologic symptoms associated with dementia in ad are not by definition core symptoms of the disease, nor are they included in the criteria for diagnosis. further limitations ensue from the relatively small size of the sample, as well as the cross - sectional nature of the study. because of these limitations, precise causal mechanisms between burden and coping strategies or vice versa can not be established, although it is worth highlighting that the relationship between burden and coping is indeed bidirectional. our data confirm that the main caregiver of the ad patient is more often a woman, usually the wife or the daughter of the ill person. taking on this role of caregiver carries with it an increasing burden, in particular in developmental and physical dimensions. the time restriction experienced by relatives, along with the loss of many opportunities, are the aspects most commonly and strongly perceived. these types of strategies seem to predispose the caregiver to a higher burden and distress. ad caregiving is associated with negative effects, and an increase in burden is associated with a higher increase in assistance. this confirms the data in the literature indicating that these individuals are physically, emotionally, and financially overwhelmed by their role. this burden, however, could be lessened if interventions tailored to caregivers were provided and then adopted, with a view to reshaping each specific dysfunctional cognitive style in the caregiver. | backgroundalzheimer s disease (ad) causes considerable distress in caregivers who are continuously required to deal with requests from patients. coping strategies play a fundamental role in modulating the psychologic impact of the disease, although their role is still debated. the present study aims to evaluate the burden and anxiety experienced by caregivers, the effectiveness of adopted coping strategies, and their relationships with burden and anxiety.methodseighty-six caregivers received the caregiver burden inventory (cbi) and the state - trait anxiety inventory (stai y-1 and y-2). the coping strategies were assessed by means of the coping inventory for stressful situations (ciss), according to the model proposed by endler and parker in 1990.resultsthe cbi scores (overall and single sections) were extremely high and correlated with dementia severity. women, as well as older caregivers, showed higher scores. the trait anxiety (stai - y-2) correlated with the cbi overall score. the ciss showed that caregivers mainly adopted task - focused strategies. women mainly adopted emotion - focused strategies and this style was related to a higher level of distress.conclusionad is associated with high distress among caregivers. the burden strongly correlates with dementia severity and is higher in women and in elderly subjects. chronic anxiety affects caregivers who mainly rely on emotion - oriented coping strategies. the findings suggest providing support to families of patients with ad through tailored strategies aimed to reshape the dysfunctional coping styles. |
peritoneal dissemination of hepatocellular carcinoma (hcc) occurs rarely and is usually considered a terminal stage. dissemination of hcc was shown along the needle biopsy tract to the abdominal wall and by rupture of hcc and as the consequence of cancer peritonitis by tumor recurrence. it should be considered that needle biopsy of the liver tumor can lead to dissemination to the abdominal wall. rupture of hcc is fatal and needs emergent treatment, as tumor cells seed into the peritoneal cavity. cancer peritonitis was shown in most cases with dissemination of hcc. however, dissemination of hcc without cancer peritonitis to the peritoneum apart from a primary tumor has not been reported. in our case, the primary tumor was not ruptured and we had not performed needle biopsy of the liver tumor. under these circumstances, we diagnosed the liver tumor as hcc based on elevation of tumor markers such as alpha - fetoprotein (afp) and protein induced by vitamin k absence or antagonist - ii (pivka - ii). we report a case of peritoneal dissemination of hcc in which operation improved the patient 's quality of life. peritoneal dissemination is a rare presentation of hcc, and we should thus examine the characteristics of further cases. a 74-year - old man was admitted to our hospital because he had palpated a mass in the right lower quadrant region. laboratory data were zinc sulfate turbidity test 19.2 ku, thymol turbidity test 10.8 ku, afp 86.6 ng / ml and pivka - ii 44.3 g / ml. hbs antigen and hcv antibody were negative. ultrasonography showed a 3.5 2.6 cm high - echoic mass in the medial segment of the liver (fig. 1). enhanced computed tomography revealed a low - density area 3 cm in diameter in the same lesion and a giant well - defined mass, 5 10 cm in size, continuing from the diaphragm to left kidney between the stomach and spleen (fig. 2). angiography showed a hypervascular tumor in the medial segment of the liver. fluoroscopy showed a tortuous lesion from the fundus to the superior of body of the stomach. endoscopic retrograde cholangiopancreatography did not detect abnormal findings. laparotomy did not reveal ascites or blood in the peritoneal cavity. in the medial segment of the liver, there was a 3 3 cm tumor evaginated to the diaphragm. there were another 5 5 cm tumor evaginated from left diaphragm and a 7 7 cm tumor at the hilum of the spleen. both tumors were not continuous and separated. then we performed partial hepatectomy and resected the tumor of the diaphragm, the tumor of the hilum of the spleen with tail of the pancreas and spleen, and the tumor of the greater omentum., 2 years after the surgery, the patient remains alive without any evidence of recurrence. peritoneal dissemination of hcc is rare and has been observed rarely in surgical patients. as a consequence of needle biopsy or rupture of the primary tumor, peritoneal dissemination is essentially limited to the late stage of hcc [1, 2, 3, 4 ]. in our case, the primary liver tumor was not ruptured and we had not performed needle biopsy. thus, our case is very rare. surgical treatment has been felt to be of little value in improving survival. despite recent advances in the diagnosis and surgical management of hcc, no effective treatment for late - stage peritoneal metastases has been developed. occasionally, systemic chemotherapy was effective in cases of peritoneal dissemination of hcc. miyake. reported a case who developed peritoneal dissemination of hcc after hepatectomy, in whom marked tumor regression was found with a combination therapy of interferon - alpha-2b and oral tegafur / uracil. there are some reports contributing to a patient 's life prognosis by surgical treatment [6, 7, 8 ]. in this case, we believe that resection of peritoneal dissemination prolonged survival with a good quality of life. peritoneal dissemination is a rare presentation of hcc, with a reported incidence of 216% in autopsy or laparoscopy cases. nakashima. reported intraperitoneal dissemination such as diaphragm, douglas pouch, pancreas, spleen and gallbladder. moreover, the rate of peritoneal dissemination of hcc was considered to be higher in cases with liver cirrhosis compared to no liver cirrhosis. the mechanism of peritoneal dissemination from hcc was thought to be a rupture of exophytic hcc into the peritoneal cavity and subsequent seeding of metastatic deposits [10, 11 ]. however, yeh. reported that only 4 (25%) of 16 patients had peritoneal dissemination from preexisting ruptured hcc. histopathologically, peritoneal dissemination of hcc is considered to be undifferentiated or poorly differentiated type. in our case, the primary lesion was a 3 3 cm tumor and an unruptured hcc, and all of the resected tumors were of well - differentiated type and steatosis. yeh. revealed that the afp values of patients developing peritoneal dissemination from hcc after hepatectomy were high (mean 3,311.3 ng / ml). tumor markers such as afp played an important role in indicating the presence of peritoneal dissemination from hcc. furthermore, yeh and chen reported that a high afp level and capsular invasion by the tumor cells may predispose posthepatectomy patients to peritoneal implantation from their hccs. in conclusion, even when disseminated hcc is found, surgical treatment should be considered for selected patients, provided that the lesions are discretely located. | treatment for the peritoneal dissemination of hepatocellular carcinoma (hcc) has not yet been established. we report a patient with hcc associated with disseminated intra - abdominal tumor. a 74-year - old man was admitted to our hospital. computed tomography showed a 3 3 cm mass in the left hepatic lobe and a giant mass between the stomach and spleen. at laparotomy, the tumor was seen in the medial segment and evaginated to the diaphragm. there was a tumor between the stomach and spleen, confirmed as a 5 5 cm tumor evaginated from the left diaphragm, and a 7 7 cm tumor adhesive to the spleen. these two tumors were not continuous and were separated. furthermore, we confirmed a 10 10 cm tumor in the pelvic cavity. we performed partial hepatectomy, resection of the tumor evaginated from the diaphragm, resection of the tumor of the spleen and tail of pancreas, and resection of the tumor in the pelvic cavity. histopathologically, all resected tumors were confirmed to be well - differentiated hcc. hcc rarely disseminates intraperitoneally. it is considered that the peritoneal dissemination of hcc occurred from poorly differentiated or undifferentiated type. then this report is a rare case. although surgical treatment of peritoneal dissemination of hcc is not curative, surgery may improve survival and provide good quality of life in selected cases. |
this is an retrospective analysis of 53 consecutive tscc patients who underwent surgical treatment of their primary tonsil lesions with simultaneous neck dissection between january 2000 and august 2008 at the ilsong memorial institute of head and neck cancer, hallym university medical center, seoul, korea. inclusion criteria included the diagnosis of primary tscc, no prior treatment, complete medical records, and the availability of all histopathological slides of resected specimens. clinical information including age, gender, alcohol and tobacco consumption, tumor location, stage, treatment modality, survival and recurrence, together with the involvement of the base of the tongue, soft palate, pterygoid muscle, posterior pharyngeal wall, or nasopharynx, were analyzed using medical records and radiological results. tumor stage was reclassified based on the 7th edition of the american joint committee on cancer (ajcc). smoking history was measured in pack - years and was divided into 2 categories based on a 20 pack - years cut off.12 alcohol consumption was classified into 2 categories based on a 14 drinks per week cut off.12 postoperatively, 23 patients had no further therapy and 30 patients received adjuvant therapy : 18 received adjuvant radiotherapy and 12 received adjuvant chemoradiation therapy. this study was approved by the institutional ethics committee of hallym university medical center (seoul, korea). all surgically resected tscc specimens were serially sectioned and embedded for tumor mapping in the department of pathology. the hematoxylin and eosin - stained glass slides were reviewed by 2 pathologists blinded to all clinical information in this study. pathological features including tumor differentiation, presence of squamous dysplasia adjacent to the tumor, presence of in situ carcinoma connected to the main invasive squamous cell carcinomas (scc), skip lesions of the in situ carcinoma unconnected with main tumor, intratumoral necrosis, growth pattern of the invasive front, depth of invasion, lymphatic invasion, superior constrictor muscle invasion, perineural invasion, and extracapsular spread in the ipsilateral cervical lymph nodes were analyzed. positive surgical margin status was considered to be any involvement of squamous dysplasia, carcinoma in situ, or invasive carcinoma. diagnosis and histological classification were based on the world health organization (who) classification.13 depth of tumor invasion was measured from the surface of the mucosa to the maximal depth with an ocular micrometer.14 for exophytic tumors, the measurement was taken from the height of the surface of the adjacent intact mucosa to the deepest point of infiltration.15 depth of invasion was classified into 2 categories based on a 2 cm cut off, a modification from our prior study.16 the tumor growth pattern at the invasive front was assessed as either cohesive or non - cohesive, the former being a well - defined pushing margin with large tumor islands, and the latter consisting of scattered, small, irregular cords or single tumor cells with a poorly defined infiltrating margin.14,17 extracapsular spread was defined as carcinoma penetrating the lymph node capsule and infiltrating extracapsular tissue.13 the chi - squared test or 2-tailed fisher exact test were used to determine associations between clinical or pathological variables and ipsilateral or contralateral cervical lymph node metastasis. disease - free survival was defined as the time from first surgery until documented relapse, including locoregional recurrence and distant metastasis. survival differences among groups were calculated using the kaplan - meier method with a log - rank test. the cox proportional hazards model was used for multivariate analyses of overall and disease - free survival. this is an retrospective analysis of 53 consecutive tscc patients who underwent surgical treatment of their primary tonsil lesions with simultaneous neck dissection between january 2000 and august 2008 at the ilsong memorial institute of head and neck cancer, hallym university medical center, seoul, korea. inclusion criteria included the diagnosis of primary tscc, no prior treatment, complete medical records, and the availability of all histopathological slides of resected specimens. clinical information including age, gender, alcohol and tobacco consumption, tumor location, stage, treatment modality, survival and recurrence, together with the involvement of the base of the tongue, soft palate, pterygoid muscle, posterior pharyngeal wall, or nasopharynx, were analyzed using medical records and radiological results. tumor stage was reclassified based on the 7th edition of the american joint committee on cancer (ajcc). smoking history was measured in pack - years and was divided into 2 categories based on a 20 pack - years cut off.12 alcohol consumption was classified into 2 categories based on a 14 drinks per week cut off.12 postoperatively, 23 patients had no further therapy and 30 patients received adjuvant therapy : 18 received adjuvant radiotherapy and 12 received adjuvant chemoradiation therapy. this study was approved by the institutional ethics committee of hallym university medical center (seoul, korea). all surgically resected tscc specimens were serially sectioned and embedded for tumor mapping in the department of pathology. the hematoxylin and eosin - stained glass slides were reviewed by 2 pathologists blinded to all clinical information in this study. pathological features including tumor differentiation, presence of squamous dysplasia adjacent to the tumor, presence of in situ carcinoma connected to the main invasive squamous cell carcinomas (scc), skip lesions of the in situ carcinoma unconnected with main tumor, intratumoral necrosis, growth pattern of the invasive front, depth of invasion, lymphatic invasion, superior constrictor muscle invasion, perineural invasion, and extracapsular spread in the ipsilateral cervical lymph nodes were analyzed. positive surgical margin status was considered to be any involvement of squamous dysplasia, carcinoma in situ, or invasive carcinoma. diagnosis and histological classification were based on the world health organization (who) classification.13 depth of tumor invasion was measured from the surface of the mucosa to the maximal depth with an ocular micrometer.14 for exophytic tumors, the measurement was taken from the height of the surface of the adjacent intact mucosa to the deepest point of infiltration.15 depth of invasion was classified into 2 categories based on a 2 cm cut off, a modification from our prior study.16 the tumor growth pattern at the invasive front was assessed as either cohesive or non - cohesive, the former being a well - defined pushing margin with large tumor islands, and the latter consisting of scattered, small, irregular cords or single tumor cells with a poorly defined infiltrating margin.14,17 extracapsular spread was defined as carcinoma penetrating the lymph node capsule and infiltrating extracapsular tissue.13 the chi - squared test or 2-tailed fisher exact test were used to determine associations between clinical or pathological variables and ipsilateral or contralateral cervical lymph node metastasis. disease - free survival was defined as the time from first surgery until documented relapse, including locoregional recurrence and distant metastasis. survival differences among groups were calculated using the kaplan - meier method with a log - rank test. the cox proportional hazards model was used for multivariate analyses of overall and disease - free survival. a total of 53 patients (48 men and 5 women) with a median age of 54 years (range, 36 to 75 years) were included in this study. ten (18.9%) patients underwent elective neck dissection and 43 (81.1%) underwent therapeutic neck dissection. seventeen (32%) patients were under 50 years of age at the time of diagnosis, and the remaining 36 (67%) patients were older. thirty two (60%) tumors were located on the right side of the tonsil and 21 (40%) on the left side of the tonsil. ten (19%) tumors were classified as t1, 28 (53%) as t2, 11 (21%) as t3, and 4 (7%) as t4. base of the tongue invasion was present in 31 (57%) patients, and soft palate and posterior pharyngeal wall invasion were identified in 26 (49%) and 11 (21%) patients, respectively. pterygoid muscle and nasopharynx invasion were present in 9 (17%) and 3 (6%) patients, respectively. ipsilateral cervical lymph node metastasis was present in 42 patients, and contralateral lymph node metastasis was identified in 9 patients. those 9 patients with contralateral cervical lymph node metastasis also had ipsilateral lymph node metastasis. patients without ipsilateral lymph node metastasis having contralateral lymph node metastasis were not identified in this study. clinical features associated with ipsilateral and contralateral cervical lymph node metastases are summarized in table 1. contralateral cervical node metastatic status was significantly associated with a higher t stage and soft palate invasion (p=0.046 and p=0.011, respectively), while ipsilateral cervical node metastasis was not associated with any clinical features, including tobacco or alcohol consumption. the average tscc tumor size was 3.11.5 cm (range, 0.3 to 7.2 cm). surgical margins for all cases did not involve squamous dysplasia, carcinoma in situ, or invasive carcinoma. ten tscc tumors (18.9%) were well differentiated, 28 (52.8%) were moderately differentiated, 15 (28.3%) were poorly differentiated, and 26 (49.1%) cases had squamous dysplasia adjacent to the main mass. squamous dysplasia was further classified into 12 mild, 10 moderate, and 3 severe dysplasia cases. squamous dysplasia tended to be accompanied by poorly differentiated tscc, rather than well or moderately differentiated tumors (p=0.017) (data not shown in table). among the total 53 tscc cases, 29 (54.7%) had the in situ scc connected to the main invasive mass, whereas 25 (47.2%) had a skip lesion of the in situ scc unconnected to the main invasive mass. the relationship between histopathological factors and ipsilateral or contralateral nodal metastases are summarized in table 2. lymphatic invasion (p<0.001) and muscle invasion (p=0.002) were significantly associated with ipsilateral cervical lymph node metastasis. we analyzed the prognostic relevance of clinical and pathological features with respect to overall and disease - free survival of patients with tscc (table 3). based on univariate analyses, patients with higher t stage, tumor invasion to the base of the tongue, and carcinoma in situ skip lesions had shorter disease - free survival periods (mean, 47 months, 54 months, and 49 months) than those without them (mean, 88 months, 100 months, and 94 months) (p=0.046, p=0.033, and p=0.039, respectively). overall survival of patients with advanced t stage tscc (mean, 47 months) and carcinoma in situ skip lesions (mean, 54 months) were significantly worse than those of patients without advanced t stage (mean, 91 months) or skip lesions (mean, 93 months) (p=0.012 and p=0.049, respectively) (fig. those variables that correlated significantly with overall or disease - free survival on univariate analyses were further analyzed by multivariate analyses using a cox regression (table 4). presence of skip lesions was the only independent prognostic factor predicting decreased disease - free survival (p=0.048 ; hazard ratio, 2.189 ; 95% confidence interval [ci ], 1.975 to 4.914). t stage (t1,2 vs t3,4) was an independent prognostic factor associated with overall survival (p=0.019 ; hazard ratio, 3.060 ; 95% ci, 1.071 to 8.746). a total of 53 patients (48 men and 5 women) with a median age of 54 years (range, 36 to 75 years) were included in this study. ten (18.9%) patients underwent elective neck dissection and 43 (81.1%) underwent therapeutic neck