article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
coronary artery disease (cad) is a leading cause of death throughout the world (1). over the four decades, a significant decrease has been observed in age - related mortality caused by cardiovascular disease (2). people in developing countries suffer from cad at a relatively younger age and about half of mi occurs under the age of fifty years (3). inadequate perfusion due to atherosclerosis is a common cause of coronary artery stenosis (2). ischemic chest pain in young adults is usually related to hypertrophic cardiomyopathy, congenital coronary abnormalities, tachyarrhythmia, myocarditis, aortic stenosis, dissection, or coarctation (4). age, male sex, hypertension, smoking, diabetes, dyslipidemia, and obesity are considered as established risk factors for cardiovascular diseases and atherosclerosis (5, 6). these agents are used currently to increase protein synthesis and muscle growth in athletes (7). since the use of anabolic steroids has been increased, different types of them produced (8). mostly people start using the anabolic steroids in school time (9). according to the statistics, 0.9% of men and 0.1% of women use these agents during their lifetime (10). in this review, a 23-year - old male body builder was reported, with myocardial infarction (mi) following use of trenbolone acetate. a 23-year - old man was referred to the emergency room with epigastric pain since the last day. he was an athlete and his previous medical history was negative. due to the absence of risk factors for heart disease, symptomatic treatment was done for him and his pain decreased so that the patient was discharged from the emergency department. but, after 3 days the patient presented again to ed with the same complaint. the pain radiated to the left arm accompanied by nausea. after obtaining the accurate history of the patient, it was elucidated that he has been using the trenbolone acetate in his daily diet since last year. the patient 's vital signs were included blood pressure 130/80 mmhg, heart rate 105 per minute, respiratory rate 25 per minute, o2 sat 98% (on room air). in physical examination, the patient had sweated and the lungs were clear on auscultation. s1 and s2 sounds of heart were normal and s3 sound was heard, too. the abdomen was soft but not tender. according to the examination and history of the patient, electrocardiogram (ecg) cardiac markers (creatine kinase mb and troponin i) were elevated. due to the unavailability of a heart center for doing an emergency percutaneous coronary intervention (pci), he was admitted to the cardiology ward and after a week, angiography was done for him. the patient s angiography showed the stenosis of the left anterior descending (lad) and left circumflex (lcx) arteries (figure 2). anabolic steroids can cause many problems such as cardiovascular which includes hypertension, left ventricular hypertrophy, impaired diastolic filling, polycythemia and thrombosis (7). the effects of steroids on lipid profile include decreasing in high density lipoprotein (hdl), increasing in low density lipoprotein (ldl) and total cholesterol. these changes are leaded to increase the risk of atherosclerosis in the coronary arteries (11 - 13). indirectly, increasing the concentrations of ldl due to the abuse of anabolic steroids may lead to an increase in sensitivity of platelets (14). long - term effects of these agents can be observed in the cardiovascular system, mental health, and increasing the risk of neoplasm (15). a) upper arrow : left anterior descending artery (lad), lower arrow : left circumflex artery (lcx) ; b) after percutaneous coronary intervention (pci) and stent placement in lad. trenbolone acetate is a synthetic anabolic steroid (16) often referred to as " fina " by users, because the injectable trenbolone acetate was originally adapted for use by bodybuilders from the dissolution of finaplix h pellets ; it is an ear implant used by cattle ranchers to maintain the weight of cattle during shipping to slaughter. trenbolone is a steroid used by veterinarians on livestock to increase muscle growth and appetite (17, 18). because these drugs have remarkable effects on bulking muscle mass and burning fats, illicit use of them therefore, it seems to be necessary that a comprehensive history of steroid consumption in young patients present to the emergency department with the chief complaint of chest pain or its equivalents should adjunct to other cardiac risk factors. when young athletes with a history of anabolic drugs refer to the emergency department with complaints of chest pain, ischemic heart issues must be considered. without the necessary symptoms to exclude ischemic heart problems, lower all authors passed four criteria for authorship contribution based on recommendations of the international committee of medical journal editors. | over the four decades, a significant decrease has been observed in age - related mortality caused by cardiovascular disease. people in developing countries suffer from cad at a relatively younger age and about half of mi occurs under the age of fifty years. abuse of anabolic steroids is one of the less common causes of atherosclerosis. in this report, a 23-year - old body builder male referred to emergency department (ed) with myocardial infarction (mi) following chronic trenbolone acetate consumption. it seems that a comprehensive history of steroid consumption in young patients referred to ed with the chief complaint of chest pain or its equivalents is necessary in adjunct to other cardiac risk factors. |
during the last decade, of the definition of the optimal treatment in high risk prostate cancer (pca) is among the topics that are of most interest to the urological community, but consensus in this field is still not reached. up until a decade ago, most t3 pca patients underwent radiotherapy (rt) or androgen deprivation therapy (adt) or a combination of both, while only about 36% were initially treated by surgery. recent publications have revealed that in selected cases of locally advanced and high - grade tumors, surgery as monotheraphy or as part of a multimodality treatment may be used instead of rt. the high risk pca population, usually described as having prostate specific antigen (psa) > 20 ng / ml, biopsy gleason score 8 or an advanced clinical stage (t3a - b) is however not homogeneous. recent studies have shown that treatment outcomes can vary widely, depending on whether patients present with only one, or rather a combination of those high - risk factors, with the latter patients having the worst outcomes [47 ]. it is still unclear which patients, according to the accepted predictors of aggressive disease behavior, are the best candidates for surgery, mostly due to the lack of data on long - term oncologic outcomes and randomized clinical trials. according to the european association of urology guidelines, surgery is optional in patients presenting with ct3a, gleason score 8 - 10 or psa > 20 ng / ml, and life expectancy of more than 10 years. even in highly selected patients with ct3b or cn1 pca, we believe that radical prostatectomy is indeed an appropriate treatment for more aggressive pca, but data for confirming that are still insufficient. the purpose of this study is to present the oncologic outcomes of patients having pt3a pca after surgery, including overall survival (os), disease progression free survival (dpfs), cancer specific survival (css) and biochemical progression free survival (bpfs). during the period 2002 - 2007, 840 radical retropubic prostatectomies (rrp) were performed in our institution. final analysis was carried out using the data of 126 patients with complete follow - up. biopsy gleason score 7 or psa > 10 ng / ml or clinical stage t3 were indications for lymph nodes removal. 71 of 126 (56.3%) patients of our study population had such criteria. for other the pathological examination of radical prostatectomy specimens and bilateral pelvic lymph nodes were performed by one dedicated uropathologist. serum psa and physical examination were performed every 3 months in the first year after surgery, every 6 months in the second and third years, and annually thereafter. data about patients death and cause of death were received from the national cancer registry. css was defined as the time from surgery to death caused by pca or complications of this disease. biochemical progression was defined as the time from surgery to psa level 0.2 ng / ml confirmed by repeated test. disease progression was defined as the development of either local disease recurrence or distant metastasis. adjuvant treatment was defined as either adt or rt given within 3 months after surgery. salvage treatment was defined as any kind of therapy (rt or adt) given later than 3 months after surgery. the kaplan - meier survival analysis was used to calculate the os, css, dpfs and bpfs. 5-year rates for os, css and dpfs in our study cohort were 96%, 98.7% and 97.3%, respectively (fig. cox regression analysis revealed that from all parameters (age, biopsy and surgery gleason score, surgical margin and lymph nodes status, preoperative psa level) only preoperative psa (p = 0.037, hr 1.054, 95% ci 1.003 - 1.108) and postoperative gleason score (p = 0.008, hr 2.05, 95% ci 1.202- 3.506) had an impact on biochemical relapse (table 2). according cox regression analysis, there were no parameters influencing overall and cancer specific mortality or disease progression. kaplan - meier analysis for overall survival (a), disease progression free survival (b) and biochemical progression free survival (c) in all study patients. r positive surgical margins, psa prostate specific antigen cox multivariate regression analysis of preoperative and histopathologic parameters for biochemical progression free survival. a mean of 6.3 (range 1 - 15) lymph nodes were removed, and the overall positive node detection rate was 2.8%. because of this small number of positive nodes we could not perform analysis in survival. the mean surgery gleason score was significantly worse when after biopsy (6.4 vs. 6.9, p = 0.001). gleason score upgrading was detected in 51.2% of cases, downgrading in 4.9% of cases. the kaplan - meier analysis demonstrates significant differences between gleason 7 and 8 for os (fig. the estimated 5-year os, css, dpfs and bpfs rates in patients with gleason score 8 were 80.8%, 88.9%, 80.8% and 27.3%, respectively, while in gleason score 7, 5-year os, css, dpfs and bpfs were 97.8%, 100%, 99% and 62.6%%, respectively. kaplan - meier analysis with log - rank test for overall survival (a), biochemical progression free survival (b) and disease progression free survival (c) stratified for prostate gleason score. preoperative psa 20 ng / ml 7.2% of study patients. there were no differences in 5-year dpfs comparing groups according psa level but at psa 20 ng / ml (fig. 3a there were no difference between groups with psa 0.2 ng / ml was detected in 23.2% of cases surgical margins status. this parameter did not have significant impact in survival, disease progression or biochemical relapse. during the last decade, the discussion about the role of surgery in locally advanced pca became increasingly active. before that time, treatment of locally advanced pca was mostly in hands of radiation oncologists. such discussion became possible for several reasons : successful treatment of high risk pca with rt monotherapy requires high radiation doses (74 - 80gy), leading to higher rates of adverse events. on the other hand, our single center study shows that surgical treatment may indeed be a reasonable treatment option in locally advanced pt3a pca with 96% os, 98.7% css, 97.3% dpfs and 60% bpfs at the 5-year follow - up mark. the survival rates of the pt3a patients in our study are similar to those reported by hsu. in a study of 200 patients with unilateral ct3a treated by surgery. they also showed that progression - free survival rates of patients with pt3a pca did not differ significantly from those with pt2 disease. some other authors have also reported their outcomes of surgical treatment for t3 pca. summarizing those results, 5-year css and os rates varied from 85 to 100% and from 75 to 98%, respectively [912 ]. direct comparison of the outcomes of surgery and radiation are inadequate because of inherent selection biases, gleason score upgrading or stage migration after surgery. nevertheless, this issue partially could be solved using data from the rtog trials, which compared rt vs. a combined approach using rt and adt. in a review of those rtog trials, different pca risk groups were identified with group 2 (gleason 6, t3nx - n1 ; or gleason 7, t1 - 2nx) and group 3 (gleason 7, t3nx - n1 ; or gleason 8, t1 - 2nx) most closely corresponding with our study population. after radiation, the 5-year os and css rates were 82% and 94% for group 2, and 68% and 83% for group 3 respectively. outcomes from another long - term study comparing rt vs. rt with concomitant adt were reported by bolla.. in the eortc - trial, 412 patients with locally advanced pca were treated with rt alone or in combination with adt. five - year os and css rates were respectively 62 and 79% in the radiation alone group. our study data showed a comparable 98.7% 5-year css, similar to rt and adt combination therapy. psa and specimen gleason score have a significant impact on the survival analysis. according to our study, patients with a psa 20 ng / ml (log rank p = 0.048, p = 0.001 and p = 0.001, respectively). patients with a psa level of 10 to 20 ng / ml did not have significantly different os, css or bpfs when compared to psa 20 ng / ml (log rank p = 0.04, p = 0.008, respectively). in the study cohort, some recent studies studied the role of psa in survival and biochemical or disease progression [5, 15, 16 ]. all authors agreed that psa > 20 ng / ml indeed could be considered as a high risk factor. gleason score has long been recognized as an important risk indicator for worse outcome. in locally advanced pca, biopsy gleason sum has a tendency to be upgraded, and in our series upgrading was indeed frequent (up to 50%). in fact, in our study, specimen gleason score was identified as one of the most important outcome predictor. our data showed a significant difference between survival curves (os, css, dpfs and bpfs) comparing gleason score 6 - 7 vs. 8 - 9. patients with postoperative gleason 8 are associated with a 2-fold increased risk for biochemical relapse. most of the published studies confirm that gleason score 8 - 10 indeed determines worse biochemical or disease free survival both in locally advanced and organ confined disease [1720 ]. our study shows that 5-year os, css, dpfs or bpfs rates in gleason score 8 - 9 pca were 80.8%, 80%, 80.8% and 27.3% compared to 97.8%,100%, 99% and 62.6% if gleason score was 6 - 7. however, significant survival differences between high and moderate grade pca does not mean that a more advanced tumor grade is a contraindication for surgery. tewari. pointed out that long term results in high grade pca after surgery are better when comparing surgically treated patients with those who underwent rt or conservative treatment. in 453 patients with biopsy gleason 8 - 10, median os after surgery was 9.7 years, while for radiation this was 6.7 years and for conservative treatment 5.2 years. the risk of cancer - related death after surgery was 68% lower than after conservative treatment and 48% lower than after rt. generally, it is accepted that patients with locally advanced pca at final histology are ideal candidates for additional treatment after surgery. rt, adt or a combination is the best choice to decrease the risk of disease progression following surgery. in the present study, only 21.4% of cases received adjuvant or salvage treatment and it demonstrate that rrp alone in pt3a pca could yield very good cancer control especially in cases with psa < 10 ng/ ml and gleason score 7. with 5-year os and css of 96% and 98.7%, our study supports the notion that radical prostatectomy with adjuvant or salvage therapy when needed may provide comparable outcomes as rt plus adt in locally advanced pca, especially in pt3a. in locally advanced pt3 pca, surgery can yield very good cancer control and survival rates especially in cases with psa < 10 ng / ml and gleason score 7. psa and gleason score after surgery are the most significant predictors of outcomes after radical prostatectomy. | introductionthe aim of this study is to present the oncologic outcomes and to determine prognostic parameters of overall (os), cancer specific survival (css), disease progression free survival (dpfs) and biochemical progression free survival (bpfs) after surgery for pt3a prostate cancer (pca).material and methodsbetween 2002 and 2007, a pt3a stage after radical prostatectomy was detected in 126 patients at our institution. kaplan - meier analysis was used to calculate os, css, dpfs and bpfs. cox regression was used to identify predictive factors of survival.resultsfive-year os, css, dpfs and bpfs rates were 96%, 98.7%, 97.3% and 60%, respectively. among patients with prostate specific antigen (psa) 20 ng / ml the 5-year os was 98.8% and 80%, respectively, whereas 5-year bpfs was 66% and 16.6%, respectively. survival was different when comparing surgery gleason score 7 and 8. 5-year os and bpfs were 98% vs. 80%, and 62.6% vs. 27.3%, respectively. specimen gleason score and preoperative psa were significant predictors of bpfs. the risk of biochemical progression increased up to 2-fold when a gleason score 8 was present at final pathology.conclusionsin locally advanced pt3 pca, surgery can yield very good cancer control and survival rates especially in cases with psa < 10 ng / ml and gleason score 7. psa and gleason score after surgery are the most significant predictors of outcomes after radical prostatectomy. |
the prevalence of diabetes in united arab emirates is estimated to be 12.6%, affecting 768 thousand people. fear of hypoglycaemia and gain in body weight are barriers for initiation of insulin therapy. modern insulin analogues are a convenient new approach or tool to glycaemic control, associated with low number of hypoglycaemia and favourable weight change. a1chieve, a multinational, 24-week, non - interventional study, assessed the safety and effectiveness of insulin analogues in people with t2 dm (n = 66,726) in routine clinical care. this short communication presents the results for patients enrolled from abu dhabi. please refer to editorial titled : the a1chieve study : mapping the ibn battuta trail. the patient characteristics for the entire cohort divided as insulin - nave and insulin users is shown in the table 1. other groups were insulin aspart (n = 13), basal insulin plus insulin aspart (n = 42), biphasic insulin aspart (n = 134) and other insulin combinations (n = 41). after 24 weeks of treatment, overall hypoglycaemic events reduced from 2.0 events / patient - year to 0.2 events / patient - year in insulin user group whereas hypoglycaemia increased from 0.1 events / patient - year to 0.5 events / patient - year in insulin naive group. however, this hypoglycaemia incidence in insulin naive group at 24 weeks was still lower than that observed in insulin users at baseline. major hypoglycaemic events remained same as that of baseline (0.1 events / patient - year) in insulin nave group whereas it reduced from 0.1 events / patient - year to 0.0 events / patient - year in insulin users. blood pressure decreased and overall lipid profile improved at week 24 in the cohort [tables 2 and 3 ]. overall demographic data all parameters of glycaemic control improved from baseline to study end in the total cohort. more than one third of patients achieved hba1c < 7.0% at week 24 [table 4 ]. overall efficacy data of the total cohort, 134 patients started on biphasic insulin aspart ogld, of which 84 (62.7%) were insulin nave and 50 (37.3%) were insulin users. after 24 weeks of starting or switching to biphasic insulin aspart, hypoglycaemic events increased from 0.2 events / patient - year to 0.8 events / patient - year in insulin nave group and from 0.5 events / patient - year to 0.6 events / patient - year in insulin users group. a small increase in body weight was also observed at the end of the study [tables 5 and 6 ]. biphasic insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to biphasic insulin aspart for both insulin nave and insulin user groups [table 7 ]. biphasic insulin aspartoral glucose - lowering drug efficacy data of the total cohort, 42 patients started on basal + insulin aspart ogld, of which 11 (26.2%) were insulin nave and 31 (73.8%) were insulin users. after 24 weeks of starting or switching to basal + insulin aspart, hypoglycaemic events reduced from 4.6 events / patient - year to 0.0 events / patient - year in insulin user group whereas hypoglycaemia was nil similar to baseline in insulin nave group. body weight decreased at the end of the study [tables 8 and 9 ]. basal+insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to basal + insulin aspart oglds for both insulin nave and insulin user groups [table 10 ]. basal+insulin aspartoral glucose - lowering drug efficacy data of the total cohort, 152 patients started on insulin detemir ogld, of which 99 (65.1%) were insulin nave and 53 (34.9%) were insulin users. after 24 weeks of starting or switching to insulin detemir, hypoglycaemic events reduced from 2.7 events / patient - year to 0.0 events / patient - year in insulin user group, whereas hypoglycaemia increased from 0.0 events / patient - year to 0.3 events / patient - year in insulin nave group. a decrease in body was also observed at 24 weeks [tables 11 and 12 ]. insulin detemiroral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin detemir oglds for both insulin - nave and insulin user groups [table 13 ]. insulin detemiroral glucose - lowering drug efficacy data of the total cohort, 13 patients started on insulin aspart ogld, of which 5 (38.5%) were insulin nave and 8 (61.5%) were insulin users. after 24 weeks of starting or switching to insulin aspart, hypoglycaemia was nil similar to that of baseline for both insulin nave and insulin user groups. a decrease in body weight was observed in insulin nave group [tables 14 and 15 ]. insulin aspartoral glucose - lowering drug safety data mean hba1c and fpg values improved from baseline to study end in those who started on or were switched to insulin aspart oglds for both insulin nave and insulin user groups [table 16 ]. of the total cohort, 134 patients started on biphasic insulin aspart ogld, of which 84 (62.7%) were insulin nave and 50 (37.3%) were insulin users. after 24 weeks of starting or switching to biphasic insulin aspart, hypoglycaemic events increased from 0.2 events / patient - year to 0.8 events / patient - year in insulin nave group and from 0.5 events / patient - year to 0.6 events / patient - year in insulin users group. a small increase in body weight was also observed at the end of the study [tables 5 and 6 ]. biphasic insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to biphasic insulin aspart for both insulin nave and insulin user groups [table 7 ]. of the total cohort, 42 patients started on basal + insulin aspart ogld, of which 11 (26.2%) were insulin nave and 31 (73.8%) were insulin users. after 24 weeks of starting or switching to basal + insulin aspart, hypoglycaemic events reduced from 4.6 events / patient - year to 0.0 events / patient - year in insulin user group whereas hypoglycaemia was nil similar to baseline in insulin nave group. body weight decreased at the end of the study [tables 8 and 9 ]. basal+insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to basal + insulin aspart oglds for both insulin nave and insulin user groups [table 10 ]. of the total cohort, 152 patients started on insulin detemir ogld, of which 99 (65.1%) were insulin nave and 53 (34.9%) were insulin users. after 24 weeks of starting or switching to insulin detemir, hypoglycaemic events reduced from 2.7 events / patient - year to 0.0 events / patient - year in insulin user group, whereas hypoglycaemia increased from 0.0 events / patient - year to 0.3 events / patient - year in insulin nave group. a decrease in body was also observed at 24 weeks [tables 11 and 12 ]. insulin detemiroral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin detemir oglds for both insulin - nave and insulin user groups [table 13 ]. insulin detemiroral glucose - lowering drug efficacy data of the total cohort, 13 patients started on insulin aspart ogld, of which 5 (38.5%) were insulin nave and 8 (61.5%) were insulin users. after 24 weeks of starting or switching to insulin aspart, hypoglycaemia was nil similar to that of baseline for both insulin nave and insulin user groups. a decrease in body weight was observed in insulin nave group [tables 14 and 15 ]. insulin aspartoral glucose - lowering drug safety data mean hba1c and fpg values improved from baseline to study end in those who started on or were switched to insulin aspart oglds for both insulin nave and insulin user groups [table 16 ]. our study reports improved glycaemic control following 24 weeks of treatment with any of the insulin analogues (biphasic insulin aspart ; basal + insulin aspart ; insulin detemir ; insulin aspart) with or without ogld. major hypoglycaemic events remained same as that of baseline (0.1 events / patient - year) in insulin nave group whereas major hypoglycaemia reduced from 0.1 events / patient - year to 0.0 events / patient - year in insulin users. though the findings are limited by number of patients, still the trend indicates that insulin analogues can be considered effective and possess a safe profile for treating type 2 diabetes in abu dhabi. | background : the a1chieve, a multicentric (28 countries), 24-week, non - interventional study evaluated the safety and effectiveness of insulin detemir, biphasic insulin aspart and insulin aspart in people with t2 dm (n = 66,726) in routine clinical care across four continents.materials and methods : data was collected at baseline, at 12 weeks and at 24 weeks. this short communication presents the results for patients enrolled from abu dhabi.results:a total of 383 patients were enrolled in the study. four different insulin analogue regimens were used in the study. study patients had started on or were switched to biphasic insulin aspart (n = 134), insulin detemir (n = 152), insulin aspart (n = 13), basal insulin plus insulin aspart (n = 42) and other insulin combinations (n = 41). at baseline glycaemic control was poor for both insulin nave (mean hba1c : 9.4%) and insulin user (mean hba1c : 9.1%) groups. after 24 weeks of treatment, both groups showed improvement in hba1c (insulin nave : 2.1%, insulin users : 1.8%). sadrs did not occur in any of the study patients. major hypoglycaemic events remained same as that of baseline (0.1 events / patient - year) for insulin nave group whereas major hypoglycaemia reduced from 0.1 events / patient - year to 0.0 events / patient - year in insulin users.conclusion:starting or switching to insulin analogues was associated with improvement in glycaemic control with a low rate of hypoglycaemia. |
osteoporosis is a common metabolic bone disease characterized by low bone mass, microarchitectural weakening leading to bone fragility, and increased fracture risk. osteoporosis affects one in three women and one in five men over the age of 50 and may not be detected until symptoms or fractures occur. white women over the age of 50 have a 50% chance of fracturing in their lifetime and these fractures result in increased morbidity and mortality risks. approximately 40% of the patients with osteoporotic hip fractures die within 5 years after their fractures occur. osteoporosis is a preventable and treatable disease ; but because of no signs present prior to a fracture, many people are not being diagnosed in time to receive effective therapy. the national osteoporosis foundation has identified many risk and predisposing factors for osteoporosis and related fractures in postmenopausal women. some of the important factors are : history of fractures in adulthood, smoking, estrogen deficiency at an early age, low body weight, poor health, low calcium intake, physical inactivity, little exposure to sunlight, alcohol abuse, and use of oral glucocorticoid therapy for more than 3 months. osteoporosis predominantly affects elderly women. while bone loss starts at about 35 years of age, the rate of bone loss increases after menopause in women. women show an estrogen - related bone loss starting at menopause, predominantly in trabecular bone, followed by a slower loss of both trabecular and cortical bones 48 years later. after this period, changes related to age generally consist of disconnections of the trabecular network ; but in men, thinning of the trabeculae is seen. since osteoporotic fractures are a health burden worldwide, resulting in reduced physical activity, increased risk of mortality, and increased medical costs, health promotion strategies focus on identifying subjects at a high risk of the disease. before a fracture occurs, osteoporosis is characterized by decreased bone mineral density (bmd) in the preclinical stage. bmd testing using dual - energy x - ray absorptiometry (dxa) is a vital component in the diagnosis and management of osteoporosis. according to the world health organization (who) criteria, bmd values are divided into the following diagnostic guidelines : normal (t - score > 1.0), osteopenia (t - score between 1.0 and 2.5), and osteoporosis (t - score 95%), others did not find a sensitivity of even 20%. horner. recommended that women having an mi below the mental foramen of less than 3 mm should be referred for investigation of osteoporosis. however, in another study which used a more lateral measurement site than mental foramen on the mandible, the threshold value was 2.75 mm. considering the results of the studies, asymptomatic dental patients with an mi of less than about 3 mm may be candidates for dxa testing. pmi is the ratio between the cortical width at the mental foramen region and the distance from the lower border to the inferior edge of the mental foramen (mi / h) [figure 4 ]. these studies considered the threshold value of 0.3 and the estimated sensitivity and specificity was higher than 70%. linear measurements on the panoramic radiographs have limitations because of unequal magnification and geometric distortion arising from exposure parameters or settings between different panoramic machines. therefore, studies on standardized panoramic radiographs would be more reliable in detecting osteoporosis. however, this is not a practical method in clinical situation. different studies revealed different intraobserver or interobserver agreement to detect osteoporosis using these panoramic indices. as none of these indices showed perfect intraoberserver or interobserver agreement, it has been suggested to assess all of these indices. menopause is the major factor contributing to the rapid decrease in the bmd of the skeleton including the jaws in the elderly women. in the mandible, local factors such as the number of teeth and mastication influence the bone to some degree panoramic radiography is used for the early detection of osteoporosis due to its low cost and the large numbers of osteoporotic patients attending the dental clinics as a result of higher life expectancies. it would be economical and beneficial if the radiographs could be used for triaging individuals with undetected osteoporosis. another advantage of using these radiographs is that these are often taken repeatedly, with similar projection and exposure parameters, making them very suitable for comparison. it is well known that the mandibular cortical bone undergoes resorptive activity in osteoporotic patients, leading to a decreased thickness and more porous inferior border, characteristics that can be determined by panoramic radiographs. studies focusing on identifying the elderly individuals with osteoporosis, especially postmenopausal women, have demonstrated the usefulness of mandibular cortical indices from panoramic radiographs. three indices were reported by most of the studies : mandibular cortical shape [mandibular cortical index (mci) or klemetti index (ki) ] and width [mental index (mi) ], and panoramic mandibular index (pmi). mci or ki refers to the appearance of the inferior cortex of the mandible and is classified as follows : c1 : the endosteal margin of the cortex is even and sharp on both sides [figure 1 ] ; c2 : the endosteal margin presents semilunar defects (lacunar resorption) and/or appears to form endosteal cortical residues on one or both sides [figure 2 ] ; and c3 : the cortical layer forms heavy endosteal cortical residues and is clearly porous [figure 3 ]. some studies have reported that women with a mild to moderate and severe eroded cortex are considered to have an increased likelihood of osteoporosis. a recent study showed that approximately 95% of japanese women identified by trained dentists using cortical shape findings did have osteopenia or osteoporosis. as a result, studies concluded that the sensitivity of mci in the diagnosis of osteoporosis (t - score 95%), others did not find a sensitivity of even 20%. horner. recommended that women having an mi below the mental foramen of less than 3 mm should be referred for investigation of osteoporosis. however, in another study which used a more lateral measurement site than mental foramen on the mandible, the threshold value was 2.75 mm. considering the results of the studies, asymptomatic dental patients with an mi of less than about 3 mm may be candidates for dxa testing. pmi is the ratio between the cortical width at the mental foramen region and the distance from the lower border to the inferior edge of the mental foramen (mi / h) [figure 4 ]. these studies considered the threshold value of 0.3 and the estimated sensitivity and specificity was higher than 70%. linear measurements on the panoramic radiographs have limitations because of unequal magnification and geometric distortion arising from exposure parameters or settings between different panoramic machines. therefore, studies on standardized panoramic radiographs would be more reliable in detecting osteoporosis. however, this is not a practical method in clinical situation. different studies revealed different intraobserver or interobserver agreement to detect osteoporosis using these panoramic indices. as none of these indices showed perfect intraoberserver or interobserver agreement, it has been suggested to assess all of these indices. menopause is the major factor contributing to the rapid decrease in the bmd of the skeleton including the jaws in the elderly women. in the mandible, local factors such as the number of teeth and mastication influence the bone to some degree. in conclusion, all three mandibular cortical indices (mci, mi, and pmi) discussed in this review are useful tools to detect low bmd. postmenopausal women with c3 category, mi <3 mm, and pmi < 0.3 may be considered for further osteoporosis investigation. | osteoporosis is a major health problem affecting one in three women over the age of 50 and may not be detected until fractures occur. since osteoporotic fractures are a health burden worldwide, identifying subjects with a high risk of osteoporosis and preventing osteoporosis - related mortality and morbidity are a very important health strategy. women show an estrogen - related bone loss starting at menopause, predominantly occurring in trabecular bone. diagnosis of osteoporosis is usually based on the bone mineral density measurement, but this is not a practical and economical technique for early detection. therefore, investigators are interested in the possibility of detecting osteoporosis from the panoramic radiographs. mandibular cortical bone undergoes resorptive activity in osteoporotic patients, leading to a decreased thickness and more porous inferior border. therefore, studies have demonstrated the usefulness of cortical width and shape, determined from panoramic radiographs, in identifying elderly individuals with undetected osteoporosis, especially postmenopausal women. in conclusion, postmenopausal women with c3 category, mental index (mi) <3 mm, and panoramic mandibular index (pmi) < 0.3 may be considered for further osteoporosis investigation. |
antimitotic agents such as the taxanes are used widely to treat various cancers. to address limitations with these agents, a new generation of inhibitors that disrupt mitosis without affecting microtubule dynamics however, we still have limited understanding of the mechanisms that dictate cell fate in response to mitotic disruption. here we show that myc drives expression of an apoptotic network that sensitizes breast, ovarian, lung, and colon cancer cells to drugs that both activate and override the spindle assembly checkpoint. moreover, we show that myc promotes both p53-independent death in mitosis and p53-dependent post - mitotic responses. our results raise opportunities to explore biomarkers and combination therapies aimed at enhancing antimitotic efficacy. antimitotic drugs are frontline treatments for breast, ovarian, and lung cancer, as well as various hematological malignancies (dumontet and jordan, 2010). these drugs bind tubulin and inhibit microtubule dynamics, and although many cancers initially respond well, some are intrinsically resistant and others acquire resistance (murray., 2012). predicting which cancers will respond is hampered by our limited understanding of the molecular mechanisms responsible for patient benefit (gascoigne and taylor, 2009 ; weaver, 2014). at high concentrations, antimitotic drugs disrupt spindle assembly, leading to mitotic arrest by persistent activation of the spindle assembly checkpoint (sac) (lara - gonzalez., 2012). sac activation blocks the anaphase promoting complex / cyclosome (apc / c), thereby preventing ubiquitination and degradation of cyclin b1, in turn maintaining the mitotic state. following prolonged arrest, cells either die in mitosis or undergo slippage, returning to interphase without completing cell division (brito and rieder, 2006). following slippage, p53-dependent post - mitotic responses then induce cell cycle arrest, senescence, or apoptosis (rieder and maiato, 2004). at lower taxol concentrations, the sac becomes satisfied, allowing cells to progress through mitosis, albeit with spindle abnormalities and chromosome segregation errors (zasadil., 2014). bypassing both death in mitosis (dim) and post - mitotic responses can fuel chromosome instability and taxane resistance (ahern., the competing - networks model helps explain whether a cell either dies in mitosis or undergoes slippage (gascoigne and taylor, 2008). according to this model, two independent networks dictate mitotic cell fate, one slowly generating a death signal, the other slowly degrading cyclin b1, leading to slippage. during a prolonged arrest, these networks work in opposite directions : while cell death signals become stronger, cyclin b1 levels slowly fall due to incomplete penetrance of sac - mediated apc / c inhibition (brito and rieder, 2006). both networks have thresholds and the fate of the cell is dictated by which threshold is breached first. whereas our understanding of the mechanisms regulating cyclin b1 degradation is well advanced, less is known about death in mitosis. it involves the intrinsic apoptosis pathway ; however, how this is regulated during mitosis is unclear (topham and taylor, 2013). the nature of the apoptotic trigger is also unclear, but dna damage seems a likely candidate, with one source being partial activation of caspase - activated dnase (cad), caused by cytochrome c leakage from mitochondria (orth., 2012). a second source is telomere deprotection, driven by the mitotic kinase aurora b (hayashi., 2012). in light of our limited understanding regarding the mechanisms responsible for apoptosis during a mitotic arrest, we adopted an unbiased approach and screened a genome - wide library for sirnas that suppress taxol - induced cell death. to define how genes identified in the screen modulate antimitotic responses, we then used single - cell time - lapse imaging to directly correlate mitotic behavior with subsequent cell fate. the competing - networks model predicts that suppressing death signals during mitotic arrest provides more time for cyclin b1 degradation, thereby shifting cell fate from death to slippage (figure 1a). to test this, we screened an sirna library to identify genes required for dim. because slippage results in cell survival, we based the screen on a viability assay (figure s1a). to maximize the assay s dynamic range, we treated rko cells, which predominantly undergo dim (gascoigne and taylor, 2008), with a saturating concentration of taxol to ensure maximal mitotic blockage and apoptotic response. we also synchronized the cells to maximize cell death by 48 hr (figure 1b). the primary screen identified 325 hits (figure s1b). to filter out off - target hits, we performed a secondary screen using a pool of four different sirnas, yielding 100 hits. because taxol - induced death requires mitotic entry and robust spindle checkpoint activation, we predicted that in addition to dim genes, the screen would also uncover genes required for cell cycle progression and sac function. indeed, we identified all the known sac components, several kinetochore proteins required for sac function and the entire chromosomal passenger complex, plus several genes required for mitotic entry (figure 1c). to distinguish cell cycle and sac genes from potential dim genes, we performed a tertiary screen measuring mitotic index at 24 hr (figure 1b) and plotted it against viability at 48 hr (figure 1c). to hone in on potential dim genes, we focused on hits with a high mitotic index at 24 hr and a substantial viability score at 48 hr (figure 1c). time - lapse microscopy showed that sirna pools targeting kcnk1, znf791, snta1, and myc shifted cell fate from death to slippage (figure s1c). importantly, mitotic exit was not accelerated, indicating inhibition of apoptosis rather than sac override. of the four hits, we first focused on myc, which encodes the bhlh - zip transcription factor c - myc (hereafter myc). myc, a potent oncogene deregulated in many cancers, regulates a multitude of genes via both transcriptional amplification and co - factor - dependent activation / repression (conacci - sorrell., 2014 ; eilers and eisenman, 2008 ; hann, 2014 ; wolf., 2015). myc thus drives numerous biological pathways including proliferation, biogenesis, and metabolism which, when deregulated, promote transformation and tumorigenesis. because myc can also drive apoptosis, primarily via the arf - mdm2-p53 pathway (lowe., 2004 ; mcmahon, 2014), we considered it an attractive candidate for a dim gene. to validate myc as a bona fide on - target hit, we deconvolved the sirna pools, identifying four distinct sirnas that repressed myc and inhibited dim (figures s1d and s2a). when combined, these four sirnas reduced myc protein levels by 90% and shifted cell fate in favor of slippage (figures 2a and 2b). in nine control experiments, quantitating 100 cells per population, 82% of cells underwent dim, while 18% slipped (figure 2c). in five myc rnai populations, 45% of cells died, while 55% slipped. moreover, titrating the sirnas revealed a correlation between myc protein levels and cell fate (figure 2d). in addition, an rnai - resistant myc transgene reverted the fate profile back toward dim (figure s2b). to further validate myc, we turned to non - rnai modalities, in particular the small molecules dmso and jq1 (figure s2c). dmso, which blocks transcriptional elongation of myc (eick and bornkamm, 1986), efficiently suppressed myc in rko cells (figure s2c) and reduced dim from 92% to 58% (figure s2d). jq1 displaces the brd4 transcriptional elongation factor from the myc promoter (filippakopoulos., 2010 ; mckeown and bradner, 2014) and accordingly jq1 inhibited myc expression in rko cells (figure s2c). this was accompanied by a substantial effect on proliferation (figure 2e). however, of the cells that did enter mitosis, only 56% were killed by taxol, demonstrating a shift in favor of slippage (figure 2e). significantly, a myc cdna resisted the dmso and jq1 effects and restored dim (figure s2d). to determine whether myc s role in dim depends on its ability to modulate gene expression, we turned to omomyc, a mutant bhlh - zip domain that sequesters myc in complexes unable to bind to e - boxes (soucek., 2002). inducing omomyc in rko cells inhibited dim (figure s2b), indicating that myc most likely promotes dim via its canonical role as a transcription factor. interestingly myc v394d, which can not bind the miz1 transcriptional repressor (wiese., 2013), rescued myc rnai (figure s2b), suggesting that myc promotes dim largely via transcriptional activation. taking together the rnai data, the dmso, jq1, and omomyc experiments, we conclude that myc is a key determinant of cell fate following prolonged mitotic arrest. the competing - networks model predicts that suppressing mitotic death provides more time for cyclin b1 degradation, thus shifting the balance toward slippage. a corollary is that the average time spent in mitosis should increase (figure 1a). consistently, whereas controls spent 17.1 hr arrested in mitosis, myc - deficient cells spent 21.3 hr (figure 2f) arrested in mitosis. moreover, when we compared the cells that died, controls took 16.0 hr, whereas myc - deficient cells took 20.4 hr ; thus, even if a cell did not escape death, inhibiting myc delayed its onset. slippage typically took longer than dim (figure 2 g) and the time from mitotic entry to slippage was not significantly affected by myc rnai (figure 2f), consistent with the notion that the two competing networks are independent, and that myc influences the death pathway but not the slippage pathway. to define how myc promotes dim, we interrogated mitosis and apoptosis gene expression modules using nanostring technology. with the exception of cenp - t, all the mitosis genes were suppressed following myc rnai (figure 3a), reflecting myc s role as a transcriptional amplifier and/or cell cycle driver. of the three notably repressed genes, survivin and mad2 promote chromosome alignment and sac function. consistently, in the absence of taxol, whereas overall mitotic timing was normal in myc rnai cells, chromosome alignment was delayed slightly and anaphase onset slightly accelerated (figure s3a). nevertheless, despite these subtle effects on an unperturbed mitosis, figure 2 clearly demonstrates that myc - deficient cells mount a robust sac response in 100 nm taxol, suggesting that mitotic deregulation is unlikely to account for the shift in cell fate. we therefore turned to the apoptosis module, which included 12 upregulated and six downregulated genes (figure 3a). because myc rnai promotes survival, the dominant effectors are likely to be upregulated pro - survival genes and/or downregulated pro - death genes. of the upregulated genes, bcl - xl is a well - established pro - survival factor, while three of the downregulated genes, namely bid, bim, and noxa, encode bh3-only pro - apoptotic proteins (figure 3a). because these are myc effectors in other contexts (mcmahon, 2014), we analyzed them in more detail. consistent with myc s known ability to repress bcl - xl (eischen., 2001), myc rnai elevated bcl - xl protein levels in rko cells (figure s3b). ectopic overexpression of bcl - xl suppressed both dim and post - mitotic apoptosis (figures 3b and s3c), supporting the notion that bcl - xl is a potent mitotic survival factor (bah. however, ectopic bcl - xl enhanced survival more potently than myc rnai, suggesting that other consequences of myc inhibition attenuate the pro - survival effect of increased bcl - xl (eichhorn., 2014). indeed, whereas mcl1 transcripts fell only marginally upon myc rnai, mcl1 protein levels fell substantially (figures s3b and s3e), possibly due to deregulation of factors involved in mcl1 turnover. however, in taxol - arrested cells, this residual mcl1 appeared to resist mitotic degradation (figure s3e). nevertheless, despite these complexities, we reasoned that bcl - xl upregulation alone is unlikely to explain the myc rnai phenotype, and therefore we turned our attention to the downregulated pro - death genes. the downregulated bh3-only proteins (figure 3a), namely bid, bim, and noxa, are known to be upregulated by myc, either directly or via the arf - mdm2-p53 pathway (mcmahon, 2014). if bid, bim, and noxa are important myc dim effectors, then their inhibition should mimic myc rnai. however, because they did not manifest in the screen they are unlikely to be essential for dim. indeed, repression of each in isolation or in pairs had little effect on mitotic fate (figure s3, co - repression of bim, bid, and noxa tipped the balance in favor of slippage (figure 3d), consistent with them being redundant downstream effectors of myc. a corollary is that overexpression of any one should revert the myc rnai phenotype. indeed, transgenic bim restored dim in myc rnai cells (figures 3e and s3h). consistent with the competing - networks concept, bim / bid / noxa rnai extended mitotic timing, whereas induction of bim accelerated the onset of dim (figure s3i). we conclude therefore that bim, bid, and noxa are redundant myc effectors required for dim. to test the role of myc in a wider context, we inhibited myc in 12 cell lines derived from colon, lung, breast, cervical, and ovarian cancers (figure s4a), then exposed them to a panel of antimitotic drugs including agents targeting eg5/ksp, plk1, cenp - e, aurora a, aurora b, and mps1. to monitor apoptosis, we used time - lapse imaging to measure caspase-3/7 activity. the effects of inhibiting myc were strikingly consistent, significantly attenuating apoptosis in nine lines (figure 4a). interestingly, myc inhibition had little effect in three lines, namely dld-1, h1703, and caov-3. dld-1 cells slip very quickly (gascoigne and taylor, 2008) ; therefore, despite inhibiting dim, slippage would be expected to continue such that myc rnai has little effect. conversely, h1703 cells die very quickly and rarely slip, suggesting that despite delaying dim, slippage may not be fast enough to permit exit. nevertheless, myc promotes apoptosis in a variety of cancer lines exposed to various antimitotic agents. in contrast to taxol, drugs targeting aurora b and mps1 drive cells through an aberrant mitosis (keen and taylor, 2009), suggesting that myc also promotes apoptosis following slippage. indeed, following exit from a prolonged taxol arrest, myc rnai reduced cell death from 60% to 25% (figure 4b). moreover, in response to an mps1 inhibitor, myc rnai reduced post - mitotic apoptosis from 40% to 18% (figure 4c) and enhanced colony formation (figure s4b). canonical myc - driven apoptosis involves the arf - mdm2-p53 pathway ; however, because p53 is disengaged during mitosis, myc - dependent dim is likely p53-independent. indeed, myc rnai suppressed apoptosis in p53-deficient hct116 cells treated with mitotic blockers (figure 4a). consistent with p53 restraining further cell cycle progression following an aberrant mitosis (thompson and compton, 2010), p53 deletion increased the number of hct116 cells entering a second mitosis from 32% to 68% (figure 4c). however, apoptosis was only slightly affected by p53 loss, 30% versus 40% in controls, indicating that post - mitotic apoptosis is largely p53-independent. interestingly, whereas myc rnai only had a marginal effect on post - mitotic apoptosis in p53-deficient cells, it increased the number of p53-proficient cells entering a second mitosis from 32% to 58% (figure 4c). thus, following an aberrant mitosis, myc not only enhances post - mitotic apoptosis but also suppresses cell cycle progression, possibly via the arf - mdm2-p53 pathway. in breast cancers, taxol does not accumulate to concentrations high enough to induce prolonged mitotic arrest ; rather cells progress through mitosis, albeit with chromosome segregation errors (zasadil., 2014). because myc promotes post - mitotic death, we reasoned that myc would also influence low - dose taxol responses. to test this, we reduced the taxol concentration to 10 nm (figure s4c), a concentration in cell culture medium that results in intracellular concentrations similar to those measured in breast cancer (zasadil., 2014). in 10 nm taxol, most rko cells died in mitosis but 31% divided, indicating that the taxol concentration was on the edge (figure 4d). of those that divided, 12.5% died in the next interphase. strikingly, myc rnai cells spent considerably less time in mitosis then divided, indicating that the sac became satisfied (figure 4d). consistently, myc rnai slightly accelerated anaphase onset during an unperturbed mitosis (figure s3a). following division in 10 nm taxol these divisions are unlikely to be normal ; indeed, when we added 100 nm wehi-539, a selective bcl - xl inhibitor (lessene., 2013), thus, inhibiting myc enhances survival in low - dose taxol but this can be ameliorated by inhibition of bcl - xl. because inhibiting myc suppresses apoptosis in response to antimitotic agents, we asked whether elevating myc expression had the opposite effect. indeed, tet - induction of a myc transgene in rko cells accelerated dim by 2.3 hr and reduced slippage, albeit modestly (figure 5a) moreover, of the cells that slipped, overexpressing myc increased post - mitotic death from 46% to 78%. consistently, overexpressing myc in rat1a cells enhances colcemid - induced apoptosis (li and dang, 1999). to examine myc overexpression in a wider context, we interrogated the genomics of drug sensitivity in cancer database (garnett., 2012), which describes 665 cell lines, 47 of which overexpress myc, in response to 141 drugs, 11 of which target microtubules or mitotic regulators. the mean half - maximal inhibitory concentration (ic50) effect for the 11 antimitotic drugs was 0.47 compared to 0.83 for the other 130 drugs (figures 5b and s5a), confirming that tumor cells overexpressing myc are more sensitive to antimitotic agents compared to drugs in general. to determine whether the myc overexpression effect extended to patient chemotherapy responses, we interrogated microarray datasets from xena, a clinical trial examining response rates in women with operable, early stage breast cancer receiving neoadjuvant capecitabine plus the antimitotic agent docetaxel (glck., 2012). tumors from patients showing complete or near - complete responses tended to have elevated myc (figures 5c and 5d). next, we analyzed the sac and cell cycle genes identified by the sirna screen (figure 1c), and the myc regulated genes identified by our nanostring analysis (figure 3a). although there was no obvious overall correlation between myc and several housekeeping genes, myc correlated positively with the sac, cell cycle, and apoptosis genes (figures 5c and 5e). moreover, the sac, cell cycle, and myc clusters were elevated in the responsive tumors (figure s5b). the elevation was not simply due to a global increase in gene expression because bcl - xl displayed a negative correlation (figures 5c5e), consistent with myc - induced suppression (figure 3a). moreover, the correlation between myc and cell cycle / sac genes was not simply due to increased proliferation, because her2-positive tumors did not show a similar pattern (figures 5e and s5c). these results suggest that a positive response to antimitotic chemotherapy requires entry into mitosis, a robust sac response, and the ability to undergo myc - dependent apoptosis. the correlation between myc expression and chemotherapy responses is provocative. however, her2-negative breast cancers include various tumor subtypes and xena used multiple chemotherapy agents. we therefore turned to a genetically constrained model system that allows single agent exposure to validate the role of myc in the context of an intact tissue. mice harboring a conditional myc allele provided such a system (phesse., 2014). ahcre myc mice were injected with -napthoflavone to delete myc in the small intestine. four days later, taxol was administered to induce mitotic arrest and then apoptosis was measured with caspase 3 staining (radulescu., 2010). in myc - deficient intestines, we observed 0.2 apoptotic cells per intestinal crypt compared to 1.2 in myc - proficient controls (figure 6). we conclude therefore that myc is a determinant of mitotic cell fate in the mouse intestine. the transcript profiling and functional experiments indicate that myc enhances dim by suppressing bcl - xl and upregulating bh3-only proteins (figure 3). however, a defining feature of myc is its ability to modulate numerous genes thereby influencing various biological processes, including biosynthesis and metabolism pathways (conacci - sorrell., 2014 ; eilers and eisenman, 2008). consequently, myc targets not included in the nanostring analysis could contribute to the phenotype. moreover, the screen identified kcnk1, znf791 and snta1 (figure s1c), but it is not immediately obvious how they might modulate apoptosis. to address these issues, we deconvolved the kcnk1, znf791, and snta1 sirna pools. in each case, only a single sirna sequence enhanced viability, suggesting that they were when transfected in isolation, the active znf791 and snta1 sirnas accelerated mitotic exit rather than delaying dim (figure s1e). in contrast, the active kcnk1 sirna induced a myc - like phenotype, suppressing dim without accelerating mitotic exit. therefore, to identify the target of this sirna, and to interrogate myc target genes not included in the nanostring analysis, we turned to global gene expression profiling. rko cells were transfected with myc, kcnk1, and snta1 sirnas and then cdna libraries were sequenced using illumina hiseq technology. myc rnai induced numerous changes, with 955 downregulated genes and 1,214 upregulated genes (figure 7a). the effect on myc itself was relatively modest, possibly reflecting negative auto - regulation (conacci - sorrell., 2014). gene ontology analysis highlighted ribosome biogenesis, metabolism, gene expression, cell cycle, and apoptosis pathways (figure s6c), consistent with known myc functions. the kcnk1 sirna affected 424 genes, with kcnk1 itself one of the most repressed (figure 7a). whereas gene ontology analysis also highlighted metabolism and biosynthesis pathways, the p values and fold enrichment scores were substantially lower (figure s6c), indicating that dim can be suppressed without major effects on metabolism and biosynthesis pathways. to understand how the active kcnk1 sirna suppresses dim, we focused on the 58 downregulated genes in common with myc (figure 7b). only two were repressed more than 2-fold in both conditions, namely snord102 and egr1. of these, egr1, a zinc finger transcription factor, stands out as it is an established myc target required for myc - dependent, p53-independent apoptosis, and it cooperates with myc to upregulate bim and noxa (boone., 2011 ; wirth., 2014). consistently, transcript profiling indicated that bim, bid, and noxa were reduced following kcnk1 sirna (not shown). to test directly whether egr1 promotes dim strikingly, this shifted cell fate from dim to slippage in a manner comparable to myc sirna (figure 7c). dim gene and suggest that kcnk1 manifested in the screen because of off - target activity toward egr1. although myc and egr1 appear to set the stage for dim, what actually triggers apoptosis during a prolonged mitotic arrest is unclear. during the course of this work, we made two observations suggesting that myc may modulate two recently identified mechanisms (hayashi. first, we noted that icad, the inhibitor of cad, was markedly reduced by myc rnai (figure 3a). this was intriguing in light of the demonstration that cad - dependent dna damage incurred during mitosis activates p53 following slippage (orth., 2012). in addition to being an inhibitor of cad, icad is also a chaperone essential for cad function (nagase., 2003), and accordingly, inhibition of both icad and myc reduced cad (figure s7a). moreover, icad rnai suppressed dim (figure 8a), suggesting that by stabilizing cad, myc promotes accumulation of dna damage during mitosis thereby accelerating dim. consistently, -h2ax accumulation was less prevalent in taxol - treated myc rnai cells (figure s7b). we were also intrigued by the very rapid dim in cells lacking bcl - xl and mcl1 (figure s3f). in addition, we noticed that in the absence of taxol, bcl - xl / mcl1-deficient cells often died upon mitotic entry (figure s7c). however, it seems unlikely that icad / cad - dependent damage accumulates fast enough to trigger apoptosis during an unperturbed mitosis. indeed, icad rnai had little protective effect in cells co - depleted for bcl - xl and mcl1 (not shown). in contrast, telomere deprotection might cause a burst of dna damage upon mitotic entry (hayashi., 2012). indeed, inhibiting aurora b in bcl - xl / mcl1-deficient cells reduced dim from 69% to 34% (figure s7c) and suppressing telomere deprotection by overexpressing trf2 also had a protective effect (figures 8b and s7d). inhibiting myc in bcl - xl / mcl1-deficient cells had an even more penetrant effect, reducing dim in the absence of taxol from 69% to 10% (figure s7c). although this could simply reflect myc s role setting the balance between pro - survival and pro - death factors, these observations raise the possibility that myc may also modulate the dna damage - inducing pathways that trigger apoptosis during a prolonged mitotic arrest. the success of the sirna screen was predicated on the existence of genes essential for dim. consistent with the sac being indirectly required for dim (taylor and mckeon, 1997), we identified all the known sac components. indeed, sac genes frequently manifest in antimitotic rnai screens, yet apoptotic regulators rarely do (daz - martnez., 2014). this suggests that the two networks governing mitotic fate are rather different : while the sac consists of essential genes, the dim network involves redundant sub - networks. myc drives expression of the apoptotic network required for dim, providing a simple explanation for why it manifested in the screen. the sac, which is conserved from yeast to man, is an all - or - nothing mechanism that responds to a single input, unattached kinetochores, and is not buffered by transcription (lara - gonzalez., 2012). in contrast, apoptosis, a metazoan characteristic, responds to multiple inputs and can be fine - tuned by transcriptional buffering depending on developmental context and homeostatic pressures (barkett and gilmore, 1999). the differing architectures also support the notion that they are largely independent (gascoigne and taylor, 2008 ; huang., 2010). in addition to driving proliferation, myc overexpression drives apoptosis via arf - mdm2-p53 (mcmahon, 2014). because p53 is disengaged during mitosis, it is not clear how this mechanism could contribute to dim, and indeed p53 is not required for myc - dependent mitotic death. moreover, myc can upregulate bim, bid, and noxa independently of p53 (campone., 2011 ; egle., 2004 ; eischen., 2001 ; recent evidence shows that myc drives p53-independent apoptosis by cooperating with egr1, itself a myc target (boone., 2011). myc promotes egr1 expression via a non - canonical mechanism involving arf and in turn, myc and egr1 are co - recruited to the promoters of bim and noxa (boone., 2011 ; it seems likely, therefore, that in interphase, myc and egr1 upregulate a cluster of redundant pro - apoptotic bh3-only proteins and suppress bcl - xl, establishing the apoptotic network which can later induce dim without the need for p53 engagement and de novo gene expression. upon entry into mitosis, the apoptotic network is balanced so that a pro - survival environment is maintained (figure 8c). however, in the presence of mitotic blockers, the balance slowly tips in favor of the pro - apoptotic bh3-only proteins, eventually triggering cell death. several processes help tip the balance, including accumulation of dna damage due to partial cad activation and telomere deprotection (hayashi., 2012 ; also, slow degradation of mcl1, possibly due to incomplete apc / c inhibition (harley., 2010), weakens pro - survival function. when myc is inhibited, the initial balance is more heavily weighted toward pro - survival, mitotic death is thus delayed providing more time for cyclinb1 degradation and slippage. when bcl - xl and mcl1 are co - inhibited, the balance is so heavily weighted toward pro - death that cells can not survive a short mitotic arrest, and even an unperturbed mitosis can induce apoptosis. myc is also required for efficient apoptosis in response to drugs that drive cells through an aberrant mitosis. whether this is because these cells inherit an apoptotic balance tipped in favor of pro - survival or can not initiate a robust post - mitotic response remains to be seen. one possibility to account for this is the arf - mdm2-p53 pathway ; by inducing arf and thus suppressing mdm2, myc may sensitize the p53-dependent mechanism that detects dna damage incurred when chromosomes missegregate (janssen., 2011). this may explain why arf - deficient mouse embryonic fibroblasts tolerate aneuploidies (silk., 2013). alternatively, following chromosome missegregation induced by sac override, myc s ability to drive global gene expression might elevate the proteotoxic burden that arises in aneuploid daughter cells, thus enhancing cell cycle suppression (tang and amon, 2013). interestingly, several mitotic regulators are synthetic lethal with myc overexpression, including cdk1, survivin, aurora b, and the sumo - activating enzyme sae-2 (den hollander., 2010 ; goga., 2007 ; kessler., 2012 ; yang., 2010). whether this is due to deregulation of mitosis per se as opposed to deregulation of cellular responses to mitotic abnormalities is unclear. consistent with the former, sae-2 modulates a spindle assembly gene expression program (kessler., 2012). consistent with the latter, our observations show that myc enhances both dim and post - mitotic responses. antimitotic agents continue to be important frontline drugs, emphasized by the impressive effect of combining taxanes with targeted therapies in the treatment of breast cancer (slamon., 2001). whether taxanes inhibit tumor growth via antimitotic or other tubulin - dependent mechanisms remains unclear (komlodi - pasztor., ovarian cancers treated with taxol and carboplatin responded better if myc was more highly expressed (iba., 2004). consistently, her2-negative breast cancers that responded to docetaxel and capecitabine had higher myc levels. the correlation between myc and cell cycle / sac genes is especially striking because her2-positive tumors do not show a similar pattern. this suggests that docetaxel - capecitabine responses require cell cycle progression and a robust sac response. in contrast, anti - tumor effects mediated by trastuzumab - docetaxel - capecitabine are more likely dominated by inhibition of her2-dependent pi3k / akt survival signaling (berns., 2007), and however, a recent study found that while triple - negative breast cancers exhibited elevated myc expression, this did not predict responses to neoadjuvant chemotherapy (horiuchi., 2012). consistent with the mechanisms we describe here, this study did however observe that elevated myc sensitized triple - negative cells to cdk1 inhibition in a bim - dependent, p53-independent manner. thus, taking together our observations, the synthetic lethality relationships described above, and the provocative clinical observations, there is considerable merit in further exploring the links between the bh3-only / bcl - xl pathway and mitotic regulators in the context of myc - driven tumors. interestingly, myc inhibition had little effect on three cell lines we studied, suggesting that this avenue may provide insight into intrinsic resistance, while changes and/or heterogeneity in myc expression may provide insight into acquired taxane resistance. myc suppresses bcl - xl in various contexts (eischen., 2001) and they inversely correlate in the breast cancer gene expression profiles we analyzed. moreover, bcl - xl overexpression potently blocks myc - driven apoptosis (pelengaris., 2002) and our observations reaffirm bcl - xl as a potent mitotic survival factor. although mcl1 and bcl - xl can partially compensate for each other during mitosis (shi., 2011), degradation of mcl1 during a mitotic arrest means that bcl - xl becomes particularly critical following slippage. because slippage is a clinically relevant phenotype (zasadil., 2014), these observations make a compelling case for combining bcl - xl inhibitors with antimitotic agents. indeed, the bcl2/bcl - xl inhibitor navitoclax sensitizes ovarian cancer cell lines to taxol (wong., 2012). similar combination strategies may also help revive the prospects of targeted antimitotic agents that have thus far been disappointing in the clinic (komlodi - pasztor., 2012 ; mitchison, 2012). exploring myc - dependent apoptotic pathways for predicative biomarkers may also facilitate better clinical evaluation of these agents. finally, as a potent driver of tumorigenesis, myc is itself an attractive anti - cancer target (mckeown and bradner, 2014 ; sodir and evan, 2011). however, if superimposed on existing taxane chemotherapy regimens, targeting myc may be counterproductive, weakening both the sac and post - mitotic apoptosis, thereby fueling genomic instability. this should not detract from myc as a target as long as mitigating strategies are also explored. our observation that pharmacological inhibition of bcl - xl potently restores apoptosis in myc - deficient cells exposed to low - dose taxol further supports the case for exploring bcl - xl inhibitors in the context of antimitotic agents. rko cells were synchronized for 16 hr using 2 mm thymidine, released then seeded in 96-well plates (greiner bio - one) containing opti - mem media (lifetechnologies), dharmafect 1 transfection reagent (dharmacon), and sirnas at a final concentration of 66 nm, after which 0.1 m taxol and viability reagent (celltiter 96 aqueousone solution cell proliferation assay, promega) were added after 24 and 68 hr, respectively, and the absorbance at 490 nm measured after 72 hr. for the tertiary screen, the mitotic index at 24 hr was determined using a bd pathway (bd biosciences). sirnas and dharmafect 1 combined in opti - mem media were added to rko cells plated at 10 10 cells / ml, yielding a final sirna concentration of 66 nm. for sirna sequences, open reading frames described in the supplemental experimental procedures were cloned into pcdna5/frt / to based vectors and isogenic, tetracycline - inducible, stable cell lines generated by co - transfection with pog44 (invitrogen) into flp - in t - rex rko cells. phase contrast imaging, cell proliferation, and apoptosis measurements were performed on an incucyte zoom (essenbioscience) with cellplayer kinetic caspase-3/7 apoptosis assay kit (essenbiosciences). on fate profiles, 0 hr corresponds to mitotic entry unless stated otherwise in the legend. cells transfected with sirnas were synchronized, released for 5 hr, then rna was prepared using trizol (life technologies). one hundred nanograms of rna was hybridized with custom ncounter reporter and capture probe sets (nanostring technologies) at 65c overnight, unhybridized probes removed, complexes bound to the imaging surface, and images acquired using the ncounter digital analyzer. for global gene expression profiling, total rna was processed using the illumina truseq stranded mrna sample preparation kit, then cdna libraries sequenced on an illumina hiseq 2000 using single read, 50 cycle runs. quality of sequencing reads was assessed using fastqc (babraham bioinformatics) and aligned to a reference genome (hg19, ucsc genome browser) using tophat. sequencing yielded on average 23.7 million unique reads per sample with a 60.7%65.7% mapping rate. cufflinks was used to generate transcript abundance as fragments per kilobase of transcript per million mapped reads (fpkm), and statistical analysis of fpkm values was calculated using r (bioconductor). cre - mediated inactivation of myc in the intestinal epithelium was induced via three intraperitoneal (i.p.) injection, tissue harvested after various time points, fixed in 4% formaldehyde, then stained for cleaved caspase 3 (r&d systems). all animal experiments were conducted under an appropriate animal project license approved by the uk home office and in accordance with the animal welfare and experimental ethics committee at the university of glasgow. statistical analysis was performed in graphpad prism 6 as follows : anova plus bonferroni (figures 2c and 2f) ; linear regression (figure 2d) ; correlation (figures s1b and 5e) ; paired t test (figure 2 g) ; wilcoxon t test (figure 4a) ; mann - whitney (figures 4b, 5a, 5b, 5d, 6, s3a, s3i, and s5b) ; kruskal - wallis (figure s1e). in figures, p values were p < 0.05, p < 0.01, p < 0.001, p < 0.0001. unless stated otherwise in the figure legend, box - and - whisker plots show median, interquartile ranges, plus min to max range. figure s1d, mean sd ; figure s4b, mean sem. | summarytaxol and other antimitotic agents are frontline chemotherapy agents but the mechanisms responsible for patient benefit remain unclear. following a genome - wide sirna screen, we identified the oncogenic transcription factor myc as a taxol sensitizer. using time - lapse imaging to correlate mitotic behavior with cell fate, we show that myc sensitizes cells to mitotic blockers and agents that accelerate mitotic progression. myc achieves this by upregulating a cluster of redundant pro - apoptotic bh3-only proteins and suppressing pro - survival bcl - xl. gene expression analysis of breast cancers indicates that taxane responses correlate positively with myc and negatively with bcl - xl. accordingly, pharmacological inhibition of bcl - xl restores apoptosis in myc - deficient cells. these results open up opportunities for biomarkers and combination therapies that could enhance traditional and second - generation antimitotic agents. |
high blood pressure is a major cause of cardiovascular disease worldwide, and recent studies showed that there is a linear correlation between blood pressure and cardiovascular disease. in recent decades rapid social and economic changes have led to the increment in prevalence of cardiovascular risk factors such as blood pressure in mediterranean and middle eastern countries. additionally, according to what different studies report, the prevalence of hypertension has been reported to be 10 to 17% in these region countries., it can be said that 25 to 35 percent of adults are affected by hypertension. because of its high prevalence, this disease is important ; however, its importance has been doubled due to the fact that hypertension is an uncontrolled disease. one of the most important factors which play a prominent role in controlling the disease is patient 's adherence. the world health organization defines adherence as the agreement between an individual 's medication - related behaviors and following nutritional and lifestyle changes recommended by health care providers. adherence or orders and information compliance are influenced by patient 's beliefs and their health conditions. however, if the patient thinks that hypertension is a controllable disease, following the recommendations may be more likely. meanwhile, some studies have reported that trivializing the illness of patient is one of the reasons behind uncontrolled blood pressure [10, 11 ] and self - care is not satisfactory in these patients [1214 ]. the role of nutrition in disease control is undeniable and diet is one of the most effective nonpharmacological strategies and studies evidenced that healthy nutrition has beneficial effects on cardiometabolic parameters [1517 ], but behavior change and maintenance are not easy because the greatest responsibility in dietary adherence is on the patients. but, unfortunately, there are several conflicting evidences and most of the patients do not pay attention to dietary care instructions, only less than half of the patients have accepted healthy diet as part of their treatment, and studies have indicated wrong eating habits among them [2123 ]. it seems that unhealthy behavior is rooted in misperceptions and incorrect knowledge of the nature of disease and its related nutritional issues, since poor knowledge of patients has been introduced as one of the reasons for the lack of blood pressure control [24, 25 ]. the main source of sodium intake in iran is salt added at the table and in cooking, since processed foods in rural areas are not used, sodium added to these foods does not have an important role ; therefore, knowledge of patients about the salt and its role in their illness can play a prominent role in dietary behavior. for this reason, the evaluation of knowledge related to hypertension in these patients is an integral part of overall health care activities since knowledge has been introduced as an outcome of patients ' education in interventional studies [27, 28 ]. the highest knowledge in these patients is associated with lower rates of quitting interventional programs and higher adherence to treatment and better control of the disease. therefore, considering the importance of nutrition in the management of hypertension and the key role of illness perceptions and knowledge in patient 's adherence to nutrition and disease control, this study was conducted to determine the relationship between illness perceptions and salt knowledge with dietary sodium intake among rural hypertensive patients in the city of ardabil in 2013. this is a cross - sectional study conducted among 671 hypertensive patients who were referred to rural health care centers in ardabil city, iran, in 2013. two - stage random sampling method was used to achieve our total sample. out of 13 health centers available in the rural area, 6 were selected during first stage randomly ; then, in the second stage, participants from each center were chosen randomly from patients ' records. after thoroughly explaining about the objectives of the study, we requested their willingness to participate in the study, and then after they agreed they were enrolled in the study. men did not show more willingness to participate in the study and complete the questionnaire, whereas women were overrepresented. the criteria for inclusion consisted of disease diagnosed by a physician and patient aged between 30 and 60 years without any complications of hypertension. exclusion criteria were patients presenting with complications of hypertension, like stroke, cerebral vascular accidents (cva), and so forth, and patients presenting with comorbidities like diabetes mellitus, renal failure, and ischemic heart disease (ihd). these exclusion criteria were considered because patients with other comorbid conditions might require special diets ; therefore, the gathered data could not be generalized to hypertensive patients. systolic and diastolic blood pressures (bp) were measured with a qualified care provider in the rural health center after 15 minutes of rest, while the subject was in a seated and relaxed position. two recordings were made at a 10-minute interval with millimeter mercury (mmhg) and the mean value of the 2 recordings (not varying by more than 5 mmhg) was calculated. the patients were classified as controlled hypertension (sbp < 140 mmhg and dbp < 90 mmhg) and uncontrolled hypertension (sbp 140 mmhg and dbp 90 mmhg) according to seventh report of the joint national committee on prevention, detection, evaluation, and treatment of high blood pressure (jnc 7) guidelines. body weight was measured with the participant wearing light clothing without shoes using a seca weight scale to the nearest 0.1 kg and height was measured in centimeters (cm) using a stadiometer while the participant was standing in an upright position without wearing shoes. body mass index (bmi) was calculated as weight in kg divided by height in meters squared. patients having a bmi of less than 18.5 were classified as underweight, from 18.5 to less than 25 were considered normal, and from 25 to less than 30 were overweight, whereas those more than 30 were considered obese. data were collected by a four - part questionnaire that consisted of the demographic data such as gender, age, educational level, systolic and diastolic blood pressure, family history, and duration of illness and salt knowledge questions (each item was prepared as part of a standard answer : correct, incorrect, or do not know) ; the illness perception (14 questions with 4-point likert option) and nutritional data were gathered by a 3-day food record questionnaire. salt knowledge scores ranged between 20 and 0 and illness perception scores were ranged from 56 to 14. the salt knowledge section included 20 questions about dietary recommendations on salt, salt intake and disease relationships, and the salt content of commonly eaten foods. all correct responses were scored as one, while incorrect responses which included do not know were assigned a score of zero. questionnaire was designed based on the literature review and face validity was approved by 5 experts in the field of health education in expert panel. content validity was approved with content validity ratio (cvr) and content validity index (cvi) and reliability for nutritional knowledge section was 0.89 and for illness perception section was 0.92. illness perceptions consisted of a 14-item self - report scale that measured patient 's cognitive and emotional representations of their illness including consequences, timeline, control, identity, and causes. its validity was confirmed by an expert panel and the test demonstrates a good pearson 's test - retest correlation coefficient. each participant completed a 3-day food record, 2 weekdays and 1 weekend, to increase accuracy ; first author provided 5 minutes of instructions to each participant on how to complete the food records. also, participants were encouraged to consume usual amounts of typical food for the completion of the food record. participants were asked to measure the volume of food consumed with household measurements (cups, tablespoons). after completing the food record, participants met the first author to review all the information for record accuracy and completeness and portion size of individual items on the food record. data were gathered by trained health professionals with interview method and spss version 18.0 for windows (spss inc., chicago, il, usa) was used for the data analysis. the demographic characteristics of the participants were reported by using descriptive statistics (frequencies, proportions, and means). the mean scores were compared with t - tests and one - way anova and relationships were assessed by multiple linear regression and pearsons correlation test. table 1 shows the sociodemographic characteristics of the participants. out of a total of 671 patients, 74.8% were female, 433 patients were in the controlled group and 243 participants were uncontrolled. no significant difference was found in the two groups ' family history, income, and educational levels. accordingly, compared with the controlled group, the mean of bmi was higher in the uncontrolled group and majority of uncontrolled group were men (table 1). in this study, the significant differences were also seen in the amount of sodium intake in all age groups and between the controlled and uncontrolled groups. participants aged between 30 and 40 had received significantly more sodium in both groups and significant difference in sodium intake was found between the two groups considering level of education, income, and gender. but in the uncontrolled group, no significant difference was found in gender (male versus female) (p = 0.05) and income (p = 0.6) (table 2). compared with the controlled group, the mean of sodium intake in the uncontrolled group was significantly higher. controlled group significantly had higher mean scores in the knowledge and illness perception. in the present study, the mean of sodium intake in the uncontrolled group was 3599 258 which was significantly greater than the controlled group (2654 540) (p < 0.001) (table 3). also, there was a significant negative correlation between sodium intake and knowledge and illness perception in both controlled and uncontrolled hypertensive patients while this correlation was greater among the uncontrolled patients (table 4). using multiple linear regressions, the results of regression analysis were significant, after adjusting for energy intake, suggesting that the knowledge and illness perception variables accounted for (r) 13.6% of the variance in sodium intake in the controlled group and these variables predicted 47.2% of sodium intake in the uncontrolled patients. other variables such as age, sex, disease duration, weight, and education were also entered into the model that did not have any significant relationship with the dependent variable (table 5). hypertension progressively and permanently damages target organs, leading to life - threatening complications and death. considering the importance of nutrition 's role in the hypertension control and the role of illness perception and nutritional knowledge in the nutritional adherence, to our knowledge, this is the first study which has examined the relationship between illness perception and knowledge with dietary sodium intake in rural hypertensive patients. in the present study, no significant differences were seen between the two groups in demographic variables (age, income, educational level, and duration of disease) so it could be said that these two groups were similar in terms of demographic characteristics. in the present study, perceptions and beliefs have an important role in the health and health behaviors [31, 32 ]. some individuals did not have information about amount of needed salt per day. in grimes. (2009), 73% of participants were not informed of the maximum allowed amount of salt. lack of knowledge is one of the other barriers to reduce sodium intake in patients. in a qualitative study my doctor said that i do not add salt to food, and i have no other information ". so compared with those with negative attitudes, people who have more knowledge are more likely to have healthy behavior and reduce their sodium intake. in the present study, salt knowledge of the controlled patients was moderate while knowledge of the uncontrolled group was not acceptable. considering the fact that in iran patients take a continuous and free care by doctors and health workers in rural health centers, having a higher knowledge expectation of patients is not unreasonable. our finding is consistent with similar studies conducted in iran and the study done by oliveria., patients were shown incorrect information about some aspects. in this study, for the question hypertension dietary was only restricted for salt about half of the patients gave the wrong answer. but in chinese study, patient 's knowledge was reported much lower and they had little information on nutrition. in this study, based on education, income, and gender, these findings were consistent with other studies in this field and the differences between the feeding habits were attributed to demographic factors such as age, sex, education, and income. salt intake was attributed to demographic factors and those middle - aged male participants with lower income and lower education consumed more salt [1, 40 ]. however, in the present study, women received more sodium than men which is inconsistent with the results of previous studies such as chung. (2004) and sheahan and fields (2008) in which the women consumed less salt. these differences in results might be justified by the social and cultural paradox and nutritional pattern in iranian rural areas and industrialized countries ; however, further investigations are needed to find more comprehensive patterns of diet, especially in rural areas. but the importance of this study was explained by the fact that demographic factors could not be changed. sodium intake in the uncontrolled group was significantly higher, more than double the recommended amount [42, 43 ] ; considering that salty taste in foods is desirable among iranian people, this finding was expected. but these patients are at high risk for complications of hypertension and it is very disturbing. however, despite that iranian people are being cared for in the rural health care centers, the recommendations should be presented to them and high salt intake causes need a wider range of investigation. in a study conducted in iran, adult women consumed 10 grams of salt per day which was 1.5 times more than the recommended daily amount. no similar study on hypertensive patients was found in iran, but the amount of sodium in american hypertensive patients was also 2.2 times more than the recommended dose. the salty taste of food was stated as an important predictor of high salt consumption and is considered as an important challenge for health workers. excessive salt consumption in people who are accustomed to the salty taste is very difficult and requires a set of interventions. meanwhile, the excess sodium intake is associated with increased blood pressure and significantly increases the risk of heart attack [46, 47 ]. for example, it is clear that reducing the sodium intake in patients and healthy subjects for 4 weeks or more, results in a significant reduction in blood pressure. pearson 's correlation and linear regression showed negative significant relationships between knowledge and perceptions with sodium intake. in addition, the correlations were higher for both variables among the uncontrolled hypertensive group. also, multiple linear regressions showed that knowledge and perception could predict 13.5% of the variation in sodium intake in controlled group while this value was 47.2% in uncontrolled group, respectively. it could be concluded that these two variables could play an important role in the feeding behaviors of the patient ; this role was seen mainly among the uncontrolled group patients. however, knowledge and perceptions play important roles in disease control and patient compliance ; however, they do not guarantee patients ' health behavior. in addition to these variables, attention should be given to environmental factors such as health careers because blood pressure is influenced by many factors and this rate of prediction can be considered a very good prediction of the knowledge and perception. 2009) in their study showed that blood pressure was uncontrollable, despite the good knowledge in patients. this was so because controlling bp was influenced by several factors including the patient - related factors (age, bmi, and lifestyle), factors associated with treatment, clinical evaluation factors (treatment techniques), and factors associated with medical equipment and facilities. also, in a similar study in iran, despite good knowledge and attitudes of patients, blood pressure was not controlled. considering the same results, a detailed and comprehensive study about the causes of bp controlling is needed ; it seems that in the current situation, all attention is paid to the patients and they will be recognized as original extradite but the fact is that patients have not participated in care designing and their participation is not considered. evidences in some contexts indicated that the most important obstacle introduced to control blood pressure includes personnel 's failure in implementing recommended health care. first, as a cross - sectional study, the findings could only be used to examine associations and not to draw inferences regarding causality. therefore, future studies should be extended to study other factors which may mediate the relationship between socio - demographic factors and sodium intake such as self - efficacy, attitudes, and salt taste and finally, an overrepresentation of females occurred despite the use of random sampling methods which was another limitation in this study. in contrast, the multiple regression analysis, the optimal sample size, and the standard tools are the strengths of this study. the other strength, according to our knowledge, is that few studies have been done on the rural hypertensive patients even in urban patients in iran and developing countries. in this study, dietary intake was assessed with 3 days of food recording instead of food recall, because 24 h food recall depended on memory and studies showed underreporting error with food recall tool [51, 52 ] ; therefore, the results were more likely to be closer to reality. knowledge and illness perception play an important role in prediction of sodium intake variation in hypertensive patients. therefore, the importance of paying more attention to these two variables in the design of interventions by health network planners and health professionals is essential. furthermore, trying to improve and update patients ' information and providing a clear picture of the condition to influence their perceptions of their disease are also required. | introduction and objectives. nutritional knowledge of the patients is important in dietary adherence. this study aimed to determine the relationship between illness perceptions and nutritional knowledge with the amounts of sodium intake among rural hypertensive patients. methods. in a cross - sectional study, 671 hypertensive patients were selected in a multistage random sampling from the rural areas of ardabil city, iran, in 2013. data were collected using a questionnaire consisting of four sections and were analyzed using pearson correlation and multiple linear regressions by spss-18. results. the mean of sodium intake in the uncontrolled hypertensive patients was 3599 258 mg / day and significantly greater than controlled group (2654 540 mg / day) (p < 0.001). knowledge and illness perceptions could predict 47.2% of the variation in sodium intake of uncontrolled group. a significant negative relationship was found between knowledge and illness perceptions of uncontrolled hypertensive patients with dietary sodium intake (r = 0.66, p < 0.001 and r = 0.65, p < 0.001, resp.). conclusion. considering the fact that patients ' nutritional knowledge and illness perceptions could highly predict their sodium intake, the importance of paying more attention to improve patients ' information and perceptions about hypertension is undeniable, especially among the uncontrolled hypertensive patients. |