dissection. seventeen (32%) patients were under 50 years of age at the time of diagnosis, and the remaining 36 (67%) patients were older. thirty two (60%) tumors were located on the right side of the tonsil and 21 (40%) on the left side of the tonsil. ten (19%) tumors were classified as t1, 28 (53%) as t2, 11 (21%) as t3, and 4 (7%) as t4. base of the tongue invasion was present in 31 (57%) patients, and soft palate and posterior pharyngeal wall invasion were identified in 26 (49%) and 11 (21%) patients, respectively. pterygoid muscle and nasopharynx invasion were present in 9 (17%) and 3 (6%) patients, respectively. ipsilateral cervical lymph node metastasis was present in 42 patients, and contralateral lymph node metastasis was identified in 9 patients. those 9 patients with contralateral cervical lymph node metastasis also had ipsilateral lymph node metastasis. patients without ipsilateral lymph node metastasis having contralateral lymph node metastasis were not identified in this study. clinical features associated with ipsilateral and contralateral cervical lymph node metastases are summarized in table 1. contralateral cervical node metastatic status was significantly associated with a higher t stage and soft palate invasion (p=0.046 and p=0.011, respectively), while ipsilateral cervical node metastasis was not associated with any clinical features, including tobacco or alcohol consumption. the average tscc tumor size was 3.11.5 cm (range, 0.3 to 7.2 cm). surgical margins for all cases did not involve squamous dysplasia, carcinoma in situ, or invasive carcinoma. ten tscc tumors (18.9%) were well differentiated, 28 (52.8%) were moderately differentiated, 15 (28.3%) were poorly differentiated, and 26 (49.1%) cases had squamous dysplasia adjacent to the main mass. squamous dysplasia was further classified into 12 mild, 10 moderate, and 3 severe dysplasia cases. squamous dysplasia tended to be accompanied by poorly differentiated tscc, rather than well or moderately differentiated tumors (p=0.017) (data not shown in table). among the total 53 tscc cases, 29 (54.7%) had the in situ scc connected to the main invasive mass, whereas 25 (47.2%) had a skip lesion of the in situ scc unconnected to the main invasive mass. the relationship between histopathological factors and ipsilateral or contralateral nodal metastases are summarized in table 2. lymphatic invasion (p<0.001) and muscle invasion (p=0.002) were significantly associated with ipsilateral cervical lymph node metastasis. we analyzed the prognostic relevance of clinical and pathological features with respect to overall and disease - free survival of patients with tscc (table 3). based on univariate analyses, patients with higher t stage, tumor invasion to the base of the tongue, and carcinoma in situ skip lesions had shorter disease - free survival periods (mean, 47 months, 54 months, and 49 months) than those without them (mean, 88 months, 100 months, and 94 months) (p=0.046, p=0.033, and p=0.039, respectively). overall survival of patients with advanced t stage tscc (mean, 47 months) and carcinoma in situ skip lesions (mean, 54 months) were significantly worse than those of patients without advanced t stage (mean, 91 months) or skip lesions (mean, 93 months) (p=0.012 and p=0.049, respectively) (fig. those variables that correlated significantly with overall or disease - free survival on univariate analyses were further analyzed by multivariate analyses using a cox regression (table 4). presence of skip lesions was the only independent prognostic factor predicting decreased disease - free survival (p=0.048 ; hazard ratio, 2.189 ; 95% confidence interval [ci ], 1.975 to 4.914). t stage (t1,2 vs t3,4) was an independent prognostic factor associated with overall survival (p=0.019 ; hazard ratio, 3.060 ; 95% ci, 1.071 to 8.746). tonsil cancers can spread beneath an intact and apparently normal surface, giving rise to a larger area of tumor involvement than that suggested by gross inspection.10 they can also invade deeply into the underlying tissues, the base of tongue, and the lateral pharyngeal wall, and have a tendency to extend upwards into the nasopharynx as well.10 furthermore, due to the abundant plexus of lymphatic vessels distributed around the palatine tonsils and the tonsillar fossa, tonsil cancers frequently give rise to nodal metastasis,6 compared to other oropharyngeal cancers.18 these aggressive characteristics have increased the urgency of finding predictive and prognostic factors that are specific to tscc. the optimal management of tscc patients with clinically - node negative status in the ipsilateral or contralateral neck remains controversial. if it were possible to elucidate potential clinicopathologic predictors for lymph node metastasis, they could be used to identify patients eligible for treatment by elective neck dissection. in this study, we found that lymphatic and muscle invasion were important histopathological factors associated with ipsilateral cervical lymph node metastasis, while a higher t stage and soft palate invasion were clinical factors associated with contralateral cervical nodal metastasis. these findings are supported by a previous study by lim.,6 which found advanced t3 - 4 stages to be associated with contralateral nodal metastasis in tscc. the authors advocated performing elective contralateral neck treatment for tscc patients with ipsilateral node metastases because the risk of contralateral occult neck involvement was 21%.1 rusthoven.19 found that tongue base and soft palate involvement were associated with contralateral nodal metastasis in tscc, which they suggested may be due to high levels of lymphatic drainage in the soft palate.19 moreover, the degree of differentiation, pattern of invasive front, as well as vascular and perineural invasion have been found to correlate with nodal metastasis in scc of the oral cavity.9,20,21 poorly differentiated tumors have higher incidence of neck involvement than well - differentiated tumors.20 scc patients with a cohesive, diffuse, invasive front have a higher incidence of neck metastasis and poorer prognosis than those who had non - cohesive, well - defined borders.21 however, the parameters mentioned above were not statistically correlated with neck metastasis in this study. although involvement of the tongue base and posterior pharyngeal wall invasion did not reach statistical significance in this study, there was an increased tendency of contralateral cervical lymph node metastasis. therefore, the microscopic confirmation of lymphatic invasion, muscle or soft palate invasion, involvement of the tongue base, and posterior pharyngeal wall invasion may help to determine the extent of neck dissection and decrease morbidity associated with unnecessary surgery or irradiation. t stage, nodal status, histological grade, and pattern of invasion have been suggested to correlate with prognosis in oropharyngeal cancers.22,23 however, the relationship between prognosis and histopathological features in tscc has not been fully explored. previously, only small numbers of tscc patients (included in a series of oral cavity and oropharyngeal cancers) have been analyzed. in this study, advanced t stage proved to be a major risk factor that adversely influenced overall survival, which is consistent with findings for other oropharyngeal cancers.22 severe dysplasia and carcinoma in situ have been reported in about 2 - 17.5% in oropharyngeal cancers, with variation between studies likely resulting from different methods and attention to detail used in pathological examinations of surgical specimens. in this study, we undertook a comprehensive analysis of dysplasia adjacent to the tumor, in situ carcinoma connected to the main invasive scc, and skip lesions of the in situ scc unconnected with the main tumor, as they were all considered to be potential sites of local recurrence. squamous dysplasia, scc in situ connected to the main tumor, and skip lesions of the carcinoma in situ were present in 49.1%, 54.7%, and 47.2% of the 53 tscc cases, respectively. interestingly, the skip lesion of the carcinoma in situ proved to be an independent prognostic factor for worse overall survival. although precursor lesions are believed to be an important indicator of malignant potential, no good data exists regarding tonsillar precursor lesions. because precursor lesions may appear clinically normal, there is the danger that they may not be completely excised thereby increasing the risk of disease recurrence.10 this is reflected by high recurrence rates at the primary site (25 - 40%) in head and neck scc,23,24 which may be due to a failure to excise skip or other precursor lesions.24 in summary, advanced t stage and soft palate invasion were associated with a high rate of contralateral nodal metastasis. advanced t stage had clear prognostic significance in predicting overall survival among tonsil cancer patients in our study. skip lesions of the carcinoma in situ were associated with worse disease - free survival. therefore, when skip lesions are encountered in a surgically resected tscc specimen, they should be commented on in the pathology report to raise clinician awareness about the potential for worse prognosis. integrating information regarding clinicopathological factors with therapeutic principles is important to improving our overall assessment of tonsil cancer. | backgroundrisk factors for lymph node metastasis in tonsillar squamous cell carcinoma (tscc) need to be established to determine the degree of surgery required to achieve high curative rates. however, little is known currently about the histopathological features predicting prognosis, specifically in tscc.methodsthis study included 53 patients who underwent surgical resection with neck dissection. clinicopathological factors investigated included age, gender, alcohol use, tobacco consumption, tumor stage, adjacent structure involvement, cell differentiation, squamous dysplasia, in situ carcinoma associated with primary invasive cancer, carcinoma in situ skip lesions, necrosis, invasive front, depth of invasion, and lymphatic, muscle, or perineural invasion.resultscontralateral cervical metastasis was associated with higher t stages and soft palate invasion. lymphatic and muscle invasion were associated with ipsilateral cervical metastasis. advanced t stage, invasion to the base of tongue, and skip lesions were associated with decreased disease - free survival. advanced t stage and skip lesions were associated with worse overall survival.conclusionsadvanced t stage and soft palate invasion may predict a high risk of contralateral nodal metastasis. t stage and skip lesion are worse prognostic factors in tscc and should be commented in pathology reports. |
for decades, joint replacement has been a procedure with major impact on the quality of life in elderly patients with joint degenerative diseases or traumatic injuries. unfortunately, some patients develop symptoms after surgical intervention. in the majority of patients, aseptic loosening due to biochemical reaction of the bone both entities have a very similar clinical appearance, but require different therapeutic approaches due to different pathophysiological substrates (1). lack of a single imaging modality that could clearly differentiate between infections and loosening makes this problem a challenge in the routine workup of these patients. laboratory analysis, including white blood cell count, erythrocyte sedimentation rate (esr) and c - reactive protein (crp) are not specific enough. canner. found that out of fifty - two patients who had an infection following joint arthroplasty, only eight (15%) had leukocytosis (2). the esr may remain elevated for months after an uncomplicated total hip replacement (3). crp levels increase in a non - specific manner as a result of infectious, inflammatory or neoplastic disorders. conventional imaging methods are helpful in some situations when complications arise (4, 5), but their diagnostic potential in distinguishing loosening and inflammation are limited. ct is superior to radiography in imaging soft tissue abscesses (6) ; however, not a recommended diagnostic tool due to significant artifacts on the images at the location of the prosthesis that hamper the optimal interpretation of the results. thus, non - attenuation - corrected images must be interpreted to avoid false - positive results if pet / ct is used for the evaluation of painful prosthesis (7). aspiration biopsy of the joint was regarded as a gold standard, but it is not convenient for the patient and may not always be helpful in distinguishing the two above - mentioned pathological entities. a positive result can confirm infection, but a negative result can not exclude it (8). nuclear medicine modalities offer several diagnostic methods that are dedicated to the diagnosis of infection and are not affected by orthopedic implants. three - phase bone scintigraphy (tpbs) is widely accepted for the diagnosis of different pathological processes of the musculoskeletal system including detection of infection with a high sensitivity and limited specificity in the diagnosis of infected joint prostheses (9). it is noticeable that reported results of different studies dealing with the problem of painful joint prosthesis show variation, which is mostly due to different interpretation criteria applied (10, 11). tpbs, with an accuracy of about 50 - 70% can be performed as the modality of primary choice in these patients, but it should be combined with other diagnostic modalities (12). white blood cell (wbc) scintigraphy labeled with 99mtc hmpao or 111in - oxine or anti - granulocyte scintigraphy using 99mtc - labeled monoclonal antibodies (moab) or their fragments are frequently used nuclear medicine imaging modalities in the detection of infection and inflammation, but it is important to emphasize that neither of these imaging methods can reliably differentiate sterile inflammation from infection (13). significant decrease in the accuracy of wbc imaging is caused by the fact that labeled leukocytes are accumulating both in infected tissue and in bone marrow (10). a combined study consisting of wbc imaging and complementary bone marrow (bm) imaging performed with radiolabeled sulphur colloid is based on the fact that both radiopharmaceuticals accumulate in marrow ; whereas, wbcs accumulate in infection, but sulfur colloid does not. although the combination of these two modalities increases the accuracy in the diagnosis of osteomyelitis up to 90%, pitfalls that could affect the results are not negligible (14). 18f - fdg - pet is a promising imaging modality for the evaluation of a variety of infectious and inflammatory processes (15). in addition, there are reports indicating that in the evaluation of inflammation or infection, 18f - fdg - pet is even more accurate than conventional nuclear medicine procedures (16). these features of 18f - fdg - pet diagnostic modalities encouraged many professionals to perform research on its applicability in patients with painful prostheses. however, the results of the studies dealing with the role of 18f - fdg - pet are so far rather inconclusive and need to be more clearly defined (12). according to chacko., the intensity of uptake is not useful for separating the infected from the aseptically loosened device (17). the periprosthetic glucose metabolism could also be enhanced to certain degrees in normal cases, which have been addressed in another study (18), and could hamper the interpretation of the examination. the reason for this shortcoming is to our opinion the unawareness of physiological remodelling processes that could be seen in asymptomatic patients. the aim of this study was to demonstrate this physiological pattern and discuss the findings in the literature. in the present study, we aim to delineate different metabolic patterns in asymptomatic patients with hip prostheses and to improve the specificity of 18f - fdg - pet in patients with suspected septic loosening of hip prosthesis. twelve patients, (6 males, 6 females) ; mean age, 73 7 (range, 58 - 91) years were enrolled prospectively into the study. none of the patients expressed any symptoms in regard to their implanted prosthesis and none of them had hematological malignancies or any metabolic bone manifestation of the primary tumor. the pet studies were performed on a full ring pet - scanner (siemens exact, knoxville, usa) as described in earlier studies (19). the results are summarized in table 1. with findings related to periprosthetic enhanced uptake, figure 1 demonstrates a case of a patient with asymptomatic hip prosthesis on both sides with enhanced uptake in the left neck region. t = trochanter, n = neck, m = male, f = female, l = left, r = right one of the largest samples of patients with hip prosthesis examined with 18f - fdg - pet was reported by reinartz and colleagues who compared pet with tpbs. the authors concluded that 18f - fdg - pet is a highly accurate diagnostic procedure to differentiate reliably between aseptic loosening and periprosthetic infection (18). they described, by a qualitative analysis, the different patterns of periprosthetic 18f - fdg uptake in different conditions, from normal to septic loosening 6 months after arthroplasty. 18f - fdg - pet has great potential in detecting the infection, but in cases of increased aseptic loosening, periprosthetic uptake of 18f - fdg could be caused by wear - induced polyethylene particles and the subsequent growth of aggressive granulomatous tissue (16). non - infectious inflammatory reactions around the neck of the prosthesis are common findings months or even years after surgery and they should not be interpreted as a finding suggestive of infection (21). application of suv (standard uptake value) as a semiquantitative parameter is usually a very important tool in the interpretation of oncological pet images, but it can not be applied as a reliable criterion in inflammatory pathology due to low specificity, particularly not as a single criterion (10). knowing the limitations of 18f - fdg - and taking into account the mechanism of its uptake in malignant tissues, leukocytes were labeled with 18f - fdg in order to increase its affinity to the inflamed tissue. although the first results were promising, it was found that 18f - fdg was rapidly released from the leukocytes. it has been suggested that the amount of increased 18f - fdg uptake is less important than the location of increased 18f - fdg uptake when this technique is used to diagnose periprosthetic infection in patients who had undergone prior hip arthroplasty (16). uptake pattern seems to be of essential importance in the diagnosis of infection and is defined as very suggestive of infection if the 18f - fdg uptake between the bone and prosthesis at the level of the midshaft portion of the prosthesis is present (23, 24). this suggests that more standardized criteria for the interpretation of the 18f - fdg scan for the diagnosis of infection on the prosthesis placement should be defined and applied in practice. depending on the type of prosthesis and on other factors, hip prosthesis can show different metabolic patterns. keeping in mind different metabolic patterns of periprosthetic 18f - fdg uptake in different conditions and the reliability of periprosthetic suv - measurement with the new pet / ct devices, it seems to be of the utmost importance to find visual criteria that could be applied in these cases (18). in this study, we could demonstrate (table 1) this pattern of hypermetabolic areas that could be defined more likely as normal and not caused by septic or aseptic loosening only on the neck and/or trochanteric area. two patients who showed enhanced periprosthetic uptake in two regions, had a history of re - implantation in one case and a period longer than 10 years after the surgery in the second case. interestingly, we could not observe focal enhanced glucose metabolism in the stem or tip region in any patient. these findings are also of importance to rule out a suspected infection, as it was shown in a recent study where fdg - pet had a sensitivity of 100% and a negative predictive value of 100% (25). the study is limited by the fact that the patients could not provide information regarding the type of prosthesis, particularly whether they were cemented or not. no patient had a leukocytosis, but 8/12 patients -- with or without periprosthetic - enhanced uptake -- had an elevated crp. since they were all referred for oncological reasons, data was not taken into consideration. the results of this study demonstrate a non - specific pattern of enhanced 18f - fdg - uptake in asymptomatic patients in the neck or trochanteric region after arthroplasty, which should be taken into consideration for correct interpretation of metabolic studies in patients with suspected septic loosening of the hip prosthesis. | background : joint replacement is a procedure with a major impact on the quality of life of patients with joint degenerative disease or traumatic injuries. however, some patients develop symptoms after the intervention caused by mechanical loosening or infection. metabolic imaging by 18f - fdg - pet investigated in these patients isoften hampered by low specificity for diagnosis of possible septic vs. mechanical loosening. the reason for this shortcoming is to our opinion the unawareness of physiological remodeling processes that could be seen in asymptomatic patients.objectives:in order to overcome this drawback, we aimed to find out the physiological metabolic functional pattern in asymptomatic patients with implanted hip prosthesispatients and methods : twelve patients (6 males, 6 females) ; mean age 73 7 (range 58 - 91) years were prospectively enrolled in the study. the patients were admitted to our department for oncological referral with implanted hip prostheses. all patients explained no symptoms with regard to their implanted prosthesis. the attenuation corrected images were used for analysis.results:fourteen hip prostheses in 12 patients were visually analyzed. seven out of 14 prostheses among 12 patients showed focal periprosthetic enhanced metabolism, two of which showed two sites of enhanced uptake ; whereas, the remaining five prostheses showed singular hypermetabolic areas within the periprosthetic site. the remaining seven prostheses in the other five patients showed no periprosthetic - enhanced uptake.conclusion:of the asymptomatic patients investigated, 58% showed focal enhanced periprosthetic glucose metabolism. this finding should be taken into consideration as a more probable unspecific metabolic pattern for correct interpretation of 18f - fdg - pet studies in patients with suspected septic loosening of the hip prosthesis. |
the menopausal stage of a woman 's life may bring a number of changes, especially with regard to her family life, relationships, and work and financial status. during the menopausal transition, vasomotor symptoms such as hot flushes occur due to hormonal fluctuations. decreased estrogen levels in tissues of the genitourinary tract can also lead to vaginal atrophy (va), a progressive, chronic condition. symptoms of va include dryness, soreness and burning or itching of the vagina, dyspareunia, and bleeding following sexual activity. these symptoms can be detrimental to a woman 's quality of life, including her relationships, sexual satisfaction, and self - esteem. despite the distress caused by symptoms of va, the majority of menopausal women the reasons for this reluctance have been surveyed in large cohorts of postmenopausal women and include embarrassment, lack of awareness that va can be treated, and a failure of health - care providers (hcps) to initiate conversation about sexual health issues, including va. human strategies for coping with change can be classified according to two dimensions of personality : a social dimension based on adlerian individual psychology principles (combatting versus acceptance) and a personal dimension based on freudian psychoanalytic principles (liberation versus control). likewise, a woman 's individual reaction to the negative changes associated with menopause and va can be predicted based on her general coping strategies. this international focus group study classified women by personality type and examined their attitudes toward menopause, va, and barriers to seeking treatment for va. recommendations for a personality - based approach to treatment were also generated based on focus group data ; the recommendations included preferred sources of information and aspects of ideal treatment for each personality type. focus groups took place in march and april of 2010 in montreal, toronto, and calgary in canada ; stockholm, sweden ; london, birmingham, and manchester in the united kingdom ; and new york, chicago, and san francisco in the united states, and were held in the national language of the respondents. three groups were held in each us city and four were held in the other cities ; all groups comprised three to five women for a total of 70 women. all participants were postmenopausal (aged between 40 and 75 years), had experienced symptoms of va, and had not sought treatment for va. sessions were held in a non - traditional setting (incorporating living - room - style seating, for example) to encourage creativity and free expression, and women were encouraged to remove their shoes to indicate that this would be an informal atmosphere. women were also invited to bring an item along which reflected well what being a woman means to them. this allowed them to speak very personally and intimately about what matters for each individual. after thanking the women for participating, each group 's moderator was instructed to reassure them that their answers would be kept confidential and that there were no right or wrong answers. this focus group study was conducted according to the standards of the market research society (http://www.mrs.org.uk/standards/#standards). women were recruited to participate via various sources, including contacts based on existing consumer panels, placing adverts on online forums, and word of mouth in some cases. women 's attitudes toward menopause, va, and the treatment of va were explored using a variety of techniques, including associations, projections (such as selecting pictures to describe a concept), and creating collages. based on their statements within the focus groups, participants were categorized using the censydiam approach, a market research analytical method that has been used for 25 years in more than 70 countries. this methodology was validated across 11 countries in four different categories in a phd thesis conducted in 2007 by a leading belgian university. the censydiam approach uses extended interviews in a casual setting using a questionnaire along with a wide range of projective techniques (i.e. fantasy, projections, allegories) in order to elucidate individual patient feelings and motivations. the focus group leaders had a psychology degree and were trained in the censydiam methodology prior to this study. further, a censydiam expert team observed the research and supervised recruitment, development of the discussion guide, preparation of the questions to the participants, and the interviews. following the research, trained and certified censydiam executives analyzed the results. because the discussion is focused on each individual woman 's personal feelings, influence from other respondents is minimized. the censydiam segments are based on motivations, which are universal, and therefore the same personality types are seen all over the world. two dimensions were used to place the women on a continuum based on their mode of interaction with the world : a social dimension based on adlerian individual psychology (individualism / dominance versus belonging / acceptance) and a personal dimension based on freudian psychoanalytic principles (liberation versus control). women who display individualism / dominance may see change as inconvenient because it can affect their social status and appearance, but they also see it as a chance to show competence and fight back. these people may be described as proactive and resolute. women who interact with their environment by belonging / acceptance look for protection and guidance and are passive toward change, which they see as neutral or overwhelming. individuals who use liberation as a coping strategy view change as constructive and as renewal ; they embrace change to cope. in contrast, individuals who cope by attempting to control a situation may feel threatened by and fearful of change. together, these dimensions define five personality types based on outside interaction and coping strategies (table 1) : (1) adventurers (individualism / liberation), (2) happy - go - luckies (belonging / liberation), (3) nurturers (belonging / neutral), (4) submissive security seekers (belonging / control), and (5) fighters (individualism / control) (figure 1). (a) personality types based on social (x - axis) and personal (y - axis) dimensions ; (b) motivation by personality type coping strategies for menopausal women with vaginal atrophy all five personality types were found in each location, although groups in the cities of the united states (figure 2a), london (figure 2b), and sweden (figure 2c) had more happy - go - luckies and adventurers and fighters, while groups in canada (figure 2d) and manchester and birmingham (figure 2e) had more nurturers and submissive security seekers. predominant personality types by location focus group participants were asked to select images of women from paintings to describe how they felt about growing older and were asked to describe the meaning of their chosen images. though some women found a strength and pride in their accomplishments, they also described feeling faded, androgynous, and insignificant or unnoticed in this stage of life. a common theme was the disconnect between a woman 's mental sense of self, which had not changed with age, and her physical self, which she sometimes perceived as being in decline. symptoms of menopause that were most concerning to participants were hot flushes and weight gain, while vaginal dryness, a symptom of va, was moderately bothersome. va symptoms were considered more serious, however, than disrupted sleep and a loss of skin elasticity. the impact of va was described in terms of its symptoms (itching and burning, dry inside and out), its effect on relationships (reinforced decreased libido, limited spontaneity), and its emotional effects (reminded women of their age, decreased feelings of femininity, increased embarrassment). behavioral adaptations to vaginal dryness included avoiding harsh or drying soaps, showering less often, and wearing breathable fabrics. for women who were sexually active and comfortable communicating with a partner, increased foreplay was cited, whereas women with decreased libido were more likely to choose abstinence. the most common treatment strategy used by focus group participants was application of lubricants. these non - prescription treatments included brands associated with sexual activity as well as oils, moisturizers, and creams. these were used routinely by sexually active women in the united states ; however, women in the united kingdom had more negative associations with lubricants, including the misperception that they are used only by sex workers. in addition to their embarrassment caused by associating lubricants with sex, women had additional complaints related to lubricant use. for example, participants did not like the fact that they were often messy or greasy, were not long - lasting, and needed to be applied directly prior to sexual activity, which decreased spontaneity. the focus group participants were selected partly because they had not previously sought treatment for their va. the women were less familiar with va symptoms than they were with other symptoms of menopause, such as hot flushes. because va symptoms may occur gradually, women saw them as a natural part of aging. this, coupled with a lack of knowledge of va treatments and a lack of discussion among their peers, meant that some women were not aware of prescription treatment options. when women were aware of estrogen therapy, they were concerned about an increased risk of breast cancer and of heart disease. these women did not differentiate between the risks of systemic hormone replacement therapy and local estrogen therapy (let), because they believed that let still gets into your system. although participants may have been uninformed about va, their hcps failed to supply this information. the systemic barriers to hcp interaction mentioned by european participants were an appointment structure not conducive to discussion, lack of direct access to specialists, and a low percentage of older female hcps. i would like to not be rushed in and out when i go to my gp [general practitioner ]. i can only go in with one problem at a time ; otherwise i have to make two appointments. hcps often did not ask about symptoms associated with va and, when women broached the topic, displayed a lack of sensitivity to the impact of va on their quality of life. i know they have to learn all these things, but honestly i do nt think he had a clue. he said [my symptoms will ] pass with time [and that i 'd be ok ]. contrary to the recommendations of the north american menopause society (nams) and the international menopause society (ims), hcps did not typically suggest vaginal low - dose let to women with va. one member of the stockholm, sweden, focus group was told by her doctor, just use [lubricant ] and your imagination ; there s no miracle product. along with the challenges that were experienced by most women in the focus groups, each personality type displayed different approaches to managing va, concerns regarding treatment, influences, and characteristics of ideal treatment (table 2). for example, women whose coping strategy involved combatting / dominance (fighters and adventurers) were generally more likely to seek treatment than those whose strategy involved belonging / acceptance (nurturers, happy - go - luckies, and submissive security seekers). women who used control to cope with menopausal changes (submissive security seekers and fighters) were more likely to respond to information validated by perceived experts, including their hcp, than were those who used a strategy of release (adventurers and happy - go - luckies). personality - based approaches to vaginal atrophy treatment va, vaginal atrophy ; hcp, health - care provider. all five personality types were found in each location, although groups in the cities of the united states (figure 2a), london (figure 2b), and sweden (figure 2c) had more happy - go - luckies and adventurers and fighters, while groups in canada (figure 2d) and manchester and birmingham (figure 2e) had more nurturers and submissive security seekers. focus group participants were asked to select images of women from paintings to describe how they felt about growing older and were asked to describe the meaning of their chosen images. though some women found a strength and pride in their accomplishments, they also described feeling faded, androgynous, and insignificant or unnoticed in this stage of life. a common theme was the disconnect between a woman 's mental sense of self, which had not changed with age, and her physical self, which she sometimes perceived as being in decline. symptoms of menopause that were most concerning to participants were hot flushes and weight gain, while vaginal dryness, a symptom of va, was moderately bothersome. va symptoms were considered more serious, however, than disrupted sleep and a loss of skin elasticity. the impact of va was described in terms of its symptoms (itching and burning, dry inside and out), its effect on relationships (reinforced decreased libido, limited spontaneity), and its emotional effects (reminded women of their age, decreased feelings of femininity, increased embarrassment). behavioral adaptations to vaginal dryness included avoiding harsh or drying soaps, showering less often, and wearing breathable fabrics. for women who were sexually active and comfortable communicating with a partner, increased foreplay was cited, whereas women with decreased libido were more likely to choose abstinence. these non - prescription treatments included brands associated with sexual activity as well as oils, moisturizers, and creams. these were used routinely by sexually active women in the united states ; however, women in the united kingdom had more negative associations with lubricants, including the misperception that they are used only by sex workers. in addition to their embarrassment caused by associating lubricants with sex, women had additional complaints related to lubricant use. for example, participants did not like the fact that they were often messy or greasy, were not long - lasting, and needed to be applied directly prior to sexual activity, which decreased spontaneity. the focus group participants were selected partly because they had not previously sought treatment for their va. the women were less familiar with va symptoms than they were with other symptoms of menopause, such as hot flushes. because va symptoms may occur gradually, women saw them as a natural part of aging. this, coupled with a lack of knowledge of va treatments and a lack of discussion among their peers, meant that some women were not aware of prescription treatment options. when women were aware of estrogen therapy, they were concerned about an increased risk of breast cancer and of heart disease. these women did not differentiate between the risks of systemic hormone replacement therapy and local estrogen therapy (let), because they believed that let still gets into your system. although participants may have been uninformed about va, their hcps failed to supply this information. the systemic barriers to hcp interaction mentioned by european participants were an appointment structure not conducive to discussion, lack of direct access to specialists, and a low percentage of older female hcps. i would like to not be rushed in and out when i go to my gp [general practitioner ]. i can only go in with one problem at a time ; otherwise i have to make two appointments. hcps often did not ask about symptoms associated with va and, when women broached the topic, displayed a lack of sensitivity to the impact of va on their quality of life. another focus group member from manchester i know they have to learn all these things, but honestly i do nt think he had a clue. he said [my symptoms will ] pass with time [and that i 'd be ok ]. contrary to the recommendations of the north american menopause society (nams) and the international menopause society (ims), hcps did not typically suggest vaginal low - dose let to women with va. one member of the stockholm, sweden, focus group was told by her doctor, just use [lubricant ] and your imagination ; there s no miracle product. along with the challenges that were experienced by most women in the focus groups, each personality type displayed different approaches to managing va, concerns regarding treatment, influences, and characteristics of ideal treatment (table 2). for example, women whose coping strategy involved combatting / dominance (fighters and adventurers) were generally more likely to seek treatment than those whose strategy involved belonging / acceptance (nurturers, happy - go - luckies, and submissive security seekers). women who used control to cope with menopausal changes (submissive security seekers and fighters) were more likely to respond to information validated by perceived experts, including their hcp, than were those who used a strategy of release (adventurers and happy - go - luckies). personality - based approaches to vaginal atrophy treatment va, vaginal atrophy ; hcp, health - care provider. this series of international focus groups revealed a variety of attitudes toward menopause that could be characterized according to a woman 's coping strategies. the women in these groups also described the detrimental emotional and physical effects of va. other studies of postmenopausal women have detailed the negative effects of va on their quality of life. more than half (52%) of respondents in the women 's voices in the menopause study described one or more negative effects of va ; these included effects on their sex lives (40%) and feeling old (32%). women who participated in the viva (vaginal health : insights, views, and attitudes) study said that vaginal discomfort would complicate their relationship with a partner (39%), affect a loving relationship with a partner (32%), and affect feelings of attractiveness (21%). in a uk - based survey, 42% of women with vaginal discomfort reported making excuses to avoid intercourse and 60% thought it had affected their confidence. in the clarifying vaginal atrophy 's impact on sex and relationships (closer) survey of approximately 4000 women with symptoms of va and approximately 4000 male partners of women who suffered from symptoms of va in north america and europe, 62% of women reported that vaginal discomfort caused them to avoid intimacy. the major reasons for this avoidance were loss of libido, finding sex painful, and concerns that sex would be painful. qualitative results from the focus groups were supported by data from quantitative surveys such as closer and viva which confirmed the distress that women feel regarding va and the urgent need to initiate the dialogue to improve postmenopausal women s quality of life. like any study, this focus group - meeting study has both strengths and weaknesses. the strengths include the opportunity for topic exploration and indirect questioning to obtain greater insights into the attitudes of women about va in a setting conducive to an interchange of ideas. this setting also allowed for ideas to be generated and feelings to be explored by encouraging interaction among the group. alternatively, the limitations of this qualitative study include small sample sizes and lack of power for statistical analyses, but the purpose of the study was to provide guidance for individualized discussions about va. women in the focus groups had symptoms of va but had failed to seek treatment for a variety of reasons, including failure to recognize va as a treatable condition. similarly, in the viva study, only 4% of participants recognized dryness, itching, burning, or soreness in the vagina, or pain during intercourse as va, and more than half (63%) did not realize that va was a chronic condition. focus group participants reported that hcps did not initiate discussions of va and, when these women described va symptoms to their doctors, they were told that these were a natural part of aging and should be endured. only 36% of hcps in the reveal (revealing vaginal effects at mid - life) survey said they had asked their patients about their vaginal health. including questions about vaginal health as a routine part of the postmenopausal well - woman examination has the potential to greatly increase the awareness and treatment of va. in particular, gps should be mindful that older women may not