, several natural and synthetic compounds are tested for various anti - cancer activities. medicinal chemistry deals with synthesis of new agents for treating cancer by higher selectivity and lower side effects (1). dacarbazine (dtic) and temozolomide (tmz ; figure 1) are two members of triazenes used in the clinical treatment of metastatic melanomas, soft tissue sarcoma, hodgkin s and non - hodgkin s lymphoma. studies show that the antitumor activities of the desired drugs are dependent on three adjacent nitrogen atoms (2 - 6). structures of dacarbazine and temozolomide used in clinical treatment methylation of o - methylguanine is the main mechanism responsible for the cytotoxicity and methyldiazonium cation is a highly reactive derivative of these compounds that can react with dna o - methylguanine (7 - 11). recently, the inhibition of tyrosine kinase receptor was suggested as a novel mechanism for triazene agents (12 - 14). the uses of these compounds are limited because they have highly toxic adverse effects such as skin toxicity, myelosuppression, cardiac and hepatic toxicity, severe nausea, and vomiting (2, 11, 15, 16). many attempts have been made for increasing the selectivity and decreasing these adverse effects including the use of aryl and heteroaryl rings in the structure of the mentioned triazenes (17 - 18). in the present study we have replaced the imidazole ring with different aryl groups and investigated the cytotoxicity of the synthesized triazenes against eight cancer cell lines (pc3, ht29, hela, hl60, jurkat, k562, mcf7, and hepg2) and a non - cancerous cell line (huvec). 1h nmr and c nmr spectra were recorded on bruker drx 300 avance spectrophotometer in dmso - d6 as the solvent and all chemical shifts are reported in units downfield from tms as internal standard. 1,3-bis(2-methoxyphenyl)triazene f, 1, 3-bis(2-cyanophenyl) triazene d, and 1, 3-bis(2-ethoxyphenyl) triazene c were synthesized according to reported literatures (19 - 20), 1,3-diphenyltriazene g was commercially available. elemental analysis was performed on a thermo finnigan flash ea 1112 (thermo fisher scientific inc, usa) instrument. typical procedure for the synthesis of 1, 3-bis (2-cyanophenyl) triazene (d) 1, 3-bis (2-cyanophenyl) triazene was prepared by the drop wise addition of nano2 (6.9 g) in 20 ml distilled water to a beaker containing of 2-aminobenzonitril (5.9 g, 0.05 mol) and of hcl solution (6.48 ml, 0.81 mol, d = 1.18 g / ml) placed in a coldwater bath. after 30 min stirring, ch3coona.3h2o (13.6 g) dissolved in 20 ml distilled water was added to the solution. the resulting colored precipitate appeared after 15 min, was evaporated to dryness in the air and then crystallized from diethyl ether in a freezer in three days (21). 1, 3-bis (2-cyanophenyl) triazene as sharp yellow powder was obtained with 88% yield, mp 129 - 131 c (mp 128 - 130 c lit). typical procedure for the synthesis of 1-(4-nitrophenyl)-3-(2-hydroxyethyl)triazene (e) 2-aminoethanol (0.05 mol, 3.054 g) was added at room temperature to a stirred suspension of 4-nitrobenzenediazonium chloride (0.05 mol) in water (20 ml) and stirring was continued for 20 min in a cold water bath and 10 min at rt. ch3coona.3h2o (13.6 g) was dissolved in 20 ml distilled water and added to the solution. crystals were collected by filtration, washed with water and recrystallized from diethyl ether to afford 1-(4-nitrophenyl)-3-(2-hydroxyethyl) triazene e with 89% yield. 1h nmr (dmso - d6, 200 mhz) (ppm) 3.56 (s, 1h), 4.42 (t, 2h), 5.05 (t, 2h), 7.20 - 7.74 (dd, 4h, j = 8.1 hz), 7.76 (s, 1h) ; c nmr (dmso - d6, 50 mhz) (ppm) 175.5, 155.3, 129.7, 125.5, 56.7, 49.4 ; ir (kbr, cm) 3500 (oh, str), 1630 (nh, bend), 1600 (c = c, str), 1500 (c = c, str), 1450 (ch, bend), 1400 (ch, bend), 1300 (n = o, str), 1200 (c - o, str), 1150 (c - n, str), 900 (c - h, oop), 700 (n - h, oop), 750 (o - h, oop) ; anal. calcd. for c8h10n4o3 : c, 45.71 ; h, 4.76 ; n, 26.67. found : c, 45.52, h, 4.58, n, 26.45. 1-(4-nitrophenyl)-3-(3-hydroxyphenyl)triazene (a) red crystals, 85% yeild, 1h nmr (dmso - d6, 200 mhz) (ppm) 3.89 (s, 1h), 5.54 (s, 1h), 6.53 - 6.61 (m, 4h), 7.90 - 7.98 (dd, 4h, j = 8 hz) ; 13c nmr (dmso - d6, 50 mhz) (ppm) 159.5, 154.8, 145.5, 144.1, 137.8, 126.7, 122.2, 113.3, 106.1, 102.2 ; ir (kbr, cm) 3300, 3400, 2800, 2700, 1650, 1600, 1450, 1300, 1200, 1150, 850 ; anal. calcd. for c12h10n4o3 : c, 55.81 ; h, 3.86 ; n, 21.71. found : c, 55.65, h, 3.67, n, 21.55. 1-(4-nitrophenyl)-3-(2-hydroxyphenyl)triazene (b) red crystals, 87% yield, 1h nmr (dmso - d6, 200 mhz) (ppm) 3.27 (s, 1h), 5.19 (s, 1h), 6.65 - 6.75 (m, 4h), 8.05 - 8.15 (dd, 4h, j = 8.2 hz) ; c nmr (dmso - d6, 50 mhz) (ppm) 157.7, 145.5, 144.1, 126.2, 122.5, 121.0, 120.9, 118.9, 117.1 ; ir (kbr, cm) 3500, 3200, 2800, 2700, 1650, 1600, 1450, 1300, 1100, 1150, 850 ; anal. calcd. for c12h10n4o3 : c, 55.81 ; h, 3.86 ; n, 21.71. found : c, 55.60, h, 3.71, n, 21.59. biological activity cell lines and culture pc3 ncbi - c427 (human prostate adenocarcinoma), ht29 ncbi - c466 (human colon carcinoma), hela ncbi - c115 (human cervix carcinoma), k562 ncbi - c122 (human chronic myelogenom leukemia), jurkat e6/1 ncbi - c121 (human acute t - cell leukemia), hl60 ncbi - c217 (human promylocyteic leukemia), mcf7 ncbi - c135 (human breast adenocarcinoma), hepg2 ncbi - c144 (human hepatocyte cancer cell line), and huvec ncbi - c554 (human umbilical vein endothelial cell) were purchased from pasture institute of tehran - iran. cell lines were grown and maintained in a humidified incubator at 37c with 5% co2 atmosphere. cells were cultured in dmem (dulbecco s modified eagle s medium) supplemented with 10% fetal bovine serum (fbs), and antibiotics (100 iu / ml penicillin and 100 l / ml streptomycin). after incubation of different concentrations (1, 5, 10, 25, 50, 100 m) of the synthesized compounds with cell lines for 24 and 48 h, the medium was removed without damaging cells for ldh assay. briefly, 100 l of the media from each well was transferred to a new plate, and 100 l of ldh reagent and catalyst (1:45) (roche diagnostics corporation, indianapolis, in, usa) was added to the supernatant and incubated for 30 min in dark at room temperature. the absorbance was recorded at 490 nm with background subtraction at 630 nm using the synergy ht multi detection micro plate reader. 20 l of 10% triton x-100 and the ldh reagent were added to untreated cells and these results were collected as a positive control. trypan blue exclusion to determine the effect of the synthesized compounds on viability of cells, approximately 0.75 10 cells / ml was transferred in a 6-well tissue culture plate and the triazenes a - g were added at different concentrations. after 48 h the cells were collected and resuspended in 0.4% trypan blue. the percentages of viable cells were counted using an inverted microscope and the percent of viability was determined in comparison with tmz as the control (23). cytotoxic activity by ldh assay the cytotoxic activities of the synthesized triazenes were examined on eight human cancer cell lines and a non - cancerous cell line by ldh assay. ldh is an enzyme exists in all cells and is released in culture medium after cell death. in this assay, nadh / h reacts with tetrazolium salt in the presence of a catalyst to form a red color compound, i.e. formazan, which can be measured at 490 nm (20). cytotoxic activities of triazene analogs with ldh assay (ic50 in m). among the compounds synthesized, 1,3-bis(2-ethoxyphenyl)triazene c had unique efficacy and selectivity as it had ic50 between 0.560 - 3.33 m on cancer cell lines and 12.61 m on normal cell line (huvec). it is important to note that one of the main factors in appearance of side effects of chemotherapy for a long time are the toxic effects on normal cells. thus for compound c, the difference between toxic dosage on cancer and normal cell line can be valuable. the other unique characteristic is the high sensitivity of cell lines pc3 and mcf7 to compound c showing ic50 values 0.590 m and 0.56 m respectively. tmz as the positive control also showed high cytotoxic effects on cell lines mcf7 and pc3 having ic50 0.77 and 1.39 m respectively ; however, its ic50 against huvec was 4.85 m. 1-(4-nitrophenyl)-3-(2-hydroxyethyl) triazene e showed weaker effect on cancer cell lines than the other compounds having ic50 between 3 - 15.54 m. among cancer cell lines the most severe toxic effect was related to 1, 3-bis (2-cyanophenyl) triazene d showing ic50 1.14 m on normal cell line (huvec). regarding the results obtained from table 1, it could be inferred that the presence of electron - donating groups on phenyl ring increased selectivity and potency of the triazenes while the absence of aromatic ring decreased the efficacy. the percentage of viability versus concentration by trypan blue exclusion on cancer cell line mcf7 (human breast adenocarcinoma). cytotoxic activity by trypan blue exclusion in addition, the viability of cancer cell lines was studied by using trypan blue exclusion. in this test the results of this assay approved the results of ldh assay. according to figures 4 and 10, compound c showed low and high cytotoxic activity on cell lines huvec and pc3, respectively. 1-(4-nitrophenyl)-3-(3- hydroxyphenyl) triazene a and 1-(4-nitrophenyl)- 3-(2-hydroxyphenyl) triazene b were structural isomers, but compound b was more effective on leukemia cell lines (hl60, k562 and jurkat) (figures 7 - 9). with regards to difference in the activity of a and b, as reported in the literature, the presumable mechanism of the cytotoxic activities of triazene compounds may be ascribed to alkylation of dna, inhibition of dna and rna synthesis, and inhibition tyrosine kinase (12 - 14, 24). the synthesized compounds have distinctly lower cytotoxicity against normal cell line and higher cytotoxicity against cancer cell lines and it can be expected that this is the selective action of the examined compounds. according to the results obtained from ldh and trypan blue exclusion, induction of apoptosis can be proposed as a probable mechanism for the synthesized triazenes. the percentage of viability versus concentration by trypan blue exclusion on cancer cell line hepg2 (human hepatocyte cancer cell line). the percentage of viability versus concentration by trypan blue exclusion on cancer cell line pc3 (human prostate adenocarcinoma). the percentage of viability versus concentration by trypan blue exclusion on cancer cell line ht29 (human colon carcinoma). the percentage of viability versus concentration by trypan blue exclusion on cancer cell line hela (human cervix carcinoma). the percentage of viability versus concentration by trypan blue exclusion on cancer cell line hl60 (human promylocyteic leukemia). the percentage of viability versus concentration by trypan blue exclusion on cancer cell line k562 (human chronic myelogenom leukemia). the percentage of viability versus concentration by trypan blue exclusion on cancer cell line jurkat (human acute t - cell leukemia). the percentage of viability versus concentration by trypan blue exclusion on non - cancerous cell line huvec (human umbilical vein endothelial cell). effects of the synthesized triazenes on studied human cancer cell lines as investigated by trypan blue exclusion after 48 h. in all experiments the reported results represent the mean standard deviation from triplicate tests in conclusion, the triazene derivatives tested in this study demonstrated cytotoxic and antiproliferative properties which warrant further investigation as potential anticancer agents. the synthesized compounds which are triazene bioisosteres were evaluated for their cytotoxicity against several human cancer cell lines and showed moderate to high potency. among these, the compound c had the highest efficacy and selectivity. from the structure - activity relationships we may conclude that the presence of aryl groups would be critical for their biological activities. further studies are in progress to define the important mechanism of action of above mentioned compounds. | compounds containing triazene ring structure are cytotoxic agents and clinically used as antitumor alkylating agents. in this study, a series of triazene derivatives holding alkyl and aryl moieties were synthesized and proved to be potent cytotoxic agents in - vitro particularly against eight cancer cell lines (pc3, ht29, hela, hl60, jurkat, k562, mcf7, hepg2) and a non - cancerous cell line (huvec). the cytotoxic activity was assessed using two methods, ldh assay, and trypan blue exclusion. some of the triazene derivatives showed cytotoxic activity more than temozolomide (tmz) as the reference drug. the synthesized triazenes showed marked cytotoxicity effects on all eight cancer cell lines. among the compounds synthesized, 1,3-bis(2-ethoxyphenyl)triazene c had unique efficacy and selectivity so that it had ic50 between 0.560 - 3.33 m on cancer cell lines and 12.61 m on normal cell line (huvec). 1-(4-nitrophenyl)-3-(2-hydroxyethyl)triazene e shows weaker effect on cancer cell lines than the other compounds having ic50 between 3 - 15.54 m. |
epithelial na channels (enac) are of importance in na - absorptive epithelium, such as in the airway, the alveolus, the kidney, and the distal colon, and control the overall rate of transapical na transport. enac proteins are mainly located in the apical membrane of polarized epithelial cells and have four homologous subunits (i.e., the,, and subunits) 1, 2. the or enac subunit, which is essential for acting as a sodium channel, forms the channel pore, whereas the and enac subunits are critical for amplifying the efficiency of na influx. in mouse, the gene scnn1d, which encodes enac, is assumed to be a pseudogene 2. in the lungs, alveolar lining fluid is critical for efficient gas exchange, and enac complexes play a crucial role in alveolar fluid clearance to maintain homeostasis of the luminal liquid. pulmonary diseases, including acute lung injury, cystic fibrosis, chronic obstructive pulmonary disease, and asthma result from or are associated with the dysfunction or dysregulation of enac, and the regeneration of epithelial cells and the restoration of ion transport are two key steps in recovery from those diseases. in this article, we review the progress of research on enac - mediated lung injury repair, in particular the role of enac proteins in re - epithelialization by endogenous and allogeneic stem / progenitor cells. the mammalian pulmonary epithelium, a multilevel, branched network, can be functionally divided into the proximal conducting airways and the distal gas - exchange domain. the development of the airways and the lung is the result of specification and separation of a group of progenitor cells from the ventral region of the anterior foregut. in humans, the development of the airways and alveoli from fetal to adult stage, the airway epithelium consists of undifferentiated columnar cells, and then ciliated cells, secretory cells, club cells, alveolar type i (ati) and type ii (atii) cells differentiate from these progenitor cells at different stages of gestation (figure 1). a recent study indicated that both ati and atii cells are derived from a lineage of bipotential progenitors during embryonic development and that atii cells undergo a switch that functions both to self - renew and to generate ati cells 4. lineage hierarchies constructed using single - cell rna - seq unveiled the differentiation steps of these bipotential progenitors 5. in adults, the lung not only undergoes a slow turnover, but also repairs itself rapidly, indicating the existence of a subpopulation of stem cells or progenitors with preserved differentiation potential. the stem / progenitor cells able to repair injured lungs include club cells, bronchioalveolar stem cells (bascs), and atii cells. in addition, submucosal gland duct stem cells and neuroendocrine cells have the potential to differentiate into club, basal, serous, or ciliated cells, as well as into distal airway epithelium. club cells, bascs, and atii cells are dominant in the pulmonary epithelium and have been generally well studied. club cells are able to self - renew, differentiate into ciliated epithelial cells, and contribute to the replenishment of both ati and atii cells in lungs injured by bleomycin or infection with h1n1 influenza 6 - 8. bascs are located in bronchioalveolar duct junctions, and following catastrophic alveolar epithelial injury, can replenish cell lineages in the alveolus 8. in addition to club cells, distal airway stem cells (dascs) and basal cells contribute to replenishing other pulmonary epithelial cells. atii cells are involved in the regeneration of alveoli, maintaining a slow self - renewal in normal lungs and then differentiating into ati cells during lung injury repair. additionally, a subpopulation of alveolar epithelial cells expressing integrin 6/4 and dascs has the potential to differentiate into atii and club cells 9, 10. recently, a new type of basally located dascs that express trp63 and keratin 5 was also reported to be crucial for epithelium regeneration in airways and alveoli 11 - 13. the expression of enac in the human respiratory system was confirmed in a development - dependent manner 3. at the early stage of embryonic development (16 wk of gestation), the - and -enac subunits were not detected in human airways 3. near birth, increased enac activity was present on the apical surface of lung epithelial cells, and active na transport was promoted 14. in adult airways, the expression pattern of enac was similar to that in the canalicular period (17 - 24 wk) (figure 1). transcripts of -enac were expressed in club cells throughout fetal lung development 15, and all four subunits (,, and) were detected in adult club cells 1, 16. enac mrna was distributed in atii cells after 28 wk of gestation 17, and enac subunits were also expressed in atii cells (figure 1) 2, 18, 19. in postnatal pulmonary epithelium, na ions flow into epithelial cells via apically located enac proteins and are actively pumped out of the cells by na - k - atpase at the basolateral membrane. apical fluid volume regulated the activity and abundance of enac in h441 cells originally derived from human club cells. dexamethasone, a corticosteroid, regulated enac activity in club- and atii - like cell cultures, by promoting the expression of enac 20 subsequent to activating the sgk1, pi3k and camp / pka signaling pathways 21. treatment with dexamethasone and camp - elevating agents can lead to the differentiation of the aforementioned native stem cells to club cells or alveolar cells 22, 23. sgk1 and pka can phosphorylate the ubiquitin ligase nedd4 - 2, which mediates the internalisation and degradation of enac by binding to the proline - rich domains of enac 24. moreover, a number of signaling molecules, such as hydrogen sulfide, nitric oxide, utp, and cpt - cgmp regulate enac activity in h441 cells 25 - 27, and respiratory syncytial virus can inhibit enac - mediated alveolar fluid clearance by upregulating the synthesis of utp and nitric oxide 28. phosphorylation of erk1/2 results in a decrease in the expression and function of enac in atii cells 29. nedd4 - 2 facilitates the effects of pkc on enac activity in atii 29 and club cells 24, and pkc may also play a role in enac - pip2-marcks complexes, which regulate the open probability of enac and can be stabilized by binding with tnf 18, another factor that may also enhance enac activity in atii cells 30, 31. pkc, camp / pi3k, pka and cgmp mediate the regulation of enac by lps in atii and club cells 32, 33, and pkc was shown to mediate wnt signaling, which regulates the differentiation of mesenchymal stem cells (mscs) to atii cells and of atii to ati cells 34. additionally, cgmp levels were inversely related with the expression of atii markers when undifferentiated lung epithelial cells were treated with inhaled nitric oxide 35. therefore, regulation of enac by erk, pkc, camp, pka, and tnf may play a role in the differentiation of endogenous progenitor / stem cells. whenever injury occurs, the epithelial stem / progenitor cells go through essentially the same process, including migrating to the injured region to cover the denuded airway and alveolar sac, and proliferating vigorously to provide enough cells for epithelium repair, differentiation, and remodeling, and finally the normal airways and lungs are regenerated structurally and functionally. for example, in naphthalene - induced airway epithelial injury, bascs exhibit highly proliferative activity in response to the injury of club cells 36. methylation of enac is an important event while aldosterone promotes the wound healing in bewo cells and other epithelial cells. mechanistically, migration of cultured epithelial and nonepithelial cells occurs in an enac - dependent manner 37, 38, and serum- and glucocorticoid - induced kinase 1 (sgk1) regulates cell proliferation through an enac - associated process. cell migration generally undergoes several processes, including depolarization, membrane elongation, adhesion, contraction, and de - adhesion, that are regulated by interactions between cells, and between cells and the extracellular matrix. chifflet. reported that actin reorganization and membrane depolarization depend on enac - regulated extracellular na ions during wound healing of bovine corneal endothelial cells 39. enac proteins are the central part of a complex that links the cytoskeleton with the extracellular matrix 40, and the binding of the c - termini of - and -enac with filamins exerts an inhibitory effect on enac function 41. found that a deficiency in enac caused more d54-mg cells to arrest in g0/g1 phase, with fewer cells accumulating in the s and g2/m phases 43 ; it was suggested that cell division is depressed when asic1 and enac are inhibited and that phosphorylation of erk1/2 may be an underlying mechanism 43. this group also found that interactions between amiloride - sensitive cation channels (asic1 and enac) and integrin-1, mediated by -actinin, could in part regulate the proliferation and migration of glioma cells 44. in addition, enac is involved in the proliferation and migration of various cancer cells 38. the effects of enac on osteoblast differentiation have been studied by several groups who found that the expression of enac mrna accompanied the osteoclastogenesis of rat osteoblasts. stimulation of osteoblast differentiation by 8-pcpt - cgmp is also dependent on the expression of enac 45 and therefore, enac activity is apparently required for the differentiation of both osteoblasts and osteoclasts. in club and atii cells, the aberrance of enac expression usually leads to na absorption disorder, hydropic degeneration and necrosis of club cells, goblet cell metaplasia, failure of airway mucus clearance, susceptibility to spontaneous bacterial infection, airway inflammation, and even death caused by airway obstruction and asphyxiation 24. enac proteins are electrically detectable as functional biomarkers of differentiated epithelial cells. because of the role of enac in the migration and proliferation of stem / progenitor cells, it can be speculated that normal enac function would be critical in the repair of injured lungs by mscs 46, 47. goolaerts and colleagues reported that impaired enac activity under hypoxic and cytomixic conditions was restored by co - cultured mscs and paracrine kgf 48. moreover, impaired enac function of alveolar fluid clearance was recovered by human mscs delivered intratracheally in a clinically related, human lung injury model 49. the improvement of enac function and the contribution of enac to re - epithelialization potentially explain the promising results of clinical trials that show a significant reduction in lung injury score in acute respiratory distress syndrome (ards) and other lung injury treated with stem cells 50 - 53. lung injury is associated with defective epithelium and dysfunctional ion transport, and stem cell therapy to repair injured tissue has broadened the prospects for treatment beyond supportive approaches. the functional consequences of normalizing injured epithelium are usually evaluated by detecting the expression and activity of enac. however, our understanding of the mechanisms by which enac regulates differentiation of lung stem / progenitor cells is incomplete, for example, whether enac contributes to the release of paracrines from allogeneic mscs, and what are the roles of enac in the re - epithelialization mediated by these paracrines. | regeneration of the epithelium of mammalian lungs is essential for restoring normal function following injury, and various cells and mechanisms contribute to this regeneration and repair. club cells, bronchioalveolar stem cells (bascs), and alveolar type ii epithelial cells (atii) are dominant stem / progenitor cells for maintaining epithelial turnover and repair. epithelial na+ channels (enac), a critical pathway for transapical salt and fluid transport, are expressed in lung epithelial progenitors, including club and atii cells. since enac activity and expression are development- and differentiation - dependent, apically located enac activity has therefore been used as a functional biomarker of lung injury repair. enac activity may be involved in the migration and differentiation of local and circulating stem / progenitor cells with diverse functions, eventually benefiting stem cells spreading to re - epithelialize injured lungs. this review summarizes the potential roles of enac expressed in native progenitor and stem cells in the development and regeneration of the respiratory epithelium. |
transrectal ultrasound (trus)-guided prostate biopsy is the most commonly used procedure for detecting prostate cancer. however, pain is the main morbidity and the main hindrance to the acceptance of trus - guided prostate biopsy by patients. several studies have shown that 19 to 30% of patients experience moderate to severe pain during prostate biopsy. there has been a shift recently from the standard sextant biopsy to a 10- to 12-core biopsy protocol to increase the cancer detection rate. two factors usually responsible for pain during prostate biopsy are anal pain due to the ultrasound probe and insertion pain of the needle through the prostate. currently, there is no universally accepted method of anesthesia for prostate biopsy as evidenced by the numerous methods that have been tried and published in the literature [6 - 9 ]. among the various methods of periprostatic anesthesia ozden. reported that the effectiveness of periprostatic anesthesia did not differ between basal injection and apical injection. furthermore, in their study, patients were randomly assigned into three groups depending on the doses of 1% lidocaine applied during periprostatic anesthesia at the basal lesion : 2.5 ml (group 1), 5 ml (group 2), and 10 ml (group 3). in that study, injection of 2.5 or 5 ml did not result in a significant difference in pain control, whereas use of 10 ml of 1% lidocaine produced better pain control. because higher doses seem to result in better pain control, at least according to this single study, the effect of doses exceeding 10 ml by basal injection needs to be discerned. to address this shortcoming, we conducted a prospective randomized controlled study to evaluate the efficacy for pain control and tolerability of periprostatic lidocaine injection according to lidocaine doses of more than 10 ml by basal injection during trus - guided prostate biopsy. this prospective randomized controlled trial comprised a series of 92 consecutive men (median age, 65.4 years ; range, 39 to 75 years) with an abnormal prostate - specific antigen (psa) level (> 4 ng / ml) or an abnormal result on a digital rectal examination who underwent trus - guided biopsy and prostatic biopsy for the first time between january 2006 and december 2008. patients were randomly assigned to three groups by using the restricted randomization method to achieve balance in group size. the random - number table was drawn up by the urologist and an appropriate anesthetic procedure was assigned to each number. group 2 received 10 ml of 1% lidocaine at the bilateral basal periprostatic lesions following rectal installation of 10 ml of 2% lidocaine gel. group 3 received 20 ml of 1% lidocaine at the bilateral basal periprostatic lesions after 10 ml of 2% lidocaine gel was instilled rectally. all patients had suppository enemas the day before and on the day of the biopsy and received intravenous antibiotics on the day before the biopsy and oral antibiotics for 7 days after the biopsy. all biopsies were performed by one individual using a 9.5 mhz hd 11 xe (philips, new york, ny, usa). periprostatic lidocaine injections were performed near the junction of the seminal vesicle with the base of the prostate with an 18-gauge acecut biopsy needle (tsk laboratory, tochigi, japan). the accuracy of the block was determined by detecting the collection of local anesthetic fluid on trus. the 12-core biopsies were obtained by using an automatic, spring - loaded device with an 18-gauge needle. after the biopsy procedure, the patients completed a questionnaire regarding the level of pain they experienced during probe insertion and biopsy. the pain score was assessed by using a 10-point linear visual analogue scale (vas ; 0 for no pain, 10 for excruciating pain). after discharge, complications such as hematuria, hematospermia, rectal bleeding, and infection were determined by interviewing each patient on his next visit to the hospital. various parameters that could be related to the degree of pain during the prostate biopsy (vas score, patient 's age, prostate volume, psa, and the detection of cancer) were statistically analyzed by pearson correlation test. this prospective randomized controlled trial comprised a series of 92 consecutive men (median age, 65.4 years ; range, 39 to 75 years) with an abnormal prostate - specific antigen (psa) level (> 4 ng / ml) or an abnormal result on a digital rectal examination who underwent trus - guided biopsy and prostatic biopsy for the first time between january 2006 and december 2008. patients were randomly assigned to three groups by using the restricted randomization method to achieve balance in group size. the random - number table was drawn up by the urologist and an appropriate anesthetic procedure was assigned to each number. group 2 received 10 ml of 1% lidocaine at the bilateral basal periprostatic lesions following rectal installation of 10 ml of 2% lidocaine gel. group 3 received 20 ml of 1% lidocaine at the bilateral basal periprostatic lesions after 10 ml of 2% lidocaine gel was instilled rectally. all patients had suppository enemas the day before and on the day of the biopsy and received intravenous antibiotics on the day before the biopsy and oral antibiotics for 7 days after the biopsy. all biopsies were performed by one individual using a 9.5 mhz hd 11 xe (philips, new york, ny, usa). periprostatic lidocaine injections were performed near the junction of the seminal vesicle with the base of the prostate with an 18-gauge acecut biopsy needle (tsk laboratory, tochigi, japan). the accuracy of the block was determined by detecting the collection of local anesthetic fluid on trus. the 12-core biopsies were obtained by using an automatic, spring - loaded device with an 18-gauge needle. after the biopsy procedure, the patients completed a questionnaire regarding the level of pain they experienced during probe insertion and biopsy. the pain score was assessed by using a 10-point linear visual analogue scale (vas ; 0 for no pain, 10 for excruciating pain). after discharge, complications such as hematuria, hematospermia, rectal bleeding, and infection were determined by interviewing each patient on his next visit to the hospital. various parameters that could be related to the degree of pain during the prostate biopsy (vas score, patient 's age, prostate volume, psa, and the detection of cancer) were statistically analyzed by pearson correlation test. the mean age of the patients was 64.011.7 years, their mean prostate volume was 49.022.5 ml, and their mean psa level was 11.014.6 ng / ml. there were no statistically significant differences in baseline characteristics between the three groups (table 1). with respect to the correlation between vas score and each parameter, such as age, prostate volume, psa, and the detection of cancer, there were no statistical significances in pearson 's correlation test (table 2). the mean pain vas scores during probe insertion were 0.930.89, 1.321.37, and 1.131.10 in groups 1, 2, and 3, respectively, and there were no statistically significant differences between the three groups (table 3). the mean pain vas scores during prostate biopsy were 5.01.48, 3.931.94, and 3.602.15 in groups 1, 2, and 3, respectively (table 3). patients in groups 2 and 3, who received a periprostatic injection of 1% lidocaine, reported significant pain reduction compared with the control group (p=0.004, 0.021). however, there was no statistically significant difference in vas score between groups 2 and 3 (p=0.533) (fig. one patient experienced temporary vasovagal syncope and recovered after conservative management with intravenous fluid therapy. although well tolerated by most men, 65 to 90% of patients reportedly have discomfort during trus - guided prostate biopsy. one study reported that 64% of patients who underwent trus - guided prostate biopsy reported anxiety concerning pain before the procedure, with 20% of patients experiencing severe post - biopsy pain. pain during trus - guided prostate biopsy can occur during transrectal probe insertion and when the needle pierces the capsule of the prostate through the rectal wall. lidocaine gel is usually instilled transrectally for pain reduction, but its efficacy when instilled transrectally is controversial. these include periprostatic injection, prostatic injection, apical anesthetic injection, and prostate plexus anesthetic injection. among them, the most commonly used method is periprostatic injection of anesthetics into the sites around the neurovascular bundle between the seminal vesicle and periprostatic tissue. the technique of periprostatic injection into the basal lesion of the prostate was adapted for local anesthesia in the present study. in the process of periprostatic injection for local anesthesia, confirmation of the appropriate injections is important to maximize the anesthetic effects for pain relief during prostate biopsy. the hypoechoic wheal (the collection of local anesthetic fluid between the rectal wall and the prostate detected by trus during periprostatic injection) is the key point for determining proper local injection (fig. 2). since nash. reported the efficacy of periprostatic anesthesia during prostate biopsy, numerous studies have also reported the effectiveness of a periprostatic nerve block. schostak. reported no significant difference in pain control between those receiving an injection of a total of 20 ml of 1% lidocaine into the apical and basal lesions and the group injected with a total of 10 ml of 1% lidocaine only into the basal lesions. trucchi. showed that an injection of 20 ml of 1% carbocaine near the junction of the seminal vesicle with the base of the prostate achieves better pain control than does 20 ml of 1% lidocaine. whereas most studies to date have demonstrated good efficacy of periprostatically injected lidocaine during prostate biopsy, there is no information or consensus about the efficacy of dose escalation of lidocaine for pain relief or of the optimal dosage of lidocaine, especially concerning injection into the junction between the seminal vesicle and the base of the prostate. presently, we assessed the efficacy of periprostatic anesthesia according to the dosage of lidocaine during trus - guided prostate biopsy. no statistically significant differences were evident in the vas score between group 2 (10 ml of 1% lidocaine) and group 3 (20 ml of 1% lidocaine). this result suggests that 10 ml of lidocaine was enough to induce maximum prostatic anesthesia. therefore, 10 ml of 1% lidocaine was judged to be sufficient for pain control. the rate of post - procedural infection is about 14.4% of all complications. in particular, the septic condition after prostate biopsy can be life - threatening. according to obek., periprostatic anesthesia is associated with a higher incidence of infectious complications and is due to the extra punctures and infiltration through a highly colonized rectum into a highly vascularized space furthermore, other complications such as hematuria, hematospermia, and rectal bleeding were resolved with conservative management. the first concerns are the study design and the statistical power related to sample size ; the lack of a placebo group and the small sample size may have influenced the statistical results. a second limitation was that we could not determine the optimal dosage of lidocaine for periprostatic anesthesia ; we only know that there was no significant difference between the group that received 10 ml and the group that received 20 ml lidocaine for periprostatic anesthesia. for pain control during prostate biopsy, the combination of periprostatic nerve block and lidocaine gel provides better pain control than does lidocaine gel alone. furthermore, 20 ml of lidocaine for periprostatic nerve block does not achieve better pain control than 10 ml of lidocaine. to determine the optimal dose of lidocaine for periprostatic anesthesia, further well - designed, placebo - controlled prospective studies involving larger populations will be needed. | purposethe aim of this study was to evaluate the efficacy of periprostatic lidocaine injection according to lidocaine dose during transrectal ultrasound - guided prostate biopsy.materials and methodsthe subjects of this study were 92 patients who had undergone transrectal ultrasound - guided 12-core biopsy of the prostate. the patients were randomly assigned to three groups : group 1 (n=31, no lidocaine injection), group 2 (n=30, periprostatic injection of 10 ml 1% lidocaine), and group 3 (n=31, periprostatic injection of 20 ml 1% lidocaine). the patients were assessed for pain by use of a 10-point visual analogue scale (vas) and for other complications after the procedure.resultsthe mean vas scores of groups 1 through 3 were 0.930.89, 1.321.37, and 1.131.10, respectively. there were no statistically significant differences between the three groups. however, the mean vas score of the biopsy pain was 5.01.48, 3.931.94, and 3.602.15, in the same groups, respectively, with statistically significant differences between group 1 and the other groups. patients in groups 2 and 3 reported significantly less biopsy pain than did group 1 patients (p=0.004, 0.021), with no statistically significant difference in vas score between groups 2 and 3 (p=0.533). with respect to post - biopsy complications, there were no significant differences in the incidence of hematuria, hematospermia, rectal bleeding, or infection among the three groups.conclusionsperiprostatic injection of local anesthesia with lidocaine was associated with significantly less pain than in the absence of anesthesia. furthermore, a 20-ml dose of lidocaine produced no better pain control than did a 10-ml lidocaine dose for prostate biopsy. |
a critical structure in interaction of the human body with the environment represents the skin surface with the stratum corneum. without the horny layer a terrestrial life would be impossible. on the other hand the stratum corneum becomes impaired in any kind of superficial or deep injuries. to retain body homeostasis recovery of stratum corneum other important protective functions of skin are protection against infection and irradiation, in particular ultraviolet (uv) irradiation. in the following chapters the epidermal thickness of an -immature newborn is about 29 m, in mature newborns and adults the thickness is about 50 m. the skin surface of the newborn is covered by protective gelatinous vernix caseosa whereas the skin surface of adults is rather dry. about 20 layers of nucleus - free corneocytes densely packed with keratin filaments are surrounded by a matrix. the matrix is composed of filaggrin and -derivates, and lipid - rich lamellar bodies. ceramides stand for about 50% of horny layer lipids and are essential for the lamellar structure of the epidermis. the free fatty acids are mostly long chained molecules with more than 20 c atoms. the water exchange is realized by migrating pores, i.e. polar transport pathways within the lipid mosaic. the matrix develops under influences of ph gradients, sodium ions and enzymes (synthetases, reductases, hydrolases, lipases). in a simplistic more recent studies discovered subunits of octaeders of corneocytes within the horny layer which may migrate. the horny layer is covered on its surface by a thin amorphous film contributing to stratum corneum structure and function. in newborns there is an almost neutral skin surface ph of 6.6 that changes within days or weeks into an acidic ph of 5.9 (acid skin surface film). this leads to activation of ph - dependent hydrolytic enzymes like -glucocerebrosidase and stratum corneum secretory phospholipase a2,. skin surface ph is modulated by microbial harvest, eccrine and sebaceous gland secretions, and endogenous catabolic pathways. exposure of horny layer to neutral buffers (i.e. wet work) or blocking of acidification increases the ph. prolonged exposure of human skin to wetness (water) and/ or occlusion leads to measurable disturbances of barrier function. the transepidermal water loss (tewl) increases in relation to duration of exposure and temperature,. initially the epidermis comes as a monolayer. in the first trimenon the epidermis is covered by single layered periderm. the epidermal thickness of an -immature newborn is about 29 m, in mature newborns and adults the thickness is about 50 m. the skin surface of the newborn is covered by protective gelatinous vernix caseosa whereas the skin surface of adults is rather dry. about 20 layers of nucleus - free corneocytes densely packed with keratin filaments are surrounded by a matrix. the matrix is composed of filaggrin and -derivates, and lipid - rich lamellar bodies. ceramides stand for about 50% of horny layer lipids and are essential for the lamellar structure of the epidermis. the free fatty acids are mostly long chained molecules with more than 20 c atoms. the water exchange is realized by migrating pores, i.e. polar transport pathways within the lipid mosaic. the matrix develops under influences of ph gradients, sodium ions and enzymes (synthetases, reductases, hydrolases, lipases). in a simplistic more recent studies discovered subunits of octaeders of corneocytes within the horny layer which may migrate. the horny layer is covered on its surface by a thin amorphous film contributing to stratum corneum structure and function. in newborns there is an almost neutral skin surface ph of 6.6 that changes within days or weeks into an acidic ph of 5.9 (acid skin surface film). this leads to activation of ph - dependent hydrolytic enzymes like -glucocerebrosidase and stratum corneum secretory phospholipase a2,. skin surface ph is modulated by microbial harvest, eccrine and sebaceous gland secretions, and endogenous catabolic pathways. exposure of horny layer to neutral buffers (i.e. wet work) or blocking of acidification increases the ph. prolonged exposure of human skin to wetness (water) and/ or occlusion leads to measurable disturbances of barrier function. the transepidermal water loss (tewl) increases in relation to duration of exposure and temperature,. 2.1.1 dry skin - xerosis cutis xerosis cutis is a consequence in epidermal water content reduction (< 10% of stratum corneum). an increased transepidermal water loss (tewl) leads to itch, scaling, roughness and fissuring. the basic principle of treatment of dry skin is the use of emollients and moisturizers. occlusive substances are for instance vaseline, mineral oils, paraffin, silicon, oils and fatty acids from both animals or vegetables. ceramides are of particular interest in cosmeceutical since they represent a major physiological constituent of stratum corneum barrier. hydrogenated polydecenes are chemically better defined substances as mineral mixtures like vaseline without their stickiness. the more and more popular vegetable oils and fatty acids are not without their own problems. some like coconut butter exert a comedogenic potential, others like peanut butter can cause allergic contact dermatitis. among water binding substances, known as humectants, urea that is also a normal components of the natural moisturizing factor (nmf) of human skin may be released from oil in water and water in oil emulsions and than penetrate into the horny layer. on average, a six - fold increase of urea concentration by topical application doubles the water content of the horny layer. vehicles are used as drug carriers as well as skincare products without a specific drug constituent. for a long time lipid combinations are designed to specifically modulate the horny layer and support barrier recovery. in recent times new pharmaceutical technologies were introduced like liposomes, nano particles, cyclodextrines, and microemulsions. however, their percutaneous penetration is limited. because of solubility problems, uv- and oxygen - instability vitamins are a challenge for topical use. percutaneous resorption of tocopheral has been demonstrated. in most cases of vitamins, however, scientific investigations of topical application are missing. a rather extensive data file, scientific and clinical, is available in case of dexpanthenol that is transformed in skin into panthothenic acid also known as vitamin b5. panthothenic acid is a component of coenzyme a involved in the synthesis of fatty acids, sterols, proteins etc. itch relief was fates and pain was reduced. in randomized, placebo - controlled studies among healthy subjects dexpanthenol significantly increased the horny layer water binding and reduced transepidermal water loss. on experimental damaged skin dexpanthenol ointment improved the stratum corneum water content more rapid and significant compared to its vehicle. 2.1.2 inflammation - radiodermatitis radiodermatitis is defined as the whole range of cutaneous reactions due ionizing irradiation. exposure of skin to ionizing irradiation activates transcription factor nf-b by formation of intracellular oxygen radicals. soaps should be avoided for skin cleansing since they may change skin surface ph into the basic range. non - erosive radiodermatitis can be treated with water - in - oil emulsions. in open trials with breast cancer patients and radiotherapy after tumour moisturizers are not capable to prevent radiodermatitis,. comparing skin cleansing and skin care with the traditional method to keep skin dry during radiotherapy of breast cancer cleansing with water was superior. in particular wet desquamation occurred less often when washing was allowed. in a study on skin care during radiation therapy a mild aloe vera - containing soap alone a protective effective has been described for panthothenol in models of oxygen radical - induced cell and tissue damage such as lipid oxidation of cell membranes treated by gamma irradiation. using a moisturizing concept with dexpanthenol topically in more than 1,000 radiotherapy patients both tolerance to treatment and acceptance of treatment by patients allergic reactions, super infections, epidermolysis, and xerosis cutis were either less frequent or even completely prevented. in contrast, a randomized study including 86 patients with larynx or breast cancer and radiotherapy dexpanthenol ointment alone had no significant effect on eortc / rtog - score of radiodermatitis, pain and itch. in this study quality of life, super infection and tolerability of irradiation the topical steroid was significantly more effective than the vehicle in the reduction of inflammation. there is no such data available for the use of other topical steroids. in erosive radiodermatitis wet compressions with black tee or eosin 1 - 2% and a short course of hydrocortisone foam have been recommended. 2.1.3 protection against skin infection and antimicrobial peptides there is a close relationship between horny layer barrier function and the risk of skin infection. a cochrane group analysis has shown that in newborns emollients alone are capable to stabilize the stratum corneum barrier thereby preventing skin infections. they may also be used as an adjuvant in management of chronic wounds that are at risk of infection or are infected without replacement of systemic antibiotics when necessary. iodine is contraindicated during pregnancy, in newborns and patients with thyroid disease since there is a significant percutaneous absorption of iodine. among topical antibiotics for the head and neck region mupirocine the drug exerts an excellent activity against staphylococcus aureus that makes it the first choice for eradication of a nasal staphyloccous reservoir. the use of other topical antibiotics like neomycine, bacitracine, polymyxine etc. is better avoided since contact - allergic reactions are not uncommon and they are not effective in deeper infections. in these cases interestingly enough, the new calls of topical calcineurin - inhibitors used for atopic dermatitis reduces the microbial settlement of skin by staphylococci and restores the barrier function,. in recent years research the human cathelicidin ll-37 is chemotactic for neutrophils, monocytes, mast cells, and t - lymphocytes, causes mast cell degranulation and supports vascularization and re - epithelialization of wounds. in human skin appendages genes like dcd and camp in addition, such substances are secreted together with the sweat and spread on the skin surface,. in newborns there is a 10- to 100-fold increase of expression of cathelicidin ll-37 and -defensin-2 compared with adult skin. this explains as a compensatory mechanism of a still immature immune system in adapting to post - uterine life. both -defensin-1 to -3 and cathelicidin ll-37 have been detected there. during the recovery of barrier function after wounding or inflammatory disease (eczema, psoriasis) the microbial settlement induces antimicrobial control mechanisms : for instance saprophytic yeast malasezzia furfur, but bacteria as well, induce the expression of -defensin-2 in human epidermal keratinocytes,. in acute wounds surgery in chronic non - infected wounds and chronic wounds not at risk of infection the principle of moist wound healing has become the standard. the use of wound dressings is a part of the concept of wound bed preparation - time. time includes the following aspects : is the tissue viable or necrotic ? in cases of necrosis debridement is necessary either with the by surgery, application of maggots (biosurgery), or enzymatic. however, the beneficial effect of regular debridement has been proven scientifically only in the treatment of diabetic foot ulcers yet. i = infection, inflammation in any case of infection and / or inflammation infection control is need either by antibiosis, removal of the bacterial biofilm or disinfection. in addition the basic pathogenic factors like hypoxia, impaired circulation, metabolic disease and oedema have to be treated as well. in chronic wounds at risk of infection silver - containing wound dressings are useful and effective,. in particular re - epithelialization of skin is supported by a moist but not wet wound milieu. the aim of moisture balance is protection against secondary infection and balancing fluid in the wound bed. for this purpose wound dressings with a semi - occlusive surface membrane combined with polyurethane foams, alginates or hydro fibres the major effects are improvement of granulation and re - epithelialization, pain reduction, reduction of dressing change frequency and thereby decreasing the nursing time,. in recent years more and more interactive dressings have been developed, that balance the content and activity of matrix metalloproteinases in the wound fluid,. the wound edge can be undermined like in pyoderma gangraenosum, hyperplastic like in plantar ulcers or growing onto the wound bed like in healing wounds (edge effect). the edge effect can also be observed after skin transplant (i.e. in full thickness reverdin islands). platelet - derived growth factor (pdgf - bb) increases the speed of re - epithelialization in diabetic and varicose ulcers. the basic mechanisms of action are neoangiogenesis and increased fibroblast activity. on the other hand, dermal matrix components like hyaluronic acid, oxygen partial pressure and other growth factors may stimulate keratinocyte proliferation and migration,. inter linked hyaluronic acid has been used as wound dressing and as a keratinocyte delivery system in tissue - engineered skin. 2.1.1 dry skin - xerosis cutis xerosis cutis is a consequence in epidermal water content reduction (< 10% of stratum corneum). an increased transepidermal water loss (tewl) leads to itch, scaling, roughness and fissuring. the basic principle of treatment of dry skin is the use of emollients and moisturizers. occlusive substances are for instance vaseline, mineral oils, paraffin, silicon, oils and fatty acids from both animals or vegetables. ceramides are of particular interest in cosmeceutical since they represent a major physiological constituent of stratum corneum barrier. hydrogenated polydecenes are chemically better defined substances as mineral mixtures like vaseline without their stickiness. the more and more popular vegetable oils and fatty acids are not without their own problems. some like coconut butter exert a comedogenic potential, others like peanut butter can cause allergic contact dermatitis. among water binding substances, known as humectants, urea that is also a normal components of the natural moisturizing factor (nmf) of human skin may be released from oil in water and water in oil emulsions and than penetrate into the horny layer. on average, a six - fold increase of urea concentration by topical application doubles the water content of the horny layer. vehicles are used as drug carriers as well as skincare products without a specific drug constituent. for a long time lipid combinations are designed to specifically modulate the horny layer and support barrier recovery. in recent times new pharmaceutical technologies were introduced like liposomes, nano particles, cyclodextrines, and microemulsions. however, their percutaneous penetration is limited. because of solubility problems, uv- and oxygen - instability vitamins are a challenge for topical use. percutaneous resorption of tocopheral has been demonstrated. in most cases of vitamins, however, scientific investigations of topical application are missing. a rather extensive data file, scientific and clinical, is available in case of dexpanthenol that is transformed in skin into panthothenic acid also known as vitamin b5. panthothenic acid is a component of coenzyme a involved in the synthesis of fatty acids, sterols, proteins etc. itch relief was fates and pain was reduced. in randomized, placebo - controlled studies among healthy subjects dexpanthenol significantly increased the horny layer water binding and reduced transepidermal water loss. on experimental damaged skin dexpanthenol ointment improved the stratum corneum water content more rapid and significant compared to its vehicle. 2.1.2 inflammation - radiodermatitis radiodermatitis is defined as the whole range of cutaneous reactions due ionizing irradiation. exposure of skin to ionizing irradiation activates transcription factor nf-b by formation of intracellular oxygen radicals. soaps should be avoided for skin cleansing since they may change skin surface ph into the basic range. non - erosive radiodermatitis can be treated with water - in - oil emulsions. in open trials with breast cancer patients and radiotherapy after tumour moisturizers are not capable to prevent radiodermatitis,. comparing skin cleansing and skin care with the traditional method to keep skin dry during radiotherapy of breast cancer cleansing with water was superior. in particular wet desquamation occurred less often when washing was allowed. in a study on skin care during radiation therapy a mild aloe vera - containing soap alone a protective effective has been described for panthothenol in models of oxygen radical - induced cell and tissue damage such as lipid oxidation of cell membranes treated by gamma irradiation. using a moisturizing concept with dexpanthenol topically in more than 1,000 radiotherapy patients both tolerance to treatment and acceptance of treatment by patients allergic reactions, super infections, epidermolysis, and xerosis cutis were either less frequent or even completely prevented. in contrast, a randomized study including 86 patients with larynx or breast cancer and radiotherapy dexpanthenol ointment alone had no significant effect on eortc / rtog - score of radiodermatitis, pain and itch. in this study quality of life, super infection and tolerability of irradiation the topical steroid was significantly more effective than the vehicle in the reduction of inflammation. there is no such data available for the use of other topical steroids. in erosive radiodermatitis wet compressions with black tee or eosin 1 - 2% and a short course of hydrocortisone foam have been recommended. 2.1.3 protection against skin infection and antimicrobial peptides there is a close relationship between horny layer barrier function and the risk of skin infection. a cochrane group analysis has shown that in newborns emollients alone are capable to stabilize the stratum corneum barrier thereby preventing skin infections. they may also be used as an adjuvant in management of chronic wounds that are at risk of infection or are infected without replacement of systemic antibiotics when necessary. iodine is contraindicated during pregnancy, in newborns and patients with thyroid disease since there is a significant percutaneous absorption of iodine. among topical antibiotics for the head and neck region mupirocine the drug exerts an excellent activity against staphylococcus aureus that makes it the first choice for eradication of a nasal staphyloccous reservoir. the use of other topical antibiotics like neomycine, bacitracine, polymyxine etc. is better avoided since contact - allergic reactions are not uncommon and they are not effective in deeper infections. in these cases interestingly enough, the new calls of topical calcineurin - inhibitors used for atopic dermatitis reduces the microbial settlement of skin by staphylococci and restores the barrier function,. in recent years research the human cathelicidin ll-37 is chemotactic for neutrophils, monocytes, mast cells, and t - lymphocytes, causes mast cell degranulation and supports vascularization and re - epithelialization of wounds. in human skin appendages genes like dcd and camp in addition, such substances are secreted together with the sweat and spread on the skin surface,. in newborns there is a 10- to 100-fold increase of expression of cathelicidin ll-37 and -defensin-2 compared with adult skin. this explains as a compensatory mechanism of a still immature immune system in adapting to post - uterine life. both -defensin-1 to -3 and cathelicidin ll-37 have been detected there. during the recovery of barrier function after wounding or inflammatory disease (eczema, psoriasis) the microbial settlement induces antimicrobial control mechanisms : for instance saprophytic yeast malasezzia furfur, but bacteria as well, induce the expression of -defensin-2 in human epidermal keratinocytes,. in acute wounds surgery is the treatment of choice. in the management of chronic wounds conservative treatments may be successful as well. in chronic non - infected wounds and chronic wounds not at risk of infection the principle of moist wound healing has become the standard. the use of wound dressings is a part of the concept of wound bed preparation - time. time includes the following aspects : is the tissue viable or necrotic ? in cases of necrosis debridement is necessary either with the by surgery, application of maggots (biosurgery), or enzymatic. however, the beneficial effect of regular debridement has been proven scientifically only in the treatment of diabetic foot ulcers yet. i = infection, inflammation in any case of infection and / or inflammation infection control is need either by antibiosis, removal of the bacterial biofilm or disinfection. in addition the basic pathogenic factors like hypoxia, impaired circulation, metabolic disease and oedema have to be treated as well. in chronic wounds at risk of infection silver - containing wound dressings are useful and effective,. in particular re - epithelialization of skin is supported by a moist but not wet wound milieu. the aim of moisture balance is protection against secondary infection and balancing fluid in the wound bed. for this purpose wound dressings with a semi - occlusive surface membrane combined with polyurethane foams, alginates or hydro fibres are useful. the major effects are improvement of granulation and re - epithelialization, pain reduction, reduction of dressing change frequency and thereby decreasing the nursing time,. in recent years more and more interactive dressings have been developed, that balance the content and activity of matrix metalloproteinases in the wound fluid,. the wound edge can be undermined like in pyoderma gangraenosum, hyperplastic like in plantar ulcers or growing onto the wound bed like in healing wounds (edge effect). the edge effect can also be observed after skin transplant (i.e. in full thickness reverdin islands). platelet - derived growth factor (pdgf - bb) increases the speed of re - epithelialization in diabetic and varicose ulcers. the basic mechanisms of action are neoangiogenesis and increased fibroblast activity. on the other hand, dermal matrix components like hyaluronic acid, oxygen partial pressure and other growth factors may stimulate keratinocyte proliferation and migration,. inter linked hyaluronic acid has been used as wound dressing and as a keratinocyte delivery system in tissue - engineered skin. | skin exerts a number of essential protective functions ensuring homeostasis of the whole body. in the present review barrier function of skin and its expression of antimicrobial peptides are discussed. barrier function is provided by the dynamic stratum corneum structure composed of lipids and corneocytes. stratum corneum is a conditio sine qua non for terrestrial life. impairment of barrier function can be due to injury and inflammatory skin diseases. therapeutic options are discussed with special emphasis of radiodermatitis and irritant contact dermatitis in patients with hearing device. the use of antimicrobial peptides is illustrated by facial inflammatory skin diseases. in wound healing new developments include biotechnological developments of matrix- and growth factors and tissue - engineered skin substitutes. in everyday wound care of chronic wounds the concept of wound bed preparation (time) constitutes the base of successful treatment. |
acute bronchiolitis is the most frequent reason for lower respiratory tract infection and hospitalization due to respiratory disease in infancy. about 50000 - 80000 hospitalizations of the infants under the age of one are attributed to this disease in the usa (1). the severe form of this disease is much more prevalent in one- to three - month - old infants and responsible for more than 50% of its incidence, causing respiratory syncytial virus, inflammationand small airway obstruction (1). clinical symptoms of acute bronchiolitis are similar to those of viral pneumonias, with fever, wheezing, and increased respiratory rate as the most important ones (2). the treatment is often supportive therapy, including fluid therapy, anti - fever drugs, and oxygen (3). some investigations have been recently conducted on the therapies like bronchodilators including salbutamol and epinephrine as nebulized (2,4). in infants particularly under age of six months, edema and inflammation in bronchioles could lead to respiratory distress because of small diameter of airways (1). there is no consensus on use of bronchodilators and/or beta - agonists (5,6). most works have indicated that bronchodilators have no role in treating these patients (7). today, inhaled salbutamol (ventolin) is used for treating bronchiolitis patients in iran s hospitals while several studies have indicated that this drug does not work (8 - 12). in many studies, the positive effect of hypertonic saline has been observed on recovering bronchiolitis symptoms (9,10). for example, comparative study of hypertonic saline 3% and 7% indicated a greater therapeutic effect of hypertonic saline 3% than that of hypertonic saline 7% in treating bronchiolitis symptoms and decreasing duration of treatment (13,14). hypertonic saline 3% was also found as better and more efficient than normal saline and hypersaline 3% nebulizer (15,16). in addition, a research conducted to compare hypertonic saline 3% with the drugs used for bronchiolitis like ventolin indicated that hypertonic saline 3% and ventolin had a greater therapeutic effect than ventolin and normal saline on treating bronchiolitis symptoms (17). in some studies, ventolin and hypertonic saline 3% had similar therapeutic effect on symptoms developed by mild to moderate viral bronchiolitis and were free of complications, as well (18). regarding the widely known complications of ventolin as the most common drug used for bronchiolitis and that no study has been yet conducted to compare the efficacy of ventolin and hypertonic saline 3% on bronchiolitisin iran, the present study was conducted to determine the efficacy of hypertonic saline 3% on treatment of acute bronchiolitis, in comparison with ventolin. this research is a double - blinded clinical trial study conducted in 2011 - 2012 on 70 referring patients with acute viral bronchiolitis. registration code of irct2012110510222n2 was issued by iranian registry of clinical trials for this study. the samples of study were examined for severity of simulated disease prior to enrollment and the patients with acute status and causing a predetermined error in the study were excluded from the investigation. inclusion criteria were patients with mild to moderate respiratory status, the first wheezing, and obtaining a score of lower than nine in respiratory distress assessment inventory (rdai), the most common clinical scoring tool for acute bronchiolitis developed based on wheezing and intercostal retraction (19). all patients were frequently visited and examined by a pediatrician in hajar hospital, shahrekord, iran till completion of their hospitalization. after the informed consent was obtained from the patients guardians, the patients were assigned into two groups of case and control. group one underwent treatment with ventolin nebulizer and group two with hypertonic saline 3% nebulizer. the prescribed dose of ventolin was 0.1 mg / kg and the required concentration was obtained by distilled water. to obtain hypertonic saline 3% solution, 3 ml sodium chloride 5% was mixed with a 5-cc vial of distilled water. the two medicinal combinations were administered to the patients of the two groups every four hours by a nebulizer instrument. the inhaled medicine accompanied with oxygen was nebulized to the patients by a face mask. clinical symptoms of the patients and the length of recovery since hospitalization initiation were calculated for each patient and registered in a special checklist based on the defined rdai criterion and day. the data were analyzed by spss software (version 22) using chi - square, t - test, paired t - test, and mann - whitney. in this study, 70 patients were randomly assigned to two groups of 35 each. group one underwent treatment with ventolin nebulizer (ventolin group) and group two with hypertonic saline 3% nebulizer (hypersaline group). the meansd age of the patients was 14.15.6 months in the ventolin group and 12.65.6 months in the hypersaline group. the meansd length of recovery was 4.140.9 days in the ventolin group and 3.060.6 in the hypersaline group. the mean length of recovery was significantly lower in the hypersaline group (p<0.001). the meansd rdai criterion on the days two, three, four, and five was respectively 5.681.3, 4.851.6, 3.621.6, and 1.420.8 in the ventolin group and 4.251.5, 3.21.5, 2.541.6, and 0.90.54 in the hypersaline group ; the mean rdai criterion was significantly lower in the hypersaline 3% group (p<0.001). the general purpose of conducting this study was to compare the efficacy of hypertonic saline 3% with that of ventolin on treating acute bronchiolitis in the children under two years. in this study, two groups (35 patients in each group) of infants hospitalized for bronchiolitis in hajar hospital, shahrekord, iran were investigated. according to the results of this study, the mean length of recovery was 4.140.4 days in the ventolin group and 3.00.6 in the hypersaline group. the patients under hypersaline treatment recovered more rapidly, which is clinically and economically important as 50000 - 80000 hospitalizations of under one - year - old infants has led to expending about 300 million dollars per year in the usa (1). other studies reported the therapeutic effect of hypertonic saline 3% on acute bronchiolitis in children. in kuzik study, use of hypertonic saline 3% nebulizer had more pleasant outcomes than the normal saline nebulizer (15). also, anil who used some medicinal combinations (ventolin nebulizer with normal saline, epinephrine with normal saline and hypertonic saline 3%, and normal saline alone) for treating acute bronchiolitis in the children found no significant difference among the groups ; the effect of hypertonic saline 3% was similar to that of other medicinal combinations (9). in zhang study, hypertonic saline 3% was more effective than normal saline (16). mandelberg compared hypertonic saline 3% nebulizer, epinephrine, and normal saline and found hypertonic saline 3% as therapeutically more effective on bronchiolitis symptoms (13). in ater study to compare ventolin nebulizer and normal saline with ventolin and hypertonic saline 5%, hypertonic saline 5% had a better therapeutic effect in the children with bronchiolitis than normal saline (20). in addition, the decreased length of hospitalization after hypertonic saline 3% was observed in some studies (10,13,17,20). the results of this study indicated that the mean rdai criterion on the day of hospitalization and prior to treatment initiation had no significant difference between the two groups. the rdai criterion indicating the disease severity had no significant difference between the two groups of study. in addition, the mean rdai criterion was significantly lower in the hypertonic saline 3% group, indicating that use of hypertonic saline 3% nebulizer was obviously more efficient than ventolin after hospitalization (the day one), i.e. from the day two to the last day of hospitalization. the greatest efficacy was noted on the day two after hypertonic saline 3%, irrespective of the last day of hospitalization. in sarrell study, there was no significant difference prior to study between the two groups, but an obviously better effect was noted by the use of hypertonic saline 3% nebulizer between the day two and the last day of hospitalization. the effect of hypertonic saline 3% was obviously better than that of normal saline on the day one in sadbhavna study, but no difference was observed between the two groups on the day two (17,21). the length of hospitalization in our study was 2 - 6 days, similar to other studies (13,15,16). although the mechanism of hypertonic saline 3% was not examined in the present work, hypertonic saline 3% was demonstrated to increase mucus clearing in dasgupta study (22). also, tomooka examined the effects of hypertonic saline on recovery of respiratory symptoms. these effects included improvement of mucous cilia s function, decrease in mucous edema and inflammatory mediators, mechanical clearing of secretions, and improvement of mucus function (23). on the other hand, no complication was observed by the use of hypertonic saline 3% nebulizer throughout the study in the studied patients, which is consistent with other studies (9,13,18). regarding the obtained results in this study and comparing them with those of other studies, we found hypertonic saline 3% nebulizer as having more pleasant therapeutic effects than ventolin on treating acute bronchiolitis in the children under two years. moreover, use of hypertonic saline 3% leads to no remarkable drug - related complications in the children ; the reason is that it is free of medicinal compounds. in addition, the treatment costs would decline considerably and hence use of hypertonic saline 3% nebulizer is recommended for treatment of acute bronchiolitis in children under the age of two. we gratefully thank research and technology deputy of shahrekord university of medical sciences. | background : complications of ventolin as the most common drug used for bronchiolitis are widely known. the present study was conducted to determine the efficacy of hypertonic saline 3%, compared with ventolin, for treatment of acute bronchiolitis in children. methods : this double - blinded clinical trial study was conducted in hajar hospital, shahrekord, iran, from 2011 to 2012. a total of 70 patients under the age of two years with bronchiolitis were divided into two groups of 35 each. ventolin nebulizer and hypertonic saline 3% nebulizer three times per day were administered in the first (ventolin) and second (hypersaline) group, respectively. the length of recovery was compared between the two groups. the data were analyzed by spss software (version 22) using chi - square, t - test, paired t - test, and mann - whitney. results : the meansd length of recovery was 4.140.9 and 3.060.6 in the ventolin and hypersaline groups, respectively. the mean duration of recovery was significantly lower in the hypersaline group (p<0.001). conclusion : hypertonic saline 3% nebulizer has more pleasant therapeutic effects on acute bronchiolitis than ventolin. therefore, use of hypertonic saline 3% nebulizer is recommended for the treatment of acute bronchiolitis in children under two years old. |
childhood cancer is a rare disease affecting 1 in 70,000 children aged 14 years and younger [1, 2 ]. lymphoid malignancy, including leukemia and lymphoma, is the most common childhood cancer, accounting for 40% of all pediatric malignancies. during the last 20 years, survival rates for pediatric acute lymphoblastic leukemia (all) and non - hodgkin 's lymphoma (nhl) have improved dramatically, mostly due to improvement of chemotherapy, allogeneic hematopoietic stem cell transplantation, and diagnostic techniques, with expected cure rates higher than 80% for pediatric lymphoid malignancy [13 ]. methotrexate (mtx) is one of the key drugs for cancer treatment and a proven critical component for pediatric all and nhl [1, 4, 5 ]. firstly, as an analog of folate, mtx is a powerful competitive inhibitor of dihydrofolate reductase (dhfr) [6, 7 ]. dhfr is responsible for converting folates to their active form tetrahydrofolate, a substrate of thymidylate synthase (ts), to convert deoxyuridine monophosphate to deoxythymidine-5-monophosphate resulting in dna synthesis. secondly, the polyglutamated forms of mtx inhibit the activity of ts directly [6, 8 ]. high - dose mtx (hd - mtx) treatment has been proven for its efficacy for the treatment of all and nhl [4, 5 ]. however, mtx often causes toxicity such as renal failure, hepatotoxicity, and severe mucositis requiring a dose reduction and cessation of treatment or hemodialysis, and it is well known that large interindividual mtx kinetic variability exhibits. therefore, it is beneficial to find patients with a high risk of developing adverse events before the initiation of the treatment [9, 10 ]. in folate metabolism, methylenetetrahydrofolate reductase (mthfr) is a key molecule to convert 5,10-methylenetetrahydrofolate (5,10-methylene - thf) to 5-methyltetrahydrofolate (5-methyl - thf), and 5,10-methylene - thf is a substrate of ts. there are two extensively examined mthfr polymorphisms, rs1801133 (c.677c > t, p.ala222val) and rs1801131 (c.1298a > c, p.glu429ala), that have been shown to have lower enzyme activity when they carry mutant alleles. a previous study reported that the t allele of mthfr rs1801133 was associated with an increased risk of relapse events but not associated with mtx concentrations nor adverse events and that rs1801131 was not associated with altered risks of relapse nor toxicity in 520 pediatric all patients by the children 's oncology group. others showed conflicting results, showing that patients with the tt genotype of mthfr rs1801133 resulted in a better overall survival rate in 126 brazilian pediatric all patients treated with mtx, and others reported that patients carrying the t allele of rs1801133 and the a allele of rs1801131 (mthfr c.t677a1298 haplotype) had a lower event free survival, and t allele of mthfr rs1801133 and c allele of mthfr rs1801131 had higher relapse ration. transporters such as adenosine triphosphate - binding cassette (abc) transporters and organic anion transporters were also reported to act for mtx disposition. solute carrier organic anion transporter family member 1b1 (slco1b1) is one of the organic anion transporters and localized at the sinusoidal membrane of hepatocytes, and its transcript has been detected in enterocytes. slco1b1 transfected cells were proven to uptake mtx in vitro, as well as other compounds such as estradiol, bilirubin, bile acids, 3-hydroxy-3-methylglutaryl coenzyme a (hmg - coa), rifampicin, angiotensin - converting enzyme inhibitors, and the active metabolite of irinotecan, sn-38 [1820 ]. tirona. reported slco1b1 polymorphisms (rs56101265, rs5606188, rs4149056, rs55901008) altered in transport of substrates in vitro. reported slco1b1 polymorphisms rs4149056 (c.521t > c, p.v174a) transfected hek cells, decreasing transporting activities. children who underwent hd - mtx for all who carry slco1b1 polymorphism rs11045879 (c.1865 + 4846t > c) and rs4149056 were shown to have lower mtx elimination in a genome - wide - association - study (gwas), whose cohort mostly consisted of caucasians and a limited number of asians [20, 22 ]. these polymorphisms in slco1b1 were confirmed associations with a higher mtx concentration at 72 hrs among spanish b - all children [22, 23 ]. japanese patients treated with mtx due to rheumatoid arthritis showed no association between slco1b1 polymorphisms (rs4149056 and rs2306283 (c.388a > g, p.n432d)) and mtx concentration nor disease status. although many studies have been conducted to investigate associations between mthfr polymorphisms and mtx toxicity in pediatric all patients, results derived from these studies are conflicting. study populations were mostly caucasians and reports from asians were limited [10, 25 ]. allele frequencies of polymorphisms differ in each ethnic population, and their effects can be influenced by different chemotherapy protocols, genetic backgrounds, and others [13, 26, 27 ]. in the present study, we genotyped 2 polymorphisms in mthfr (rs1801133 and rs1801131) and 2 more polymorphisms in slco1b1 (rs4149056 and rs11045879) in japanese all / nhl patients treated with hd - mtx and examined the relationship between genotypes and prognosis / adverse events. to investigate associations of polymorphisms of mthfr (rs1801133 and rs1801131) and slco1b1 (rs4149056 and rs11045879) and prognosis or clinical course including mtx concentrations in japanese children who developed lymphoid malignancy treated with hd - mtx. eighty - two acute lymphoblastic leukemia (all) and 21 non - hodgkin lymphoma (nhl) children were enrolled in the present study. all patients were treated at two main and exclusively pediatric malignancy treating regional hospitals in ibaraki prefecture (university of tsukuba hospital and ibaraki children 's hospital) between november 1993 and november 2012. the study was approved by the ethics committee of the university of tsukuba in accordance with the ethical guidelines for human genome / gene analysis research of the ministry of health, labor and welfare of japan and the declaration of helsinki. all patients received intravenous mtx continuously at 3 g / m/12 hrs or 24 hrs, or 5 g / m/24 hrs with folic acid rescue following the protocol of the tokyo children 's cancer study group (tccsg) l99 - 15, all - bfm 95, or nhl b9604. monitoring of mtx concentration in plasma was carried out every day until the concentration was below 0.1 mol / l. toxicity data were retrospectively collected objectively, blinded genotypes, from the patients ' medical files. toxicity was graded according to the common terminology criteria for adverse event (ctcae) v4.0 released from the cancer therapy evaluation program of the national cancer institute (http://ctep.cancer.gov/). the highest grade of toxicity observed for each patient during the mtx therapy period was recorded. data were collected including vomiting, diarrhea, serum hepatic enzyme (alt), serum bilirubin and renal toxicity (serum creatinine), and mtx concentrations at 48 and 72 hrs after infusion. mol / l at 48 hrs or 0.1 mol / l at 72 hrs. above 1.5 mg / dl patients who developed at least one adverse event (maximum / base line creatinine ratio higher than 1.5, alt elevation more than grade 1 according to the criteria of ctcae v.4.0, t - bil elevation 1.5 mg / dl) were categorized as having global toxicity. dna was extracted using genomic dna isolation kit (qiaamp dna blood mini kit, qiaamp dna blood midi kit or qiaamp dna ffpe tissue : qiagen, vealo, the netherlands) from 0.5 to 2 ml peripheral blood, bone marrow, or paraffin - embedded bone marrow / tissue in complete remission following the manufacturer 's instructions. c, rs1801131) and slco1b1 (c.1865 + 4846t > c, rs11045879, c.521t > c, rs4149056) were genotyped using the taqman assay - on - demand snp typing system (applied bio systems, foster city, ca, usa) following the manufacturer 's instructions. pcr was performed on a 384-well format with 5 ng of dna each, and automatic allele calling was performed using abi prism 7900ht data collection and analysis software, version 2.2.2 (applied biosystems). the accuracy of the genotyping for rs1801131 in children who had relapsed or died was confirmed by direct sequence using the primers 5-tttggggagctgaaggacta-3 (forward) and 5-ctttgtgaccattccggttt-3 (reverse) as reported by shimasaki. and the bigdye terminator v.1.1 cycle sequencing kit (applied biosystems) on an abi prism 3130 genetic analyzer (applied biosystems). control genotype frequencies were obtained from hapmap database (hapmap jpt, http://www.ncbi.nlm.nih.gov/) and genome medicine database of japan (gemdbj, https://gemdbj.nibio.go.jp/dgdb/index.do) which consisted of healthy japanese individuals and have been genotyped using illumina sentrix humanhap550 genotyping beadchip and infiniumhd 610-quad beadchip (illumina, san diego, ca), and principal component analysis has been performed to remove relatives, duplications, and han chinese (https://gemdbj.nibio.go.jp/dgdb/web/common/help.jsp#manual). the genetic effects of the association between the case - control status and each individual snp were assessed by chi - square test or fisher 's exact test. for the analysis of associations among adverse events during mtx treatment and polymorphisms, the worst value of toxicity markers (alt elevation, bilirubin elevation, or creatinine ratio) that each patient experienced during all hd - mtx courses and polymorphisms of mthfr and slco1b1 were assessed by chi - square test. to confirm the suitability of mtx concentrations as a toxicity marker, the associations between different toxicity markers (alt elevation, bilirubin elevation, or creatinine ratio) and mtx plasma concentration at 48 and 72 hrs among evaluable 149 courses conducted for all in total were examined by chi - square test or fisher 's exact test. children enrolled in our study consisted of 82 patients diagnosed as all (b - cell precursor 69, t - lineage 9, others 4) and 21 children diagnosed as nhl (burkitt 10, t - lineage 5, diffuse large b cell lymphoma 2, others 4). the number of patients who were in their first complete remission was 89, relapsed 8, and died 6. table 2 shows the genotype of mthfr and slco1b1 in patients and controls hapmap jpt obtained from the ncbi database and gemdbj. deviation from hardy - weinberg expectations was examined by chi - square test and was applied to each of snps (p = 0.049 for rs1801133, p = 0.633 for rs1801131, p = 0.495 for rs11045879, and p = 0.686 for rs4149056). differences of allele frequencies were assessed by chi - square test and there were no differences with control data. among hapmap jpt, the p value for rs1801133 was 0.442, rs1801131 was 0.924, rs11045879 was 0.896, and rs4149056 was 0.066. among gemdbj, the p value for rs1801133 was 0.885, rs1801131 was 0.765, and rs4149056 was 0.408. thirty - four of 89 children in their first complete remission carried at least one c allele of rs1801131 (mthfr c.1298ac / cc genotype), and no children who relapsed / died carried this genotype, in which frequency was significantly different (p = 0.004). figure 2 shows event free survival according to the genotype of mthfr c.1298a > c (rs1801131). all assessable weekly 3 g / m hd - mtx courses following the treatment protocol of tccsg l99 - 15 for standard or high risk all patients totaled 149. for assessing the associations of adverse events during each mtx administration and each genotype, we analyzed these homogeneously treated 149 courses of weekly hd - mtx (table 4). courses undergone for children with the aa genotype of rs1801131 (mthfr c.1298aa) tended to correlate to mtx concentration of higher than 1.0 mol / l at 48 hrs after administration but not statistically significant (p = 0.06), and no other genotypes were correlated to mtx concentrations. only 9 of 49 courses undertaken for children with the cc genotype of rs1801133 (mthfr c.677cc) developed common terminology criteria for adverse event (ctcae) v4.0 more than grade 1 alt elevation, whereas 41 of 100 courses undertaken for children with at least one t allele of rs1801133 (mthfr c.677ct / tt) developed elevated serum liver enzyme (p = 0.006). thirty - eight of 96 courses undertaken for children with the aa genotype of rs1801131 (mthfr c.1298aa) resulted in elevated serum liver enzyme, 11 of 52 with at least one c allele of rs1801131 (mthfr c.1298ac / cc genotype) resulted in alt elevation (p = 0.036). only 8 of 32 courses conducted with patients who carried the cc genotype of rs1801133 (mthfr c.677cc) resulted in the next mtx administration being delayed more than 5 days due to adverse events such as serum hepatic enzyme, renal toxicity, or infection, as 33 of 69 courses for patients who carry at least one t allele of rs1801133 (mthfr c.677ct / tt genotype) resulted in the next mtx administration being delayed which had been planned to have been conducted weekly (p = 0.030). no adverse events such as elevated mtx concentration, alt elevation, hyperbilirubinemia, or prognosis were statistically correlated to two polymorphisms in slco1b1 (rs11045879 and rs4149056) (tables 2 and 3). mtx concentrations and adverse events were analyzed by chi - square test (table 5). elevated mtx concentrations at 48 hour were associated with higher creatinine ratio (p < 0.001) and delayed weekly mtx administration (p = 0.013). high dose methotrexate is highly effective for broad cancers including lymphoid malignancies such as leukemia and lymphoma. however, its adverse events differ among each ethnicity and could significantly affect its clinical course. previously, genetic polymorphisms of mtx pathway protein were reported as one of the predictable values. with recent excellent advances in the prognosis among childhood lymphoid malignancy, it is vitally important to detect the factors that influence the prognosis in this limited number of poorer prognostic patient cohort other than factors that have already been thoroughly examined. in our study, all children who had relapsed or died carried the aa genotype of rs1801131 (p = 0.004). previous studies using caucasian all patients reported that the t allele of rs1801133 was correlated with poor prognosis, but the polymorphism of rs1801131 was not associated with the prognosis of the patients. on the contrary, the tt genotype of rs1801133 and the ac genotype of rs1801131 were reported to be associated with lower overall survival in brazilian patients with pediatric all, and the t allele of rs1801133 and the a allele of rs1801131 (mthfr c.t677a1298 haplotype) had a lower event free survival among caucasians. substitution of a to c of rs1801131 causes an amino acid change of glutamine to alanine at the position 429 in mthfr and showed lower enzyme activity in vitro, and lymphoblasts with the ac genotype of rs1801131 required higher mtx concentrations in order to inhibit 50% of the control ts activity than those with the cc genotype of rs1801131. our results showing the aa genotype of rs1801131 to be associated with poor prognosis might be explained by the fact that lower mthfr enzyme activity due to substitution of a to c of rs1801131 leads to reduced conversion of 5,10-methylene - thf to 5-methyl - thf, resulting in more substrate for ts, thereby leading to more dna synthesis and lesser mtx sensitivity as reported in a previous ex vivo study. t) was reported as a candidate predictor of mtx lower elimination, but its results are controversial and many different results have been reported [10, 11, 23 ]. trevino. discovered significant associations among lower mtx elimination and polymorphisms in slco1b1 (rs11045879 and rs4149056). lopez - lopez. confirmed this result in spanish population [20, 23 ]. most of those researches were conducted among caucasians and studies among japanese were limited. in our study population, all patients consisted of japanese, and association study among slco1b1 polymorphism in pediatric lymphoid malignancies had not been conducted previously. mtx concentration at 48 hrs was one of the strong predictors to develop a delay in the next course of mtx administration and serum creatinine elevation (table 5). in our study population, courses conducted for patients carrying the aa genotype of rs1801131 (mthfr c.1298aa) tended to have a higher mtx concentration at 48 hrs ; however, this association did not reach statistical significance. polymorphisms in slco1b1 (rs11045879 and rs4149056) were not correlated to mtx concentrations at 48 hrs (p = 0.687 and p = 0.567, resp.). the discrepancies among studies previously conducted among caucasians might be caused by differences of genetic backgrounds, lifestyles, or treatment protocol. this is retrospective study, so in the future a prospective research for japanese children is warranted. polymorphisms in mthfr (rs1801133 and rs1801131) were associated with serum alt elevation (p = 0.006 and p = 0.036, resp.). patients who carried at least one t allele of rs1801133 (mthfr c.677ct / tt genotype) were also associated with more than 5 days of delay of the next mtx administration, which was planned to undergo weekly (p = 0.03). patients with adult acute lymphoblastic leukemia carrying at least one t allele of rs1801133 (mthfr c.677ct / tt genotype) were associated with developing alt elevation as ctcae v.4.0 grade more than 1, which was the same result as reported previously. however, this result is different from the two previous studies that were conducted for japanese children with leukemia or lymphoma and did not show statistical associations between the t allele of rs1801133 and hepatic enzyme elevations [10, 31 ]. reported that the ac genotype of rs1801131 (mthfr c.1298 ac) showed lower adverse event. de jonge. reported that lymphoblast with the ac genotype of rs1801131 (mthfr c.1298ac) required higher mtx concentrations in order to inhibit 50% of the control ts activity ex vivo. these results suggest that the aa genotype of rs1801131 tends to develop more adverse events, which corresponds to our results. significant correlations of polymorphisms in slco1b1 and mtx eliminations were discovered by the gwas study, which mostly consists of ancestry of european or african descent and a small number of asian descent [20, 23 ]. these polymorphisms were not correlated to mtx concentrations at 48 hrs in our study population (p = 0.529 for rs11045879, p = 0.413 for rs4149056) (table 4). the differences might be caused from different protocols, ethnicity, or backgrounds, including supportive care or lifestyle and study design. we conducted an association study of polymorphisms (rs1801133 and rs1801131 of mthfr and rs11045879 and rs4149056 of slco1b1) and adverse events during hd - mtx treatment and prognosis in japanese childhood lymphoid malignancies. patients that carried polymorphisms of rs1801131 (mthfr c.1298ac / cc genotype) had not relapsed nor died. the ct / tt genotype of rs1801133 (mthfr c.677ct / tt genotype) resulted in higher serum hepatic enzyme and delayed administrations during weekly high dose mtx. relations of slco1b1 polymorphisms (rs11045879 and rs41490586) in japanese children were assessed for the first time and found to have no correlations with any adverse events, mtx concentrations or outcome. | backgrounds. outcome of childhood malignancy has been improved mostly due to the advances in diagnostic techniques and treatment strategies. while methotrexate (mtx) related polymorphisms have been under investigation in childhood malignancies, many controversial results have been offered. objectives. to evaluate associations of polymorphisms related mtx metabolisms and clinical course in childhood lymphoid malignancies. method. eighty - two acute lymphoblastic leukemia and 21 non - hodgkin 's lymphoma children were enrolled in this study. four single nucleotide polymorphisms in 2 genes (mthfr (rs1801133/c.677c > t / p.ala222val and rs1801131/c.1298a > c / p.glu429ala) and slco1b1 (rs4149056/c.521t > c / p.v174a and rs11045879/c.1865 + 4846t > c)) were genotyped by taqman pcr method or direct sequencing. clinical courses were reviewed retrospectively. results. no patient who had the ac / cc genotype of rs1801131 (mthfr) had relapsed or died, in which distribution was statistically different among the aa genotype of rs1801131 (p = 0.004). polymorphisms of slco1b1 (rs11045879 and rs4149056) were not correlated with mtx concentrations, adverse events, or disease outcome. conclusions. polymorphisms of mthfr (rs1801131) could be the plausive candidate for prognostic predictor in childhood lymphoid malignancies. |
diagnosis is one of the principal tasks of primary care, yet incident - reporting systems typically receive very low rates of diagnostic errors (1). more targeted techniques, such as record screening or interviewing gps about their most memorable errors have been more successful at identifying diagnostic error but have been retrospective in their approach (2,3). they can not recreate the diagnostic process that resulted in an error and can not reliably determine patient features at presentation, information elicited by the clinician (due to incomplete records and selective memory), other diagnoses considered, how clinical information was interpreted and what inferences were made at the time of the diagnosis (4). a us study of closed malpractice claims in the ambulatory setting estimated that cognitive factors (e.g. judgment errors, vigilance and memory lapses, lack of knowledge) were implicated in virtually all diagnostic errors, either alone (in 55% of errors) or in association with patient and / or system - related factors (5). a recent study of difficult diagnoses in general practice, funded by the uk department of health, identified information gathering as the most important determinant of diagnostic accuracy (6). in agreement with other studies, it found no effect of experience (years in practice) on diagnostic accuracy or the gathering of critical information, but did find that there was a reduction in the overall amount of information elicited with increasing experience (7,8). computerized diagnostic decision support systems (cddss) may be able to play an important role in assisting information gathering, yet previously, cddss required clinicians to either enter the clinical features observed or tick them off on a list in order to receive diagnostic suggestions. when (i.e. type of diagnostic problem, timing during the consultation) and what type of support would be useful. suggesting differential diagnoses at the start of the consultation (on the basis of the patient 's age / sex / risk factors and presenting complaint) is a fairly easy type of support to provide from a technical point of view, would not require clinicians to change their current practice nor the way that they record information, and could represent an easy means of implementing decision support. suggesting, would be to draw attention to important diagnoses that might otherwise be ignored. there is encouraging evidence that asking clinicians to engage in the systematic generation and testing of hypotheses can increase diagnostic accuracy in challenging problems without degrading performance in simple problems (9). a second type of support can be triggered at the end of the consultation, only when serious diagnoses have not been excluded. alerting has the advantage of being selective, and therefore more likely to be attended to by the clinician. the disadvantage is that it would be provided after the clinician has gone through the problem and made a diagnosis (i.e. after the problem has been mentally represented in a certain way) and this is known to be very resistant to restructuring and change (10). alerting is more resource - intensive in its development, as it will require gps to change the way that they record information collected during the consultation. complete and accurate recording of information would be needed for the support to be triggered effectively and be useful to the clinician. in this paper, we aimed to conduct a review of existing systematic reviews to assess the current consensus on how cddss can meet the requirements of supporting the cognitive task of diagnosis, and the currently perceived barriers that prevent the integration of cddss with electronic health record (ehr) systems. since several systematic reviews of the effect of electronic decision support systems have been conducted, and the purpose of this study was not to perform another review, but to synthesize the requirements for cddss, we chose to conduct a meta - review of existing systematic reviews and meta - reviews. an electronic search for journal articles was conducted in june 2012, spanning medline, embase, psycinfo and web of knowledge. two researchers (mn and bd) then independently reviewed the selected full text articles, to agree a final list. two researchers (bd and ok) then analysed the full text of shortlisted articles. common reasons for exclusion included non - systematic reviews of computerized dss effectiveness and reviews of cddss effectiveness in other areas of medical decision making (e.g., prescription). the resulting shortlist contained 32 articles (31 identified by electronic search) which were read for relevance. the repeat search in december 2014 identified a further 13 potentially eligible papers, of which one was included (figure 1). we, therefore, were unable to comment exclusively from either a diagnostic or a primary care perspective, but have where possible identified in table 1 the number of cddss studies as opposed to other types of decision support (order entry, guidelines, etc.). our results suggest that there are four significant challenges to be met if a fully integrated cddss is to be realized. first, a more standardized computable approach to knowledge representation is needed, and second, one that can be readily updated as new knowledge is gained. third, a deep integration with the ehr is needed in order to trigger at appropriate points in cognitive workflow, this latter being the final challenge. the current barriers are a failure to use dynamic vocabulary tools, which are able to capture and code relevant diagnostic findings, integrate these with the ehr and coupling these with an individualized diagnosis made by the physician. ahmadian. have examined the role of standardized terminologies in dss (11). they found that systems that used standard terminologies (such as icd, snomed - ct) were more likely to be integrated with an ehr system than stand - alone systems. the terminology used needs to be sufficiently fine - grained and unambiguous as to adequately represent the decision rule and allow reasoning with the clinical data. this is potentially much more complex than for clinical workflow applications. in particular, the uncertainty and challenges posed by the representation and management of a variety of complex diagnostic problems sit at the intersection of dss and computational intelligence provided by agent - based technology (12). a demonstration of that potential has been successfully shown in the eu fp6 ist healthagents project (ist200427214) (13). this focused on the development of a distributed, agent - based dss, which implemented a series of automated classifiers based on pattern recognition methodologies for the diagnosis and prognosis of brain tumours. the implication of maintaining ontology for computerized diagnostic dss is that work will need to be done to add new problems. (15), both make the point that not only are cddss complex interventions where the net effect is the product not just of the technology but of its uptake and use, but also that the effectiveness of the cddss will vary according to the condition studied. semantic interoperability with the her standards and granularity issues. to achieve the full potential of cddss, the reason for this is that double entry of data is a complete barrier to the uptake of cddss. ahmadian. also found that cddss that used standards for the representation of semantic concepts were more likely to be integrated (11).. carried out a regression analysis of predictors of effectiveness in cddss studies, where significant factors included automatic triggering of reminders at the point of care, integration with the ehr, a direct recommendation for care and requisite reason to bypass (17). this finding was replicated by garg., who also found that suggesting was more effective than critiquing (16). common reasons for exclusion included non - systematic reviews of computerized dss effectiveness and reviews of cddss effectiveness in other areas of medical decision making (e.g., prescription). the resulting shortlist contained 32 articles (31 identified by electronic search) which were read for relevance. the repeat search in december 2014 identified a further 13 potentially eligible papers, of which one was included (figure 1). we, therefore, were unable to comment exclusively from either a diagnostic or a primary care perspective, but have where possible identified in table 1 the number of cddss studies as opposed to other types of decision support (order entry, guidelines, etc.). our results suggest that there are four significant challenges to be met if a fully integrated cddss is to be realized. first, a more standardized computable approach to knowledge representation is needed, and second, one that can be readily updated as new knowledge is gained. third, a deep integration with the ehr is needed in order to trigger at appropriate points in cognitive workflow, this latter being the final challenge. the current barriers are a failure to use dynamic vocabulary tools, which are able to capture and code relevant diagnostic findings, integrate these with the ehr and coupling these with an individualized diagnosis made by the physician. ahmadian. have examined the role of standardized terminologies in dss (11). they found that systems that used standard terminologies (such as icd, snomed - ct) were more likely to be integrated with an ehr system than stand - alone systems. the terminology used needs to be sufficiently fine - grained and unambiguous as to adequately represent the decision rule and allow reasoning with the clinical data. this is potentially much more complex than for clinical workflow applications. in particular, the uncertainty and challenges posed by the representation and management of a variety of complex diagnostic problems sit at the intersection of dss and computational intelligence provided by agent - based technology (12). a demonstration of that potential has been successfully shown in the eu fp6 ist healthagents project (ist200427214) (13). this focused on the development of a distributed, agent - based dss, which implemented a series of automated classifiers based on pattern recognition methodologies for the diagnosis and prognosis of brain tumours. the implication of maintaining ontology for computerized diagnostic dss is that work will need to be done to add new problems. (15), both make the point that not only are cddss complex interventions where the net effect is the product not just of the technology but of its uptake and use, but also that the effectiveness of the cddss will vary according to the condition studied. semantic interoperability with the her standards and granularity issues. to achieve the full potential of cddss, the reason for this is that double entry of data is a complete barrier to the uptake of cddss. ahmadian. also found that cddss that used standards for the representation of semantic concepts were more likely to be integrated (11).. carried out a regression analysis of predictors of effectiveness in cddss studies, where significant factors included automatic triggering of reminders at the point of care, integration with the ehr, a direct recommendation for care and requisite reason to bypass (17). this finding was replicated by garg., who also found that suggesting was more effective than critiquing (16). the literature on computerized cddss for medical diagnosis is sparse compared with the evidence - base that supports guideline reminders, prompts, prescribing support and other aspects of decision support. our literature review was a meta - review of existing systematic reviews, the focus of which was to elicit requirements for the future development of cddss, and is not reported as a new systematic review. however, we were able to identify four key requirements for the development of future cddss. these findings must be tempered by the fact that very few of the decision support systems in the reviews were diagnostic in nature, and, given the nature of the reviews, it is impossible to separate out solely primary care cddss. we did not sift out the different original papers from the source systematic reviews, but they were a very heterogeneous group, consisting of a variety of clinical problems and different specialist settings. risk of bias assessment is difficult in a meta - review, and must rely on appropriate methods in the source reviews. unfortunately, the extreme heterogeneity of source studies precluded narrative synthesis in these systematic reviews, and we are unable to make further comment on the potential for bias. there is an urgent requirement to study primary care cddss in carefully designed randomized studies with diagnostic accuracy and patient outcomes. we take the view that for computerized diagnostic decision support systems to be effective they need to be automatic ; linked seamlessly to the ehr and to its knowledge engine, and to give prompts and reminders at timely points in the decision - making process. the system needs to offer an advantage to clinicians over and above the ability to generate safety - critical diagnostic alerts. with increasing litigation against general practitioners, and more than half of all claims being related to diagnostic error, there would be considerable enthusiasm for a system that was able to utilize the dynamic vocabulary tools to quickly capture and code relevant diagnostic findings, and couple these with an individualized diagnosis based on the best - available evidence (19). this information would be inserted into the ehr far faster and more accurately than via most ehr interfaces. in addition, the more richly coded information would be ideal material for enrichment of clinical prediction rules via knowledge mining techniques. a primary care focussed dss would then enable either suggesting or alerting functions, or both to be built into the ehr system. a recent study has shown that, with simulated cases, suggesting can improve diagnostic accuracy over unaided decision making, whilst alerting had no benefit. there are significant opportunities offered by technical and informatics advances in the past few years that may finally allow for the development of effective computerized diagnostic decision support. these include the development of the semantic web and standards for representing knowledge in a computable way (21). the pervasive availability of information in a machine - processable format, and the ability to link to devices wirelessly, means that we should no longer consider the ehr as a static, desk - bound system but rather as a knowledge - manager (22). this is important as it will eventually lead to a shift in professional and market place expectations of the role of ehr systems (23). | abstract background : computerized diagnostic decision support systems (cddss) have the potential to support the cognitive task of diagnosis, which is one of the areas where general practitioners have greatest difficulty and which accounts for a significant proportion of adverse events recorded in the primary care setting. objective : to determine the extent to which cddss may meet the requirements of supporting the cognitive task of diagnosis, and the currently perceived barriers that prevent the integration of cddss with electronic health record (ehr) systems. methods : we conducted a meta - review of existing systematic reviews published in english, searching medline, embase, psycinfo and web of knowledge for articles on the features and effectiveness of cddss for medical diagnosis published since 2004. eligibility criteria included systematic reviews where individual clinicians were primary end users. outcomes we were interested in were the effectiveness and identification of specific features of cddss on diagnostic performance. results : we identified 1970 studies and excluded 1938 because they did not fit our inclusion criteria. a total of 45 articles were identified and 12 were found suitable for meta - review. extraction of high - level requirements identified that a more standardized computable approach is needed to knowledge representation, one that can be readily updated as new knowledge is gained. in addition, a deep integration with the ehr is needed in order to trigger at appropriate points in cognitive workflow. conclusion : developing a cddss that is able to utilize dynamic vocabulary tools to quickly capture and code relevant diagnostic findings, and coupling these with individualized diagnostic suggestions based on the best - available evidence has the potential to improve diagnostic accuracy, but requires evaluation. |