be receiving care from a gynecologist and should consider asking brief, open - ended questions that include a ubiquity statement describing va as a common condition of postmenopausal women. women in the focus groups were asked for their reactions to the term vaginal atrophy. vaginal atrophy participants were then given a definition of va that included a medical explanation of the hypoestrogenic state, a list of common va symptoms, and a statement that va is experienced by up to 40% of all women. this definition resonated with many of the women, who thought it described their symptoms, was straightforward, and validated their concerns with a scientific explanation. this experience was echoed by women who participated in the viva study ; only 2% of respondents thought that vaginal atrophy was a suitable term for dryness, itching, burning, soreness in the vagina, or pain during intercourse. clinicians may therefore wish to use alternate language to describe va, such as vaginal health following menopause, vaginal discomfort, or vaginal dryness. the nams and ims both recommend the use of let to relieve symptoms of va that do not respond to non - prescription therapies or where symptoms are severe. the options for let include a conjugated estrogen cream, an estradiol cream, a vaginal estradiol ring, and a vaginal tablet. each of these formulations has been shown to be efficacious, safe, and well - tolerated. the women who participated in focus groups were separated into personality types based on their strategies for coping with change. hcps may similarly incorporate a personalized approach to discussing va depending on behavioral cues provided by their patients. women who could be described as adventurers respond best to messages about treatments that can maximize their opportunity for pleasure while also allowing for spontaneity. adventurers draw information from many sources, particularly those on the internet. hcps can help adventurers, who were generally receptive to treatment, connect with scientifically sound resources. fighters respond best to scientific evidence presented in a straightforward but detailed manner and may therefore be persuaded to seek help by a well - informed hcp. happy - go - luckies preferred simple, convenient, and easy - to - use treatments. because these women may cope well with the adversity associated with va, it is particularly important that their hcp initiate the conversation about va. nurturers seek solutions that will bring them closer to their partners while remaining safe for both members of the relationship. nurturers may feel most comfortable speaking to friends or family ; however, an hcp may also provide information in the form of pamphlets that can be shared with a partner. finally, submissive security seekers can be persuaded by treatment options that are safe and discreet. this latter group was considered the least likely to initiate treatment, but they should not be considered a lost cause as they were among the most likely to respond to hcp recommendations. focus group participants reported that hcps did not initiate discussions of va and, when these women described va symptoms to their doctors, they were told that these were a natural part of aging and should be endured. only 36% of hcps in the reveal (revealing vaginal effects at mid - life) survey said they had asked their patients about their vaginal health. including questions about vaginal health as a routine part of the postmenopausal well - woman examination has the potential to greatly increase the awareness and treatment of va. in particular, gps should be mindful that older women may not be receiving care from a gynecologist and should consider asking brief, open - ended questions that include a ubiquity statement describing va as a common condition of postmenopausal women. women in the focus groups were asked for their reactions to the term vaginal atrophy. vaginal atrophy was viewed negatively because it sounded medical, overly intellectual, and somewhat frightening. participants were then given a definition of va that included a medical explanation of the hypoestrogenic state, a list of common va symptoms, and a statement that va is experienced by up to 40% of all women. this definition resonated with many of the women, who thought it described their symptoms, was straightforward, and validated their concerns with a scientific explanation. this experience was echoed by women who participated in the viva study ; only 2% of respondents thought that vaginal atrophy was a suitable term for dryness, itching, burning, soreness in the vagina, or pain during intercourse. clinicians may therefore wish to use alternate language to describe va, such as vaginal health following menopause, vaginal discomfort, or vaginal dryness. the nams and ims both recommend the use of let to relieve symptoms of va that do not respond to non - prescription therapies or where symptoms are severe. the options for let include a conjugated estrogen cream, an estradiol cream, a vaginal estradiol ring, and a vaginal tablet. each of these formulations has been shown to be efficacious, safe, and well - tolerated. the women who participated in focus groups were separated into personality types based on their strategies for coping with change. hcps may similarly incorporate a personalized approach to discussing va depending on behavioral cues provided by their patients. women who could be described as adventurers respond best to messages about treatments that can maximize their opportunity for pleasure while also allowing for spontaneity. adventurers draw information from many sources, particularly those on the internet. hcps can help adventurers, who were generally receptive to treatment, connect with scientifically sound resources. fighters respond best to scientific evidence presented in a straightforward but detailed manner and may therefore be persuaded to seek help by a well - informed hcp. happy - go - luckies preferred simple, convenient, and easy - to - use treatments. because these women may cope well with the adversity associated with va, it is particularly important that their hcp initiate the conversation about va. nurturers seek solutions that will bring them closer to their partners while remaining safe for both members of the relationship. nurturers may feel most comfortable speaking to friends or family ; however, an hcp may also provide information in the form of pamphlets that can be shared with a partner. finally, submissive security seekers can be persuaded by treatment options that are safe and discreet. this latter group was considered the least likely to initiate treatment, but they should not be considered a lost cause as they were among the most likely to respond to hcp recommendations. the 70 postmenopausal women who participated in this series of focus groups reacted to the challenges of menopause, including symptoms of va, in many different ways. these focus groups contributed to a growing body of work showing that menopausal women are often unaware that va is a medical condition and that it has prescription treatment options. based on their patient 's personality and their level of comfort and engagement with vaginal health, hcps may use some of the insights described here to encourage the appropriate use of let and improve their patient 's quality of life. | objectivethe impact of postmenopausal vaginal atrophy and women 's coping strategies were evaluated through international focus groups.methodsthree-hour focus groups of three to five postmenopausal women who had symptoms of vaginal atrophy but had not sought treatment were conducted in canada, sweden, the united states, and the united kingdom. participants were asked about their experience with menopause and vaginal atrophy, including use of non - prescription treatments and their interactions with health - care providers. women were classified as one of five personality types, based on their interaction with the world (individualism or belonging) and strategies for coping with stress (control or liberation).resultsvaginal atrophy was not recognized as a medical condition by focus group participants, and women had not used treatments for vaginal atrophy apart from non - prescription lubricants. women who had discussed vaginal atrophy symptoms with their doctor felt their concerns were dismissed as a normal part of aging, and they did not receive counseling about treatment options such as low - dose estrogen therapy. those whose coping strategy involved dominance, combatting, or individualism were more likely to seek treatment than those whose strategy involved submission, acceptance, or belonging. women who used control to cope with menopausal changes were more likely to respond to information validated by perceived experts than were those who used a strategy of release.conclusionswomen's reactions to their vaginal atrophy varied according to personality. use of a personality - based approach to patient counseling may encourage patients to discuss vaginal atrophy with their health - care provider and seek treatment. |
in india, the prevalence of inborn errors of metabolism is one in 2497 newborns and alkaptonuria have incidence of about 1/250, 000. a delay in diagnosis and treatment of this disease can result in arthritis and ochronosis (darkening of the tissues) due to the slow accumulation of the dark polymer of homogentisic acid (ha) in cartilage and other mesenchymal tissue ; this leads to the dark blackened spots in the sclera, cornea, ear cartilage, and arthritis with advancing age. one was a 4-month - old female baby born of a non - consanguineous marriage and another early presentation was reported at the age of 10 years with the complaint of bluish discoloration of sclera. our case was a 1-year 5-month - old male child, brought with complaints of reddish discoloration of the nappies and clothes and breath - holding spells. there was no history of crying while passing urine, poor urinary stream or bleeding from skin or mucus membrane. there was no history of fever, rash, abdominal pain, constipation or alteration of sensorium. the mother of the baby was a known case of thalassemia trait ; however, had never received transfusion. the baby s parents were consanguineous cousins. the father s thalassemia status could not be elicited. on examination, the baby weighed 8.5 kg with head circumference 44 cm and length 81 cm and the baby was conscious and alert. the capillary refill time was between 3 s and 4 s. the heart rate was 146/min. the baby was admitted for observation and investigations, and the initial differential diagnosis included alkaptonuria, myoglobinuria, hemoglobinuria, porphyria, and hemochromatosis. hemoglobin was 10.2 g / dl (normal 10.5 - 14 g / dl), packed cell volume, mean corpuscular volume (mcv) and mean corpuscular hemoglobin were low at 31.9% (normal 32 - 42%), 68 fl (normal 72 - 88 fl), and 21.8 pg (normal 24 - 30 pg), respectively. mcv concentration was 32% (normal 31.5 - 34.5%) and red cell distribution width 17.1% (normal 11 - 16%). serum iron, total iron binding capacity, and ferritin levels were within the reference range. hemoglobin analysis by cation exchange high - pressure liquid chromatography (hplc) revealed hb a0 to be 80.4% and hb a2 to be 6.1% (normal 2.40 - 3.60). the hplc picture on correlation with the complete hemogram suggested -thalassemia trait. the renal function and liver function were within the reference range. the child s urine porphyrin, estimations were within normal levels, and serum lead levels and -amino levulinic acid were not tested. no abnormalities were detected on the electroencephalogram, leading us to believe that the breath holding spells were due to anemia. urine was of normal color when voided but turned black over variable periods spontaneously ; furthermore, turned black with benedict s reagent, strong alkali (filter paper impregnated with 10% sodium hydroxide turned black within 5 min when dipped into the urine) and ferric chloride (addition of dilute ferric chloride solution drop by drop showed an evanescent violet blue color). however, it starts to darken upon standing, and this is caused by oxidation and polymerization of the homogentisic acid, and it is enhanced with an alkaline ph. benedict s test was strongly positive with red brown precipitate at the bottom and black colored supernatant. glucose oxidase test (with multistix) was negative excluding the role of glucose as reducing substance. for the qualitative assay of ha, to 0.5 ml of sample, a few drops of 10% ammonia was added followed by the addition of 3% silver nitrate solution. a greenish black color developed, signifying the presence of a substantial amount of ha. quantitative examination of urine by tandem mass spectrometry revealed that concentration of ha in urine was 91 mg / dl (normally ha is not present in urine). the child was treated symptomatically, and he was given vitamin c (50 mg once a day for 3 months), low phenylalanine and tyrosine diet, and advised to monitor counts, get liver and renal function tests carried out every 2 weeks. on the request of his parents, the child was discharged after 3 days and advised to follow - up in the outpatient department (opd). after 3 months post - therapy, his ha levels had not reduced. currently, the baby is under follow - up every 6 months in the opd. alkaptonuria is due to an inborn error of metabolism of the tyrosine linkage in the process of protein metabolism, the end product being 1, 4-dihydroxyphenyl - acetic (homogentisic) acids, which is passed into the urine. alkapton urine is normal in color when freshly passed, but on exposure to air and light rapidly darkens from the surface downwards, ultimately assuming a dark - brown or black color. therefore, its presence can be detected in urine quite readily by first making the urine strongly alkaline with caustic soda or caustic potash. this color change does not take place with the substances occurring normally in urine, or pathologically except with homogentisic acid. isolated case reports from india are also available. however, our case is probably the first documented case of alkaptonuria co - existing with thalassemia in a 1-year 5-month old baby with no symptom except reddish discoloration of nappies and clothes. our use of basic biochemical tests supported the heightened index of suspicion to lead us to a diagnosis in 3 days. the gene encoding homogentisate 1, 2-dioxygenase, is the only gene in which mutations are known to cause alkaptonuria. various presentations of alkaptonuric patients have been described such as aortic valve regurgitation and inferior myocardial infarction, ochronosis with joint pain, end - stage renal failure and pigmented conjunctival lesions. the aminoacids tyrosine and phenylalanine are not metabolized beyond the stage of homogentisic acid, which is, therefore, excreted in urine. ha is a strong reducing agent, which on exposure to atmospheric oxygen for some hours, gets converted to an oxidized polymer that is black in color. levels of ha in the blood are minimally increased because it is rapidly cleared by the kidneys. since, ascorbic acid impedes oxidation and polymerization of ha in vitro, its use has been suggested as a possible means of decreasing pigment formation and deposition. estimates show that 1.5% of world populations are carriers of -thalassemia, and about 50% of incidence is from south - east asian population, which mainly includes countries such as india, thailand, and indonesia. the carrier rate for -thalassemia varies from 1% to 17% in india with an average of 3.2%. curtin and kan although, co - incidence of more than one inherited disease in highly consanguineous kinships has been described, the novel combination of alkaptonuria and -thalassemia has not yet been reported in the literature. further, genetic studies are required to analyze any possible linkage between thalassemia and alkaptonuria. we would however like to stress that in infancy, a history of dark - stained diapers should alert the physician to alkaptonuria, and they can be evaluated with simple urine testing on an outpatient basis. a mild dietary restriction of phenylalanine and tyrosine reduces ha excretion, thus, avoiding or minimizing later complications. the mild antioxidant nature of ascorbic acid helps to retard the process of conversion of homogentisate to the polymeric material that is deposited in cartilaginous tissues. although limited use of nitisinone, an inhibitor of the enzyme 4-hydroxyphenylpyruvate dioxygenase, which mediates the formation of ha, has been reported, safety of prolonged use is still an open question. | since the aggregate incidence of inborn errors of metabolism is relatively high, a high degree of suspicion is essential to correctly diagnose an inborn error of amino acid metabolism. we report a case of alkaptonuria an autosomal recessive disorder that occurs due to deficiency of homogentisic acid oxidasein a -thalassemia infant presenting with reddish discoloration of nappies and clothes, breath holding spells, and microcytic hypochromic anemia. born to consanguineous cousins, to our knowledge, the combination of -thalassemia and alkaptonuria, which we have described in this baby, has not been reported earlier. |
aspirin and other agents characterized as nonsteroidal anti - inflammatory drugs (nsaids) are designed primarily to decrease pain and inflammation. the molecular basis for actions of nsaids is believed to be their ability to inhibit cyclooxygenase (cox) activity and block the production of prostaglandins. among nsaids, aspirin and sulindac can prevent the development of colon cancer and act as an anti - inflammatory agent by their inhibition of prostaglandin synthesis. cancer of the uterine cervix is the second leading cause of death from cancer in women worldwide and also the most prevalent gynecological malignancy in korea. we investigated whether aspirin induced apoptosis in human cervical cancer hela cells. to investigate the mechanism by which aspirin exerts its apoptosis effects, the effect of aspirin on the gene expression was studied by differential mrna display rt - pcr (dd rt - pcr). employing dd rt - pcr methods, we identified aspirin - responsive gene and mu - type calpain, which was confirmed by real - time quantitative pcr. the two isoforms are classified according to their ca requirements : mu - type calpain and m - type calpain require micromolar and millimolar concentrations of ca for activation, respectively. growing evidence suggested that calpain may play a central role in the execution of apoptosis via modulation of caspase-3 activity in glucocorticoid - treated and irradiated thymocytes, neuronal cells exposed to uv, or mcf-7 breast cancer cells treated with -lapachone [57 ]. further progress in cancer prevention would depend on understanding the mechanisms through which aspirin exerts molecular action. however, the molecular mechanisms through which aspirin alters colonic tumorigenesis are unknown. in this report, we describe a potential mechanism by which aspirin induces apoptosis in human cervical cancer cells. to examine whether mu - type calpain mediates antitumor effects in hela cells, hela cells were stably transfected with mu - type calpain cdna. tumor formation and caspase-3 activity of stably transfected cells were measured in nude mice. in this paper, we suggest that aspirin has an antitumor effect via the expression of mu - type calpain gene in cervical cancer cells. human cervical cancer cells, hela, were plated in a 24-well plate at a density of 1 10 cells / well and treated with various doses of aspirin. to detect an apoptotic body, cells were stained with hoechst 33342 dye and assessed for morphological signs of apoptosis. the proportion of cells in g0/g1, s, and g2/m was determined by flow cytometric analysis of dna content (becton dickinson, peterson, nj, usa). total rna was extracted from cells with trizol reagent (invitrogen, carlsbad, calif, usa), following the protocol that was provided. cell monolayers were washed with pbs, and 1 ml of trizol/10 cells with 4 units of rnase inhibitor were added. for each sample, 2 g of rna were treated with dnase l (roche, basel, switzerland) at 37c for 30 minutes to remove contaminating dna. one - base - anchored oligo - dt primers were used to reverse transcribed total rna into first - strand cdna, which were amplified subsequently by pcr using the arbitrary upstream primers. pcr products were labeled with 2 ci of [p]dctp (amersham, arlington, ill, usa), and analyzed on a 6% polyacrylamide - urea gel. the cdna bands that were unique to control or aspirin - treated cells were cut out of the gel, eluted, and reamplified by pcr. the candidate cdna was cloned into pgem - t vector (promega, madison, wi, usa). we relied on the taqman assay (perkin - elmer model 7700 ; foster city, ca, usa) to quantitate the amount of calpain mrna. the forward and reverse primers and the fam - tagged probe used for the mu - type calpain gene in the assay were 5-ggatgtcattccgagact, 5-ctcgtagaccgcgaag, and 5-6fam - tctgcaacctcacacccgac - tamra, respectively. the forward and reverse primers and fam - tagged probe used for the - actin gene were 5-aacttgagatgtatgaaggcttttgg, 5-tttttttttttttttttttttttttttttaag, and 5-6fam - caactggtctcaagtcagtgtacaggtaagccct - tamra, respectively. to measure the relative abundance of the calpain gene in any given rna sample, the amplification value derived using the calpain sequence was divided by the amplification value using the - actin sequence. the mu - type calpain cdna was retrieved with the following primers : forward 5-aggatgtcggaggaga