in may 2009, a 7-year - old female dog was admitted to a veterinary clinic in bijilo, the gambia, for elective ovariohysterectomy. the owner of the dog, a snake farm operator, reported late abortions during several pregnancies of the animal. the dog had been kept on the farm premises, where adult snakes (african rock pythons, python sebae) had died several months before of infection with adult a. armillatus pentastomes (figure 1, panel a). during the dog s surgery, hundreds of pentastomid larvae were seen on the enteral serosa, bladder, uterus, and in the omentum (figure 1, panels b, c). in april 2010, a male stray dog, 6 months of age, was admitted to the veterinary clinic for elective neutering. adult and larval parasite specimens were preserved in 100% ethanol for further parasitologic, histologic, and molecular examinations. a) ventral view of 2 adult a. armillatus parasites recovered from the lungs and trachea of a deceased rock python ; a gravid female (bottom) and a pre - adult female (top) are shown. the parasites showed 20 and 18 marked body rings, and had a length of 10 cm and 9 cm and a body width of 58 mm and 35 mm, respectively. b) heavily parasitized omentum of a female stray dog, showing typical encapsulated c - shaped larval stages of a. armillatus parasites. the larvae had a length of 1819 mm and a body width of 2 mm and showed 2022 rings. scale bars = 1 cm. to investigate the extent of infection and determine whether transmission to humans on the snake farm grounds had occurred, we collected serum specimens from the 46-year - old male caucasian snake farm owner, his 28-year - old wife, his 3 children, and the infected female dog. serum samples were transferred to the institute of hygiene and microbiology (university of wrzburg, wrzburg, germany) for analysis by elisa and western blot based on larval parasite antigens. dna of the pentastome specimens (2 adults from the snakes, 1 larva from each dog) was extracted by using the qiagen tissue kit (qiagen, hilden, germany) and subjected to 18s rrna and cytochrome c oxidase (cox) gene pcr with primers pent629f (5-cggttaaaaagctcgtagttgg-3) and pent629r (5-ggcatcgtttatggttagaactaggg-3) and primers cox1-f (5-ctgcgacaatgactattttcaac-3) and cox1-r (5-atatgggaagttctgagtagg-3). after sequencing and blast (www.ncbi.nlm.nih.gov/blast) analysis of the partial 18s rrna gene amplicons, the sequences showed high homology with a. agkistrodontis and porocephalus crotali parasites. however, no a. armillatus 18s rrna gene entry existed in genbank ; cox gene sequences showed high homology with a. armillatus, followed by a. agkistrodontis. the 4 amplified partial 18s rrna gene sequences were 100% identical, as expected for the same species, but heterogenicity was seen in the cox sequences (99.7% identity). when phylogenetic trees were constructed, the nearest neighbor of a. armillatus was a. agkistrodontis in both models for both genes, followed by p. crotali and linguatula serrata (18s rrna only as no cox entry existed). all pentastomes analyzed clustered together and formed their own branch, with argulus sp. being the nearest maxillopodan / branchiuran neighbor in both models by using 18s rrna sequence data, and speleonectes tulumensis (remipedia) crustaceans when cox sequences were used (figure 2). the 18s sequence of a. armillatus was submitted to genbank (accession no. molecular phylogeny of 4 armillifer amillatus specimens based on partial 18s rrna and partial cytochrome c oxidase (cox) gene sequences. panels a and c show cladograms based on maximum - likelihood (ml) ; panels b and d show minimum - evolution (me). in the cladograms, the approximate likelihood ratios are given next to the branches to indicate the statistical support for the respective branches. in panels b and d, the percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown next to the branches, and the evolutionary distances are given as scale bars as the number of base substitutions per site. the phylogram of the partial 18s rrna sequences (b) depicts respective host species for the parasitic pentastomida., reighardia sternae, and hispania vulturis belong to the order cephalobaenida, whereas snake parasites armillifer spp. and porocephalus spp. and dog parasites linguatula spp. note that not all species have entries for 18s rrna and cox genes in genbank. genbank accession numbers of the species depicted can be found in the table (table). muscle (www.ebi.ac.uk/tools/muscle/index.html) and revtrans 1.4 (www.cbs.dtu.dk/services/revtrans/) were used for the alignment of partial 18s rdna and cox sequences, respectively. ml analyses of the 18s rdna sequences were performed with phyml 3.0 (http://atgc.lirmm.fr/phyml/) under the tn93 + i + substitution model (6 rate classes and nni algorithm for tree searching). ml analyses of the cox sequences were performed under the generalized time reversible + i + substitution model. approximate likelihood ratios were used to estimate the branch supports of the inferred ml phylogeny, which was visualized with treegraph2. mega4 (www.megasoftware.net) was used for me analysis of the 18s rdna sequences under the tn93 + i + substitution model, and with maximum composite likelihood for cox sequences. the close neighbor interchange algorithm was used for tree searching, with pair - wise deletion of sequence gaps and considering differences in the substitution pattern among lineages. the crude parasite antigen elisa was set up in a similar manner to an in - house echinococcus multilocularis elisa (11) by using larvae from the canine omentum. because no serum specimens from persons with proven armillifer spp. infections were available as positive controls, a stored serum sample was used from a patient with a histologically confirmed l. serrata infection (12). ten serum samples from healthy german blood donors served as negative controls, and a standardized threshold index of 1.0 was calculated (11). in addition, the serum of the infected female dog was tested, as well as 10 serum samples from uninfected dogs from germany. the crude larval antigen was also used in a western blot (2 g / slot), and all serum samples from the gambia and the serum sample from the linguatula spp.infected patient were analyzed. of the serum samples tested, only the serum sample from the snake farm owner was positive for pentastomiasis in the elisa, index 1.2. the control serum sample from the patient with linguatuliasis exhibited an index of 1.3. when tested by western blot, the serum of the farm owner demonstrated a banding pattern similar to the l. serrata positive control serum. both serum samples exhibited 97-kda and 37-kda bands, and the serum from the patient with linguatuliasis had an additional 50-kda band (not shown). when dog serum samples were tested, only the sample from the gambia showed a positive reaction in the elisa, with an index of 1.0. pentastomiasis is a parasitic zoonosis with an increasing number of recognized human infections in west africa. our investigation highlights the local transmission of infective a. armillatus ova to dogs and, by serologic evidence, also to 1 human, and thus demonstrates a public health concern. possibly because of their eating habits (e.g., consumption of dead snakes), dogs seem to be at high risk and could function as sentinel animals. in this study, we set up serologic assays for pentastomiasis based on raw larval a. armillatus antigens and screened the farm workers for past infection. the infection of 1 person, the snake farm owner, could be demonstrated by elisa and western blot for human serum samples. in 1982, an indirect immunofluorescence assay based on a. armillatus larvae was used for a survey in the ivory coast ; results indicated a low seroprevalence (13). in most human cases, pentastomiasis is asymptomatic and is an incidental finding during surgery or autopsy, and diagnosis largely relies on parasitologic and histopathologic examination (2,14,15). recently, pcrs have been developed for canine pentastomiasis (9), but dna sequences in the databases are limited to a few species of pentastomes only. we have provided partial 18s rrna gene sequences of a. armillatus pentastomes and used pcr for the diagnosis of pentastomiasis from a clinical sample (9). we also constructed phylogenetic trees for all pentastome species infecting humans and animals from which sequence data were available. phylogenetic analysis showed that pentastomes formed their own branch in proximity to the branchiura and remipedia, a finding which is consistent with results of a previous study by others who investigated a. armillatus as a sole member of the pentastomes in comparison with pancrustaceans (1). the nearest phylogenetic relatives of a. armillatus are a. agkistrodontis and p. crotali, 2 species of the porocephalida, followed by l. serrata and by the members of the cephalobaenida (pentastomes that infect birds). the phylogenetic trees constructed here indicate a coevolution of the pentastomes and other maxillopodan / branchiuran parasites with their vertebrate hosts (birds, snakes, mammals, and fish). we demonstrated that the serum of a patient with linguatuliasis markedly cross - reacted on the elisa and western blot based on armillifer spp. personal hygiene measures were implemented, such as thorough hand cleansing after handling snakes and avoidance of contact with snake excretions. public health institutions have been informed, and future studies will address the extent of seroprevalence in the local population. | visceral pentastomiasis caused by armillifer armillatus larvae was diagnosed in 2 dogs in the gambia. parasites were subjected to pcr ; phylogenetic analysis confirmed relatedness with branchiurans / crustaceans. our investigation highlights transmission of infective a. armillatus ova to dogs and, by serologic evidence, also to 1 human, demonstrating a public health concern. |
the mechanisms involved in the generation of migraine attack are probably multifactorial and are not fully understood. the neurogenic inflammation is generated by the release of neuropeptides such as calcitonin gene - related peptide (cgrp) from trigeminal neurons terminals and leads to inflammation with the release of cytokines such as interleukin-6 (il-6) and tumor necrosis factor - alpha (tnf-). some studies demonstrated elevated levels of these cytokines in jugular vein during acute migraine attacks, however, there were discrepant results with respect to the determination of serum levels of cytokines in migraine patients [36 ]. brain - derived neurotropic factor (bdnf) is a neurotrophin that has been implicated in the generation and modulation of pain. some studies have found that bdnf levels are altered in migraine patients when compared to controls. therefore, it is unknown whether there is any change in the serum level of bdnf during migraine attacks. the aim of this study was to investigate the levels of tnf-, soluble tnf receptors 1 and 2 (stnf - r1 and stnf - r2), and bdnf during migraine attack and in headache - free period in adult patients with episodic migraine. nine patients with established diagnosis of episodic migraine without aura were included in this study. the diagnosis of migraine was done by a headache specialist according to the international headache criteria. all patients signed informed consent form before inclusion in the study and this study was approved by the local ethics research committee. the impact of migraine was evaluated with migraine disability assessment (midas) and headache impact test (hit). the first evaluation was during a migraine attack when the patients sought medical attention. at this time the second evaluation was performed 1 week later if the patient reported to be completely pain free in the last 72 h. in both evaluations blood samples were collected for the determination of serum markers. serum was separated within 30 min and the supernatant was stored at 70c until required. for analysis, samples were thawed. the concentration of tnf-, stnf - r1, stnf - r2 and bdnf in serum of migraine patients with and without pain was assessed by using sandwich elisa kits (highly sensitive r&d systems, for tnf- and duo set r&d systems minneapolis, mn, usa, for stnf - r1, stnf - r2 and bdnf). the detection limits for these assays were 0.5 pg / ml for tnf- and 5.0 pg / ml for stnf - r1, stnf - r2 and bdnf. wilcoxon signed - rank test was used for comparison of tnf-, stnf - r1, stnf - r2, and bdnf concentrations from the patients during the migraine attack and in the pain - free period. spearman correlation test was used to evaluate correlation between age, time of migraine, midas, hit, and vas with serum tnf-, stnf - r1, stnf - r2, and bdnf concentrations. all the calculations were performed using graphpad prism version 4.00 for windows software (graphpad software inc., san diego, ca, usa). nine patients with established diagnosis of episodic migraine without aura were included in this study. the diagnosis of migraine was done by a headache specialist according to the international headache criteria. all patients signed informed consent form before inclusion in the study and this study was approved by the local ethics research committee. the impact of migraine was evaluated with migraine disability assessment (midas) and headache impact test (hit). the first evaluation was during a migraine attack when the patients sought medical attention. at this time the second evaluation was performed 1 week later if the patient reported to be completely pain free in the last 72 h. in both evaluations blood samples were collected for the determination of serum markers. serum was separated within 30 min and the supernatant was stored at 70c until required. for analysis, samples were thawed. the concentration of tnf-, stnf - r1, stnf - r2 and bdnf in serum of migraine patients with and without pain was assessed by using sandwich elisa kits (highly sensitive r&d systems, for tnf- and duo set r&d systems minneapolis, mn, usa, for stnf - r1, stnf - r2 and bdnf). the detection limits for these assays were 0.5 pg / ml for tnf- and 5.0 pg / ml for stnf - r1, stnf - r2 and bdnf. wilcoxon signed - rank test was used for comparison of tnf-, stnf - r1, stnf - r2, and bdnf concentrations from the patients during the migraine attack and in the pain - free period. spearman correlation test was used to evaluate correlation between age, time of migraine, midas, hit, and vas with serum tnf-, stnf - r1, stnf - r2, and bdnf concentrations. all the calculations were performed using graphpad prism version 4.00 for windows software (graphpad software inc., san diego, ca, usa). sd midas and hit scores were 39.5 44.8 and 63.3 5.7, respectively. the intensity of pain during migraine attack period ranged from 5 to 10, the mean being 8.4 1.7. the comparison of tnf-, stnf - r1, stnf - r2 serum levels during migraine attack and during pain - free period are shown in fig. 1. there was no significant difference in tnf- (sum of signed ranks (w) 6.0), stnf - r1 (sum of signed ranks (w) 15.0), stnf - r2 (sum of signed ranks (w) 17.0) levels between these two periods (p > 0.05).fig. 1tnf, stnf - r1, and stnf - r2 serum levels in patients during migraine attacks and in headache - free periods tnf, stnf - r1, and stnf - r2 serum levels in patients during migraine attacks and in headache - free periods the comparison of bdnf serum levels during migraine attack and during migraine - free period is shown in fig. 1. bdnf serum levels were significantly increased during migraine attack period (sum of signed ranks (w) 43.0 ; p = 0.008). age, length of disease, midas, hit and vas scores did not correlate with tnf-, stnf - r1 and stnf - r2 levels during migraine attack or in the headache - free period. serum levels of bdnf were inversely correlated with the headache (r = 0.6325, p = 0.043). cytokines are pain mediators and it is believed that they are implicated in neurovascular inflammation resulting in migraine pain. in this study, we found no significant differences in the serum levels of tnf-, stnf - r1, and stnf - r2 during migraine attack and attack - free period and no correlation between these cytokines and clinical parameters. other studies have also investigated tnf- level during and outside migraine attacks with contradictory results. while some studies found no difference in tnf- serum levels [3, 4 ], others described increased levels of tnf- during migraine attack. regarding that tnf- is an unstable molecule with a reduced half - life, several authors assess its soluble receptors as an index of tnf- activity. found decreased levels of stnf - r1 during migraine attack, suggesting that this would result in less buffer capacity for locally released hyperalgesic tnf-. in contrast, we found no difference in the serum levels of stnf - r1 and stnf - r2 levels during migraine attacks, undermining the view of increased tnf- activity during headache period. future studies are needed to better establish the role of tnf- in the generation of migraine attack. there is little evidence that bdnf levels are altered in migraine patients and that bdnf gene polymorphisms are related with genetic susceptibility to migraine [8, 13 ]. in this study, there was an increased serum level of bdnf during migraine attack when compared to headache - free period. besides its neurotrophic function, bdnf is a pain modulator acting in the efficiency of glutamatergic and gabaergic / glycinergic synapses. also, bdnf is in involved in the pathogenesis of migraine comorbidities such as epilepsy and depression. the precise role of bdnf in epilepsy is not fully understood but bdnf infusion has been shown to induce seizures and scavenging bdnf in vitro appears to reduce kindling development. considering that an imbalance between excitatory glutamate - mediated transmission and gaba - mediated inhibition has been postulated in migraine pathogenesis and that bdnf has been shown to modify excitability, it is possible that increased bdnf concentration may participate in the generation of migraine attack. moreover, bdnf was recently shown to intermediate an increase of cgrp p2x3 receptor synthesis. the increase in the expression of p2x3 receptor would enhance the effect of released cgrp in triggering neurogenic inflammation. we did not the phase of menstrual cycle the female patients were when the blood was collected. these results need to be confirmed in future studies with a more conspicuous number of patients and with a more controlled definition of the time of blood sampling both during the ictal and interictal period. to the best of our knowledge, this is the first report to show that bdnf level is increased during migraine attack and that it is inversely related with headache intensity. the relevance of bdnf in migraine is possibly related with cgrp action. currently, there are two cgrp antagonists being tested for migraine attacks in phase ii and phase iii studies, olcegepant and telcagepant [2, 16, 17 ]. it is extremely important to investigate if neurotropic factors production is influenced by the use of these new drugs. also, future studies should evaluate these molecular mediators in different types of migraine, the effects of prophylactic therapy, and the impact of migraine comorbidities such as depression and anxiety on the levels of these mediators. a better knowledge of the relevance of molecular mediators of migraine as well as their central and peripheral actions may provide clues to the development of future new drugs directed to different targets of the migraine pathophysiologic process. | there is a growing body of evidence implicating inflammatory cytokines and brain - derived neurotropic factor (bdnf) in the generation of migraine pain. no previous study evaluated bndf levels during migraine attacks and there are conflicting results regarding tumor necrosis factor - alpha (tnf - alpha) serum levels. this study compared serum levels of tnf - alpha, soluble tnf receptors 1 and 2 (stnf - r1 and stnf - r2), and bdnf during migraine attacks and in headache - free periods. nine patients with episodic migraine were clinically evaluated during a migraine attack and in a headache - free period. blood sample of each patient in both occasions was collected and all serum was submitted to tnf - alpha, stnf - r1, stnf - r2, and bdnf determination by elisa. there was no significant difference in the serum levels of tnf - alpha, stnf - r1 and stnf - r2 in migraine attack period and headache - free period. bdnf serum levels were significantly higher during migraine attack than in pain - free period. this is the first report showing that bdnf serum levels increase during migraine attack. this reinforces the view that bdnf may be implicated in the physiopathology of migraine. |
iran is geographically located in the thalassemia belt, extending from the mediterranean basin through the middle - east, indian subcontinent, and the southeast asia. according to the available record, number of thalassaemia cases in this region is well over 150 million cases. in iran 26,000 cases of major thalassaemia have been officially documented, and the total estimated prevalence of this disorder is 24.91/100,000, which places iran in the list ofthe most affected countries in the world. the first screening program for prevention of thalassaemia was initiated in 1991 in the fars province located in the south of iran. the next major screening program formed in 1995 by the joint contribution and efforts of the iranian thalassaemia society and the iranian blood transfusion organization, where all the high - school students in tehran, the capital of iran, were screened for thalassaemia disorder in cooperation with the local high - schools. by 1996, under the direction of the genetic department of centre for disease control and prevention of the ministry of health (moh) and guidance of an academic advisory committee, screening for the identification of this disorder became a national program. the initial national prevention program included : (1) pre - marital screening ; (2) counseling parents with thalassaemic children ; (3) evaluating the impact of thalassaemia on individuals who married before the implementation of the national screening program. in 2003, genetic counseling for at - risk couples at the time of pregnancy was added to the program. for example, while abortion for any reason was illegal and prohibited in iran as a muslim country but the islamic clergies declared a fatwa to permit the abortion of homozygote beta - thalassaemic fetuses, even after 16 weeks of gestational age. another protective measure of the program, which led to nearly 80% decrease in the incidence of major beta - thalassemia within the first eight years include prohibition of marriage in couples where both parents were the carriers of thalassaemic trait. west - azerbaijan is located in the north west of iran neighboring three countries including iraq, turkey, and the republic of azerbaijan. in 2006 the province had a population of 3,015,361 people. the thalassaemia pre - natal screening program in west - azerbaijan has used two prong strategies to prevent major beta - thalassemia ; retrospective and prospective. for the retrospective component families who already were known as carriers for thalassemia were identified and provided with frequent counseling and education. in the prospective phase, which is depicted in figure 1, couples who wish to register their marriage blood samples are checked for complete blood count (cbc) and red blood cell indices with an automatic cell counter. the premarital certificate is issued if the mean corpuscular haemoglobin (mch) is 27pg and the mean corpuscular volume (mcv) is 80fl. otherwise, the blood sample of the couple will be studied with column chromatography to determine the level of hemoglobin (hba2). pre - natal screening program in iran individuals with an hba2 3.5% but 7%, they will be scheduled to received further tests (i.e. cellulose acetate electrophoresis at ph 8.4 for hbs, hbg, hbe, hbc and /-thalassaemia differentiation). the disease and its consequences and possible options (including canceling the marriage, or proceeding with the marriage plan while accepting not to conceive a child) are then discussed with each of the carrier couples. on the other hand, couples who decide to go forward with the marriage plans and happen to conceive a child will receive prenatal screening and are offered elective abortion in cases where fetus is affected. one located in tehran and the other in fars, a province in the southern region of iran. both centres are far from the west - azerbaijan province, therefore, couple 's access to prenatal screening for thalassaemia is limited. some evaluations demonstrated the prenatal screening for thalassaemia to be cost - effective.[810 ] in cyprus, the annual cost of screening and prenatal diagnosis program was found to be almost equal to the cost of treatment of all existing patients for five years. considering the different results of cost analysis in different settings, in this study we aimed to evaluate the cost - effectiveness of the thalassaemia pre - natal screening program that has been took place in this province since 1996. the first screening program for prevention of thalassaemia was initiated in 1991 in the fars province located in the south of iran. the next major screening program formed in 1995 by the joint contribution and efforts of the iranian thalassaemia society and the iranian blood transfusion organization, where all the high - school students in tehran, the capital of iran, were screened for thalassaemia disorder in cooperation with the local high - schools. by 1996, under the direction of the genetic department of centre for disease control and prevention of the ministry of health (moh) and guidance of an academic advisory committee, screening for the identification of this disorder became a national program. the initial national prevention program included : (1) pre - marital screening ; (2) counseling parents with thalassaemic children ; (3) evaluating the impact of thalassaemia on individuals who married before the implementation of the national screening program. in 2003, genetic counseling for at - risk couples at the time of pregnancy was added to the program. for example, while abortion for any reason was illegal and prohibited in iran as a muslim country but the islamic clergies declared a fatwa to permit the abortion of homozygote beta - thalassaemic fetuses, even after 16 weeks of gestational age. another protective measure of the program, which led to nearly 80% decrease in the incidence of major beta - thalassemia within the first eight years include prohibition of marriage in couples where both parents were the carriers of thalassaemic trait. west - azerbaijan is located in the north west of iran neighboring three countries including iraq, turkey, and the republic of azerbaijan. in 2006 the thalassaemia pre - natal screening program in west - azerbaijan has used two prong strategies to prevent major beta - thalassemia ; retrospective and prospective. for the retrospective component families who already were known as carriers for thalassemia were identified and provided with frequent counseling and education. in the prospective phase, which is depicted in figure 1, couples who wish to register their marriage blood samples are checked for complete blood count (cbc) and red blood cell indices with an automatic cell counter. the premarital certificate is issued if the mean corpuscular haemoglobin (mch) is 27pg and the mean corpuscular volume (mcv) is 80fl. otherwise, the blood sample of the couple will be studied with column chromatography to determine the level of hemoglobin (hba2). pre - natal screening program in iran individuals with an hba2 3.5% but 7%, they will be scheduled to received further tests (i.e. cellulose acetate electrophoresis at ph 8.4 for hbs, hbg, hbe, hbc and /-thalassaemia differentiation). the disease and its consequences and possible options (including canceling the marriage, or proceeding with the marriage plan while accepting not to conceive a child) are then discussed with each of the carrier couples. on the other hand, couples who decide to go forward with the marriage plans and happen to conceive a child will receive prenatal screening and are offered elective abortion in cases where fetus is affected. currently, there are only two genetic counseling centres in iran. one located in tehran and the other in fars, a province in the southern region of iran. both centres are far from the west - azerbaijan province, therefore, couple 's access to prenatal screening for thalassaemia is limited. some evaluations demonstrated the prenatal screening for thalassaemia to be cost - effective.[810 ] in cyprus, the annual cost of screening and prenatal diagnosis program was found to be almost equal to the cost of treatment of all existing patients for five years. considering the different results of cost analysis in different settings, in this study we aimed to evaluate the cost - effectiveness of the thalassaemia pre - natal screening program that has been took place in this province since 1996. the conduct of this study was approved by the scientific review board of urmia university of medical sciences, iran. data for the evaluation of the second phase (prenatal screening) of the program (2002 - 2006) was obtained from the centre for disease control and prevention (cdc) of the ministry of health office. the following measures were used for program evaluation : the economic burden of thalassaemia is determined by the birth prevalence of the affected infants and the cost that is accrued to treat the infected individuals, to the point where they can be a healthy functioning member of the society. this cost was compared with the total cost of implementing the prevention program (conducting laboratory tests, etc.) among couples to detect the thalassemia trait. in this paper, descriptive and sensitivity analysis were used to provide a cost analysis of a thalassaemia prevention program in west - azerbaijan for the period between 2002 - 2006. sensitivity analysis was applied for cost evaluation and the descriptive analysis was used for other items. the following measures were used for program evaluation : the economic burden of thalassaemia is determined by the birth prevalence of the affected infants and the cost that is accrued to treat the infected individuals, to the point where they can be a healthy functioning member of the society. this cost was compared with the total cost of implementing the prevention program (conducting laboratory tests, etc.) among couples to detect the thalassemia trait. in this paper, descriptive and sensitivity analysis were used to provide a cost analysis of a thalassaemia prevention program in west - azerbaijan for the period between 2002 - 2006. sensitivity analysis was applied for cost evaluation and the descriptive analysis was used for other items. according to the centre for disease control and prevention of the iran 's ministry of health (moh), 112 patients with major thalassaemia have been registered until 2006. of these patients, 46 (41%) were diagnosed / identified after the introduction of the thalassaemia prevention program. the program 's minimum coverage rate was reported at 63% in 2003 and its maximum coverage reached 90% in the year 2006. program coverage rate in iran (2002 - 2006) for the same period (2002 - 2006), the average rate of marriage cancellation among the carrier couples was reported at 53%, with the minnimum rate of 38% in 2003 and the maximum rate of 69% in 2006 [figure 3 ]. rate of canceling marriage among iranian carrier couples moreover, the average annual incidence rate of major thalassaemiais reported at 19.8 cases per 100,000 live births with the highest rate being 28/100,000 live births during 2003 [figure 4 ]. the 10-year incidence rate of major thalassaemiasince the introduction of the thalassaemia prevention program in west - azerbaijan was 46 cases of which 32 (70%) were born during the first five years of the thalassaemia prevention program. the incidence rate of major thalassemia per 100,000 live births (2002 - 2006) due to the lack of availability of the prenatal diagnostic (pnd) test for major thalassaemia in west - azerbaijan province the suspected individuals were directed to the referral centres (tehran). only six couples received the genetic counselling and none of them undergone cvs (chorionic villus sampling). of the six couples, only one affected fetus with major thalassaemia (17%) was detected, which subsequently was aborted once legal permission was obtained. the life - time cost of optimum treatment in developed countries has been estimated about 1,350,000 usd (un - subsided) per patient. this includes the cost of blood transfusions, medications, the essential treatments, hospital care and home visits. thalassaemic patients receive red blood cell transfusions every 2 - 3 weeks, amounting to approximately 24.6 liters of blood a year. in iran, 50 - 60% of all donated blood each bag of blood costs the country 's blood transfusion organization at least 25 usd. desferrioxamine is not manufactured in iran and importing a 500 mg vial of the drug costs about 3 usd. a 12-year - old, 30 kg patient treated with regular blood transfusion requires three vials daily throughout his life. this, in addition to the cost of disposable syringes and scalp - vein needles, which is about 3,360 usd per year and the cost of infusion pump, which is about 400 usd, adds up to approximately 3,760 usd per case, annually. very few people can afford receiving optimum care, therefore, considering that government - funded healthcare coverage is limited, many thalassaemic patients die immaturely.[1315 ] table 1 depicts the estimate cost of treating a thalassaemia patient. the estimate cost of treating a thalassaemia patient in iran considering that the cost of providing optimum care for a thalassaemic patient can add up to 6,500 usd per year -based on the aforementioned data, therefore the cost of care for 46 such patients can escalade to approximately 300,000 usd annually, and 3 million usd for a ten - year program. on the other hand, the cost of preventing similar cases based on the aforementioned data, would roughly add up to 4600 usd. in addition, it is estimated that 235 cases could have been prevented just by conducting screening program and couple consulting. considering the costs provided by moh, the total cost of caring for 235 cases could catch up to 15,275,000usd in 10 years. during first ten years of implementation of the thalassemia screening program, almost 44,500 people in urmia, were screened for thalassemia before the marriage. this costs almost 4,450,000 usd which should be added to the above mentioned three million dollars (the cost of optimum care for 46 thalassemia cases occurred against the implementation of prevention program). according to the sensitivity analysis, 7,825,000 usd was saved during ten years since 1997 until 2006 by preventing 235 major thalassemia cases to be occurred. we found that the total cost of preventing one case of thalassemia (100 usd) is less than a single year of optimum treatment for a case with major thalassemia (6500 usd). furthermore, the cost of screening the population (44,500 people) in addition to the cost of optimum care for the 46 major thalassemia patients (i.e. those who were born against the implementation of the prevention program) can reach up to 7,450,000 usd which is extremely lower than the cost of optimum care for 235 potential thalassemia cases who may be born in the absence of prevention program. thus the thalassemia prevention program is demonstrated to be quite cost - effective. all the new cases of thalassaemia (46 cases) in the period between 1996 - 2006 were identified in patients with family history of thalassaemia. of the new cases, this couple were married a year prior to the initiation of the program and were worried about having a child with major thalassaemia. although the result of their genetic test showed no risk of major thalassaemia, their child became a major case. parents non - compliance with the recommended prevention measures is often responsible for the new cases of major thalassaemia. these are parents who lack access to appropriate health insurance to cover the cost of pnd tests. in west - azerbaijan pnd is not yet available to every family suggesting a need to prioritize access to comprehensive health insurance at least to all the at - risk parents in this region. currently, only a few health care plans offer comprehensive coverage for screening and diagnosis of thalassaemia to the at -- risk families, but couples have to travel to the capital (i.e. tehran) to receive the tests. the thalassaemia prevention screening program has been successful in cyprus where screening is mandatory although prenatal diagnosis is optional. in turkey, the results of a four - year premarital screening program demonstrates that the counseling services for the carrier couples, the prenatal diagnosis, and the termination of pregnancy in cases of an affected fetus were successful in preventing major thalassemia. similar prevention measures have resulted in successfully curbing thalassaemia in saudi arabia. in these countries, except in cyprus, at- risk couples are mandated by law to call off their weddings. in northern sardinia, due to appropriate education, compliance for the prenatal diagnosis increased from 87% to 96%. a report from italy notes an increase in pnd among couples with minor thalassaemia. there were no significant relationship between sampling for pnd and such outcomes. in our study, only one couple was identified with major thalassaemia via pnd. in conclusion, the thalassaemia prevention program including a premarital and pre - natal screening has been cost - effective in west - azerbaijan province of iran. this study demonstrates that the costs of detection of high - risk couples or an affected fetus and termination of pregnancy are quite cheaper than the cost of full treatment of a major thalassaemia case. | background : thalassaemia is one of the most common mendelian disorders in mediterranean area. iran has about 26,000 thalassaemic patients, so it is one of the most affected countries. the aim of this study was to evaluate the screening program and cost analysis of thalassaemia prevention program in west - azerbaijan province of iran.methods:this study evaluated the efficacy of health system 's thalassaemia prevention program with a sensitivity analysis for its costs. the second five years of the program was evaluated. the economic burden of thalassaemia is determined by the birth prevalence of the affected infants and the cost that is accrued to treat the infected individuals and was compared with the total cost of screening the couples for thalassemia trait.results:the average incidence rate of major thalassaemia was 19.8 per 100,000 live births and mean coverage rate of program was 74%. the rate of canceling the marriage among carrier couples was 53%. cost analysis showed that the cost of screening and prenatal diagnosis program was much lower than the cost of treatment in potential thalassaemic patients.conclusions:the prevention program of thalassaemia including a premarital and pre - natal screening in west azerbaijan province is demonstrated to be cost - effective. taking some actions in order to increase the coverage of pre - marital screening, providing pre - natal diagnosis in private and public sector, complete insurance coverage for the high - risk couples to perform the investigations more easily, were recommended. |
as an occupation or past - time, fishing is widely practiced around the world. however, surprisingly, despite such extensive prevalence, injuries to the eyes from fish - hooks are rarely reported. a literature search provided less than a dozen cases of fish - hook injuries to the ocular structures. so far, there has been no reported case of actually using the cut - it - out technique for fish - hook removal, even though, it is reported in the literature as an option. thus, this case report focuses on a rather uncommon, though devastating form of injury and on an unusual technique to manage this situation. when they do occur, they can be associated with corneal lacerations and scars, traumatic cataracts, choroidal hemorrhage, vitreous hemorrhage, retinal detachment, and even endophthalmitis. once the fish - hook is impaled in the ocular structures, extraction can become a challenge for the attending surgeon. however, we report a case where the uncommon technique of cut - it - out was successfully employed to remove the fish - hook out of the patient 's eye. an 11-year - old boy was referred to our clinic with a history of injury to the right eye while fishing the day before. apparently while pulling the line, the fish - hook flew to the patient 's right eye and got embedded in the cornea. someone had cut the line and the dangling hook was taped to the cheek [figures 1 and 2 ]. patient on initial presentation the fish - hook on closer inspection on examination, the visual acuity was a perception of light (pl) ; with projection accurate in all quadrants in the affected right eye and 20/20 unaided vision in the left eye. the fish - hook had penetrated the cornea and impaled itself in the deeper tissues. there was a settled hyphema and the deeper tissues were obscured by it and corneal edema. a written consent was obtained from the parents for the removal of the fish - hook under general anesthesia. we planned to use the commonly employed method of advancement of the fish - hook tip outside the cornea and snipping off the tip with wire cutters. however, during the surgery, we found the hook stuck firmly to the underlying tissues. the hyphema and edema were making visualization impossible. on trying to pull the fish - hook out, it got stuck in the cornea. was then pushed in along the shank until the barb could be felt near the cornea. this was then used to guide the fish - hook out of the eye [figure 3 ]. a subconjunctival injection of dexamethasone and gentamicin was given to complete the procedure [figure 4 ]. the fish - hook on extraction immediate post - extraction appearance at 1 week of follow - up, the eye showed minimal inflammation [figure 5 ]. the vision was still pl ; with accurate projection of light in the affected eye. the damage to the iris at the pupillary margin and a traumatic cataract was visible. fishing is an occupation or hobby for a vast number of individuals across the globe. the coastline of malaysia itself extends for 4675 km and fishing is widely practiced here. however, surprisingly, ocular injuries from fish - hooks are rarely seen. a recent search of the literature provided just one report of two cases from malaysia. fish - hook injuries to the eye can involve the eyelids and the anterior- or posterior - segments. there are five methods mentioned for fish - hook removal from the para - ocular or ocular tissues. these include the following : (i) advance - and - cut technique. the hook is pushed forward until the tip and barb are outside the eye. subsequently, wire cutters are used to cut the hook between the barb and the bend. (ii) back - out or retrograde technique. in this method, the hook is removed by simply backing it out through the entrance wound. as the barb can inflict more ocular damage during this maneuver, it is employed only for barbless fish - hooks. this method is employed for removal of the fish - hook from non - ocular tissues. the barb is covered with the needle to prevent it from entangling in the tissues and both are then withdrawn together. (subsequently, the hook is backed out of the eye similar to the back - out technique. patients with fish - hook injuries usually have corneal lacerated wounds and penetration of the lens, leading to traumatic cataracts. in our patient also, the hook had entered the cornea and was stuck in the deeper structures. we also wish to perform a cataract extraction for our patient, once the inflammation subsides. as the cornea is usually involved in these injuries, the usual sequel is corneal scarring. unless extensive, other complications reported include choroidal and vitreous hemorrhages, retinal tears, and retinal detachments. endophthalmitis is also known to occur. in one patient, the endophthalmitis developed after three weeks of the injury. the cut - it - out technique for fish - hook removal is an ideal option in cases where visualization is difficult. ultimately, prevention is the key. | an 11-year - old boy was involved in an injury with a fish - hook to his eye. the hook had impaled itself to the cornea and deeper structures. there was associated corneal edema and hyphema, making visualization difficult. in this case, we performed the unusual cut - it - out technique to remove the hook from the eye. |
adaptive immunity is a highly differentiated biological system composed of b and t lymphocytes that play a critical role in the fight against infections and malignancies. appropriate function of the immune system critically depends on the fine - tuned control of signals from cell - surface receptors and their activation threshold governing downstream cellular events such as cell differentiation. the signaling threshold is vital for ensuring efficient cell activation, but only when required, such as upon pathogen invasion. diminished lymphocyte activation leads to a variety of immune deficiencies, whereas a lowered activation threshold can lead to autoimmune disorders and cancerogenesis, emphasizing the importance of refined mechanisms ensuring correct threshold for cell activation (tsubata, 1999 ; hermiston., 2003). emerging evidence implicates the actin cytoskeleton as a key regulator of cell signaling. the cellular cytoskeleton is a continuously remodeled dynamic network that provides force and support to cellular structures and also serves as tracks for vesicle and organelle movement. the actin cortex underlies the plasma membrane, where it has been traditionally thought to mainly act as support to the membrane. however, the cortical actin cytoskeleton is in intimate interaction with both lipid and protein components of the plasma membrane. indeed, cortical actin participates in various cellular events occurring proximal to the membrane, such as endocytosis, focal adhesions, and regulation of membrane protein diffusion and organization (le clainche and carlier, 2008 ; mooren., 2012 ; trimble and grinstein, 2015). the multifunctional and dynamic quality of actin impart it with characteristics that make it a potent mechanism for controlling and/or tuning receptor signaling ; this may be particularly important for receptors that need to be tightly regulated, such as immune receptors. indeed, mutations in genes that encode actin regulatory proteins are associated with human immunodeficiencies, such as wiskott - aldrich syndrome, underscoring the importance of the actin cytoskeleton in immune cell activation (derry., 1994 ; machesky and insall, 1998). in this review, we concentrate on recent studies examining the role of the actin cytoskeleton in controlling receptor triggering and cell signaling. we focus on the role of the cytoskeleton in regulating receptor compartmentalization, dynamics, and clustering. these parameters play a key role in defining the function of a protein, because they may facilitate or inhibit interactions with protein partners and thus regulate the cellular outcome of receptor engagement. we propose that actin serves as a critical point of integration of receptor signaling such that changes in the cytoskeleton induced by one signal can readily influence the function of other receptors. we frame this discussion largely in terms of the b cell receptor (bcr), for which recent studies have highlighted a striking role for actin in constraining bcr signaling. we discuss the implication of receptor cross talk with the cytoskeleton not only in the context of the low - level constitutive (tonic) signal necessary for b cell survival, but also as a mechanism to influence the threshold of activation. we posit that modulation of the actin cytoskeleton is a general mechanism for integrating cross talk between different signaling pathways. understanding the mechanisms how the cytoskeleton can control protein protein interactions to consequently regulate cell signaling may have broad implications for understanding human health and disease. as this review is focused on the role of the actin cytoskeleton in controlling receptor signaling, it is prudent to briefly introduce some of the key structures of the cytoskeleton and the mechanisms that regulate these structures, although this is by no means meant to be a comprehensive review of the cytoskeleton ; for this, we refer the reader to several excellent reviews (bezanilla., 2015 ; carlier., 2015 ; case and waterman, 2015 ; de la cruz and gardel, 2015). what we aim to highlight, and hope the reader will consider throughout this review, is that different actin - based structures may differentially modulate the steady - state organization and dynamics of membrane proteins, and although few of the studies discussed herein specifically define the actin features in relation to their data, we believe that this in an important consideration that may have significant implications for both the interpretation of data and the functional implications of the findings. the actin cytoskeleton broadly refers to actin - based cytoskeletal structures, encompassing a variety of functionally distinct structures of different actin organization and regulated by different actin regulatory proteins (fig. the actin cortex is composed of a dense mesh - like array of f - actin estimated to be between 50 nm and 2 m in thickness tangent to the plasma membrane and anchored to the cell membrane through interaction with both membrane proteins and lipids (bray and white, 1988 ; charras., 2006). of the cell, functioning to define cell shape and provide resistance to mechanical stress. lamellipodia refers to the sheet - like protrusive structure composed of branched f - actin and primarily involved in cell locomotion (small., 2002). the finger - like protrusions known as filopodia consist of long, straight, bundled f - actin and are thought to function as exploratory fingers for the cell (mattila and lappalainen, 2008). to fulfill these various functions in a multitude of cellular events, both the dynamics and structural properties of the actin cytoskeleton must be tightly regulated. this is achieved by a plethora of actin - binding proteins that orchestrate different aspects of actin dynamics in a highly spatiotemporally controlled manner. many actin - binding proteins are recruited to and activated, or inactivated, at the cell membrane, regulating the formation of these submembranous cytoskeletal structures (saarikangas., 2010). each of these structures involves a distinct balance of actin polymerization, depolymerization, and filament capping and bundling and share several factors conveying these properties (fig. all actin - based structures require actin nucleation and polymerization that converts monomeric actin into f - actin. two main actin nucleators are the arp2/3 complex, which forms branched actin networks, and the formin family proteins that induce formation of long and straight filaments. the sheet - like lamellipodia is considered chiefly nucleated by the arp2/3 complex (welch., 1997), whereas the activity of formins is involved in inducing linear f - actin in filopodia (peng., 2003). although all actin - based structures in cells require a set of actin - regulatory factors, the balance of the activity of these regulatory factors varies in different actin - based structures. actin depolymerization by the cofilin family of proteins, for example, is important in lamellipodia, where filaments undergo highly dynamic treadmilling (bugyi and carlier, 2010), whereas cross - linking of filaments by actin - bundling proteins, such as fascin, is critical to provide the required stability to filopodia (kureishy., 2002). general principles of the regulation of submembranous actin structures by various actin - binding proteins. carefully regulated balance of filament polymerization, depolymerization, bundling, and capping together with contractility and regulated connections to the plasma membrane lead to different properties of actin - based structures, such as actin cortex, lamellipodia, and filopodia. the actin cortex is a relatively stable mesh - like network of interconnected and contractile filaments that are physically linked with the membrane and aligned under it in a juxtaposed manner. at the leading edge of the cell, lamellipodia are highly dynamic structures where branched filaments are aligned perpendicular to the membrane and push it forward. filopodia, also found in the leading edge, are finger - like structures, where long and straight filaments are bundled together to protrude the membrane outward. the actin cortex is the least studied of these submembranous actin structures, although it is present in virtually every cell. de novo formation of the f - actin network under the membrane of expanded blebs has been used as a model system for actin cortex generation (charras., 2006). the cortex seems to be generated by cooperation of two actin nucleator machineries : arp2/3 complex and the formin mdia1. the balance of these two nucleators, together with filament cross - linkers and the molecular motor myosin ii, which provides contractility, contributes to the relatively stable but still rapidly adjustable cortical meshwork of f - actin (fritzsche. the flexibility of mature cortex is illustrated by the existence of both short and long filaments with differential dynamic behavior, as demonstrated by single - particle tracking (gowrishankar., the f - actin network of the cortex is involved in various cellular events at the plasma membrane. cortex remodeling is required upon endo- and exocytosis, for instance, and it serves as the origin or building material for other actin structures like lamellipodia and filopodia. located right beneath the plasma membrane, the actin cortex also physically connects to it by various membrane it is hardly surprising that such a dense filamentous mesh close to and intimately connected with the plasma membrane can affect the behavior and function of membrane proteins. interestingly, already the ancient bacterial actin homolog mreb is able to organize bacterial cell membrane and membrane protein diffusion (strahl., 2014), underlining the significance of the cortical cytoskeleton in the regulation of membrane protein function. it should also be kept in mind that the actin cytoskeleton further works together with the microtubule cytoskeleton as well as various intermediate filaments. whereas microtubules provide polarity and intracellular organelle organization, for instance, the cytoplasmic intermediate filaments are considered critical for cell resistance against mechanical stress (huber., 2015). (bottom left) protein 4.1-ankyrin - spectrin network (baines, 2010 ; baines., 2014). (top right) septins (gilden., 2012 ; bridges and gladfelter, 2015). (bottom right) myosin 1 (mcconnell and tyska, 2010). in the immune system, the critical role of the actin cytoskeleton is demonstrated by various human pathologies and mouse models. for example, the causal gene product for wiskott - aldrich syndrome, an x - linked recessive disease characterized by immune dysfunction and recurrent infections as well as predisposition to develop lymphomas and leukemias, is wiskott - aldrich syndrome protein, wasp, an immune cell specific activator of the arp2/3 complex (derry., 1994). the same syndrome is also caused by mutations in wasp - interacting protein, wip (lanzi., 2012), which forms a complex with and stabilizes wasp (de la fuente., 2007). a recent study in t cells demonstrated that wasp - dependent arp2/3 activation is required for actin polymerization foci localized at sites of t cell receptor (tcr) signaling and promotion of plc activation and subsequent calcium signaling. however, t cell immunological synapse is able to form upon inhibition of arp2/3 activity by the inhibitor ck666, suggesting that formin - based actin polymerization plays the major structural role (kumari., 2015). moreover, rho family gtpases including cdc42 and rac, which are considered master regulators of the actin cytoskeleton capable of activating multiple cytoskeletal regulators (heasman and ridley, 2008), play an important role in b cell activation. b cell specific deletion of cdc42 was recently shown to lead to a dramatic impairment in the generation of antibody producing plasma cells (burbage., 2015). in addition, inactivation of rac1 and rac2 in a mouse model leads to a complete lack of b cells, possibly because of deficient bcr signaling during development, as has been shown in mature b cells (walmsley., 2003 ; brezski and monroe, 2007 ; arana., 2008). notably, impaired activity of g - nucleotide exchange factors such as vav and dock8, which regulate the activity of rhogtpases, has profound effects on b cell activity and the humoral immune response, through defective formation of the immunological synapse (doody., 2001 ; although it is currently not well understood how much of these disease phenotypes are caused by abnormalities in the actin cortex or membrane protein functions, a recent study has shown that in b cells, absence of the actin regulatory protein, wip, affects signaling capabilities, likely because of altered organization and dynamics of bcr and the coreceptor cd19 (keppler., 2015), providing strong genetic evidence that the actin cytoskeleton plays a key role in receptor signaling. here, we discuss means by which the actin cytoskeleton can regulate membrane receptor signaling thresholds and integration of different signals through controlling molecular organization and dynamics of cell surface proteins. the plasma membrane is densely packed with each of the thousands of surface proteins represented by up to hundreds of thousands of molecules. for example, mature b cells express two isoforms of the bcr, with between 20,000 and 150,000 molecules of igm and 250,000 and 300,000 molecules of igd (mattila., 2013). how these thousands of molecules are organized within the membrane is an important question for understanding the mechanism of receptor triggering and the initiation of signaling. although plasma membrane proteins were once considered to be largely randomly distributed on the surface of cells (singer and nicolson, 1972), research over the last 40 years has consistently demonstrated that the plasma membrane is compartmentalized. indeed, using a variety of experimental techniques to probe the topography of membrane proteins, research has uncovered a smorgasbord of protein organizations : some proteins appear to be monomers ; some are dimers, trimers, or higher - order oligomers ; and some are found as discrete clusters of tens of molecules of different molecular species, which have been variably called such varied organization has been noted not only for different proteins but also for proteins of the same molecular type, including the bcr, and this can be rather confusing for the uninitiated. further complicating the matter, many cell surface proteins undergo clustering upon activation, and these structures also need to be named ; in the case of immune cells, the term microclustering has become common nomenclature. what is emerging is a dynamic view of the plasma membrane, where cell surface proteins are likely found on a continuum from single proteins to clusters of a few to tens of molecules. in the following paragraphs, we discuss some of the work that has led to this modified view of the plasma membrane, potential mechanisms that regulate these dynamic assemblies, and importantly, the functional significance for intercellular communication. researchers at the interface between immunology and biophysics made many of these important observations of the nonrandom distribution of cell surface proteins in lymphocytes. early studies used flow cytometry based frster resonance energy transfer (fret) experiments, which are sensitive to intermolecular distances less than 10 nm, the reasoning being that if plasma membrane proteins are homogeneously distributed, then the likelihood of two proteins being within such close proximity would be highly unlikely and fret would not occur. instead, fret experiments revealed homo- and heteroassociations of numerous membrane proteins including major histocompatability complex (mhc) class i and ii (chakrabarti., 1992 ; matko., 1994 ; szllsi., 1996), epidermal growth factor receptor (gadella and jovin, 1995), interleukin-2 receptor -subunit and icam-1 (szllsi., 1987 ; burton., 1990), and mhc class i and ii, cd20, and tetraspanins (szllsi., 1996). although these studies established that, in contrast to the fluid mosaic model, many plasma membrane proteins were nonrandomly distributed, they could not provide spatial information about protein distribution or the number of molecules that are closely associated. to address this, researchers turned to transmission em (tem), which revealed nanometer - scale islands of proteins including mhc class i (damjanovich., 1995), mhc class ii (jenei., 1997), and the interleukin-2 receptor -subunit and transferrin receptor (vereb., 2000). interestingly, these studies also revealed higher hierarchical level receptor clustering in which these protein islands organized into island groups with mean sizes between 400 and 800 nm, raising the question of whether there was functional significance to the codistribution of these proteins. wilson. also used tem to visualize the distribution of several cell surface proteins in b cells, mast cells, and fibroblasts using a technique to generate plasma membrane sheets, which exposes the inner surface of the plasma membrane for immunostaining. by counting gold particles they found that approximately one - third of particles marking fcr1 are distributed as singlets and the rest are found in clusters of two or three particles and occasionally up to nine particles (wilson., 2000). in contrast to the observation of the codistribution of other proteins mentioned previously (damjanovich., 1995 ; jenei., 1997 ; vereb., 2000), wilson. (2001) found that linker for activation of t cells (lat), found primarily in clusters of 10 nm apart (the maximum intermolecular distance for fret measurements) while clearly still having a nonrandom or compartmentalized distribution (fig. we also found that a key regulator of bcr signaling, the positive coreceptor cd19, also exists in nanoclusters, and the proportion of molecules in clusters and density of clusters was within the range of igm and igd (mattila., 2013). it is important to note that it is not only transmembrane proteins that display a nonrandom distribution ; proteins bound to the outer or inner leaflet of the plasma membrane exhibit constitutive clustering on the nanoscale. for example, the ras family of small g proteins, which are bound to the inner leaflet of the plasma membrane, are found in nanoclusters containing approximately seven proteins and radii of roughly 9 nm, notably smaller than the nanoclusters discussed above. approximately 30% of k - ras is organized in clusters, and the remaining 70% is found as monomers (plowman., 2005). interestingly, these authors report that this ratio of monomer to cluster is independent of expression level, suggesting a mechanism that actively regulates the extent of clustering. more recently, gaus and colleagues report that the nature of the membrane anchor impacts protein clustering, such that proteins anchored to the inner leaflet of the plasma membrane exhibit significantly different clustering parameters than proteins anchored to the outer leaflet (magenau., 2015). schematic diagram illustrating igm (blue) and igd (red) nanoclusters at the surface of b cells based on super - resolution storm analysis reported in mattila. a heterogeneity of clusters is present from monomers to small clusters of varying size and number of molecules. dashed circles on the right show zoomed - in view of nanoclusters in box outlined. based on a mean cluster size with radius of 70 nm and considering the surface area of the cell and the number of bcr at the cell surface, we calculated a theoretical estimate of receptor density within nanoclusters and depict an average igm cluster and a high - density igd cluster, as igd was found to be significantly more densely packed than igm nanoclusters. inset box on left depicts a model of the actin cytoskeleton (green) in relation to nanoclusters based on electron tomography data from morone. collectively, these data firmly establish the nonrandom distribution of cell surface proteins as a general phenomenon. of note, proteins are found as monomers to clusters ranging from a few molecules to tens of molecules, which are typically called either protein islands or nanoclusters. however, caution should be taken in assigning absolutes to the number and proportion of molecules within these constitutive assemblies as calculations based on super - resolution localizations and protein density may be subject to inaccuracies. for example, a recent two - color palm study suggests that lat is predominantly found in very small nanoclusters (two to three molecules) and that previous studies noting larger lat clusters (lillemeier., 2010) may have overestimated lat cluster sizes because of differences in data analysis and statistical techniques (sherman., 2011). it is, however, also likely that the range of nanocluster size and density reflects the dynamic nature of these assemblies, instead of a view where these entities are static. the biophysical mechanisms that regulate the size and temporal lifetimes of these assemblies largely have yet to be elucidated. gheber and edidin (1999) proposed that these dynamic assemblies are dependent on diffusional barriers and the trafficking of proteins to the cell surface in vesicles. thus, the population of clusters might be heterogeneous in size and concentration at any given time because clusters are born at different moments of exocytic vesicle fusion, after which their size increases, but concentration decreases over time. using both mathematical modeling and experimental testing, they provide evidence that clusters are born by the delivery of vesicles to the plasma membrane and that the size and lifetime of these assemblies are dependent on diffusional barriers mediated by the actin cytoskeleton. stabilizing the actin cytoskeleton increases the lifetime of clusters and conversely depolymerizing the actin network increases the size of clusters as molecules diffuse away, ultimately decreasing the lifetime of clusters (lavi., 2007, 2012). the formation of nanoclusters via vesicle delivery to the plasma membrane may not be the only mechanism of formation, as mathematical modeling supported by experimental data suggests that even transient protein actin interactions coupled with actin dynamics / treadmilling and myosin contractility can lead to protein nanoclustering, even for glycophosphatidylinositol (gpi)-anchored proteins, which are themselves not directly linked to actin (goswami., 2008 ;, in which various gpi - anchored proteins are largely mobile and form transient homodimers based on ectodomain protein protein interactions (suzuki., 2012). however, the assembly of greater raft domains, or nanoclusters of rafts, likely involves actin filaments (goswami., 2008 ; a role for the actin cytoskeleton in the formation and/or maintenance of nanoclusters is consistent with data showing actin staining associated with protein islands in t cells visualized by tem and a dramatic reduction in the density of islands upon actin disruption (lillemeier., 2006). in contrast, our data suggest that the organization of both the bcr and cd19 is not altered upon disruption of the actin cytoskeleton (mattila., 2013), although it should be noted that the length of drug treatment in these two studies differed dramatically ; lillemeier and colleagues treated cells with actin inhibitors for 150 min, whereas we used an acute treatment (5 min), and thus it could be that the remaining cortical actin network is sufficient for maintenance of bcr and cd19 nanoclusters. interestingly, the size of many receptor nanoclusters is consistent with actin - defined compartments (50200 nm) revealed by electron tomography (morone., 2006) and super - resolution imaging showing the mean hole in the actin mesh is < 100 nm (brown., 2012), suggesting that the actin meshwork may indeed limit the size of these clusters. another mechanism for nanoclusters of plasma membrane proteins are protein protein and protein lipid interactions. this has been shown for the adaptor protein lat, which exhibits constitutive nanoscale clustering that is dependent on two juxtamembrane cysteine residues as well as four distal tyrosines, indicative of a role for palmitoylation and protein lipid interactions, and protein protein interactions, respectively (sherman., 2011). in the case of bcr, reth and colleagues have shown that the size of igd complexes isolated biochemically was dependent on class - specific amino acids in the transmembrane region (schamel and reth, 2000), suggesting that protein protein interactions might be particularly important for igd bcr nanoclusters. we found that cd19 nanoclusters were dependent on the tetraspanin cd81 (mattila., 2013). tetraspanins are a large family of small transmembrane proteins that form homo- and multimers that further interact in cis with a multitude of membrane proteins. so - called tetraspanin - enriched microdomains within the plasma membrane laterally organize the membrane and strongly influence organization of their interaction partners, including immune receptors and integrins (charrin., 2014). interestingly, the role of cd81 in cd19 nanoclustering does not appear to be holding the clusters together, as deficiency of cd81 did not lead to loss of nanoclusters, but rather in organizing cd19 within the clusters, as deficiency of cd81 led to an 80% increase in the density of cd19 within nanoclusters (mattila., 2013). a recent study using dual - color stimulated emission depletion microscopy to gain super - resolution imaging of various tetraspanin - enriched microdomain structures in membrane sheets of b cells and dendritic cells found that tetraspanins cd37, cd53, cd81, and cd82 formed individual nanoclusters (< 120 nm) that showed little overlap with each other (zuidscherwoude., 2015). this is surprising considering earlier studies of tetraspanin tetraspanin heterophilic interactions (yez - m., 2009) ; however, specific cell types and tetraspanins might differ in this respect. tetraspanin - enriched microdomains are one example of membrane - organizing microdomains, but lipids themselves are also capable of provoking membrane order. lipid raft membrane domains were first characterized by simons and ikonen (1997) and suggested to promote compartmentalization of membrane proteins for membrane trafficking or serve as signaling platforms. initial studies on these sphingolipid and cholesterol - rich assemblies relied on biochemical methods using detergent extraction that led to notable controversy in the field. however, technological advances have now provided ample evidence of the existence of separated lipid domains that function in the organization of membrane proteins (lingwood and simons, 2010). recent work combining super - resolution imaging and fluorescence lifetime measurements of membrane dyes that report lipid packing indeed implicates lipid microdomains in the nonrandom distribution of proteins (owen., 2012). an often overlooked mechanism for membrane protein organization may be the interaction of these glycosylated cell surface proteins with members of the secreted family of lectins, called galectins, which can bind and cross - link cell surface proteins, creating glycan - based domains (brewer., 2002). indeed, the galectin lattice has been implicated in the compartmentalization of cell surface proteins (pace., 1999 ; chen., 2007) and the regulation of epidermal growth factor receptor diffusion (lajoie., 2009), providing compelling evidence for a possible role for these proteins in the nonrandom organization of cell surface proteins. interestingly, galectins may also influence the nanoscale clustering of proteins through domains other than the carbohydrate recognition domain, as has been suggested for h - ras and k - ras (belanis. in support of this, truncation of the carbohydrate recognition domain of the transmembrane lectin dc - sign altered the formation and stability of constitutive dc - sign microdomains (liu., 2012). taking these observations together, it is likely that a single mechanism does not control the nanoscale organization of proteins, but rather a combination of these mechanisms is at work either in isolation or in combination, depending on the specific protein, resulting in the variety of protein islands of different size and density observed at the surface of cells. a compelling question is whether there is functional significance for the constitutive nanoscale clustering of cell surface proteins. one of the earliest proposals for the function of constitutive clustering was that the clustering of mhc class i and class ii, which present pathogen - derived peptides to t cells, would facilitate antigen presentation. to test this, mhc class i cluster size was altered and the functional effect of this alteration examined. by incubating cells with exogenous -2 microglobulin, a constituent of mhc class i, the small clusters of mhc class i could be dispersed and a corresponding reduction in t cell responses was observed (bodnr., 2003). in contrast, stabilizing the actin - based membrane skeleton resulted in larger than normal clusters and enhanced t cell responses (kwik., 2003 ; fooksman., thus, the size and stability of constitutive nanoclustering may modulate intercellular communication. in the case of mhc, this clustering may serve as a mechanism to enhance tcr recognition of rare peptide mhc complexes. conversely, the constitutive nanoscale clustering of k - ras and h - ras proteins is proposed to act as a functional platform for signaling as abrogation of nanoclustering inhibits signal transduction (tian., 2007). another possibility is that the nanoscale compartmentalization of the plasma membrane serves to segregate functional units of signaling complexes. this notion is consistent with tem data showing tcr and fcr1 islands are segregated from the adaptor protein lat (wilson., 2001 ; lillemeier., 2010) in the steady state, although recent two - color palm data of tcr and lat challenge the view that these molecular species are present in separate nanodomains (sherman., 2011). conversely, it has been suggested that the coclustering of il2r and icam-1 may help to promote the directed delivery of cytokines to target cells (burton., an interesting question is why the proportion and density of igm in constitutive clusters is less than igd. do differences in the clustering state of the receptor regulate its properties, such as mechanism of triggering or requirements for ligand valency ? indeed, a mutant of igd unable to induce bifc and thus presumably monomeric was found to be more active (yang and reth, 2010). moreover, monovalent engagement readily activated igg1-bcrs expressed on memory b cells (avalos., 2014), and this isotype has an enhanced capacity to oligomerize / cluster upon ligand engagement (liu., 2010). although the enhanced response of memory b cells is no doubt linked to increased affinity of these bcrs, it may also be that the nanoscale organization (avalos., 2014) of this isotype interestingly, a recent study suggests that memory t cells have increased antigen sensitivity through increased number and size of tcr oligomers at the cell surface (kumar., 2011). because tcrs do not undergo somatic hypermutation leading to increased affinity, as bcrs do, the increased prevalence of oligomeric tcrs may be reflective of a process of avidity maturation, as suggested by the authors. intriguingly, altered nanoscale organization of the adhesion molecule lfa-1 and the lectin dc - sign has been noted in the differentiation of monocytes to dendritic cells, and these changes in receptor organization have important functional consequences for ligand binding (cambi., 2004, 2006). it will be interesting to determine the mechanisms for these differentiation - specific organizations and whether these alterations are mediated by changes in the actin cytoskeleton. extensive research in membrane protein biology has demonstrated that many cell surface proteins exhibit restricted diffusion on both the micrometer scale over milliseconds as well as nanometer and microsecond scales (kusumi., 2012). consequently, it was proposed in the membrane - skeleton fence model that transmembrane proteins protrude into the cytoplasm and collide with the underlying cortical actin cytoskeleton (membrane skeleton) resulting in temporary confinement of membrane proteins (kusumi., 2005). confined diffusion is observed not only for transmembrane proteins that protrude into the cytoplasm but also for lipids and gpi - anchored proteins, which are only linked to the outer layer of the plasma membrane, and thus, the anchored transmembrane protein picket model was proposed ; in this model, transmembrane proteins are anchored to and aligned along the membrane skeleton, effectively acting as rows of pickets to the free diffusion of gpi - anchored proteins and lipids (kusumi., 2005, 2012). molecules within these membrane compartments delineated by fences and pickets undergo short - term confined diffusion and long - term hop diffusion between compartments. (fujiwara., 2002 ; suzuki., 2005). many studies have provided evidence that support the model that the actin cytoskeleton defines diffusion barriers for membrane proteins and lipids by disrupting the actin cytoskeleton either genetically or pharmacologically (sheetz., 1980 ;, 2004 ; charrier., 2006 ; lenne., 2006 ; wheeler., 2007) the first study to directly visualize the actin cytoskeleton and an immune receptor simultaneously, in this case fcr, demonstrated that actin filaments defined micron - sized domains that confine receptors (andrews., 2008). we took a similar approach to examine the role of the actin cytoskeleton on bcr mobility. using dual - view total internal reflection fluorescence microscopy and single - particle tracking, we provided evidence that the actin cytoskeleton defines diffusion barriers for the bcr (treanor., 2010). interestingly, the diffusion of the two bcr isotypes expressed by mature naive b cells, igm and igd, showed a high degree of restricted diffusion with 50% of igm and almost 90% of igd nearly immobile. this observation is in striking contrast to the nearly entirely mobile state reported for fcr (andrews., 2008). it should be noted that because of the low labeling density required for single - particle tracking experiments, it is not possible to verify if the tracked molecules were bcr monomers or organized in nanoclusters on the cell surface. it is tempting to speculate that perhaps protein dynamics reflect the state of clustering to some extent (at least on this macroscopic timescale). indeed, the proportion of igm bcr versus igd bcr found in clusters (mattila., 2013) is similar to the proportion of very slow diffusing bcrs for these two isotypes (treanor., 2010). consistent with this notion, gpi - ap nanoclusters are less mobile than gpi - ap monomers (goswami., 2008). interestingly, the diffusion of both igm and igd increased upon treatment with actin depolymerizing agents, although not to the same extent, suggesting additional mechanisms may regulate bcr diffusion, particularly in the case of igd. an intriguing question is whether membrane protein diffusion dynamics are spatially modulated within the cell depending on the local actin architecture. for example, membrane protein diffusion may be different in the relatively stable cross - linked and membrane - linked network of actin filaments within the cortex, compared with the highly dynamic organization of actin within lamellipodia, which is undergoing continuous remodeling. in our study, we primarily focused on bcr movement within the cortex and only rather crudely defined actin - rich versus actin - poor regions within this area. we did, however, observe linear bcr diffusion at the cell periphery within actin - rich filopodia (treanor., 2010), suggesting that indeed, membrane protein diffusion may be regulated by different f - actin based structures. the mechanism for this linear diffusion of bcr within filopodia has yet to be investigated, as well as how this might modulate bcr triggering within these exploratory fingers. linear diffusion of a population of cd36 has also been reported, although in this case it was within troughs radiating from the perinuclear region and aligned along microtubules where actin was locally displaced from the membrane (jaqaman., 2011). indeed, the actin cytoskeleton does not work in isolation from other cytoskeletal networks, and thus, the proximity and connections between the actin network and the plasma membrane are critical with regard to the effect on membrane proteins. in mammalian cells, these linkers include ezrin - radixin - moesin (erm) proteins, 4.1 protein, ankyrin, spectrin, septin, filamin, and myosin 1, which we have highlighted in fig., we found that not only actin, but also the erm family protein ezrin defined barriers to bcr diffusion. the binding of erm proteins to both membranous targets and actin is regulated by phosphorylation (bretscher., 2002), thus providing a mechanism to modify membrane protein diffusion in highly dynamic manner. indeed, in b cells, ezrin underwent dynamic reorganization, which appeared to allow bcr to transition from immobile to mobile states, acting as a kind of gate to plasma membrane compartments (treanor., 2010). interestingly, in these studies we noted that the erm network is much more dynamic than actin reorganization in the cortex, suggesting that indeed, the erm proteins may be a key mechanism to rapidly regulate membrane protein diffusion. because both tcr and bcr stimulation induce a transient dephosphorylation of erm proteins (delon., 2001 ; faure., 2004 ; gupta., 2006 ; ilani., 2007), these proteins may provide a more general mechanism to tune receptor diffusion in response to ligand binding. in contrast to bcr, the mobility of the key coreceptor cd19 was less affected by disruption of the actin cytoskeleton in naive unstimulated b cells, despite showing highly limited mobility (mattila. these observations were supported by simultaneous visualization of the actin cytoskeleton and single - particle tracking experiments, which showed that cd19 diffusion was independent of the density of actin. instead, immobilization of cd19 was largely mediated by the tetraspanin cd81 ; cd19 diffusion was markedly increased in cd81-deficient b cells. interestingly, deficiency of cd81 rendered cd19 mobility more sensitive to disruption of the actin cytoskeleton, suggesting some degree of cross talk between protein similar to cd81, other tetraspanins, like cd151 and cd82 for instance, have been found to regulate the diffusion of their interacting proteins, such as 6 integrins and egf receptor, respectively (danglot., 2010 ; yang., 2012). thus, tetraspanin microdomains within the plasma membrane may play an important role in regulating diffusion of several membrane proteins. a relatively slow half - life of 1015 s was demonstrated for the bulk of cd63 and cd82 in photobleaching studies (hoorn., 2012). a more detailed study of cd9 tetraspanin by single particle tracking revealed high mobility for the majority of cd9 molecules, whereas a minority appeared confined in cd9 tetraspanin microdomains. interestingly cd9 tetraspanin microdomains were very stable in both position and shape over an imaging period of 10 min and resistant to latrunculin b treatment (espenel., 2008), in line with our data on tetraspanin - dependent but largely actin - independent mobility of cd19 (mattila., 2013). the bcr presents an interesting model for the role of actin in regulating signaling, with differential requirements for actin depolymerization and polymerization spatially and temporally modulated. given the potential role for actin in organizing receptor nanoclusters and membrane protein diffusion, and the importance of these parameters in signaling, it is likely that the findings on the role of actin in regulating bcr signaling may be broadly relevant to many cell surface receptors. we found that the cytoskeleton plays a critical role in controlling bcr signaling and that treatment with agents disrupting actin organization was sufficient to induce bcr signaling in the absence of any ligand (treanor. we hypothesized that by restricting the diffusion of bcr, the cytoskeleton regulates collaboration with the activatory coreceptor cd19 ; disruption of the diffusion barrier defined by the actin cytoskeleton increases bcr (bcr nanocluster) diffusion and thus increases the likelihood that the bcr will encounter the coreceptor cd19 (treanor and batista, 2010 ; treanor, 2012). this idea is consistent with the collision coupling or mobile receptor hypothesis (jans, 1992 ; jans and pavo, 1995), which postulated that lateral diffusion of membrane proteins was required to facilitate protein - protein interactions necessary for signal transduction. in support of this hypothesis, we found that the spontaneous bcr signal triggered by disruption of the cytoskeleton is dependent on cd19 (mattila., 2013). these data suggest that release of bcr nanoclusters allows for either bcr collisions that activate cd19 or direct bcr access to cd19 that then facilitates signaling through the bcr (fig. 4). the coming together of nanoclusters of bcr and cd19 is reminiscent of the concatenation of protein islands of tcr and the coreceptor lat (lillemeier. thus, it seems likely that by restricting the diffusion of the bcr, the cytoskeleton is capable of regulating the interactions between the bcr and cd19. although our data suggest an opening up of the actin cytoskeleton is necessary to facilitate protein protein collisions, actin - void structures such as troughs aligned along microtubules can create channels for the linear diffusion of cd36 that promotes receptor interaction and clustering (jaqaman., 2011). (a) en - face view of the cell cell contact showing nanoclusters of bcr and cd19 are brought together to form signaling microclusters. some microclusters contain only igm, some contain only igd, and some contain both igm and igd as shown in depoil. note that not all bcrs form microclusters ; monomers and nanoclusters of bcr not in microclusters are shown as semitransparent. (b) side view of cell cell contact showing actin and erm proteins are reorganized to form a fence around bcr microclusters as shown in treanor. these signaling microclusters lead to localized reorganization of actin that will release unengaged monomers / nanoclusters of bcr from the actin - defined diffusion barrier providing a positive feedback loop to amplify bcr signaling. if the actin cytoskeleton restricts the interaction between bcr and cd19 by limiting bcr mobility, then alteration of the actin cytoskeleton must be a critical step in the initiation of bcr signaling in response to ligand. indeed, several lines of evidence support an opening up of the actin network upon bcr stimulation. hao and colleagues have shown that bcr stimulation is accompanied by rapid depolymerization of the actin cytoskeleton (hao and august, 2005). moreover, erm proteins are rapidly dephosphorylated upon bcr stimulation, which would lead to a conformational folding of the protein and release of the membrane actin connection, allowing for increased mobility of bcr (gupta., 2006 ; we also found that bcr stimulation was accompanied by a transient increase in the overall mobility of the bcr (treanor., 2011), supporting the idea that signaling induced alteration in actin modifies bcr diffusion dynamics, thus creating a positive feedback loop whereby the increased bcr mobility increases the likelihood of interaction between bcr and cd19 (mattila., 2013), further amplifying bcr signaling. in line with this, b cells deficient in key cytoskeleton regulators such as cdc42 and wip result in altered cytoskeleton and defective bcr signaling. alteration of the actin cytoskeleton and release from diffusional barriers may not only be important for bcr signaling ; indeed, the first study to demonstrate a functional outcome from release of a receptor from actin - defined confinement showed that alterations in the actin cytoskeleton induced by phorbol ester increases the mobility of lfa-1 and consequently lfa-1 inside - out signaling (kucik., moreover, destabilization of actin was reported to increase the diffusion of serotonin1a receptor, and this increased diffusion was strongly correlated with the efficiency of ligand - mediated signaling (ganguly., 2008). collectively, these data indicate that depolymerization of the actin cytoskeleton and release of receptors from diffusional barriers is an important step in the initiation of signaling. interestingly, a recent study has demonstrated that actin - defined confinement regions sequester the transmembrane chemokine cx3cl1 from the membrane metalloprotease adam10 and disruption of the cytoskeleton increases association and consequently cleavage and release of soluble chemokine (wong., 2014). thus, actin - defined membrane compartmentalization may be a general mechanism for regulating a variety of cellular processes. although alteration of actin and release of receptor diffusion boundaries is important for bcr signaling, it has also been shown that the actin cytoskeleton plays an important role in morphological changes that accompany b cell activation (kuokkanen., 2015). upon encountering ligand, the b cell rapidly spreads out over the ligand - containing membrane and then slowly contracts back (fleire., 2006). although this response clearly requires actin polymerization, it is not necessarily in contradiction to the depolymerization of actin discussed above. in fact, it is likely that the redistribution and polymerization of actin at the periphery of the cell during cell spreading further facilitates the breakdown of the cortical actin meshwork, which was immobilizing bcr nanoclusters. the polymerization of actin occurs not only at the lamellipodia but also at bcr microclusters (treanor., 2011), the micron - scale signaling active clusters that, according to our storm data, are multiple nanoclusters of bcr and cd19 brought together (fig. the formation and integrity of bcr and tcr microclusters is dependent on the actin cytoskeleton as pretreatment of cells with actin depolymerizing agents abrogates microcluster formation (campi., 2005 ; fleire., 2006 ; varma., 2006) and treatment after microcluster formation results in the breakup of microclusters and loss of both ligand and signaling proximal kinase from within clusters (treanor., 2011). the erm - mediated linkage of the actin - cytoskeleton was also important for maintaining bcr microcluster integrity and downstream signaling (treanor., 2011). in contrast, the large central accumulation of tcrs known as the central supramolecular activation cluster is not affected by disruption of f - actin, likely because these tcrs are on the surface of extracellular microvesicles that bud from the center of the immunological synapse (choudhuri., 2014). clearly, the actin cytoskeleton has multifaceted roles in regulating bcr signaling ; these roles are spatially and temporally modulated to both permit interaction of receptor nanoclusters as well as support the interaction and thus sustained signaling. this is not to imply that actin is the only player ; no doubt additional mechanisms are important for the formation and maintenance of signaling bcr microclusters. it has been suggested that ligand engagement by the bcr induces a conformational change in the fc portion to reveal an interface in the c4 domain that promotes bcr clustering (tolar., 2009). in addition, we recently found that the tetraspanin molecule cd81, which governs the mobility and the molecular organization of cd19 within the membrane as discussed above, also functions as an amplifier of bcr signaling by facilitating the collaboration of cd19 with the bcr (mattila., 2013). in b cells deficient in cd81, the molecular mechanism by which cd81 facilitates bcr activation is not clear, but it might involve supporting the optimal conformation or membrane localization of cd19. clearly, the actin cytoskeleton plays a critical role in controlling and regulating receptor signaling. this raises the question of whether alterations in the actin cytoskeleton induced through one receptor signaling pathway alter diffusion dynamics of another receptor, thus facilitating the interaction between functional protein partners. does the actin cytoskeleton provide a mechanism for mediating cross talk between cell surface receptors and thus the integration of various environmental stimuli ? in support of this idea, a recent study has shown that in toll - like receptor (tlr)-activated b cells, cofilin - mediated increase in actin turnover leads to faster bcr diffusion as well as stronger cell activation by suboptimal bcr stimulation (freeman.,, infection detected via innate immune receptors would modulate actin regulation of bcr - cd19 interactions resulting in priming of bcr and increased bcr sensitivity for ligand (fig. moreover, in the in vivo context, cells are not static but rather constantly migrating within lymphoid tissue in response to chemokine signaling, and thus, the actin cytoskeleton is undergoing constant dynamic remodeling. how this effects receptor diffusion within the various f - actin based structures is a key question. for example, extension of lamellipodia in a migrating cell could either lead to release of receptors from constrains formed by f - actin or induce rapid linear motion with rearward actin flow for receptors that remain bound to actin. how these altered diffusion dynamics impact on receptor signaling is an important area to investigate. we propose that the actin cytoskeleton provides a mechanism to integrate environmental stimuli through modification of receptor organization and dynamics and, consequently, protein protein interactions regulating receptor signaling. in the context of b cells, alterations in the actin cytoskeleton induced through non bcr - signaling pathways are able to tune bcr activation through increased bcr diffusion dynamics and thus the probability that the bcr will encounter cd19. changes in actin dynamics could be induced, for example, through innate immune receptors such as tlrs, as recently shown by freeman. a recent study showed that baffr signaling leads to phosphorylation of ig/ subunits and subsequent activation of the kinase syk (schweighoffer., 2013) ; perhaps this is caused by baffr - induced changes in the cytoskeleton and increased interaction between bcr and cd19. this integration of environmental stimuli via actin dynamics could result in priming of bcr and increased bcr sensitivity for ligand. it could also offer perspective on tonic bcr signaling as periodic spatiotemporal changes in the cytoskeleton could modulate bcr cd19 interactions and initiate localized ligand - independent signaling. release of receptors from cytoskeletal constraints caused by altered actin dynamics or organization could offer a novel perspective on bcr tonic signaling necessary for b cell survival (lam., 1997). the mechanism for this low - level ligand - independent constitutive signal, which critically depends on cell surface expression of bcr, is not well understood. we speculate that periodic spatiotemporal changes in the cytoskeleton, caused for example by cell migration, interactions with other cells, or integration of other environmental stimuli, could modulate bcr - cd19 collisions and initiation of localized tonic bcr signaling. indeed, in the study by freeman. (2015), activation of b cells with tlr ligands and the resultant alteration in actin dynamics led to increased bcr diffusion and increased basal levels of phosphorylated erk and akt, likely corresponding to tonic signaling. in addition to bcr, tonic signaling also depends on b cell activating factor (baff), a cytokine of the tnf family, which binds to baff receptor (baffr) on b cells. a recent study showed that baffr signaling leads to phosphorylation of bcr ig/ subunits and subsequent activation of the kinase syk (schweighoffer., 2013). interestingly, a recent study has shown that syk is important for actin cytoskeleton reorganization and simply inhibiting this kinase is sufficient to alter actin organization and mobility of fcr in macrophages (jaumouill., 2014). a role for syk in actin dynamics is supported by our observations that syk - deficient b cells have altered f - actin organization (treanor., 2010). moreover, b cells deficient in other signaling molecules known to be involved in actin organization, including plc2 and vav, show decreased bcr diffusion (treanor., 2010) thus, the important collaboration between bcr and baffr in supporting b cell survival may be caused by baffr - induced changes in the cytoskeleton leading to the activation of the bcr - cd19 arm of signaling. in the in vivo context, it is unlikely that receptors work in isolation, but rather collaborate to integrate the multitude of environmental signals. interestingly, in b cells, cd19 appears to act as a hub for pi3k signaling and consequently, defects in cd19 signaling in wip - deficient b cells as a consequence of altered cd19 organization and dynamics results in pi3k activation defects by bcr, cd40, baffr, and cxcr5 (keppler., 2015). the actin cytoskeleton could provide a mechanism to integrate these signals through modification of receptor organization and dynamics and, consequently, protein protein interactions regulating receptor signaling. in further support of this idea, a recent study suggested that remodeling of the cytoskeleton initiated by costimulatory signals can regulate tcr signaling (tan., 2014). whether these phenotypes correlate with increased receptor diffusion and altered intermolecular interactions remains to be shown. a new view of the plasma membrane is emerging, one in which membrane proteins are organized in constitutive dynamic molecular assemblies, regulated by a combination of protein protein and protein lipid interactions and interactions with the underlying actin cytoskeleton. the mobility of many of these membrane constituents is restricted by the actin cytoskeleton, and this may play a key role in controlling receptor signaling through limiting the interactions with functional protein partners. this role of the cytoskeleton of regulating protein protein interactions and thus signaling might also provide an explanation for ligand - independent receptor signaling, such as tonic bcr signaling, which is absolutely required for b cell survival but mechanistically enigmatic. however, many questions remain with respect to how this critical cytoskeletal regulation of receptors is achieved and how cells maintain optimal signal thresholds for various continually changing conditions. environmental stimuli in the in vivo context may modulate the actin cytoskeleton and thus tune the threshold of receptor activation, either by increasing actin dynamics and reorganization or by stabilizing the cortical actin cytoskeleton. future research will need to identify how the milieu of environmental stimuli influences the cytoskeleton and consequently bcr triggering. such knowledge may help in our understanding of autoimmune disease and b cell malignancies as well as inform effective vaccination strategies. furthermore, this information may also prove vital for understanding cytoskeletal regulation of signaling and cross talk of various signal pathways in several other cell types. | recent evidence implicates the actin cytoskeleton in the control of receptor signaling. this may be of particular importance in the context of immune receptors, such as the b cell receptor, where dysregulated signaling can result in autoimmunity and malignancy. here, we discuss the role of the actin cytoskeleton in controlling receptor compartmentalization, dynamics, and clustering as a means to regulate receptor signaling through controlling the interactions with protein partners. we propose that the actin cytoskeleton is a point of integration for receptor cross talk through modulation of protein dynamics and clustering. we discuss the implication of this cross talk via the cytoskeleton for both ligand - induced and low - level constitutive (tonic) signaling necessary for immune cell survival. |
progeroid syndromes (pss) are a group of fatal, severe and rare genetic disorders characterized by various clinical features and phenotypes of physiological ageing prematurely. these syndromes include clinically and genetically heterogeneous diseases such as ataxia - telangiectasia, bloom syndrome, cockayne syndrome, fanconi anaemia, hutchinson - gilford syndrome, rothmund - thomson syndrome, trichothiodystrophy, xeroderma pigmentosum, and werner syndrome (also known as adult progeria)1. among the different forms of progeria, the classical and most extensively studied type is the hutchinson gilford progeria syndrome (hgps), named after the two scientists (jonathan hutchinson in 1886 and hastings gilford in 1897) who independently delineated and described the syndrome. as of now, the prevalence of this syndrome is one in 4 - 8 million new births2. incidence of progeria is uniform throughout the world showing no gender, geographical or ethnic predisposition, and hence mostly considered as sporadic. presently, there are about 114 children across 39 countries diagnosed with hgps2. the average age of survival is 13.5 years (with life expectancy about 8 - 21 years) and death occurs due to stroke, myocardial infarction3, heart failure or atherosclerosis (cardiovascular disease). of the clinical symptoms of various pss like growth retardation, skin atrophy, alopecia, lipodystrophy, osteolysis and an augmented susceptibility for malignant tumours, the notable thing in hgps is that the cognitive abilities remain unaffected45. classical hgps is usually caused by a sporadic autosomal dominant mutation (except unique inheritable variety such as werner 's syndrome)6. there are a few atypical forms of progeria, also called non - classical progeria in which growth is less retarded, scalp hair fall off slowly, progression of lipodystrophy is delayed, osteolysis is more visible with exception in face and survival is observed mostly till adulthood4. mostly, hgps occurs as a result of a de novo point mutation in the dna7. these children look normal and healthy at birth but in due course of time (mostly within a year) they gain very less weight due to growth failure. by the age of one and a half to two years, they are thin with small face and abnormal jaw size relative to the size of head, have high - pitched voice, irregular dentition, a pinched nose and notably big wide - open eyes, undersized dystrophic clavicles and absence of sexual maturation8. body fat and eyelashes are progressively lost and hair start becoming thinner and fall off, finally to become completely bald (alopecia). the skin becomes very thin, delicate and translucent through which veins could be seen8. complaints of angina, high blood pressure, stiffness of joints and hip dislocation are also common. clinical findings show that these patients show prolonged prothrombin time and elevated platelet count which is not seen in normal physiological ageing9. the biochemical analyses show normal results except for the increased low - density lipoproteins and cholesterol levels in the serum and increased urinary excretion of hyaluronic acid (ha) in these patients10. as an estimate, not many studies have been done to evaluate various signaling pathways or neurochemical profile in the brain of such subjects. therefore, the involvement of brain signaling pathways in the pathogenesis of the disease can not be ruled out. advancement of heart disease occurs at an exceptionally accelerated rate in these children at the age of around 13 years which is comparable to the prevalence in normal population around the sixth decade or so2. only a single report of the survival of a patient up to 45 years has been reported11. werner syndrome (ws) is a rare ps very similar to hgps in its clinical symptoms. the mutation lies in the wrn gene encoding dna helicase, located on chromosome 8, which impairs telomere maintenance and further dna replication in the cell. individuals with this syndrome develop normally until about 10 years of age and exhibit clinical symptoms in early teenage years. ws is more prevalent in japan and in the italian island of sardinia than any other part of the world. about 1000 cases are reported in the world ; more than 800 of these cases are in japan1415. there is another similar and rare premature ageing syndrome known as dyskeratosis congenita (dkc). dkc is an inheritable bone - marrow failure disorder linked to mutations in dkc1, terc, tert, nop10, nhp2, tin2 or tcab1 genes16, implicating the physiology of telomeres17. trichothiodystrophy (or tay 's syndrome) is an autosomal recessive disease identified by small stature, mental and overall growth retardation, ocular defects, brittle hair and other developmental abnormalities like congenital ichthyosiform erythroderma. patients have abnormal production of transcription factor ii h (tfiih), a general transcription factor active in basal transcription and nucleotide excision repair, due to mutations in genes encoding any of the 3 subunits of tfiih ercc2 (xpd), ercc3 (xpb), and gtf2h5 (ttda)18. cockayne syndrome, another rare congenital disorder, is characterized by growth failure, atypical photosensitivity and importantly impaired development of the nervous system. mutations in any of the ercc6 and ercc8 genes bring about defect in dna repair mechanism which eventually precipitates this disease19. by the age of two years, the distinctive physical appearance of cachectic dwarfism with sunken eyes, reduction of the skin and hair thickness and an arched standing posture characterizes the ageing process. neuropathological investigations demonstrate widespread demyelination in the central and peripheral nervous systems of the patients. there is also neuronal loss in the cerebral cortex and cerebellum, and calcification around capillaries in the cerebral cortex and basal ganglia1. the two known molecular lesions of hgps are the mutated lmna gene and/or abnormal post - translational processing (zmpste24 gene mutations) both of which ultimately result in abnormally formed lamin a called progerin. de novo point mutations in the lamin a / c gene called lmna (which produces lamin a and lamin c proteins as alternative splice products) causes hgps721. most of the hgps cases (around 90%) carry the lmna g608 g (ggc > ggt) mutation within exon 11 of lmna which activates a splice donor site that results in production of a dominant negative form of the lamin a protein22. lmna gene is present on chromosome 1 and the point mutation results in the deletion of 50 amino acids of prelamin a23 which destabilizes the nucleus further and is fatal for the cell. cells with abnormal nuclear shape are often implicated in a number of disease pathologies in which lamin a proteins are mutated, collectively referred to as laminopathies24. lamin a is a key protein component of nuclear scaffolding that holds the nucleus together by forming the inner layer of the membrane. due to its deficiency, the young patients of hgps develop various phenotypic characteristics like loss of hair, development of craniofacial deformities, wrinkled appearance and cardiovascular defects leading to heart attack or stroke. the disease is characterized by definite defects in nuclear shape due to the mutated gene resulting in distorted nuclear membranes in 50 per cent of the cells as compared to less than 1 per cent cells of the normal individuals25. ageing related distortion in nuclear shape in humans is also known to be linked to the nuclear lamina, particularly to progerin, as seen in cases of hgps25. interestingly, brain, unlike other tissues, predominantly synthesizes lamin c and very little prelamin a and thus escapes the deleterious effects of lmna mutation. cells expressing mutant lamin a show aberrant dna damage responses27 and since lamin a expression is restricted to a few cell types there is an explicit difference in the cells and tissues getting affected. further, as the defective lamin a protein makes the nucleus unstable, the resultant cellular instability appears to lead to the process of premature ageing in progeria. in vitro studies employing a morpholino oligonucleotide targeted to the activated cryptic splice site showed the reversibility of the diseased cellular phenotype by correcting the aberrant splicing episode. however, there was no rescue from the symptoms by simply introducing the wild - type lamin a protein28. interestingly after the splicing correction, the hgps cells show normal nuclear morphology with corrections in aberrant cellular levels and distribution of lamina - associated protein and also the rectification of the errors in heterochromatin - specific histone modifications28. other disorders like emery - dreifus muscular dystrophy, atypical werner syndrome and charcot - marie - tooth type 2b1, in addition to hgps, can occur due to mutations in the lmna gene293031. the farnesylation of a c - terminal cysteine (the c of the caax motif), endoproteolytic release of the last three amino acids (the aax) and methylation of the newly exposed farnesylcysteine residue are involved in the process triggered by prelamin a. further, zmpste24 (an endoplasmic reticulum membrane protease) cleaves prelamin a at the c terminus including the farnesylcysteine methyl ester to release a total of 15 more residues to generate the full lamin a. on the other hand, progerin has been shown to provoke various progerian phenotypes in mice irrespective of being farnesylated or not33. lamins are known to interact with various inner nuclear membrane proteins of which the sun domain protein called sun1 has been implicated in the pathogenesis of hgps. chen have reported that loss of sun1 gene in lmna mice corrects the cellular and tissue related abnormalities and remarkably improves lifespan. also, by knocking down over accumulated sun1 from primary hgps cells, they showed that problems like nuclear defects and early cellular senescence got corrected. over accumulation of sun1 is considered to play a key role in hgps and hence holds a promise in designing therapeutic strategies in future. various hypotheses have been put forward for the involvement of reactive oxygen species, oxidative stress and defects in the dna repair mechanism to explain their roles in the accelerated ageing process in the hgps condition1. it has been reported that telomere length is shorter in hgps fibroblasts compared to age - matched controls35. another study suggests that mutant lamin a reduces telomere length through a direct effect and that expression of mutant lmna is a requisite for telomere loss in hgps36. the increased cell death in an organism can be due to some aberration in dna repair mechanism or shortening of telomere or defects in telomeric dna. in order to develop a better understanding of the pathogenesis and progression of pss and design potential therapies, effort has been put in by scientists globally to develop animal models of the same. lmna mice develop cardiac and skeletal myopathic phenotype similar to the emery - dreifuss muscular dystrophy in humans38. another study showed that homozygous mice carrying autosomal recessive mutation in lmna gene have a phenotype resembling hgps, with marked growth retardation, pathologies of skin and bone and death by 4 - 5 weeks of age39. dna repair deficient ercc1 mice show a slight retardation in embryonic and early post - natal development, but the growth almost stops in the second post - natal week, leading to death by 4 weeks of age40. these ercc1 mice exhibit skin, liver and bone marrow pathologies, progressive ataxia and premature ageing. zmpste24 mice are normal at birth but soon develop progeroid symptoms like alopecia, kyphosis, abnormalities in dentition and bones, etc4142 which improve when treated with protein farnesyltransferase inhibitor (fti)4344. zmpste24 mice also exhibit very high circulating levels of growth hormone (gh) and a drastic reduction in plasma insulin - like growth factor 1 (igf-1)45. the gh / igf-1 signaling is known to be crucial for the control of longevity46. recombinant igf-1 treatment refurbishes the balance between igf-1 and gh in zmpste24 mice, delays the onset of many progeroid symptoms and improves their lifespan considerably45. in vitro studies also implicate the possible role of ftis in the treatment of hgps47. a recent study has shown that rapamycin inhibits aberrant mtorc1 signaling in lmna mice and improves their cardiac and skeletal muscle functions thereby enhancing their survival48. although the pursuit for finding an effective treatment for hgps is still on, yet there is still no diagnostic kit available for early detection of the same. usually in practice, a clinical assessment is done based on the phenotypical evidence and medical history of the child. following this, a genetic test for lmna mutation is commonly done for confirming the diagnosis of hgps to initiate the treatment programmes early in the progression of the disorder. a case report on hgps has reported that clinical diagnosis can also be established by radiological findings - diastasis of the sagittal suture with several wormian bones in the skull ; hypoplastic mandible with infantile angle ; the presence of fish - mouth vertebrae ; the occurrence of bilateral coxa valga deformity ; resorption of terminal phalanges, etc10. a class of cancer drugs known as farnesyltransferase inhibitors (ftis) has shown promise of reversing the structural abnormalities of the nucleus (associated with build up of prelamin a) which is one of the characteristics of the cells in the hgps children. as the name suggests, these drugs restrict the activity of farnesyltransferase required to make a liaison between farnesyl groups and progerin proteins. ftis have shown improvement in many of the features of progeria - like mouse model3349. specifically, ftis improve the nuclear shape in the fibroblasts from the patients of pss50 and improve nuclear blebbing in the fibroblasts of mouse model with the gene targeted for hgps23. one study has shown the prevention of both the onset and late progression of cardiovascular disease by a fti (tipifarnib) in a transgenic lmna g608 g mouse model of hgps51 supporting the use of these drugs. varela and co - workers52 have shown prelamin a and its truncated form progerin / ladelta50 to undergo alternative prenylation by geranylgeranyltranferase when the farnesyltransferase was inhibited. this study has tried to explain the low efficiency of ftis in improving the physical composition of the progeroid mouse models. they further showed that the combination of statins and aminobisphosphonates inhibited both farnesylation and geranylgeranylation of progerin and prelamin a and also improved ageing related phenotype of zmpste24 mice strikingly. in addition, these extended the longevity of the mice significantly52. under the partnership of progeria research foundation, national institutes of health, children 's hospital boston and dana - farber cancer institute, the progeria clinical drug trial was initiated in 2010 to test the effectiveness of three drugs of hope a statin drug called pravastatin (normally used for lowering cholesterol and preventing cardiovascular disease), a bisphosphonate drug called zoledronic acid (usually used for improving osteoporosis and to prevent skeletal fractures) and a farnesyltransferase inhibitor called lonafarnib (a drug that reversed progeroid associated phenotype and abnormalities in various murine models)53. the clinical trial conducted in 25 progeroid children over two years has reported that lonafarnib, a fti drug, has been successful in facilitating weight gain and improving cardiovascular and skeletal pathologies54. this is a tremendous achievement in the progress of progeria research that will perhaps pave its way to the discovery of a definite treatment for this rare and complex syndrome. progeria (or hgps) is a rare syndrome which makes it difficult to study. due to the efforts of parents of the affected children, a few research groups and the progeria research foundation (prf), the awareness of this syndrome for example, elevated ha levels have been suggested as specific marker for hgps105556, but other studies have nullified this by reporting that urinary and serum levels of ha in hgps patients are comparable with controls57. gordon and co - workers57 did a thorough analysis of the serum and urinary hyaluronidases by both quantitative (using elisa) and qualitative (using a gel detection method) methods and contravened the use of ha as a marker for hgps. hence, the search for an accessible and definite kind of diagnostic marker is still on. a study has shown that dna damage results in suppression of the gh / igf-1 axis which in turn leads to remarkable progeroid symptoms40. more research on the causes and patterns of dna damage in hgps and ageing may provide some useful links between ageing and ps(s). the positive or negative interactions between the lmna gene and other genes controlling ageing and longevity can be studied in appropriate animal models for better understanding of the pathogenesis and progression of hgps. the prf has 121 cell lines in their cell and tissue bank, which are available on request for research purposes. a clear perception of the mechanism of pathogenesis of hgps and other pss would be helpful in understanding the abnormal conditions in the diverse branches of basic and applied life sciences like molecular biology, basic cellular senescence phenomenon, mitochondrial physiology, oncology, functional genomics and proteomics, dermatology especially dermal physiology, stem - cell biology, and many other degenerative disorders regarding which our knowledge is still meager59. thus, discovery of a cure for ps(s) would not only help the affected children but also a large number of patients suffering from cardiovascular diseases, stroke, cancer, etc. proteins linked to hgps are suspected to play a pivotal role in the ageing process and this could be one of the reasons responsible for making these children predisposed to premature, progressive heart disease. when factors like igf-1 signaling and functional cascade of events (of hormones) are checked in the prevalent and existing models of ageing and longevity (diet restriction), it has been observed that there is a significant shift from the normal parameters. this shift can be due to pituitary or any organ related faults, defect in the micronutrient (like vitamin d, etc.) metabolism, abnormal protein glycation, disturbed antioxidant status, to any other physiological process. it has been observed that wnin / ob (wistar of national institute of nutrition obese rat) obese rats exhibits an unusual premature aging60, develop various tumours, and have other immune response deficits6162. these kinds of animal models should be checked for their genomic, proteomic and biochemical status to look into the details of the common or shared and probably faulty pathways. the field of gerontology gained importance relatively late when compared to other areas of research. however, presently a lot of effort is being put in by researchers in this area to delay the normal ageing process and the trauma that follows the common physical, psychological, and social implications associated with it. the inheritance pattern of hgps is known but it appears mostly as a sporadic disorder. hence to address it efficiently it will be worthwhile to study the causal cellular and molecular mechanisms that accelerate the ageing process leading to rapid progression of the disease. | progeria is characterized by clinical features that mimic premature ageing. although the mutation responsible for this syndrome has been deciphered, the mechanism of its action remains elusive. progeria research has gained momentum particularly in the last two decades because of the possibility of revealing evidences about the ageing process in normal and other pathophysiological conditions. various experimental models, both in vivo and in vitro, have been developed in an effort to understand the cellular and molecular basis of a number of clinically heterogeneous rare genetic disorders that come under the umbrella of progeroid syndromes (pss). as per the latest clinical trial reports, lonafarnib, a farnesyltranferase inhibitor, is a potent drug of hope for hutchinson - gilford progeria syndrome (hgps) and has been successful in facilitating weight gain and improving cardiovascular and skeletal pathologies in progeroid children. this can be considered as the dawn of a new era in progeria research and thus, an apt time to review the research developments in this area highlighting the molecular aspects, experimental models, promising drugs in trial and their implications to gain a better understanding of pss. |
benign prostatic hyperplasia (bph) is a pathological symptom frequently found in the elderly population. treatment options for men with symptomatic bph include active monitoring, phytochemical treatment, medical therapy with -blockers or 5--reductase inhibitors, and surgery (barry., 1997 ; watson., 2004). the use of complementary and alternative medicine (cam) for the treatment of bph patients has a long history, especially in european countries (ortiz, 1998 ; pathak., 2003). nevertheless, there is still a considerable degree of skepticism from the urologic community about the efficiency and safety of these cam products. this is mainly due to the lack of an established mechanism of action for cam (melo., 2002 ; the cam used in this trial was pumpkin seed oil, saw palmetto oil and a combination of pumpkin seed oil and saw palmetto oil (ernst, 2002 ; hirsch, 2000). for these materials, the mechanisms of action may include alteration of cholesterol metabolism, anti - androgenic activity (including 5--reductase inhibitor activity), anti - inflammatory effects, and a decrease in available sex hormone binding globulin (cristoni., 2000). although the mechanisms of action of these materials have been investigated in many in vitro and indirect in vivo studies, they have yet to be clearly defined (shoskes, 2002 ; wilt., 2000). nevertheless, many bph patients are currently taking these cam materials everyday without apparent adverse effects (vickers, 2000). yet, long - term treatment of bph patients with cam is necessary in order to assess the occurrence of side effects. therefore, the objective of this study was to carry out a long - term study to determine the effectiveness and the potential side effects of pumpkin seed oil and/or saw palmetto oil in the treatment of korean men with symptomatic bph. bph patients with an international prostate symptom score (ipss) of 8 or more participated in a randomized, double - blind, placebo - controlled trial of pumpkin seed oil and saw palmetto oil for a 12-month period. volunteers were requested to sign the documents of clinical examinations agreement after careful review of the instructions. clinical examinations were conducted for 18 months at chung - ang university medical center, department of urology. by baseline checkup of general health, patients with any major diseases except bph or patients who had bph related treatment such as 5--reductase inhibitor, -receptor blocker, urogenital surgery or any other alternative therapy for bph were excluded. any other medication or surgery related to bph sixty - two patients were distributed into 4 separate groups according to their time sequence of participation ; group a (placebo, control, sweet potato starch, 320 mg / day), group b (pumpkin seed oil, 320 mg / day), group c (saw palmetto oil, 320 mg / day) and group d (the combination of pumpkin seed oil, 320 mg / day and saw palmetto oil, 320 mg / day). sweet potato starch (bum - ah, seoul, korea), standardized pumpkin seed oil and saw palmetto oil (ria international, new jersey, usa) were prepared in hard capsules. patients took 2 capsules per day in the morning and the evening after a meal, over a 12-month period. after the baseline assessment of general health, each participant visited the hospital every 3 months to measure bph parameters such as ipss, quality of life score (qol), serum prostate specific antigen (psa), prostate volume (pv) and maximal urinary flow rate (mfr). fifteen patients (24%) were dropped during the trial due to aggravation of symptoms (n=13), movement (n=2) and initiation of bph medication (n=1). they have been checked on overall functioning, difficulties with intervention adherence and adverse symptoms weekly by phone, and visited hospital every 3 months. ipss and qol were assessed using standard questionnaire forms (2003 american urology association guideline on the management of bph : diagnosis and treatment recommendations) (zhang., 2008). the questionnaire for ipss is composed with seven questions and each measured on a 5 point scale. for the assessment, the patients responded on a scale of 0 (delighted) to 6 (terrible) to the question, " if you were to spend the rest of your life with your urinary condition just the way it is now, how would you feel about this ? " the serum psa was measured using an electrochemiluminescence method (cho., 2005) 2005) (voluson 730 prov ge healthcare, austria), and mfr was done using an uroflowmeter (willetts., 2003) pv and mfr measurements started after 6 months because the urologists advised that there would not be a significant change over a short period such as the first 3 months of treatment. all patients were measured for body weight, height and body mass index (bmi) (fanics co. ltd, hm-170, korea) at the beginning of the experiment. the differences among groups and experimental periods of each group were analyzed by tukey 's studentized range test for bph parameters. bph parameters for ipss, qol, serum psa, pv and mfr were expressed as the mean standard error, and were age adjusted against group a (control), in which acquired by analysis of covariance (ancova) with least square mean (lsmean). bph patients with an international prostate symptom score (ipss) of 8 or more participated in a randomized, double - blind, placebo - controlled trial of pumpkin seed oil and saw palmetto oil for a 12-month period. volunteers were requested to sign the documents of clinical examinations agreement after careful review of the instructions. clinical examinations were conducted for 18 months at chung - ang university medical center, department of urology. by baseline checkup of general health, patients with any major diseases except bph or patients who had bph related treatment such as 5--reductase inhibitor, -receptor blocker, urogenital surgery or any other alternative therapy for bph were excluded. any other medication or surgery related to bph sixty - two patients were distributed into 4 separate groups according to their time sequence of participation ; group a (placebo, control, sweet potato starch, 320 mg / day), group b (pumpkin seed oil, 320 mg / day), group c (saw palmetto oil, 320 mg / day) and group d (the combination of pumpkin seed oil, 320 mg / day and saw palmetto oil, 320 mg / day). sweet potato starch (bum - ah, seoul, korea), standardized pumpkin seed oil and saw palmetto oil (ria international, new jersey, usa) were prepared in hard capsules. patients took 2 capsules per day in the morning and the evening after a meal, over a 12-month period. after the baseline assessment of general health, each participant visited the hospital every 3 months to measure bph parameters such as ipss, quality of life score (qol), serum prostate specific antigen (psa), prostate volume (pv) and maximal urinary flow rate (mfr). fifteen patients (24%) were dropped during the trial due to aggravation of symptoms (n=13), movement (n=2) and initiation of bph medication (n=1). they have been checked on overall functioning, difficulties with intervention adherence and adverse symptoms weekly by phone, and visited hospital every 3 months. ipss and qol were assessed using standard questionnaire forms (2003 american urology association guideline on the management of bph : diagnosis and treatment recommendations) (zhang., 2008). the questionnaire for ipss is composed with seven questions and each measured on a 5 point scale. for the assessment, the patients responded on a scale of 0 (delighted) to 6 (terrible) to the question, " if you were to spend the rest of your life with your urinary condition just the way it is now, how would you feel about this ? " the serum psa was measured using an electrochemiluminescence method (cho., 2005) (voluson 730 prov ge healthcare, austria), and mfr was done using an uroflowmeter (willetts., 2003) pv and mfr measurements started after 6 months because the urologists advised that there would not be a significant change over a short period such as the first 3 months of treatment. all patients were measured for body weight, height and body mass index (bmi) (fanics co. ltd, hm-170, korea) at the beginning of the experiment. the differences among groups and experimental periods of each group were analyzed by tukey 's studentized range test for bph parameters. bph parameters for ipss, qol, serum psa, pv and mfr were expressed as the mean standard error, and were age adjusted against group a (control), in which acquired by analysis of covariance (ancova) with least square mean (lsmean). the average age of patients who completed the 1 year trial was 53.3 years, and the average age of group d was significantly higher than those of groups b and c (table 1). the average height, weight and bmi of patients were not significantly different among groups, and the average bmis of all groups were within an overweight range based on korean obesity evaluation criteria (lee., 2006). ipsss in groups b, c and d were significantly reduced (p < 0.05) after 3 months of treatment (table 2). ipss of group b was decreased by 12.0 points (58.0% change), from 20.7 to 8.7 after 12-month treatment. ipss of group c was also decreased by 9.2 points (50.3% change), from 18.2 to 9.1. the average ipss of group d showed a constant decline from the beginning (19.0) to the end of the 12-month treatment (4.7) by 14.3 points, indicating 75.3% improvement in voiding symptoms. in particular, bph status of group d was improved from moderate (8~19) to mild (7) according to ipss. the reduction of ipss after 12 month treatment was highest in group d, however, there was no significant difference among the groups. the qol were significantly improved in groups b and c after 3 months, and in group d after 6 months (p < 0.05) (table 3). the qol score of group a (placebo) was not changed, but those of group b and group c were reduced by 1.7 points (40.5% change) and 1.4 points (38.9% change) after 12-month treatment, respectively. the qol score of group d was reduced by 2.2 points (57.9% change) after 12-month treatment. the serum psa levels of groups a, b and c remained unchanged during the 12 month trial. the serum psa levels of group d showed a constant decline from the beginning (1.2 ng / ml) to the end of the 12-month treatment (0.7 ng / ml), indicating 41.7% reduction. the pv of groups b, c and d showed a gradual decline over the experimental period, but these changes were not statistically significant (table 5). as shown in table 6, the mfr of group a was gradually decreased over the experimental period with a worsening in urinary symptoms. the mfr of group b was significantly increased after 6 months and that of group c was significantly increased at 12 months (p < 0.05). the mfr of group b was increased from 14.8 ml / second at the initiation of the study to 17.0 ml / second at the end, for an improvement of 14.9%. the mfr of group c was increased from 14.0 to 21.2 ml / second after 12-month treatment, which was an improvement of 51.4%. the mfr score of group d, however, was not changed significantly during the treatment period. correlation between parameters existed ; ipss vs qol (correlation coefficient = 0.635, p < 0.05), ipss vs mfr (correlation coefficient = -0.375, p < 0.05), qol vs mfr (correlation coefficient = -0.255, p < 0.05), and prostate volume vs serum psa (correlation coefficient = 0.323, p < 0.05). in the meanwhile, there were no statistically significant differences in all bph parameters among groups at every treatment time. the use of phytochemicals (phytosterols) as an alternative therapy for the relief of lower urinary tract symptoms due to a prostatic disease seems to be growing quickly all over the world, including the republic of korea (buck, 2004). a phytochemical based therapy is widely given to men with symptomatic bph in western europe, where physicians prescribe phytochemical products in the same manner as they prescribe drugs (marks. the results of this study show that the symptoms of bph for all patients receiving treatment with pumpkin seed oil, saw palmetto oil, or a combination of pumpkin seed oil plus saw palmetto oil were improved over 12 months, in comparison with placebo. but therapeutic efficiency was not improved by combination of these two compounds. during the experimental period, according to braeckman 's study (1994), oral doses of saw palmetto oil 160 mg twice daily for 3 months improved ipss about 22% after 45 days and 35% at 90 days. this was comparable with our result in which group b (33.8%) and group c (33.2%) showed similar improvement after 3 months. in the study by bach (2000), 12-month pumpkin seed treatment improved the ipss at least 5 points and overall improvement of 64.8%. in a double - blind randomized trial that compared the effects of saw palmetto (320 mg / day) with 5--reductase inhibitor (5 mg / day), the ipss was declined by 37% and 39%, respectively (carraro., 1996) after 6 months of treatment. hisashi. (2005) reported a significant linear relationship between ipss and qol score, a finding in agreement with our own, in which ipss was correlated exactly with qol score. both ipss and qol score tended to decline significantly at the 3rd month of treatment in our study, a finding similar to that of other researchers (nickel, 1998 ; willetts., 2003). there have been recent reports suggesting that the serum psa value may not be the best marker for prostate cancer detection, but it still remains one of the simplest means of early diagnosis and follow - ups for this disease. serum psa is also increased in other conditions such as bph, prostatitis and others (lee., 2005 ; (2002) showed saw palmetto does not affect serum psa level within 12 months of treatment. in our study, only a minimal change of psa was observed within the normal range (0.0~4.0 ng / ml), although a synergistic combination of pumpkin seed oil and saw palmetto oil may have contributed to the decrease of serum psa level observed in our study. braeckman (1994) showed that prostate volume was significantly decreased by 9% after 45 days and 10% after 90 days of treatment with saw palmetto oil. but several of reports demonstrated only a minimal change of prostate volume within 1 year (marks.. we also could not detect any significant decrease of the prostate volume even within 12 months. in a randomized trial of natural products by preuss. (2001), the ipss was decreased significantly after 90 days, but serum psa, mfr and pv were not changed. this is in contrast to the present study in which the serum psa of patients fed the combination of pumpkin seed oil and saw palmetto oil was decreased, and mfr in the pumpkin seed oil group was increased, significantly after 6 months. in a study by moon. (1990), urinary flow rate of bph patients supplemented with sitosterol was increased from a baseline mfr of 9.3 ml / s to 12.2 ml / s after 4 weeks of treatment, and continued to increase consistently for 12 weeks. (1996) reported that the average mfr was increased from 10.36 ml / s to 14.44 ml / s without any adverse effects after 12 months of treatment with saw palmetto oil. in addition, this treatment did not influence the effectiveness of drugs taken for other chronic diseases by these patients. 1990) studied the combination of saw palmetto with pumpkin seed oil and reported a significant increase in mfr value in bph patients after 3 months of treatment. our study showed a similar effectiveness on mfr in the pumpkin seed oil group and the saw palmetto oil group, but the combination of pumpkin seed oil with saw palmetto oil group did not significantly affect mfr. the action mechanism of pumpkin seed oil is well known by its inhibition on 5--reductase which converts testosterone into dht (dihydrotestosterone) (gossell - williams.. meanwhile various action mechanisms are suggested for saw palmetto oil, including nuclear estrogen receptor inhibitor (di silverio., 1992), inhibition of cyclooxygenase and 5-lipoxygenase pathway (breu., 1992) as well as 5--reductase inhibition (weisser., 1996). recently, epithelial contraction in the prostate transition zone was demonstrated by marks. according to the difference in action mechanisms, a synergistic effect on bph was expected from combination treatment of pumpkin seed oil and saw palmetto oil. in our study, combination treatment of pumpkin seed oil and saw palmetto oil induced a higher symptomatic improvement, though not statistically significant, in ipss, qol and psa than a single treatment. a better result is expected by increasing subject numbers and longer observation period as well as in vitro mechanism studies. based on the results of this study, it could be suggested that pumpkin seed oil and saw palmetto oil are clinically safe and may be effective complementary and alternative medicine for bph. | this study was to investigate the role of complementary and alternative medicine in the prevention and treatment of benign prostatic hyperplasia. for this purpose, a randomized, double - blind, placebo - controlled trial was performed over 12 months on 47 benign prostatic hyperplasia patients with average age of 53.3 years and international prostate symptom score over 8. subjects received either sweet potato starch (group a, placebo, 320 mg / day), pumpkin seed oil (group b, 320 mg / day), saw palmetto oil (group c, 320 mg / day) or pumpkin seed oil plus saw palmetto oil (group d, each 320 mg / day). international prostate symptom score, quality of life, serum prostate specific antigen, prostate volume and maximal urinary flow rate were measured. in groups b, c and d, the international prostate symptom score were reduced by 3 months. quality of life score was improved after 6 months in group d, while those of groups b and c were improved after 3 months, compared to the baseline value. serum prostate specific antigen was reduced only in group d after 3 months, but no difference was observed in prostate volume in all treatment groups. maximal urinary flow rate were gradually improved in groups b and c, with statistical significance after 6 months in group b and after 12 months in group c. none of the parameters were significantly improved by combined treatment with pumpkin seed oil and saw palmetto oil. from these results, it is suggested that administrations of pumpkin seed oil and saw palmetto oil are clinically safe and may be effective as complementary and alternative medicine treatments for benign prostatic hyperplasia. |
their high oscillator strength and large exciton binding energies make single - walled carbon nanotubes (swcnts) highly promising materials for the investigation of strong light matter interactions in the near infrared and at room temperature. to explore their full potential, high - quality cavities possibly with nanoscale field localization are required. here, we demonstrate the room temperature formation of plasmon exciton polaritons in monochiral (6,5) swcnts coupled to the subdiffraction nanocavities of a plasmonic crystal created by a periodic gold nanodisk array. the interaction strength is easily tuned by the number of swcnts that collectively couple to the plasmonic crystal. angle- and polarization resolved reflectivity and photoluminescence measurements combined with the coupled - oscillator model confirm strong coupling (coupling strength 120 mev). the combination of plasmon exciton polaritons with the exceptional charge transport properties of swcnts should enable practical polariton devices at room temperature and at telecommunication wavelengths. |
|
the estrogen deficiency or hypoestrogenism associated with menopause is one of many factors that influence the aging process in women. although urothelium sensitivity to estrogenic hormone action has long been known, the urinary bladder being a target organ for the actions of estrogens, the pathophysiologic changes of the urotheluim resulting from menopause is poorly elucidated. because of this, the therapeutic usage of the estrogen - like hormone replacement therapy in the atrophic process of the urinary bladder associated with menopause is still controversial. for the experiment we used thirty young adult wistar female albino rats (weight 23050 g) housed in a conventional animal facility. then the animals were randomly divided into three equal experimental groups : first group which underwent sham operation, representing the reference group (sham group), estrogen group (bov+e) whice received estrogen hormones and untreated ovariectomized group (bov) which received no medication after ovariectomy. in order to observe the effects of the hexestrol diacetate on the urinary bladder urothelium at 14 days after oophorectomy, time required for appearance of the postoperative ovarian hormonal insufficiency, the estrogenic replacement therapy was carried for six weeks by intramuscular administration of 10 g hexestrol diacetate, twice weekly. after this interval the animals were euthanized and necropsied. during necropsy tissue samples were harvested and fixed in 10% neutral buffered formalin. all the experimental protocol used in this study had been approved by the ethics committee of the iuliu haieganu university of medicine and pharmacy (number 621.04/2010). tissue samples after complete aldehyde fixation were routinely processed into paraffin embedded blocks. from each paraffin block multiple sections were cut and stained according to standard protocols by hematoxylin - eosin (he). the tissue processing and analyses followed the international recommendation of the inhand (international harmonization of nomenclature and diagnostic criteria for lesions in rats and mice), both the body and neck of the urinary bladder being submitted to the histopatological examination. the histology slides were examined under an olympus bx microscope and images were obtained with an olympus sp 350 digital camera. for the assessment of the cell proliferative activity of the bladder s urothelium we used the immunohistochemical expression of the proliferating cell nuclear antigen (pcna) (dako danmark, cat. the antigens from tissue sections were unmasked by boiling for 3 minutes in ph 6 sodium citrate buffer. the activity of the endogenous peroxidase and alkaline phosphatase were suppressed using the dual endogenous enzyme - blocking reagent from dako (product no. s200389). after blocking the antibody specific binding sites, slides were incubated with primary antibodies for 2 hour at room temperature in a humid chamber. the antigens expression was detected using the universal lsab - hrp kit (dako, product no. the positive antibody reaction was observed by incubation of the slides with diaminobenzidine for 12 minutes. finally slides were counterstained with mayer s hematoxylin (dako, product no. s330930) and mounted with an xylen compatible medium (merck, germany). for quantification of the pcna and caspase 3 urothelial expression, we followed the protocol previously used by thiruchelvam. for immunohistochemical assessment of the proliferative and apoptotoc activity in the urinary bladder. briefly, nuclei were counted on 1020 microscopic fields at 20x amplification so that on each analyzed bladder sample 1,000 nuclei being counted. the proliferative and apoptotic index of the urotelium results from the percentage of immunolabeled cells positive for pcna and respective for caspase 3. the statistical test used in the calculation and interpretation of our results is the mono - factorial analysis system anova, p value of < 0.05 being considered statistically significant. for the experiment we used thirty young adult wistar female albino rats (weight 23050 g) housed in a conventional animal facility. then the animals were randomly divided into three equal experimental groups : first group which underwent sham operation, representing the reference group (sham group), estrogen group (bov+e) whice received estrogen hormones and untreated ovariectomized group (bov) which received no medication after ovariectomy. in order to observe the effects of the hexestrol diacetate on the urinary bladder urothelium at 14 days after oophorectomy, time required for appearance of the postoperative ovarian hormonal insufficiency, the estrogenic replacement therapy was carried for six weeks by intramuscular administration of 10 g hexestrol diacetate, twice weekly. after this interval the animals were euthanized and necropsied. during necropsy tissue samples were harvested and fixed in 10% neutral buffered formalin. all the experimental protocol used in this study had been approved by the ethics committee of the iuliu haieganu university of medicine and pharmacy (number 621.04/2010). tissue samples after complete aldehyde fixation were routinely processed into paraffin embedded blocks. from each paraffin block multiple sections were cut and stained according to standard protocols by hematoxylin - eosin (he). the tissue processing and analyses followed the international recommendation of the inhand (international harmonization of nomenclature and diagnostic criteria for lesions in rats and mice), both the body and neck of the urinary bladder being submitted to the histopatological examination. the histology slides were examined under an olympus bx microscope and images were obtained with an olympus sp 350 digital camera. for the assessment of the cell proliferative activity of the bladder s urothelium we used the immunohistochemical expression of the proliferating cell nuclear antigen (pcna) (dako danmark, cat. the antigens from tissue sections were unmasked by boiling for 3 minutes in ph 6 sodium citrate buffer. the activity of the endogenous peroxidase and alkaline phosphatase were suppressed using the dual endogenous enzyme - blocking reagent from dako (product no. after blocking the antibody specific binding sites, slides were incubated with primary antibodies for 2 hour at room temperature in a humid chamber. the antigens expression was detected using the universal lsab - hrp kit (dako, product no. the positive antibody reaction was observed by incubation of the slides with diaminobenzidine for 12 minutes. for quantification of the pcna and caspase 3 urothelial expression, we followed the protocol previously used by thiruchelvam. for immunohistochemical assessment of the proliferative and apoptotoc activity in the urinary bladder. briefly, nuclei were counted on 1020 microscopic fields at 20x amplification so that on each analyzed bladder sample 1,000 nuclei being counted. the proliferative and apoptotic index of the urotelium results from the percentage of immunolabeled cells positive for pcna and respective for caspase 3. the statistical test used in the calculation and interpretation of our results is the mono - factorial analysis system anova, p value of < 0.05 being considered statistically significant. the histopathological aspect observed in the urothelium of the bov group was the marked atrophy, aspect suggested by the decreased thickness of urothelium, presence of cells with intensely eosinophilic cytoplasm, hyperchromatic nuclei and loss of intercellular junctions (figure 1). the morphologic changes were also observed in the urothelium of the bov+e group, but the atrophic phenomenon was present in a lesser form than those observed in the bov group. interesting in the bov+e group was the alternation between thickened, hyperplastic areas of urothelium and of normal - looking urothelium were noticed. regarding the urothelium proliferative activity, a state highlighted by immunohistochemical expression of pcna, in all the studied groups we observed cells with division activity (cells in the s phase of the cell cycle). important differences between groups were reflected primarily in the number of cells that have proliferative activity as well as in the arrangement of these cells within the three areas of the urothelium. thus, if the proliferation index for the reference group was 3411%, for the bov+e group it had a tendency to increase (p<0.05) to values of 4314% (figure 2a). for the bov group, distribution of pcna positive cells in the control group was predominant in the basal layer of the urothelium, uniformly distributed in the basal layer of cells and in a lesser amount in the intermediate layer of urothelium. the pcna positive cells in the bov group were unevenly distributed, areas of intense immunolabeled cells alternating with negative groups of cells in both basal and intermediate layers of urothelium. for the bov+e group the distribution of the pcna positive cells within the urothelial layers was uniform, positive cells being observed both in the basal layer and the intermediate one. thus, if in the control group the apoptotic activity was observed almost exclusively in the outer cell layers of the urothelium, with an apoptotic index of 0.50.1% for the ovariectomized groups, the apoptotic index had a significant increase reaching 1.250.1% for bov+e group and 1.760.8% for bov group. significant differences were observed between bov+e and bov groups, the number of cells following apoptosis being significantly reduced for bov+e group compared with the bov group. for both ovariectomized groups the distribution of cells that undergo thus, for both bov+e and bov groups caspase 3 positive cells were observed in the superficial and intermediate layers or even in the baseline. the histopathological aspect observed in the urothelium of the bov group was the marked atrophy, aspect suggested by the decreased thickness of urothelium, presence of cells with intensely eosinophilic cytoplasm, hyperchromatic nuclei and loss of intercellular junctions (figure 1). the morphologic changes were also observed in the urothelium of the bov+e group, but the atrophic phenomenon was present in a lesser form than those observed in the bov group. interesting in the bov+e group was the alternation between thickened, hyperplastic areas of urothelium and of normal - looking urothelium were noticed. regarding the urothelium proliferative activity, a state highlighted by immunohistochemical expression of pcna, in all the studied groups we observed cells with division activity (cells in the s phase of the cell cycle). important differences between groups were reflected primarily in the number of cells that have proliferative activity as well as in the arrangement of these cells within the three areas of the urothelium. thus, if the proliferation index for the reference group was 3411%, for the bov+e group it had a tendency to increase (p<0.05) to values of 4314% (figure 2a). for the bov group, the divisional activity of urothelium did not change significantly from the sham group. distribution of pcna positive cells in the control group was predominant in the basal layer of the urothelium, uniformly distributed in the basal layer of cells and in a lesser amount in the intermediate layer of urothelium. the pcna positive cells in the bov group were unevenly distributed, areas of intense immunolabeled cells alternating with negative groups of cells in both basal and intermediate layers of urothelium. for the bov+e group the distribution of the pcna positive cells within the urothelial layers was uniform, positive cells being observed both in the basal layer and the intermediate one. thus, if in the control group the apoptotic activity was observed almost exclusively in the outer cell layers of the urothelium, with an apoptotic index of 0.50.1% for the ovariectomized groups, the apoptotic index had a significant increase reaching 1.250.1% for bov+e group and 1.760.8% for bov group. significant differences were observed between bov+e and bov groups, the number of cells following apoptosis being significantly reduced for bov+e group compared with the bov group. for both ovariectomized groups the distribution of cells that undergo thus, for both bov+e and bov groups caspase 3 positive cells were observed in the superficial and intermediate layers or even in the baseline. estrogen hormones play a key role in maintaining the normal morphology and function of the lower urinary tract, role which is modulated directly through estrogen receptors (er and er) found on the urothelium or indirectly folowing alternative route through a rapid pathway, unmediated by estrogen receptor. significant decreases in the level of estrogens consecutive to spontaneous or surgically induced menopause results in important urothelial atrophy, atrophy which is based mainly on an increase of apoptotic activity in the urothelium. as in the study of aikawa, we also found that substitutive administration of estrogens led to a decrease of apoptotic cells in the urothelium and also a reduction of the atrophic effects in the urothelium secondary of the surgically induced menopause. here we include the effect of estrogens on the expression of the proteins of bcl2 family, especially on the expression of bax protein. in the urothelium of rats a reduced amount of bax protein, one of the most important proapoptotic proteins in eukaryotic cells, was observed after estrogen supplementation in a surgically induced model of menopause. another mechanism by which estrogen contributes to the integrity of the urothelium is that estrogens promote, in normal and tumoral cells, the cell survival, this mechanism being important especially in pathological situation in which the cellular stress grows. the protective effect of estrogens on the urothelium is mediated also by increasing the blood amount in the bladder s wall and by raising the amount of glycosaminoglycans from the superficial layers of the urothelium. one of the most important factors which modulate urothelial cell proliferation and differentiation are estrogens, especially 17b - estradiol, by activating the two estrogenic cell receptors er and er. a growth in the number of cell in division from the urothelium found in our study could be linked to the activation of the cyclin d1 by estrogens, cyclin d1 having a prime role in triggering the cellular division in the urothelium. the important role of estrogen in maintaining the urothelium integrity is emphasized by the fact that hormone replacement therapy reduces the atrophy and apoptotic phenomena at this level, while promoting the urothelium proliferative activity. the presented findings demonstrate that proliferative and apoptotic activity of the urinary bladder urothelium is significantly affected the systemic level of estrogen hormones. in addition, systemic administration of the hexestrol diacetate has an important effect on bladder urothelium turnover by modulating the proliferative and apoptotic activity of the urothelial cells. | aimsin this study we followed the effect of menopause and estrogenic replacement therapy on the proliferative and apoptotic activity of the bladder urothelial cells.methodsthe experimental model of menopause was reproduced using a standard protocol of bilateral ovariectomy in rats, estrogen replacement therapy being achieved by systemic administration of hexestrol diacetate for six weeks. proliferative and apoptotic activity was monitored by quantifying the urothelium imunoexpression for pcna antigen as a marker of s phase of the cell cycle and cleaved caspase 3 for monitoring apoptotic activity.resultsfollowing ovariectomy, the main changes were urothelial atrophy associated with intensification of the apoptotic activity at these level. estrogen therapy managed to improve the urothelium activity by reducing the apoptotic index and by increasing urothelial proliferative activity.conclusionsthe results show the important role of estrogens in maintaining urothelial activities, highlighting their potential use in the treatment of urothelium atrophic and degenerative processes associated with menopause. |
tuberculosis is the major cause of skeletal infection in the developing countries. skeletal tuberculosis accounts for 10 35 % of extra pulmonary tuberculosis and only 2 % of all cases of tuberculosis. less than one percent of skeletal tuberculosis occurs in the shoulder. we reviewed all the previous reports of scapular tuberculosis in english literature to analyse the common clinical presentation, the site of occurrence in scapula and radiographic appearance. a 17-year - old male presented with dull aching pain and gradually progressive swelling over the left scapular region since five months. physical examination revealed a swelling of 3 x 3 cm which was located in the left supraspinous region. terminal range of motion was restricted with pain especially during the last 15 of abduction. his blood investigations were unremarkable with esr of 15 mm / hr. anteroposterior radiograph of left shoulder revealed a well defined, 4 x 3 cm osteolytic lesion at the superomedial aspect of body of scapula, with surrounding sclerosis [fig.1 ]. his chest radiograph was normal. since appearance was similar to a bone tumor, differentiation was important and work up on same lines was planned. whole body bone scan showed abnormal increase in tracer uptake in the body of scapula with the rest of the skeleton being normal. computer tomography (ct) showed erosions involving the supero - medial aspect of the body of scapula and along the base of the spinous process of scapula [fig. 2 and fig.3 ]. magnetic resonance imaging (mri) scan revealed a well- defined lobulated lesion [fig.4 ]. a ct guided biopsy was done tissue and fluid were sent for cultures and histopathology. biopsy revealed granulomas composed of epithelioid cells, lymphocytes and a few multinucleate giant cells suggestive of tuberculosis. preoperative anteroposterior radiograph of the left shoulder showing osteolytic lesion in the superomedial aspect of scapula with surrounding sclerosis computer tomograph 3d reconstruction images showing erosive lesions on the body of scapula around the spinous process. computer tomograph showing erosion of the left scapula magnetic resonance imaging showing the extent of cold abcess he was started on antitubercular therapy for a period of nine months. at one year follow up, he had painfree full range of movements of shoulder. a 17- year old girl presented with swelling over her right upper back since three months. physical examination revealed a 6 x7 cm soft, cystic and fluctuant swelling over the right scapular region [fig.5 ]. clinical photograph of the patient demonstrating cold abscess on the right scapular region there were no discharging sinuses. blood investigations revealed hemoglobin of 10.3 gm %, total count of 11,300 and the erythrocyte sedimentation rate was 97mm / hr. radiograph showed an osteolytic lesion in the inferior angle of scapula with surrounding sclerosis [fig. 6 ]. computer tomography of thorax showed a large well defined homogenously hypoechoic mass measuring about 63 69 mm in the posterior chest wall, abutting and infiltrating right trapezius, supraspinatus, infraspinatus and lattissimus dorsi, with extension into the right axilla. there were erosions and destruction of inferior angle of the right scapula with suspected sequetra [fig. all these features were suggestive of abscess in the posterior chest wall with osteomyelitis of right scapula. ultrasonography of the abdomen was normal. she underwent incision and drainage of the abscess along with debridement, sequestrectomy and curettage of right scapula [fig.8 ]. mycobacterial culture (lowenstein jensen medium) demonstrated acid fast bacilli typical of mycobacterium tuberculosis after six weeks which was sensitive to all the first line antituberculous drugs. biopsy showed inflammatory granulation tissue and fibroadipose tissue containing discrete confluent granulomas composed of epithelioid histiocytes and langhans type multinucleate giant cells surrounded by a dense infiltrate of lymphocytes, plasma cells, and aggregates of neutrophils. she had complete resolution of symptoms and no recurrence at the end of three year follow up. anteroposterior preoperative radiograph of the right shoulder showing an osteolytic lesion in the inferior angle of scapula computer tomograph axial images showing involvement of scapula and multiple sequestra. a 17-year - old male presented with dull aching pain and gradually progressive swelling over the left scapular region since five months. physical examination revealed a swelling of 3 x 3 cm which was located in the left supraspinous region. terminal range of motion was restricted with pain especially during the last 15 of abduction. his blood investigations were unremarkable with esr of 15 mm / hr. anteroposterior radiograph of left shoulder revealed a well defined, 4 x 3 cm osteolytic lesion at the superomedial aspect of body of scapula, with surrounding sclerosis [fig.1 ]. his chest radiograph was normal. since appearance was similar to a bone tumor, differentiation was important and work up on same lines was planned. whole body bone scan showed abnormal increase in tracer uptake in the body of scapula with the rest of the skeleton being normal. computer tomography (ct) showed erosions involving the supero - medial aspect of the body of scapula and along the base of the spinous process of scapula [fig. 2 and fig.3 ]. magnetic resonance imaging (mri) scan revealed a well- defined lobulated lesion [fig.4 ]. a ct guided biopsy was done tissue and fluid were sent for cultures and histopathology. biopsy revealed granulomas composed of epithelioid cells, lymphocytes and a few multinucleate giant cells suggestive of tuberculosis. preoperative anteroposterior radiograph of the left shoulder showing osteolytic lesion in the superomedial aspect of scapula with surrounding sclerosis computer tomograph 3d reconstruction images showing erosive lesions on the body of scapula around the spinous process. computer tomograph showing erosion of the left scapula magnetic resonance imaging showing the extent of cold abcess he was started on antitubercular therapy for a period of nine months. at one year follow up, he had painfree full range of movements of shoulder. a 17- year old girl presented with swelling over her right upper back since three months. physical examination revealed a 6 x7 cm soft, cystic and fluctuant swelling over the right scapular region [fig.5 ]. clinical photograph of the patient demonstrating cold abscess on the right scapular region there were no discharging sinuses. blood investigations revealed hemoglobin of 10.3 gm %, total count of 11,300 and the erythrocyte sedimentation rate was 97mm / hr. radiograph showed an osteolytic lesion in the inferior angle of scapula with surrounding sclerosis [fig. computer tomography of thorax showed a large well defined homogenously hypoechoic mass measuring about 63 69 mm in the posterior chest wall, abutting and infiltrating right trapezius, supraspinatus, infraspinatus and lattissimus dorsi, with extension into the right axilla. there were erosions and destruction of inferior angle of the right scapula with suspected sequetra [fig. all these features were suggestive of abscess in the posterior chest wall with osteomyelitis of right scapula. she underwent incision and drainage of the abscess along with debridement, sequestrectomy and curettage of right scapula [fig.8 ]. mycobacterial culture (lowenstein jensen medium) demonstrated acid fast bacilli typical of mycobacterium tuberculosis after six weeks which was sensitive to all the first line antituberculous drugs. biopsy showed inflammatory granulation tissue and fibroadipose tissue containing discrete confluent granulomas composed of epithelioid histiocytes and langhans type multinucleate giant cells surrounded by a dense infiltrate of lymphocytes, plasma cells, and aggregates of neutrophils. she had complete resolution of symptoms and no recurrence at the end of three year follow up. anteroposterior preoperative radiograph of the right shoulder showing an osteolytic lesion in the inferior angle of scapula computer tomograph axial images showing involvement of scapula and multiple sequestra. tuberculosis is a major health problem in the developing countries. despite recent advances in its diagnosis and treatment, it has become a global epidemic with the emergence of hiv infection and multidrug resistance. skeletal tuberculosis occurs secondary to hematogenous spread from primary focus which are usually pulmonary or lymph nodes.. less than 1% of all skeletal tuberculosis affects the shoulder, a fraction of it involves the scapula. clinically, the findings with restricted shoulder movements may mimic frozen shoulder and the diagnosis is delayed or missed. radiographs usually show osteopenia, osteolytic lesion with poorly defined edges and varying amounts of sclerosis and periostitis. ct and mri are useful to delineate the extent of the lesion. the differential diagnosis for a lytic lesion on radiograph are pyogenic infections both bacterial and fungal, tumours like bone cysts, telangiectatic osteosarcoma, sarcoidosis or eosinophilic granuloma. hence tissue biopsy is important in the diagnosis of the condition. though afb smear is not very sensitive, mycobacterial cultures are specific. biopsy showing epitheloid granulomas and caseous necrosis is gold standard in the diagnosis of tuberculosis. we did a literature review on isolated scapular tuberculosis and found ten reported cases [table 1 ]. the most common presentation was pain and swelling and only two patients had discharging sinus. cold abscess was present in 70 % of the cases and only 30 % of all patients had systemic features like fever, loss of weight and appetite. out of the twelve cases, six occurred in the body, three in the spine of scapula, two in the inferior angle and one in acromion. seventy percentage of the cases were under 30 years of age while 90% of cases presented before six months from the onset of symptoms. all patients had osteolytic lesions on radiographs, with 60 % of them had marginal sclerosis. review of literature of previously reported cases of isolated scapular tuberculosis analysis of all twelve patients with isolated scapula tuberculosis the main step in the diagnosis of skeletal tuberculosis is thorough clinical and radiological examination. from our analysis, tuberculosis of the scapula must be suspected if a patient presents with age less than 30 years, with pain and swelling in the scapular region less than six months duration and radiographs showing osteolytic lesion with surrounding marginal sclerosis. though rare, tuberculosis should always be suspected in isolated scapular swelling in developing countries. surgery is advised only if there is giant sequestra or when there are no signs of improvement 3 to 4 weeks after initiating antitubercular therapy. both patients showed dramatic improvement with nine months of therapy and showed complete resolution of the disease. since all the patients reported so far with isolated involvement of scapula are immunocompetent, may be there was less chance of dissemination and none of them were multidrug resistant. high index of suspicion is necessary to identify scapular involvement in all patients with shoulder pain. thorough clinical and radiological examination is necessary to avoid misdiagnosis, as most shoulder problems are treated as periarthritis or frozen shoulder. radiographs should be overlooked to identify any lesion in acromian, clavicle, scapula, coracoid process other than head of humerus. to conclude, high index of suspicion is necessary for diagnosing this condition in endemic areas. | introduction : isolated tuberculosis of the scapula is rare. the presentation mimics the tumors of scapula. hence it is important to know the clinical presentation and when to suspect tubercular osteomyelitis of scapula. few cases have been described before. we have analyzed all reports with isolated scapular tuberculosis so far and described the varied presentations.case report : we report two cases of isolated scapular tuberculosis. one patient underwent aspiration and was started on antituberculous drugs (att) and the other underwent debridement, drainage of abscess and then was started on att. both had excellent outcomes at the end of one year follow up. we reviewed previous published literature of isolated scapular tuberculosis. the most common presentation of scapular tuberculosis is as follows : age less than 30 years and there is no difference with respect to gender. swelling and pain are the commonest symptoms. lytic areas with surrounding sclerosis is the commonest radiological finding. body of the scapula is affected most commonly. prognosis is excellent with adequate treatment.conclusion:to conclude, clinicians should have high index of suspicion for diagnosing this condition as it mimics tumors. pain and swelling is the most common presentation of scapular tuberculosis. radiography shows lytic lesion with marginal sclerosis. the prognosis is excellent with appropriate treatment. |
chyle is composed of albumin, emulsified fat and fibrin. in tropical country like india, chyluria is a chronicsequelae of filariasis. up to 10% patient with filariasis may experience chyluria in tropical countries (1). chyluria has no sex predilection ; but young adult male from poor socio - economic background are mainly affected (2). it is recognized as tropical disease associated with spontaneous remissions and exacerbation (3). in our state, it is not uncommon to find pregnant females with chyluria. the study aims to present our experience of managing 43 cases with chyluria during pregnancy over a period of ten years from july 2003 to june 2014. forty three pregnant female patients, who presented to the department of urology, igims, patna, from july 2003 to june 2014, were evaluated for chyluria (tables 1 - 3). all the patients were evaluated by history, physical examination, routine examination of urine for chyle and chylomicron, culture sensitivity of urine, complete blood count (cbc) tests, blood sugar, renal function test, post prandial glucose test for chyle in urine, zeihl - nelson staining for acid fast bacilli, ultrasonography, cystourethros copy for lateralization and to exclude other pathology. all the patients were managed initially by conservative means - bed rest, high protein diet, and avoidance of fat, oil, milk, and milk product. all patients were administered isoxsuprine hydrochloride (10 mg) 1 tab twice daily for two days prior to the procedure and continued two days after completion of procedure. ceftriaxone l gwas injected just before the procedure. under local an aesthesia (2% xylocaine jelly instilled in urethra), cystoscope was passed into the bladder, bladder washed and cleared of clots and side of chylus efflux determined. with the help of ureteric catheter 10 ml solution of sclerosant (5 ml of 10% povidone iodine was mixed with normal saline in equal amount to make it 10 ml) instilled slowly into renal pelvis. after eight hours, 5 ml of 25% dextrose mixed with normal saline in equal amount to make it 10 ml was again instilled. ureteric catheter was left indwelling and for next two days and same solution was instilled alternately at an interval of eight hours. two patients underwent mtp after failure of sclerotherapy or because of personal preference in desperate cases. in overall, 67.44% of patients were in the age group of 20 to 30 years followed by 30.23% in the age group of 30 to 40 years. 74.41% of the patients were referred to us in their second trimester followed by third trimester (13.95%) and least in first trimester. thirteen patients (30.33%) hadchyluria before pregnancy. in our series, about half (n = 21) patient presented with chyluria only while others presented with other associated symptoms like dysuria (n = 6), chyluria mixed with hematuria (n = 3), urinary retention (n = 10), fever / uti (n = 4), and decreased fetal movement (n = 4) (table 4). after one course of sclerotherapy thirteen patients improved, 19 patients needed second course of sclerotherapy, while two patients who presented in first trimester underwent medical termination of pregnancy at their own choice. caesarian section was done in three patients, two of them at 37 weeks of pregnancy and one at 40 weeks of pregnancy after failure of sclerotherapy. one patient who did not improve even after caesarean section responded to conservative management and four weeks course of diethyl carbamazine (100 mg three times a day). colicky pain developed in eight patients just after sclerosant instillation and in four patient urine output decreased while four patients developed transient fever and two patients developed urinary tract infection (table 4). chyluria is a state of lymphourinary reflux via fistulous communications secondary to lymphatic stasis caused by obstruction of the lymphatic flow (10). it is a form of chronic filarial syndrome, caused by intermittent discharge of intestinal lymph (chyle) into the renal pelvis and finally into the urine (2). chyluria is generally thought as harmless conditions in majority but in our part of state fatal outcome has been seen when not properly managed. persistent chyluria can lead to malnutrition due to loss of protein and lipid (12). it becomes more important to diagnose and aggressively treat pregnant patient to prevent morbidity and mortality of mother and child. chyluria is a urological manifestation of lymphatic system disease which may lead to nutritional deficiency, recurrent clot colic, urinary retention, urinary tract infection, hematuria and a state of compensated immunosuppression. chyluria may lead to serious immunological and hemostatic deficit due to igg and iga deficiency (13). there are various theories regarding development of chyluria ; but nowadays, two theories have been implicated as causative factors them : obstructive theory [aye and aung, 1975 (14) ] regurtitative theory [ngan and leong, 1977 (15) ] this is the commonest form in india and mainly associated with wuchereria bancrofti infection. non parasitic causes includes tuberculosis, congenital lymphangioma of urinary tract, trauma, pregnancy, malignant infiltration of lymphatics (13). the most common etiological factor for chyluria is filariasis and should be considered filarial unless proven otherwise particularly in filarial belt (10). chyluria is the end result of impairment of retroperitoneal lymphatics due to vicious cycle of infection sclerosis obstructive retrograde dilatation, stasis backflow and spontaneous rupture with fistualisation into the urinary tract. in the present study we encountered half of the patients (n = 21) were suffering from chyluriaalone followed by urinary retention (n = 10) dysuria (n = 6) fever and decreased fetal movement (n = 4 each) and hematuria (n = 3). there are so many investigations for diagnosis and management of chyluria apart from routine examination of blood and urine. specialized tests are test for chyle in urine i.e. ether test, methylene blue test, afb in three consecutive morning sample of urine. detection of microfilaria is described in centrifuged preparations of cystoscopically catheterized urine, but very rarely in normally voided urine samples specially the chylous sample (16). other tests are radiological i.e. retrograde pyelography, lymphangiography, lymphangioscintigraphy, intravenous pyelography, ct - scan, mri, ultrasonography, enzyme linked immunosorbent assay (elisa) for filarial antigen in blood and antibodies specific to recombinant filarial antigen wbsxp - i have been used to develop in elisa for detecting circulating antigen filarial in serum of patient with filariasis (17). another elisa to detect specific igg4 antibodies in un - concentrated urine has been developed (18). recently, triglyceride has been demonstrated to be universally present in chyluria, even in clear urine. the amount of triglyceride has been found to be directly proportional to haziness of chylous urine. we tailored investigation to routine examination of urine, acetic acid test, afb in three morning sample of urine, investigation to test for chyle in urine after injestion of 75 g of butter on night before the test and send first morning sample of urine (ether test) and urethrocystos copy and lateralization. addition of few drops of 10% acetic acid in 1 ml of chylous urine clears the opacity in cases of phosphaturia, while opacity persists in chyuria (20). equal part of chylous urine and ether mixed in a test tube and shaken vigorously. hematinic multivitamins some patients improve (n = 6) but this should not be tried for more than two weeks. if symptoms not improve, because of devastating squeal due to loss of protein and immunoglobulinssclero therapy should started without delay. diethyl carbamazine should not be used in pregnant patient because its safety has not been established in pregnancy ; although, it is being used by some physician in these cases without reported ill effect on foetus. in our study we found that most of the patient (32/37) improved by three day regimen of sclerotherapy with 10% povidone iodine mixed with equal amount of normal saline and 25% dextrose. outcome of pregnancy was not affected with this regime and all the patient deliver full term healthy baby. there are various agent used for sclerotherapy such as agno3, povidone iodine, dextrose and radiographic contrast material in different concentrations. severe and fatal complications such as interstitial nephritis, papillary necrosis, acute tubular necrosis are associated with use of silver nitrate as sclerosant in chyluria. mortality has been reported due to acute tubular necrosis on instillation of silver nitrate in both ureters (21, 22). it is as effective as 1% agno3 but not associated with severe and fatal complications such as interstitial nephritis, papillary necrosis and acute tubular necrosis. combination of sclero therapy using a 5% povidone iodine and 50% dextrose solution has been found to be safe and cost - effective minimally - invasive therapy for chyluria refractory to conservative treatment. a 5 ml of 50% dextrose combined with 5 ml 0.2% povidone iodine provides stronger and better fibrotic response (9). different workers (8, 9, 23, 24) found 87 - 100% success rate of sclerotherapy with betadine alone or in combination with dextrose. our success rate with combination sclerotherapy of betadine and dextrose was 86.2%, which is similar to result of other workers (table 5). complications of sclerotherapy was transient hematuria (n = 10) which developed after two days of sclerotherapy, which was managed by abandoning the procedure, hydration of patient and antibiotic coverage. colicky pain developed in 8 patients just after instillation of sclerosant which subsided in 10 minutes period. few patients required antispasmodic decreased urine output developed in 4 patients which was managed by of of diuretics for two to three days and adequate hydration. nausea and vomiting developed in two patients managed by antiemetic drugs. by dietary restriction and bed sclerotherapy with 10% povidone iodine and 25% dextrose is a safe and effective method with high cure rate. non parasitic causes includes tuberculosis, congenital lymphangioma of urinary tract, trauma, pregnancy, malignant infiltration of lymphatics (13). non parasitic causes includes tuberculosis, congenital lymphangioma of urinary tract, trauma, pregnancy, malignant infiltration of lymphatics (13). the most common etiological factor for chyluria is filariasis and should be considered filarial unless proven otherwise particularly in filarial belt (10). chyluria is the end result of impairment of retroperitoneal lymphatics due to vicious cycle of infection sclerosis obstructive retrograde dilatation, stasis backflow and spontaneous rupture with fistualisation into the urinary tract. pregnant female with chyluria may present as monosymptomatic or may be polysymptomatic. in the present study we encountered half of the patients (n = 21) were suffering from chyluriaalone followed by urinary retention (n = 10) dysuria (n = 6) fever and decreased fetal movement (n = 4 each) and hematuria (n = 3). there are so many investigations for diagnosis and management of chyluria apart from routine examination of blood and urine. specialized tests are test for chyle in urine i.e. ether test, methylene blue test, afb in three consecutive morning sample of urine. detection of microfilaria is described in centrifuged preparations of cystoscopically catheterized urine, but very rarely in normally voided urine samples specially the chylous sample (16). other tests are radiological i.e. retrograde pyelography, lymphangiography, lymphangioscintigraphy, intravenous pyelography, ct - scan, mri, ultrasonography, enzyme linked immunosorbent assay (elisa) for filarial antigen in blood and antibodies specific to recombinant filarial antigen wbsxp - i have been used to develop in elisa for detecting circulating antigen filarial in serum of patient with filariasis (17). another elisa to detect specific igg4 antibodies in un - concentrated urine has been developed (18). recently, triglyceride has been demonstrated to be universally present in chyluria, even in clear urine. the amount of triglyceride has been found to be directly proportional to haziness of chylous urine. we tailored investigation to routine examination of urine, acetic acid test, afb in three morning sample of urine, investigation to test for chyle in urine after injestion of 75 g of butter on night before the test and send first morning sample of urine (ether test) and urethrocystos copy and lateralization. addition of few drops of 10% acetic acid in 1 ml of chylous urine clears the opacity in cases of phosphaturia, while opacity persists in chyuria (20). equal part of chylous urine and ether mixed in a test tube and shaken vigorously. cleared urine indicates chyluria. by conservative management with rest, high protein diet, hematinic multivitamins some patients improve (n = 6) but this should not be tried for more than two weeks. if symptoms not improve, because of devastating squeal due to loss of protein and immunoglobulinssclero therapy should started without delay. diethyl carbamazine should not be used in pregnant patient because its safety has not been established in pregnancy ; although, it is being used by some physician in these cases without reported ill effect on foetus. in our study we found that most of the patient (32/37) improved by three day regimen of sclerotherapy with 10% povidone iodine mixed with equal amount of normal saline and 25% dextrose. outcome of pregnancy was not affected with this regime and all the patient deliver full term healthy baby. there are various agent used for sclerotherapy such as agno3, povidone iodine, dextrose and radiographic contrast material in different concentrations. severe and fatal complications such as interstitial nephritis, papillary necrosis, acute tubular necrosis are associated with use of silver nitrate as sclerosant in chyluria. mortality has been reported due to acute tubular necrosis on instillation of silver nitrate in both ureters (21, 22). it is as effective as 1% agno3 but not associated with severe and fatal complications such as interstitial nephritis, papillary necrosis and acute tubular necrosis. combination of sclero therapy using a 5% povidone iodine and 50% dextrose solution has been found to be safe and cost - effective minimally - invasive therapy for chyluria refractory to conservative treatment. a 5 ml of 50% dextrose combined with 5 ml 0.2% povidone iodine provides stronger and better fibrotic response (9). different workers (8, 9, 23, 24) found 87 - 100% success rate of sclerotherapy with betadine alone or in combination with dextrose. our success rate with combination sclerotherapy of betadine and dextrose was 86.2%, which is similar to result of other workers (table 5). complications of sclerotherapy was transient hematuria (n = 10) which developed after two days of sclerotherapy, which was managed by abandoning the procedure, hydration of patient and antibiotic coverage. colicky pain developed in 8 patients just after instillation of sclerosant which subsided in 10 minutes period. few patients required antispasmodic decreased urine output developed in 4 patients which was managed by of of diuretics for two to three days and adequate hydration. nausea and vomiting developed in two patients managed by antiemetic drugs. by dietary restriction and bed sclerotherapy with 10% povidone iodine and 25% dextrose is a safe and effective method with high cure rate. | background : chyluria i.e. passage of chyle in urine, giving it milky appearance, is common in many parts of india but rare in west. very few case of chyluria in pregnant female has been reported in literature. persistence of this condition may have deleterious effects on health of child and mother. in the present study 43 cases of chyluria during pregnancy and their management seen over a period more than 10 years have been presented.objectives:the study aims to present our experience of managing 43 cases with chyluria during pregnancy over a period of ten years from july 2003 to june 2014.patients and methods : forty three pregnant patients with chyluria, who presented between july 2003 to june 2014 to the department of urology, indira gandhi institute of medical sciences, patna were included. patients underwent conservative management and/or sclerotherapy after evaluation. follow - up of all patients was done by observation of urine color, routine examination of urine and test for post prandial chyle in urine up to 3 months after delivery.results:conservative management by dietary restriction of fat and physical rest was successful in six patients. thirteen patients improved after first course of sclerotherapy with 10% povidone iodine and 25% dextrose and 19 patients improve after second session. in non - responders, three patients who were near term underwent caesarian section while two patients opted for medical termination of pregnancy at their own will. after sclerotherapy, minor complications like clot retention, fever, hematuria, and abdominal pain were observed in small number of patients and managed symptomatically.conclusions:sclerotherapy for symptomatic relief of chyluria during pregnancy showed high response rate (86.2%) in short term follow - up. sclerotherapy with 10% povidone iodine and 25% dextrose combination have been proved safe and effective during pregnancy. medical termination of pregnancy and cesarean section (those near term) may be the options in resistant cases not responding to sclerotherapy. |