and reverse 5-ccagtacacaagtccct. pcr reaction products were cloned into pcr3.1 vector (invitrogen). the vector pcr or recombinant pcrcal was stably transfected into hela cells by liposome. control, vector - transfected (pcr / hela), and calpain - transfected cells (pcrcal / hela) were counted by the trypan blue exclusion assay and coulter counter (coulter corporation, fl, usa) for measuring stably transfected cell growth. five experiments. cells (1.5 10) were plated in cell culture dishes (100 mm) and allowed to attach for 48 hours under cell culture conditions. then the cells were treated and the activity of caspase-3 was measured using the fluorogenic enzyme substrates, z - devd - afc (molecular probes, eugene, ore, usa). samples were read in a fluorometer equipped with a 400 nm excitation filter and 505 nm emission filter. balb / c nu / nu mice, 46 weeks of age, were acclimated and caged in groups of five. hela, pcr / hela, and pcrcal / hela cells (1.5 10) were injected subcutaneously into the right flank of the nude mouse. the mean tumor diameter was measured by dial caliper, and the volume was calculated by the formula : volume (mm) = (square root of width length). the experiment was repeated three times and performed according to the guidelines of the animal experimental committee, national institute of health, south korea. statistical calculations were performed using the microsoft excel 97 program (1998 ; microsoft co., redmond, wash, usa) to estimate p - value. the significance level (p - value) we performed dna synthesis assay to study the effects of aspirin on hela cells. aspirin inhibited growth of cervical cancer cells in a time- and concentration - dependent manner (data not shown). aspirin - induced morphological changes were evident in a concentration - dependent manner (see figure 1). cells treated with aspirin became sparse, long squared, and detached from the dishes. apoptotic bodies (indicated by white arrows in figure 1) were shown after aspirin treatment. to show apoptosis in the cells treated with aspirin, flow cytometry analysis was performed. the population of sub - g1 phase was changed from 1.2 to 18.9% in cells treated with 1 mm aspirin for 48 hours. that of sub - g1 phase at 2 and 3 mm was in the similar range. after hela cells were treated with aspirin for 48 hours, we performed differential display rt - pcr and selected differentially expressed genes, which was expressed with absolute difference between control and aspirin - treated cells. expression of calpain mrna was confirmed by real - time quantitative pcr (see figure 2). calpain gene was highly expressed in aspirin - treated hela cells in a concentration - dependent manner. calpain gene was upregulated by 4.4, 6, and 8.8 folds in the 1, 2, and 3 mm aspirin - treated hela cells, respectively. we have cloned mu - type calpain cdna into pcr3.1 vector. the vector pcr or recombinant pcrcal was stably transfected into hela cells (pcr / hela cell or pcrcal / hela cell). to assess whether change of cell biology was caused after gene transfection, we measured cell proliferation. pcrcal / hela cells appeared to have a markedly different growth pattern compared with hela cells and pcr / hela cells (see figure 3(a)). to establish a relationship between calpain and caspase-3, caspase-3 activities were measured. as shown in figure 3(b), caspase-3 activity was elevated in pcrcal / hela cells. the markedly increased activity levels of caspase-3 in pcrcal / hela cells suggest a correlation of caspase-3 activity and calpain protein. in investigation of calpain role in the tumorigenicity 1.5 10 stably transfected cells were subcutaneously injected into the flank of the mouse. when tumor burden was measured by day 49, hela cells and pcr / hela cells produced tumors of 2126 163 mm and 1638 213 mm, respectively, while pcrcal / hela cells produced markedly small tumor of 434 206 mm in volume (see figure 3(c)). we report that aspirin inhibited the proliferation of cervical adenocarcinoma cells in a time- and dose - dependent manner. this agrees with other studies showing that aspirin inhibited the proliferation of cancer cells [2, 4, 812 ]. apoptosis was shown to be responsible for the cell growth inhibitory effects of aspirin in ht29 human colon carcinoma cells. our morphological observation of nuclear condensation after aspirin treatment suggests that aspirin increases apoptosis in cervical cancer cells (see figure 1). these results demonstrate that aspirin is an effective antitumor drug that induces apoptosis in cervical cancer cells. a few molecular mechanisms of aspirin have been proposed. it is well known that activation of p53 expression is involved. in this study, we have shown that aspirin induces the calpain gene and calpain gene activation inhibits the tumor formation. these results support the previous findings that aspirin induces apoptosis by the regulation of bcl-2 and caspase-3 in human cervical cancer cells [3, 17 ]. therefore, aspirin might play roles in the inhibition of tumor formation through activation of calpain gene. calpain is a calcium - dependent cysteine protease that is implicated in calcium - dependent cell death [17, 18 ]. calpain plays an essential role in apoptotic commitment by cleaving bax and generating the bax / p18 fragment, which in turn mediates cytochrome c release and initiates the apoptotic execution. calpain activation plays a critical role in cancer cell adhesion and motility ; and calpain could be related to a therapeutic strategy targeting multiple disease states [2124 ]. in our experiments, caspase-3 activity was increased in the calpain - transfected hela cells, suggesting a correlation of calpain and caspase-3 (see figure 3(b)). the involvement of caspase-3 in the calpain action is in agreement with the results in the photoreceptor cell, where calpain executes apoptosis via modulation of caspase-3 activity. accompanying the increased caspase-3 activity, tumor growth was reduced by calpain gene expression, leading to the role of calpain as an apoptosis mediator (see figure 3(c)). have analyzed calpain release from cultured chondrocytes stimulated by a proinflammatory cytokine, tumor necrosis factor- (tnf-). the effects of nsaids on calpain release were also examined. however, their results were in contrast to our expectation. nsaids examined (aspirin, loxoprofen - srs, diclofenac sodium, indomethacin, and ns398) potently inhibited tnf--induced release of calpain. in addition, they showed that pge2 alone failed to stimulate, but it significantly augmented the release of calpain in the presence of 1 ng / ml tnf- in hcs-2/8 cells. moreover, inhibition of calpain release by an nsaid, loxoprofen - srs, was significantly reversed by 100 nm pge2. therefore, we suggest that aspirin may have cancer - preventing effects through calpain gene expression, which leads to caspase-3 activation. | aspirin and other nonsteroidal anti - inflammatory drugs show efficacy in the prevention of cancers. it is known that they can inhibit cyclooxygenases, and some studies have shown that they can induce apoptosis. our objective in this study was to investigate the mechanism by which aspirin exerts its apoptosis effects in human cervical cancer hela cells. the effect of aspirin on the gene expression was studied by differential mrna display rt - pcr. among the isolated genes, mu - type calpain gene was upregulated by aspirin treatment. to examine whether calpain mediates the antitumor effects, hela cells were stably transfected with the mammalian expression vector pcr3.1 containing mu - type calpain cdna (pcrcal / hela), and tumor formations were measured in nude mice. when tumor burden was measured by day 49, hela cells and pcr / hela cells (vector control) produced tumors of 2126 mm3 and 1638 mm3, respectively, while pcrcal / hela cells produced markedly smaller tumor of 434 mm3 in volume. the caspase-3 activity was markedly elevated in pcrcal / hela cells. the increased activity levels of caspase-3 in pcrcal / hela cells, in parallel with the decreased tumor formation, suggest a correlation between caspase-3 activity and calpain protein. therefore, we conclude that aspirin - induced calpain mediates an antitumor effect via caspase-3 in cervical cancer cells. |
many studies have shed insight on particular trends in the number and morphology of roots of mandibular premolar and molars amongst different races,1 and information regarding the number of roots and shape is important for dental procedures such as surgical extractions, periodontal treatments, orthodontic movements, and root canal treatments.2 a number of studies have reported that the number of roots and root canal types may vary according to ethnicity, and a literature search reveals that comparatively few studies have evaluated the root anatomy of mandibular premolars and molars in ethnic populations using cone - beam computed tomography (cbct).3 cbct is advancement in ct imaging, and it has potential applications for the imaging of high - contrast structures in the head and neck, as well as dentomaxillofacial regions ; it has been applied in periodontal evaluations ; endodontics, including assessment of periapical pathology and periradicular surgical planning ; orthodontic evaluations ; and dentoalveolar trauma evaluation.4,5 the cbct scanner can collect volume data by means of a single rotation with a cone - shaped x - ray beam and two - dimensional detectors,6 and cbct is capable of providing images of high diagnostic quality, with shorter scanning times and lower radiation dosages compared to those of conventional ct scans.7,8 recently, a study was conducted to investigate the incidence of distolingual (dl) roots in the mandibular molars using cbct scans, and it was suggested that this method may be a practical tool for noninvasive and 3-dimensional reconstruction imaging for use in morphologic analyses and endodontic applications.9 the main purpose of this study was to investigate the root and morphology of korean mandibular premolars and molars, and to evaluate the prevalence of three - rooted mandibular first molars having distolingual root (radix entomolaris), three - rooted mandibular second molars, and c - shaped (gutter - shaped) roots in mandibular second molars. cbct images of mandibular first premolars, second premolars, first permanent molars, and second premolars were collected from patients who visited the dental hospital at seoul st. we evaluated 430 patients aged 38.118.1 (n=236 females and 194 males ; table 1). the axial thickness was 0.4 mm, the voxels were isotopic, and the obtained data were analyzed with m - view (seoul, korea). serial axial cbct images were evaluated continuously by moving the toolbar from the floor of the pulp chamber to the apex to determine the number of roots and their morphology. to evaluate the bilateral occurrence of 3-rooted mandibular first molars, 3-rooted mandibular second molars, and c - shaped mandibular second molars, we only evaluated patients who had bilateral mandibular first molars or bilateral mandibular second molars (figure 16). the total number of roots, the incidence, and the correlations between left- and right - side occurrences and between males and females were analyzed with commercially available software (pasw statistics 18, spss inc. statistically significant differences were evaluated using the chi - square test, with significance set at p.05 ; table 3 and 4). in addition, 784 mandibular second premolars were one - rooted (99.4%), and five second premolars (0.6%) were two - rooted teeth. there were no significant differences between females and males regarding the overall occurrence of the roots (p>.05). likewise, the occurrence on the left side and the right side did not show any statistically significant difference (p>.05 ; tab. 3 and 4). the majority of first molars (77.4%) had one mesial and one distal root (table 3 and 4). one hundred sixty - two mandibular first molars (22.3%) had dl roots, and two first molars (0.3%) were one - rooted teeth. the bilateral incidence of three - rooted mandibular first molars was similar between male (n=28) and female subjects (n=25 ; p>.05 ; table 5). regardless of gender, the overall occurrence on the left side and the right side showed a statistically significant difference (p=.011). the right mandibular first molar (tooth n=90, 13.5%) had a higher incidence of being a three - rooted tooth when compared with the left side (tooth n=59, 8.9%). most mandibular second molars (54.5%) were two - rooted teeth with one mesial and one distal root ; 2.3% of the second molars had three roots having one dl root, and one tooth (0.1%) had three roots with two mesial roots. in total, 293 teeth (41.3%) had c - shaped roots (table 3 and 4). the bilateral incidence of a three - rooted mandibular second molar having one dl root was similar between females (n=2) and males (n=2 ; table 5). the right mandibular second molars (tooth n=6) had a similar incidence of being a three - rooted tooth when compared with the left side (tooth n=7). the bilateral incidence of a c - shaped mandibular second molar having one dl root was higher in females (n=77) than in males (n=45 ; p.05 ; table 3 and 4). in addition, 784 mandibular second premolars were one - rooted (99.4%), and five second premolars (0.6%) were two - rooted teeth. there were no significant differences between females and males regarding the overall occurrence of the roots (p>.05). likewise, the occurrence on the left side and the right side did not show any statistically significant difference (p>.05 ; tab. the majority of first molars (77.4%) had one mesial and one distal root (table 3 and 4). one hundred sixty - two mandibular first molars (22.3%) had dl roots, and two first molars (0.3%) were one - rooted teeth. the bilateral incidence of three - rooted mandibular first molars was similar between male (n=28) and female subjects (n=25 ; p>.05 ; table 5). regardless of gender, the overall occurrence on the left side and the right side showed a statistically significant difference (p=.011). the right mandibular first molar (tooth n=90, 13.5%) had a higher incidence of being a three - rooted tooth when compared with the left side (tooth n=59, 8.9%). most mandibular second molars (54.5%) were two - rooted teeth with one mesial and one distal root ; 2.3% of the second molars had three roots having one dl root, and one tooth (0.1%) had three roots with two mesial roots. in total, 293 teeth (41.3%) had c - shaped roots (table 3 and 4). the bilateral incidence of a three - rooted mandibular second molar having one dl root was similar between females (n=2) and males (n=2 ; table 5). the right mandibular second molars (tooth n=6) had a similar incidence of being a three - rooted tooth when compared with the left side (tooth n=7). the bilateral incidence of a c - shaped mandibular second molar having one dl root was higher in females (n=77) than in males (n=45 ; p<.05). the right mandibular second molar (n=146, 22.1%) had a similar incidence of having a c - shaped root when compared with the left side (n=135, 20.5% ; p=.512 ; tab. this study used cbct to evaluate the number of roots and the morphology of premolars and molars in 430 korean individuals. mandibular first premolars and second premolars almost all of the mandibular first premolars (99.9%) were reported to be single - rooted, and only 0.1% had two roots ; these results are similar to the findings of a previous report, which showed the incidence of one root and two roots to be 98% and 0.2%, respectively.10 the majority of mandibular second premolars (99.4%) had one root, and the incidence of two roots was extremely rare (0.6%). previous studies have found that almost all of the second premolars were single - rooted (99.6%), and the incidences of two roots and three roots were 0.3% and 0.1%, respectively.11 in this study, the majority (77.4%) of 726 mandibular first molars had two roots located mesially and distally, and 22.3% of mandibular first molars had an additional root located distolingually. when present, the additional root in a mandibular molar is usually located distolingually, and this additional dl root is called the radix entomalaris.12 it is considered to be a normal morphologic variant and may be identified as a mongolian trait.9 it is reported that the mongoloid population exhibits significantly more mandibular first molars with three roots than other populations, with a 3:1 ratio when compared with caucasians and african americans ; this variation could be considered a genetically determined characteristic.13 this result was similar to the evaluation of a western chinese population by cbct, showing that 25.8% of the pool of cases examined had an extra dl root in the mandibular first molars.3 unilateral or bilateral occurrence of an additional root in the first permanent molar has been studied.14 in some reports, all three - rooted molars occurred unilaterally.12 the incidence rates of bilateral and unilateral three - rooted first molars in korean individuals in the present study were 15.9% and 6.5%, respectively. if the incidence was calculated using three - rooted molars as the denominator, the bilateral and unilateral distribution increased to 71.1% (106/149) and 28.9% (43/149), respectively. the bilateral occurrence rates of previous studies conducted among asian populations were 57.0% (japan),15 61.0% (hong kong),16 68.6% (taiwan),17 and 88.0% (taiwan).18 several investigators have reported a gender predilection of the distolingual root in the mandibular first molar. many studies have found male predominance,9,14,15,17,1921 but some studies have also reported that the prevalence is greater among females.17 in the present study, there was no significant difference according to gender (female vs. male, p=.461). topologic predilection for the presence of the dl root in the mandibular first molar may be a controversial issue.3 many previous studies have identified a predilection for the right side,2,9,14,17 but some investigators have reported the opposite.3 the present study showed a predilection for the occurrence of dl roots on the right side for first molars. in the case of mandibular second molars, the majority (54.5%) of 710 teeth had two roots located mesially and distally, and 2.3% of mandibular first molars had an additional root located distolingually. in a very rare case (0.1%), an additional root was detected at the mesiobuccal side, and this root is called the radix paramolaris.12 according to previous reports, the incidence of two separate roots is similar to the finding of the present study ; past research has demonstrated 54.0% among thai study participants1 and 58.2% among burmese participants.22 there was a similar predilection for the occurrence of additional dl roots on the right side and left side for second molars (p=.077), and the prevalence of the dl root showed no statistically significant difference between genders (p=.782). c - shaped roots occurred in 41.3% of mandibular second molars in this study. it is reported that the radiographic appearance of a c - shaped root in mandibular second molars may differ, depending on the exact morphology and orientation of the root.22 the percentage of c - shaped roots in the mandibular second molars varied significantly between previous studies, which have reported 6.0% in sri lanka,23 10.0% in the sudan,24 10.6% in saudi arabia,25 10.9% in thailand,1 and 22.4% in the burmese population.22 a higher incidence of c - shaped roots was reported among chinese and korean populations.26,27 furthermore, 31.5% of the mandibular second molars had c - shaped roots from hong kong,26 and 32.7% of the mandibular second molars in the korean population under clinical evaluation had c - shaped canals;27 in addition, using ct, c - shaped canals were found in 98 teeth (44.5%) out of 220 teeth in this korean population.28 root and root canal anatomy of mandibular second molars from hong kong populations revealed a higher incidence of c - shaped canals (52%).29 the c - shaped root canal system is an anatomical variation found mostly in mandibular second molars,30 more frequently in asians than in other racial groups.31 the incidence rates of bilateral and unilateral c - shaped root in the second molars in korean individuals in the present study were 37.0% and 5.6%, respectively. if the incidence was calculated using c - shaped second molars as the denominator, the bilateral and unilateral distribution increased to 86.8% (244/281) and 13.2% (37/281), respectively. this study showed that the prevalence was greater in female (tooth n=178) subjects compared to male subjects (tooth n=103 ; p<.05). however, there were similar incidence rates of additional dl roots on the right side (tooth n=146) and left side (tooth n=135) for the second molars (p=.512). understanding the anatomy of roots of permanent premolars and molars may help dental practitioners performing both endodontic and periodontal procedures.12,32 this knowledge may help the operator during diagnosis and treatment for endodontic therapy.33 it was reported that a significantly higher magnitude of periodontal parameters (probing depth and clinical attachment loss) at the distolingual site of molars with the dl root than in molars without the dl root in molars with advanced periodontitis ; and it is plausible that an additional root may also be a contributing factor to localized periodontal destruction.34 c - shaped roots may have narrow root grooves that are pre - disposed to localized periodontal disease.22 in this study, the majority (77.4%) of 726 mandibular first molars had two roots located mesially