gingival recession, due to trauma, inflammatory conditions or anatomic factors is defined as partial denudation of the root surface due to apical migration of the gingival margin. indications including esthetics, defect progression, hypersensitivity, or difficulties with oral hygiene support the use of periodontal plastic surgical procedures. current case reports introduce a novel, minimally invasive approach, i.e. vestibular incision subperiosteal tunnel access (vista). this entails making an access incision in the maxillary anterior frenum, followed by elevation of a subperiosteal tunnel. a case of millers class i and class ii multiple gingival recession in the maxillary anterior region extending from 13 to 23 was reported to the department of periodontics [figure 2 ], the oxford dental college and hospital, bangalore. at the initial visit, thorough scaling and root planing was performed, patient was put on strict oral hygiene maintenance and recalled after 1-week. the vista approach began with a vestibular access incision in the midline of the maxillary frenum [figure 3 ], which provided access to the entire anterior maxilla [figure 4 ]. subperiosteal tunnel was created by passing the incision through the periosteum and inserting a periosteal elevator between the periosteum and bone through the vestibular access incision. to mobilize gingival margins and facilitate coronal repositioning, the tunnel was extended at least one or two teeth beyond the teeth requiring root coverage. in order to achieve a low - tension coronal repositioning of the gingiva, the tunnel was sufficiently elevated beyond the mucogingival junction as well as through the gingival sulci of the teeth being augmented. subperiosteal tunnel extension was carried out interproximally also below each papilla without making any surface incisions. freshly prepared platelet - rich fibrin (prf) membrane was then trimmed to fit the dimensions of the recipient site and the width was adjusted to extend at least 3 - 4 mm beyond the bony dehiscence 's overlying the root surfaces. the prf membrane was then carefully inserted into the subperiosteal tunnel and repositioned below the gingival margin of each tooth. the membrane and mucogingival complex were then advanced coronally and stabilized in the new position with a coronally anchored suturing technique. direct interrupted sutures at approximately 2 - 3 mm apical to the gingival margin of each tooth were placed using 3 - 0 silk suture. sutures were tied, and the knots positioned at the mid coronal point of each tooth and stabilized at that position by placing composite stops. after 6 months of follow - up, it was noticed that 91% of root coverage was achieved [figure 6 ]. case-1 - insertion of platelet rich fibrin case 1 - coronally anchored suture with composite stops case-1 - periodontal dressing placed case-1 - vestibular access incision in maxillary midline frenum case-1 - 1-year postoperative view case 2 was a 50-year - old man who presented with millers class ii gingival recession defects, ranging from 2 to 4 mm, on all four maxillary anterior teeth [figure 7 ]. usage of vista technique to treat gingival recession in this case was similar to the above case report described [figure 8 ]. horizontal mattress sutures were placed, and the knot was placed on the palatal aspect with a coronally anchored suturing technique [figure 9 ]. case-2 - coronally anchored sutures on the palatal aspect composite stops which more plaque retentive was thereby interfering in the healing process and affecting esthetics were avoided in this case. after 12 months of follow - up, 96% root coverage was noted for all four treated teeth, along with 1 - 2 mm of gain in width of keratinized gingiva [figure 10 ]. a case of millers class i and class ii multiple gingival recession in the maxillary anterior region extending from 13 to 23 was reported to the department of periodontics [figure 2 ], the oxford dental college and hospital, bangalore. at the initial visit, thorough scaling and root planing was performed, patient was put on strict oral hygiene maintenance and recalled after 1-week. the vista approach began with a vestibular access incision in the midline of the maxillary frenum [figure 3 ], which provided access to the entire anterior maxilla [figure 4 ]. subperiosteal tunnel was created by passing the incision through the periosteum and inserting a periosteal elevator between the periosteum and bone through the vestibular access incision. to mobilize gingival margins and facilitate coronal repositioning, the tunnel was extended at least one or two teeth beyond the teeth requiring root coverage. in order to achieve a low - tension coronal repositioning of the gingiva, the tunnel was sufficiently elevated beyond the mucogingival junction as well as through the gingival sulci of the teeth being augmented. subperiosteal tunnel extension was carried out interproximally also below each papilla without making any surface incisions. freshly prepared platelet - rich fibrin (prf) membrane was then trimmed to fit the dimensions of the recipient site and the width was adjusted to extend at least 3 - 4 mm beyond the bony dehiscence 's overlying the root surfaces. the prf membrane was then carefully inserted into the subperiosteal tunnel and repositioned below the gingival margin of each tooth. the membrane and mucogingival complex were then advanced coronally and stabilized in the new position with a coronally anchored suturing technique. direct interrupted sutures at approximately 2 - 3 mm apical to the gingival margin of each tooth were placed using 3 - 0 silk suture. sutures were tied, and the knots positioned at the mid coronal point of each tooth and stabilized at that position by placing composite stops. after 6 months of follow - up, it was noticed that 91% of root coverage was achieved [figure 6 ]. case-1 - insertion of platelet rich fibrin case 1 - coronally anchored suture with composite stops case-1 - periodontal dressing placed case-1 - vestibular access incision in maxillary midline frenum case-1 - 1-year postoperative view case 2 was a 50-year - old man who presented with millers class ii gingival recession defects, ranging from 2 to 4 mm, on all four maxillary anterior teeth [figure 7 ]. usage of vista technique to treat gingival recession in this case was similar to the above case report described [figure 8 ]. horizontal mattress sutures were placed, and the knot was placed on the palatal aspect with a coronally anchored suturing technique [figure 9 ]. case-2 - coronally anchored sutures on the palatal aspect composite stops which more plaque retentive was thereby interfering in the healing process and affecting esthetics were avoided in this case. after 12 months of follow - up, 96% root coverage was noted for all four treated teeth, along with 1 - 2 mm of gain in width of keratinized gingiva [figure 10 ]. periodontal therapy has historically been directed primarily at the elimination of disease and maintenance of a functional healthy dentition and supporting tissues. however, more recently periodontal therapy, consistent with dental therapy in general, is increasingly directed at esthetic outcomes for patients, which extend beyond tooth replacement and tooth color to include the soft tissue component framing the dentition. gingival recession is clinically manifested by an apical displacement of gingival tissues, leading to root surface exposure, which often causes poor esthetics, increased susceptibility for root caries and dentinal hypersensitivity. treatment of gingival recessions has become an important therapeutic issue due to the increasing number of cosmetic requests from patients. patient 's esthetic demands, due to exposure during smiling or function, of portions of the root surface are the main indication for root coverage procedures. thus, complete root coverage up to the cementoenamel junction is the goal to be achieved when the patient complains about esthetic appearance of teeth. furthermore, even if complete root coverage is surgically accomplished ; the result may not be completely satisfactory in the case of excessive thickness of gingiva or poor blending of the area. this happens very frequently when free or connective tissue graft is harvested from the palate and utilized for root coverage. another factor to be considered is that gingival recession is very seldom localized to a single tooth. more frequently gingival recessions affect group of adjacent teeth. in order to minimize the surgeries and to optimize the esthetic result, treatment of isolated or multiple gingival recessions with different surgical procedures depends on many factors such as defect size, presence or absence of keratinized tissue adjacent to the defect, and thickness of the gingiva which are related to the defect and/or patient. arrays of therapeutic options are available for treatment of gingival recession defects, though many of these are better suited for treatment of isolated defects. some of the limitations of the current techniques include need for harvesting of autogenous donor tissues and their associated morbidity, as well as scar formation at the recipient site resulting from surface incisions. moreover, muscle pull during healing often leads to incomplete root coverage or relapse of the recession. the minimally invasive vista approach presented in these case reports, combined with a broad wound - healing growth factor, affords a number of unique advantages to the successful treatment of multiple recession defects. the vista approach overcomes some of the short - comings of intrasulcular tunneling techniques used for periodontal root coverage. the remote incision reduces the possibility of traumatizing the gingiva of the teeth being treated. critical to the success of vista is a careful subperiosteal dissection that reduces the tension of the gingival margin during coronal advancement while at the same time maintaining the anatomical integrity of the interdental papillae by avoiding papillary reflection. placement of the initial incision and a tunnel entrance within the maxillary frenum results in little to no visible scarring, assisting in maximizing the esthetic outcome in this critical restorative area. an important technical difference between the vista and other tunneling approaches and more classical techniques of gingival augmentation is the degree of coronal advancement of the gingival margin advocated during the procedure. as noted earlier, the gingival margin, with its membrane, is advanced to the most coronal level of the adjacent interproximal papillae rather than to the cementoenamel junction. sutures are then secured to the facial / palatal aspect of each tooth ; effectively preventing apical relapses of the gingival margin during the initial stages of healing. in both the cases presented here, apical migration of the gingival margin over relatively long periods of follow - up was either minimal or nonexistent with this tunnel procedure. the rigid fixation of the gingival margins introduced with the present coronally anchored suturing technique minimizes micromotion of the regenerative site. reduction of micromotion has proven to be a major advantage of the present technique over conventional methods, where gingival margin may be subject to displacement during facial movements. in vista technique, it was also possible to treat multiple recession defects without requiring secondary harvesting procedures. in a study by zadeh, they used bioguide as a membrane in the vista technique. use of prf in these case reports has several advantages over other membranes or grafts like they play multiple vital roles in early wound - healing, development, and maturation of a normal vasculature, cost effective and eliminates any chances of immune reaction. an array of treatment options exists for treatment of gingival recession, some of which are better suited for localized recession defects. multiple contiguous gingival recession defects, however pose significant functional and esthetic problems to large numbers of the population. the need to simultaneously address multiple recession defects is often problematic and hampered by inherent short - comings of some of the current procedures. although vista has been applied in other regions, its application is most advantageous in the esthetic zone. thus, to conclude, this technique can be used successfully in the treatment of multiple gingival recessions, and further studies with larger numbers of patients will provide further data and evidence. | gingival recession is a common manifestation in most populations. gingival recession is clinically manifested by an apical displacement of the gingival tissues, leading to root surface exposure. gingival recession may be a concern for patients for a number of reasons such as root hypersensitivity, erosion, root caries, and esthetics (wennstrom 1996). recently, new techniques have been suggested for the surgical treatment of multiple adjacent recession type defects. these are mainly derived from the coronally advanced flap, a supraperiosteal envelope technique in combination with a subepithelial connective tissue graft, or its evolution as a tunnel technique. the current case reports introduce a novel, minimally invasive approach applicable for both isolated recession defects as well as multiple contiguous defects in the maxillary anterior region. access to the surgical site is obtained by means of an approach referred to as vestibular incision subperiosteal tunnel access. |
gorham 's syndrome (gs) is characterized by proliferation of vascular channels that results in destruction and resorption of osseous matrix. since its initial description by jackson as a case of massive osteolysis of the humerus in a 12-year - old boy in 1838 and then by gorham and stout in 1955,[24 ] the precise aetiology of the disease is largely unknown. the osteolytic process can affect any bone, although shoulder and pelvis are commonly affected., we report the uneventful perioperative care of a 21-year - old patient with gs, for decompression and fusion of upper thoracic spine. a 21-year - old, 78 kg male patient presented with pain in the upper back. since the last 1 month, he was having weakness of both lower limbs leading to inability to walk and sit for a long duration. past history revealed disappearance of right clavicle between 3 and 12 years of age and, subsequently, he was diagnosed as gs by biopsy of right clavicle. physical examination and vital signs were within normal limits. magnetic resonance imaging of the spine revealed increasing kyphosis at the upper thoracic level centering at d1 - 2, and cord compression mainly at the d1 - 2 level. therefore, he was planned for decompression and fusion of c3 d5 spine. just before shifting to the operating room (or), his pulse rate (pr) was 78 beats / min, blood pressure (bp) was he was premedicated with butorphanol 1 mg, promethazine 12.5 mg and glycopyrrolate 0.2 mg intramuscular 45 min prior to surgery. the patient was shifted to the or and standard monitors were attached and midazolam 1.5 mg was given intravenously (iv), followed by 100% inspired oxygen administration for 5 min. after loss of consciousness, manual in - line stabilisation (mils) of the neck was provided by a second anaesthesiologist, and after confirming adequate mask ventilation, iv rocuronium 50 mg was given following which trachea was intubated with 8.5 mm i d cuffed flexometallic tube. anaesthesia was maintained with 40% oxygen in nitrous oxide and end - tidal sevoflurane 11.5% using circle system. intraoperative monitoring included ecg, non - invasive bp, capnometry, pulse oximetry, temperature, urine output, train of four using tof watch and gas analyser. subsequently, the patient was positioned prone for the surgery over the bolsters, taking great care to avoid eye and bony compression. posterior decompression and fusion of c3 to d5 and interbody cage insertion at d1 - 2 was done. the patient received 2 l of lactated ringer solution and blood loss was replaced with tetrastarch (130/0.42) 500 ml. the patient was reversed with neostigmine 3 mg and glycopyrrolate 0.5 mg iv, and the trachea was extubated. then, the patient was shifted to the post - anaesthesia care unit (pacu) with oxygen 5 l / min using face mask. in the pacu, pain management was done with iv paracetamol 1 g and then 6 hourly, over 15 min, iv ketorolac 30 mg and titrated dose of iv morphine using 2-mg aliquots to maintain visual analogue score (0 means no pain, 10-worst pain) of 3 using syringe pump. the patient was observed overnight in the pacu and shifted to his room the next day without any complications. gs or disappearing bone disease, or massive osteolysis, is a mysterious bone disease of unknown aetiology, which affects patients from 1.5 to 72 years, although it occurs most commonly in the 2 and 3 decades. there is no evidence of any endocrine, metabolic, neoplastic, infectious or neurologic disturbances. the pathologic process is the replacement of normal bone by an aggressively expanding but non - neoplastic vascular tissue, similar to haemangioma or lymphangioma. clinical manifestation varies from pain and swelling of the affected extremity, to limitation of motion and weakness of the involved limb. diagnosis is based on clinical and radiological findings, which is confirmed by biopsy of the bone. surgical treatment options include resection of the lesion and instrumentation using bone grafts and prostheses. anaesthesia for major spine surgery, such as spinal stabilization, present a number of challenges. prolonged anaesthesia, significant blood loss, hypothermia, positioning, concerns of air embolism, spinal cord monitoring and respiratory complications make anaesthetic management very challenging. a proper plan should be made and discussed with surgeons pre - operatively regarding anticipated duration of surgery, blood conservation strategies (use of antifibrinolytics, hypotensive anaesthesia, cell saver, acute normovolaemic haemodilution), neurologic monitoring to prevent spinal cord damage, wake - up test, post - operative ventilation and pain management. although we had motor - evoked potential monitoring in our hospital, we did not use them, as our patient had lower limb power of 1/5 pre - operatively. apart from the above - mentioned concerns for major spine surgery, additional problems in our patient were cervical spine protection during induction and positioning. mils of the cervical spine during airway manoeuvres should always be used in patients without radiological abnormalities. however, in patients with cervical cord compression, awake fibreoptic intubation should be considered. anaesthesia induction (intravenous or inhalational) might need to be modified depending on the presence or not of lesions involving maxillary or mandibular bone in which inhalational induction, especially in children, and mask ventilation might not be possible. great care should be taken while positioning prone for surgery, especially pressure over eyes, bony points and abdomen should be avoided. respiratory system involvement in the form of chylothorax in gs patients is not an infrequent complication and, hence, needs special mention. patients might present for surgery with this complication or they might develop it post - operatively. diseases of ribs, scapula or thoracic vertebrae may lead to the development of chylothorax from direct extension of lymphangiectasia into the pleural cavity or via invasion of thoracic duct. these patients should undergo complete respiratory assessment (arterial blood gas analysis, spirometry). if there is restrictive lung disease, ventilation should be undertaken by using low tidal volume and high respiratory rate. in these patients post - operative ventilatory problem leading to re - intubation and prolonged ventilation has been described in the literature. therefore, extubation has to be planned carefully, with due preparation for prolonged intensive care unit management. fortunately, our patient did not have any respiratory involvement and complication as well. in a very recent case report, a nulliparous lady with gs was managed successfully under spinal anaesthesia for urgent caesarean section. the same patient had a fused cervical spine due to surgery of cervical spine thus posing a serious challenge for airway management. hence, neuraxial anaesthesia can be safely employed in infra - umbilical surgeries provided there is an absence of lumbar spinal osteolytic lesions. however, chylothorax - induced hypoproteinaemia dictates cautious use of high protein - bound drugs. succinylcholine may produce unpredictable fasciculation and the possibility of fracture in osteoporotic bones is a concern ; hence, better to be avoided. fortunately, our patient had an uneventful recovery, without any further neurological sequelae. apart from regular concerns for major spine surgery, special attention should be given to airway management and positioning, and anticipation of post - operative pulmonary complication will go a long a way in safe anaesthesia for this rare disorder. | gorham 's syndrome (gs) is a rare disorder characterized by proliferation of vascular channels resulting in destruction and resorption of osseous matrix leading to bone loss. bone loss leads to joint instability and problems during airway management and positioning for surgery. respiratory involvement further complicates anaesthesia management. we report the anaesthetic care of a 21-year - old male patient of known gs for spine decompression and fusion in prone position. airway management, induction technique, pathophysiology of the disease, drug selection and other concerns of anaesthesia for major spine surgery has been discussed reviewing the sparse literature available. |
elevated serum alkaline phosphatase (alp) level is an essential marker for the diagnosis of vitamin d deficiency (1). some cases of vitamin d deficiency are diagnosed accidentally on the basis of elevated alp levels. therefore, cases without high alp may be excluded from a diagnosis of vitamin d deficiency. hypophosphatasia is a congenital skeletal disease caused by mutation of the alpl gene, which encodes the alp isozyme, tissue - nonspecific alkaline phosphatase (tnsalp) (2). hypophosphatasia is characterized by severe reduction of alp as well as various skeletal abnormalities such as rickets. since most cases are transmitted as an autosomal recessive trait, those heterozygous for alpl mutation are carriers who exhibit a low or normal alp level (3). here, we describe a case of vitamin d deficiency without an elevated alp level in a patient that proved to be a heterozygous carrier of hypophosphatasia. a 1-year - old japanese girl was referred to our hospital for the evaluation of genu varum. she had no history of bone fractures. at her initial visit, her serum intact pth level was elevated (273 pg / ml, normal range : 1065 pg / ml) while her serum alp, calcium, and inorganic phosphate levels were normal (527 u / l, normal range : 3951289 u / l ; 9.5 mg / dl, normal range : 8.810.6 mg / dl ; 5.9 mg / dl, normal range : 3.86.2 mg / dl, respectively). her percentage of tubular reabsorption of phosphate (% trp) was elevated (96.9%, normal range : 8095%). her urine calcium / creatinine level was reduced (0.019, normal range : 0.0350.80), and her urine cross - linked n - telopeptide of type i collagen (ntx) level was 1340 nmol bce / mmol creatinine (normal range : 3692385 nmol bce / mmol creatinine). additional measurement of serum 25-hydoxyvitamin d (25-ohd) was not performed, because of normal serum alp levels. on limb radiography, calcification of epiphyses was detected, and both flaring and fraying of metaphyses were also detected slightly (fig. therefore, the patient was initially diagnosed with spontaneously half - healed vitamin d deficiency rickets and was followed closely without treatment. however, 3 months later, her serum intact pth level remained elevated and serum 25-ohd level was reduced (6 ng / ml, normal range : 20100 ng / ml). the patient was subsequently diagnosed with vitamin d deficiency. the serum intact pth level improved immediately after initiation of alfacalcidol administration and has not been elevated since the end of treatment. in addition, her serum alp level decreased gradually (table 1table 1 laboratory data). the metaphyses were flared and frayed slightly. although these courses of treatment support the diagnosis of vitamin d deficiency, the relatively low alp level was atypical. low serum zinc level, which is one of the causes of reduced alp level, was not identified (71 g / dl, normal range : 64118 g / dl). mild elevation of the urine phosphoethanolamine (pea) level (279.1 mol / g creatinine, normal range : 83222 mol / g creatinine) suggested hypophosphatasia (4). genomic dna was extracted from peripheral blood leukocytes of the patient and her parents after obtaining written informed consent. all coding exons and flanking introns of alpl were analyzed using the pcr direct sequencing method. an alpl heterozygous mutation, c.1559delt, was detected in the patient and her father (fig. black dots indicate heterozygous alpl carriers (c.1559delt).), but no mutation was detected in her mother. the serum alp level of her father was mildly reduced (84 u / l, normal range : 96284 u / l) and that of her mother was normal (180 u / l). this is the first report of vitamin d deficiency without an elevated serum alp level in a carrier of hypophosphatasia. vitamin d deficiency is reemerging worldwide (5), and elevated serum alp is a hallmark of this disease (1). vitamin d deficiency may fail to be diagnosed if serum alp is not elevated. however, simultaneous measurement of the serum intact pth level is helpful for diagnosis. measurement of urine pea was useful for the diagnosis of hypophosphatasia in the present case. while severe elevation of the urine pea level (approximately > 1000 mol / g creatinine in childhood) is detected in patients with hypophosphatasia, mild elevation suggests carrier status of this disease (3). the alpl mutation c.1559delt is the most common mutation in japanese patients with hypophosphatasia (6). a homozygous c.1559delt mutation is involved in the perinatal lethal form of hypophosphatasia with a severe reduction in serum alp (6). the heterozygous mutation is found in carriers who present various levels (either low or normal) of serum alp without skeletal abnormality (3). furthermore, urine pea levels also range from normal to high in such individuals (3). the frequency of carriers is predicted to be high (1/480) (3). since vitamin d deficiency is reemerging, the present case should be kept in mind, as the possibility of such conditions occurring more frequently is high. vitamin d deficiency rickets was reported to be associated with the infantile form of hypophosphatasia in a 9-month - old boy (7). in that report, although the serum alp level increased from 66 u / l at baseline to 400 u / l at diagnosis, it decreased soon after treatment. on the other hand, the present case was considered to be mild vitamin d deficiency because of the mild elevation of serum alp level and lack of clinical findings of active rickets. in conclusion, an alpl heterozygous mutation was detected in a patient with vitamin d deficiency without an elevated serum alp level. measurement of serum intact pth and urine pea levels is helpful for diagnosing vitamin d deficiency and identifying carriers of hypophosphatasia, respectively. | elevated serum alkaline phosphatase (alp) is a screening marker for the diagnosis of vitamin d deficiency, which may fail to be diagnosed if serum alp is not elevated. here, we describe a case of vitamin d deficiency without elevation of serum alp. a 1-year - old japanese girl was referred to our hospital for the evaluation of genu varum. her serum intact pth level was elevated, while her serum alp level was normal. furthermore, her serum 25-hydroxyvitamin d level was reduced, and her urine phosphoethanolamine (pea) level was mildly elevated. alpl gene analysis revealed she was a heterozygous carrier of hypophosphatasia (c.1559delt). serum intact pth and urine pea evaluations were helpful for diagnosing vitamin d deficiency and hypophosphatasia carrier status, respectively. therefore, the possibility of vitamin d deficiency without elevation of serum alp should be considered. |
percutaneous transhepatic biliary drainage (ptbd) is an established nonsurgical procedure for the management of biliary obstruction, especially in patients in whom an endoscopic approach to the biliary system is impossible.1,2 compared with endoscopic biliary drainage, ptbd secures more stable drainage because it allows for serial monitoring of the quality and quantity of bile discharge. duodenobiliary or jejunobiliary reflux of intestinal contents through a ptbd catheter, however, sometimes causes recurrent catheter obstruction or cholangitis. here, we report a novel technique to prevent jejunobiliary reflux through a ptbd catheter : " antireflux ptbd technique. " a 64-year - old female patient was referred to our department with a 1-day history of abdominal pain and fever. she had a history of choledochojejunostomy with roux - en - y reconstruction for common bile duct injury during laparoscopic cholecystectomy for cholecystolithiasis 2 years earlier. laboratory data on admission were as follows : white blood cells, 13,900/mm (normal, 3,700 to 8,000/mm) ; total bilirubin, 3.6 mg / dl (normal, 0.2 to 1.2 mg / dl) ; alkaline phosphatase, 868 iu / l (normal, 104 to 338 iu / l) ; -glutamyltranspeptidase, 320 iu / l (normal, 0 to 59 iu / l) ; and c - reactive protein, 6.12 mg / l (normal, 0.00 to 0.29 mg / dl). a contrast - enhanced computed tomography scan of the abdomen revealed marked dilatation of the bile duct of the left liver without evidence of bile duct stones or tumors. based on these findings, a diagnosis of acute cholangitis due to biliary obstruction was made. after obtaining informed consent from the patient and her family members, a 0.035-inch polymer - coated guidewire (radifocus ; terumo co., tokyo, japan) was passed successfully through the obstruction. at the end of the procedure, an 8-fr balloon - tipped internal - external drainage catheter (create medic co., kanagawa, japan) however, the occlusion of the ptbd catheter due to reflux of intestinal contents occurred repeatedly accompanied by elevated serum liver enzymes, requiring frequent cleaning of the catheter with flushing of natural saline to facilitate bile flow (nine times in 14 days). larger - caliber (10-, 12-, and 16-fr) catheters failed to prevent the reflux of intestinal contents into the catheter. to circumvent the problem, we introduced a novel method using a modified ptbd catheter with an antireflux mechanism. we used a commercially available 10-fr internal - external drainage catheter (create medic co.), which originally had side holes 1 to 10 cm (1 cm apart) from the tip. we cut the distal side of this catheter and made side holes at 1 cm and 5 to 10 cm (1 cm apart) from the tip. furthermore, the tip of the catheter was ligated with a nylon thread just proximal to the side hole (1 cm from the tip) (fig. placement of a modified catheter over the prepositioned guidewire was achieved without any technical difficulties (fig. ultrasonography performed 2 days after the procedure demonstrated the disappearance of pneumobilia, indicating successful prevention of the reflux of intestinal contents and air from the jejunum. neither obstruction nor the discharge of intestinal contents through the catheter was observed until the prophylactic exchange of the catheter, 100 days after the procedure. at the time of removal of a modified catheter, we passed a guidewire through one of the proximal side holes without any technical difficulties. although ptbd is an established procedure for biliary obstruction, clogging of a ptbd catheter by biliary sludge is inevitable. it is believed that bacterial colonization in the biliary system (bactibilia), which is usually seen after ptbd catheter placement, plays a major role in sludge formation, eventually leading to catheter obstruction.3 - 5 loss of papillary sphincter function after choledochojejunostomy, the location of the catheter tip in the intestine, and duodenal tumor invasion6 provoke the reflux of duodenal and jejunal contents into the biliary system as well as into the catheter, increasing the risk of catheter obstruction and cholangitis. in some cases, however, the catheter tip should be placed in the intestine in order to stabilize the catheter position or to dilate an anastomotic stricture. frequent catheter irrigation with normal saline, larger diameter catheter placement, and periodical catheter exchanges have been attempted to prevent ptbd catheter obstruction. our patient developed recurrent catheter obstruction in a short period of time despite the aforementioned attempts to decrease this complication. we considered that in this patient, free reflux of intestinal contents into the catheter may have caused the unfavorable outcome. to prevent jejunobiliary reflux this novel ptbd technique (" antireflux ptbd ") successfully prevented jejunobiliary reflux of intestinal contents in our patient based on the evidence of clearer bile discharge through the catheter and the disappearance of pneumobilia. the advantage of this technique is its simplicity ; a commercially available ptbd catheter is easily modified using a nylon thread. this technique, therefore, is applicable to clinical practice in many centers without technical difficulties or additional cost. we consider that patients with increased intraluminal pressure (e.g., afferent loop obstruction) are especially suitable candidates for antireflux ptbd because the enhanced jejunobiliary reflux is likely to provoke severe, life - threatening bacterial cholangitis.7,8 because a modified catheter is inserted in a fashion similar to that of a rapid exchange catheter, more technical difficulties may be encountered compared with the usual catheter exchange with a guidewire through the entire length of the catheter (fig. in addition, a guidewire must be passed through one of the proximal side holes of a modified catheter at the time of catheter exchange (fig., however, these potential disadvantages were overcome without any technical difficulties. in conclusion, the antireflux ptbd technique is an effective procedure in select patients with recurrent ptbd catheter obstruction due to reflux of intestinal contents. | percutaneous transhepatic biliary drainage (ptbd) is an established procedure for biliary obstruction. however, duodenobiliary or jejunobiliary reflux of the intestinal contents through a ptbd catheter sometimes causes recurrent catheter obstruction or cholangitis. a 64-year - old female patient with a history of choledochojejunostomy was referred to our department with acute cholangitis due to choledochojejunal anastomotic obstruction. emergent ptbd was performed, but frequent obstructions of the catheter due to the reflux of intestinal contents complicated the post - ptbd course. we therefore introduced a catheter with an antireflux mechanism to prevent jejunobiliary reflux. a commercially available catheter was modified ; side holes were made at 1 cm and 5 to 10 cm (1 cm apart) from the tip of the catheter, and the catheter was ligated with a nylon thread just proximal to the first side hole. using this novel " antireflux ptbd technique, " jejunobiliary reflux was prevented successfully, resulting in a longer patency of the catheter. |
isolated dislocations of the trapezio metacarpal joint without associated fracture has been reported very rarely in the literature. there are reports of associated injuries like fracture of the trapezium, dislocation of the metacarpophalangeal joint and fractures of the base of the thumb metacarpal. authors report a case of isolated carpometacarpal dislocation of the right thumb, in an adult, successfully managed conservatively. at 15 months follow up the patient had full function of the hand without any clinical or radiological evidence of instability or posttraumatic arthritis. isolated dislocations can be successfully managed by closed reduction and immobilization in a back slab, with unstable dislocations requiring surgical intervention. isolated dislocations of the trapezio metacarpal joint [tm ] without associated fracture is a very rare injury[1 - 4 ], with few reports in the literature. associated injuries reported include, fractures of the trapezium [5 - 7 ], dislocation of the metacarpophalangeal joint (mp) [4,8 - 10 ], and associated fracture of the base of the metacarpal. there is debate over optimal management of the dislocation, with reports suggesting conservative management [1, 9 ], to aggressive surgery, including ligament reconstruction [11 - 13 ]. however, if the joint is stable after a closed reduction, immobilization in a thumb spica can result in a stable joint. 36 year old patient presented in the accident and emergency of a regional referral hospital with pain and deformity of the right thumb, following an alleged road traffic accident. the patient was unable to move the right thumb, and had a prominence over the dorsal aspect of the right hand. radiographs of the right hand revealed a dorsal dislocation of the carpo - metacarpal joint of the right thumb without any associated fracture (fig.1a, b). following reduction, the tm joint was found stable, and hence it was decided to treat the dislocation in a thumb spica. he was followed up every week for the first 3 weeks with weekly radiographs which confirmed concentric reduction of the tm joint. at 6 weeks radiograph at 15 months follow up showed well reduced and stable tm joint without any signs of arthritis. however there was a calcified shadow over the radial aspect of the thumb (white arrow), which could be due to calcification in the straight antero lateral ligament (fig. frontal radiograph of the hand showing the dorsal dislocation of the tm joint frontal radiograph at 15 months follow up showing calcification of the ligament [white arrow ], and congruent joint. thumb has a unique role in the function of the hand, and a normal thumb is essential for digital pincing and for a powerful grip. both trapezial and metacarpal surfaces have double inverse curvature in the shape of a saddle. an injury which is occasionally reported is carpo - metacarpal dislocation of the thumb, can lead to long standing hand disability if not properly treated. isolated carpometacarpal dislocation of the thumb is a very rare injury [1 - 4 ], accounting for less than 1% of all hand injuries. isolated tm dislocations almost always displace dorsally, but there are reports of volar dislocations. most thumb dislocations are dorsal, and are classified as simple [reduced closed ] and complex [irreducible closed and requiring open reduction ]. many associated injuries has been reported along with tm dislocation of the thumb, which includes fracture of the trapezium[5 - 7,15 ], dislocation of the metacarpophalangeal joint, also known as floating thumb, injury of the ulnar collateral ligament, fracture of the distal radius and bennett fracture. force causing flexion and axial loading of the metacarpal base result in rupture of the dorsolateral ligament and dorsal subluxation. the dorsal ligament complex is the largest and thickest and most important ligamentous restraint [10, 13, 16 ] and if this ligament is cut, the major stabilizer is lost and a caropmetacarpal dislocation ensues [13, 16 ]. if the metacarpal is further flexed, the anterior oblique ligament is stripped from the base of the metacarpal resulting in complete dislocation [1, 2 ]. optimal treatment method is still debatable varying from closed reduction and casting, percutaneous fixation, ligamentous repair, capsular placation followed by k wire fixation [1, 2 ]. milankov and miljjkovic has named this injury as the bennett fracture without a fracture implying that the injury is unstable after closed reduction as in a bennett fracture. closed reduction and a plaster cast with the thumb in abduction, and kept for 4- 6 weeks is the preferred treatment if the joint is stable [1, 4, 8, 9, 13 ]. if the joint is unstable, it is preferable to hold the reduction with k wires, with or without capsulorrhaphy. though many ligamentous reconstructive procedures have been described using the tendons around the wrist, conservative management may still gives equally good results [1, 8 ]. however recurrent instability is a concern and ligament reconstruction should be considered in unstable cases. our case was stable after reduction and conservative management with thumb spica gave good functional result. marcotte and trzeciak too reported that the isolated dorsal mcp joint dislocation remains stable after closed reduction. patients with tm dislocation showing no signs of instability after a closed reduction can be managed conservatively [1, 13 ]. post reduction the joint was stable and conservative management in spica cast gave good clinical result. isolated tm joint dislocations, if stable after a closed reduction could be managed in a plaster cast with good functional results. | introduction : isolated dislocations of the trapezio metacarpal joint without associated fracture has been reported very rarely in the literature. there are reports of associated injuries like fracture of the trapezium, dislocation of the metacarpophalangeal joint and fractures of the base of the thumb metacarpal.case report : authors report a case of isolated carpometacarpal dislocation of the right thumb, in an adult, successfully managed conservatively. at 15 months follow up the patient had full function of the hand without any clinical or radiological evidence of instability or posttraumatic arthritis.conclusion:isolated dislocations can be successfully managed by closed reduction and immobilization in a back slab, with unstable dislocations requiring surgical intervention. |
in recent years, successive changes in mental health care systems have made them evolve from classical institutionalized care based on hospitalization to community health care with psychosocial rehabilitation. these changes have re - established patients and their caregivers at the center of health care programs. caregivers are usually unpaid nonprofessionals, often family and friends who have significant input in the care and support of people affected by severe psychiatric illnesses. in the uk, the national service framework for mental health recognized the vital role caregivers play in delivering health care. patients and their caregivers are more and more involved in decision making when it comes to their care, the rehabilitation process, and preventing relapses, as well as research programs. this cooperation between patients, caregivers, and physicians has become the foundation of a participatory health care system in which the relationships between each of the parties are considerably reinforced. this is the context in which patient - reported outcomes (pros) have been developed and become standard practice in recent years for evaluating the effectiveness of health care. pros also help the clinician understand how patients experience their illness, by evaluating aspects such as their quality of life, disability, satisfaction, or level of functioning. in addition to taking into account the patient 's viewpoint with pros, it is necessary to pay more attention to the expectations and the constraints of the caregivers who have become key players in today 's health care system. it is currently accepted that mental disorders have a much larger impact than what was assumed before the advent of community psychiatry ; this impact is especially large on the caregivers to the patients. as the health care systems evolve, relatives have become the main caregivers for patients with severe mental disorders. they must provide support to their relatives with mental disorders while withstanding some of the consequences of the illness and the treatments. the impact of mental illness on related caregivers is well documented. it causes changes in the quality of life, restricts roles and activities, and increases psychosomatic, anxious, or depressive symptoms. moreover, caregivers ' negative experiences may affect their ability to care for the patients. taking into account the caregivers ' experience, their viewpoint, and their expectations is of particular interest. a better understanding of the effects of mental disorders on caregivers of patients will enable us to extend help and support tailored to their needs. these actions should relieve caregivers of their constraints and improve the effectiveness of their helpful actions by guiding them. current research orientations are determined by the importance of measuring caregiver expectations and the necessity of reliable outcome indicators for caregivers. research is currently focused on two main issues, which are : (i) studying the impact of the patient 's illness on their caregivers ; and (ii) setting up specific and validated measuring tools for caregiver outcomes. these indicators must be designed similarly to pros, to be user - oriented in this case, caregiver - oriented taking into account their specificities, their perceptions and their expectations. it has been reported that the burden of disease for caregivers is assessed differently depending on who performs the evaluation, the clinician, or the closest caregiver. indeed, objective burden indicators (ie, the patient 's symptoms, behavior, and sociodemographic characteristics, and also the changes in household routine, family or social relations, work, leisure time, and physical health) do not coincide with subjective burden indicators (ie, the mental health and subjective distress among family members). this difference in viewpoint in evaluating the burden of disease may be explained in part by a lack of awareness of health care workers when it comes to the needs and issues of caregiving families of psychiatric patients. this confirms the difficulty in assessing the caregivers ' constraints and the necessity in raising awareness for health care personnel of the importance of taking into account the viewpoint of caregivers and their patients. the way they experience their relatives ' illness or the impact it will have on them will depend more on the functional impact of the disorders. their perceptions seem strongly linked to dimensions such as global functioning, social integration, or improvements in daily life management. thus, caregivers expect much more from health care than merely reducing their relatives ' symptoms. the clinician 's evaluation may therefore be enriched by taking into account the caregiver 's perspective, yielding therapeutic proposals, organizational changes, or political decisions that are better suited to the expectations of the patient 's family and friends. these caregiver perspectives remain little used, however, in the care of individual patients and caregivers and in the general orientations of health care systems and political decisions concerning mental health care. the majority of available data to date is from studies of caregivers of patients with dementia. these advances in research in the field of dementia can be explained by the fact that caregivers of patients with dementia have dependent relatives with severe disorders, so they request much more support than caregivers of patients with other mental disorders or chronic illnesses. to quantify this research, we did the following pubmed searches : dementia and caregiver and outcome yielded 962 results, whereas schizophrenia and caregiver and outcome yielded only 176 results and bipolar disorder and caregiver and outcome yielded only 42 results. generally speaking, the outcomes measured in the field of dementia were mainly focused on burden, quality of life, support needs, and coping strategies. these outcomes have been featured in reviews which list them along with their measuring instruments. they are currently used on a daily basis by clinicians and researchers, and have thus become study variables in measuring instruments used for evaluating care programs for caregivers. they are used to quantify the advantages of structured support programs for caregivers of patients with dementia and to identify some determining factors in the observed improvements. although caregivers have become essential partners in mental health care, and although they must be included in the evaluation process for health care and intervention programs, harvey have shown that there is no established consensus on which measurements and tools should be used to evaluate the experiences of caregivers in the field of mental health care. the same can be said for outcome measures for caregivers of patients with psychiatric disorders, which focus on the same aspects of the caregiving experience as the outcome measures used for caregivers of patients with dementia, the risk being that the lack of specificity of these measures would cause them to be of little use, as we shall see. in the field of schizophrenia, most of the measurements are focused on the burden of the illness on the caregivers, while a small number aim to improve coping strategies, perception of needs or quality of life, with the inherent limitations of the tools we mentioned previously. even fewer tools are available for caregivers of patients with mood disorders, and those that do exist focus on measuring burden, quality of life, stigma and coping strategies, or family functioning. apart from these two nosographic frameworks, little research has been done on outcomes for caregivers of patients with other pathologies. there have been a few studies on the caregivers of patients with eating disorders, and with attention deficit - hyperactivity disorder (adhd). we have only found one study on the outcomes for caregivers of patients with personality disorders, and have found none on caregivers of patients with addictions or substance abuse disorders. this study of the literature reveals that most outcome measures for caregivers of patients with mental disorders can be placed in three main categories : (i) caregiver 's well - being (table i) ; (ii) their experience of caregiving (table ii) ; and (iii) caregiver 's needs for professional support (table iii). nevertheless, a caregiving relationship is complex as it involves many parameters, which complicate the conceptual definition of outcomes of interest. these parameters are just as linked to general aspects of the caregiving relationship (ie, the type of care given, the types of interactions, and the quality of the relationship) as they are to more specific aspects inherent to the pathology or mental disorder and its functional consequences on the patient 's day - to - day life. thus, caregiver quality of life, burden, and needs are determinant to the caregiving experience, but it remains unclear whether the scales that have been developed specifically to measure them evaluate fundamentally different dimensions of the caregiving experience. this limits the scope of the measurements taken, especially when several different measuring tools are used. this review of the literature on caregiver outcomes shows that the numerous tools used for these evaluations are very heterogeneous, as they are designed to investigate several more - or - less linked aspects of the caregiving relationship. the most frequently represented ones are the generic tools used in caregiver outcome studies, but which were n't developed specifically for caregivers in mental health. some of these measuring tools, such as sf 36, were even initially developed for noncaregivers. other less numerous tools, though more diverse, were developed specifically for caregivers in dementia or in general mental health. most of these are very specific to a particular aspect of the caregiving experience (eg, zarit caregiver burden interview), and some allow for a more global evaluation of the caregiving experience (eg, carers ' and users ' expectations of services carer version). finally, some rare tools were specifically designed for caregivers of patients with a specific illness (eg, caregiver schizophrenia quality of life questionnaire). once the outcome for the study has been chosen, clinicians and researchers must choose which tool to use amongst the plethora of available tools that have been developed. this decision is complicated by the lack of specificity, the heterogeneity, and the sheer number of available tools. as for specificity we have mentioned that the tools used are, for the most part, generic tools which were developed based on noncaregiver populations or populations of caregivers of patients with nonmental disorders. regrettably, classical psychometric data such as reliability, validity, responsiveness, acceptability, and feasibility, or more precise psychometric data such as appropriateness, precision, and interpretability have rarely been verified with caregivers of patients with mental disorders. these characteristics have a strong influence on the pertinence, reliability, and precision of evaluations, and yet they are rarely known or mentioned. in their review of the literature, harvey identify outcome measuring tools for caregivers and specify which psychometric properties are available for these tools. they reported that many of the tools that were used were considered irrelevant by the caregivers themselves, and that many of the psychometric characteristics were either incomplete or missing. on the one hand, the vast majority of the questionnaires which were used were designed based on expert opinions and clinician 's perspectives without any actual input from caregivers. on the other hand, not all of them were tested on populations of caregivers of patients with mental disorders, and the available psychometric data concerning their use on such populations are inconsistent. the validity of using these tools is in question, as they are used in everyday practice and yet have neither been specifically designed for, nor tested on caregivers. it is generally accepted that it is preferable for evaluation questionnaires to be designed from the perspective of the perceptions of the people who they will be used to evaluate, in order to improve their relevance and their validity. otherwise, some of the positive aspects of caregiving will rarely be examined in the caregiver outcome evaluation scales, although it is readily apparent that the caregiving experience is not always perceived as being only a burden. improving the measurement of these little - known aspects of the caregiving relationship in the field of mental disorders would certainly allow for an improved understanding of the experience and for offering better support. it can be recommended that interviews or focus groups of caregivers be pivotal in defining outcomes and designing measuring tools that will be better adapted to the expectations and perceptions of caregivers. the issue here seems to be similar to that of the pros, many different ones are being used, and they are varied and not always relevant. this is largely linked to the fact that a large proportion of these measures took the expert 's viewpoint into account more than that of the patient. it is then necessary to be cautious when it comes to caregiver outcomes to avoid these same pitfalls. without a consensus on the caregiver outcomes which should be promoted and used, these same issues are likely to arise : ill - adapted and irrelevant tools for measuring outcomes for caregivers of patients with mental disorders. some other issues must then be examined carefully in order to limit the risk of getting incorrect results during the measurements which would then become generalized. the first point to examine is whether the generic tools which have been used thus far are adapted for evaluating caregivers of patients with mental disorders. the validation process for these tools has not been used on these populations, so their validity is in doubt, especially given that the caregivers of patients without mental disorders may not have the same needs and expectations as caregivers of patients with mental disorders. as we have seen, it is essential to design tools based on the viewpoint of the populations being studied, in this case, caregivers of patients with mental disorders. this will improve the acceptability and the precision of the tool, validating its content. although it is easier to verify these factors when designing a new tool based on a predefined target population, some alternatives include testing these data on preexisting tools based on a general population or on populations of caregivers of other diseases, although this involves a risk of questioning issues that are less relevant for caregivers of patients with mental disorders. a relevant outcome must echo the specific expectations and needs of caregivers of patients with mental disorders. it should also eventually yield informative measurements that will guide clinicians and researchers in their activities. perhaps some of the outcomes currently being examined are not relevant to regular practice. evaluating caregivers ' needs may be more helpful to clinicians to orient families towards specific programs that meet their personal needs, whereas a scale measuring quality of life would be more useful for research on quality of life, and for drawing conclusions concerning decision - making when organizing health care. there is, however, a lack of consensus on the definition of quality of life and exactly which experiential aspects it involves. additionally, interpreting quality of life data is not straightforward (eg, response shift phenomena). as we have seen previously, the various outcomes being studied refer to highly interrelated aspects of the caregiving relationship. similarly, it has yet to be seen whether the same aspects of the caregiving relationship are involved in all clinical situations. caregivers of patients with dementia may not have the same constraints and needs as caregivers of patients with schizophrenia or bipolar disorder, or they may not experience the same impact on their quality of life. this should be a prerequisite to developing measuring tools, as this should inform us as to whether these tools should be used as general measuring instruments in mental health care and/or for specific disorders or clinical caregiving situations (eg, very young caregivers, ethnic minorities, caregivers of children, and caregivers of suicidal patients). research on such outcomes and the development of measuring tools still require large - scale investigation efforts, which will be costly both in time and money. as we have previously seen, if they are to be informative, it is absolutely necessary that the measures be reliable, precise, and sensitive to changes, which means any sources of bias or confusion must be detected. for the purpose of precision, it also seems to be important that these measuring tools come with a user guide. using and interpreting scores will be more effective and informative, allowing for adjustments to the support offered to caregivers or orienting the organizational methods of the health care system. generalizing the participation of caregivers of patients in defining outcomes and designing questionnaires seems to be the most effective way to overcome these hurdles in creating adapted measuring tools. the medical community will then have relevant and validated measuring tools with known psychometric properties, allowing for the development of large - scale studies and sharing results for analysis. thus, the caregiver outcome measurements will serve as a guide to health care professionals in receiving, informing, supporting, and accompanying patients and their relatives, particularly on two levels. in regular practice, they will be used to monitor the effects of the support groups, information systems, or psychological educational programs offered to caregivers. some interesting results are already available. for example, in schizophrenia it appears that quality of life in both patients and caregivers are linked, with a strong relationship with the negative syndrome and the general psychopathology of the disorder. thus, a better control of patients ' symptoms would reduce subjective burden in caregivers. in the same way psychoeducation courses for caregivers of individuals with schizophrenia, it seems important this family interventions focus more on patient and caregiver characteristics, and consider some clinical and social features. moreover, such caregiver outcomes allow comparisons between support programs with better consideration for caregivers ' perspectives. thus, madigan found no difference for bipolar patient caregivers between multifamily group psychoeducation and solution focused group therapy. both programs demonstrated reduction in burden. using adapted and targeted questionnaires will allow the support offered to caregivers to be adjusted, which will most likely improve the relationships between patients and their caregivers. to this end, they may eventually be integrated directly in the treatment pathways via electronic data capture modes of administration. these outcome measures can also be integrated in e - health interventions that could be an efficient alternative to provide education and support for caregivers. some experiments of internet - based supportive interventions for caregivers of patients with dementia shows promising effects. these questionnaires, used in research programs with validated tools and following similar standardized rules to the ones pros use, will make it possible to analyze the determining factors in the caregiving relationship and understand the mechanisms that come into play in how the illness is experienced. thus, we know that caregivers of schizophrenia patients appraise caregiving more negatively than those of bipolar affective disorder patients. in a recent study, it was shown that caregivers of individuals with affective disorders reported higher quality of life levels than caregivers of schizophrenic patients. interestingly, the differences between caregivers of individuals with bipolar disorders and individuals with schizophrenia concerned mental and psychological dimensions, while the differences between major depressive disorder and schizophrenia concerned only physical dimensions. these findings confirm the necessity of a multidimensional approach in identifying the most - impaired domain to improve programs for caregivers. this research on caregivers ' outcomes may lead to the identification of new dimensions that can be stress contributors for caregivers. mollerleimkuhler and jandl explore different dimensions, such as expressed and perceived emotions, which may have a relative prognostic value in caregivers ' stress. another recent study emphasizes the importance of the point of view in the experience of the illness. thus, karow showed an important difference between symptomatic remission and subjective outcome criteria, with a preference on the patients ' side for subjective outcome, including well - being. in the choice of treatment decisions, this is an additional argument to supplement the experts ' assessment of symptomatic remission with patients ' and caregivers ' assessment. these already interesting and promising results will be refined by the use of more appropriate measurement tools and will be generalized by the use of standardized measures. caregiver outcomes are important elements and these should be taken into account in our regular practice, particularly within the context of the changes in the health care system. the medical community has globally become aware of the necessity of taking patient and caregiver viewpoints into account in the process of deinstitutionalization and developing community psychiatry. progress still needs to be made, however, in order to have tools available for measuring caregiver experiences with relevant content that has validated psychometric properties. similarly to pros, these caregiver outcome measures will serve as a guide to clinicians, social workers, and therapists in treating and managing patients while also helping decisionmakers, policy - makers, payers, or regulators in adjusting and measuring the impact of health interventions. they open the way for taking caregivers into account better, meeting their needs in the treatment of patients, and should help orient health care policy and organizational methods in mental health care by giving caregivers of patients with mental disorders their rightful place, and providing them with better resources in a reinforced cooperation with health care providers. | patient - reported outcomes (pros) are increasingly important in health care and mental health research. furthermore, caregivers become partners in care for patients with mental disorders, and health workers are more attentive to the expectations and needs of caregivers. a number of outcomes for caregivers are measured and used in daily practice in order to promote actions to improve health care systems and progress in research on the impact of mental disorders on their caregivers. this paper proposes an inventory of the different outcomes and different measurement tools used to assess the impact of disorders, raising a number of methodological and conceptual issues that limit the relevance of measurement tools and complicate their use. finally, we propose some recommendations promoting the development of relevant outcome measures for caregivers and their integration into current systems of care. |
cyclin - dependent kinase inhibitor 1a (p21, cip1) mitochondria - associated membrane nuclear localization signal maintenance of genome stability requires mobilization of the dna damage response (ddr), both to repair the day - to - day chemical nicks and bruises and resolve acute damage following exposure to ionizing radiation (ir) or chemotherapeutics. cells respond to these chemical mishaps and overtly acute genotoxic insults by inducing the tumor suppressor protein p53 (tp53, known as p53), whose role in the regulation of the ddr is complex, involving changes in the expression of more than 3,000 genes and activation of cell cycle checkpoints to allow dna repair. the most intensively studied p53 target genes include cyclin - dependent kinase inhibitor 1a (cdkn1a, known as p21), which promotes cell - cycle arrest or senescence, and p53 upregulated modulator of apoptosis (puma, also known as bcl2-binding component 3 [bbc3 ]) and bcl2-associated x protein (bax, also known as bcl-2-like protein-4), which are activated to induce apoptosis when cellular damage is irreparable. the transcriptional activity of p53 requires post - translational modifications, including phosphorylation and acetylation, to stabilize p53 and enhance its transactivation functions, respectively. the class iii histone deacetylase sirtuin 1 (sirt1) represses p53 transcriptional activation by deacetylating p53 following dna damage. sirt1 can be regulated transcriptionally and post - transcriptionally and through interactions with other cellular proteins in diverse pathways. the complexity of these functions suggests that regulation of sirt1 activity probably requires additional cellular factors. we recently identified the multifunctional sorting protein phosphofurin acidic cluster sorting protein-2 (pacs-2) as a novel mediator of p53 action in response to genotoxic insult (fig. pacs-2 was initially identified by its cytoplasmic roles in mediating mitochondria - associated membrane (mam) formation, autophagy, and protein traffic in the secretory and endocytic pathways (fig. 1, panel b). in response to apo2 ligand / tumor necrosis factor - related apoptosis - inducing ligand (apo2l / trail), pacs-2 switches to a proapoptotic effector that promotes membrane permeabilization of mitochondria and lysosomes, which is required for the activation of executioner caspases and cell death (fig. our finding that pacs-2 is required for apo2l / trail - induced apoptosis led us to ask whether pacs-2 would similarly be required for apoptosis induced by dna damage. surprisingly, we found that whereas sirna knockdown of pacs-2 in hct116 human colon carcinoma cells reduced apo2l / trail - induced apoptosis, it sensitized cells to doxorubicin - induced apoptosis and this effect was dependent on p53. thus, pacs-2 has a proapoptotic role in apo2l / trail action but an anti - apoptotic role in response to genotoxic insult (fig. (a) dna damage induces nuclear pacs-2-mediated cytoprotection through inhibition of sirt1-mediated p53 deacetylation to promote p21-dependent cell cycle arrest. (b) phosphorylation state - dependent homeostatic function of pacs-2 to regulate either mam integrity or cargo trafficking in secretory and endocytic pathways. (c) signaling by death ligands triggers pacs-2 dephosphorylation to induce mitochondria and lysosome membrane permeabilization, leading to caspase-3 activation and cell death. ac, acetylated lysine ; p, akt - phosphorylated ser437 on pacs-2 ; er, endoplasmic reticulum ; mam, mitochondria - associated membrane ; trail - r, trail receptor ; tbid, truncated bid. (a) dna damage induces nuclear pacs-2-mediated cytoprotection through inhibition of sirt1-mediated p53 deacetylation to promote p21-dependent cell cycle arrest. (b) phosphorylation state - dependent homeostatic function of pacs-2 to regulate either mam integrity or cargo trafficking in secretory and endocytic pathways. (c) signaling by death ligands triggers pacs-2 dephosphorylation to induce mitochondria and lysosome membrane permeabilization, leading to caspase-3 activation and cell death. ac, acetylated lysine ; p, akt - phosphorylated ser437 on pacs-2 ; er, endoplasmic reticulum ; mam, mitochondria - associated membrane ; trail - r, trail receptor ; tbid, truncated bid. to characterize this previously undescribed role for pacs-2 in ddr, we used cell cycle analyses combined with western blotting (wb) and in vivo enterocyte migration studies in the gastrointestinal track of pacs-2 mice. we observed that pacs-2 knockdown reduced p53 acetylation in response to dna damage, thereby blunting the induction of p21 and cell cycle progression. this p21 repression increased apoptosis as previously described, which suggests a p21-dependent cytoprotective role for pacs-2 in ddr. consistent with the above data, we found that the migration of bromodeoxyuridine - positive (brdu) enterocytes along the crypt - villus following ir was restricted in wild - type mice but not in pacs-2 mice. together, these data describe the functional importance of pacs-2 as a specific in vivo regulator of the p53-p21 axis in ddr. we confirmed that p53 acetylation and p21 induction levels in pacs-2 depleted cells or tissues were sirt1 dependent, as sirt1 knockdown or addition of the sirt1 inhibitor ex-527 restored p53 acetylation and p21 induction, as observed by wb, as well as p21-dependent cell cycle arrest, in pacs-2 knockdown cells. the inhibition of sirt1 by pacs-2 was also confirmed by in vitro assays showing that pacs-2 directly binds to and inhibits sirt1-catalyzed p53 deacetylation. together, these data support a previously undescribed role of pacs-2the inhibition of sirt1 following dna damage as a cytoprotective component of the p53 signaling pathway, although the specific protein motifs or residues involved and the molecular mechanism by which pacs-2 inhibits sirt1 catalytic activity are still not fully understood. the promotion of p53-dependent p21 expression by pacs-2 depended on its ability to traffic to the cell nucleus. sequence analysis of human pacs-2 identified one nuclear localization signal (nls) and at least 2 putative nuclear export signals. correspondingly, mutation of the pacs-2 nls blocked its nuclear trafficking. moreover, pacs-2 responded to dna damage by increased translocation into the cell nucleus, where it repressed sirt1-mediated p53 deacetylation. curiously, sequence alignment of the nls sequences in pacs proteins from different species reveals that pacs-2 underwent a late evolutionary adaptation to acquire nuclear trafficking motifs. this new, and surprising, function of pacs-2 parallels the role of p53 in directing cell cycle arrest found in higher metazoans but not in worms or flies, where p53 function is limited to apoptosis induction. thus, these findings described a new compartment - specific function of pacs-2 following dna damage in response to the heightened need for p53 to resolve the damage. however, the mechanism by which pacs-2 is mobilized from the cytoplasm to the nucleus in response to dna damage remains unclear. overall, our work characterizes pacs-2 as a new inhibitor of sirt1 to specifically regulate the p53p21 axis in response to dna damage. interestingly, the role of the nuclear pool of pacs-2 in promoting p21-dependent cell cycle arrest could correlate with the role of the cytoplasmic pool of pacs-2 in promoting autophagy.. future work will determine how the ratio of pacs-2 pools is regulated in response to different stimuli and the crosstalk between them. | sirt1 regulates p53 transcriptional activation in response to genotoxic insult by deacetylating key lysine residues. we recently identified the multifunctional protein pacs-2 as a sirt1 inhibitor. after dna damage, pacs-2 binds and inhibits sirt1 to increase p53-dependent transactivation of the cdk inhibitor p21 (cdkn1a) and induce cell cycle arrest. |
the transcription factor p53 plays vital roles in the regulation of cellular processes and suppression of tumor development. mice lacking p53 develop normally but are prone to the development of a variety of tumors.tp53, the gene encoding the p53 protein, is mutated or deleted in nearly 50% of human cancers, rendering p53 nonfunctional as a tumor suppressor. although p53 retains wild - type status in the remaining 50% of human cancers, its function is effectively inhibited by a variety of mechanisms. one major inhibitory mechanism is through overexpression of mdm2 (also called hdm2 in humans). the role of mdm2 as a primary negative endogenous regulator of p53 is supported by evidence that mdm2-null is embryonically lethal in mice which can only be rescued by concurrent deletion of the tp53 gene. mdm2 and p53 regulate each other mutually through the autoregulatory feedback loop shown in figure 1. the autoregulatory feedback loop of the p53mdm2 interplay operates as follows : upon activation, p53 transcribes mdm2, leading to an increase of mdm2 mrna and protein and in turn, mdm2 protein binds to p53 directly through their n - termini and inhibits p53 function through three major mechanisms : (1) upon binding, mdm2 ubiquitinates p53 by functioning as an e3 ligase promoting proteasomal degradation of p53 ; (2) interaction of mdm2 with p53 blocks the binding of p53 to its targeted dna, rendering p53 ineffective as a transcription factor ; (3) mdm2 promotes export of p53 out of the cell nucleus, leaving p53 inaccessible to targeted dna and reducing its transcriptional ability. through these three inhibitory mechanisms, mdm2 functions as an effective antagonist of wild - type p53. consistent with its role as an efficient inhibitor of p53 tumor suppressor, mdm2 in cells, when overexpressed, is oncogenic. an analysis of 28 different types of cancers involving nearly 4000 human tumor samples shows that in 7% of human cancers, the mdm2 gene has been amplified. in addition to mdm2 gene amplification, mdm2 overexpression can be caused by a variety of mechanisms, such as single nucleotide polymorphism at nucleotide 309 (snp309) in its gene promoter, enhanced transcription, or increased translation. mdm2 overexpression correlates with poor clinical prognosis and poor response to current cancer therapies. in supporting its powerful inhibitory role of p53 tumor suppressor function, mdm2 gene amplification and tp53 gene mutation are mutually exclusive in human cancers. because mdm2 plays a primary role in inhibition of the p53 tumor suppressor function and antagonizes p53 through their direct interaction, blockade of the mdm2p53 protein protein interaction would liberate p53 from mdm2, thus restoring the tumor suppressor function of wild - type p53. agents designed to block the mdm2p53 interaction may have a therapeutic potential for the treatment of human cancers retaining wild - type p53. the mdm2p53 interaction has been mapped to the first 120 n - terminal amino acid residues of mdm2 and the first 30 n - terminal residues of p53. in 1996, a high - resolution cocrystal structure of mdm2 with a p53 peptide (residues 1529) was reported (figure 2, pdb code 1ycr). the cocrystal structure showed that the mdm2-bound p53 peptide adopts an -helical conformation and interacts with mdm2 primarily through three hydrophobic residues, phe19, trp23, and leu26. in this review, these p53 binding pockets on the mdm2 surface will be referred to as the phe19, trp23, and leu26 pockets. these three p53 binding pockets in mdm2 are compact and well - defined and suggest the feasibility of the design of high - affinity, non - peptide inhibitors that bind in the mdm2 pockets (mdm2 inhibitors) and block the mdm2p53 interaction. several reviews have summarized the progress in the design of mdm2 inhibitors. in this review, we will focus on those mdm2 inhibitors that have been advanced into human clinical trials and discuss the outlook of mdm2 inhibitors as a new class of anticancer agents. currently, seven small molecule mdm2 inhibitors have advanced into clinical trials for treatment of human cancers (table 1). of these clinical - stage compounds, the chemical structures for rg7112 (3), rg7388 (6), mi-77301/sar405838 (10), and amg 232 (14) have been disclosed but no structural information is available for the other three compounds. the first mdm2 inhibitor to enter phase i clinical trials was 3 (figure 3), discovered at hoffmann - la roche and based on a class of compounds called nutlins (figure 3). cis - diphenyl substituted imidazoline - containing compounds, called the nutlins, were reported as a first class of potent, specific, and orally active small molecule mdm2 inhibitors. one of the most potent compounds in the initial report was nutlin 3a (1), which binds to mdm2 protein with ic50 = 90 nm. a cocrystal structure of mdm2 complexed with nutlin 2 (2, figure 4, pdb code 1rv1) was obtained at a resolution of 2.3, which provided for the first time structural information for a non - peptide, small - molecule inhibitor bound to mdm2. superimposition of the cocrystal structures of mdm2/2 and mdm2/p53 peptide (figure 4) shows that two 4-bromophenyl rings and ethoxy substituent of 2 occupy the trp23, leu26, and phe19 pockets of mdm2, respectively. this study provides an elegant example of a non - peptide, druglike, small molecule mimicking the -helical p53 peptide structure in its binding to mdm2. compound 1 activates wild - type p53 in cancer and normal cells but selectively kills tumor cells. it inhibits cell growth with ic50 of 12 m in human cancer cell lines with wild - type p53 (sjsa-1, hct116, and rko) and demonstrates approximately 10-fold selectivity over cancer cells harboring mutated p53 (mda - mb-435 and sw480). these observations are consistent with the hypothesis that the antitumor activity of mdm2 inhibitors should be p53-dependent. in vivo, oral administration of 1 dose - dependently activates p53 and induces expression of p53 targeted genes, including p21 and mdm2. importantly, 90% inhibition of tumor growth is achieved in the sjsa-1 tumor xenograft model in mice upon treatment with nutlin 3 (the racemic form of 1) at 200 mg / kg orally twice a day for 20 days with no sign of toxicity in treated animals. further optimization of 1 to improve its binding affinity to mdm2, cellular potency, pharmacokinetics, and chemical stability ultimately yielded 3 (figure 3), the first mdm2 inhibitor to advance into clinical trials. four major modifications were made to 1 to yield 3 : (i) dimethyl groups on the imidazoline ring were added to prevent oxidation of the imidazoline ring ; (ii) an ethyl ether group replaced the isopropyl ether in 1, reducing the molecular weight slightly while retaining good mdm2 binding affinity ; (iii) a tert - butyl group was used to replace the methoxyl group in 1, which is a metabolic soft spot ; (iv) a 3-(methylsulfonyl)propyl group was introduced into the piperidine ring to enhance mdm2 binding and improve pharmacokinetic (pk) properties. notwithstanding these substantial modifications to the 1 structure, 3 and 1 interact with mdm2 very similarly based upon superposition of their cocrystal structures (figure 5, pbd codes 4ipf and 4j3e). the two 4-chlorophenyl groups occupy the trp23 and leu26 pockets of mdm2, and the ethoxyl group is in the phe19 pocket. the methylsulfonyl moiety of 3 extends out of the binding pocket and is exposed to solvent. superposition of cocrystal structures of mdm2 to 3 (cyan) and 1 (orange). compared with 1 it effectively inhibits cell growth in cancer cell lines with wild - type p53 (ic50 = 0.182.2 m) and demonstrates good selectivity over cancer cell lines with a p53 mutation (ic50 = 5.720.3 m). 3 robustly activates wild - type p53 in vitro and in vivo, and upon oral administration at 50 mg / kg in mice, good systemic exposure is achieved with a high auc (251.2 gh / ml) and cmax (15.5 g / ml) and slow clearance (t1/2 = 8.8 h). in two xenograft models of sjsa1 and mhm osteosarcoma cell lines with mdm2 gene amplification and overexpression of mdm2 protein, 3 dose - dependently inhibits tumor growth and achieves partial tumor regression at 100 mg / kg daily, oral administration without signs of toxicity in mice. compound 3 has been tested in clinical trials against a wide range of cancers, including sarcoma, myelogenous leukemia, and hematologic neoplasms, and results of phase i studies of 3 in chemotherapy - naive patients with mdm2-amplified liposarcoma have recently been reported. upon treatment with 3, a good human pk profile was achieved and a steady state was reached on day 8. clear activation of p53, increase in p21 protein, and apoptosis induction in tumors were observed. treatment with 3 showed signs of antitumor activity in patients ; post - treatment, 14 patients were found to have stable disease and one had a confirmed partial response. in addition, 16 out of 20 patients were treated with 3 for more than 6 months. all patients treated with 3 had at least one adverse event, and 12 serious adverse events were observed in eight patients, including neutropenia (six patients) and thrombocytopenia (three patients). it was found that exposure to 3 was correlated with hematological toxicity. on the basis of the clinical data for 3, it was concluded that the potential for late hematological toxicity, particularly thrombocytopenia, should be considered in future clinical trials of mdm2 inhibitors. the synthesis of 3, based on published reports, is summarized in scheme 1. reagents and reaction conditions : (a) alme3, toluene, reflux ; (b) phosgene, et3n ; (c) et3n ; (d) resolution by chiral chromatography. on the basis of the structures of mi-219 (8, figure 8) and 3, the hoffmann - la roche group designed and synthesized the pyrrolidine - containing compound 4(33) as an mdm2 inhibitor. the two phenyl groups in 4 adopt a trans configuration, in contrast to 3 and 8 in which the two substituted phenyl groups are in a cis configuration. compound 4 binds to mdm2 with a good affinity (ic50 = 196 nm) but is weaker than 3. the cocrystal structure of mdm2/4 (figure 7, pbd code 4jrg) shows that the 4-chlorophenyl group and neopentyl group of 4 occupy the trp23 and phe19 pockets, respectively, while the 2-chlorophenyl group occupies the leu26 pocket and partakes in a interaction with the his96 residue. additionally, the carbonyl group of 4 forms a hydrogen bond with nh of his96. pharmacokinetic studies showed that 4 has a high clearance rate and poor oral bioavailability, issues that were addressed in further modification efforts. activity relationship (sar) analyses show that addition of fluorine atoms to the two phenyl rings of 5(33) enhances the mdm2 binding affinity. the dihydroxybutyl side chain of 5 was replaced with a variety of groups with the goal of improving the mdm2 binding affinity, cellular potency, microsomal stability, and pk properties. this led to the identification of m - methoxybenzoic acid group as an optimal group at this site, which ultimately resulted in the discovery of 6 (also known as ro5503781, figure 6) for clinical development. it displays potent cell growth inhibitory activity in cancer cell lines containing wild - type p53 (average ic50 = 30 nm) and displays > 100-fold selectivity over cancer cell lines containing mutated p53. furthermore, it has good microsomal stability and good pk properties. in mice, it has high oral bioavailability (80%), moderate clearance (t1/2 = 1.6 h), and good systemic exposure and metabolic stability and is more potent than 3 and 1 in induction of p53 activation in vivo. with oral daily administration, it achieves tumor regression in the sjsa-1 osteosarcoma xenograft model in mice at 25 mg / kg. it is currently in three phase i clinical trials for treatment of patients with solid tumors, acute myelogenous leukemia, or advanced malignancies as a single agent and in combination with chemotherapeutics. the maximum tolerated dose for 6 is 500 mg in a daily dosing (q.d.), 5 day schedule, 500 mg in a twice - daily (b.i.d.), 3-day schedule and 1600 mg in a b.i.d., weekly schedule. activation of p53, as measured by mic-1 concentration in plasma, was observed either with daily dosing for 5 days or with b.i.d. dosing for 3 days, but it is stronger with daily, 5-day dosing. interestingly, thrombocytopenia, neutropenia, febrile neutropenia, and diarrhea were the dose - limiting toxicities. reagents and reaction conditions : (a) agf, et3n, ch2cl2, rt, 18 h ; (b) cf3co2h, ch2cl2, rt, 18 h ; (c) resolution by chiral chromatography ; (d) ph2pocl, (i - pr)2net, ch2cl2, rt ; (e) aq naoh, thf, methanol, 40 c. the small molecule mdm2 inhibitor 10 (figure 8), discovered at the university of michigan, was advanced into phase i clinical trials by sanofi in 2012. compound 10 was obtained through extensive optimization of a class of spirooxindoles, such as 7, first reported in 2005 from our laboratory. compound 7 was designed using a structure - based approach to mimic three key p53 binding residues (phe19, trp23, and leu26) but has weak mdm2 binding affinity (ki = 8.46 m). subsequent modifications of the two phenyl rings and the aliphatic and the amide side chain were carried out to improve its mdm2 binding affinity, cellular potency, and in vivo pk properties. addition of a 3-chloro substituent atom on the phenyl ring and replacement of the isopropyl group with neopentyl improves the mdm2 protein binding affinity, as does replacement of the dimethylamide with a monosubstituted amine. the addition of a fluorine atom next to the chlorine on the oxindole ring generally improves the pk profile of spiro - oxindole - containing mdm2 inhibitors. following these modifications, a potent compound, 8(41) this compound binds to mdm2 with ki = 23.5 nm and activates wild - type p53 in cancer cells. 8 shows fairly potent cell growth inhibitory activity (ic50 1 m) in cancer cell lines with wild - type p53, and it is more than 10-fold less potent in cancer cells harboring mutated or deleted p53. oral administration of 8 at a dose of 300 mg / kg twice daily completely inhibits tumor growth inhibition but fails to achieve tumor regression in the sjsa-1 xenograft tumor model. further optimization of 8 led to 9(44) (mi-888), in which the spiro - oxindole scaffold has a different stereochemistry. the trans conformation of two substituted phenyl rings in 9 was found to be critical for improved mdm2 binding affinity. in addition, removal of the fluorine atom from the oxindole ring is beneficial to mdm2 binding affinity and addition of a single fluoro substituent on the phenyl ring improves the pk profile. finally, the soluble tail, the cis-3-hydroxy-3-methyl - cyclobutylamino group, also contributes to the improved mdm2 binding affinity and a good in vivo pk profile. 9 has an excellent mdm2 binding affinity (ki = 0.44 nm) and shows potent cell growth inhibition potency in sjsa-1 and rs4;11 cell lines (ic50 of 80 and 60 nm, respectively). it displays > 100-fold selectivity for cancer cell lines with wild - type tp53 over those with mutated or deleted tp53. it is stable in mouse, rat, and human microsomes and has high systemic exposure in a mouse pk study. oral daily administration of 9 at 100 mg / kg achieves complete and durable tumor regression in both the sjsa-1 osteosarcoma and acute leukemia rs4;11 xenograft models in mice without signs of toxicity. replacement of the cis-3-hydroxy-3-methylcyclobutylamino group of 9 with a trans-4-hydroxycyclohexylamino group led to clinical compound 10. compound 10 binds to mdm2 with a ki value of 0.88 nm. a cocrystal structure of the mdm2/10 complex (figure 9) was determined and provided a structural basis for its high binding affinity to mdm2. 10 mimics the three key p53 binding residues (phe19, trp23, and leu26) in hydrophobic contacts and hydrogen bonding in its interaction with mdm2 but captures additional interactions. the cl atom in the oxindole group of 10 has extensive hydrophobic contacts with mdm2. there is stacking between the his96 of mdm2 and the 2-fluoro-3-chlorophenyl in 10, and a hydrogen bond between the imidazole side chain of his96 and the carbonyl group in 10. interestingly, the n - terminus of mdm2 (residues 1018) refolds and enjoys extensive interactions with 10 through val14 and thr16, which contributes 25-fold to the binding affinity. in contrast, the n - terminus of mdm2 (residues 118) has no significant contribution to the binding of p53 peptides and 1. compound 10 inhibits cell growth with ic50 values of 100200 nm in sjsa-1, rs4;11, lncap, and hct116 cancer cell lines containing wild - type p53 and demonstrates > 100-fold selectivity over cancer cells lines with mutated or deleted p53. compound 10 effectively activates wild - type p53 in cancer cell lines at concentrations as low as 30 nm in vitro and in xenograft tumor tissue of leukemia and solid tumors, leading to p53-dependent cell cycle arrest and/or apoptosis in tumor cells. with daily oral administration at 100 mg / kg, it achieves complete and durable tumor regression in mouse xenograft models of sjsa-1 osteosarcoma and rs4;11 acute leukemia, partial (80%) regression in the lncap prostate cancer xenograft model, and complete tumor growth inhibition in the hct116 colon cancer xenograft model. a single oral dose of compound 10 at 200 mg / kg induces strong apoptosis in the sjsa-1 tumor tissue with the effect lasting for > 3 days and complete tumor regression in 100% of animals. mechanistically, robust transcriptional up - regulation of puma induced by 10 is associated with robust apoptosis in cancer cell lines in vitro, tumor tissue in vivo, and complete tumor regression in xenograft models in mice. these preclinical data suggest the strong therapeutic potential of compound 10 for the treatment of different types of human cancer. sanofi initiated a phase i clinical trial of compound 10 to assess its safety, tolerability, pharmacokinetics, and biological activity in patients with advanced cancer. a second phase i trial was initiated in 2013 to evaluate 10 in combination with pimasertib, an allosteric inhibitor of mek1/2 in patients with solid tumors. (a) toluene, molecular sieves 4, reflux overnight ; (b) trans-4-aminohexanol, thf, rt, 2 days ; (c) can, acetonitrile h2o compound 14 (figure 10), discovered and developed by amgen, entered phase i clinical trials for the treatment of human cancer in 2012. this compound was obtained through structure - based design and extensive optimization of a new class of mdm2 inhibitors containing piperidin-2-one. structures of piperidinone - containing compounds. the piperidinone - containing compound 11(48) (figure 10) was designed as an mdm2 inhibitor based upon a structural analysis of known mdm2 inhibitors, such as 1, 8, and a previously reported mdm2 inhibitor by amgen, to mimic three key binding residues in p53. compound 11 binds to mdm2 with ic50 = 34 nm and served as an excellent lead compound for further optimization. upon the basis of the nmr and cocrystal structures of 11 or its analogues complexed with mdm2 (figure 11, pdb codes 4hmb and 2lzg), further optimization of two sites of 11 yielded 12 (am 8553), which has an ic50 value of 1.1 nm to mdm2 (kd = 0.4 nm to mdm2). compound 12 effectively activates wild - type p53 in vitro and in vivo and dose - dependently inhibits tumor growth in the sjsa-1 xenograft model in mice. at 150 and 200 mg / kg daily oral dosing for 2 weeks, it achieves partial tumor regression (27%) after 2 weeks of treatment. it was further optimized for potency, pharmacokinetic properties, and in vivo efficacy. this yielded a series of potent and orally active mdm2 inhibitors including 13(38) and 14, whereas the latter was selected for clinical development. nmr structure of mdm2/11 (left) and x - ray crystal structures of mdm2/11 analogue (middle and right). several high - resolution cocrystal structures of mdm2 complexed with members of this class of mdm2 inhibitors have been determined and provide structural insights into their high affinity binding. in the mdm2/13 cocrystal structure (figure 12, pdb code 4oas), the 3-chlorophenyl and 4-chlorophenyl groups project into the leu26 and trp23 pockets, respectively. the sulfonyl tert - butyl group resides in the small pocket around g58, and the carboxylic acid forms a salt bridge with the his96 residue of mdm2. the cocrystal structure for mdm2/14 has not been reported, but amgen scientists predict that 14 has a similar binding model as 13. furthermore, binding between inhibitors in this class (e.g., 11) and mdm2 induces reorganization of the extreme n - terminus of the mdm2 protein and promotes additional hydrophobic contacts between the m - chlorophenyl moiety in the inhibitors and the val14 and thr16 residues in mdm2 (figure 11, right). hence, 14 not only mimics the three key p53 residues but captures additional interactions not observed between p53 and the refolded mdm2 to achieve a very high binding affinity with mdm2. compound 14 binds to mdm2 with ic50 = 0.6 nm in a competitive binding assay and has a kd value of 0.045 nm with mdm2, determined by surface plasmon resonance (spr). it potently inhibits cell proliferation with ic50 values of 9.1 and 10 nm in an brdu proliferation assay in the sjsa-1 and hct-116 cell lines, respectively, and demonstrates over > 1000-fold selectivity over the hct-116 p53 knockout (p53) cell line. in efficacy studies using human tumor xenograft models in mice, it effectively inhibits tumor growth in the sjsa-1 osteosarcoma model with an ed50 of 9.1 mg / kg with daily oral administration and demonstrates complete tumor regression in 10 of 12 animals treated with 60 mg / kg daily. it also effectively and dose - dependently inhibits tumor growth in the hct-116 xenograft model with twice daily dosing with an ed50 of 16 mg / kg and achieves tumor stasis (100% tumor growth inhibition) without tumor regression. in preclinical safety evaluations, no significant liability was found for 14 to preclude it from clinical development ; it was projected to have a low clearance rate and consequently a long half - life in humans. reagents and reaction conditions : (a) 10% t - buok, thf, rt, 2 d ; (b) 0.2% rucl2[(s - xylbinap)(s - daipen) ], 40% t - buok, i - proh, h2 (50 psi), rt, 65 h ; (c) lioh, thf / meoh / h2o ; (d) ppts, toluene, reflux ; (e) lihmds, allyl bromide, thf ; (f) neat, 100 c, overnight ; (g) tf2o, 2,6-lutidine, ch2cl2, 78 to 0 c ; (h) aq nahco3 ; (i) tf2o, 2,6-lutidine. the mdm2 inhibitor mk-8242, also known as sch 900242, developed by merck has been tested since 2011 as a single agent or in combination with cytarabine in patients with advanced solid tumors or leukemia. the mdm2 inhibitors, cgm097 (35) developed by novartis international ag and ds-3032b (36) developed by daiichi sankyo inc., have also entered phase i clinical trials in 2013. compound 35 is to be tested in selected patients who have advanced solid tumors with p53 wild status. compound 36 will be tested in patients who have advanced solid tumors or lymphomas. the chemical structures and preclinical data for these three clinical - stage mdm2 inhibitors have not been disclosed. in addition to the seven compounds that have been advanced into clinical development, there are several additional classes of mdm2 inhibitors that have been reported by industrial and academic groups. johnson & johnson reported a class of benzodiazepine - containing compounds as mdm2 inhibitors. one of the better compounds they reported was 15 (figure 13 and table 2), which had mdm2 binding affinity (kd = 80 nm), while its corresponding enantiomer was 50 times less potent. compound 15 has low cell permeability, rapid in vivo clearance, and low bioavailability. subsequent modifications led to 16, in which soluble tails were added and the carboxylic acid moiety was replaced by a substituted benzyl group. compound 16 shows mdm2 binding (ic50 = 394 nm) and brdu incorporation (ic50 = 1.1 m) in the mcf-7 cell line. examples of reported mdm2 inhibitors in the literature. binding affinity was measured as kd ; binding affinity was measured as ki average of three cell lines sjsa-1, hct116, and rko researchers at the university of newcastle reported isoindolinone - containing compounds as mdm2 inhibitors. subsequent optimization efforts guided by nmr analysis led to the identification of compound 17 (figure 8), which has binding affinity to mdm2 (ic50 = 0.17 m) in an elisa assay and cell growth inhibition (gi50 = 5.2 m) in the sjsa-1 cell line. in addition to 14, scientists from amgen reported a class of chromenotriazolopyrimidine compounds as mdm2 inhibitors. extensive modifications of these compounds led to 18, which binds to mdm2 with ic50 = 350 nm and shows moderate cellular activity and microsomal stability, high oral bioavailability (54%), and slow clearance in rodents. in 2010, chemical modifications led to 19, which has cellular growth inhibition activity > 20 times that of nutlin-3 in a selected subset of cancer cell lines. researchers from daiichi sankyo reported a class of 5,6-dihydroimidazo[2,1-b]thiazol - containing compounds (20, 21) as potent mdm2 inhibitors.20 has high mdm2 binding affinity (ic50 = 9.2 nm) but poor metabolic stability, resulting in weak in vivo antitumor efficacy in an mv4 - 11 xenograft model. after extensive modifications, 21 was obtained and shows high mdm2 binding potency (ic50 = 58 nm), moderate solubility (25 g / ml) in ph 6.8 phosphate buffer, good hepatic microsomal stability, and high systemic exposure in mice. it also showed 50-fold selectivity in tp53 wild type over tp53-mutated cell lines (gi50 = 0.22 m in mv4;11 vs gi50 = 10 m in dld-1). upon oral administration of 21 at a daily dose of 200 mg / kg, 76% tgi was achieved at the end of treatment in mouse mv4;11 tumor xenograft model with no sign of acute toxicity. a class of compounds featuring a 3-(1h - imidazol-5-yl)-1h - indole-2-carboxylic acid structure was reported independently by two groups. scientists from novartis reported 22, which has an mdm2 binding affinity of ic50 = 30 nm. in addition, 23 was synthesized by dmling s group at the university of pittsburgh by means of a three - component reaction and was found to have mdm2 binding affinity (ki = 916 nm) in a fluorescent polarization assay. another class of 2-indolecarboxylic acid containing mdm2 inhibitors also has three hydrophobic groups converging on a sp carbon and 24 ; the best of these compounds binds to mdm2 with ki = 130 nm. in 2012, 1h - pyrrolone - containing compounds, such as 25, 25 has mdm2 binding (ki = 0.15 m) and cell growth inhibition (ic50 1.9728.11 m) in saoc-2, u-2os, a549, and nci - h1299 cell lines. using pharmacophore - based virtual screening, wang and co - workers identified thiophene - containing compounds as mdm2 inhibitors. one of the most potent of these compounds, mcl0527 - 3 (26), shows mdm2 binding affinity (ic50 = 0.90 m) and cell growth inhibition (ic50 of 2.41, 0.59, and 102.3 m in a549, hct116, and sjsa-1 cell lines, respectively). a dihydroimidazole - containing compound pb11 (27), synthesized from a multiple component reaction followed by amidation, has mdm2 binding affinity (kd = 0.8 m). merck scientists recently reported a class of piperidine - containing compounds (28, 29) with mdm2 binding (ic50 of 169 and 41 nm, respectively). detailed sar studies and computational calculations suggested that substituents on the 2-position of the piperidine ring, for example the allyl moiety of 28, can stabilize the binding conformation of the piperidine ring and are compatible with both polar and nonpolar functional groups. however, both compounds 28 and 29 inhibit cyp 3a4 (ic50 1000 times better than the affinities of p53 peptides. pharmacokinetic properties, including oral bioavailability, have also been extensively optimized for these clinical - stage mdm2 inhibitors. the successful discovery of these highly potent and selective mdm2 inhibitors with optimized pharmacokinetic properties is a success of modern medicinal chemistry in targeting protein protein interactions. when the interaction of mdm2 with p53 is blocked, these potent mdm2 inhibitors inhibit mdm2-mediated p53 ubiquitination and degradation, leading to accumulation and activation of p53 protein in cells with wild - type p53. activation of p53 results in transcription of p53-targeted genes, including p21, a cell cycle regulator, and puma, a proapoptotic protein, leading to cell cycle arrest and/or apoptosis in tumor cells. since mdm2 is also a p53-targeted gene, mdm2 inhibitors also induce up - regulation of mdm2 mrna and protein. as expected, these potent and selective mdm2 inhibitors dose - dependently and effectively activate p53 in tumor cells with wild - type p53 but not in tumor cells harboring mutated or deleted p53. they potently inhibit cell growth in cancer cell lines with wild - type p53 and show high selectivity over cancer cell lines with mutated or deleted p53. interestingly, while mdm2 inhibitors can inhibit cell cycle progression in all tumor cell lines with wild - type p53, they effectively induce apoptosis in only some cancer cell lines. analysis of p53-regulated proapoptotic genes, puma, noxa, and bax, in a number of cancer cell lines revealed that puma, but not noxa and bax, was induced by mdm2 inhibitors and the magnitude of puma induction correlates with the degree of apoptosis induction. although earlier generations of mdm2 inhibitors such as 1 and 8 are capable of inhibiting 100% tumor growth in xenograft models of human cancer, they are unable to achieve complete tumor regression. however, recently discovered mdm2 inhibitors such as 10 and 14, with improved binding affinities to mdm2, cellular potencies, and significantly optimized pharmacokinetic properties, can effectively induce complete tumor regression in the sjsa-1 osteosarcoma xenograft model in mice. the sjsa-1 osteosarcoma cell line has mdm2 gene amplification and is sensitive to mdm2 inhibitors in apoptosis induction. although only 7% of all human cancers have an amplified mdm2 gene, a higher frequency of mdm2 gene amplification occurs in certain tumor types, including well - differentiated liposarcomas (> 80%), soft tissue tumors (20%), osteosarcomas (16%), and esophageal carcinomas (13%). the complete tumor regression achieved by these new mdm2 inhibitors in the sjsa-1 xenograft model suggests their therapeutic potential as single agents for the treatment of human cancers with mdm2 gene amplification. additionally, mdm2 inhibitors such as 6 and 10 have been shown to achieve tumor regression in leukemia xenograft models in mice. in other xenograft models, such as the xenograft model of the hct-116 colon cancer cell line, mdm2 inhibitors effectively inhibit tumor growth (tumor stasis) but fail to achieve tumor regression. this is consistent with their ability to effectively inhibit cell cycle progression and their inability to induce apoptosis in the hct-116 cell line. taken together, these in vivo data suggest that mdm2 inhibitors may have a strong therapeutic potential for the treatment of a subset of human solid tumors and leukemia. in addition to the development of mdm2 inhibitors as single agents, mdm2 inhibitors have been evaluated in combination with both traditional chemotherapeutic agents and molecularly targeted agents. these potent mdm2 inhibitors in clinical development are highly selective for mdm2, but they fail to target mdmx, which directly interacts with p53 and inhibits its function. since a number of chemotherapeutic agents such as irinotecan and doxorubicin can effectively down - regulate mdmx, their combination with mdm2 inhibitors can be very effective for the treatment of human cancers with high expression of both mdm2 and mdmx proteins. in addition to these traditional chemotherapeutic agents, mek inhibitors such as trametinib are very effective in induction of down - regulation of mdmx. indeed, mek inhibitors such as trametinib and pimasertib are currently being evaluated in combination with either 10 or 14 in clinical trials for the treatment of patients with acute myeloid leukemia or solid tumors. acquired resistance of tumor cells to cancer drugs is a major clinical challenge in drug development. because mdm2 inhibitors are only effective in targeting tumor cells with wild - type p53, they may select resistant tumor cells that acquire p53 mutation(s) that escape mdm2 control. indeed, treatment of sjsa-1 cells with nutlin 3 in cell cultures has resulted in selection of colonies that contain p53 mutations in dna binding domain and become highly resistant to nutlin 3. therefore, combinations of mdm2 inhibitors with agents that are effective against tumor cells with p53 mutations should be tested to prevent or delay acquired resistance. since mdm2 inhibitors also activate p53 in normal cells and normal tissues, there is a concern that activation of p53 can cause toxicity in those normal tissues sensitive to p53 activation, such as bone marrow, spleen, and small intestines. data from phase i clinical trials of 3(40) and 6(34) showed that these mdm2 inhibitors cause thrombocytopenia (decrease of platelets in blood), which is a major dose - limiting toxicity. mechanistic studies showed that 3 promoted apoptosis of megakaryocyte (mk) progenitor cells, resulting in a reduction of their numbers and affected mature mk cells by blocking dna synthesis during endomitosis and impairing platelet production. therefore, determination of appropriate dose schedules that can achieve robust p53 activation and strong antitumor activity but have manageable on - target toxicity will be another critical task for the successful development of these potent mdm2 inhibitors. | design of small - molecule inhibitors (mdm2 inhibitors) to block the mdm2p53 protein protein interaction has been pursued as a new cancer therapeutic strategy. in recent years, potent, selective, and efficacious mdm2 inhibitors have been successfully obtained and seven such compounds have been advanced into early phase clinical trials for the treatment of human cancers. here, we review the design, synthesis, properties, preclinical, and clinical studies of these clinical - stage mdm2 inhibitors. |
lupoid cutaneous leishmaniasis (cl) is a rare form of cl having a striking resemblance to other granulomatous cutaneous conditions of infectious or inflammatory origin. the authors present a patient with a facial lupoid cl and discuss the diagnostic tools of this parasitological infection, the main differential diagnosis, and treatment. a 54-year - old tunisian woman, with no past medical history of lupus erythematosus or infectious disease, presented with a 3-month history of a slowly enlarging erythematous and infiltrated plaque, extending over the nose, the right cheek, and the internal aspect of the right lower eyelid. microscopic examination of a parasitological smear showed numerous leishmania in their amastigote form, inside monocytes, confirming the diagnosis of cl. the patient was cured by fluconazole 200 mg / day for 6 weeks after pancreatic intolerance with intramuscular meglumine antimoniate (60 mg / kg / day for 7 days), and no response to doxycycline (200 mg / day for 6 weeks). lupoid cl is easily suspected in countries in which there is an endemic of leishmaniasis. in countries where there is nt an endemic, although rarely observed, this diagnosis should also be kept in mind in front of an infiltrated facial lesion of a tuberculoid aspect on histology, especially when there is a positive travel history to an area in which there is an endemic. cutaneous leishmaniasis (cl) is a widespread parasitic disease in tunisia with numerous clinical presentations. lupoid leishmaniasis is the most common cl among patients with unusual presentations.1 the authors present its clinical feature, the diagnostic tools, differential diagnosis, course, and treatment of this uncommon long - lasting form of cl. a 54-year - old tunisian woman, with no past medical history, presented with a 3-month history of a slowly enlarging erythematous plaque of the central face. cutaneous examination showed a large solitary erythematous and infiltrated plaque, extending over the nose, a large part of the right cheek, and reaching the internal aspect of the right lower eyelid. over the nose, the lesion appeared slightly squamous (figure 1). the patient did not respond to oral amoxicillin (4 g / day) for 10 days, prescribed by another physician before she was referred to our department. the resulting tissue was smeared on a slide and stained with may grnwald giemsa (merck k gaa, 64271, darmstadt, germany). microscopic examination showed numerous leishmania appearing in their amastigote form, outside monocytes (figure 2), confirming the clinical suspicion of cl. the patient was treated with intramuscular injections of meglumine antimoniate (ma), 60 mg / kg / day. on the 7th day of treatment, she had elevated levels of serum amylase (two times the normal level) with high urine amylases. she then underwent fluconazole 200 mg / day for 6 weeks, with a significant improvement of the lesion. large erythematous and infiltrated plaque, extending over the nose, the right cheek and reaching the internal aspect of the right lower eyelid. extracellular amastigote form with the nucleus (a) and the kinetoplast (b). tunisia is a country where cl is frequent and there have been incidences in which there has been an endemic and an epidemic of old world leishmaniasis.2 thus, the diagnosis of cl was easily suspected in our patient, when presented with such a facial lesion having a chronic course with no signs of inflammation, pain, or pruritus. in tunisia, there are three main epidemiological and clinical forms, depending on geographic origin and each due to a different species of leishmania : the sporadic cl, which is predominant in the north of tunisia and caused by leishmania infantum mon-24, the zoonotic form (centre and south - west of tunisia) caused by leishmania major mon-25, and the chronic cl occurring in the southern - east of tunisia and caused by leishmania killicki.3 the most frequent form is the zoonotic form, which is epidemic with a seasonal outbreak especially in autumn and summer (mean of 30005000 cases per year).3 in zoonotic cl, lesions have a rapid self - limiting evolution and in the absence of treatment, lesions heal in 68 months. in contrast, the chronic form is a long - lasting infection with a 26 year duration having an endemic pattern along the year (50100 cases per year).3,4 since the patient originates from and lives in the north of tunisia, our patient probably had the sporadic form of cl (l. infantum). the sporadic form is also a relatively long - lasting infection with a 12 year duration. it occurs at an incidence of 30 cases per year.3 the typical clinical presentation is an erythematous infiltrated, ulcerated, and crusted papule or nodule (classical oriental sore) of any region of the body, with a frequent involvement of exposed areas, especially the face and limbs. this typical lesion heals slowly over a period of 312 months and constitutes the most frequent one.5 there are many other clinical forms of cl, among them the lupoid cl, observed in the present patient, which is a particularly uncommon form with characteristic spreading of the initial lesion leading to a solitary erythematous ; infiltrated plaque with unlimited borders progressively confounding with adjacent normal skin. sometimes, brown - red or brown - yellow papules appear and progressively coalesce and even lead to the formation of apple - jelly nodules, characteristic of the lupoid aspect of this form.6,7 the lesion may even be squamous with a psoriasiform aspect or produce crusts, and may closely resemble lupus vulgaris (lv). although not as destructive as lv, lupoid cl may persist and spread for many years and aggravate gradually.7,8 lupoid cl is most prevalent in the endemic areas of leishmaniasis, particularly in the middle east and afghanistan with a reported incidence of 0.5%6.2% of all cl cases.9 in tunisia, in a recent study including sporadic cl cases, lupoid cl represented 8.9% of cases in adults.10 it seems that in lupoid cl, the parasite is not killed, but it replicates inside the macrophage. these findings suggest that certain leishmanial strains, which induce chronic disease, may have the capacity to evade intracellular destruction by activated macrophages, or that there is a defect in the t - cell activation process.7,11 in lupoid cl, the amastigote forms are rare or absent on a parasitological smear.7,8 in this patient, there was fortunately a positive parasitological smear. this can be explained by the short course of the lesion (only 3 months) at the moment of diagnosis. histologically, the aspect is that of a tuberculoid granuloma with giant multinucleated cells but without classification. intra - macrophagic amastigotes are also rare or usually absent.7,8 in this form of cl, promastigotes are also difficult to maintain on novy - macneal - nicolle (nnn) medium, especially in sporadic cl due to l. infantum. although species - specific polymerase chain reaction (pcr) analysis is sensitive in cases of acute cutaneous leishmaniasis, momeni. found lesser sensitivity of pcr in lupoid leishmaniasis (only 47%).6 in the literature, leishmania tropica is thought to be the most frequent causative agent of lupoid cl.7 in tunisia, this form seems to be less rare with l. infantum and l. killicki. in case of negative parasitological examination and in the absence of intra - amastigotes on histology, diagnosis is made based on suggestive clinical aspect, facial localization, chronic evolution, and sometimes patients may recall the initial sandfly bite. all these criteria in a region where there is an endemic or epidemic of leishmaniasis, like tunisia, or even in case of positive travel history to an endemic area, can aid in correct diagnosis. despite all the above - mentioned arguments for the diagnosis of cl, when presented with such a facial lesion, the authors can evoke other diagnoses such as lv (cutaneous tuberculosis),12 lupus erythematosus (le), or lupus pernio, which is a form of cutaneous sarcoidosis and facial erysipelas.12,13 in the absence of randomized controlled trials, there is not enough data about the correct and selective therapeutic protocol for the treatment of lupoid cl. this is also the case in tunisia, where most clinicians use either intralesional ma or intramuscular injection of ma 60 mg / kg / day for 1520 days in cases of resistance to local injections, multiple lesions (> 5), proximity to the cartilage, joint, and periorificial lesions.10 this dose is considered as the standard dose of systemic ma in the treatment of cl.14 oral fluconazole has been shown to be safe and effective for cl with advantages particularly important in pediatrics;15,16 for some authors it may be a second line treatment.17 the patient responded adequately to fluconazole after ma intolerance. many other treatments have been reported to be used as monotherapy in treating cl such as cryotherapy, paramomycin ointment, intradermal injections of sodium stibogluconate, oral itraconazole, pentamidine, and miltefosine for the last few years. lupoid cl is usually resistant to conventional therapies for cl and it may persist and spread slowly for many years.18,19 due to possible resistance of lupoid cl to the previous modalities, combined therapies were tried. reported a successful result with a combination of ma and allopurinol.20 nilfrousihzadeh also showed that 17%, 57%, and 65% of complete cure of the lesions at the end of the 4th, 8th, and 10th week, respectively, were observed with combined cryotherapy, paramomycin, and intralesional ma in treating lupoid and chronic leishmaniasis,21 however, another study showed that carbon dioxide laser seems to be highly effective since it led to 90% efficacy in treating 24 patients with lupoid cl,18 and another study reported 16 cases who responded very well to ma without chronic infection or relapse, which suggests that lupoid cl should be revisited and redefined.7 in conclusion, while lupoid cl is an easily - suspected diagnosis in endemic countries for leishmaniasis, outside endemic areas it can be mistaken for other disorders due to a clinical similarity. thus, this diagnosis should be considered in patients who present an infiltrated facial plaque with a tuberculoid granuloma on histology. | backgroundlupoid cutaneous leishmaniasis (cl) is a rare form of cl having a striking resemblance to other granulomatous cutaneous conditions of infectious or inflammatory origin. the authors present a patient with a facial lupoid cl and discuss the diagnostic tools of this parasitological infection, the main differential diagnosis, and treatment.case reporta 54-year - old tunisian woman, with no past medical history of lupus erythematosus or infectious disease, presented with a 3-month history of a slowly enlarging erythematous and infiltrated plaque, extending over the nose, the right cheek, and the internal aspect of the right lower eyelid. microscopic examination of a parasitological smear showed numerous leishmania in their amastigote form, inside monocytes, confirming the diagnosis of cl. clinical aspect was in favor of lupoid cl. the patient was cured by fluconazole 200 mg / day for 6 weeks after pancreatic intolerance with intramuscular meglumine antimoniate (60 mg / kg / day for 7 days), and no response to doxycycline (200 mg / day for 6 weeks).discussionlupoid cl is easily suspected in countries in which there is an endemic of leishmaniasis. in countries where there is nt an endemic, although rarely observed, this diagnosis should also be kept in mind in front of an infiltrated facial lesion of a tuberculoid aspect on histology, especially when there is a positive travel history to an area in which there is an endemic. |
thus, taxane formulations with surfactants such as polysorbate 80 and ethanol have been approved for the management of several cancers, including prostate adenocarcinoma (14). however, ethanol and polysorbate 80 have the tendency to cause infusion - related toxicities and hypersensitivity reactions (57). to avoid these adverse events, premedication with corticosteroids and antihistamines furthermore, several new drug delivery systems have been researched, such as liposomes, polymeric micelles, protein and nanospheres (814). nanotechnology for drug delivery has achieved significant improvements in the efficacy and safety of drugs (1517). these nanoparticles are composed of organic substances, such as lipids, phospholipids, dextran and chitosan. the drug particles are occasionally reduced in size to nanoparticles in order to avoid use of other substances as carriers (1820). we herein present the case of a patient with adenocarcinoma of the prostate with bone metastasis, who developed an allergic reaction to conventional docetaxel and was later started on doceaqualip, a nanosomal docetaxel lipid suspension (ndls). doceaqualip, which is devoid of polysorbate 80 and ethanol, was developed with lipids generally recognized as safe (gras) by the us food and drug administration. doceaqualip has achieved a higher systemic availability of docetaxel when compared with conventional docetaxel in patients with solid tumors. furthermore, the increased efficacy of doceaqualip compared with that of conventional docetaxel has been proven in patients with breast cancer without requirement for any premedication (18). a 65-year - old male patient from nairobi, kenya, initially presented with severe back pain in august, 2015. the patient was evaluated and diagnosed with adenocarcinoma of the prostate with bone metastasis after undergoing fluorodeoxyglucose (fdg) positron emission tomography / computed tomography (pet / ct). prostate needle biopsy revealed adenocarcinoma of the prostate with a gleason score of 8 (4 + 4) and he was treated with goserelin acetate injection and bicalutamide tablets for ~3 months. the patient had a history of hypertension that was controlled with treatment, and a history of transurethral resection of the prostate (turp). the patient had an eastern cooperative oncology group (ecog) performance status of < 2. a ga-68 prostate - specific membrane antigen (psma) pet / ct scan revealed post - turp changes, with small mild nodular hypermetabolism in the left posterior peripheral zone, likely representing residual prostatic disease. 1), with a standardized uptake value (suv) of 10.5 for the prostate and 18.0 for skeletal lesions. the serum prostate - specific antigen (psa) level was 0.32 ng / ml. the cardiac function was normal, with an ejection fraction of 62%. chemohormonal therapy was planned and the patient was admitted for the first cycle of chemotherapy. injection of docetaxel 120 mg, denosumab 120 mg and degarelix 240 mg was scheduled, with 5 cycles planned for docetaxel. following written informed consent, the first cycle was initiated with conventional docetaxel (taxotere) 120 mg after premedication with corticosteroids and antihistamines. the patient developed an anaphylactic reaction (bronchospasm, hypotension and skin rash) within 5 min ; he was administered an iv injection of chlorpheniramine maleate (avil), hydrocortisone and paracetamol, and recovered within 10 min. after 12 h, the patient received 120 mg of the ndls doceaqualip, which was well - tolerated without any adverse reactions. the patient subsequently received the next 3 cycles of chemotherapy with doceaqualip. a reassessment examination performed after the third cycle of chemotherapy with a ga-68 psma pet / ct scan (fig. 1) showed mild interval regression of the small mild nodular hypermetabolism in the left posterior peripheral zone and morphologically stable heterogenous osteosclerotic lesions with internal regression of the metabolic activity. no new metastases were observed, with an suv of 6.9 for the prostate and 19.4 for the skeletal lesions. the patient received the fifth cycle of doceaqualip in march, 2016, along with degarelix injection 80 mg, denosumab 120 mg, filgrastim 300 g and bicalutamide tablets 50 mg. the patient was followed up 3 months later and the adenocarcinoma of the prostate had regressed considerably. the taxanes paclitaxel (taxol) and docetaxel (taxotere) have been proven to be effective as first - line therapy for metastatic cancer in several randomized clinical trials and are widely prescribed chemotherapeutic agents (21,22). docetaxel is considered to be one of the more promising taxanes, and docetaxel formulations with polysorbate 80 and ethanol (taxotere) have been advocated in the management of different types of cancer, including prostate, non - small - cell lung, ovarian, breast and head and neck cancer. polysorbate 80 in conventional docetaxel leaches plasticizers from polyvinylchloride infusion sets affecting the intravenously administered drug, and also causes hypersensitivity reactions, with the most common symptoms being bronchospasm, urticaria and hypotension (23). to minimize these toxicities and avoid hypersensitivity reactions, however, corticosteroids are reported to cause hyperglycemia and increased infectious episodes (24). fatalities due to polysorbate 80-containing docetaxel anaphylaxis may occur even after such prophylaxis (23). several formulations, such as taxane analogues and prodrugs, docetaxel - encapsulated nanoparticle - aptamer bioconjugates albumin nanoparticles, polyglutamates, emulsions, liposomes, docetaxel fibrinogen - coated olive oil droplets and submicronic dispersions, have been developed to avoid the abovementioned toxicities. doceaqualip was primarily developed to avoid toxicities associated with polysorbate 80 and ethanol and to avoid premedication (18). doceaqualip is formulated with nano aqualip technology that has nano - carriers in suspension form, composed of gras lipids, and has demonstrated a better safety profile with a higher bioavailability compared with docetaxel (18). moreover, even with premedication with corticosteroids and antihistamines, minor reactions (e.g., flushing and rash) occur in ~40% of patients treated with conventional docetaxel (4,18,25). similarly, the patient described herein, who had adenocarcinoma of the prostate with extensive bone metastasis, developed an allergic reaction when administered conventional docetaxel with polysorbate 80 and ethanol, despite being premedicated with corticosteroids and antihistamines. the patient was immediately administered iv corticosteroids and antihistamines to manage the allergic reaction, and the first cycle of ndls doceaqualip 120 mg (75 mg / m) was later initiated, along with denosumab 120 mg and filgrastim 240 mg. the treatment was well - tolerated, without any adverse reactions. the patient 's condition also improved, as evidenced with pet scans before and after the administration of doceaqualip (fig. the patient developed prostate cancer post - turp, which is consistent with the findings of karlsson (26) who suggested a mildly increased risk (standardized incidence ratio : 1.26 ; 95% confidence interval : 1.171.35) of prostate cancer following turp (26). this case report further adds to the evidence that conventional docetaxel with polysorbate 80 and ethanol has the propensity to result in adverse reactions, despite premedication with corticosteroids and antihistamines. the ndls doceaqualip may be an excellent tool in the management of prostate cancer with bone metastasis. | docetaxel has been widely used in the treatment of several cancers, including adenocarcinoma of the prostate gland. as docetaxel is insoluble in water, it must be administered with polysorbate 80 and ethanol, which are known to cause hypersensitivity reactions. premedication with corticosteroids and antihistamines is advocated prior to docetaxel administration ; however, toxicities, occasionally fatal, have been reported, even with corticosteroid premedication. we herein report the case of a patient with adenocarcinoma of the prostate, with bone metastasis and an eastern cooperative oncology group performance status of < 2, who developed an allergic reaction to conventional docetaxel (taxotere), despite being premedicated with corticosteroids and antihistamines. the patient was managed with corticosteroids and antihistamines, and was later started on doceaqualip, a nanosomal docetaxel lipid suspension. doceaqualip was well - tolerated by the patient and 5 cycles were subsequently administered, without any adverse reactions. adenocarcinoma also regressed, as evidenced by positron emission tomography / computed tomography. |
oral mucocutaneous conditions are a group of disorders which are observed in the dental practice. oral mucosal manifestations may be the initial feature, or the only sign of such diseases. in other cases, lesions occur in both the skin and mucosae, with severe clinical manifestations involving the tissues. correct diagnosis is critical, since proper treatment and follow - up will depend on which disease is involved. however, vesiculo - bullous lesions frequently present diagnostic problems because the lesions often resemble each other clinically and routine histological examination sometimes can not differentiate between them. thus immunohistology particularly immunofluorescence is increasingly being used with routine histology to accurately diagnose vesiculo - bullous lesions. these conditions are caused by a genetic mutation or are due to an autoimmune response. this study was carried out in the department of oral pathology, sri ramachandra dental college & hospital, chennai. the study population consisted of 26 patients with oral mucocutaneous diseases who were selected randomly. of the 26 patients,6 patients were under pulse therapy who were clinically and histopathologically diagnosed as pemphigus. these patients were free of active lesions and their disease activity was assessed by indirect immunofluorescence (iif) who were grouped separately. based on the clinical and provisional diagnosis, the remaining 20 patients who had active lesions were subjected to both direct immunofluorscence (dif) and iif and were divided into four groups. we carried out histopathology study with subsequent immunofluorescent technique to study the pattern of immunofluorescence in each group. they were immediately washed in normal saline and placed in michel 's medium and transported to the laboratory within 24 hours. whole blood was allowed to clot, centrifuged, and the serum was separated and transported to the laboratory. the study consisted of 26 patients of pemphigus, pemphigoid, lichen planus, and lupus erythematosus. they were grouped as follows : group i pemphigus (seven cases, patients with active lesions) group ii pemphigus (six cases, patients on pulse therapy and completely free of active lesions) patients in group i, ii, iii, and iv were subjected to histopathologic, dif, and iif examination, and patients in group v were subjected to iif alone. group i v, included patients with age ranging from 28 to 60 years (42.5 years). group i, ii, and v showed male predominance and group iii and iv showed female predominance. group i iv showed site predilection for buccal mucosa, labial mucosa, tongue, gingival, and palate. i : histopathology showed suprabasilar cleft and acantholytic cells superficial to the basal cells which were attached to connective tissue (tombstone appearance). both acute and chronic inflammatory cells and increased vascularity was seen within the connective tissue. ii : histopathology showed subepithelial split, red blood cells (rbcs) and inflammatory cells in the cleft. dif showed linear deposition of fluorescence outlining the basement mem brane zone (bmz) and extending irregularly into the superficial lamina propria as shaggy pattern. iv : histopathology showed hyperparakeratosis, thickening of the spinous cell layer, and degeneration of basal cell layer within the epithelium. dif showed deposition of one or more immunoreactants in a shaggy or granular band at the bmz. charts 1 and 2 shows the reliability of dif and iif as a confirmatory diagnostic test in patients with pemphigus, pemphigoid, lichen planus, and lupus erythematosus. oral mucosal vesiculobullous and ulcerative lesions can be broadly divided into those conditions with an acute onset and a self - limiting course and those with a chronic course. in general, acute ulcerations seldom present diagnostic problems and, being self - limiting may be ignored by the patient. chronic ulcerations, however, are often painful and persistent, causing patients to seek diagnosis and treatment. also, they frequently present diagnostic problems because the lesions may resemble each other clinically and routine biopsies may offer histological similarities and diagnosis of nonspecific inflammation. thus, immunofluorescence is increasingly being used with routine histology to accurately diagnose these lesions. so, this study was conducted with an attempt to diagnose, differentiate, and detect such vesiculo - bullous and ulcerative lesions by immunofluorescence. oral cavity was the first site to be involved in up to 70% of cases and is the only site affected in 50% of patients. buccal mucosa was most commonly involved.[35 ] also, in our study the clinical features were consistent with the above mentioned findings. williams in 1989 stated that dif performed on perilesional tissue reveals a uniform fishnet pattern of binding of igg localized to the intercellular spaces. parlowsky. in 2003 stated that dif reveals the deposition of complement (c3) and igg, iga, or igm, within the intercellular spaces of epithelium resulting in a reticular pattern diagnostic of pemphigus. in our study also, out of seven patients, six patients showed intercellular fluorescence of igg (86%) [figure 1 ], one case also showed complement (c3) (14%) [figure 2 ] resulting in a fishnet or reticular pattern. based upon the clinico - pathologic correlation in conjunction with negative dif result, we suspected behcet 's syndrome. thus dif is essential for the diagnosis and must be performed to complement the clinical diagnosis. intercellular space deposition of igg in the epithelium (dif) pemphigus complement (c3) found scattered in the wall of the bullae (dif) pemphigus sirois, in 2000 stated that circulating antibodies (immunoglobulins) are detected in 80%90% of patients with pemphigus vulgaris (pv). iif performed on a monkey esophagus demonstrated the presence of circulating igg auto antibodies that bound to the epithelium with an intercellular staining pattern. mutasim. in 2001 stated that a punctate or granular fluorescence is appreciated at higher magnification. challacombe. in 2001 stated that assay of serum antibody titers by iif may also help to guide in prognostication and therapy. in our study also, circulating antibodies were detected in six patients (86%), who were symptomatic. iif performed on monkey esophagus demonstrated the presence of igg auto antibodies bound to the epithelium with an intercellular staining pattern [figure 3 ]. a punctate or granular fluorescence was well appreciated. one case showed negative result which may be due to clinicopathologic correlation of the disease as behcet 's syndrome. six patients who were on pulse therapy for pemphigus, are completely free of lesions were grouped separately. these negative results indicate less severity of the disease, i.e., good prognosis and helps to taper the drug dosage. granular fluorescence of igg in the intercellular space of spinosum (iif) pemphigus in our study, age of the patient ranged from 35 to 55 years with a mean age of 45 years. cicatricial pemphigoid (cp) occurs predominantly in females and bullous pemphigoid (bp) occurs in males. most commonly involved sites of the oral cavity are buccal mucosa, labial mucosa, gingival and palate. challacombe. in 2001 stated that dif using perilesional mucosa showed a linear continuous band at the bmz usually with igg and c3 but often with iga in virtually 100% of patients with clinical characteristics of pemphigoid [bp and mucous membrane pemphigoid (mmp) ]. dif is essential for the diagnosis of mmp and must be performed to complement the clinical findings. jordan. in 2002 stated that deposition of c3 in the bmz is detected in almost all patients. in our study also, two cases showed a linear continuous band of c3 along the bmz (67%) [figure 4 ] and one case also showed fibrin in the same location (33%) [figure 5 ]. in one case, the dif result was negative which may be attributed to the mucosal peeling of the epithelium. linear and continuous band of c3 deposit along the basement membrane zone (bmz) (dif) pemphigoid linear deposits of fibrin along the bmz (dif) pemphigoid weinberg, in 1999 reported that iif studies are not reliable and may be negative or low in some cases. there is little correlation between the severity of the disease and the antibody titre, in contrast to pemphigus vulgaris in which iif studies are diagnostic. challacombe. in 2001 stated that the increased detection rate of circulatory antibodies by iif may be linked to the type of substrate, since salt - split skin was shown to be significantly better than intact skin, oral mucosa, or rabbit or monkey esophagus. in our study, iif performed on monkey esophagus in all the three cases showed negative results which may go in accordance with the results of few authors that selection of substrate plays an important role in the detection of circulating antibodies. like majority of authors, in our study also patients were in the age group of 3060 years and females were more commonly affected. buccal mucosa was the site most frequently involved and oral lesions in all the cases were bilateral. regezi and scuibba in 1998 stated that dif study demonstrated the presence of fibrinogen along the bmz in 90%100% of cases. jordan. in 2002, stated that lp show a characteristic pattern of fibrinogen deposition outlining the bmz and extending irregularly into the superficial lamina propria, described as shaggy or fibrillar pattern. a fine granular deposition of c3 is frequently seen in bmz. in our study also, all the cases showed deposition of fibrinogen along the bmz (100%). out of six, one case showed the characteristic pattern of fibrinogen deposition outlining the bmz and extending irregularly into the superficial lamina propria as shaggy pattern [figure 6 ], four cases showed linear deposits of fibrin along the bmz [figure 7 ], and one case showed granular deposition of fibrin along the bmz. fibrin deposition along the bmz extending as irregular strands into the superficial lamina propria (dif) linear deposits of fibrin along the bmz (dif) iif may be a useful test if results of histopathologic and dif examinations are not specific. it was reported that none of the oral lesions showed the characteristic pattern of staining for lichen planus specific antigen (lpsa) by iif. in our study, all the patients showed negativity for iif. in our study, both the cases of systemic lupus erythematosus (sle) occurred in the age group of 2030 years and both were females. orally both the cases showed occurrence in the labial mucosa and one case also occurred in the buccal mucosa. in our study of two cases of sle, butterfly distribution over the malar region was seen in one case. in both the cases, generalized manifestations such as oral ulcers, histopathologically, oral lesions of sle are characterized by hyperkeratosis, alternating atrophy, thickening of the spinous cell layer, and degeneration of basal cell layer within the epithelium. subepithelial lymphocytic infiltration within the ct is also an important finding. in our study, both the cases showed nonspecific histopathologic features. in one case, in which the patient had malar rash and ana test was positive, the epithelium was denuded and the deeper stroma showed infiltration by lymphocytes. in other case, the histopathologic features showed acanthosis and slight edema in focal areas in the basal layer. dif testing of lesional tissue shows deposition of one or more immunoreactants (usually igg, igm, or c3) in a shaggy or granular band at the bmz. in our study, dif results for both the cases were negative. approximately 95% of these patients have antibodies directed against multiple nuclear antigens (antinuclear antibodies). antibodies directed against double stranded dna are noted in 70% patients with sle and are more specific for the disease. according to the results of our study, we could conclude that, in sle cases apart from dif, the diagnosis should be confirmed by ana and double stranded dna test only. in our study of two cases of dle, one patient is a male aged 32 years and the other is a female aged 29 years. distribution on the malar regions across the bridge of the nose. in our study, either of the two cases showed this appearance. vermillion border of the lower lip was involved in both the cases showing painful ulceration due to the crusting or bleeding which is a characteristic of dle. in our study of two cases of dle, only in one case the histopathologic features are suggestive of dle, showing features of hyperkeratosis, acanthosis, focal areas of liquefaction degeneration of basal layer, and basal zone shows deposits of pas positive material. subepithelial areas show focal collection of dense chronic inflammatory cell infiltrate. in another case, the histopathology features were suggestive of actinic chelitis showing atrophic stratified squamous epithelium, subepithelial zone of mild chronic inflammatory cells and a band of amorphous, a cellular, basophilic change known as solar elastosis. dif testing of lesional tissue shows deposition of one or more immunoreactants (usually igg, or c3) in a shaggy or granular band at the bmz. also, dif testing of one case showed granular deposits of igg, c3 and faint deposits of igm along the bmz (25%) [figures 810 ]. linear deposition of igg along the bmz (dif) linear deposition of c3 along the bmz (dif) linear deposition of igm along the bmz (dif) few authors reported that in the recent years, substrate selection also plays a major role in the detection of circulating antibodies. if performed on human skin showed superior results when compared to oral mucosa. in our study, iif performed on monkey esophagus substrate in all four cases of lupus erythematosus showed negative results which may be attributed to substrate selection. oral cavity was the first site to be involved in up to 70% of cases and is the only site affected in 50% of patients. buccal mucosa was most commonly involved.[35 ] also, in our study the clinical features were consistent with the above mentioned findings. williams in 1989 stated that dif performed on perilesional tissue reveals a uniform fishnet pattern of binding of igg localized to the intercellular spaces. parlowsky. in 2003 stated that dif reveals the deposition of complement (c3) and igg, iga, or igm, within the intercellular spaces of epithelium resulting in a reticular pattern diagnostic of pemphigus. in our study also, out of seven patients, six patients showed intercellular fluorescence of igg (86%) [figure 1 ], one case also showed complement (c3) (14%) [figure 2 ] resulting in a fishnet or reticular pattern. based upon the clinico - pathologic correlation in conjunction with negative dif result, we suspected behcet 's syndrome. thus dif is essential for the diagnosis and must be performed to complement the clinical diagnosis. intercellular space deposition of igg in the epithelium (dif) pemphigus complement (c3) found scattered in the wall of the bullae (dif) pemphigus sirois, in 2000 stated that circulating antibodies (immunoglobulins) are detected in 80%90% of patients with pemphigus vulgaris (pv). iif performed on a monkey esophagus demonstrated the presence of circulating igg auto antibodies that bound to the epithelium with an intercellular staining pattern. mutasim. in 2001 stated that a punctate or granular fluorescence is appreciated at higher magnification. challacombe. in 2001 stated that assay of serum antibody titers by iif may also help to guide in prognostication and therapy. in our study also, circulating antibodies were detected in six patients (86%), who were symptomatic. iif performed on monkey esophagus demonstrated the presence of igg auto antibodies bound to the epithelium with an intercellular staining pattern [figure 3 ]. one case showed negative result which may be due to clinicopathologic correlation of the disease as behcet 's syndrome. six patients who were on pulse therapy for pemphigus, are completely free of lesions were grouped separately. these negative results indicate less severity of the disease, i.e., good prognosis and helps to taper the drug dosage. in our study, age of the patient ranged from 35 to 55 years with a mean age of 45 years. cicatricial pemphigoid (cp) occurs predominantly in females and bullous pemphigoid (bp) occurs in males. most commonly involved sites of the oral cavity are buccal mucosa, labial mucosa, gingival and palate. challacombe. in 2001 stated that dif using perilesional mucosa showed a linear continuous band at the bmz usually with igg and c3 but often with iga in virtually 100% of patients with clinical characteristics of pemphigoid [bp and mucous membrane pemphigoid (mmp) ]. dif is essential for the diagnosis of mmp and must be performed to complement the clinical findings. jordan. in 2002 stated that deposition of c3 in the bmz is detected in almost all patients. in our study also, two cases showed a linear continuous band of c3 along the bmz (67%) [figure 4 ] and one case also showed fibrin in the same location (33%) [figure 5 ]. in one case, the dif result was negative which may be attributed to the mucosal peeling of the epithelium. linear and continuous band of c3 deposit along the basement membrane zone (bmz) (dif) pemphigoid linear deposits of fibrin along the bmz (dif) pemphigoid weinberg, in 1999 reported that iif studies are not reliable and may be negative or low in some cases. there is little correlation between the severity of the disease and the antibody titre, in contrast to pemphigus vulgaris in which iif studies are diagnostic. challacombe. in 2001 stated that the increased detection rate of circulatory antibodies by iif may be linked to the type of substrate, since salt - split skin was shown to be significantly better than intact skin, oral mucosa, or rabbit or monkey esophagus. in our study, iif performed on monkey esophagus in all the three cases showed negative results which may go in accordance with the results of few authors that selection of substrate plays an important role in the detection of circulating antibodies. like majority of authors, in our study also patients were in the age group of 3060 years and females were more commonly affected. buccal mucosa was the site most frequently involved and oral lesions in all the cases were bilateral. regezi and scuibba in 1998 stated that dif study demonstrated the presence of fibrinogen along the bmz in 90%100% of cases. jordan. in 2002, stated that lp show a characteristic pattern of fibrinogen deposition outlining the bmz and extending irregularly into the superficial lamina propria, described as shaggy or fibrillar pattern. a fine granular deposition of c3 is frequently seen in bmz. in our study also, all the cases showed deposition of fibrinogen along the bmz (100%). out of six, one case showed the characteristic pattern of fibrinogen deposition outlining the bmz and extending irregularly into the superficial lamina propria as shaggy pattern [figure 6 ], four cases showed linear deposits of fibrin along the bmz [figure 7 ], and one case showed granular deposition of fibrin along the bmz. fibrin deposition along the bmz extending as irregular strands into the superficial lamina propria (dif) linear deposits of fibrin along the bmz (dif) iif may be a useful test if results of histopathologic and dif examinations are not specific. it was reported that none of the oral lesions showed the characteristic pattern of staining for lichen planus specific antigen (lpsa) by iif. in our study, all the patients showed negativity for iif. in our study, both the cases of systemic lupus erythematosus (sle) occurred in the age group of 2030 years and both were females. orally both the cases showed occurrence in the labial mucosa and one case also occurred in the buccal mucosa. in our study of two cases of sle, butterfly distribution over the malar region was seen in one case. in both the cases, generalized manifestations such as oral ulcers, histopathologically, oral lesions of sle are characterized by hyperkeratosis, alternating atrophy, thickening of the spinous cell layer, and degeneration of basal cell layer within the epithelium. subepithelial lymphocytic infiltration within the ct is also an important finding. in our study, both the cases showed nonspecific histopathologic features. in one case, in which the patient had malar rash and ana test was positive, the epithelium was denuded and the deeper stroma showed infiltration by lymphocytes. in other case, the histopathologic features showed acanthosis and slight edema in focal areas in the basal layer. dif testing of lesional tissue shows deposition of one or more immunoreactants (usually igg, igm, or c3) in a shaggy or granular band at the bmz. in our study, dif results for both the cases were negative. approximately 95% of these patients have antibodies directed against multiple nuclear antigens (antinuclear antibodies). although this is a nonspecific finding, it is useful as a screening study. antibodies directed against double stranded dna are noted in 70% patients with sle and are more specific for the disease. according to the results of our study, we could conclude that, in sle cases apart from dif, the diagnosis should be confirmed by ana and double stranded dna test only. in our study, both the cases of systemic lupus erythematosus (sle) occurred in the age group of 2030 years and both were females. orally both the cases showed occurrence in the labial mucosa and one case also occurred in the buccal mucosa. in our study of two cases of sle, butterfly distribution over the malar region was seen in one case. in both the cases, generalized manifestations such as oral ulcers, histopathologically, oral lesions of sle are characterized by hyperkeratosis, alternating atrophy, thickening of the spinous cell layer, and degeneration of basal cell layer within the epithelium. subepithelial lymphocytic infiltration within the ct is also an important finding. in our study, both the cases showed nonspecific histopathologic features. in one case, in which the patient had malar rash and ana test was positive, the epithelium was denuded and the deeper stroma showed infiltration by lymphocytes. in other case, the histopathologic features showed acanthosis and slight edema in focal areas in the basal layer. dif testing of lesional tissue shows deposition of one or more immunoreactants (usually igg, igm, or c3) in a shaggy or granular band at the bmz. in our study, dif results for both the cases were negative. approximately 95% of these patients have antibodies directed against multiple nuclear antigens (antinuclear antibodies). although this is a nonspecific finding, it is useful as a screening study. antibodies directed against double stranded dna are noted in 70% patients with sle and are more specific for the disease. according to the results of our study, we could conclude that, in sle cases apart from dif, the diagnosis should be confirmed by ana and double stranded dna test only. in our study of two cases of dle, one patient is a male aged 32 years and the other is a female aged 29 years. distribution on the malar regions across the bridge of the nose. in our study, either of the two cases showed this appearance. vermillion border of the lower lip was involved in both the cases showing painful ulceration due to the crusting or bleeding which is a characteristic of dle. in our study of two cases of dle, only in one case the histopathologic features are suggestive of dle, showing features of hyperkeratosis, acanthosis, focal areas of liquefaction degeneration of basal layer, and basal zone shows deposits of pas positive material. subepithelial areas show focal collection of dense chronic inflammatory cell infiltrate. in another case, the histopathology features were suggestive of actinic chelitis showing atrophic stratified squamous epithelium, subepithelial zone of mild chronic inflammatory cells and a band of amorphous, a cellular, basophilic change known as solar elastosis. dif testing of lesional tissue shows deposition of one or more immunoreactants (usually igg, or c3) in a shaggy or granular band at the bmz. complement components are present less frequently. in our study also, dif testing of one case showed granular deposits of igg, c3 and faint deposits of igm along the bmz (25%) [figures 810 ]. linear deposition of igg along the bmz (dif) linear deposition of c3 along the bmz (dif) linear deposition of igm along the bmz (dif) few authors reported that in the recent years, substrate selection also plays a major role in the detection of circulating antibodies. if performed on human skin showed superior results when compared to oral mucosa. in our study, iif performed on monkey esophagus substrate in all four cases of lupus erythematosus showed negative results which may be attributed to substrate selection. although histopathology remains gold standard for most of the diseases, it is recognized from this study that not all lesions are amenable to definitive histopathological diagnosis. dif can provide a valuable additional criterion in diagnosing chronic, ulcerative or erosive diseases of oral mucosa if the biopsy specimens are taken from appropriate sites and have attached epithelium. however, the consistency of dif can not be substantiated due to limited sample size which is attributed to cost effectiveness. iif can be used to detect circulating autoantibody in the blood which it does in approximately 80% of patients with pemphigus vulgaris. a negative result, however, does not exclude a diagnosis of pv. while monitoring the circulating pemphigus autoantibody titers via iif is not an essential part of the diagnosis of pv, it is useful in assessing therapeutic response and predicting relapse. | aim : to study the immunofluorescence pattern and to assess its reliability as a confirmatory diagnostic test in patients with pemphigus, pemphigoid, lichen planus, and lupus erythematosus and also to assess the disease activity by indirect immunofluorscence (iif) in patients with pemphigus only.materials and methods : twenty - six patients were included in the study group, out of which, 6 patients were clinically and histopathologically diagnosed as pemphigus, completely free of active lesions were subjected to iif only to assess the disease activity and were grouped separately. based on the clinical and provisional diagnosis, the remaining 20 patients who had active lesions were subjected to direct immunofluorscence (dif) and iif and were divided into four groups. biopsy specimens were taken from the periphery of the lesions and were examined by both conventional light microscopic and dif methods. five milliliters of venous blood was collected from each patient and were subjected to iif.results:histopathological diagnosis was consistent with direct immunofluorescence study in 15 cases (75%). the various immunofluorescence patterns observed in our study were consistent with those described by various authors in standard textbooks and articles.conclusion:histopathology remains gold standard for most of the diseases, it is recognized from this study that not all lesions are amenable to definitive histopathological diagnosis thus ; dif can provide a valuable additional criterion in diagnosis. |
neurosteroids (ns), a term proposed by the physiologists baulieu and robel (1990), is widely used to refer to the steroids synthesized in the brain. through their interaction with neuronal membrane receptors and ion channels, they are capable to modify the brain excitability (lambert., 2003 ; depending on its chemical structure, the steroids interactions with the gabaa receptor may produce positive or negative modulations (majewska, 1992 ; reddy, 2003). among the positive modulators of this receptor are two progesterone 's metabolites : the 5-pregnane-3-ol-20-one (allopregnanolone) and its isomer 5-pregnane-3-ol-20-one (pregnanolone ; gasior., 1999). the interest on these steroids arises from their potential activity as anticonvulsants, anesthetics, anxiolytic or sedative - hypnotic agents (akk., 2007) useful for the treatment of several neurological and psychiatric disorders (gasior., 1999). also, various physiological and pathophysiological conditions have been associated with changes in allopregnanolone and pregnanolone levels (akk., 2007). although the natural ns can be used in epileptic patients (herzog, 1999), certain properties, like their short biological half - life, avoid their clinical use. for that reason, synthetic steroids (ss), that exhibit better bioavailability and efficacy, have an important therapeutic potential in brain disorders, becoming an alternative for this kind of pathologies (reddy and kulkarni, 2000 ; morrow, 2007). the medicinal chemistry of neuroactive steroids (nas) has been focused in the development of ss analogues preserving the absolute configuration of naturally occurring steroids. structure / activity studies indicate that the 3-hydroxyl configuration is required for binding and activity (purdy., for example, the 3-methylated synthetic analog of allopregnanolone, ganaxolone (3-hydroxy-3-methyl-5-prengan-20-one) is capable to overcome these limitations, showing effective anticonvulsant properties (carter., 1997 ; reddy and woodward, 2004). in fact, until now, it is the only ss that has been proved in human clinical trials for epilepsy (nohria., 2010). according to the reversal potential of the permeate ions, the postsynaptic gaba response can be excitatory or inhibitory (akk., 2007). the binding of the convulsant t - butyl - bicyclophosphorothionate (tbps) to the gabaa receptor can be allosterically modulated by allopregnanolone and pregnanolone (ramanjaneyulu and ticku, 1984). when gaba is present, these metabolites have a significantly increased binding affinity, and under this condition, it is possible to reflect the functional state of this receptor (majewska, 1992 ; hawkinson., 1994). similarly, nas can also stimulate the binding of flunitrazepam or muscimol to the receptor (majewska. the ns exposure enhances the opening probability of the chloride channel, so that the mean time open is increased, resulting in a reduction of neuronal excitability. harrison and simmons (1984) demonstrated that alphaxalone (alpx ; 3-hydroxy-5-pregnane-11,20-dione), another allopregnanolone synthetic analogue, was able to enhance the gaba - evoked responses. also, a positive allosteric modulation of gabaa receptor was found with the ss ganaxolone (carter., 1997 ; gasior., 1997 it has been described that at least two ent-16-ketosteroid synthetic analogues (3-5-androsten-16-one and 3-5-4methoxy - androsten-16-one ; with an absolute opposite configuration to nas), produced a more potent inhibition of the tbps binding than alpx (qian., 2013). moreover, we showed a decrease in tbps binding and an increase in flunitrazepam and muscimol binding by the administration of ss epoxies (analogues to allopregnanolone and pregnanolone) with an intramolecular oxygen bridge that keeps the a / b angle of the steroid nucleus in a controlled way (veleiro and burton, 2009 ; rey., 2013). cumulative evidence indicates the existence of neuroprotective properties of nas in a variety of experimental paradigms (schumacher., 2004). they have a major influence on the central nervous system (cns) activity and are essential for growth and survival of neurons and glial cells (wang., 2005 ; melcangi., studies in adult animals after brain injury indicate that nas have an important role in repairing processes, enhancing myelination and reducing apoptotic processes (ibanez., 2004). during pregnancy, stressful events which lead to transient hypoxia / ischemia, stimulate nas production in the brain providing further protection (nguyen., 2004). this supports the importance of nas in brain development and suggests that the exposure to normal nas levels is critical. in traumatic brain injury, progesterone has the most important repair - promoting actions (he., 2004a) and it acts through its reduced metabolites like allopregnanolone (djebaili., 2004 ; he. the neuroprotective actions of allopregnanolone have been shown in hypoxia - induced brain injury models, where its levels increase in response to acute hypoxic stress, as a protective mechanism to reduce excitotoxicity (hirst., 2006). in fact, we have described a protective effect of allopregnanolone on astrogliosis (kruse., 2009) and neuronal damage (kruse., 2010) caused by hypoxia in perinatal cultures of cerebral cortex and hippocampus of the rat. studies with the ss mifepristone (ru486), reported that it acts as a neuroprotective agent against excitotoxicity and traumatic brain injury (behl., 1997 ; mccullers., 2002) and protects purkinje cells from cell death in postnatal rat and mouse cerebellum organotypic slice cultures (ghoumari., 2003), through the reversion of chloride efflux in the gabaa receptor elicited by gaba (rakotomamonjy., we have also demonstrated that two ss epoxies, (analogues of allopregnanolone and pregnanolone,) were capable to prevent the glial and neuronal damages in the perinatal cultures of cerebral cortex and hippocampus (rey., 2013). in adults, the brain ischemic stroke the loss of energy supply by the mitochondrial dysfunction and posterior increased oxidative stress contributed to the neuronal injury. therefore, a trend has been set in the development of steroid drugs that reduce the excitotoxicity and the oxidative stress, for treatments of acute brain injuries or chronic neurodegenerative diseases. because the current therapies are still limited one example is the ss 5-androst-3,5,6-triol showed a robust neuroprotective effects when it was tested in vitro (chen., 2013). the alzheimer 's disease (ad) produces a brain degenerative process, with neuronal losses and decreased synapses. present therapies are focused on stopping the progression of the disease, but the major challenge remains, in restore cognitive function through the regeneration of lost neurons and neural circuitry. in aged and ad brains, the pool of neural stem cells, their proliferative potential and the allopregnanolone content are markedly diminished (bernardi., 1998 ; genazzani., 1998 ; weill - engerer., studies using transgenic ad mice showed that allopregnanolone has neurogenic properties (wang., 2008). these in vitro and in vivo neurogenic features, coupled to low molecular weight, easy blood brain barrier penetration and lack of toxicity, are the key elements required to consider the use of allopregnanolone as a neurogenic / regenerative therapy for neurons restoration in ad patients (brinton and wang, 2006 ; irwin and brinton, 2014). estrogen has also showed neuroprotective properties, preventing the development of neurodegenerative disorders like ad. hormonal therapy at menopause (to restore normal levels) appears to reduce the risks, but this kind of treatment has been associated with detrimental effects. moreover, estrogen like neuroprotection effects were observed with the ss 4-estren-3,17-diol that differs structurally from estrogens only on the a ring (kousteni., 2002 ; cordey., in addition, similar neuroprotective actions have been described with the ss ent - steroid of 17-estradiol (covey, 2009). another important issue is the influence of the ss on the local natural ns synthesis. nas are present in the nervous system and in other steroidogenic tissues, like gonads and adrenal glands. in the cns,, the cholesterol is converted to pregnenolone by the cytochrome p450 side - chain cleavage enzyme (cyp450scc ; iwahashi., then, the pregnenolone is oxidized to progesterone by the 3-hydroxysteroid dehydrogenase enzyme (3-hsd ; zwain and yen, 1999) being this conversion an essential step in the biosynthesis of all steroid hormones. allopregnanolone is synthesized from progesterone, by the sequential enzymatic steps of the type i 5-reductase (5-r) and the 3-hydroxysteroid dehydrogenase enzymes (3-hsd ; mellon., 2001). the rate - limiting step in neurosteroidogenesis is the unidirectional reduction of progesterone to the 5-dihydroprogesterone (5-dhp) by the 5-r. functionally expression of these enzymes has been described in pluripotent progenitor cells (melcangi., the expression of 3-hsd enzyme has been demonstrated in several tissues like adrenal glands, gonads and cns (rheaume., 1991 ; guennoun., 1995 ; coirini., 2003). moreover, pregnenolone conversion into progesterone has been demonstrated in rat homogenates from septum and amygdala (weinfeld., 1980). the co - expression of 3-hsd and gabaa receptor subunits in different brain regions (laurie. 1992) gives an anatomo - functional support for the in situ production of progesterone and the gabaa receptor modulation (guennoun. although regulatory mechanisms underlying the ns biosynthesis inside the brain remain unclear, it is well known the capacity of steroids of negatively modulate the 3-hsd activity in different steroidogenic endocrine glands and in peripheral nervous system, like sciatic nerve (guennoun., 1995 ; coirini., the ru486 caused an impact on the 3-hsd enzyme activity in rat adrenal gland (albertson., 1994) but not in gonads (sanchez., 1989). in our work, we described that ss epoxies caused a dose - dependent decrease on the 3-hsd activity. in fact, the analogues of pregnanolone produced less inhibition than those with the conformation allopregnanolone - like (rey., 2013). ns are endogenous regulators of neuronal excitability (lambert., 2003 ; akk., 2009). within the brain, reduced steroids (like allopregnanolone and pregnanolone) are highly selective and potent modulators of the gabaa receptor functions (gasior., 1999). thus, their anticonvulsant, anesthetics and anxiolytic properties are useful in the treatment of several neurological and psychiatric disorders (schle., 2011). neuroprotective effects against adverse early life events (patchev., 1997) and neurogenic effects on neurodegenerative diseases, like ad (brinton and wang, 2006), have been observed with allopregnanolone administration. steroids with similar activity like this progesterone metabolite provide big opportunities for therapeutic treatments reducing hormonal side effects (morrow, 2007 ; reddy, 2010). the principal disadvantage of endogenous ns administration is their poor bioavailability caused by their rapid in vivo metabolism. thus, endogenous ns stimulation synthesis or synthetic steroids analogues (poisbeau., 2014) might constitute promising novel strategies for several disorders treatments. the current medicinal chemistry around nas is focused on the development of new ss analogues, having the absolute configuration of natural steroids. several studies indicate that the 3-hydroxyl configuration is the key for binding and activity, but modifications in the steroid nucleus may emphasize different pharmacophores. among the ss developed are ganaxolone and alpx which have anesthetic and anticonvulsant properties. until now, ganaxolone is the only one ss that has been used on human clinical trials for epilepsy (nohria., 2010). on the other hand, the ss ent - neurosteroids produced more potent inhibition of tbps binding from the gabaa receptor than alpx (qian.. moreover, we found that some ss epoxies reduce the tbps binding and stimulate the flunitrazepam and muscimol binding in a dose - dependent manner (rey., this type of effects was observed with the synthetic allopregnanolone analogue co 2 - 6749 (gma-839 ; way-141839 ; 3,21-dihydroxy-3-trifluoromethyl-19-nor-5-pregnan-20-one ; vanover., 2000). in fact, neurosteroidogenic agents, that lack benzodiazepine - like side effects, are promising for the treatment of anxiety and depression (reddy, 2010). neuroprotective effects have been described with several ss in hypoxia - induced brain injury models. among others, the ss ru486 was able to protect against excitotoxicity and traumatic brain injury (behl., 1997 ; mccullers., 2002) and the 5-androst-3,5,6-triol showed a neuroprotective action in an ischemic stroke model in vitro (chen., 2013). moreover, in perinatal brain tissues submitted to hypoxic conditions, restricted analogues from allopregnanolone or pregnanolone showed similar properties preventing the glial and neuronal damage (rey., 2013). on the other hand, neurogenic properties on ad were observed with the 4-estren-3,17-diol and ent - steroid of 17-estradiol administrations (kousteni., 2002 ; covey, 2009). another issue to take in consideration for the development of ss is related to the presence of all the enzymes necessary for ns synthesis in the brain (mensah - nyagan., 1999 ; agis - balboa., 2006 ; do rego., 2009). although regulatory mechanisms around ns biosynthesis are still unclear, it is well known the capacity of steroids to negatively modulate the 3-hsd activity (in almost all steroidogenic tissues) and the importance of a minor effect on these activities by the ss administration. specific enzymes and nuclear hormone receptors for endogenous steroids have structurally defined binding sites. it is important that the ss should be developed lacking the possibility to bind with high affinity to these proteins. therefore the ss drugs might not strongly interfere with the natural steroids biosynthesis or their specific receptors. it would be also advantageous that the half - life of these new ss might be quite different and potentially longer, than those of steroid already used as anticonvulsants, anxiolytics, or another neuroactive - neurogenic agents. thus, it is likely that the development of new ss for therapeutical use will continue requiring a great deal of effort with the attendant generation of new knowledge. | neurosteroids, like allopregnanolone and pregnanolone, are endogenous regulators of neuronal excitability. inside the brain, they are highly selective and potent modulators of gabaa receptor activity. their anticonvulsant, anesthetics and anxiolytic properties are useful for the treatments of several neurological and psychiatric disorders via reducing the risks of side effects obtained with the commercial drugs. the principal disadvantages of endogenous neurosteroids administration are their rapid metabolism and their low oral bioavailability. synthetic steroids analogues with major stability or endogenous neurosteroids stimulation synthesis might constitute promising novel strategies for the treatment of several disorders. numerous studies indicate that the 3-hydroxyl configuration is the key for binding and activity, but modifications in the steroid nucleus may emphasize different pharmacophores. so far, several synthetic steroids have been developed with successful neurosteroid - like effects. in this work, we summarize the properties of various synthetic steroids probed in trials throughout the analysis of several neurosteroids - like actions. |
in vertebrates, numerous processes occur in a rhythmic manner. during the course of evolution, animals have evolved biological rhythms that are associated with changes in the lighting and temperature of their environment. one of the most important biological rhythms is the circadian rhythm generated by endogenous oscillators, termed the circadian clock, which has a period very close to 24 hours and is synchronised with environmental light conditions. the hormonal signal used to reliably reflect environmental light conditions is melatonin (n - acetyl-5-methoxytryptamine), which is synthesised in the pineal gland. this gland is localised in a third ventricle (iiiv) evagination called the pineal recess. it stays in contact with the cerebrospinal fluid (csf) from the iiiv, which results in the local concentration of melatonin in the iiiv being approximately 20 times higher in the csf than in blood. in all mammalian species studied, melatonin secretion is regulated by norepinephrine (ne), which is released from sympathetic nerve fibres exclusively at night. the biosynthesis of melatonin is a well - characterised multistep sequence of reactions that starts with the hydroxylation of tryptophan to 5-hydroxytryptophan (5-htp) by the enzyme tryptophan hydroxylase (tph). next, aromatic amino acid decarboxylase (ddc) converts 5-htp to 5-hydroxytryptamine (5-ht ; serotonin). then, 5-ht is transformed to n - acetylserotonin by arylalkylamine - n - acetyltransferase (aanat). finally, n - acetylserotonin is converted to melatonin by the enzyme hydroxyindole - o - methyltransferase (hiomt). the circulating level of melatonin reflects pineal secretory activity because it is not stored within the pinealocytes but freely diffuses out of the cells into blood capillaries immediately after its formation. a conservative feature of vertebrates is that the plasma level of melatonin increases at night, whereas diurnal levels of this hormone are relatively low. one of the most significant pleiotropic effects of melatonin is the regulation of the immune system. both diurnal and seasonal changes in immune function are thought to directly reflect changes in pineal melatonin secretion. melatonin plays a role as an immunomodulator, regulating the development, differentiation, and function of lymphoid tissues. the pineal gland likely participates in the innate immune response because it expresses mrna encoding transcripts for all ten members of the toll - like receptor (tlr) family. therefore, the function of this gland may be affected by a number of the pathogen - associated molecular patterns recognised by these receptors. the interactions occurring between the immune system and the pineal gland seem to be bidirectional. however, the feedback effect of the inflammatory response on the pineal gland 's neuroendocrine functions is poorly understood. molecules carrying feedback information from the immune system to the pineal gland may include inflammatory mediators, such as cytokines, prostaglandins (pgs), and histamine, that penetrate this region of brain during inflammatory response. a few studies have shown that the secretory activity of pinealocytes can be modified by antigenic stimulation, histamines, cytokines [11, 12 ], and prostaglandins [13, 14 ]. also our previous ex vivo study showed that the pleiotropic proinflammatory cytokine interleukin- (il-) 1 suppressed melatonin secretion in ovine pineal glands. immune mediators have easy access to the pineal gland because it is a part of the brain that lacks the blood - brain barrier. the secretory activity of the pineal gland may also be modulated by immune mediators present in the csf because during peripheral inflammation proinflammatory cytokines, including il-1, il-6, and tumor necrosis factor (tnf) can cross the blood - brain and blood - csf barriers and reach the brain parenchyma [1719 ]. a study on rats showed that almost immediately after the peripheral injection of the bacterial endotoxin lipopolysaccharide (lps), the level of proinflammatory cytokines in the csf is significantly elevated. moreover, melatonin synthesis may be affected by the autocrine actions of inflammatory mediators, as it has been reported that, in addition to producing melatonin, the pineal gland can be induced to synthesise several cytokines, such as il-1, il-6, and tnf [2124 ]. factors other than inflammation may influence pineal melatonin production via mechanisms that are dependent on proinflammatory cytokines. the decrease in melatonin secretion observed in association with alzheimer 's disease has been postulated as being responsible for the circadian disorganisation, decrease in sleep efficiency, and impaired cognitive function observed in patients with this disease. sleep difficulties and other symptoms associated with low melatonin levels also accompany depressive disorders [26, 27 ]. there is evidence implicating the levels of il-1 in the brain in the aetiology and pathophysiology of both alzheimer 's disease and depression [28, 29 ]. the majority of the studies concerning the broadly understood bilateral interactions between the immune and pineal systems have been performed on rodents, mainly rats, which are nocturnal species. however, there are important differences in the intracellular mechanisms regulating melatonin secretion that distinguish rodents and other mammals, including ungulates and primates. therefore, the present studies were performed on ewes, which exhibit significantly greater similarities in their mechanisms regulating melatonin secretion to human than do rodent species. this study was designed to determine the effects of il-1 injected into the iiiv of the brain on melatonin release and the expression of the enzymes of the melatonin biosynthetic pathway in sheep during two distinct photoperiodic conditions : a short night (sn - long - day ; 8 : 16) period and long night (ln - short - day ; 16 : 8) period. these studies were performed on adult, two - year - old blackface ewes during two different photoperiods : in may / june during a short night (long - day, 8 : 16) period and in november / december during long night (short - day, 16 : 8) period. the animals were maintained indoors in individual pens and were exposed to the natural daylight present at 52n latitude and 21e longitude. the ewes were in good condition ; that is, their body condition was estimated to be 3 based on a five - point scale, and the animals were acclimated to the experimental conditions for one month. the ewes were always within visual contact with other members of the flock to prevent isolation stress. the animals were fed a consistent diet of commercial concentrates with hay and water available ad libitum. one month before the experiment, all groups of ewes were cannulated with push - pull cannulas into the third ventricle according to the method described elsewhere. all animals had venous catheters implanted into their jugular vein the day before the experiment. all procedures were performed with the consent of the local ethics committee of warsaw university of life sciences, sggw poland. in each of the two experimental treatments, the animals (n = 12) were randomly divided into two groups : control (n = 6) and il-1-treated (n = 6) ewes. the experimental procedures were performed during the night, in the darkness, and in the presence of a red light. two hours after sunset, the animals received an intracerebroventricular (icv.) injection of il-1 (50 g / animal ; sigma - aldrich, st. louis, mo, usa) dissolved in 50 l of ringer 's solution through stainless steel cannulas. the blood samples were then collected at 15 min intervals, starting one hour after sunset and continuing for 5 hours after the treatment. blood samples were collected into heparinised tubes and immediately centrifuged in an mpw 260rh centrifuge (mpw med. instruments, warsaw, poland) for 10 min at 1000 g at 4c. the ewes were euthanised 4 hours after the final central injection of il-1 or ringer 's solution at 3 a.m. during the ld period and 10:00 p.m. during sd period. their brains were immediately removed from their skulls, and the pineal gland was dissected into two parts, frozen in liquid nitrogen, and stored at 80c until assay. melatonin was assayed in the blood plasma according to the method of fraser. and as modified in our laboratory using ovine antimelatonin serum (dr. a. foldes, csrio, australia). louis, mo, usa) was used as a standard and [o - methyl-3h]-melatonin (amersham plc, amersham, uk) as a tracer. the sensitivity of the assay was 17 8 pg / ml and the intra- and interassay coefficients of variation were 11% and 13%, respectively. the cortisol concentrations in the plasma were determined via radioimmunoassay according to kokot and stupnicki, using rabbit anti - cortisol antisera (r/75) and an hplc - grade cortisol standard (sigma - aldrich, st. the assay sensitivity was 1 ng / ml and the intra- and interassay coefficients of variation for cortisol were 9% and 12%, respectively. pineal glands were analysed for 5-ht and 5-hiaa contents using high - performance liquid chromatography (hplc) with electrochemical detection. final concentrations were calculated relative to the recovery of the internal standard 5-hydroxyindole (sigma - aldrich, st. the analytical procedures previously described by smulikowska. were used with minor modifications. briefly, pineal glands were thawed and homogenised at 0c in 0.1 m hclo4 (1 : 10 w / v) (sigma - aldrich, st. louis, mo, usa) with 200 ng of 5-hydroxyindole added as an internal standard, and the homogenates were centrifuged in a sigma 1 - 14k centrifuge (sigma - aldrich, st. louis, mo, usa) at 12 000 g for 15 min. the concentrations of 5-ht and 5-hiaa were determined via hplc using a waters 515 system (waters corporation, milford, ma, usa) coupled to an electrochemical detector (hewlett packard 1049a, hp inc., palo alto, ca, usa) equipped with a glassy carbon working electrode and a ag / agcl reference electrode. the electrochemical detector was set at an oxidative potential of 0.650 v. supernatant (50 l) was injected into an lc-18-db (15 cm 4.6 mm i d, 5 m) supelco column (sigma - aldrich, st. louis, mo, usa) protected by a supelcosil lc-18-db supelguard 2 cm precolumn (5 m particle size ; sigma - aldrich, st. louis, mo, usa) and was eluded isocratically with a mobile phase consisting of 0.01 mol / l nacl (sigma - aldrich, st. louis, mo, usa), 0.001 mol / l edta (sigma - aldrich, st. louis, mo, usa), and 12% ch3oh (sigma - aldrich, st. the limit of detection was 10 pg/50 l for 5-ht and 5 pg/50 l for 5-hiaa. the total rna and protein from the explants were isolated using the nucleospin rna / protein kit (macherey - nagel gmbh & co., dren, germany). the purity and concentration of the isolated rna were spectrophotometrically quantified by measuring the optical density at 230, 260, and 280 nm in a nanodrop 1000 spectrophotometer (thermo fisher scientific inc., the rna integrity was confirmed by electrophoresis using 1% agarose gel (reducta nu, prona marine research institute, vigo, spain) stained with ethidium bromide (sigma - aldrich, st. louis, mo, usa). to synthesise cdna, the maxima first strand cdna synthesis kit for rt - qpcr (thermo fisher scientific, waltham, ma, usa) and 2 g of total rna were used. real - time rt - pcr was performed using the hot firepol evagreen qpcr mix plus (solis biodyne, tartu, estonia) and hplc - grade oligonucleotide primers (genomed, warszawa, poland). the primer sequences were designed using primer 3 software [35, 36 ] (table 1). one reaction mixture (total volume : 20 l) contained 4 l of pcr master mix (5x), 14 l of rnase - free water, 1 l of primers (0.5 l each primer, working concentration 0.25 m), and 1 l of the cdna template. the reactions were run on a rotor - gene 6000 instrument (qiagen, dusseldorf, germany). the following protocol was used : 95c for 15 min and 30 cycles of 95c for 10 s for denaturation, 60c for 20 s for annealing, and 72c for 10 s for extension. relative gene expression was calculated using the comparative quantification option of the rotor - gene 6000 software version 1.7 (qiagen, dusseldorf, germany). three housekeeping genes were examined : glyceraldehyde-3-phosphate dehydrogenase (gapdh), -actin (actb), and histone deacetylase 1 (hdac1). the mean expression of these three housekeeping genes was used to normalise the expression of the analysed genes. the results are presented in arbitrary units, as the ratio of the target gene expression to the mean expression of the housekeeping genes. before electrophoresis, the protein concentrations of the samples isolated using the nucleospin rna / protein kit (macherey - nagel gmbh & co., dren, germany) were quantified using the protein quantification assay kit (macherey - nagel gmbh & co. ; dren, germany). louis, mo, usa) was added to a volume of sample containing 50 g of total protein to bring the total sample volume to 20 l. next, to 20 l of these samples, 19 l of laemmli buffer (sigma - aldrich, st. louis, mo, usa) and 1 l of -mercaptoethanol (sigma - aldrich, st. electrophoresis was performed in the presence of molecular weight markers (spectra multicolor broad range protein ladder, thermo fisher scientific inc., rockford, il, usa). denatured samples and molecular weight standards were loaded on 412% polyacrylamide gels and subjected to electrophoresis in a tris - glycine running buffer using the protean ii xi cell (bio - rad laboratories, inc. next, proteins were transferred in tris - glycine blotting buffer to polyvinylidene difluoride membranes (immobilon-p (0.45 m), merck kgaa, darmstadt, germany) using the trans - blot sd semi - dry transfer cell (bio - rad laboratories, inc., hercules, ca, usa) for 30 min at 20 v. the membranes were blocked for 1 h at room temperature in blocking buffer made up of tris buffered saline at ph 7.5 with 0.05% tween-20 (tbst) (sigma - aldrich, st. louis, mo, usa) containing 3% bovine serum albumin fraction v (sigma - aldrich, st. next, the membranes were incubated overnight at 4c with the following primary antibodies : goat anti - tph polyclonal antibody (cat number sc-15116, santa cruz biotechnology inc., dallas, tx, usa), rabbit anti - ddc polyclonal antibody (cat number sc-99203, santa cruz biotechnology inc., dallas, tx, usa), goat anti - aanat polyclonal antibody (cat number sc-55612, santa cruz biotechnology inc., dallas, tx, usa), rabbit anti - hiomt polyclonal antibody (cat number bs-6961r, bioss inc., woburn, ma, usa), and mouse anti - actb monoclonal antibody (cat number sc-47778, santa cruz biotechnology inc., dallas, tx, usa) dissolved in blocking buffer at dilutions of 1 : 100, 1 : 200, 1 : 100, 1 : 200, and 1 : 1000, respectively. after washing three times, the membranes were incubated with the following secondary hrp conjugated antibodies : bovine anti - rabbit igg - hrp (cat number sc-2379, santa cruz biotechnology inc., dallas, tx, usa), donkey anti - goat igg - hrp (cat number sc-2304, santa cruz biotechnology inc., dallas, tx, usa), and goat anti - mouse igg1 heavy chain (hrp) (cat number sc-2304, abcam, cambridge, uk) dissolved in blocking buffer at a dilution of 1 : 10000. after washing three times, the membranes were visualised using chromogenic detection with a pierce 1-step tmb - blotting substrate solution (thermo fisher scientific, waltham, ma, usa). after visualisation, the membranes were dried and scanned using an epson perfection v370 photo scanner (seiko epson corporation, suwa, japan). the densitometric analysis of the scanned membrane was performed using imagej software (research services branch, national institute of mental health, bethesda, md, usa)., tulsa, ok, usa). the raw data, after passing a normality test, were subjected to a two - way analysis of variance (anova) to determine any significant influences of the two parameters (photoperiod and il-1-treatment), followed by tukey 's post hoc test. it should be noted that, for hormone and body temperature data, to identify treatment effects, the mean values for the period after the treatment (1 to 4 h) were established and included in the statistical analysis. central injection of il-1 increased (p < 0.05) the rectal body temperature of ewes in the sn (40.6 0.1c) and ln (40.8 0.2c) photoperiods compared with that of the control groups (39.4 0.2c and 39.1 0.1c, resp.) (figure 1). control ewes from the sn photoperiod were characterised by lower (p < 0.05) levels of circulating melatonin (76 4 pg / ml) compared with the levels in animals from the ln (198 22 pg / ml) photoperiod. central administration of il-1 reduced (p < 0.05) secretion of melatonin in animals from both the sn (37 3 pg / ml) and ln (91 8 pg / ml) photoperiods (figure 2). treatment with il-1 stimulated (p < 0.05) cortisol release in ewes from both the sn (90 8 ng / ml) and ln (42 5 ng / ml) photoperiods compared with its level in the control ewes (8 1 ng / ml and 17 4 ng / ml, resp.) injection of il-1 into the third ventricle of the brain reduced (p < 0.05) 5-ht concentrations in the pineal tissue of animals from both the sn (91 10 pg / mg) and ln (205 17 pg / mg) photoperiods compared with its level in the control ewes (396 59 pg / mg and 509 77 pg / mg, resp.). although the concentration of 5-ht in the tissues collected from the control animals did not differ, the reduction in 5-ht content was greater (p < 0.05) in the pineal glands dissected from the sn ewes than it was in the ln ewes (figure 4). it was found that the concentration of 5-hiaa in the pineal glands of control individuals was lower (p < 0.05) during the sn (57 19 pg / mg) photoperiod than during the ln (193 10 pg / mg) photoperiod. central administration of il-1 elevated (p < 0.05) the concentration of 5-hiaa in the pineal glands of ewes during both the sn (222 35 pg / mg) and ln (261 18 pg / mg) photoperiods (figure 4). intracerebroventricular injections of il-1 decreased (p < 0.05) the gene and protein expression of tph enzyme in the pineal tissues collected from both sn and ln ewes (figure 5(a)). il-1 treatment suppressed (p < 0.05) the pineal expression of aanat mrna and protein but only in the glands of ewes from the ln photoperiod (figure 5(c)). injection of il-1 inhibited (p < 0.05) the expression of hiomt protein but only in the pineal glands of ewes during the sn photoperiod. on the other hand, no effect of il-1 treatment on the expression of hiomt mrna injection on the gene and protein expression of ddc was found (figure 5(b)). injection of exogenous il-1 into the third ventricle did not affect the gene expression of il-1 in the pineal gland, but it stimulated (p < 0.05) mrna expression of the il-1 type 1 receptor (il-1r1), the il-1 type 2 receptor (il-1r2), and the interleukin-1 receptor antagonist (il-1rn) regardless of the photoperiods (figure 6). however, the action of il-1 was stronger (p < 0.05) in the sn than in the ln photoperiods. in the animals receiving icv. injections of il-1, a stimulation (p < 0.05) of interleukin 6 signal transducer (il6st) gene expression was found regardless the photoperiod, and increasing (p < 0.05) levels of il6 receptor (il6r) gene expression were found but only in animals from the ln season (figure 7). in was found that the nocturnal expression of mrna encoding tnf was higher (p < 0.05) in the pineal glands from the sn animals than in those from the ln animals. although il-1 treatment did not influence the gene expression of tnf, its stimulatory (p < 0.05) effect on the expression of tnf type 1 receptor (tnfrsf1a) and tnf type 2 receptor (tnfrsf1b) mrna was found, regardless of the photoperiod (figure 8). the results presented in the paper represent the first study describing the effect of centrally acting il-1 on the nocturnal secretion of melatonin from the pineal gland. it was clearly demonstrated that the injection of il-1 into the iiiv suppressed melatonin release in sheep, regardless of the photoperiod. the data obtained here fully support the results of our ex vivo studies demonstrating that il-1 suppressed ne - stimulated melatonin secretion from explants of ovine pineal glands. the existence of an interplay between il-1 and the pineal gland has also been found in experiments on rats indicating a significant dose - dependent decrease in serum melatonin levels under the influence of exogenous recombinant human il-1, which was abolished by an anti - human il-1 receptor antibody. our study suggests that decreased secretion of melatonin may result from the reduced synthesis of its intermediate, 5-ht, in the pineal gland of il-1-treated animals. moreover, the reduction in 5-ht concentration, which was higher during the sn than the ln photoperiod, fully reflects the changes in melatonin secretion. lowering the pineal 5-ht concentration is not likely due to a reduction in tryptophan content in this gland. numerous studies have shown that il-1 noticeably increases the concentration of this amino acid in the brain [3840 ]. the results obtained here suggest that the 5-ht decrease in the pineal gland may result, at least partially, from a decreased expression of the tph1 enzyme in this gland. a reduction of the expression of the enzyme converting tryptophan to 5-htp may profoundly influence all downstream stages of melatonin biosynthesis, especially because it was determined that tph1 had the highest relative level of gene expression among the enzymes of the melatonin biosynthetic pathway. on the other hand, a reduction of pineal 5-ht levels may result from the increased metabolism of this neurotransmitter. the experiments performed on rodents also show that il-1 treatment increases 5-ht metabolism throughout the brain [38, 39 ]. our results show that central il-1 injection decreased the concentration of 5-ht in parallel with increased concentrations of its metabolite, 5-hiaa. it is thought that 5-ht can be metabolised in the pineal gland via two distinct pathways. the first leads to the formation of n - acetylserotonin and then to melatonin. in the second one, 5-ht is metabolised by the enzyme monoamine oxidase (mao) to yield 5-hydroxyindole acetaldehyde. in turn, this intermediate is then either oxidised to 5-hiaa or reduced to 5-hydroxytryptophol. both of these are substrates for hiomt and yield 5-methoxyindole acetic acid and 5-methoxytryptophol, respectively [41, 42 ]. because norepinephrine (ne) was found as a factor inhibiting the formation of 5-hiaa in the pineal gland, increased concentrations of this metabolite suggest a reduced stimulation of the pineal gland by ne in il-1 treated ewes. a study on rats showed that il-1 stimulates the formation of the main ne metabolite 3-methoxy-4-hydroxyphenylethylene glycol in the central nervous system, which suggests that il-1 promotes the metabolism of this neurotransmitter. it is worth mentioning that the same study reported a decrease in the ne content of the hypothalamus, as well as in the dorsal posterior brain stem, after il-1 treatment. however, the results obtained show a significant reduction of aanat gene and protein expression in the pineal glands of individuals centrally injected with the cytokine during the ln photoperiod. in sheep from the sn photoperiod, no influence of il-1 treatment on both gene and protein expression of aanat was found. these results are generally consistent with our previous results obtained during an ex vivo study, which showed that il-1 might have reduced the level of aanat protein. the modulatory action of il-1 on aanat expression seems to be targeted on the posttranscriptional level of the expression of this enzyme because the same study showed a lack of any effect of il-1 treatment on aanat mrna expression. it is thought that, in all vertebrates, aanat is the key enzyme in melatonin synthesis, often called the melatonin rhythm enzyme. it is currently postulated that the mechanisms regulating melatonin synthesis converge at the control of aanat enzyme activity. in all mammals studied, ne stimulates melatonin synthesis via the activation of two subtypes of adrenergic receptors, although the intracellular mechanisms leading to the stimulation of melatonin synthesis in the pinealocytes may vary among species. activation of 1-adrenergic receptors increases the intracellular concentration of camp, which is followed by the activation of the camp - dependent protein kinase a (pka). both elevated camp levels and pka activation are indispensable for the stimulation of aanat and melatonin synthesis in all mammalian species studied so far. in turn, the activation of 1-adrenergic receptors elevates the intracellular calcium ([ca]i) level caused by the release of calcium ions from intracellular stores. the ne - dependent activation of the 1-adrenergic / camp / pka and 1-adrenergic/[ca]i pathways is conserved in mammalian physiology, but the downstream mechanisms that link these signalling cascades with aanat activation and melatonin production exhibit marked interspecies variations. in rodents, the camp / pka pathway controls transcriptional mechanisms regulating melatonin synthesis. it has been demonstrated that stimulation by ne results in an approximately 100-fold increase in camp levels in rat pinealocytes. moreover, the day / night rhythm of the changes in camp concentrations in the rat pineal gland parallel the pattern of changes in aanat mrna expression, which increases by approximately 150-fold during the night [43, 46 ]. in ungulates and primates, melatonin synthesis is controlled by mechanisms targeting the posttranslational regulation of aanat. in these animals, pinealocytes constantly synthesise the aanat protein from continually available aanat mrna. in the absence of noradrenergic stimulation, the aanat protein is destroyed by proteasomal proteolysis. under ne stimulation, elevated camp levels result in the phosphorylation of aanat by pka. this posttranslational modification leads to the interaction of phosphorylated aanat with 14 - 3 - 3 proteins, protecting aanat from degradation [1, 47 ]. it is worth noting that our study shows that among all the genes for the enzymes of the melatonin biosynthetic pathway only aanat gene expression exhibited a moderate but significant difference between the sn and ln photoperiods. to the best of our knowledge, this is the first scientific report showing that the nocturnal expression of the aanat gene in ovine pineal glands may be affected by photoperiod. however, a previous study on sheep showed the presence of day / night fluctuations in aanat transcription in the pineal gland. it was found that the nocturnal level of aanat mrna was approximately 2 times higher than the daily level of this transcript. some recent evidence suggests that hiomt could also be a target for immune - pineal interactions. a study on chickens showed that peripheral inflammation enhanced both hiomt gene expression and its enzymatic activity. in addition, our ex vivo study on ovine pineal explants showed that glands collected from lps - treated animals were characterised by higher hiomt expression than those isolated from control ewes. because stress mediators are generally considered to be stimulators of melatonin secretion, it has been suggested that the stimulatory influence of inflammation on hiomt expression and activity may result from inflammatory - dependent activation of the hypothalamic - pituitary - adrenal (hpa) axis activity. based on our results it might be concluded that hiomt is not sensitive to il-1 action at the transcriptional level, but il-1 may reduce the protein expression of this enzyme. however, this suppressive effect of il-1 on hiomt was evident only during the sn period. this suggests that the influence of an immune / inflammatory challenge on hiomt expression may not be the same under all circumstances. the inhibitory action of il-1 on the synthesis and release of melatonin may result from its direct action on the pineal cells. our study showed that central injection of il-1 increased the gene expression of both types of il-1 receptor. it is generally accepted that il-1 acts on target cells to stimulate the expression of its corresponding receptor. in addition, our previous ex vivo studies showed that the direct action of il-1 enhanced il-1r1 gene expression in ovine pineal explants. moreover, the data presented here show that central il-1 treatment significantly stimulates the transcription of il-1rn in the pineal gland. it seems likely that increases in the gene expression of both il-1r2 and il-1rn in the pineal cells may be a mechanism protecting the gland against overstimulation by il-1. however, il-1r2 is structurally similar to il-1r1, and it plays a role as a decoy receptor. its cytoplasmic domain is significantly truncated relative to that of il-1r1 and is devoid of a toll - il-1 receptor (tir) region, which renders il-1r2 incapable of transmembrane signalling. in turn, il-1rn is a competitive inhibitor that prevents il-1 and il-1 from interacting with il-1r1. on the other hand, an increase in the amount of mrna encoding il-1r1 indicates a stimulatory effect on the transduction pathway of this receptor. in vitro studies have shown that the upregulation of il-1r1 mrna expression or cell surface levels of il-1r1 by il-1 is not an effect of its direct action. this study showed that the activation of the il-1r1 transduction pathway by il-1 leads to the stimulation of endogenous pge2 synthesis, which in turn enhances il-1r1 expression in the cells. it is worth noting that the relative gene expression of il-1r1 was higher than the expression of il-1r2 and il-1rn in the pineal gland from both the control and lps - treated individuals, which indicates the importance of the il-1r1-dependent signalling pathway in the regulation of pineal function. in addition, although the expression of the il-1 gene was found in the ovine pineal gland, no influence of experimental treatment or photoperiod on the transcription of this cytokine was found. these data are consistent with our previous ex vivo study, which showed a lack of an effect of il-1 treatment on its gene expression in pineal explants. these results support previous reports on the constitutive expression of il-1 in the rat pineal gland, which has also been shown to correlate with diurnal melatonin rhythms, where il-1 mrna levels are higher during daylight than during darkness. unexpectedly, this study found that il-1 expression was upregulated in pineal cultures after treatment with ne. increased il-1 expression via ne treatment ex vivo and the decline in il-1 expression at night, when ne levels are elevated, were explained based on immunocytochemical data showing that astrocytes are the predominant cell type expressing this cytokine in vivo, whereas il-1-positive cells are predominantly microglia in pineal explants and dispersed cell cultures. they assumed that these two types of il-1 expressing cells may differently affect the pinealocytes activity. our previous study performed on ex vivo model suggested that in sheep ne rather regulates pineal il-1 synthesis via its anti - inflammatory mechanism of action, which was previously reported for other mammalian cells [51, 52 ]. beyond the direct action of il-1 on the pineal cells, this cytokine may also affect the melatonin synthesis indirectly via induction of the synthesis of other proinflammatory mediators. its ability to stimulate the synthesis of proinflammatory cytokines such as il-6 and tnf has been well demonstrated in numerous cells. injection of il-1 stimulated il-6 gene expression directly in the pineal gland but the il-1 induced transcription of il-6 was higher in sn than ln photoperiod. the stimulatory influence of il-1 on the expression of il-6 has been previously described in the adult rat pineal organ cultures. our study showed that both mrna encoding il-6r and il6st are expressed in the ovine pineal gland. moreover, il-1 treatment stimulated the gene expression of il6st regardless of the photoperiod, and it stimulated il-6r but only during the ln photoperiod. the expression of il6-r mrna has been previously demonstrated in the pineal gland of rats. however, the same study showed that the transcription of il-6r is rather stable and not sensitive to peripheral lps treatment. these findings all suggest that ovine pineal cells may be sensitive to il-6 stimulation ; however, this issue has not been studied yet. although central il-1 injection did not influence tnf transcription in our study, it significantly raised the gene expression of tnfrsf1a and tnfrsf2 in the pineal gland cells. this suggests that the pineal gland may be a target for tnf synthesised in brain regions outside the pineal gland. it also might be that the lack of il-1-induced changes in tnf transcription was a result of the time that elapsed since the icv. injection of il-1. the pineal glands were collected four hours after il-1 treatment, and a study on rats, which analysed the profile of proinflammatory cytokines in the csf after peripheral lps injection, showed that, after initial elevation, the level of tnf showed the fastest reduction among all assayed cytokines. however, tnf is known for its ability to interfere with the processes of melatonin biosynthesis. a study on denervated pineal glands in rats demonstrated that tnf inhibited the transcription of aanat and the synthesis of the melatonin precursor n - acetylserotonin. moreover, a study on women with acute inflammation showed that suppression of the nocturnal melatonin surge was significantly correlated with an increase in circulating tnf. at the beginning of inflammation when tnf- levels were high, the nocturnal surge of melatonin was suppressed, and as soon as tnf- levels returned to levels that were below detection, the nocturnal melatonin surge was restored [56, 57 ]. it is worth mentioning that the results of our study analysing the gene expression of proinflammatory cytokines reflected the whole pineal gland, and it is impossible to judge which type of pineal cells expresses the mrna encoding proinflammatory cytokines and their corresponding receptors. it is postulated that, in addition to direct actions on pinealocytes, cytokines and other immune factors regulate pineal gland functioning indirectly affecting the pineal glial cells. it is considered that the effect of cytokines such as ifn- and il-1 on pinealocytes is generally mediated by microglia, when tnf exerts its biological effects acting directly on pinealocytes because tnf receptor is expressed directly on pinealocytes [21, 49 ]. it is worth mentioning that indirect action of il-1 on the melatonin secretion could be also mediated by prostaglandins. however, in the present study, the effect of central injection of il-1 on the brain prostaglandins has not been studied, the raise in the rectal body temperature in all treated ewes indirectly indicates that il-1 stimulated production of central pgs. it was established that pgs are involved in the regulation of melatonin secretion in the pineal gland [13, 14 ]. however, the role of distingu pgs in the modulation of melatonin secretion seems to be differentiated. pge1 and pge2 increased melatonin secretion in rat pineal explants, whereas pgf2n decreased melatonin release. it has previously been shown that il-1 administered both peripherally and centrally activates the hpa axis in several different species [5860 ]. in the present study, icv. injection of il-1 increased cortisol secretion, which indicates that the stress axis was activated. a study performed on rats showed that the pineal gland expresses glucocorticoid receptors, which potentiate ne - induced melatonin production in cultured rat pineal glands. additionally, results of an in vivo study on rats showed that a component of the hpa axis, corticosterone, enhanced nocturnal pineal melatonin production. however, there is some evidence that the role of hpa axis components in the modulation of melatonin secretion is more complex and elusive. a study on humans demonstrated that corticotropin - releasing hormone has an inhibitory effect on the pineal secretion of melatonin. however, il-1 had a greater stimulatory effect on cortisol release during the sn than ln photoperiod. the lower stimulation of the hpa axis by central il-1 may result from protective action of melatonin, whose circulating level is higher during the ln than during the sn photoperiod. numerous studies have shown that melatonin attenuates the adrenocortical response to stress and reduces the biosynthesis, release, and glucocorticoid - responsiveness of hypothalamic adrenocorticotropic hormone secretagogues [63, 64 ]. in summary, our study supports the thesis that centrally acting il-1 is responsible for distortions in nocturnal melatonin secretion patterns. this may result from a reduction of both serotonin concentration and the expression of the melatonin rhythm enzyme aanat. therefore, it is difficult to judge which il-1- induced pathway plays a pivotal role in the mediating of its inhibitory action on melatonin synthesis. it may involve mechanisms induced by direct action of il-1 on the pineal cells through pineal il-1 receptors. however, acting both at the pineal level and in other brain structures il-1 may also provoke synthesis of other proinflammatory cytokines and pgs, which also may influence melatonin secretion. the indirect mechanism of il-1 action on the pineal secretion of melatonin may also involve components of activated hpa axis ; however the role of particular stress mediators in the modulation of melatonin secretion is differentiated. of great importance till now, the majority of the studies concerning broadly understood bilateral interactions between immune and pineal systems were performed on rodents. however, there are important differences in the intracellular mechanisms regulating melatonin secretion that distinguished rodents and other mammals including ungulates and primates. it seems that obtained results may be considered as more universal for day - active species including human than the results of studies on nocturnal animals, such as rats. therefore, our study may shed new light on the aetiology of melatonin secretion disorders, which commonly accompany inflammatory diseases, alzheimer 's disease, and depression. | in vertebrates, numerous processes occur in a rhythmic manner. the hormonal signal reliably reflecting the environmental light conditions is melatonin. nocturnal melatonin secretion patterns could be disturbed in pathophysiological states, including inflammation, alzheimer 's disease, and depression. all of these states share common elements in their aetiology, including the overexpression of interleukin- (il-) 1 in the central nervous system. therefore, the present study was designed to determine the effect of the central injection of exogenous il-1 on melatonin release and on the expression of the enzymes of the melatonin biosynthetic pathway in the pineal gland of ewe. it was found that intracerebroventricular injections of il-1 (50 g / animal) suppressed (p < 0.05) nocturnal melatonin secretion in sheep regardless of the photoperiod. this may have resulted from decreased (p < 0.05) synthesis of the melatonin intermediate serotonin, which may have resulted, at least partially, from a reduced expression of tryptophan hydroxylase. il-1 also inhibited (p < 0.05) the expression of the melatonin rhythm enzyme arylalkylamine - n - acetyltransferase and hydroxyindole - o - methyltransferase. however, the ability of il-1 to affect the expression of these enzymes was dependent upon the photoperiod. our study may shed new light on the role of central il-1 in the aetiology of disruptions in melatonin secretion. |