and distally, and 22.3% of mandibular first molars had an additional root located distolingually. when present, the additional root in a mandibular molar is usually located distolingually, and this additional dl root is called the radix entomalaris.12 it is considered to be a normal morphologic variant and may be identified as a mongolian trait.9 it is reported that the mongoloid population exhibits significantly more mandibular first molars with three roots than other populations, with a 3:1 ratio when compared with caucasians and african americans ; this variation could be considered a genetically determined characteristic.13 this result was similar to the evaluation of a western chinese population by cbct, showing that 25.8% of the pool of cases examined had an extra dl root in the mandibular first molars.3 unilateral or bilateral occurrence of an additional root in the first permanent molar has been studied.14 in some reports, all three - rooted molars occurred unilaterally.12 the incidence rates of bilateral and unilateral three - rooted first molars in korean individuals in the present study were 15.9% and 6.5%, respectively. if the incidence was calculated using three - rooted molars as the denominator, the bilateral and unilateral distribution increased to 71.1% (106/149) and 28.9% (43/149), respectively. the bilateral occurrence rates of previous studies conducted among asian populations were 57.0% (japan),15 61.0% (hong kong),16 68.6% (taiwan),17 and 88.0% (taiwan).18 several investigators have reported a gender predilection of the distolingual root in the mandibular first molar. many studies have found male predominance,9,14,15,17,1921 but some studies have also reported that the prevalence is greater among females.17 in the present study, there was no significant difference according to gender (female vs. male, p=.461). topologic predilection for the presence of the dl root in the mandibular first molar may be a controversial issue.3 many previous studies have identified a predilection for the right side,2,9,14,17 but some investigators have reported the opposite.3 the present study showed a predilection for the occurrence of dl roots on the right side for first molars. in the case of mandibular second molars, the majority (54.5%) of 710 teeth had two roots located mesially and distally, and 2.3% of mandibular first molars had an additional root located distolingually. in a very rare case (0.1%), an additional root was detected at the mesiobuccal side, and this root is called the radix paramolaris.12 according to previous reports, the incidence of two separate roots is similar to the finding of the present study ; past research has demonstrated 54.0% among thai study participants1 and 58.2% among burmese participants.22 there was a similar predilection for the occurrence of additional dl roots on the right side and left side for second molars (p=.077), and the prevalence of the dl root showed no statistically significant difference between genders (p=.782). it is reported that the radiographic appearance of a c - shaped root in mandibular second molars may differ, depending on the exact morphology and orientation of the root.22 the percentage of c - shaped roots in the mandibular second molars varied significantly between previous studies, which have reported 6.0% in sri lanka,23 10.0% in the sudan,24 10.6% in saudi arabia,25 10.9% in thailand,1 and 22.4% in the burmese population.22 a higher incidence of c - shaped roots was reported among chinese and korean populations.26,27 furthermore, 31.5% of the mandibular second molars had c - shaped roots from hong kong,26 and 32.7% of the mandibular second molars in the korean population under clinical evaluation had c - shaped canals;27 in addition, using ct, c - shaped canals were found in 98 teeth (44.5%) out of 220 teeth in this korean population.28 root and root canal anatomy of mandibular second molars from hong kong populations revealed a higher incidence of c - shaped canals (52%).29 the c - shaped root canal system is an anatomical variation found mostly in mandibular second molars,30 more frequently in asians than in other racial groups.31 the incidence rates of bilateral and unilateral c - shaped root in the second molars in korean individuals in the present study were 37.0% and 5.6%, respectively. if the incidence was calculated using c - shaped second molars as the denominator, the bilateral and unilateral distribution increased to 86.8% (244/281) and 13.2% (37/281), respectively. this study showed that the prevalence was greater in female (tooth n=178) subjects compared to male subjects (tooth n=103 ; p<.05). however, there were similar incidence rates of additional dl roots on the right side (tooth n=146) and left side (tooth n=135) for the second molars (p=.512). understanding the anatomy of roots of permanent premolars and molars may help dental practitioners performing both endodontic and periodontal procedures.12,32 this knowledge may help the operator during diagnosis and treatment for endodontic therapy.33 it was reported that a significantly higher magnitude of periodontal parameters (probing depth and clinical attachment loss) at the distolingual site of molars with the dl root than in molars without the dl root in molars with advanced periodontitis ; and it is plausible that an additional root may also be a contributing factor to localized periodontal destruction.34 c - shaped roots may have narrow root grooves that are pre - disposed to localized periodontal disease.22 there was a high prevalence of three - rooted mandibular first molars and c - shaped roots in mandibular second molars from this korean population, identified using cbct, and the results showed similarities with previous studies of asian populations. cbct may be a practical method to evaluate the number and shape of teeth and to compare the results of previous studies regarding the occurrence of these types of teeth among different ethnic groups ; in addition, cbct can be used to collect data regarding the occurrence and morphology of the roots, thus offering useful information to dental practitioners. | objective : the purpose of this study was to investigate the root / number of roots and morphology of mandibular premolars and molars in a korean population, and to evaluate the prevalence of three - rooted mandibular first molars having distolingual (dl) roots, three - rooted mandibular second molars, and c - shaped roots in mandibular second molars.methods:serial axial cone - beam computed tomography (cbct) images of the mandibles were collected from 430 korean patients. the total number of roots in the mandibular premolars and molars was counted, and the incidence and the correlations between left- and right - side occurrences and between males and females were analyzed.results:the majority of mandibular first premolars and second premolars had one root (99.9% and 99.4%, respectively). three - fourth of first molars (77.4%) had one mesial and one distal root, and the incidence of a three - rooted tooth having dl root was 22.3%. a little more than half the number of mandibular second molars (54.5%) were two - rooted. finally, 2.3% of the second molars had three roots having one dl root, and 41.3% had c - shaped roots.conclusion:there was a high prevalence of three - rooted mandibular first molars and c - shaped roots in mandibular second molars among a korean population, detected using cbct, and the results showed similarities with previous reports about other asian populations. it may be suggested that cbct is a practical method of evaluating the number and shape of teeth. data regarding the occurrence and morphology of the roots may provide useful information to dental practitioners. |
pyogenic granuloma is an excessive proliferation of granulation tissue that usually develops after minor trauma or surgery. the objective of our report is to describe the clinicopathological feature of this rare disease and give insight on clinical features that help in the diagnosis. this report presents a case of a four year old child who had fleshy growth of one week duration on the right eye after seven weeks of pain and redness. therefore, it should be considered as a differential diagnosis in corneal mass especially after an infection or trauma. pyogenic granuloma is an exuberant proliferation of granulation tissue that typically develops after minor trauma or surgery. ocular pyogenic granulomas are usually found on the external surface of the eyelid or the palpebral conjunctiva. corneal pyogenic granuloma is rare - only few cases have been reported, and the probable reason could be corneas ' avascularity (1, 2). a constant clinical finding of these reported corneal lesions is either an epithelial defect in the presence of corneal neovascularization and ocular surface disease or mechanical irritation. it can rarely complicate corneal surgeries, and there is one report following penetrating keratoplasty (3). because of its rarity, it could be misdiagnosed as ocular malignant lesion and could end up in destructive surgeries like enucleation (2, 4). we report an unusual case of pyogenic granuloma of the cornea in a 4 year old male child presented to jimma university specialized hospital ophthalmology department in september 2012. a four years old boy was admitted to jimma university specialized hospital department of ophthalmology on september 14, 2012 with a complaint of fleshy growth on the right eye. eight days before presentation, the family noticed a small, fleshy, pinkish growth at the center of the right eye. the lump increased in size within a short period and caused irritation and difficulty closing the lids. the child had ocular pain, redness of the eye, photophobia and swelling of the lids for six weeks before the development of the lump. subsequently, the symptoms worsened and the child lost vision after a few weeks of the onset of pain and redness. he had eye discharge and difficulty opening the eye since the onset of the illness. on examination, the eye was full of mucopurulent discharge ; the cilia were matted ; the lid was swollen, and the conjunctiva was injected. on the cornea, there was a pink, fleshy, vascularized, sessile mass (7 mm 5 mm) at the center (figure 1). injected eye with discharge and sessile mass on the cornea with the impression of corneal pyogenic granuloma, we admitted the child. after admission, he was treated with topical ciprofloxacin every 1 hour for 2 days and then every 2 hours for three days. the eye was irrigated and cleaned daily with normal saline to wash off the discharge. subsequently, the antibiotic was tapered till the infection was cleared (figure 2). a child with corneal mass after infection was controlled after the infection was controlled, the mass was excised from the cornea and sent for pathologic examination (figure 3). the histopathological examination showed extensive ulceration of the corneal epithelium with underlying granulation tissue formation and regeneration of the remaining epithelium and no atypia was seen within the limit of the biopsy. a child with pyogenic cornea granuloma intra the patient was followed up for more than a month with topical antibiotic and cycloplegic. subsequently, the defect healed and leucoma corneal opacity (figure 4) developed with the final visual acuity of light perception. a child with corneal scaring after corneal granuloma excision pyogenic granulomas were originally described by poncet and dor in 1897 (5). the term is a misnomer since it contains neither the inflammatory (purulent) exudate nor the typical epitheloid giant cell reaction characteristic of granulomatous inflammation. granulation tissue consists of proliferating connective tissue (fibroblasts and fibrocytes) and newly formed capillary channels. it may also occur in the mucosal regions such as gingiva, hard palate, cheek, tongue, and the nasal fossa. in the eye, it has been reported to arise at many sites, including the eyelid skin, conjunctiva, limbs, lacrimal puncta, acquired ophthalmic orbits and veins of the ocular adnexa. the occurrence of pyogenic granuloma on the cornea is relatively rare (1, 2). its occurrence on the cornea was first reported by minckler (4) who reported a case which was misdiagnosed as conjunctival squamous cell carcinoma and after enucleation confirmed to be pyogenic granuloma of the cornea. the commonest clinical presentation of the corneal pyogenic granuloma is a rapidly growing lump which, on slit lamp examination, appears as well circumscribed, smooth surfaced, pink, sessile, and highly vascularized mass (2, 6, 7). there is also a case report with the appearance of smooth hemorrhagic surface due to bleeding into the mass (8). the size of the mass in our patient was within the range of the reported cases which is 33 mm to 8x9 mm. most of the patients with pyogenic granuloma of the cornea had a rapid course with presentation within one month of the onset of the growth (68) which was also the case in our patient. cornea pyogenic granuloma commonly grows at the sites of pre - existing corneal trauma or corneal ulcer due to infectious keratitis which are the two commonly identified risk factors (1, 2, 6, 7, 9). the commonest type of trauma associated with corneal pyogenic granuloma is mechanical injury, and there is also a case report of corneal pyogenic granuloma following snake oil the other risk factors are ocular surgeries like penetrating keratoplasty (3) and surgery for ocular surface neoplasia (8). there is also a case report of spontaneous development of corneal pyogenic granuloma (10). the histopathological finding of our case was consistent with the common histopathological findings of corneal pyogenic granuloma. the typical histopathological finding of pyogenic granuloma is an excessive proliferation of granulation tissue with mononuclear cell infiltration (2, 6, 7). corneal pyogenic granuloma can be a challenging case to diagnose especially if it involves the limbus. there were cases misdiagnosed as conjunctival squamous cell carcinoma and ended with enucleation (5, 11). other differential diagnoses include anterior segment choristoma, a vascular hamartoma or a viral papilloma (6). the age of onset, history of prior trauma or infection, rapid growth and the clinical appearance will often point to the correct diagnosis., we suspected that the lesion was a pyogenic granuloma because it was acquired with underlying keratitis, grew rapidly and it was confirmed by histopathological examination. there is one case report which showed recurrence of the problem after excision (12). after surgical excision of the mass, the cornea may heal with scarring, especially if there is an underlying inflammatory process like our case. our patient did not get such service due to lack of well established service in our center and because the other centers were inaccessible for the patient. despite its rarity, pyogenic granuloma should be considered in any patient with a fleshy, vascularized, elevated, rapidly growing corneal mass, especially in the setting of corneal infection. | backgroundpyogenic granuloma is an excessive proliferation of granulation tissue that usually develops after minor trauma or surgery. ocular involvement usually happens on the external surface and cornea is rarely involved. the objective of our report is to describe the clinicopathological feature of this rare disease and give insight on clinical features that help in the diagnosis.case reportthis report presents a case of a four year old child who had fleshy growth of one week duration on the right eye after seven weeks of pain and redness. slit lamp examination showed vascularized central corneal mass with surrounding stromal infiltrates. the mass was excised, and histopathological examination confirmed pyogenic granuloma of the cornea.conclusioncorneal pyogenic granuloma could be a rare complication of infectious keratitis. therefore, it should be considered as a differential diagnosis in corneal mass especially after an infection or trauma. |
mullerian duct anomalies (mda), though rare, can be a treatable cause of pelvic pain and infertility. the spectrum of mullerian duct anomalies is a continuum rather than distinct entities, and some complex anomalies have features of more than one class. since there are no precise clinical or imaging criteria to enable specific categorisation of such anomalies, there is ambiguous classification of these anomalies by various radiologists and clinicians. we report a case of a rare complex mda, diagnosed as unicornuate uterus with cervical dysgenesis and cavitated, noncommunicating rudimentary horn. there has been no similar case reported in the literature till date, adding to the spectrum of complex anomalies. a nulliparous, 30-year - old female, presented to the infertility clinic with complaints of primary amenorrhoea and infertility, with chronic pelvic pain for more than ten years duration. the patient had prior been investigated several times, including sonography of pelvis, outside our institution, with all inconclusive reports. the patient underwent ultrasound in the radiology department of our institute, which demonstrated the presence of a normal sized anteverted uterus, oriented more toward the left side of pelvic cavity. a complex mass comprising of solid and cystic components was found on the right side. the patient was advised pelvic magnetic resonance imaging (mri) to better characterise the ultrasound findings. mri of the pelvis showed presence of two asymmetric uterine horns, smaller on the right side with thin myometrium and normal sized left with normal myometrium. both endometrial cavities were distended with hemorrhagic contents and showed no communication to each other. were normally developed, however there was no demonstrable communication between the endometrial cavity and the endocervical canal. a diagnosis of unicornuate uterus with cervical dysgenesis and a cavitated, noncommunicating rudimentary horn on the right side, was made [figure 1 ]. axial t1w (a) and t2w (b) images showing unicornuate uterus (u) with rudimentary right horn (r). sagittal t2w images (c, d) showing well formed cervix (arrow) with no communication between endometrial cavity and endocervical canal. coronal t1w image (e) showing hematometra in unicornuate uterus (u) and rudimentary horn (r) with left hematosalpinx (arrow) the patient was taken up for laprohysteroscopy. the cervix was well developed but the hysteroscope could not be negotiated beyond the isthmus, consistent with cervical dysgenesis. dense adhesions were found in the pelvic cavity, likely due to retrograde menstruation and stage iv endometriosis. the fallopian tubes on both sides were dilated with thick, oedematous walls and were found congested. due to delayed presentation of the patient, advanced endometriosis, dense pelvic adhesions and a failed attempt to recanalize / reconstruct cervix, a decision for hysterectomy was taken after obtaining patient 's consent [figure 2 ]. mullerian duct anomalies (mda), though rare, may present in different ways from infancy to young adulthood, with mucocolpos, hematocolpos, hematometra, primary amenorrhea, pelvic pain, infertility, or repeated pregnancy loss. an understanding of the differences between these uterovaginal anomalies is crucial in understanding the respective clinical manifestations, different treatment regimens and prognosis. many classifications of uterine anomalies exist including the buttram and gibbons and the american fertility society (afs) classification. though these classifications are important in the treatment of infertility and symptoms arising from obstruction or deformity, it is important to realise that these classification systems serve merely as a framework and not all anomalies will fit completely into one of these categories. it is more important to accurately describe the different components of the complex anomalies so that appropriate management can be planned. the modified afs classification by rock and adam embraces a broader collection of uterine and vaginal anomalies without conflicting observations or over simplicity encountered in other classifications. this classification correlates anatomic anomalies with embryologic arrests, classifying uterovaginal anomalies as dysgenesis disorders or vertical or lateral fusion defects. class iv of this classification is a useful addition, embracing any possible unusual configurations or combination of defects, since genital tract aberrations do not necessarily follow any defined and consistent pattern. a unicornuate uterus with a rudimentary horn is the most uncommon uterine anomaly, representing approximately 20% of all mda. a cavitated, non - communicating rudimentary horn in a unicornuate uterus represents approximately 4.4% of all mda. congenital cervical anomalies, including agenesis and dysgenesis are even rarer, with less than 200 cases of cervical agenesis being reported till date. many authors have recommended hysterectomy as an initial procedure for a patient with cervical dysgenesis / agenesis with a functioning uterine corpus. considering the small potential for pregnancy, some authors advocate procedures of recanalisation or reconstruction of cervix, especially in cases of cervical dysgenesis. imaging plays an important role in detection and classification of mda, thereby guiding appropriate management. although many of these anomalies may be initially diagnosed at hysterosalpingography or sonography, further imaging by mri is often required for definite diagnosis and elaboration of secondary findings. complex anomalies and secondary findings of endometriosis along with renal anomalies are optimally characterised noninvasively. the present case is unique, comprising of combination of two rare anomalies, a unicornuate uterus with cervical dysgenesis and a cavitated noncommunicating rudimentary horn. this anomaly can be assigned to class iv of modified afs classification by rock and adam. the review of literature did not reveal a similar case, though many authors have emphasized the possibility of complex anomalies in a patient with features of more than one class. in the present case, the diagnosis was delayed due to complex nature of the anomaly and absence of an integrated clinico - radiological classification scheme for specific diagnosis of such anomalies. to conclude, various complex mda may exist with combined features of more than one class. an integrated clinical and radiological classification and familiarity with rare and complex mda is essential. early surgery offered to the patient may reduce patients suffering, help restore a patent outflow tract and may preserve fertility in some cases. | mullerian duct anomalies, though rare, can be a treatable cause of pelvic pain and infertility. various complex mullerian duct anomalies may exist with combination of features of more than one class. since there are no precise clinical or imaging criteria to enable specific categorisation, there is ambiguous classification of these anomalies by various radiologists and clinicians. a young female presented with complaints of chronic pelvic pain, primary amenorrhoea and infertility. the patient was evaluated by sonography and magnetic resonance imaging and diagnosed as case of complex mullerian duct anomaly, a unicornuate uterus with cervical dysgenesis and cavitated, noncommunicating, rudimentary right horn. the findings were confirmed on laprohysteroscopy and the patient underwent hystertectomy. there should be an integrated clinico - radiological classification scheme and familiarity with rare and complex anomalies for appropriate diagnosis and management of complex mullerian duct anomalies. |
both the palmar grasp reflex and the plantar grasp reflex are very primitive in the sense that they can be elicited in all normal preterm infants at as early as 25 weeks of postconceptional age (pca). during routine ultrasound examination, fetal palmar reflex grasping of the umbilical cord has been repeatedly observed, which first appears at 16 weeks ' gestation [24 ]. these grasp reflexes are easy to elicit but have been proved to be of distinctive clinical significance for the early detection of infants with neurodevelopmental abnormalities [58 ]. this reflex is also primitive, being seen in some preterm infants at 25 weeks of pca and in the majority by 30 weeks of pca. since his report, many authors have devised a variety of methods for eliciting the reflex, and the underlying neural mechanism including afferent pathways of the reflex has been a subject of considerable discussion [1013 ]. the phylogenetic meaning of this reflex also remains unclear [9, 10 ]. it is interesting that, in spite of the great difference in the motor behavior, there is a close interrelationship between these primitive reflexes in the responses : the palmar grasp reflex inhibits the moro reflex [12, 1417 ]. this paper mainly concerns the clinical significance and neural mechanism of the grasp reflex and the moro reflex and also attempts to discuss the meaning of these reflexes based on comparison of the responses in human infants with those in monkey infants and the hierarchical interrelation of the responses of the primitive reflexes. to elicit the palmar grasp reflex, the examiner inserts his or her index finger into the palm of the infant from the ulnar side and applies light pressure to the palm, with the infant lying on a flat surface in the symmetrical supine position while awake [1820 ]. the response of the reflex comprises flexion of all fingers around the examiner 's finger, which is composed of two phases : finger closure and clinging. the latter occurs as a reaction to the proprioceptive stimulation of the tendons of the finger muscles due to slight traction subsequent to the application of pressure to the palm [21, 22 ]. the plantar grasp reflex is elicited by pressing a thumb against the sole of a foot just behind the toes [6, 18, 23 ]. milani - comparetti and gidoni devised another method for eliciting the plantar grasp reflex. they tested for the presence of the reflex by placing the infant in a supported standing position, stimulating the soles of the feet by floor contact, looking for plantar flexion of the toes. determination of whether the response of the hands and feet is a true reflex or a voluntary grasping movement can be difficult in older infants. an examiner should test several times with an appropriate interval between the tests, carefully observing the infant 's behavior [8, 25 ]. the grasp reflexes of the hands and feet in normal term infants have been studied by several authors. their results were fairly consistent regarding the times of the appearance and disappearance of the reflexes. the palmar grasp reflex and the plantar grasp reflex can be elicited in all infants during the first 3 and 6 months of age, respectively. thereafter they decrease along with the intensity of the responses, usually disappearing by 6 and 12 months of age, respectively [6, 7, 2527 ]. the disappearance of the reflexes is significantly related to the commencement of the voluntary use of hands or standing [28, 29 ]. in contrast to the studies involving term infants, those involving preterm infants have been few. allen and capute examined 47 infants and concluded that the intensity of the primitive reflexes including the grasp reflexes of the hands and feet in the preterm infant at term (40 weeks of pca) was similar to that in full - term newborns reported in the literature. we analyzed the data for 834 infants (332 term and 502 preterm) who were later confirmed to be normal on follow - up examination between ages 3 to 9 years. the primitive reflex responses of preterm infants were compared with those of term infants, according to corrected age as to expected birth date. no difference was evident in the changes in responses including that of the plantar grasp reflex between term and preterm infant groups throughout the first year of life. in general, a primitive reflex in infants is regarded as abnormal when it is absent or diminished during the period it should be actively elicitable or lasts beyond the normal age limit for its disappearance the response of the palmar grasp reflex may be less intense during the first and second days after birth. the absence of this reflex usually reflects peripheral (i.e., root, plexus, or nerve) or spinal cord involvement, especially regarding asymmetrical responses [18, 30, 31 ].. the response may be increased and retained longer, compared with that in normal infants, on the affected side(s) of the upper limb(s) in infants with spastic hemiplegia or quadriplegia, whereas it is very weak in infants with cerebral palsy (cp) of the athetoid type [26, 27, 32 ]. the clinical value of the plantar grasp reflex in infants has been investigated in more detail than that of the palmar grasp reflex. in 1932, brain and curran reported two cases showing no response at the age of 6 months who both suffered from bilateral marked spasticity and one case showing a vigorous response at the age of 2.5 years who suffered from congenital choreoathetosis. they also investigated the reflex in 59 patients with down 's syndrome, ranging in age from 1 to 45 years. they discovered that up to age 20 years, the response was present in 25 of 42 patients and, after age 20 years, in 3 of 17. we analyzed 617 infants (291 term and 326 preterm) whose plantar grasp reflex was examined before 1 year of age. their diagnoses were confirmed by follow - up examinations and comprised normality in 458, cp in 78, and mental retardation (mr) in 81. we obtained several results : the reflex reactivity in infants with cp of the spastic type was significantly reduced ; infants with cp of the athetoid type exhibited an extremely strong retention of the reflex ; infants with mr also exhibited a tendency for prolonged retention of the reflex ; the reflex profile in infants with cp of the athetoid type with spasticity, or of the ataxic type, was not different from that in normal control subjects. other authors also reported the characteristics of the plantar grasp reflex in children with neurodevelopmental abnormalities of various types, and their results were well consistent with ours [26, 27, 34 ]. a reduced or negative plantar grasp reflex during early infancy can be a sensitive indicator of later development of spasticity. of 2267 infants whose plantar grasp reflex had been examined before 1 year of age, we analyzed the neurodevelopmental outcome in 47 infants exhibiting a negative response during the first 6 months of age and in 46 infants exhibiting a significantly reduced response at ages 1 to 4 months. the diagnoses comprised cp in 75, mr in 7, borderline intelligence in 2, motor delay in 1, and normality in 8. of the 75 cases with cp, 69 had the spastic type and 4 the athetoid type with spasticity. the total number of patients with cp of the spastic type or the mixed type with spasticity among the entire 2267 infants in this series was 107, and 73 of these 107 patients with cp with spasticity (68.2%) exhibited a negative or reduced response during early infancy. in the remaining 34 infants with cp with spasticity who exhibited a normal response during the corresponding period, a high concordance between the side of an abnormal plantar grasp reflex during infancy and the laterality of the disturbance of motor function in children with cp of the spastic type was demonstrated. the side affected, or more affected, in motor function was in accordance with the side that exhibited a diminished or more diminished response in most subjects with spastic hemiplegia, diplegia, and quadriplegia. because anencephalic infants demonstrate a positive grasp reflex in both the hands and feet, the cerebral hemispheres are apparently not necessary for the reflexes [3739 ]. shahani. reported that the latency of the palmar grasp reflex was 40 msec on direct electrical stimulation of the afferent fibers in the median and ulnar nerves at the level of the wrist in an adult patient who showed the palmar grasp reflex following a vascular lesion in the cerebral hemisphere. this short latency excludes the long cerebral reflex arcs and puts this grasp reflex in the category of segmental reflexes mediated at the level of the spinal cord. the grasp reflexes can be elicited in neonates and early infants as a result of insufficient control of the spinal mechanism by the immature brain, but the reflexes gradually disappear with age, due to the increased inhibition accompanying brain maturation [23, 41 ]. adult patients with lesions in the frontal lobes sometimes exhibit a grasp reflex of the hands and feet [23, 33, 37, 4145 ]. such reappearance of these reflexes in adults is attributed to the release of the spinal reflex center from the disturbed higher brain mechanism, suggesting that these reflexes are only inhibited, and not lost, after the infantile period. many attempts have been made to determine the pathological site of the grasp reflexes by means of clinical observation or animal experiments [37, 4648 ]. in 1927, adie and critchley analyzed 13 patients with a tumor or vascular lesion in a frontal lobe who exhibited a palmar grasp reflex on the side opposite to that of the diseased frontal lobe. they confirmed that the palmar grasp reflex was most evident when pyramidal signs were absent, and thus they concluded that the lesion responsible for the reflex was extrapyramidal. in 1938, goldstein described that a lesion involving the medial aspect of a frontal lobe seemed to be especially prone to produce the plantar grasp reflex on the opposite side. more recent studies have implicated lesions of the medial or lateral frontal cortex anterior to the primary motor area, that is, the supplementary motor area (sma), premotor cortex, and cingulate motor cortex, as the etiology of the palmar grasp reflex [23, 45, 48, 49 ]. these findings indicate that nonprimary motor areas comprise substantial portions of the brain that exert inhibitory control over the spinal reflex mechanism underlying the grasp reflexes and that the destruction of these structures will release the inhibitory control and thus lead to the reappearance of the reflexes. nonprimary motor areas play important roles in the planning, preparation, initiation, and execution of motor behavior [5055 ]. these areas contain corticospinal neurons and thereby a somatotopically arranged map of the body [54, 5658 ]. however, the cortical projections from these areas to the spinal cord do not necessarily have a direct influence on spinal motor neurons. the majority of the neurons terminate in the intermediate zone in the spinal cord and connect with interneurons [53, 56, 59, 60 ]. the essential roles of nonprimary motor areas in the spinal cord are thought to be in the preparation and modulation of the spinal circuitry through interneurons rather than the generation of movements that require a direct command to the spinal motor neurons [52, 53, 60, 61 ]. on the other hand, because interneurons are substantially related to the modulation of spinal reflexes [52, 57 ], the descending inhibitory control of the grasp reflexes by nonprimary motor areas may also occur through spinal interneurons. as brain maturation proceeds, increasing control of the spinal circuit by the nonprimary motor areas will replace the simple reflex grasping during early infancy, with more regulatory and adaptive voluntary grasping in older infants. however, the proportion of patients with a lesion of a nonprimary motor area in whom a grasp reflex can be elicited is not necessarily high. in the series of de renzi and barbieri, the palmar grasp reflex was elicited in 21 of 32 (66%) patients with a medial frontal lesion and in 8 of 30 (26%) with a lateral frontal lesion. on the other hand, a minority of patients with a deep lesion including the basal ganglia without frontal cortical damage were reported to exhibit a positive palmar grasp reflex, and the extension of an sma lesion into more lateral regions of area 6 may increase the strength of the grasp reflex. these observations seem to indicate that the inhibitory stimuli from upper brain structures travel via multiple routes, and the extent of the release of control depends not only on the specificity of the location but also on the extent and severity of the lesions. clinical studies have revealed that some patients with a frontal lesion exhibit a grasp reflex of the hands or feet, or both [33, 41, 43 ]. this finding suggests that different sites are specific to each of the grasp reflexes of the hands and feet within the nonprimary motor cortex. as demonstrated, each nonprimary motor area retains some degree of a somatotopically arranged map of the body that represents peripheral innervation, which is dominated by descending pathways from the area through connections to different levels of the spinal cord [54, 5658 ]. we speculate that the grasp reflexes of the hands and feet may be elicited according to the specific location of each lesion corresponding to the fingers or toes on the map in nonprimary motor areas. in normal circumstances, higher brain centers control the spinal mechanism that regulates the coordination among agonists, antagonists, and synergists in an adaptable manner by means of reciprocal innervation. in children with spastic type cp, however, deviation in terms of reciprocal innervation caused by damage to the pyramidal tract leads to excess cocontraction at proximal joints, whereas deviation leads to excess reciprocal inhibition through spastic antagonists at distal joints, inducing weakness of the agonists. a diminished or negative plantar grasp reflex may be caused by weak toe flexors, as induced by excessive reciprocal inhibition of the flexors through the predominance of extensors over flexors in tonus in a lower limb in these children. they also exhibit the predominance of finger flexors over extensors in their upper limbs, which may cause a facilitated palmar grasp reflex on the affected side(s) in spastic hemiplegia and quadriplegia. on the other hand, in children with cp of the athetoid type, the deviation of reciprocal innervation always leads to excess reciprocal inhibition. any attempt at movement produces excessive relaxation of the antagonists, inducing an extreme range of movements. although the released control of the spinal reflex mechanism because of a lesion in the basal ganglia seems to be the most likely cause of facilitation of the plantar grasp reflex in these children, the excessive relaxation of toe extensors, in response to the toe flexion at the moment of elicitation of the reflex, may be another factor causing an exaggerated response. children with athetosis generally exhibit decreased tonus of finger muscles, especially of flexors, which causes a weak grasp and the release of objects too easily. the relative predominance of finger extensors over flexors, in addition to the specific weakness of the finger muscles, may be a factor causing the diminished palmar grasp reflex in these children. in infants, the maturation of cortical connections overrides the generators of primitive reflexes in the spinal cord and brain stem with age and eventually leads to the disappearance of the primitive reflexes and the emergence of righting and equilibrium reactions [34, 63 ]. the disappearance and emergence of these reflex mechanisms were demonstrated to be chronologically related to the attainment of motor milestones in normal children. in children with mr, however, the process of evolution of these reflex mechanisms is prolonged, in accordance with the retardation of maturation in brain function, resulting in retention of primitive reflexes and the delayed attainment of motor milestones [24, 29, 34, 64 ]. in his original method, moro elicited the reflex by hitting the pillow on either side of an infant 's head with the hands. later a variety of methods for eliciting the reflex were devised including hitting on the table surface, warm or cold application to the chest or stomach, and a tap on the abdomen [10, 11 ]. nowadays, however, the head drop method is the most common, because a slight drop of the infant 's head relative to the body axis in the supine position is generally accepted as the most effective technique for eliciting the reflex [10, 11, 19 ]. for elicitation in this method, the infant is held suspended in a symmetrical supine position with one of the examiner 's hands behind the chest and the other supporting the head, and the head being held in a midline position and then dropped back a few cm. it is important to ensure that both the subject 's hands are open at the moment of elicitation of the reflex so as not to provoke an asymmetrical response. the drop of the baby method is an alternative one for eliciting the reflex : the infant is suspended horizontally, as in the head drop method, and then the examiner lowers his or her hands rapidly about 10 to 20 cm and brings them to an abrupt halt. there is no dorsiflexion of the neck with this technique. on the other hand, lesn reported that a nociceptive stimulus applied to the infant 's skin and subcutaneous tissue of the epigastrium by pinching was effective for eliciting the reflex. the initial phase of the response comprises abduction of the upper limbs at the shoulders and extension of the forearms at the elbows, with slight extension of the spine and retraction of the head. the forearms are supinated and the digits extended, except for the semiflexed index fingers and thumbs, forming the shape of a there is sometimes a slight tremor or clonus - like rhythmic movements of the limbs. subsequently the arms adduct at the shoulders and the forearms flex at the elbows : the upper limbs describe an arc - like movement, bringing the hands in front of the body, which finally return to the original position [10, 11, 18 ]. the responses of the lower limbs are usually eliminated from the evaluation, because they show wide variability among the normal population [11, 19, 20 ]. with this reflex, habituation develops only on an experimental basis with intensively repetitive trials, that is, not in the clinical setting [17, 66 ]. no significant difference in the response has been reported at birth or through the first 5 months of age between the term cephalic - presenting and breech - presenting infant groups. the study of the moro reflex in normal term infants has been undertaken by many authors. the reflex can be elicited in all infants during the first 12 weeks of age. after the neonatal period, however, the response becomes increasingly less typical with age, eventually consisting only of abduction and extension of the upper limbs. beyond 12 weeks of age, the proportion of infants exhibiting a negative response rapidly increases, reaching about 80% at 20 weeks of age. the reflex usually disappears by 6 months of age [11, 31, 6870 ]. several authors compared the moro reflex in preterm infants tested at 40 weeks pca or at 4 months of corrected age with that in term infants. although none of the studies confirmed the outcome in the subjects, there is a general agreement as to the similarity in the response between the two groups, especially when only infants with no or low perinatal risk factors are compared [1, 7175 ]. based