staphylococcus aureus is one of the most significant bacterial pathogens and can cause diseases ranging from minor and surgical site infections to potentially life - threatening endocarditis [24 ] and bacteraemia [58 ]. it is a particular problem in hospitals as a consequence of the emergence and dissemination of multidrug - resistant forms such as methicillin - resistant s. aureus (mrsa), vancomycin intermediate susceptibility s. aureus (visa), and heterogenous visa (hvisa). the prevalence of these antibiotic resistant forms means that the discovery of novel chemotherapeutic agents to combat these pathogens is of key importance [9, 10 ]. the lantibiotics (lanthionine - containing antibiotics) are a group of posttranslationally modified antimicrobial peptides of which nisin and lacticin 3147 are among the most extensively investigated. a number of lantibiotics have been noted to exhibit potent antimicrobial activity against staphylococci of clinical relevance. in agar diffusion assays, the type i lantibiotics epidermin, pep5, epicidin k7, and epilancin 280 display impressive levels of activity against coagulase negative staphylococci (cns), and it has been suggested that their potential could be exploited to prevent the colonization of medical devices. nisin has also been shown on several occasions to possess significant anti - staphylococcus activity. when tested against 20 mrsa strains, one study revealed that the minimum inhibitory concentration (mic) of nisin a ranged between 1.5 and 16 mg / l, while a more recent investigation revealed mics of 0.54.1 the in vitro activity of other forms of nisin (nisin f, q, and z) against mrsa has also recently been highlighted. the in vivo activity of a number of lantibiotics against staphylococci has also been investigated. the effectiveness of the epidermin - like mutacin b - ny266 was tested on mice infected by intraperitoneal (ip) injection with 3.1 10 cfu of s. aureus smith / mouse. immediately after injection, mutacin b - ny266 was administered, also via the ip route, at concentrations of 110 mg / kg of mouse and was found to be protective. more recently, it has been established that microbisporicin, in addition to having potent in vitro activity (mic 0.13 g / ml), effectively controls murine septicemia caused by s. aureus in female cd-1 mice (2325 g). the mice were infected via the ip route with 1 10 cfu of s. aureus smith 819 atcc 19636 in 0.5 mls gastric hog mucin. microbisporicin was then administered intravenously or subcutaneously (sc) 1015 mins after infection at final concentrations of 1015 the effective dose 50 (ed50) of microbisporicin was found to be 2.1 mg / kg regardless of whether it was administered via iv or sc. ed50 values were determined on the bases of survival of the mice to the seventh day. higher doses of microbisporicin (200 mg / kg) led to the survival of all animals treated and were nontoxic. nisin f effectively controlled the mrsa strain, s. aureus k, in immunocompromised wistar rats following the introduction of 4 10 s. aureus cells into the nostrils of the rats for 4 consecutive days before treating with 8192 arbitrary units (au) of nisin f intranasally for the subsequent 4 days. in contrast, however, when 1 x10 s. aureus xen 36 cells were injected intraperitoneally, the administration of a lower concentration of nisin f (640 au) after 4 hours succeeded in inhibiting the growth of the pathogen for only 15 minutes after which time the pathogen reemerged. finally, short- and long - term in vivo studies with mersacidin established that this lantibiotic quite effectively inhibited mrsa introduced intranasally into immunocompromised (hydrocortisone - treated) balb / c mice. for the short term trial, the mice were infected on days 5, 7, and 9 with 3 1010 cfu of the s. aureus strain. the mice were then treated intranasally with mersacidin (1.66 mg / kg per treatment) twice a day on days 10, 11, and 12. for the longer trial, the mice were challenged with s. aureus on days 5, 7, 9, 30, 32, and 34 and subsequently treated with mersacidin on days 35, 36, and 37. in both cases the mersacidin treatment successfully inhibited mrsa - induced rhinitis. notably, a comparison of the in vitro and in vivo activity of mersacidin against a number of mrsa strains indicates that mersacidin more effectively inhibits s. aureus in vivo. these peptides are active as a consequence of the synergistic activity of two lanthionine - containing peptides [22, 23 ]. lacticin 3147 has been found to exhibit potent in vitro activity against a range of pathogenic bacteria including clostridium difficile, vancomycin - resistant enterococci, propionibacterium acne, penicillin - resistant pneumococcus, and streptococcus mutans [14, 2426 ] as well as pathogenic mycobacteria such as mycobacterium avium subsp paratuberculosis and mycobacterium tuberculosis h37ra. of greatest relevance to this study is the fact that lacticin 3147 possesses anti - staphylococcus activity. the lantibiotic itself, when incorporated into a teat seal, protects against s. aureus - associated bovine mastitis [28, 29 ], while use of a lacticin 3147-producing lactococcus lactis dpc 3251 within a teat dip inhibits s. aureus both in vitro and also in vivo. the in vitro activity of lacticin 3147 against clinical mrsa isolates has also been established with mics ranging from 1.9 to 15.4 mg / l. despite lacticin 3147 being one of the most extensively studied lantibiotics, its ability to control a systemic infection caused by s. aureus, or indeed any other pathogen, has not been investigated. here we address this issue using balb / c mice infected via the ip route with s. aureus xen 29, a strain of methicillin sensitive s. aureus (mssa) that has been genetically modified to express the photorhabdus luminescens lux genes to facilitate in vivo imaging. the ability of subcutaneously administered lacticin 3147 to control infection was assessed by in vivo imaging and microbiological analysis of the organs of sacrificed animals. the in vitro activity of lacticin 3147 and vancomycin (employed as a positive control) against s. aureus xen 29 was assessed through mic determination assays carried out in triplicate as described previously with purified lacticin 3147, prepared via hplc, again as described previously. s. aureus xen 29 (derived from the parental pleural isolate s. aureus 12600 ; xenogen corporation, almeda, ca) possesses a copy of the modified luxabcde operon of p. luminescens integrated at a single site on the chromosome. s. aureus xen 29 was cultured overnight in brain heart infusion (bhi) broth aerobically at 37c from an isolated colony growing on bhi agar containing 200 g / ml kanamycin. on the day of the trial, the overnight culture was subcultured (1 : 100 dilution) into fresh bhi and grown to log phase (od600 nm of 0.5). this culture was diluted to facilitate the ultimate administration of the culture in the form of a 1 10 cfu/100 l dose in 0.5% hog gastric mucin (sigma aldrich). mice were fed a standard rodent diet ad libitum and all animal studies were approved by the animal experimentation ethics committee. 13 balb / c female mice (7 weeks old, 15 g 2 g in weight) were divided into 3 groups (a, b, c ; n = 3, 5, and 5, resp.). at t0 mice in groups a c received the 1 10 cfu dose (100 l volume) via the ip route in 0.5% gastic hog mucin (sigma aldrich). at t1.5 mg / kg of ltn and 43.8 mg / kg of ltn, corresponding to 30.76 mm lacticin 3147/kg) in a single dose and a second dose at t3hrs (25.425 mg / kg ltn and 21.90 mg / kg ltn ; 15.382 mm lacticin 3147/kg). vancomycin (50 mg / kg ; 33.6 mm / kg) was administered at t1.5 hrs and at t3hrs to the mice in group b while the mice in group a received pbs (once) as a control. both antimicrobials and pbs were adminisitered subcutaneously in 100 l doses. in vivo imaging was carried out at two time points that is, 3 hours and 5 hours postinfection. mice were anaesthetized for bioluminescent imaging via the inhalation of aerosolized isoflurane mixed with oxygen. the mice were then transferred to the ivis chamber ventral side up, and luminescence was measured over a 3-to-5 mins exposure time. the imaging system measures the number of photons reaching each detector of the charged - couple device camera, and the ivis software translates these data into false color images that display regions of intense luminescence with red, moderate luminescence in yellow and green and mild luminescence in blue. the images contained herein are photographic images with an overlay of bioluminescence that uses this computer - generated color scale. these organs were mechanically disrupted and serial dilutions made which were subsequently plated in 100 l volumes on tsa kan plates in order to enumerate the staphylococci present in each organ. luminescent images were quantified with ivis imaging software. the total flux (number of photons / s / cm) was calculated by a user defined area (region of interest) covering the infection site. the flux was averaged across all mice from each respective group. the reduction in luminescence was quantified and represents a comparison with the luminescence from mice administered phosphate - buffered saline control at the same time point. the mean and standard error of the mean (sem) of the luminescence at the final time point and bacterial counts for the mice were calculated for all groups. differences in the bioluminescence and bacterial counts analyzed through a one - way analysis of variance, followed by the holm - sidak posttest (sigma stat, version 3.5). the ability of subcutaneously injected lacticin 3147 to control a systemic s. aureus infection following the introduction of the pathogen into the murine peritoneal cavity was investigated. this involved in vivo imaging to detect levels of light emitted by the pathogen within mice and through the postmortem microbiological analysis of organs. negative and positive controls were employed in the form of mice treated with pbs and the glycopeptide antibiotic vancomycin, respectively. the target strain s. aureus xen 29 is a methicillin sensitive isolate which has been employed previously to facilitate an investigation of acute in vivo infections [3236 ]. prior to commencement of the study, the in vitro sensitivity of xen 29 to lacticin 3147 was assessed. l for vancomycin and lacticin 3147, respectively (table 1). for in vivo studies, mice received a dose of 1 10 cfu and, 1.5 hrs postinfection, were administered lacticin 3147 (50.85 mg / kg of ltn and 43.8 mg / kg of ltn), vancomycin (50 mg / kg), or pbs. at t3hrs, the mice were subject to ivis imaging, and second doses of lacticin 3147 (25.425 mg / kg and 21.90 mg / kg) and vancomycin (50 mg / kg) were administered to the relevant mice. ivis analysis of the progression of the s. aureus xen 29 infection showed that the pathogen spreads systemically and eventually also occupies the thoracic cavity in mice injected with pbs 5 hrs (t5hrs) after injection of the pathogen. a significant (p = 0.000116) reduction in the rlu measurements corresponding to the thoracic region of the lacticin 3147 treated group was evident when compared to that of the pbs (negative) control group (figure 1) at this time point highlighting the ability of the lantibiotic to prevent systemic spread of the s. aureus xen 29 infection. in contrast, lacticin 3147 does not significantly reduce rlu values corresponding to the peritoneal cavity relative to the control. it may be that lacticin 3147 is deficient in penetrating the peritoneal cavity (figure 1). to further ascertain lacticin 3147 efficacy, culture - based analysis of staphylococcal levels in the organs lacticin 3147 treatment resulted in a significant reduction (p < 0.05 in all cases ; figure 1) in pathogen numbers in the liver, spleen, and kidneys of the mice treated relative to the pbs - treated controls (figure 1). as expected, vancomycin brought about a significant reduction in s. aureus levels relative to the pbs - treated controls as determined by both bioimaging and culture - based analysis. notably, numbers of s. aureus in the spleens of lacticin 3147- and vancomycin - treated mice were statistically indifferent. however, vancomycin treatment more successfully lowered s. aureus numbers in the liver and kidneys. while both lacticin 3147 and vancomycin bind lipid ii, [10, 37, 38 ] differences exist with respect to their mechanism of action. vancomycin binds to the c - terminal d - ala - d - ala motif of the pentapeptide of lipid ii whereas, on the basis of similarities between ltn and mersacidin, it is proposed that lacticin 3147 binds to the sugar phosphate head group of lipid ii. furthermore, lacticin 3147 is also capable of forming pores in the membranes of target cells [37, 38 ]. it should be noted that while similar mg / kg doses of lacticin 3147 and vancomycin were employed in this study, our in vitro investigations established that vancomycin is 19 times more potent than lacticin 3147 against xen29 (mic values ; 1.013 mg / l and 19.1 mg / thus the dose of vancomycin administered in vivo corresponded to 100-fold that of the in vitro mic whereas lacticin 3147 was administered at a level 8-fold greater than its in vitro mic. this may explain the enhanced ability of vancomycin with respect to clearance of xen 29 from the peritoneal cavity. this is the first occasion upon which the impact of lacticin 3147 against a systemic infection has been assessed and thus it is also the first instance of its administration subcutaneously. it may be that lacticin 3147 can not travel to the peritoneum to eradicate the infection but can prevent the spread of infection throughout the blood stream. as stated previously, mersacidin has successfully been shown to inhibit a systemic mrsa infection in mice when administered via the subcutaneous route. however, mersacidin is a one - component lantibiotic and is also globular which may provide facile delivery through the skin. it, like vancomycin, is quite a small peptide with a molecular weight of 1, 825 da. lacticin 3147 consists of 2 peptides with molecular weights of 3305 da (ltn) and 2847 da (ltn), and it may be that the larger size of the individual peptides or a specific difficulty relating the transport of one of the components to the peritoneal cavity may be an issue. mutacin b - ny266 has also been shown to protect against s. aureus in the peritoneum, but this lantibiotic was administered intraperitoneally, and thus transfer to the site of infection was not an issue. in conclusion, here we have provided evidence that lacticin 3147 could be employed to treat systemic infections. both culture- and bioluminescence - based analyses reveal that the lantibiotic significantly reduces numbers of the s. aureus xen29 relative to the negative control by preventing the dissemination of the pathogen. although these results are more promising than those described when nisin f was employed in a similar manner (19), differences with respect to the strains of s. aureus employed, concentrations of lantibiotic, and other factors mean that a direct comparison of outcomes is not possible. while further investigations are required, over longer periods of time, to more extensively assess the clinical potential of lacticin 3147, it is worth noting that lacticin 3147 possesses many physicochemical properties that favour its in vivo application. these include excellent activity over a broad ph range, especially at physiological ph (ph 7), the absence of cytotoxicity towards eukaryotic cells, its broad spectrum of activity at nanomolar concentrations, its alternative mode of action, and the presence of (methyl)lanthionine bridges that confer structural rigidity to lantibiotics and reduce proteolytic attack. these properties, accompanied by its ability to inhibit a systemic s. aureus infection, make lacticin 3147 a promising candidate for potential applications in human medicine. | the objective of this study was to investigate the in vivo activity of the lantibiotic lacticin 3147 against the luminescent staphylococcus aureus strain xen 29 using a murine model. female balb / c mice (7 weeks old, 17 g) were divided into groups (n = 5) and infected with the xen 29 strain via the intraperitoneal route at a dose of 1 106 cfu / animal. after 1.5 hr, the animals were treated subcutaneously with doses of phosphate - buffered saline (pbs ; negative control) or lacticin 3147. luminescent imaging was carried 3 and 5 hours postinfection. mice were then sacrificed, and the levels of s. aureus xen 29 in the liver, spleen, and kidneys were quantified. notably, photoluminescence and culture - based analysis both revealed that lacticin 3147 successfully controlled the systemic spread of s. aureus in mice thus indicating that lacticin 3147 has potential as a chemotherapeutic agent for in vivo applications. |
during recent years, the trend toward laparoscopic approach for hernia repair in children has been increasingly justified. the ability to detect and repair the contralateral opening of internal rings simultaneously, along with safe high ligation of the hernia sac without injury of the vas deference or the spermatic vessels, make laparoscopic approach a reliable alternative to the conventional open techniques (1) most of these methods employ a laparoscope inserted via an umbilical incision and two lateral ports for instruments to ligate the hernia defect. the necessity for intra - abdominal skills, such as intracorporeal suturing, knot tying, and (2) recurrence rate after laparoscopic surgery is generally known to be higher than after open surgery. with the increase in laparoscopic inguinal hernia repair, several treatment techniques have developed over the past two decades, aimed at improving the outcome ; the various techniques differ in their approach to the inguinal internal ring, suturing and knotting techniques, number of ports used in the procedures, endoscopic instruments used, mode of dissection of the hernia sac, and extracorporeal and intracorporeal suturing and knotting techniques. i used two 5 mm ports which reduce the port numbers and size, the purse string suturing, and extracorporeal knotting of the hernia sac. the main outcome measurements were correlation between clinical diagnosis, abdominal ultrasound results and the laparoscopic evaluation of contralateral hernia, feasibility of two ports laparoscopic repair of the inguinal hernia, conversion rate, need for additional port, operative time, postoperative pain and requirement of analgesia, hospital stay, recurrence rate, and fat of nonexcised hernia sac and development of postoperative hydrocele. written consent was obtained from the family after getting full information about the surgery and the postoperative squeal. all patients received one dose of antibiotic prophylaxis in the form of ceftriaxone 50 mg / kg at the time of induction of anesthesia. under general endotracheal anesthesia, endopath xcel port (5 mm) with 00 scope inserted supra umbilical by close technique. seconded working port 5 mm was inserted according to the unilaterally and bilaterally hernia under visualization (figure 1). patient position was changed to trendelenburg position 45 which helped in reduction of the hernia contents and gave better visualization of the rings. proline 3/0 suture mounted needle was passed from the outside through skin and abdominal wall muscles to the peritoneal cavity under visualization (figure 2). the hernial sac neck was closed by purse string 3/0 non- absorbable proline suture as high as possible (figure 3). the suture was placed between the peritoneum and the fascia with preservation of the testicular vessels and the vas deference. the needle pushed out the abdomen by the laparoscopic needle holder until it appears outside the abdomen. the knot was fixed deep in the abdominal wall by small snip skin incision by number 11 knife. full inspection of the abdominal wall and the closed defect was done (figure 4). all patients were asked to come for follow - up at outpatient clinic after 7 days, 2 weeks, 6 months, and 1 year. 90 children including 75 males and 15 females underwent two ports laparoscopic inguinal hernia repair. 70 (77.7%) cases were suffering unilateral inguinal hernia and 20 (22.2%) patients had bilateral inguinal hernia. out of the 20 cases these cases were diagnosed as left congenital inguinal hernia by clinical and ultrasound examinations while the laparoscope shows the metachronous hernia at the time of surgery. the mean operative time for unilateral repairs was (15 to 20 minutes) and bilateral hernia repair was (21 to 30 minutes). the scars on the abdominal wall were small and minute (5 mm incision for umbilical port, 5 mm working port and stitch site). there was one patient who got noncomplicated right recurrent inguinal hernia after two weeks from surgery. this patient underwent open right herniotomy where the hernia sac was not closed and proline stitch did not surround all the circumferences of the sac. another case gets stitch sinuses at the proline knot site, which required open surgical removal of the stitch and open herniotomy at the same time. in this case the hernia sac was closed completely by the proline stitch. once the proline stitch removed the sac opened, so, herniotomy and trans fixation was done. inguinal hernia in pediatric age group is a common problem and all the pediatric surgeons are fully familiar with the various aspects of its traditional surgical repair through the groin incision which has a high success rate and acceptable cosmetic results with few complications. by far one of the drawbacks of this conventional technique is inability to rule out the contralateral patent processes vaginalis and synchronous hernia. with the advent of minimal access surgery, many pediatric surgeons accepted it, as a suitable and reliable alternative to the open techniques, considering its superiority for handling tissues during repair of recurrent inguinal hernias and also for its capabilities in regard to justifying and managing the synchronous subtle contralateral hernia. however, there are still some issues regarding the introduction of laparoscopic inguinal hernia repair as the gold standard method, especially taking into consideration the possible longer operative time and the inevitable need for three separate ports which is the case in routine laparoscopic herniotomy techniques. in these works only two ports were used to do laparoscopic hernia repair in children, which increases the benefit of the laparoscopic herniotomy. the modified, new laparoscopic technique improved the diagnosis of ipsilateral hernia, using extracorporeal tying, that yields excellent cosmetic result. out of the 20 cases 5 (25%) case these cases were diagnosed as left congenital inguinal hernia clinically and ultrasound examinations can not detect the metachronous hernia in the right side prior to surgery. laparoscope was superior to ultrasound in diagnosis of the metachronous hernia, while in other studies significant number of children (20%) presenting with unilateral hernias have contralateral patent processes vaginalis [5, 6 ]. the options for detection of contralateral patent processes vaginalis are many, namely, routine bilateral open surgery explorations, use of ultrasonography, laparoscopy, and the wait and watch policy. although laparoscopy proves advantageous over open surgery by precise detection and simultaneous repair of contralateral patent processes vaginalis, its management remains a contentious issue. the current consensus amongst surgeons practicing open surgery favors operating on the symptomatic side alone as the rate of metachronous hernia is significant that it necessitates subsequent surgery in a twentieth of patients. therefore, this advantage of laparoscopic hernia repair may be significant in clinical practice as it gives good diagnosis and also repair for the metachronous hernia. in open surgery, time is consumed in gaining access, obtaining adequate exposure, identification of the hernia sac, and dissection of the cord structures from the sac without harming the important cord structures. in laparoscopic surgery, approaching from within makes the area of interest bloodless, and the magnification renders anatomy splendidly clear, making surgery precise. but the time limiting step remains intracorporeal suturing that places considerable demands on the requirement of hand eye coordination, especially while negotiating the posterior and medial hemicircumference of the internal ring, over the iliac and inferior epigastric vessels. with growing experience and in this study the subfascia purse string suture and extracorporeal subcutaneous knotting with two ports markedly reduce the operative time over the traditional three ports laparoscopic hernia repair with intracorporeal suture ligation. in this study the mean operative time for unilateral repairs was (15 to 20 minutes) and bilateral hernia repair was (21 to 30 minutes) ; the mean duration of surgery was markedly less than the operative time noted in lukong study. the extracorporeal suturing was effective easy not need for special tool or surgical skills which also proved by other studys [11, 12 ]. the difference in postoperative pain following open surgery and laparoscopic surgery is subject to controversy. some report less pain while others report greater pain in the immediate postoperative period following laparoscopic surgery compared with open surgery. parietal pain predominates in open surgery can well be controlled by caudal analgesia. on the other hand, pain perception is multimodal and multifactorial in laparoscopic surgery. in addition to parietal pain caused by port placement, capnoperitoneum causes visceral pain due to stretching (peritoneal and diaphragmatic) and acidosis. neither the use of smaller ports nor the use of caudal analgesia would completely obliterate pain following laparoscopy. therefore, the decrease in the size of the incision does not necessarily translate into a proportionate decrease in pain. hence, the difference in postoperative pain between laparoscopic surgery and open surgery is not significant enough to rate either surgery superior. in this study, the intraperitoneal gas pressure was located less than in other studies due to the less number of ports and no need for intra - abdominal surgical maneuvers. which reduced the post - operative pain. lee and liang introduced the endo - needle designed specifically for laparoscopic extraperitoneal closure of the patent processus vaginalis. they reported no complications related to the procedure and a remarkably low recurrence rate (0.88%). prasad. used a stainless steel curved awl and a 1.7 mm telescope to safely perform needlescopic inguinal herniorrhaphy. shalaby. used rn for closure of iir in 150 patients successfully with excellent cosmetic results without any recurrence. chan and tam introduced the saline injection and needle sign to reduce the recurrence rate in his series. used the tnh technique in 67 repairs, and 146 repairs were performed using the seal technique. they stated that seal resulted in marked reduction of operative time when compared to the tnh technique (unilateral : 15 versus 25 minutes ; bilateral : 25 versus 40 minutes). they added that avoiding the vas deferens and gonadal vessels during the seal repair in boys may leave a small gap at the internal ring as well as leaving the hernia sac in situ, which has the potential to contribute to a higher incidence of recurrence in male patients. they believe that ligation of the internal ring leads to scarring and obliteration of the space distally. fluid accumulating in the distal sac postoperatively often reabsorbs spontaneously and does not necessitate additional intervention. in this study there was no hydrocele detected as a postoperative complication in spite of no excision of the sac and the recurrence rate was 1% recurrence. several piercings of the peritoneum by rn around the neck of the sac may add fixation of the suture at this level that prevents migration of the suture distally initiating recurrence. this may explain the high incidence of recurrence in the series of manoharan. and bharathi. however, chan and tam reported a very low recurrence rate (1%) after refinement of the technique by using tnh and injecting saline around the vas and vessels and using the needle sign to avoid damage to the testicular vessel and vas. prasad. reported no recurrence in their early small series of 8 cases. the results of this study confirm the safety and efficacy of laparoscopic hernia repair with two ports in congenital inguinal hernia in children. it resulted in good diagnosis and management of metachronous hernia and marked reduction of operative time, less recurrence, no hydrocele formation, excellent cosmetic, and no postoperative pain results. | introduction. several laparoscopic treatment techniques were designed for improving the outcome over the last decade. the various techniques differ in their approach to the inguinal internal ring, suturing and knotting techniques, number of ports used in the procedures, and mode of dissection of the hernia sac. patients and surgical technique. 90 children were subjected to surgery and they undergone two - port laparoscopic repair of inguinal hernia in children. technique feasibility in relation to other modalities of repair was the aim of this work. 90 children including 75 males and 15 females underwent surgery. hernia in 55 cases was right - sided and in 15 left - sided. two patients had recurrent hernia following open hernia repair. 70 (77.7%) cases were suffering unilateral hernia and 20 (22.2%) patients had bilateral hernia. out of the 20 cases 5 cases were diagnosed by laparoscope (25%). the patients ' median age was 18 months. the mean operative time for unilateral repairs was 15 to 20 minutes and bilateral was 21 to 30 minutes. there was no conversion. the complications were as follows : one case was recurrent right inguinal hernia and the second was stitch sinus. discussion. the results confirm the safety and efficacy of two ports laparoscopic hernia repair in congenital inguinal hernia in relation to other modalities of treatment. |
hospital - acquired pneumonia (hap) is the second most common nosocomial infection, occurring in 0.5%2% of general hospital admissions1,2 and in 15%20% of patients in intensive care units,3 likely because of the prevalent use of mechanical ventilation. hap is a life - threatening condition that is associated with increased in - hospital mortality of 22%60%.4 with extended hospital length of stay and an increasing number of patients with multidrug - resistant hap, treating hap is expensive. one episode of hap has been shown to increase hospitalization costs by up to usd 40,000 in the usa.5 the incidence of hap in chinese tertiary care hospitals ranges from 5.9% in general hospitalized patients6 to 28.2% in critically ill patients.7 overall mortality in chinese patients with diagnosed hap was reported as 25.3%.8 of the reported deaths, pseudomonas aeruginosa and staphylococcus aureus infections accounted for 70.6% and 66.7% of cases, respectively. differences have been observed in the causative pathogens patterns associated with hap in the people s republic of china compared to western countries, with more than half of chinese patients with hap caused by gram - negative pathogens.7,8 as a result, it is expected that chinese patients might respond differently to the empirical use of different antibiotics. vancomycin and linezolid are the first - line treatments for methicillin - resistant s. aureus (mrsa),1 and with the increasing risk of hap caused by mrsa,9 the empirical use of vancomycin and linezolid for hap is becoming commonplace in the people s republic of china. however, because the hap causative pathogen(s) is not routinely identified in chinese tertiary care hospitals, the empirical use of vancomycin and linezolid for suspected mrsa infection is common. there is a paucity of evidence concerning the use of vancomycin and linezolid in the people s republic of china for the treatment of difficult hap under routine clinical practice. thus, to address the current evidence gap, this retrospective cohort study was conducted using a hospital administrative database to collect information from routine clinical use of vancomycin and linezolid for patients with hap and compare their associated impact on clinical outcomes and health resource utilization. a representative tertiary care hospital in shanghai, people s republic of china was selected to conduct this retrospective cohort study. the study observation time was set from january 1, 2008 to february 28, 2012, which was the time period that both vancomycin and linezolid had hospital prescription records and were available for use at the hospital. linked hospital administrative databases, using a unique patient identifier, were used to identify eligible hospital episodes with occurrence of hap. the hospital prescription database was searched using the key words vancomycin and linezolid during the study observation time. the hospital radiological examination database was further interrogated for any chest radiograph or computed tomography reports containing the key words for radiological signs for pneumonia including infiltrate, consolidation, and/or pleural effusion. the hospital admission registry database was interrogated to exclude hospital episodes with a diagnosis of pneumonia at hospital admission, age younger than 18 years, or survival time less than 72 hours. the hospital prescription database was also accessed to exclude hospital episodes with a treatment duration of vancomycin or linezolid that was less than 48 hours. to control the heterogeneity associated with the highly varied admission diagnoses, the study cohort only included hospital episodes with admission diagnoses ranked in the top ten in distribution for the two antibiotics. all eligible hospital episodes were identified within the hospital administrative databases, and the necessary information was extracted. the hospital admission registry database was used to extract patient demographic information, including age, gender, health insurance plan, hospital admission diagnosis, hospital admission and discharge dates, and vital status at hospital discharge. the hospital radiological examination database was used to collect information on the radiological signs for pneumonia. the hospital drug prescription database was used to extract information on specified antibiotics between the first diagnosis of hap and initial administration of vancomycin or linezolid, as well as information on dosage and treatment duration for vancomycin and linezolid, antibiotics combined with vancomycin or linezolid for treating hap, and any additional use of antibiotics after the treatment with vancomycin or linezolid. the hospital discharge summary database was used to obtain information on comorbidities, the primary intervention for the hospital admission diagnosis, type of hospital ward at the time of diagnosis of hap, the use of mechanical ventilation prior to and after a diagnosis of hap, signs and symptoms of pneumonia, pneumonia - related complications, and cause of death. the hospital daily management database was used to extract information on body temperature, pulse rate, breath frequency, blood pressure, and arterial oxygen saturation during treatment with vancomycin or linezolid. the hospital laboratory database was used to extract white blood cell counts, bacteria gram stain and culture test results, and bacteria antibiotic resistance test results obtained during treatment. the hospital billing summary database was used to extract billing summary information for medications, medical examinations, medical supplies, and other unclassified expense items. unit prices and dosage information associated with vancomycin and linezolid were extracted from the hospital prescription databases to calculate the drug costs for these two antibiotics. in this study, the diagnosis of hap was established using a combination of radiological signs seen on chest radiographs or computed tomography examination and at least one of the following signs or symptoms prior to initiation of treatment with vancomycin or linezolid : auscultatory findings of pneumonia, dyspnea, tachypnea, or hypoxemia in the hospital discharge summary ; body temperature > 37.8c ; respiratory rate > 30 breaths / minute ; systolic blood pressure 10,000 cells / mm ; and/or positive bacterial test from cultures of respiratory tract, sputum, or blood samples. the primary clinical outcome measures used were the clinical responses at the end of treatment. clinical responses were further classified as clinical cure, clinical improvement, and treatment failure. clinical cure was defined as the resolution of the baseline clinical signs and symptoms of pneumonia with improvement or lack of progression of radiographic findings. clinical improvement was defined if a clinical cure was not achieved but any improvements of the baseline signs and symptoms of pneumonia were seen at the end of treatment. treatment failure was defined as the persistence or progression of the baseline signs and symptoms of pneumonia and/or administration of another effective antibiotic because of lack of clinical improvement from the treatment with either of the two antibiotics of interest. secondary clinical outcome measures included any occurrences of pneumonia - related complications (pulmonary edema, sepsis, infection shock, and/or respiratory failure), pneumonia - related mortality (defined as any death caused by pneumonia - related complications), and all - cause mortality at the end of treatment and at hospital discharge, respectively. the primary cost outcome measures used were the hospital costs that were classified into the acquisition costs of vancomycin or linezolid, other medication costs, medical examination costs, medical supply costs, and other unclassified costs. student s t - test for continuous variables and chi square test for proportional variables were performed to identify unbalanced patient baseline characteristics associated with the antibiotic treatment groups. multiple logistic regression analysis was conducted to identify those baseline characteristics independently predicting the treatment selection for hap in this tertiary care hospital. patients with the same primary hospital admission diagnosis were included to perform propensity score matching and identify the best matched pairs (1:1) for the two antibiotics using the greedy approach.10 the matched pairs for the top ten hospital admission diagnoses were pooled to create matched treatment groups for adjusted comparisons on clinical effectiveness and resource consumption and costs associated with the antibiotics. paired t - test and mcnemar s test were used for adjusted comparisons on clinical responses, pneumonia - related complications, pneumonia - related mortality, and all - cause mortality. wilcoxon signed - rank test was performed in the adjusted comparisons on the median hospital costs because the distribution of hospital costs was often skewed.11 to further adjust residual imbalance of patient baseline characteristics after matching, multiple logistic regression analyses using the generalized estimating equation were performed to adjust those unbalanced baseline characteristics12 and estimate the risk differences in treatment failure at the end of treatment pneumonia - related in - hospital mortality and all - cause in - hospital mortality, respectively. multiple linear regression analyses using the generalized estimating equation were also performed to explore any differences in the common logarithm of categorized hospital costs between the two antibiotics after adjustment of unbalanced baseline characteristics between the propensity score matched treatment groups. statistical significance was defined as a two - sided p - value less than 0.05. the data analyses were performed using the sas version 9.2 statistical package (sas institute inc., cary, nc, usa). linked hospital administrative databases, using a unique patient identifier, were used to identify eligible hospital episodes with occurrence of hap. the hospital prescription database was searched using the key words vancomycin and linezolid during the study observation time. the hospital radiological examination database was further interrogated for any chest radiograph or computed tomography reports containing the key words for radiological signs for pneumonia including infiltrate, consolidation, and/or pleural effusion. the hospital admission registry database was interrogated to exclude hospital episodes with a diagnosis of pneumonia at hospital admission, age younger than 18 years, or survival time less than 72 hours. the hospital prescription database was also accessed to exclude hospital episodes with a treatment duration of vancomycin or linezolid that was less than 48 hours. to control the heterogeneity associated with the highly varied admission diagnoses, the study cohort only included hospital episodes with admission diagnoses ranked in the top ten in distribution for the two antibiotics. all eligible hospital episodes were identified within the hospital administrative databases, and the necessary information was extracted. the hospital admission registry database was used to extract patient demographic information, including age, gender, health insurance plan, hospital admission diagnosis, hospital admission and discharge dates, and vital status at hospital discharge. the hospital radiological examination database was used to collect information on the radiological signs for pneumonia. the hospital drug prescription database was used to extract information on specified antibiotics between the first diagnosis of hap and initial administration of vancomycin or linezolid, as well as information on dosage and treatment duration for vancomycin and linezolid, antibiotics combined with vancomycin or linezolid for treating hap, and any additional use of antibiotics after the treatment with vancomycin or linezolid. the hospital discharge summary database was used to obtain information on comorbidities, the primary intervention for the hospital admission diagnosis, type of hospital ward at the time of diagnosis of hap, the use of mechanical ventilation prior to and after a diagnosis of hap, signs and symptoms of pneumonia, pneumonia - related complications, and cause of death. the hospital daily management database was used to extract information on body temperature, pulse rate, breath frequency, blood pressure, and arterial oxygen saturation during treatment with vancomycin or linezolid. the hospital laboratory database was used to extract white blood cell counts, bacteria gram stain and culture test results, and bacteria antibiotic resistance test results obtained during treatment. the hospital billing summary database was used to extract billing summary information for medications, medical examinations, medical supplies, and other unclassified expense items. unit prices and dosage information associated with vancomycin and linezolid were extracted from the hospital prescription databases to calculate the drug costs for these two antibiotics. the diagnosis of hap was established using a combination of radiological signs seen on chest radiographs or computed tomography examination and at least one of the following signs or symptoms prior to initiation of treatment with vancomycin or linezolid : auscultatory findings of pneumonia, dyspnea, tachypnea, or hypoxemia in the hospital discharge summary ; body temperature > 37.8c ; respiratory rate > 30 breaths / minute ; systolic blood pressure 10,000 cells / mm ; and/or positive bacterial test from cultures of respiratory tract, sputum, or blood samples. the primary clinical outcome measures used were the clinical responses at the end of treatment. clinical responses were further classified as clinical cure, clinical improvement, and treatment failure. clinical cure was defined as the resolution of the baseline clinical signs and symptoms of pneumonia with improvement or lack of progression of radiographic findings. clinical improvement was defined if a clinical cure was not achieved but any improvements of the baseline signs and symptoms of pneumonia were seen at the end of treatment. treatment failure was defined as the persistence or progression of the baseline signs and symptoms of pneumonia and/or administration of another effective antibiotic because of lack of clinical improvement from the treatment with either of the two antibiotics of interest. secondary clinical outcome measures included any occurrences of pneumonia - related complications (pulmonary edema, sepsis, infection shock, and/or respiratory failure), pneumonia - related mortality (defined as any death caused by pneumonia - related complications), and all - cause mortality at the end of treatment and at hospital discharge, respectively. the primary cost outcome measures used were the hospital costs that were classified into the acquisition costs of vancomycin or linezolid, other medication costs, medical examination costs, medical supply costs, and other unclassified costs. patient baseline characteristics associated with each hospital episode were summarized using descriptive statistical methods. student s t - test for continuous variables and chi square test for proportional variables were performed to identify unbalanced patient baseline characteristics associated with the antibiotic treatment groups. multiple logistic regression analysis was conducted to identify those baseline characteristics independently predicting the treatment selection for hap in this tertiary care hospital. patients with the same primary hospital admission diagnosis were included to perform propensity score matching and identify the best matched pairs (1:1) for the two antibiotics using the greedy approach.10 the matched pairs for the top ten hospital admission diagnoses were pooled to create matched treatment groups for adjusted comparisons on clinical effectiveness and resource consumption and costs associated with the antibiotics. paired t - test and mcnemar s test were used for adjusted comparisons on clinical responses, pneumonia - related complications, pneumonia - related mortality, and all - cause mortality. wilcoxon signed - rank test was performed in the adjusted comparisons on the median hospital costs because the distribution of hospital costs was often skewed.11 to further adjust residual imbalance of patient baseline characteristics after matching, multiple logistic regression analyses using the generalized estimating equation were performed to adjust those unbalanced baseline characteristics12 and estimate the risk differences in treatment failure at the end of treatment pneumonia - related in - hospital mortality and all - cause in - hospital mortality, respectively. multiple linear regression analyses using the generalized estimating equation were also performed to explore any differences in the common logarithm of categorized hospital costs between the two antibiotics after adjustment of unbalanced baseline characteristics between the propensity score matched treatment groups. statistical significance was defined as a two - sided p - value less than 0.05. the data analyses were performed using the sas version 9.2 statistical package (sas institute inc., cary, nc, usa). the initial screening of the hospital prescription database identified 3,708 hospital episodes with vancomycin prescription records and 273 hospital episodes with linezolid prescription records. after further excluding hospital episodes without radiological evidence for pneumonia (n=1,841), patients with a diagnosis of pneumonia at hospital admission (n=93), those younger than 18 years (n=22), those with a survival time less than 72 hours (n=13), or those with less than 48 hours of treatment with vancomycin or linezolid (n=402), 1,610 patients were included. these were then ranked by hospital admission diagnoses and the 681 hospital episodes that were associated with the top ten most common admission diagnoses (621 for vancomycin and 60 for linezolid) were included to create the study cohort (figure 1). the study cohort of patients with a study - specified criteria case of hap consisted of 621 and 60 cases who were administered vancomycin and linezolid, respectively. these patients had a mean age of 56.7 years and were more likely to be men (70.6%). the most common hospital admission diagnoses among this restricted cohort were highly related to heart diseases (72.8%), including coronary heart disease (23.0%), multiple valve diseases (19.7%), aortic aneurysm and dissection (14.4%), rheumatic mitral valve diseases (8.8%), and non - rheumatic aortic valve disorders (6.9%). over four out of five patients (82.5%) included in this cohort received heart - related surgery, and mechanical ventilation was previously or currently used in more than half of the study cohort (55.8%). in addition, 95.7% of patients developed hap 48 hours or longer after hospital admission and 83.7% of hap cases were diagnosed using a chest radiograph. the most frequently used first - line antibiotics for hap in this cohort were cephalosporins (42.8%) and other -lactams (45.2%). hap causative pathogen and antibiotics resistance were not routinely assessed during treatment in the study cohort. some patient baseline characteristics were not balanced between the two antibiotic treatment groups (table 1). when compared to the linezolid group, the vancomycin group was significantly younger (mean age : 56.4 versus 60.2 years, respectively ; p=0.035), more likely to have comorbid heart failure (23.4% versus 10.0%, respectively ; p=0.015), have a hospital admission diagnosis of multiple valve diseases (20.0% versus 3.3%, respectively ; p=0.001), have heart - related surgery (84.4% versus 36.7%, respectively ; p<0.001), and have been treated initially with cephalosporins for hap (43.8% versus 23.3%, respectively ; p=0.002). however, the linezolid group had significantly higher proportions of hospital admission diagnoses concerning lung or digestive system cancers (40.0% versus 9.2%, respectively ; p<0.001), chronic obstructive pulmonary disease (5.0% versus 1.0%, respectively ; p=0.037), surgery related to the liver (11.7% versus 2.9%, respectively ; p=0.004) or stomach (16.7% versus 2.6%, respectively ; p<0.001), symptom control management (15% versus 3.5%, respectively ; p=0.001), and current use of mechanical ventilation (46.7% versus 26.3% ; p<0.001). multiple regression analysis further confirmed that no current use of mechanical ventilation (odds ratio [or ] : 0.200 ; 95% confidence interval [ci ] : 0.0990.404 ; p<0.001), heart - related surgery (or : 8.183 ; 95% ci : 2.53826.388 ; p<0.001), and previous treatment with cephalosporins (or : 3.747 ; 95% ci : 1.5628.987 ; p=0.003) were significantly and independently associated with the selection of vancomycin versus linezolid for hap empirical treatment. one - to - one propensity score matching of the vancomycin to the linezolid cases resulted in 60 best - matched pairs from the initial study cohort (figure 2). the average dosages of vancomycin and linezolid in the matched patients were 1,485 and 1,111 mg / day, respectively. treatment duration was slightly longer (11.8 versus 9.3 days, respectively ; p=0.319) in the matched vancomycin group. in addition, the matched vancomycin treatment group was associated with a significantly higher proportion of combination treatment with cephalosporins (43.3% versus 18.3%, respectively ; p=0.007). after matching, vancomycin versus linezolid group imbalance persisted for prevalence of current (16.7% versus 46.7%, respectively ; p=0.001) and previous use (46.7% versus 63.3%, respectively ; p=0.033) of mechanical ventilation and the front - line antibiotic treatment with cephalosporins (51.7% versus 23.3%, respectively ; p=0.001) and other -lactams (36.7% versus 56.7%, respectively ; p=0.029). a comparison of the clinical responses at the end of treatment between vancomycin and linezolid showed an almost identical clinical cure rate (30.0% versus 31.7%, respectively ; or : 0.923 ; p=0.847) associated with the two antibiotics and slightly higher treatment failure rate (55.0% versus 45.0%, respectively ; or : 1.494 ; p=0.289) associated with vancomycin in the created 60 matched pairs (table 2). the hospital stay length associated with vancomycin was slightly longer than that for linezolid without statistical significance (46.0 versus 39.1 days, respectively ; p=0.311). no significant differences in the occurrences of pneumonia - related complications, pneumonia - related death, and all - cause death at the end of treatment were identified between the two matched treatment groups. however, higher rates of pneumonia - related mortality (10.0% versus 1.7%, respectively ; or : 6.425 ; p=0.059) and all - cause mortality (18.3% versus 3.3%, respectively ; or : 6.564 ; p=0.013) at hospital discharge were observed in the matched linezolid treatment group. with further adjusting for the unbalanced baseline characteristics between the two matched treatment groups, the risk difference of treatment failure rate associated with the two antibiotics was further reduced (or : 1.139 ; 95% ci : 0.8871.461 ; p=0.308). the risk differences of pneumonia - related mortality and all - cause mortality at hospital discharge were also reduced and the lower risk of all - cause mortality associated with vancomycin was approaching statistical significance (or : 0.186 ; 95% ci : 0.0331.039 ; p=0.055) (figure 3). the median total hospital costs associated with the study cohort exceeded rmb 85,033 (or usd 13,471), the gross domestic product per capita in shanghai in 2012.13 directly comparing the allocation of hospital costs in the matched patients indicated that vancomycin was associated with significantly lower median drug acquisition cost (rmb 2,880 versus rmb 8,194, respectively ; median difference : rmb 5,314 ; p<0.001 ; 1 rmb = 0.16 usd), medical examinations (rmb 3,059 versus rmb 3,807, respectively ; median difference : rmb 748 ; p=0.042), and other unclassified care (rmb 27,686 versus rmb 44,826, respectively ; median difference : rmb 17,141 ; p=0.006) when compared to linezolid (table 3). however, this study only observed a strong but nonsignificant trend indicating lower median total hospital costs associated with vancomycin in the comparison with linezolid (rmb 113,160 versus rmb 133,825, respectively ; median difference : rmb 20,665 ; p=0.076). after further adjustment of unbalanced baseline characteristics between the two matched treatment groups, vancomycin was associated with significantly lower common logarithm of acquisition cost (coefficient : 0.826 ; 95% ci : 1.088 to 0.564 ; p<0.001) but similar common logarithm of hospital costs for other medications (coefficient : 0.072 ; 95% ci : 0.2600.404 ; p=0.671), medical examinations (coefficient : 0.061 ; 95% ci : 0.3480.227 ; p=0.679), medical supplies (coefficient : 0.102 ; 95% ci : 0.5520.348 ; p=0.657), and other unclassified care (coefficient : 0.101 ; 95% ci : 0.3810.178 ; p=0.478) when compared to linezolid. the study cohort of patients with a study - specified criteria case of hap consisted of 621 and 60 cases who were administered vancomycin and linezolid, respectively. these patients had a mean age of 56.7 years and were more likely to be men (70.6%). the most common hospital admission diagnoses among this restricted cohort were highly related to heart diseases (72.8%), including coronary heart disease (23.0%), multiple valve diseases (19.7%), aortic aneurysm and dissection (14.4%), rheumatic mitral valve diseases (8.8%), and non - rheumatic aortic valve disorders (6.9%). over four out of five patients (82.5%) included in this cohort received heart - related surgery, and mechanical ventilation was previously or currently used in more than half of the study cohort (55.8%). in addition, 95.7% of patients developed hap 48 hours or longer after hospital admission and 83.7% of hap cases were diagnosed using a chest radiograph. the most frequently used first - line antibiotics for hap in this cohort were cephalosporins (42.8%) and other -lactams (45.2%). hap causative pathogen and antibiotics resistance were not routinely assessed during treatment in the study cohort. some patient baseline characteristics were not balanced between the two antibiotic treatment groups (table 1). when compared to the linezolid group, the vancomycin group was significantly younger (mean age : 56.4 versus 60.2 years, respectively ; p=0.035), more likely to have comorbid heart failure (23.4% versus 10.0%, respectively ; p=0.015), have a hospital admission diagnosis of multiple valve diseases (20.0% versus 3.3%, respectively ; p=0.001), have heart - related surgery (84.4% versus 36.7%, respectively ; p<0.001), and have been treated initially with cephalosporins for hap (43.8% versus 23.3%, respectively ; p=0.002). however, the linezolid group had significantly higher proportions of hospital admission diagnoses concerning lung or digestive system cancers (40.0% versus 9.2%, respectively ; p<0.001), chronic obstructive pulmonary disease (5.0% versus 1.0%, respectively ; p=0.037), surgery related to the liver (11.7% versus 2.9%, respectively ; p=0.004) or stomach (16.7% versus 2.6%, respectively ; p<0.001), symptom control management (15% versus 3.5%, respectively ; p=0.001), and current use of mechanical ventilation (46.7% versus 26.3% ; p<0.001). multiple regression analysis further confirmed that no current use of mechanical ventilation (odds ratio [or ] : 0.200 ; 95% confidence interval [ci ] : 0.0990.404 ; p<0.001), heart - related surgery (or : 8.183 ; 95% ci : 2.53826.388 ; p<0.001), and previous treatment with cephalosporins (or : 3.747 ; 95% ci : 1.5628.987 ; p=0.003) were significantly and independently associated with the selection of vancomycin versus linezolid for hap empirical treatment. one - to - one propensity score matching of the vancomycin to the linezolid cases resulted in 60 best - matched pairs from the initial study cohort (figure 2). the average dosages of vancomycin and linezolid in the matched patients were 1,485 and 1,111 mg / day, respectively. treatment duration was slightly longer (11.8 versus 9.3 days, respectively ; p=0.319) in the matched vancomycin group. in addition, the matched vancomycin treatment group was associated with a significantly higher proportion of combination treatment with cephalosporins (43.3% versus 18.3%, respectively ; p=0.007). after matching, vancomycin versus linezolid group imbalance persisted for prevalence of current (16.7% versus 46.7%, respectively ; p=0.001) and previous use (46.7% versus 63.3%, respectively ; p=0.033) of mechanical ventilation and the front - line antibiotic treatment with cephalosporins (51.7% versus 23.3%, respectively ; p=0.001) and other -lactams (36.7% versus 56.7%, respectively ; p=0.029). a comparison of the clinical responses at the end of treatment between vancomycin and linezolid showed an almost identical clinical cure rate (30.0% versus 31.7%, respectively ; or : 0.923 ; p=0.847) associated with the two antibiotics and slightly higher treatment failure rate (55.0% versus 45.0%, respectively ; or : 1.494 ; p=0.289) associated with vancomycin in the created 60 matched pairs (table 2). the hospital stay length associated with vancomycin was slightly longer than that for linezolid without statistical significance (46.0 versus 39.1 days, respectively ; p=0.311). no significant differences in the occurrences of pneumonia - related complications, pneumonia - related death, and all - cause death at the end of treatment were identified between the two matched treatment groups. however, higher rates of pneumonia - related mortality (10.0% versus 1.7%, respectively ; or : 6.425 ; p=0.059) and all - cause mortality (18.3% versus 3.3%, respectively ; or : 6.564 ; p=0.013) at hospital discharge were observed in the matched linezolid treatment group. with further adjusting for the unbalanced baseline characteristics between the two matched treatment groups, the risk difference of treatment failure rate associated with the two antibiotics was further reduced (or : 1.139 ; 95% ci : 0.8871.461 ; p=0.308). the risk differences of pneumonia - related mortality and all - cause mortality at hospital discharge were also reduced and the lower risk of all - cause mortality associated with vancomycin was approaching statistical significance (or : 0.186 ; 95% ci : 0.0331.039 ; p=0.055) (figure 3). the median total hospital costs associated with the study cohort exceeded rmb 85,033 (or usd 13,471), the gross domestic product per capita in shanghai in 2012.13 directly comparing the allocation of hospital costs in the matched patients indicated that vancomycin was associated with significantly lower median drug acquisition cost (rmb 2,880 versus rmb 8,194, respectively ; median difference : rmb 5,314 ; p<0.001 ; 1 rmb = 0.16 usd), medical examinations (rmb 3,059 versus rmb 3,807, respectively ; median difference : rmb 748 ; p=0.042), and other unclassified care (rmb 27,686 versus rmb 44,826, respectively ; median difference : rmb 17,141 ; p=0.006) when compared to linezolid (table 3). however, this study only observed a strong but nonsignificant trend indicating lower median total hospital costs associated with vancomycin in the comparison with linezolid (rmb 113,160 versus rmb 133,825, respectively ; median difference : rmb 20,665 ; p=0.076). after further adjustment of unbalanced baseline characteristics between the two matched treatment groups, vancomycin was associated with significantly lower common logarithm of acquisition cost (coefficient : 0.826 ; 95% ci : 1.088 to 0.564 ; p<0.001) but similar common logarithm of hospital costs for other medications (coefficient : 0.072 ; 95% ci : 0.2600.404 ; p=0.671), medical examinations (coefficient : 0.061 ; 95% ci : 0.3480.227 ; p=0.679), medical supplies (coefficient : 0.102 ; 95% ci : 0.5520.348 ; p=0.657), and other unclassified care (coefficient : 0.101 ; 95% ci : 0.3810.178 ; p=0.478) when compared to linezolid. to the authors knowledge, this is the first real - world study describing the clinical characteristics and management associated with a large cohort of patients with difficult hap in a chinese tertiary care hospital. this study confirmed that the causative pathogen was not routinely identified for hap in current clinical practice in the people s republic of china. however, the patients in the study cohort were treated using vancomycin or linezolid when hap did not respond to first - line antibiotic treatment. although the initial search identified approximately 4,000 eligible hospital episodes, highly varied hospital admission diagnoses and the relatively small number of patients receiving linezolid substantially reduced the sample size of the study cohort used in the data analyses. after adjusting for possible confounding effects with propensity score methods and conventional regression methods, the two antibiotics were found to have comparable clinical responses at the end of treatment. however, the in - hospital mortality rate associated with linezolid was five times higher than that for vancomycin in the study cohort. even though vancomycin was associated with significantly lower acquisition costs and the higher in - hospital mortality associated with the linezolid group increased utilization of health resources,14 the longer length of hospital stay associated with vancomycin treatment likely led to more consumption of health resources and reduced total hospital cost saving in patients receiving vancomycin for their hap. identification of the causative pathogen for hap was not routinely conducted in the study cohort as only five of the 681 included patients had laboratory records for bacterial culture testing. thus, the treatment with vancomycin and linezolid was largely empirical. when compared with published randomized trials comparing vancomycin versus linezolid for hap caused by gram - positive organisms15 or mrsa,16 the current study observed that the clinical cure rates associated with the two antibiotics were almost reduced by half. because gram - negative organisms are the predominant causative pathogens for hap in chinese tertiary hospitals,10 it was suspected that mrsa was not the main pathogen associated with hap in the current study cohort, and the clinical responses associated with the two antibiotics were substantially diminished as a result. in addition, linezolid was reported to increase mortality when compared to vancomycin, oxacillin, or dicloxacillin when used for the treatment of patients infected with gram - negative bacteria alone or in patients infected with both gram - positive and gram - negative bacteria.17 it was suspected that the high risk of gram - negative infection in the current study cohort was a factor that increased the in - hospital mortality associated with treatment with linezolid. the possible high risk of hap caused by gram - negative bacteria in the study cohort also explained why the previously reported superiority of linezolid in clinical response was not observed.18 according to the latest randomized trial comparing linezolid and vancomycin in patients with hap caused by mrsa, the clinical cure rate associated with linezolid was only increased by 11%.13 such small increase on clinical response could be easily diluted if half of the study cohort were infected by gram - negative bacteria. health care resource utilization associated with this study cohort was considerable, with the median total hospitalization costs associated with the two antibiotics exceeding the local gross domestic product per capita. this study did not differentiate between hospital costs attributable to medical care related to hap and other causes ; however, it did demonstrate that the lower acquisition cost of vancomycin likely led to the observed nonsignificant trend showing lower total hospital cost associated with vancomycin. it is also suspected that the lower in - hospital mortality associated with vancomycin likely extended the hospital stay length, which likely increased hospital resources utilization19 and neutralized the saved acquisition costs associated with vancomycin and reduced the likelihood of observing significant difference in total hospital costs between the two antibiotics. it confirmed that hap causative pathogens were not routinely assessed for after the initial empirical use of antibiotics in chinese tertiary care hospitals. because mrsa is unlikely to be the predominant causative pathogen for hap in chinese tertiary care hospitals, current empirical treatment strategy without guidance by identified hap causative pathogens unlikely optimizes health outcomes but may cause harm and unnecessary usage of health care resources associated with the misuse of antibiotics. in addition, the increased mortality associated with the empirical use of linezolid for difficult cases of hap further addressed the need for hap causative pathogen assessment to avoid the treatment with linezolid in hap caused by gram - negative bacteria. finally, this study suggested that empirical use of vancomycin to treat difficult hap was cost - effective by having lower in - hospital mortality but likely costing less than linezolid. future clinical practice guidelines could use this evidence to further support the established first - line treatment with vancomycin for difficult hap.20 this retrospective cohort study had several limitations that need to be considered when interpreting the study results. although this study initially identified approximately 4,000 hospital episodes, the small number of patients receiving linezolid and strict propensity score matching dramatically reduced the sample size of patients to 60 matched pairs in the adjusted comparisons. thus, the study results were based on a highly selected study cohort with a relatively small sample size and the risk of selection bias is high. the data sources used for the study were hospital administrative databases that did not contain information on disease severity, contraindications of two antibiotics (vancomycin was not likely used in patients with renal failure21 and linezolid was not likely used in patients receiving select serotonergic agents22), or the socioeconomic status of the patient, which could substantially confound both clinical and cost outcomes. although this study used several indicators to measure clinical response assessment, approximately 10% of patients did not have a clinical response assessment due to missing information. the study did not adjust for the hospital admission year in the cost analyses. because linezolid was launched in the people s republic of china in 2007, the number of patients receiving linezolid was not likely to be similarly well distributed by hospital admission year as those receiving vancomycin, a medication that has been available and widely used in hospital practice for many years. in addition, the high currency inflation rates occurring in the people s republic of china during the study observation time period could lead to an overestimation of hospital costs associated with linezolid. this retrospective observational cohort study suggested that the empirical use of vancomycin and linezolid was associated with comparable clinical responses for hap that failed with first - line antibiotic treatment in a chinese tertiary care hospital. however, the study showed a higher in - hospital mortality rate associated with linezolid treatment, possibly due to the lack of the treatment guidance by hap causative pathogen assessment. although the acquisition cost of vancomycin was significantly lower, the longer length of hospital stay associated with vancomycin likely increased the use of health resources and discounted total hospital costs saved by vancomycin. thus, vancomycin was considered more cost - effective than linezolid by leading to lower in - hospital mortality but likely costing less for empirically treating difficult hap in chinese tertiary care hospitals where causative pathogens for hap were not routinely assessed. | aimsto evaluate clinical outcomes and allocation of hospital costs associated with empirical use of vancomycin or linezolid for hospital - acquired pneumonia (hap) in the people s republic of china.methodshospital episodes including hap treated by vancomycin or linezolid between 2008 and 2012 in a chinese tertiary care hospital were retrospectively identified from hospital administrative databases. propensity score methods created best - matched pairs for the antibiotics. the matched pairs were used for adjusted comparisons on clinical response and allocation of hospital costs. multiple regression analyses adjusting residual imbalance after matching were performed to confirm adjusted comparisons.resultssixty matched pairs were created. adjusted comparisons between vancomycin and linezolid showed similar clinical response rates (clinical cure : 30.0% versus 31.7%, respectively ; p=0.847 ; treatment failure : 55.0% versus 45.0%, respectively ; p=0.289) but a significantly lower in - hospital mortality rate for vancomycin (3.3% versus 18.3%, respectively ; p=0.013). after further adjusting for the imbalanced variables between matched treatment groups, the risks of treatment failure associated with the two antibiotics were comparable (odds ratio : 1.139 ; p=0.308) and there was a nonsignificant trend of lower risk of in - hospital mortality associated with vancomycin (odds ratio : 0.186 ; p=0.055). the total hospital costs associated with vancomycin had a nonsignificant trend of being lower, likely because of its significantly lower acquisition costs (median : rmb 2,880 versus rmb 8,194 ; p<0.001 ; 1 rmb = 0.16 usd).conclusionin tertiary care hospitals in the people s republic of china, empirical treatment of patients with hap with vancomycin had a comparable treatment failure rate but likely had a lower in - hospital mortality rate when compared with linezolid. vancomycin also costs significantly less for drug acquisition than linezolid when treating hap empirically. |
allostery plays a fundamental role in most biological processes and has been suggested to be present in nearly all proteins. one of the best - studied allosteric phenomena is the activation of a receptor, which we will denote as r, by a ligand, denoted as l. the most common model for allostery in this system is the allosteric two - state model (atsm). we can construct a thermodynamic cycle for the process of ligand - induced activation of the receptor:1we refer to this as an allosteric cycle. to describe the allostery in this system, the allosteric efficacy,, can be calculated from the cycle as2where (assuming the volume is constant), each equilibrium constant is a function of the difference in helmholtz free energy, a, for the two states:3thus,4for convenience, we will discuss the allosteric efficacy in terms of the quantity a, which we will call the thermodynamic coupling. a is symmetric at equilibrium, that is, a for receptor activation conditional on ligand binding is equivalent to the a for ligand binding conditional on activation. thus, the following two definitions of a are equivalent:5however, there is no reason to assume that the receptor activation is a two - state process. in fact, nmr experiments have revealed a multimodal activation process in the 2-adrenergic receptor (2ar), and quantitative mass spectroscopy experiments have revealed ligand - specific states in the same system. these results, along with other evidence for additional states in 2ar and other receptors, indicate that activation must be treated as either involving more than two discrete states, or even as involving a continuous conformational space.. the complex behavior of an allosteric receptor is thus unlikely to be well described by a single reaction coordinate ; instead, the large number of potential conformational states may be best described by multiple collective variables (cvs ; variables that are functions of the atomic coordinates) that are thermodynamically coupled in nontrivial ways. it is impossible to understand the molecular mechanism of ligand - induced receptor activation without explicitly considering the thermodynamic coupling between the ligand binding site and active site, so a minimal set of cvs should at least include one cv for each one of these sites. these cvs are intrinsic to the specific receptor, and their thermodynamic coupling arises from the complex network of molecular interactions that separates them spatially in the receptor s structure. this intrinsic thermodynamic coupling is of great interest, as an understanding of the nature of this coupling can be used to inform both the design of ligands that modulate function in a highly specific manner, and the design of receptors with modified allosteric properties. we have previously represented this intrinsic thermodynamic coupling using the recently developed allosteric ising model (aim), a two - state model of allostery that implicitly includes the potential energy of interaction between structural components. while the aim and other statistical mechanical models of allostery, such as the ensemble allosteric model, have allowed us to derive some analytical features of simple allosteric systems, a general method that does not rely on the two - state assumption is still needed to study the intrinsic thermodynamic coupling between structural components in real systems. here we describe such a method and illustrate its capabilities by showing how allosteric coupling in the alanine dipeptide molecule contributes to the overall shape of the / free energy surface, and by identifying the interactions that are necessary for this coupling and their contributions to the energetics. to quantify the intrinsic thermodynamic coupling between cvs, we will derive expressions analogous to the allosteric efficacy for the coupled perturbation of discrete or continuous cvs away from their equilibrium distributions. let represent the coordinates of the allosteric protein and its environment that define our system, which does not include any ligand that we consider here as external perturbations. the probability density of each microstate r is given by the boltzmann distribution,6where u(r) is the potential energy function. the numerator is the boltzmann factor denoted as7the free energy can be written as a functional of the boltzmann factor function,8we define a cv as a function x(r) of the system s coordinates that can be either continuous or discrete. for a continuous cv, the probability density function is9for a discrete cv, the probability mass function, p(x), is defined by an identical expression, but is bounded to be less than 1 everywhere. we can calculate the free energy conditional on a value of the cv as10equation 10 can be rewritten in terms of either f(x) or p(x). because we use the histogram method to estimate the probability mass function of the cvs in the application following this derivation, we will assume discrete cvs described using p(x) without loss of generality. the free energy becomes11consider a second cv, y(r), with analogous probability function and free energy definitions. a joint probability mass function for the two cvs can be written as12so that the analogous free energy conditional on values of both cvs is13 one can imagine x(r) to describe the ligand binding site and y(r) to describe the active site of the protein ; the binding of a ligand to the system then acts as an external perturbation to the distributions of these cvs. to quantify the intrinsic coupling between these cvs, we apply artificial perturbations to the equilibrium cv distributions such that one or both cvs become constrained to a given value. from the equilibrium state and these artificially perturbed states, we calculate the allosteric efficacy of the following thermodynamic cycle:14we will refer to this class of thermodynamic cycles as the thermodynamic coupling of the perturbations at position (x, y) in the cv space, a(x, y), can be calculated as15equation 15 simplifies to16this is the mathematical definition we propose for the central quantity a(x, y) that we call the thermodynamic coupling function for the cvs x(r) and y(r). in two dimensions, eq 16 defines what we call the allostery landscape (see figure 1 for an example). our calculations reveal that the allosteric coupling between and destabilizes the high free energy regions and stabilizes the l and c7ax states. (a) the alanine dipeptide molecule with the backbone dihedral angles and indicated by arrows. the molecule is partitioned in three domains as indicated by the black lines (see text for details). (b) free energy surface a(,) calculated according to eq 13, with prominent states labeled in white. in all panels, and are expressed in radians. (c) the allostery landscape representing the thermodynamic coupling between cvs and, calculated according to eq 16. (d) the normalized allosteric coupling, calculated according to eq 19. in panels c and d, greyed - out regions represent data that are not surely different from zero, based on its 95%-confidence interval estimated by bootstrapping (see methods). it should be noted that the thermodynamic coupling function has a natural normalization when the cvs are discrete. if the two cvs are maximally coupled, constraining one cv will fully constrain the other. thus, at maximum coupling,17and thus18we can then normalize (16) to this upper bound to define the normalized allosteric coupling (ac),19the ac ranges from 1 to 1 and matches the convention commonly used for positive and negative allostery ; positive values indicate that constraining one cv reduces the free energy required to constrain the other, whereas negative values indicate that constraining one cv increases the free energy required to constrain the other. in essence, the magnitude of the ac describes what fraction of the maximal allostery is contributing to the free energy of the joint state, whereas the sign of the ac describes whether that allostery is positive or negative. when applied to the biophysical information transmission process occurring in a receptor (i.e., the thermodynamic coupling between the ligand binding site and the active site), the definitions above indicate that the thermodynamic coupling function is negative if measuring the active site to be in the active state reduces the uncertainty associated with whether or not the ligand binding site is in the bound state. the two - state ligand - induced receptor activation model defined in eq 1 can be just as easily described using the thermodynamic coupling function if the collective variables x(r) and y(r) are defined to take only two discrete values (bound / unbound and on / off, respectively). in this context, the two - state allosteric efficacy in eq 4 can be calculated from an allosteric cycle composed of four allosteric perturbation cycles:20so that21thus, a large negative acycle for the allosteric coupling between activation and ligand binding indicates that when the receptor is in the active state, the uncertainty that a ligand is bound is greatly reduced, whereas when the receptor is in the inactive state, the uncertainty that a ligand is not bound is greatly reduced. the mutual information, which is often used to quantify allostery, is defined as22interestingly, a(x, y) in eq 16 is proportional to the logarithmic term in 22, which is known as the pointwise mutual information (pmi),23like the allosteric efficacy, the pmi is symmetric (i.e., the order of variables x and y does not matter). to understand the pmi from the perspective of information theory, one can consider the information gained due to the reduction in uncertainty associated with measuring a variable. this information gain by measuring x(r) to be equal to x is24however, if two variables are measured, and those variables are dependent on each other, the amount of information gained by measuring the second variable will be different from the amount that would be gained if it were measured alone. for example, if y(r) was measured to be y, the probability distribution of x(r) is now conditioned on y(r) = y, and thus the information gained by measuring x(r) becomes25the pmi is the difference in the information gain,26the mutual information is the pmi weighted by the joint probability density function. consequently, the mutual information gives a high weight to the thermodynamic coupling of perturbations of high equilibrium probability states and low weight to those of low equilibrium probability. this is important for the mechanistic interpretation of allosteric couplings that are quantified only by their mutual information, as functionally significant perturbations do not necessarily drive the protein toward a region of its intrinsic cv space that is already high probability prior to perturbation. in fact, perturbations such as ligands generally drive the system away from the unbound equilibrium (e.g., where the inactive state is preferred to the active state), so the mutual information would end up giving larger weight to less functionally relevant states. in such cases, when considering only the protein s degrees of freedom, the mutual information is not a good quantification of the intrinsic thermodynamic couplings that mediate the system s response to ligand binding. even in the simplest case of the allosteric coupling between ligand binding and activation as described in the atsm, the mutual information between ligand binding and activation will depend on the affinity of the ligand, and will go to 0 as the affinity goes to either 0 or, independent of the allosteric efficacy of the ligand. therefore, we argue that it becomes preferable instead to analyze the entire 2-dimensional thermodynamic coupling surface, a(x, y), which we call the allostery landscape, as it contains information regarding the allosteric efficacy for all possible perturbations to the distribution of those cvs. the thermodynamic coupling function is also related to the copula density function from probability theory. the copula density function of a bivariate probability distribution is27where p(x) and p(y) any multivariate distribution can be expressed as a set of marginal probability distributions and a copula that defines the dependency between them, and the entropy of the copula distribution is equivalent to the mutual information. thus, a multivariate thermodynamic coupling function behaves like a copula, defining the information transmission properties of the allosteric system. the relationship between the thermodynamic coupling function and fundamental concepts in information theory and probability theory suggest that past work in these fields may be able to be adapted for biophysical applications and provide new insights into allostery. having introduced a quantification of the allosteric coupling between two cvs with the allostery landscape, a major mechanistic question still remains. what features of the structure and energetics of a given system define the thermodynamic coupling function ? to answer this question, we derive the change in thermodynamic coupling function when a generic biasing potential energy term ubias(r) is added to the system s total potential energy function, u(r). the change in thermodynamic coupling, eq 16, at any point in the cv space can be estimated using a free energy perturbation approach, which we will refer to here as biasing to avoid confusion with perturbing that refers here to constraining the system at (x, y) in the cv space in eq 14. the change in free energy of the system when a biasing potential is added is28the change in free energy of the perturbed states can be similarly written as29thus, the biased thermodynamic coupling function is30we wish to understand the contribution to the thermodynamic coupling function of a structural feature of interest, or of a specific interaction between structural elements of the system. assuming this feature of interest is described by a specific energy term uint(r) of the total potential energy function u(r), we can use eq 30 with a biasing potential that is equal and opposite to that energy term, ubias(r) = uint(r). in the next section, we use this approach to quantify the contribution of specific interactions in the alanine dipeptide system by mapping the corresponding change in thermodynamic coupling, a(x, y) = a(x, y) consider the special case of a particular energy term of interest that is a function of a cv, z(r). this corresponds to a biasing potential of the form ubias(r) = uint(z(r)). we have found (see appendix) that this results in the following biased thermodynamic coupling functions:1.if z(r) is independent of either x(r) or y(r),2.if z(r) is conditionally independent of y(r) given x(r), or if z(r) = x(r),31the second result is interesting because in this case a(x, y) becomes a function of y only. a corresponding result is found if x(r) and y(r) are permuted. if z(r) is independent of either x(r) or y(r), if z(r) is conditionally independent of y(r) given x(r), or if z(r) = x(r),31 importantly, these findings indicate that the influence of any specific energy term on the thermodynamic coupling between two cvs can be clearly defined from the difference between the unbiased and biased thermodynamic coupling functions. the two conditions described above indicate that unbiasing by a potential energy term that mediates an allosteric coupling will have a two - dimensional effect on the thermodynamic coupling function (i.e., the second term in eq 30 is dependent on both x(r) and y(r)). we know that, owing to nonadditive effects, the free energy contributions of such coupled energy terms can not be rigorously deconvoluted. therefore, the contributions obtained by biasing the allosteric coupling function (shown in figure 2), can not be taken as a sensu stricto decomposition of a(x, y). this method nonetheless allows for the detailed analysis of the mechanism of allosteric coupling and can be applied generally across any system whose conformational ensemble can be sampled using methods such as molecular dynamics (md). contributions of specific interactions to the allosteric coupling function of the alanine dipeptide. the contribution of the specific interactions identified for each panel was calculated according to eq 30, revealing the prominent role of bonded interactions between the termini and channel. (a) contribution of the dihedral energy term corresponding to the definition of the angle (c n cc). the corresponding interaction energy as a function of and, biased free energy surface, the biased allosteric coupling function, and the associated ac are shown in figure s2. (c) contribution of the nonbonded interactions between the termini and the channel. (d) contribution of the bonded interactions involving atoms from both the termini and the channel. greyed - out regions represent data that are not surely different from zero, based on its 95%-confidence interval estimated by bootstrapping (see methods section). as we show below with the example of the alanine dipeptide in solution, md can provide the data necessary for our formalism to be implemented for specific allosteric proteins of interest. the need for this type of data in order to describe allostery is foreshadowed by the discussion accompanying weber s introduction of a multistate model of cooperativity in oligomers in 1972. he noted that a thermodynamic description of allostery based on the protein s intrinsic conformational equilibrium (referred to as tautomerization) was far more restricted in scope and less useful than a model based on its oligomerization equilibrium. characterization of tautomerizations in molecules involving as large a number of potential degrees of freedom as proteins is confined to some structural detail that happens to be observable and that it appeared unlikely than any method can furnish us with a precise determination of the tautomerization constants necessary to characterize completely the system. indeed, in order to utilize the formalism derived above, it is necessary to observe a large number of degrees of freedom simultaneously with high accuracy and precision so that a free energy landscape can be estimated. although such detail had not yet been described for proteins in 1972, the first molecular dynamics (md) simulation of a protein was published just five years later in 1977. using md simulations, we are now able to estimate the equilibrium distribution and corresponding free energy landscape of one or more cvs in many proteins, while simultaneously observing both the coordinates of all atoms in the system and their interaction energies, which is essential to the application of the formalism derived above. to illustrate the use and utility of the thermodynamic coupling function, we analyzed the allostery landscape of the alanine dipeptide in solution. the alanine dipeptide is a popular model system for testing enhanced sampling and free energy methods as the entire system can be described well by only two cvs, the and torsion angles along the bonds connecting the alanine c atom to the capped n- and c - terminus, respectively (see figure 1a). here, in analogy to larger allosteric systems, we consider that captures the state of the n - terminal domain and the state of the c - terminal domain, and we ask the question of how the n - terminal and c - terminal domains of the protein are allosterically coupled. despite the small size of the system, the irregular features of the / free energy surface (see figure 1b) indicate that these cvs are thermodynamically coupled in a nontrivial way, and thus the alanine dipeptide is an ideal model system for illustrating the power of the thermodynamic coupling function. we constructed the 2-dimensional / probability density function of alanine dipeptide in water from five independent 50 ns trajectories produced with driven adiabatic free energy dynamics (see methods). following a protocol that we previously demonstrated to yield well - converged free energy surfaces up to 40 kj / mol above the global minimum, we reconstructed the free energy landscape shown in figure 1b using the reweighted histogram estimator. to investigate which features of the alanine dipeptide free energy landscape are due to thermodynamic coupling between the two angles, we used eq 16 to calculate the thermodynamic coupling function shown in figure 1c. significant allosteric couplings are evident in the regions of the left - handed -helix (known as l, which should not be confused with the symbol for allosteric efficacy) and the region labeled c7ax (shown on figure 1b, slightly lower than the c7ax conformation stabilized in the gas phase). this indicates that if is driven to the (0 to 2 rad/0 to 120) region, the transition of to the (0 to 2 rad/0 to 120) and (1 to 2 rad/60 to 180) regions becomes more favorable. in the normalized ac landscape of the alanine dipeptide, calculated according to eq 19 and shown in figure 1d, the l and c7ax, regions have couplings of around 0.4, indicating that a substantial amount of the maximal theoretically possible / allostery contributes to these state s stabilities. thus, while these regions have a relatively low probability, our analysis suggests that the allosteric coupling accounts for the small but significant populations of l and c7ax conformations that appear at equilibrium. in addition, there appears to be significant coupling present at the transition region between l and ppii, and to a lesser extent between r and c7ax, indicating that these transitions may also be facilitated by allostery. we also see significant negative allosteric coupling in the high free energy regions, which indicates that an unfavorable thermodynamic coupling between the cvs contributes to the high free energy of these regions. the mutual information, eq 22, between and is 1.11 0.01 nats (95% confidence interval from bootstrapping), or for better comparison to the thermodynamic coupling, 0.29 0.03 kj / mol at 300 k. it should be noted that these values are quite low compared to the numerous regions of high thermodynamic coupling and normalized ac (|a(x, y)| > 6 kj / mol, |ac(x, y)| > 0.3, see figure 1), and thus utilizing the mutual information alone understates the thermodynamic coupling between and. mapping the quantity summed over in eq 22 (see figure s1) shows that the major contributions to the mutual information come from very localized regions of the cv space. thus, using a single number to quantify the coupling between and misses the fact that the allostery landscape has significant regions of both negative and positive coupling. this can be important if, for example, one seeks to design a ligand that allosterically stabilizes a lower probability state. to understand which structural features contribute to the thermodynamic coupling of and, we decomposed the alanine dipeptide into three structural components, as shown in figure 1a : (i) the n - terminus, which includes all atoms on the n - terminal side of the c carbon, (ii) the c - terminus, which includes all atoms on the c - terminal side of c, and (iii) the channel, which includes c as well as the hydrogen and methyl side chain bound to it. these three structural components can mediate the / thermodynamic coupling through three different mechanisms : (i) direct nonbonded interaction of the termini (estimated with a dielectric constant = 60), (ii) indirect interaction of the termini through nonbonded interactions with the channel, and (iii) indirect interaction of the termini through bonded interaction with the channel. thus, we estimated the potential energy uint(r) contributed by each of these groups of energy terms for each frame along the trajectories and reweighted the free energy landscape with an equal and opposite biasing potential ubias(r) according to eq 28, see figures s2s4. we then calculated the contribution of uint(r) to the thermodynamic coupling landscape a(x, y) using eqs 29 and 30, as represented on figure 2 in the form of a(x, y) = a(x, y) we also biased using the negative of the potential energy term corresponding exactly to the definition of the (r) cv, that is, the c n cc dihedral angle. this reweighting resulted in one - dimensional variations of the thermodynamic coupling function along the axis, as expected from eq 31 (see figure 2a). interestingly, while chemical intuition may suggest that the direct interaction of the termini is the major mediator of the thermodynamic coupling, we find that the direct nonbonded interaction only contributes to the negative thermodynamic coupling surrounding the central forbidden region, as shown in figure 2b. the only other significant change to the thermodynamic coupling function is one - dimensional bands at 1 and 1 rad, which indicates that the interaction itself may to some extent be indirectly coupled to through its direct dependency on. figure 2d shows that the bonded interactions between the termini and the channel are the most significant contributors to both the positive and negative thermodynamic coupling between the termini, while the nonbonded interactions between the termini and the channel (figure 2c) do not significantly contribute to the thermodynamic coupling. these results suggest that and become thermodynamically coupled due to the energetics of the bonds, angles, and dihedrals composed of atoms shared between each terminus and the channel. for example, the and dihedrals each share the angle formed by three central atoms. different combinations of and frustrate this central angle to different extents, leading to a thermodynamic coupling between the two. we however note that in the alanine dipeptide system, the energy terms described above are tightly coupled with each other, as well as with other energy terms (such as the internal bonded energy of the channel). therefore, the contributions represented in figure 2 do not represent an exact decomposition of a(x, y) and must be regarded as useful cues for the qualitative understanding of how allosteric coupling can be established between two domains of a molecular system. we have derived a thermodynamic coupling function based on the allosteric efficacy that quantifies the allosteric coupling between two continuous or discrete cvs. we find that the thermodynamic coupling function is related to both the pointwise mutual information and the copula, and is best represented in the form of an allostery landscape, in units of free energy. such a representation reveals the allosteric response to all possible perturbations of the cvs. we showed that the allostery landscape of the and dihedral angles of the alanine dipeptide contains positive allosteric couplings that appear to stabilize the l and c7ax conformations, and negative allosteric couplings that coincide with the high regions of the / free energy landscape. on the basis of the formalism we developed, we were able to attribute features of this thermodynamic coupling function to specific interaction energy terms, thus allowing interpretation of the allosteric landscape. it is important to note that the criterion introduced here for determining whether a specific interaction mediates an allosteric coupling is more rigorous than our previous n - body information - based criterion. while the 3-body information between three cvs is in fact a function of biased thermodynamic coupling functions (see appendix, eq 46), if z(r) is conditionally independent of x(r) or y(r) given the other cv, the 3-body information will be maximal. consequently, the 3-body information does not permit to determine definitively whether z(r) mediates a thermodynamic coupling between x(r) and y(r), or if one of the cvs mediates a thermodynamic coupling between z(r) and the other. specifically, the 3-body information criterion will include some number of false positives (as we have previously described), whereas all structural features that correspond to a potential energy term and have a two - dimensional influence on the thermodynamic coupling function can be considered to be effective mediators of the thermodynamic coupling. the concepts developed here are very general and are applicable to larger molecular systems, provided enough sampling is available and the functionally relevant cvs are known. this second condition is especially noteworthy for cases in which a complete functional description involves multimolecular considerations. for example, to apply this method to a specific gpcr, one must first identify the cvs that best describe the agonist binding process and the g protein activation process. however, in order to understand agonist - induced activation of a g protein by a gpcr, one may need to also understand the thermodynamic coupling between the agonist binding cv and additional cvs that describe the process of g protein binding to the gpcr as well as the process of g protein activation. our new theoretical formalism and its computational implementation remains applicable despite such complications, and can serve as a powerful tool in understanding the molecular mechanisms of the many proteins in which allostery is essential to biological function. it has the potential to identify novel allosteric sites that modulate functionally important reaction coordinates, and such capabilities can help achieve a large variety of end points. examples include the design of novel therapeutic agents that allosterically modulate their specific targets in new ways, as well as the elucidation of allosteric mechanisms to guide the design of novel, synthetic allosteric proteins. the alanine dipeptide (n - acetyl - alanine - n-methyl amide) was modeled with the all - atom charmm22 force field and solvated in explicit tip3p water molecules. charmm22 was chosen as it is able to reproduce an accurate alanine dipeptide free energy landscape without utilizing the cmap term used by other force fields. we chose to avoid force fields using the cmap term as it induces a trivial thermodynamic coupling through a direct interaction between and, rather than allowing it to emerge from separate terms of the traditional potential energy function. molecular dynamics simulation were performed using the charmm port in the gromacs 4.5 program with particle - mesh ewald treatment of electrostatics and lennard - jones interactions switched off between 10 and 12. similarly to our previous study on dipeptides, enhanced sampling was achieved with driven adiabatic free energy dynamics (dafed), also known as temperature accelerated molecular dynamics (tamd), implemented in the plumed plugin. two collective variables (cvs), defined as the backbone dihedral angles and, were coupled (harmonic constant 1000 kj / mol / rad) to heavy fictitious particles (pseudomass 50 amunm / rad) held at temperature ts = 600 k by generalized gaussian moment thermostats (order 2). simulations were conducted in five independent replicates of 50 ns each after a standard equilibration phase starting with independent initial velocities. free energy surfaces (fess) in the (,) plane were reconstructed using the reweighted histogram smoothed with multivariate gaussian kernel regression in matlab (release 2015b, the mathworks, inc. a cutoff of 40 kj / mol was used for the fess, above which sampling was too poor for reliable surface estimation. in principle, estimating an observable from a dafed / tamd simulation requires binning the observable values in the cv space, and reweighting each bin by a function of the fes at this point. however, a(x, y) in eq 16 depends only on the probability mass at 300 k in the cv space, p(,). this can be derived directly from the density obtained from the dafed / tamd simulation, padb(,), by rescaling and renormalizing,32due to the surface smoothing steps, propagation of uncertainties is not practical for estimating confidence intervals on the allostery landscape instead, we use the bootstrapping approach. specifically, because observations from md time series are notoriously not independent, we use block bootstrapping ; that is, we generate artificial samples by drawing at random (with replacement) segments of trajectory of 1 ns in length. then, for each bin in the (,) plane, we estimate a 95% confidence interval for the allosteric coupling function and for the ac based on the standard deviation among the bootstrapped samples. if in a given bin this confidence interval includes the value zero, the existence of an allosteric effect can not be assessed with certainty in this bin and we represent it in a greyed - out color in panels c and d of figure 1 and in figure 2. | allostery plays a fundamental role in most biological processes. however, little theory is available to describe it outside of two - state models. here we use a statistical mechanical approach to show that the allosteric coupling between two collective variables is not a single number, but instead a two - dimensional thermodynamic coupling function that is directly related to the mutual information from information theory and the copula density function from probability theory. on this basis, we demonstrate how to quantify the contribution of specific energy terms to this thermodynamic coupling function, enabling an approximate decomposition that reveals the mechanism of allostery. we illustrate the thermodynamic coupling function and its use by showing how allosteric coupling in the alanine dipeptide molecule contributes to the overall shape of the / free energy surface, and by identifying the interactions that are necessary for this coupling. |