on the findings in normal infants, the absence or diminution of the moro reflex within 2 to 3 months of age and the persistence of the response beyond 6 months of age can be regarded as abnormal. the absence of the response during the neonatal period and early infancy is of especial clinical significance and may indicate a compromised condition or disorder including birth injury, severe birth asphyxia, intracranial hemorrhage, infection, brain malformation, general muscular weakness of any cause, and cp of the spastic type [10, 31, 69, 76, 77 ]. on the other hand, a hyperactive response of the reflex is a common feature of neonatal withdrawal from maternal drug abuse including volatile substances, heroin, and opioids [7880 ]. an exaggerated response may also be detected in infants with a severe bilateral intrauterine disturbance such as hydranencephaly. damage to a peripheral nerve or cervical cord or a fracture of the clavicle may inhibit the reflex on the affected side. however, it should be noted that dubowitz demonstrated an asymmetrical response in normal infants. their responses appeared to be related to the clenching of one fist during the procedure, and he considered that this might be caused by inhibition of the response on one side due to contraction of the finger flexors. because reiners. found, in a prospective study, that none of 22 infants with a clavicular fracture exhibited an asymmetrical moro response, the diagnostic value of the reflex for the detection of such fractures should not be overestimated. retention of the reflex is common in children with mr without motor disturbance including down 's syndrome and in children with cp of the athetoid type [10, 69 ]. it is also sometimes observed in children with a severe brain malformation or with cp of the spastic type [31, 69 ]. katona reported that the moro reflex could be elicited in anencephalic newborns with a nervous system that had developed only to the rostral level of the pons. in a study involving analysis of the relationship between the morphological structures of the rudimentary brain and primitive reflexes in six anencephalic newborns, hanabusa found that the moro reflex could be elicited only when reported that the average latency of the moro reflex in 15 term neonates in the quiet awaking state detected with an optoelectronic device was 117.0 ms on the right arm and 129.2 ms on the left. these latencies are much longer than those of the spinal reflexes, clearly indicating that the reflex is mediated in the brain stem, not at the level of the spinal cord [83, 84 ]. thus, the center of the moro reflex seems to be in the lower region of the pons to the medulla. the origin of afferent pathways for the moro reflex, whether it is primarily vestibular, proprioceptive, or exteroceptive, has been a main subject of discussion. the head drop, the most common way of eliciting the reflex, stimulates both the vestibular system and the proprioceptive receptors in the neck. rnnqvist investigated the reflex by tilting the table without extension of the infants ' neck to eliminate the proprioceptive inputs from the cervical vertebrae and neck muscles. the response could be elicited in 225/250 trials (90%), and twenty - one of the 25 negative trials were made while the infants were sleeping or crying. prechtl also demonstrated that sudden raising or dropping of the infants, whose head, neck, and trunk were fixed in a plaster cast, could elicit the response.. reported an infant with charge syndrome who exhibited a persistent complete absence of the moro reflex with preservation of other primitive reflexes. moro 's original method can not yield a satisfactory response if the table is too stable to produce a change in position on striking and necessitates jolting movement of the table to elicit a response. these findings support the view that this reflex is principally mediated by the vestibular system. in contrast to the grasp reflex, the moro reflex has not been observed in a fetus, which is also in agreement with its vestibular origin, because fetuses are protected from acceleration or shaking in intrauterine life [68, 86 ]. on the other hand, parmelee jr. found that vestibular stimulation was not sufficient for a good moro response when neck movement was prevented. prechtl described an infant with bilateral absence of the inner ears who had exhibited a normal moro response to a head drop, which was reported by karlsson in an address to a study group in oxford. these observations suggest that the proprioceptive inputs from the neck also contribute to elicitation of the reflex. there are direct and indirect, via the cervical cord, ascending pathways that originate in the proprioceptive receptors in the neck and connect with vestibular nuclei. the signals generated by the head drop may travel via these routes to reach and activate the reflex mechanism in the brain stem. the head drop method is most effective, because it produces a large number of ascending signals to the target through the two pathways and thereby induces a high level of neural excitation that acts on the reflex center. although pinching of an infant 's epigastrium has been reported to be effective for eliciting the reflex, a nociceptive stimulus is generally ineffective [10, 11 ]. besides the primary somatosensory afferents, there is a path taken by nociceptor axons that reaches the pontine reticular formation, which has close interconnections with vestibular nuclei [8789 ]. the nociceptive signals may travel via this pathway toward the reflex center in the brain stem. however, the level of neural excitation generated by nociceptive stimulation appears to be usually low, and the response can be elicited only when it infrequently exceeds the threshold of the reflex. the reflex center probably contains a number of interneurons, because of the relatively long latency. the routes of afferent pathways can be multiple, and the efferent pathways of the response seem to originate in the vestibulospinal and/or reticulospinal neurons, because the response can even be obtained in anencephalic newborns devoid of both corticospinal and rubrospinal neurons [17, 39 ]. thus, the reflex movement is generated by the subcortical structures without cortical participation, which explains why focal cerebral injury does not cause distinct disturbance of the moro reflex. it is also noteworthy that no asymmetrical response is sometimes detected in neonates and young infants who later develop spastic hemiplegia. the primary motor cortex and nonprimary motor areas project a lot of neurons to different motor centers in the brain stem including vestibulospinal and reticulospinal neurons. the moro reflex in infants disappears with age, due to the increased inhibition of these upper brain structures. although there has been much confusion regarding the moro response and the startle reaction in the past, most authors agree today that they are different entities [1012, 17 ]. the startle reaction, the response to a sudden stimulus, is one of the defensive reactions and consists essentially of flexion movements. detailed observations with video recording or film and an electrophysiological study with surface electrodes demonstrated the differences in motor behavior between them. katona found that the startle reaction induced by an auditory stimulus showed clear habituation in premature infants, whereas the moro reflex did not, and that the startle reaction could not be elicited in anencephalic newborns, while the moro reflex was always elicited in these infants. investigated the moro reflex using a tilt table with simultaneous monitoring of autonomic parameters including respiration, heart rate, and transcutaneous po2 and pco2 and concluded that the reflex was not the result of a startle reaction, because of no significant alteration in these parameters. in 1891, robinson described that a newborn human infant was able to support its own weight when it was holding on to a horizontal rod. he tested more than 60 infants under one month old and found that they were able to hang by their hands for at least 10 seconds, and one infant succeeded in hanging for 2 minutes and 35 seconds. richter had the opportunity of testing the palmar grasp reflex in five monkey infants. they showed a grasp reflex that was much stronger than that of human newborn infants. brain and curran examined the plantar grasp reflex in nine adult anthropoid apes and monkeys and found that none of the monkeys showed the grasp reflex and that the prehensile function of the adult monkey 's feet was highly specialized, responding to a variety of stimuli. they also observed a number of infant monkeys, some within a few days of birth, slung beneath the mother 's belly or clinging to her flanks only with their hands and feet, receiving no support from her. although only a day or two old, they held on while she jumped from bough to bough and did not leave her until they were weaned. based on these findings, the grasp reflex of the hands and feet in human infants could be regarded as a rudiment of phylogenetic functions that were once essential for monkey infants in arboreal life and that have lost their usefulness in the human species [28, 33, 62 ]. as mcgraw stated, modern infants, as well as their fairly recent human antecedents, do not need to hang on with their hands and feet from the moment of birth. in his original paper, moro emphasized the clasping aspect of the reflex and claimed that the reflex is a primitive movement analogous to that in young apes and bats, by which they instinctively embrace or cling to their mothers. however, the question has been raised as to his biological interpretation by several authors. parmelee jr. stated that moro 's emphasis in his belief that the reflex is an atavistic lifesaving reflex resulted in some of the present - day confusion. mitchell described that in the moro response, the essential component is the extension movement, and thus it should not be called an embrace or clasp on the other hand, amiel - tison and grenier commented that the moro reflex can be seen as a hindrance to voluntary motor activity, and this parasitical movement is a nuisance that the newborn retains until a subsequent stage of maturation when inhibitory brain function begins. the unique movement behavior of the moro reflex is thus difficult to understand, and its phylogenetic meaning remains unclear. several authors observed in human newborns that the palmar grasp reflex inhibits the moro reflex [12, 15, 16, 22, 91 ]. later, katona found in newborn apes and monkeys that the moro reflex was regularly observed and it was inhibited on elicitation of the palmar grasp reflex. because this interrelation between the grasp reflex and the moro reflex would be essential for newborn animals to keep clinging and to prevent a fall, the interrelation observed in human newborns could also be regarded as a phylogenetic rudiment. katona noted another fact that a sudden auditory stimulus triggered a strong reinforcement of the grasp reflex in such young animals, which also supports the view that the startle reaction is one of the defensive reactions. pollack found, in term human newborns, that sucking increased the palmar grasp reflex, whereas head rotation had no influence on this grasp reflex. lippmann noted in human newborns that the babkin reflex consisting of head flexion and mouth opening in response to pressure on the palms of both hands was not obtained during sucking. brown and fredrickson also observed in human newborns that the palmar grasp reflex did not affect the sucking reflex but that the sucking reflex increased the strength and the duration of the palmar grasp reflex. if the same interrelation between the sucking reflex and the palmar grasp reflex exists in monkey infants, it would be very helpful for them to firmly cling to their mother while feeding. the asymmetrical tonic neck reflex (atnr) elicited by head rotation usually induces extension of the upper and lower limbs on the face side in infants. if the palmar grasp reflex is predominant over the atnr in monkey infants, as demonstrated in human infants, head rotation would not bring any reduction in the response of the grasp reflex, and the animal infant would keep clinging to its mother. since the babkin reflex is regarded as the rudiment of hand - mouth coordination for preying in animals [96, 97 ], it appears to be rational that the reflex is unable to be elicited during feeding. thus, the hierarchical interrelations among the primitive reflexes observed in human newborns seem to be indispensable for monkey newborns for their essential behavior such as feeding, moving, and preventing a fall, although the interrelations have not been fully elucidated in monkey infants. based on the findings already mentioned in this paper, the moro reflex in the young monkey would be elicited when the vestibular system is stimulated with abrupt tilting of the body or head while it is being passively held by its mother without active clinging caused by the palmar grasp reflex. in this situation, the mother would notice her baby was off balance from its exaggerated reflex movement, and she would immediately try to seize the baby to prevent a fall. it might be possible to assume that the moro reflex in monkey neonates plays a role in such interaction between mother and child for protection against a fall. to clarify the meaning of the moro reflex, it appears necessary to determine in monkeys in what situation the reflex is elicited and how the response works in the mother and child. the absence or a weak response of the reflex during early infancy may reflect peripheral nerve or spinal cord involvement or may predict the development of athetoid type cp, whereas the response may be hyperactive in children with spasticity in their upper limbs. the plantar grasp reflex is also of high clinical significance, especially in terms of the detection of spasticity. no reflex, or a diminished one, during early infancy is often a sensitive predictor of the development of spastic cp. the grasp reflex of the hands and feet is mediated by the spinal reflex mechanism, which, however, appears to be under regulatory control of nonprimary motor areas through the spinal interneurons. the absence of the moro reflex during the neonatal period and early infancy is highly diagnostic, indicating a variety of compromised conditions. the center of the reflex is probably in the lower region of the pons to the medulla. the grasp reflex of the hands and feet in human infants could be regarded as a rudiment of phylogenetic function, whereas the phylogenetic meaning of the moro reflex remains unclear. the hierarchical interrelations among the primitive reflexes seem to be essential for monkey newborns for their arboreal life, although it has not been fully elucidated. the possible role of the moro reflex in these newborns was discussed in relation to the interrelations. | the plantar grasp reflex is of great clinical significance, especially in terms of the detection of spasticity. the palmar grasp reflex also has diagnostic significance. this grasp reflex of the hands and feet is mediated by a spinal reflex mechanism, which appears to be under the regulatory control of nonprimary motor areas through the spinal interneurons. this reflex in human infants can be regarded as a rudiment of phylogenetic function. the absence of the moro reflex during the neonatal period and early infancy is highly diagnostic, indicating a variety of compromised conditions. the center of the reflex is probably in the lower region of the pons to the medulla. the phylogenetic meaning of the reflex remains unclear. however, the hierarchical interrelation among these primitive reflexes seems to be essential for the arboreal life of monkey newborns, and the possible role of the moro reflex in these newborns was discussed in relation to the interrelationship. |
a healthy 60-year - old male with a 30 pack - year smoking history presented with 2 months of right eye pain, headache, and photophobia. his ocular history was significant for pterygium excision with mitomycin c in the right eye 5 years ago as well infiltrative infectious scleritis secondary to enterobacter cloacae and curvularia fungus species 2 years ago. his first episode of the right eye infectious scleritis presented as scleral thinning 3 mm nasal to the limbus with overlying infiltrates that resolved with topical moxifloxacin and natamycin over the course of 3 months. however, a residual calcified plaque remained in the area of scleral thinning. two years later, the patient returned complaining of several weeks of worsening pain and photophobia in the right eye. on examination, his best - corrected visual acuity was 20/25 in the right eye and 20/20 in the left eye. examination of the right eye revealed soft, yellow - white purulent material overlying the existing calcified plaque with extensive scleral thinning [fig. 1 ]. slit - lamp photograph of the right eye 2 years after initial presentation, now with an elevated mass of purulence overlying the area of scleral thinning a limbal peritomy was performed to define the areas of scleral thinning, and the purulent material was noted to be adherent to the calcific plaque. the plaque and purulent material were excised with gentle traction and sent for culture and histopathology. to avoid scleral perforation, a tutoplast scleral graft was sutured over the scleral defect and covered with a conjunctival flap. initially, the patient was treated with hourly topical moxifloxacin, fortified tobramycin, and natamycin. gomori methenamine silver stains of the purulent material eventually revealed a marked amount of branching fungal hyphae (indicated by arrow) with cultures growing pseudomonas aeruginosa and bipolaris fungus [fig. 2 ]. gomori methenamine silver stain of purulent area demonstrating numerous branching hyphae (arrow) indicative of fungus nine days after the procedure, the patient developed moderate discomfort in the right eye. examination revealed a retracted conjunctival flap with further purulent material overlying the scleral patch graft. a decision was made to inject subconjunctival voriconazole, and qid dosing of topical cyclosporine 2% plus oral ketoconazole (400 mg daily) was added to his treatment plan. after 10 weeks of treatment, the patient 's symptoms had resolved, and vision returned to baseline [fig. 3 ]. once clinical evidence of infection resolved, medications were discontinued. slit - lamp photograph of the right eye on postoperative month 3 with epithelialization of the scleral patch graft and resolved infection in our patient, aggressive medical and surgical management resulted in complete resolution of the infection. surgical intervention was elected due to the chronicity and recurrence of the lesion and due to the possibility of impending scleral perforation. in vitro strains of dematiaceous fungi have shown to respond well to antifungals such as natamycin and amphotericin b. hence, a suggested clinical treatment modality includes topical natamycin 5% supplemented with oral ketoconazole. keratitis has been shown to resolve in over 70% of cases with dematiaceous fungi, but poor penetration of antimicrobials through the collagen - bound scleral layer poses a challenge for effective treatment. the persistence of organisms such as pseudomonas species and fungal hyphae in the sclera despite aggressive medical therapy has been reported. for such cases of infectious keratoscleritis that are refractive to medical treatment such as this particular case, the best option may be to include surgical management such as excision with lamellar corneoscleral graft and/or cryotherapy. infectious scleritis typically presents as an extension of keratitis resulting from ocular injury, often from trauma, foreign bodies, radiation, or surgery. infectious scleritis following pterygium removal has been reported, and is often related to postoperative beta irradiation and/or intraoperative antimetabolites. the events resulting in an infection involve direct pathogenic invasion of the sclera that triggers an immune - mediated vasculitis and necrosis at the site of pterygium excision. hence, if a presumed inflammatory scleritis does not respond as expected to steroid treatment, an infectious etiology should be considered. such cases can be diagnosed through smear / culture, scleral biopsy, or anterior chamber aspirate. poor prognosis in infectious scleritis includes corneal involvement, inappropriate antimicrobial therapy, and presence of fungal infection. thus, mycotic scleritis should always be considered in the differential diagnosis, and prompt diagnoses and treatment are critical to salvage vision. to our knowledge, this is the first report of infectious scleritis without corneal involvement caused by the bipolaris species. | we report an interesting case of infectious scleritis from coinfection of pseudomonas aeruginosa and bipolaris with no corneal infiltrate. a healthy 60-year - old man with a history of infectious scleritis following pterygium excision presented with purulent material growing p. aeruginosa and 1 + colonies of bipolaris species of fungus. broad spectrum treatment was initiated with hourly topical moxifloxacin, fortified tobramycin, and natamycin along with a subconjunctival injection of voriconazole and topical cyclosporine, with po ketoconazole. after 10 weeks of aggressive empiric treatment, the patient 's symptoms had resolved, and his vision returned to baseline although a scleral patch graft was utilized to stabilize scleral thinning. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.