to integrate all available data regarding the fatty acid ethanolamide metabolism and distribution in the human body, we created a mechanistic ordinary differential equation - based model as shown in figure 2. to account for the known mutually exclusive binding of ethanolamides to faah and to enable the use of all clinical biomarker data for parameter estimation, the model included not only aea, but also oea, pea, sea, and lea. the resulting model was fit to the individual clinical data for a single oral dose of 10 mg of pf-04457845. supplementary table s1 and model s1 show the ordinary differential equations, parameters, and data sources. values were estimated from the clinical trial data with the remainder fixed, based on literature or in - house laboratory data. it was found that a good fit to the data could be achieved, provided faah - independent clearance was included in the model (figure 3). figure 3 also illustrates that removal of the faah - independent clearance from the model (for example, assuming maximal rate of the process equal to zero) resulted in both substantial changes in the shape of the time response curve and a significant increase of more than 10-fold the maximal biomarker concentration. response kinetics of faah activity in human plasma at 1 and 10 mg of pf-04457845. furthermore, this model also accurately simulated the observed human dynamics of aea, lea, pea, and oea at both 1 and 10 mg of pf-04457845 (figure 4). we used this model to simulate the brain cb1 occupancy in hypothetical patients at doses of 0.140 mg. these simulations showed that the projected occupancy saturated at ~25%, independent of the drug dose. however, increasing dose did prolong the time at peak receptor occupancy (figure 5). to obtain insight into the most influential parameters in the model, we carried out a sensitivity analysis. integrating the resulting values yielded a representation of the influence of each parameter on the cb occupancy in brain. the results are summarized in figure 6 and show that the five most influential parameters in their order of influence, respectively, were kdeg_faah (the degradation rate constant for faah), p_a (the precursor substrate concentration for nape synthesis), b_faah_brain (brain faah concentration), a - nat_a (the brain n - acyltransferase catalyzing the synthesis of the aea precursor n - arachidonoyl phosphatidylethanolamine from p_a), and kp_b (the brain partition coefficient). typically, preclinical species data are used as indicators of probable drug efficacy in patients, with arguably some successes in pain. however, the utility of animal models of pain to predict outcome in humans in general is controversial and in the case of faah inhibitors, there are reports of both clear efficacy in inflammatory pain and, conversely, no activity. in this context, we decided to use a quantitative systems pharmacology approach to exploring the likely risks for pf-04457845 before progression to patient trials. this approach has the benefit that the model produced can enable complex interactions to be accounted for, allow key assumptions to be systematically identified, and furthermore provide a tool using which these assumptions can be made explicit and easily communicated. supplementary table s1 and model s1 summarize the model, together with the equations and parameters used. due to a lack of human data, some of the parameters necessary to construct the model were drawn from a range of sources and species. hence, a key caveat is that these may not accurately represent the patient population values. nevertheless, we have shown that the current model adequately describes the observed clinical end points in our data set. from a sensitivity analysis of the data, we concluded that parameters controlling the level of faah enzyme in the brain were ranked most highly. to date, as far as we are aware, there are limited data on this in humans, and estimates of the relevant parameters in human brain would be useful to validate our model estimates. from a pharmacology perspective, the observation of the importance of brain levels of faah to cb occupancy in brain implies that optimal efficacy may be dependent on the extent of the delivery of drug to faah in the brain. hence, a hypothesis on the basis of our model results is that drugs with the maximum blood the available data suggest that pf-04457845 exhibits good blood brain barrier permeability. the substrate concentrations and enzyme involved in the synthesis of nape were also influential, consistent with the aea substrate in brain being a limiting factor. thus, our model suggests that relevant contextual data on the precursor substrate levels could be valuable to enhance our understanding. the partition coefficient for aea into lipid was also found to be very important to the prediction of cb occupancy. given this, data were generated in our laboratories to define this as accurately as possible. these data were consistent with previous estimates and confirmed the high lipophilicity of aea. although the highest ranked parameters related to aea mainly, our sensitivity analysis showed that parameters influencing other ethanolamides did also influence the outcome for cb occupancy by aea (not shown). this observation, together with our assumption that the pea, oea, lea, and pea ethanolamide substrates bind mutually exclusively to faah, would suggest that including all known substrates for faah in the model may be important for accurately describing the receptor occupancy dynamics. a key conclusion drawn from this modeling exercise was that the initial iteration of the model could not explain the plateau observed in the data and, therefore, a faah - independent clearance mechanism must exist. a literature survey revealed that there are numerous candidates for this process, including cyclooxygenases, cytochromes p450, and hydrolases, in addition to nonenzymatic routes such as renal clearance. by including an additional clearance process in the model, estimating the parameters for the clearance process from our data, and comparing these values with those in the available literature, we were able to quantitatively rank the possible mechanisms. this highlights a key benefit of the systems pharmacology approach, specifically that the additional dynamic information can be used to prioritize hypotheses. table 1 summarizes enzymes that can degrade aea and, consequently, can be considered possible candidates for role of the unknown enzyme. selection of the best candidate is based on the reasoning that the unknown enzyme should start to contribute substantially to aea degradation when faah is completely (or almost completely) inhibited with pf-04457845. this requirement yields a plateau in the clinically measured time dependences of aea following pf-04457845 administration, as observed. the reciprocal contribution of faah and the unknown enzyme to aea degradation can be interpreted in the following manner : (i) in the absence of pf-04457845, faah is the main enzyme responsible for aea degradation and the contribution of the unknown enzyme is negligible and (ii) when pf-04457845 inhibits faah, the unknown enzyme becomes the main contributor to aea degradation. one of the possible ways to meet with these requirements is to assume that the km value of the unknown enzyme with respect to aea is greater than that of faah. in this case, inhibition of faah with pf-04457845 results in an increase in aea and, as a consequence, acceleration of its degradation by the unknown enzyme. we have found km values of all enzymes with respect to aea in the literature (table 1) and have concluded that cyclooxygenase-2 and n - acylethanolamine - hydrolyzing acid amidase only have km values greater than that of faah. however, similar to aea, the time dependence of pea resulting from pf-04457845 administration also has a plateau (figure 4). this means that cyclooxygenase-2 can not be a candidate for the unknown enzyme because it can not metabolize xea with saturated fatty acid (for example, pea) and, as a result, must not contribute to pea degradation to provide a plateau hence, we concluded that the most likely faah - independent route was via the enzyme n - acylethanolamine - hydrolyzing acid amidase. this enzyme has structural and functional similarity to acid ceramidase but no homology to faah. it belongs to the choloylglycine hydrolase family and has an acidic ph optimum in contrast with faah. the organ distribution of the messenger rna in rats revealed that it is widely distributed. the development of specific inhibitors of n - acylethanolamine - hydrolyzing acid amidase, along with appropriate pharmacokinetics, will be useful to test the hypothesis that this enzyme is in part responsible for faah - independent clearance in vivo. this may be important if combinations of faah inhibitors with other drugs are required for efficacy in pain. for example, the use of r - profens in combination with faah inhibitors has recently been proposed for pain indications. our hypothesis suggests that this may not be an optimal approach, unless r - profens can significantly inhibit n - acylethanolamine - hydrolyzing acid amidase in vivo. figure 4 shows that the maximum plasma aea achieved was of the order of 10 nmol / l. the primary in vitro binding affinity for aea given that the free fraction for aea in plasma is ~0.0001, this gives a maximum free concentration of ca 1 pmol / l. according to standard free drug hypothetical assumptions around equilibrium of free drug between compartments, this yields an occupancy estimate of 0.0005%. alternatively, it could be argued that aea is subject to effects that invalidate typical free drug assumptions. in our modeling exercise, we used the following distinctions ; first, aea accesses its receptor only after partitioning to the plasma membrane and that the kd, observed can be calculated according to ligand partitioning theory and kd, obs = kd kp where kd, obs = observed kd, kd = local receptor binding affinity, and kp = partition coefficient between the aqueous and internal membrane environment ; and second, aea clearance between the plasma and brain is transporter mediated. taking into account these considerations, our simulations indicate a maximum occupancy in the region of 25%. this model does not, however, account for any localized concentrations occurring, for example, due to physical separation of aea and its clearance mechanisms, and local occupancy in excess of this value may be possible. one clear conclusion however is that 25% or higher receptor occupancy implies that imaging technology may be an option to measure occupancy and resolve these questions. a limitation of our model is that it does not include the available data on the cb agonist 2-arachidonoyl glycerol, which is thought to be mainly hydrolyzed in vivo by monoacylglycerol lipase. monoacylglycerol lipase has attracted interest as a target for pharmacological intervention for various indications including pain, and inhibitors of the enzyme have been developed. thus, an interesting next step would be to develop a model that includes 2-arachidonoyl glyceroland hence more fully reflects all of the relevant biology. this model could be used to explore questions relating to, for example, the benefits of combinations of faah and monoacylglycerol lipase inhibitors. of critical importance for drug discovery in the endocannabinoid pathway is the relationship between cb occupancy, the extent of nerve firing attenuation, and in turn the impact of this on pain. there are some data, for example, in rat brain slices, showing that aea substantially depresses glutamatergic synaptic transmission in the striatum. indeed, in part this observation has led to the hypothesis that cb1 agonists may potentially have an antinociceptive effect. however, to our knowledge, there are no quantitative data relating the reported substantial depression of synaptic transmission (i) with an analgesic effect or (ii) the level of receptor occupancy to give a specific level of synaptic transmission attenuation. hence, a key conclusion from the systems pharmacology perspective was that it is not possible at this point to draw any conclusions on the extent of receptor occupancy required to deliver sufficient decrease in nerve firing to affect nociception. in summary, this quantitative systems pharmacology based evaluation of faah as a target for pain led to the following conclusions ; firstly, although some significant and perhaps detectable cb1 occupancy could be expected by inhibiting faah in humans, the quantitative data to predict an effect in pain are lacking. secondly, the impact of faah inhibitors is limited by a faah - independent mechanism. finally, the incomplete understanding of redundancies in the biology (for example, with respect to effects of aea not only on cb1 but also on trpv1) imply the presence of risks in interpreting the steady - state outcome of perturbing this system with a drug. notably, when pf-04457845 was evaluated recently in osteoarthritis patients, it exhibited no discernible analgesic effect. taken together, these conclusions lead to the recommendations that any future progression of faah inhibitors for human disease should be accompanied by efforts to develop technologies that will enable demonstration of pharmacology at cb1, as advocated more generally by others. in addition, a better quantitative understanding of the relationship between receptor occupancy and attenuation of synaptic transmission should be developed, together with an improved knowledge of how the components of the ec system behave in humans. together, these should enable more optimal development of modulators of the ec system in the future. more generally, this example shows the benefit of a systems pharmacology approach as an adjunct to traditional approaches to developing confidence in a target preclinically, rather than focusing mainly on animal models of disease. the key added value of the systems pharmacology discipline is to highlight questions that may be critical to a positive outcome but that are obscured from a traditional drug discovery perspective due to, for example, system complexity. the mathematical representation of a model enables explicit communication of assumptions and these can be challenged with data and alternative hypotheses, in contrast with other approaches. in addition, although such models undoubtedly have uncertainties, this does not mean they are not useful because the model was created to enable an enquiry into our understanding, rather than specifically for the purpose of describing data, as has been discussed recently. furthermore, a model is not static and can be improved by integrating appropriate data. if this can be executed in a timely way, in tandem with model construction, as has been successfully used in pharmacokinetic / pharmacodynamic model development, this will provide a novel methodology to tackle attrition in drug discovery. all models were developed and analyzed using dbsolve optimum (isbspb, moscow, russia) and matlab / simbiology version 2010b, 2011b, or 2013b (matlab, natick, ma). the model comprised 39 variables and 75 reactions (for summary of model, reactions, parameters, and sources, see supplementary table s1 and model s1). four physiological compartments were introduced to model the behavior : the brain, the plasma, the remaining parts of the body, and an additional compartment representing the blood brain barrier formed by the microvascular endothelial cells. the blood brain barrier was introduced as the pathway for the clearance of xea (aea, oea, pea, and lea) between the brain and the plasma. clearance of ethanolamides between model compartments and tissue binding was modeled according to standard physiologically based pharmacokinetic techniques taking into account a logd value for aea of ~7.2 (critchell k, personal communication). the lipophilic properties of aea and other ethanolamides results in high - affinity binding to both human serum albumin and lipoproteins. hence, the free fraction of xea was very low and fixed at fu ~ 0.0001 (pfizer in - house data). ec production was assumed to be due to the nape - phospholipase d biosynthetic pathway. faah hydrolyzes both aea and other noncannabinoid ethanolamides and this was modeled assuming competitive inhibition at the faah active site. rate equations for these enzymes were derived in accordance with standard enzyme kinetics techniques, as given in supplementary table s1. parameters of the rate equations were identified on the basis of in vitro experimental data available in literature. using in vitro binding data from literature, aea was assumed to bind to cb1 in the brain following initial partitioning of the agonist into the plasma membrane before receptor engagement. the effective dissociation constant was proposed to be ~200 nmol / l as was reported in ref. parameters for the pharmacokinetics and irreversible inhibition of faah by pf-04457845, basal levels of anandamide synthesis, and faah activity were identified using clinical phase i trial data and assuming that steady - state faah and aea are given by the respective ratios of synthesis and degradation rates. these data include (i) pf-04457845 pharmacokinetics, (ii) faah activity, and (iii) time response in concentrations of ethanolamides, measured in blood, resulting from single administration of compound. sensitivity analysis was carried out using matlab as follows. assuming a model has a species of interest, x, and two parameters, y and z, the time - dependent sensitivities of x with respect to each parameter value are the time - dependent derivatives, where the numerator is the sensitivity output and the denominators are the sensitivity inputs. all models were developed and analyzed using dbsolve optimum (isbspb, moscow, russia) and matlab / simbiology version 2010b, 2011b, or 2013b (matlab, natick, ma). the model comprised 39 variables and 75 reactions (for summary of model, reactions, parameters, and sources, see supplementary table s1 and model s1). four physiological compartments were introduced to model the behavior : the brain, the plasma, the remaining parts of the body, and an additional compartment representing the blood brain barrier formed by the microvascular endothelial cells. the blood brain barrier was introduced as the pathway for the clearance of xea (aea, oea, pea, and lea) between the brain and the plasma. clearance of ethanolamides between model compartments and tissue binding was modeled according to standard physiologically based pharmacokinetic techniques taking into account a logd value for aea of ~7.2 (critchell k, personal communication). the lipophilic properties of aea and other ethanolamides results in high - affinity binding to both human serum albumin and lipoproteins. hence, the free fraction of xea was very low and fixed at fu ~ 0.0001 (pfizer in - house data). ec production was assumed to be due to the nape - phospholipase d biosynthetic pathway. faah hydrolyzes both aea and other noncannabinoid ethanolamides and this was modeled assuming competitive inhibition at the faah active site. rate equations for these enzymes were derived in accordance with standard enzyme kinetics techniques, as given in supplementary table s1. parameters of the rate equations were identified on the basis of in vitro experimental data available in literature. using in vitro binding data from literature, aea was assumed to bind to cb1 in the brain following initial partitioning of the agonist into the plasma membrane before receptor engagement. the effective dissociation constant was proposed to be ~200 nmol / l as was reported in ref. parameters for the pharmacokinetics and irreversible inhibition of faah by pf-04457845, basal levels of anandamide synthesis, and faah activity were identified using clinical phase i trial data and assuming that steady - state faah and aea are given by the respective ratios of synthesis and degradation rates. these data include (i) pf-04457845 pharmacokinetics, (ii) faah activity, and (iii) time response in concentrations of ethanolamides, measured in blood, resulting from single administration of compound. sensitivity analysis was carried out using matlab as follows. assuming a model has a species of interest, x, and two parameters, y and z, the time - dependent sensitivities of x with respect to each parameter value are the time - dependent derivatives, where the numerator is the sensitivity output and the denominators are the sensitivity inputs. neil benson, piet van der graaf, and gai ling li have been employees of pfizer. don nichols is an employee of pfizer. as editor - in - chief for cpt : pharmacometrics and systems pharmacology, p.h. van der g. was not involved in the review or decision process for this article. | the level of the endocannabinoid anandamide is controlled by fatty acid amide hydrolase (faah). in 2011, pf-04457845, an irreversible inhibitor of faah, was progressed to phase ii clinical trials for osteoarthritic pain. this article discusses a prospective, integrated systems pharmacology model evaluation of faah as a target for pain in humans, using physiologically based pharmacokinetic and systems biology approaches. the model integrated physiological compartments ; endocannabinoid production, degradation, and disposition data ; pf-04457845 pharmacokinetics and pharmacodynamics, and cannabinoid receptor cb1-binding kinetics. the modeling identified clear gaps in our understanding and highlighted key risks going forward, in particular relating to whether methods are in place to demonstrate target engagement and pharmacological effect. the value of this modeling exercise will be discussed in detail and in the context of the clinical phase ii data, together with recommendations to enable optimal future evaluation of faah inhibitors. |
the majority of mastocytosis appears in the childhood in which urticaria pigmentosa and mastocytoma are the most common types. some variant of diffuse cutaneous mastocytosis like pseudoxanthomatous mastocytosis or xanthelasmoid are extremely rare, especially in the adult. mastocytosis is a group of disease that characterized by increased the population of mast cells in many organs such as skin, bone marrow, liver, spleen, and lymph nodes which among the skin is the most common involved organ. the majority of mastocytosis appears in childhood and urticaria pigmentosa (up), and mastocytoma are the most common types. the most presentation in adults are red - brown macules and papules on the trunk and proximal limbs. other presentation such as telangiectasia macularis eruptive perstans and diffuse cutaneous mastocytosis (dcm) are rare in adults. the term xanthelasmoid, nodular, and pseudoxanthomatous mastocytocytosis describe all the same clinical condition with slight variations, therefore, could be considered as synonyms and have been introduced to describe the presence of yellowish papular or nodular lesion. herein, we describe an adult male with cutaneous mastocytosis showing multiple pruritic widespread skin colored to yellow ovoid papules like eruptive xanthoma. a 60-year - old male visited our outpatient clinic with a 1-year history of generalized yellowish ovoid, and skin color papular eruption located on the trunk, groin, and extremities. he first noticed pruritic papules, and 23 months later many yellow and ovoid pruritic papules emerged. medical history, family history, and social history of the patient were all negative. he denied taking any medications before admission and there was no apparent episode of any infection before the onset of the eruption. patient 's adverse drug reaction history was also negative. on skin physical examination firm, well - defined ovoid skin colored to yellow papules were seen on the distal and proximal of upper and lower extremities, trunk, groins, and abdomen [figure 1a and b ]. (a) multiple eruptive firms, ovoid, and well - defined papules on the distal and proximal of upper extremities, trunk, and the abdomen. (b) the close up of papules with the skin to yellowish color lesions were in different evolutionary stages varying in size from 2 to 5 mm. vital signs such as blood pressure, respiratory rate, and heart rate of the patient were stable, and the temperature was 36.9c. he had no other symptoms such as bone pain, weight loss, fatigue, and abdominal discomfort. diagnostic laboratory tests such as full blood cell count with differential, peripheral blood smear, renal, and liver function tests all were normal. investigations was continued by histopathological examination of the skin biopsy from one of the lesion on the trunk revealed proliferation of mast cells with ovoid and spindle nuclei with distinct cytoplasm borders around capillaries, which was compatible mastocytosis [figure 2a and b ]. based on concurrent clinical and pathological features, we diagnosed our case as xanthelasmoid mastocytosis. bone marrow biopsy was advised him, but the patient did not have any desire to do. h1 antihistamine, cetirizine 10 mg orally nightly and fexofenadine 120 mg for every morning was prescribed for pruritus control which was successful, but eruptions were persistent without any changes. treatment with phototherapy recommended to the patient but despite 1-year course, no significant improvement was seen in the lesions. proliferation of mast cells with ovoid and spindle nuclei with distinct cytoplasm borders around capillaries. there are four clinical variants for cutaneous mastocytosis : up, telangiectasia macularis eruptiva perstans, solitary mastocytoma, and dcm. it was first described in 1875 by fox with the term of xanthelasmoid mastocytosis. the exact prevalence of the xanthelasmoid mastocytosis is not clear but in a study in 1923, prevalence of 8% was estimated at that time, and in another study in 1999, 25% of children with up and mastocytoma showed a pattern of xanthelasmoid form. it is characterized with the multiple yellowish papules resembling both xanthoma and pseudoxanthomatous elasticum. until 1893, colcott collected 19 other similar cases ; although all of them were in the ranging ages of 3 days to 5 months. the similar presentation of this group of patients was a brown macules or patches or brownish - drab rounded areas, which was different from our patient. our case was remarkable because of the age of onset, the severity of the cutaneous involvement and though lesions were on the process of evolution, there were no pigmented macular lesions, as different and well defined types of lesions may coexist. based on the best of our knowledge, the acute presentation of xanthelasmoid mastocytosis has not been reported in the adult population, yet. the frequency of dcm has been reported by lange. based on gdansk center registry, they just reported one adult with dcm ; however, the onset of the cutaneous involvement was in his childhood as other reports. in another report by chraibi., a 20 years french female has been diagnosed with xanthelasmoid mastocytosis. by the way ; we can find out that the presented case is the only dcm with adult onset in men. as in our case, darier 's sign is often negative in xanthelasmoid mastocytosis. unlike macular forms the infiltration of mast cells in xanthelasmoid forms predominantly affecting the deep dermis one of the concerns about the dcm in pediatric patients is its association with systemic symptoms, such as severe diarrhea, gastrointestinal manifestations, shock, and hypotension because of the much higher concentration of mast cells. but, in our patient, no systemic symptoms were observed during the hospital stay and inpatient visits. on the other hand, since the high incidence of systemic symptoms in pediatric patients with dcm, this presentation is considered with a poor prognosis and consequently a closer long - term follow - up ; however, our patient evaluated completely without any major complications till now. so, it seems that the prognosis of adult patients might be different with pediatric patients. indeed, we should noticed that like other variant of cutaneous mastocytosis, the prognosis of this form is dependent on the age of onset and systemic involvement. in adults, avoidance of mast cell degranulation agents such as aspirin, codeine, stress, trauma, temperature changes, and certain foods is the most important component of the treatment. other treatment options include antihistamines, topical or systemic corticosteroids, mast cell stabilizer, puva therapy, and interferons. antihistamines was prescribed for pruritus control was successful, but eruptions were persistent without any changes and despite 1-year phototherapy, no significant improvement was seen in the lesions. pseudoxanthomatous mastocytocytosis is a rare variant, and our case was remarkable because of the adult age of onset and the severity of the cutaneous involvement. to the best of our knowledge, the acute presentation of xanthelasmoid mastocytosis has not been reported in the adult male population, yet. pseudoxanthomatous mastocytocytosis is a rare variant, and our case was remarkable because of the adult age of onset and the severity of the cutaneous involvement. to the best of our knowledge, the acute presentation of xanthelasmoid mastocytosis has not been reported in the adult male population, yet. pseudoxanthomatous mastocytocytosis is a rare variant, and our case was remarkable because of the adult age of onset and the severity of the cutaneous involvement. to the best of our knowledge, the acute presentation of xanthelasmoid mastocytosis has not been reported in the adult male population, yet. | xanthelasmoid or pseudoxanthomatous mastocytosis is an extremely rare variant of diffuse cutaneous mastocytosis. herein, we describe an adult male with cutaneous mastocytosis showing multiple widespread yellowish ovoid papules like eruptive xanthoma. a 60-year - old male visited our outpatient clinic with a 1-year history of generalized yellowish, ovoid, and skin color papular eruption located on the trunk, groin, extremities, with the modest pruritus. vital signs were stable, and darier 's sign was negative. no other subjective and objective signs were detected during the examination. no abnormality was detected in his diagnostic laboratory tests. skin biopsy was taken, and histopathologic examination revealed proliferation of mast cells with ovoid and spindle nuclei with distinct cytoplasm borders around the capillaries, which was compatible with mastocytosis. antihistamine was prescribed for pruritus control which was successful, but eruptions were persistent, and even 1-year phototherapy was not useful. |
consolidation refers to the idea that, following the experience of an event, the memory for that event undergoes a process of stabilization that renders the memory more resistant to brain injury or interference from similar experiences. building on the work of marr [1, 2 ], squire. suggested that a memory representation or memory trace was dependent upon both medial temporal lobe (in particular, the hippocampus proper) and neocortical structures, and that consolidation was the process by which cortical - cortical connections within the trace were strengthened until eventually the memory could be retrieved in the absence of the hippocampus. the question of whether a consolidated autobiographical memory, dependent primarily on neocortex rather than hippocampus, is qualitatively unchanged from the memory that was first encoded was not addressed explicitly in the squire. proposal. indeed, the consolidation view inherently assumed that memories over time remained a faithful record of the original event. this assumption was previously questioned by bartlett, who demonstrated that memory retrieval was a constructive process rather than a mere replay of the past. using the now famous war of the ghosts story and what he called the method of repeated reproduction, he showed that there was considerable variability in how a story was recalled over time. repeated reproduction of the story typically led to a shortened, more stereotyped version of it, with details either discarded, transformed, or added anew. bartlett 's study implied that changes in a memory after initial learning affected not only the strength, but the content of that memory as well. in recent years one version emphasizes that the role of the hippocampus in retrieval is time - limited and that the informational components of memories are represented solely in cortical regions this has become known as the standard theory of memory consolidation cf. [5, 6 ]. thus, the content of memories remains unchanged through the consolidation process. remote memories retrieved solely from neocortex (as the case in amnesic patients with hippocampal damage) should be as rich and detailed as remote memories retrieved by comparable controls with an intact hippocampus. without further hippocampal involvement, the content of consolidated memories should remain stable and consistent over time, a faithful record of the original event. the theory is supported by evidence of temporally graded retrograde amnesia and a correlation between the severity of retrograde amnesia and the severity of anterograde amnesia [712 ]. nadel and moscovitch developed an alternative theory of memory consolidation, known as the multiple trace theory (mtt). similar to the standard theory of consolidation, mtt posits that the establishment of long - term memories involves a lengthy interaction between the hippocampal region of the medial temporal lobes (mtls) and neocortical regions both adjacent to the mtl (e.g., perirhinal and parahippocampal cortices) and at a distance (e.g., prefrontal cortex). those memories that are reactivated, it is presumed, are made stronger while others are forgotten. unlike standard theory, mtt posits that the hippocampus remains an integral part of the memory trace and is thus always involved in retrieval of long - term episodic memories regardless of the age of the memory. evidence supporting this view comes from neuroimaging studies showing that retrieval of detailed episodic memories activates the hippocampus no matter how old these memories are [1418 ] and from studies showing that remote episodic memories retrieved by amnesic patients lack the detail present in remote episodic memories retrieved by an individual with an intact hippocampus. according to mtt, each time an episode is retrieved and rehearsed, a new hippocampally - dependent trace is created. retrieval, or reactivation, of a memory trace leads to reencoding, which both strengthens and changes that trace making the details of the event more accessible, either through an expansion of the original trace or creation of a new, altered trace. importantly, the altered trace may incorporate additional components of the context of retrieval, or even new information that is inadvertently (or incorrectly) generated by the act of retrieval. in this regard, mtt provides a mechanism for bartlett s notion that as memories age and consolidate, they are not just strengthened, but also may be qualitatively altered. the present study examined the effects of the passage of time and repeated reactivation, or retrieval, on remote autobiographical memories, and how medial temporal lobe and neocortical structures change in response to these two variables using functional magnetic resonance imaging (fmri). twelve middle - aged participants recalled autobiographical memories for events that occurred at least two years prior to the time of the study. one group of memories was retrieved during a single retrieval session on day 1 of the study and not again until the day of the scan, which occurred 30 days later (remote retrieval condition). another group of memories was retrieved repeatedly during multiple retrieval sessions that occurred weekly on days 1, 7, 14, 21, and 28 of the study and finally in the scanner (multiple retrieval condition). the third group of memories was retrieved during a single retrieval session on day 28 as well as in the scanner (recent retrieval condition). on day 30 while the study focused primarily on fmri patterns of activation within medial temporal lobe and other cortical regions, the design also allowed us to examine the effect of the passage of time and repeated retrieval on qualitative aspects of the retrieved memories. while neither the standard theory nor mtt makes explicit claims about the qualitative changes that occur to memories as they undergo repeated retrieval, considering the assumptions of mtt outlined earlier, we hypothesized that multiple retrievals would result in the memories becoming more accessible and more detailed over time. we further hypothesized that, contrary to standard theory, activation within the medial temporal lobe, including hippocampus proper, would be either maintained or increased as a function of multiple retrievals in comparison to the mere passage of time. twelve middle - aged participants (ages 4063 ; mean age 54.6 ; mean years of education, 16.2 ; range 1220) with no prior history of head injury, neurological disorder, or psychiatric disorder participated in this study. participants received monetary compensation for their participation. a list of typical life events, such as your wedding day or a birthday party, was used to generate memory prompting cues for the memory retrieval sessions. the list was an extended version of the one developed by levine.. participants were instructed to recall events that occurred at least two years ago and extending as far back as they could remember. they were asked to provide the approximate date of each memory to ensure that it occurred more than two years ago. they were also instructed to discuss exclusively events that occurred in a specific place and time and that happened only once. each participant was instructed to visualize the details of the event, mentally playing the event out as if it were a scene in a movie, while verbally describing all the details of the event that they could remember, including what happened, who was there, where they were, the physical details of the scene, and the time of day. following recollection of each event, participants were asked to rate the memory on several scales, including the importance of the event both at the time it occurred and currently, the emotionality of the event at the time it occurred and currently, how vividly the memory was recalled, and their overall arousal or energy level at the time of the event. ratings were made on a 15 scale, respectively, representing not at all, somewhat, moderately, very, or extremely. participants were also asked to rate how positive or negative the event was at the time that it occurred using the following scale : very negative (3), somewhat negative (1), neutral (0), somewhat positive (+ 1), and very positive (+ 3). at the end of the interview session, participants were instructed not to ruminate on any of the memories or relate the memories to friends or family until completion of the experiment. the experimenter used the information derived from the initial retrieval session to create specific cues for each memory for use in subsequent retrieval sessions, for example, in each of the retrieval sessions that followed, participants were instructed to recall all the details they could remember about the event, even if they had already mentioned them in a previous retrieval session. one interviewer conducted all the initial interview sessions and another interviewer conducted all the subsequent phone interview sessions. the memory cues were presented in a new, randomized order at each retrieval session. all sessions were tape recorded and then transcribed afterwards. in the initial interview session, participants were provided with generic event cues until they generated a list of 24 autobiographical memories as described in section 3.2. participants were asked to discuss memories that were particularly memorable and rich in detail. if only a few aspects of a memory were retrieved and no further information came to mind, the participant was asked to move on to another cue. the interviewer kept track of the number of positively and negatively rated memories to ensure that an approximately equal number of each was collected. after the interview, the 24 memories were divided into two lists of 12, with each list including approximately the same number of memories from each lifetime period (childhood, adolescence, young adulthood, and middle age), as well as roughly the same number of positive and negative events. one list was used in the remote retrieval condition and the other list was used in the multiple retrieval condition. the remote retrieval items were not retrieved again until the day of the scan (day 30) and the multiple retrieval items were retrieved during four additional weekly phone interviews scheduled throughout the month, and then finally on the day of the scan (days 7, 14, 21, 28, and 30). they were provided with the 12 specific memory cues from the multiple retrieval list derived from their memories gathered on day 1. on day 28, in addition to retrieving items from the multiple retrieval condition as described above, during the final phone session participants were interviewed exactly as they were on day 1 for 12 additional autobiographical memories. the memories met the same criteria as memories in the other two conditions, having occurred over two years ago, and including a similar number of positively and negatively valenced memories from a similar distribution of life periods. thus, memories were obtained and retrieved under three conditions, as depicted in figure 1 : remote retrieval only retrieved once, 30 days prior to the scan session ; multiple retrieval retrieved five times throughout the course of the month leading up to the scanning session ; and recent retrieval only retrieved once, 2 days prior to the scanning session. during fmri scanning, stimuli were presented using dmdx presentation software on high - resolution visuastim digital goggles (resonance technologies, inc. participants held a mouse in their right hand that was modified for use in the scanner. participants were presented with all 36 memory cues described earlier in random order. participants were instructed to press the mouse button as soon as they had read the memory cue and were aware of the memory that the cue referred to. they were instructed to recall all of the details of the memory throughout the remainder of the 12-second period, exactly as they had in each previous retrieval session. each memory cue was followed by a 4-second rest period. during this time, participants were instructed to clear their minds and wait for the next cue. following scanning, participants were asked a series of follow - up questions regarding their memories. for each memory, they were asked whether or not they had been successful in the scanner in remembering the memory that corresponded to the cue provided, and if so, if they actively retrieved the details of the event for the full 12 seconds that the cue was presented. images were collected on a general electric 3.0 tesla signa vh / i whole body echospeed scanner equipped with optimized acgd gradients. a sagittal localizer was collected first for use in aligning t1-weighted anatomical images (matrix = 256 256, tr = 500, te = 14 milliseconds, fov = 24 cm, sections = 31, 4 mm, no skip) parallel to the anteroposterior commissural plane covering the whole brain. following collection of the t1 images, functional images were acquired in a single functional scan in the same alignment as the t1 scans, using a single - shot spiral in / spiral out sequence (matrix = 64 64, fov = 24 cm, tr = 2040 milliseconds, te = 30 milliseconds, flip angle = 90, sections = 31, thickness = 4 mm, no skip). a total of 400 volumes were collected, taking approximately 14 minutes to complete. finally, a high - resolution spgr 3d anatomical volume was acquired (1.5 mm sections covering whole brain, matrix = 256 256, tr = 22 milliseconds, te = 4 milliseconds, flip angle = 30, fov = 25 cm) for coregistration of images in mni coordinate space. audio recordings of each of the five retrieval sessions were transcribed for script analysis., three types of details were identified : internal, external, and editorial. internal details referred to information that was central to the memory event itself, including the time, place, date, and names of individuals, any specifics about the location or what happened during the event. these details occurred or were present during the time frame of the event itself. for example, this was during the summer before i turned sixteen provided the timing of the event external details reflected general information not unique to the memory, or referred to events that occurred outside of the time window of the memory event, or provided a judgment about the present based on the past. for example, i had gone on train rides in the past, to the grand canyon and such, provided context for the event taking your first plane flight but did not provide specific information about the event itself. editorial details included statements made by the participant that reflected uncertainty, such as, now that i think about it, it had to have been, providing no additional information regarding the memory. two independent raters performed the script analysis on all memories, with inter - rater reliabilities above 85%. any discrepancies were discussed and adjudicated by j. campbell. for the purpose of analyses, internal and external details were added together and are referred to as total memory detail count. for each memory the total number of words spoken by the participant was obtained using the word counting function in microsoft word. in addition, three memories from each participant were selected at random for consistent analysis. essentially, the phrases used to describe each separable detail of each memory were analyzed for consistency across each retrieval session. for retrieval sessions on days 7, 14, 21, and 28, the number of details that were repeated from the previous retrieval session was measured and expressed as a proportion of the previous session details. for example, if five details were described in the initial retrieval session on day 1 and four of those details were repeated during retrieval of the same memory on day 7, the consistency score would be 4/5, or 0.80. single retrieval memories were retrieved for a second time in the scanner on day 30. as a result, behavioral data from this session are not available for analysis. analysis of functional neuroimages software (afni ;) was used to examine images for motion or other artifact. images were processed and analyzed using statistical parametric mapping 2 (spm2, wellcome department of cognitive neurology, university of glasgow, glasgow, scotland). preprocessing included realignment, normalization to a standard mni template (http://www.mrc-cru.cam.ac.uk), and smoothing using an 888 mm gaussian filter. the design was specified using a hemodynamic response function (hrf) with partial derivatives for time and dispersion. the onset for each memory trial was specified at 1 second prior to the response time for the memory cue (recall that participants pressed the mouse button when they recognized the cue and began recalling the memory) ; and duration was specified at the time from the onset (response time 1 second) to the end of the 12-second stimulus presentation period. this localized the time when the participants were actively recalling the memory and removed time from the analysis when the participant was reading the cue. other fmri studies have similarly modeled rt into the fmri design by item matching, covariate analysis, or using rt to temporally model onset of autobiographical memory elaboration [2628 ]. contrast vectors were defined for each participant, producing parameter estimates at each voxel for each contrast of interest. contrast images were then submitted to a second - order random - effects group analysis using the general linear model. regions of significant activation were identified using marsbar by combining the resulting group contrast images with either the specified anatomical masks from the marsbar toolbox or masks drawn using marsbar based on clusters of activation. the purpose of the behavioral analyses of memories within the multiple retrieval condition was to determine whether or not repeated recollection of the same event resulted in memories that were less detailed, stereotyped, or gist - like, as described by bartlett, or more detailed and accessible, as predicted by mtt. for the multiple retrieval condition only, item analysis for word count, total detail count, and editorial detail count were conducted within three separate repeated measures analyses of variance (anova) across five retrieval sessions, days 1, 7, 14, 21, and 28. because of the large variability in the length of individual memories, we conducted item analyses, with detail counts, and so forth, for each memory included as a separate datum, rather than using averages of memories across each participant. it should be noted, however, that conducting the analyses using participant averages for retrieval sessions did not change the overall pattern of results although some differences across conditions no longer reached statistical significance. results for word counts, total details, and editorial details are depicted in figure 2. generally, the length of memories as measured by both word count and number of details increased across the first three retrieval sessions (days 1, 7, 14), and then remained stable across subsequent retrievals (days 21, 28). a repeated measures anova confirmed that mean word count differed across retrieval sessions, f (4,140) = 7.46, p 2.98, p <.01, while days 728 did not differ from one another, t s < 1.62, nonsignificant. as the amount of information in the memories increased over repeated retrievals, so did the consistency of the specific details that were described. the consistency measure for the subset of 36 memories that was evaluated increased across retrieval sessions, suggesting that the story related by the participant was becoming more stereotyped or scripted. it also suggested that, while new details were being added across the early sessions, details provided in earlier sessions were maintained. table 1 shows that phrase consistency increased significantly between day 7 and day 14, t (1,35) = 2.22, p <.05, and between day 14 and day 28, t (1,35) = 2.93, p <.01, with day 21 falling midway between days 14 and 28. the overall increase in word count and total memory details observed across retrieval sessions could be attributable to multiple successive retrievals but could also be attributable to the participant becoming increasingly comfortable with the interviewer and the interview process. this may have resulted in an increased willingness to report more details about their memories generally, regardless of how many times they were retrieved previously. in order to confirm that retrieval rather than personal comfort levels with the interview process was driving the increase in details, we compared two sets of memories retrieved on day 1 (remote retrieval, multiple retrieval) with two sets of memories retrieved on day 28 (recent retrieval, multiple retrieval). we expected that the two sets of memories on day 1 should not differ from one another in detail or word count, since they were all retrieved for the first time in the same session. on day 28, if repeated retrieval was responsible for the change over time, then only details for memories in the multiple retrieval condition should increase. if interview comfort was responsible for the change, then all memories retrieved on day 28, both within the multiple retrieval condition and the newly retrieved memories in the recent retrieval condition, should increase. a two - factor repeated measures anova was conducted to examine the influence of time (day 1 versus day 28) and retrieval (single versus multiple), and indicated a significant interaction between time and retrieval for both word count and total memory details, f (1,143) = 6.43, p <.01 and f (1,143) = 4.60, p <.05, respectively. follow - up t - tests revealed significant increases between day 1 and day 28 for the multiple retrieval condition in both word count, t (1,143) = 4.05, p <.001, and total details, t (1,143) = 2.64, p <.01. on day 28, word counts and details for memories in the multiple retrieval condition were significantly higher than memories in the recent retrieval condition which were retrieved only once, t(1,143) = 2.13, p <.05 ; and t (1,143) = 2.46, p <.05, respectively. in contrast, the differences in word count and details between day 1 and day 28 for the two single retrieval conditions (remote retrieval versus recent retrieval) did not approach significance, t s < 1, nonsignificant. the results strengthen the conclusion that multiple retrieval sessions resulted in memory recollections that were longer, more detailed, and more consistent, and this increase was not due to a change in the reporting characteristics of the participant during the course of the experiment. while in the scanner, participants were asked to respond by pressing the mouse button when they had completed reading the memory cue and begun recalling the specific memory. thus, reaction times may be taken as a general indication of accessibility, or the effort required to retrieve the memory. reaction times for the three memory conditions are presented in table 2. a repeated measures anova revealed that the mean reaction times differed significantly between the three retrieval conditions f (2,128) = 7.70, p <.001. paired t - tests indicated that mean reaction times were significantly longer for remote retrieval than multiple retrieval memories, t (1,129) = 3.71, p <.001, and shorter for the multiple retrieval compared to recent retrieval memories, t (1,129) = 2.63, p <.01. the difference in reaction time between the remote retrieval and recent retrieval conditions was not significant, t<1. note that the same pattern of differences was observed when the analyses were conducted on the average reaction times per participant, one - way anova, f (1,10) = 73.76, p <.001. for the subject - level analysis, the reaction time data suggest that memories in the multiple retrieval session were the easiest to access, followed by recent retrieval memories, and then memories in the remote retrieval condition. this finding has implications for the imaging results that follow. in separate group contrasts, each memory condition was compared to rest at p <.005 uncorrected, in order to identify the general pattern of brain activation. we expected to see considerable overlap because in all three conditions participants are recalling well - established and vivid memories. figure 4 depicts the distribution of brain activation observed in each condition compared to rest. the results are consistent with previous studies of autobiographical memory retrieval, indicating activation of bilateral hippocampus, precuneus, lateral prefrontal cortex superior parietal lobules, retrosplenial cortex, and left - lateralized superior temporal gyrus. regions not commonly observed in studies of memory retrieval, including bilateral caudate nucleus, thalamus, and orbital frontal cortex, are also activated. hippocampal activation appears similar across the three conditions, with bilateral activation in the middle region, extending to more posterior regions in the left hemisphere. mean effect sizes were assessed using region of interest (roi) analyses. because of the significant overlap, a mask was made of common active voxels across the three memory conditions. the mask was then convolved with anatomical masks from marsbar in order to identify those voxels that fell within major anatomical regions showing activation, including left and right posterior parahippocampal gyrus, left and right hippocampus proper, left and right amygdala, and also bilateral caudate nucleus, superior temporal gyrus, precuneus, and superior temporal gyrus. the mean effect sizes were obtained for each region from individual datasets and were then compared directly across the three memory conditions in spss with a repeated measures anova and follow - up paired t - tests. table 3 shows the major regions of activation across the three conditions, mean effect sizes, brodmann s areas, talaraich coordinates, and contrast results for each of the regions. the results show a general pattern of greater activation for remote retrieval memories compared to recent retrieval, multiple retrieval, or both memory types within the hippocampus, parahippocampal gyrus, precuneus, and middle - frontal gyrus. no region showed greater activation for multiple retrieval compared to remote retrieval memories. one problem with interpretation of these results is that the three memory types differed in retrieval effort, as measured by rt. remote retrieval memories, which were not recalled for over a month prior to scanning, took a significantly longer amount of time to retrieve than either recent or multiple retrieval memories. this difference in rt can influence the amplitude of fmri signal, particularly since the data were modeled using reaction time to define onset time, which then determined the duration of the item as well. generally, longer item durations will result in higher amplitude signal. this issue was approached in several ways. first, a random - effects group analysis directly comparing the multiple and recent retrieval conditions was performed at p <.01, uncorrected. both conditions contained memories that had been retrieved only two days prior to the scan, so memories were matched for recency of retrieval. in addition, because the rts for the multiple retrieval condition were shortest, any increased activations observed in this condition can not be the result of increased retrieval time. we hypothesized that multiple retrievals would result in increased activation in brain regions associated with recollection, compared to memories in the recent retrieval condition that were recollected only once. table 4 shows the results for this analysis, indicating that multiple retrievals resulted in significantly greater activation in cortical, but not medial temporal, regions. increased activation was observed in frontal, parietal, thalamic, temporal, and precuneus regions. no medial temporal lobe region temporal lobe region showed differential activation between the two retrieval conditions. in addition, no region showed greater activation for recent retrieval memories compared to multiple retrieval memories, despite the longer rts for recently retrieved memories. a second analysis addressing this issue matched memories from each of the three conditions on rts. the previous analysis suggested that multiple retrievals resulted in increased activation in cortical, but not medial temporal lobe, regions. the same increases should be evident comparing multiple retrieved memories to both recently retrieved and remotely retrieved memories, while controlling for rts. one method for dealing with differences in rts would be to add the rts as covariates to the model, but this may be problematic given the relatively small number of items in each memory condition and the assumption of a linear relationship between rt and signal. instead, memories were matched across the three conditions based on rts for each individual. using the criterion of dropping fewer than 3 memories from each condition, we were successful in equating rts for 6 of the 12 participants, usually dropping either the shortest rts in the multiple retrieval condition or the longest rts in the remote retrieval condition. the matched data sets were compared directly in two separate random - effects group analyses comparing multiple retrieval with recent retrieval, and multiple retrieval with remote retrieval. a more liberal threshold (p <.05) was applied to the group contrasts in order to compensate for the loss of power due to the smaller number of participants. the mean number of memories included in each condition was also well matched. in addition, number of total details, editorial details, and word counts for the selected memories were nearly identical to the detail and word counts for the original memory sets from these participants, suggesting that our matching procedure did not result in a biased subset of memories being included for analysis. the random - effects analysis provided results that were consistent with the previous direct comparison of multiple retrieval and recent retrieval memories. several brain regions showed greater activation for multiple retrieval memories compared to both recent and remote retrieval conditions, including left superior parietal lobule, right precuneus, bilateral retrosplenial cortex, right superior temporal gyrus, and bilateral perirhinal cortex. in the opposite contrasts, no region showed greater activation for either recent or remote retrieval memories compared to the multiple retrieval condition. we again performed roi analyses for medial temporal lobe regions as described earlier, this time applied to the matched rt data. the results listed in table 7 show no significant differences in effect sizes for medial temporal lobe regions across the three memory conditions. the results are consistent with the notion that the earlier differences in activation in medial temporal lobe were driven by differentially longer item durations, particularly for the remote retrieval memories. the present study examined the influence of repeated retrievals and the passage of time on the subsequent retrieval of autobiographical memories. results suggest that multiple retrievals, but not the passage of time, have an impact on the representation of autobiographical memories, reflected in both the quality of the memories during subsequent retrieval and the pattern of regional brain activation as measured by fmri. we will first discuss the behavioral data and then the fmri results and their implications for theories of explicit memory consolidation. multiple retrievals of well - established memories resulted in three behavioral changes : increased speed of access to the memory, increased consistency in the manner in which memories were described, and a gradual increase in recalled details across repeated retrieval sessions, most prominently across the first three sessions. the increase in speed of access is probably due to the participant 's repeated exposure to the identical memory cues as well as repeated rehearsal of the processes involved in search. others have argued that the access component of memory retrieval can be separated from the reconstructive phase of recollection, where participants are actively rebuilding the story of the memory, and these two components may have different neural signatures. increased consistency of recall may reflect scripting, or the development and refinement of a narrative over multiple retrievals, that then accompanies a memory. this narrative becomes an integral part of the memory and may be an important vehicle for the additions, deletions, and distortions that can occur in autobiographical memories with time. this process is different than the changes described by bartlett where stories are condensed, schematized, and generally lose extraneous detail as they are reproduced multiple times. the third behavioral change we observed, increased recall of details due to retrieval practice, has been described by other researchers as well. of particular relevance is the literature on hypermnesia for episodic events, in which more details of an event are brought to mind across several retrieval attempts even after the individual has indicated that they can not recall any additional details. although the typical hypermnesia paradigm entails free recall of lists of words or pictures [30, 31 ], the phenomenon has also been demonstrated using autobiographical memories [32, 33 ]. repeated recall of autobiographical memories within a brief period of time (an hour) resulted in recollections that were more consistent and included more details of the original event (e.g., details of the reading of the o. j. simpson verdict approximately eight months after it was aired on television). in the present study, we also found increased detailed recollection for events over the first three retrieval sessions even though the retrieval sessions were spaced by weeks, rather than minutes. studies of remote autobiographical memory rarely have the ability to clearly address the issue of veracity ; that is, whether or not memory details produced by participants actually occurred as they are reported. the present study focuses on changes in recollection over time in response to retrieval, rather than accuracy of the recollections. studies that address the issue of accuracy most often rely on lists of words, pictures, or newly acquired short stories, at the expense of the rich, emotional detail associated with remote autobiographical memories that have been related many times and in many different contexts, perhaps throughout a lifetime. one notable exception to this is ulrich neisser s analysis of the testimony of john dean. neisser found that dean s exhaustive accounts of the intensely emotional and important events surrounding the watergate scandal occurring during the nixon administration were generally devoid of correct details, despite the fact that dean was highly confident in the accuracy of his recollections. nevertheless, neisser noted that the general information contained in dean s memories who knew what, who did what was correct, even if the event itself had been revised and reconstructed to a surprising degree, a phenomenon that he dubbed repisodic memory. the circumstances in which multiple retrievals increase accuracy (as in hypermnesia) or result in reconstructive and erroneous recollections (as may be the case with autobiographical memories) have yet to be determined. recently, marsh distinguished between the act of repeatedly retelling the story of a life event in social settings with that of repeatedly recalling information in an environment such as a psychology laboratory the former deemphasizes accuracy and leads to distortions, while the latter emphasizes accuracy and consistency. at this point the lability of memories during retrieval has been demonstrated elsewhere with very different types of memory. for example, recent work with animals suggests that the act of retrieval or even partial retrieval destabilizes the memory trace. nader. have shown that following reactivation of a memory trace, injection of a protein - synthesis inhibitor blocks reconsolidation rendering the original memory trace inaccessible. this result has been demonstrated with rats in an amygdala - dependent fear conditioning paradigm and also with appetitive, food - rewarded spatial discrimination tasks mediated by both amygdala and hippocampal regions [3739 ]. consistent with the animal work, robertson. have demonstrated that retrieval or practice of motor skills results in two independent outcomes that are quite consistent with the formulations of mtt. first, the skill memory becomes fragile and susceptible to translation, distortion, or the addition of new components. second, retrieval allows for reconsolidation of the original event, which results in further strengthening and stabilization of the skill. thus, a single long practice session of a particular skill is less beneficial than several interleaved learning trials which provided multiple opportunities for reconsolidation, reminiscent of the verbal learning paradigms of the 1960 's comparing the effects of spaced versus massed retrieval. robertson and cohen make the point that memories are not singular but include multiple components which may be strengthened differentially by practice or retrieval, and may be mediated by different brain mechanisms. for example, a rat learning a spatial maze learns the spatial layout of the maze, and also learns the response mapping to obtain the reward. in the present study, it is possible that various behavioral changes observed, such as the speed of access, increased consistency, and increased details, may be relatively independent of one another and are influenced by different variables. the fmri results provide further evidence that episodic memory representations change with repeated retrievals, but not with the passage of time. not surprisingly, all memories showed a similar distribution of activation that has been described in other studies of autobiographical memory retrieval [15, 42 ]. memories that were retrieved one month ago (remote retrieval) showed greater activation across virtually all brain regions involved in memory retrieval, including hippocampus, compared with both the recent and multiple memory conditions. interpretation of this result, however, is complicated by the fact that memories that have not been retrieved for a period of time (in the present study, one month) are more difficult to access, as measured by response times. after equating rts across all retrieval conditions, increased activation for memories in the remote condition was no longer observed ; in fact, there were no measurable differences between the remote and recent memory conditions, both sets of memories previously retrieved only on a single occasion. in contrast, compared to the single retrieval conditions, memories that had been retrieved multiple times elicited increased activation in a network of brain regions, most notably in lateral prefrontal, parietal, cingulate, superior temporal, and retrosplenial / precuneate regions, all regions that have been previously observed during memory retrieval for emotional events [15, 43 ]. in this case, increased activation was associated with decreased reaction times, and hence can not be attributed to differential effort in accessing the memories. increased cortical activation is predicted by both the standard theory of consolidation and mtt, which suggest that cortical - cortical connections will be strengthened as a memory is consolidated. however, mtt emphasizes the importance of repeated retrieval for reconsolidation rather than the mere passage of time, while standard theory does not directly address this issue. we assume that these cortical increases are related to the behavioral changes described earlier, but further research is needed to clarify how the specific behavioral changes are related to changes in fmri signal. in contrast to cortical regions described above, with the exception of an anterior bilateral region of perirhinal cortex (ba area 28), no differences in activation were observed in hippocampus proper, entorhinal cortex, parahippocampal cortex, or amygdala once memories were equated for accessibility. this does not appear to be the result of decreased power due to smaller numbers of participants, because significant activations for each condition compared to the rest control condition were still observed in medial temporal lobe structures for all three memory types, and clear differences were observed between conditions in other brain regions, including perirhinal cortex. rather, medial temporal lobe activity was maintained across repeated retrievals, neither increasing nor decreasing. it is important to note, however, that the present study emphasized remote and emotionally salient memories, with nearly two thirds of the events occurring in early childhood, adolescence, or early adulthood. these remote memories may already have reached an asymptotic level of hippocampal activation, and further increases in activity may not be detectable using fmri. the impact of multiple retrievals and the passage of time on newly formed memories may show a very different pattern of results. for example, there is ample evidence that newly formed memories are reactivated during offline processes occurring largely during sleep [4446 ], which may play a larger role during the early stages of the consolidation process. in summary, the present results demonstrate two consequences of repeated retrieval of remote, well - established autobiographical memories that are consistent with the predictions of mtt. first, repeated retrieval of memories, but not the mere passage of time, resulted in memories that were more accessible and more detailed, and ultimately lead to a consistent script or narrative that was integrated with the memory. second, repeated retrievals resulted in increased activation within neocortical regions and maintenance of activation within medial temporal lobe structures. despite the remote nature of these memories, hippocampal activation was robust and did not decrease across time or repetitions, findings that are contrary to the predictions of the standard theory of consolidation. whether or not hippocampal activation would actually increase in newer, less well - established autobiographical memories as a function of repeated retrieval and time remains to be seen. clearly, involvement of hippocampus and cortex in memory retrieval is complex, reflecting both the level of effort required to retrieve old memories and the ongoing alterations of existing representations as memories are retrieved and related. further research will be needed to disentangle the separate contributions to hippocampal and neocortical regions to the distinct processes involved in memory retrieval. | multiple trace theory (mtt) predicts that hippocampal memory traces expand and strengthen as a function of repeated memory retrievals. we tested this hypothesis utilizing fmri, comparing the effect of memory retrieval versus the mere passage of time on hippocampal activation. while undergoing fmri scanning, participants retrieved remote autobiographical memories that had been previously retrieved either one month earlier, two days earlier, or multiple times during the preceding month. behavioral analyses revealed that the number and consistency of memory details retrieved increased with multiple retrievals but not with the passage of time. while all three retrieval conditions activated a similar set of brain regions normally associated with autobiographical memory retrieval including medial temporal lobe structures, hippocampal activation did not change as a function of either multiple retrievals or the passage of time. however, activation in other brain regions, including the precuneus, lateral prefrontal cortex, parietal cortex, lateral temporal lobe, and perirhinal cortex increased after multiple retrievals, but was not influenced by the passage of time. these results have important implications for existing theories of long - term memory consolidation. |
pluripotent cells have the capacity of differentiating towards cell types from the three germinal layers of the body while holding a high replication potential. in this way, embryonic stem cells derived in the 1980s (mouse) and 1990s (human) revolutionized biomedical research, offering the possibility to produce de novo tissues that could be used to replace or regenerate diseased organs ; however, ethical concerns and host / donor immunological mismatch have contributed to the hurdles that challenge clinical applications. a paradigm shift within the field of regenerative medicine occurred in 2006 with the derivation of pluripotent cells from somatic fibroblasts by transduction with a set of four transcription factors. uniquely, this platform eliminates the need for embryonic tissue and opens a new avenue for personalized drug testing, diagnosis, and therapy [4, 5 ]. studies that followed have optimized the derivation of induced pluripotent stem (ips) cells from human somatic sources [613 ] and have refined this process to increase reprogramming efficiency [1417 ]. also, numerous protocols have been described to guide differentiation of these bioengineered pluripotent cells into diverse cell types useful for broad applications in discovery and translational science [1826 ]. notably, specialized cardiovascular lineages derived through the process of nuclear reprogramming of healthy and/or diseased somatic tissues have been applied across the continuum of biomedical applications [2730 ]. the opportunity to refine tissue - specific differentiation protocols by identifying the appropriate somatic tissue source and reprogramming strategy would accelerate the field of cardiovascular regenerative biology. based on the epigenetic and transcriptional carryover that follows reprogramming, a residual memory may be influenced by both tissue of origin and the reprogramming process [32, 33 ]. the impact of this memory will likely be dependent on the use or application of the bioengineered ips cells while understanding the determinants of residual memory may lead to targeted optimization of the reprogramming process. original studies on nuclear reprogramming by viral transduction utilized murine embryonic fibroblasts [3, 34, 35 ], a cell commonly used in stem cell biology, to bioengineer a pluripotent state from a somatic cytotype ; however, the embryonic origin of these cells raised the possibility for contamination with pluripotent progenitors rather than bona fide reprogramming. this scientific uncertainty was addressed by applying adult fibroblasts as alternative starting material to generate pluripotent stem cells. these somatic cells were also amenable to reprogramming, demonstrating that pluripotent ground state can be reset in adult - derived cells that were previously fully committed to a defined phenotype. a broad array of cell types have subsequently been used as tissue source, including other adult somatic tissues such as dermal skin [39, 40 ], liver / stomach biopsy, beta cells from the pancreas, as well as neural [43, 44 ], and hematopoietic cells. the possibility of reprogramming somatic cells derived from different starting tissues at similar efficiency rates would support a stochastic model in which reprogramming a pluripotent state was limited by time and not inherent to the starting cell type. in this way, all donor cells, regardless of their tissue origin, eventually could be reset to the pluripotent state upon continuous overexpression of stemness - related genes. this finding, in contrast to an elite model that suggests that only a specific subpopulation of progenitor cells could be completely reprogrammed, indicated that differentiation is a fully reversible process ; however, it has also been shown that distinct tissue types have various bioengineering requirements to ensure full reprogramming towards the pluripotent ground state. a case in point, stomach epithelium and hepatocytes require lower levels of reprogramming factors to achieve pluripotency, thus offering an advantage to bioengineer ectopic expression with alternative delivery strategies. despite the universal reprogramming theory that enables a wide pool of starting cell sources, comparison of reprogrammed pluripotent cells derived from distinct tissues unmasked differences in the in vivo differentiation and growth capacity. in this regard, mouse adult tail tip fibroblasts and adult hepatocytes have demonstrated the highest risk of dysregulated teratoma formation when injected into immunodeficient mice in contrast to ips cells derived from embryonic fibroblasts or stomach epithelium characterized by a lower teratogenic propensity similar to embryonic stem cells. thus, residual molecular profiles, inherent to source tissue, do apparently determine the phenotypic outcome upon in vivo transplantation into a permissive environment. in human cells, successful reprogramming has also been possible using several starting tissue sources that include, beyond dermal skin [6, 7 ], keratinocytes, adipose tissue, and peripheral blood [1013 ]. furthermore, nuclear reprogramming by transcription factor transduction has been used to obtain pluripotent cells derived from patients. ips cells have been generated from both genetic and non - inheritable diseases, including parkinson s disease, duchenne muscular dystrophy, becker s muscular dystrophy, down s syndrome, huntington s disease, myeloproliferative disorders, amyotrophic lateral sclerosis, fanconi s anemia, type 1 diabetes, spinal muscular atrophy, familial dysautonomia, leopard syndrome, and long qt syndrome. in cardiovascular applications, patient - specific ips cells have been used to identify molecular causes of disease deepening our understanding of various cardiac syndromes and demonstrating the usefulness of this platform as a translational discovery tool. in particular, long qt syndrome patient dermal fibroblasts have been reprogrammed and subsequently differentiated into cardiomyocytes that were shown to display characteristic phenotypes recapitulating molecular features of the disease. a detailed characterization and comparison with cells derived from healthy relatives led to significant discoveries regarding the molecular causes of this disease and allowed for therapeutic protective drug testing in vitro. in a similar way, molecular features of hypertrophic cardiomyopathy found in patients with leopard syndrome have also been recapitulated in vitro using ips cells coupled with cardiac differentiation protocols. therefore, ips cell technology permits patient - specific and in vitro studies not possible from other sources of primary human cells [27, 28 ]. therapeutic application of ips cells has also been tested in cardiac disease revealing the capacity to rescue morphological and functional physiological parameters in vivo in a model of acute ischemic injury to the myocardium. in fact, reprogrammed cells injected at the site of infarction show engraftment for several weeks together with physical and physiological integration within the host tissue. cells corresponding to all three cardiac lineages (cardiomyocytes, smooth muscle, and endothelium) can be derived from the injected ips cells, contributing to a reduced fibrotic scar as well as to the recovery of the functional parameters representative of cardiac performance. therefore, reprogramming somatic cells into functional pluripotent stem cells demonstrates the ability to produce cardiac regeneration from ordinary tissue sources. in addition to therapeutic studies, multiple reports have consistently demonstrated the cardiac differentiation potential of ips cells in vitro (table 1). beyond first approximation of gene expression, structural characterization and beating activity originally used as landmarks of cardiac differentiation [20, 21, 29, 55, 56 ], functional parameters such as electrophysiological characterization, force measurements, and drug regulation have emerged as a critical component defining the cardiogenic potential of ips cells [5764 ]. table 1multimodal characterization of cardiac differentiation potential of ips cellstissue sourcegene expressioniffacsultra - structurepatch clampcalcium imagingmeapharmacol responsein vivo chimerismin situ contributionref. no.mouse fibroblastmouse fibroblastmouse fibroblastmouse fibroblastmouse and human fibroblastmouse fibroblastmouse fibroblastmouse fibroblastmouse fibroblasthuman fibroblasthuman fibroblasthuman fibroblasthuman fibroblastif immunofluorescence, facs fluorescence activated cell sorting, mea multielectrode array, pharmacol pharmacological multimodal characterization of cardiac differentiation potential of ips cells if immunofluorescence, facs fluorescence activated cell sorting, mea multielectrode array, pharmacol pharmacological the application of ips technology as a tissue - specific discovery platform, diagnostic tool, or therapeutic agent highlights the importance of reproducible cardiac differentiation. notably, the original tissue in which nuclear reprogramming is performed influences the differentiation potential of the resulting ips product (fig. 1). initially, marchetto. described how neural stem cells that had been reprogrammed to fulfill pluripotency criteria (e.g., in vitro differentiation and in vivo teratoma formation) displayed incomplete suppression of neural - specific genes and partial induction of early embryonic genes. these results were confirmed by ghosh. in an extended array of human reprogrammed cells derived from fetal or newborn fibroblasts, adipose stem cells, and keratinocytes, each of them maintaining a transcriptional memory corresponding to the tissue of origin. upregulation of lineage - specific genes in the ground state predicted possible downstream effects on the differentiation capacities of the bioengineered ips lines. this observation was confirmed when mesoderm reprogrammed cells were shown to give rise to osteogenic cells more efficiently than blood - derived ips cells, thereby yielding additional hematopoietic colonies. therefore, somatic cells reprogrammed by transcription factor induction favorably differentiate along lineages related to the donor cell (fig. 1). dna methylation patterns in promoter regions and histone acetylation, both components of the epigenetic state of the cell, have been shown to correlate with the propensity of differentiation after reprogramming adding epigenetic memory as an important level of regulation in the bioengineering process [31, 32 ]. furthermore, the transcriptional fingerprint of ips cells derived from distinct origins reveals gene expression patterns characteristic of the original cell source. in an attempt to erase residual epigenetic and transcriptional memories from bioengineered pluripotent cells, according to polo. and in agreement with previous work describing reprogramming as a process that continues in vitro for several passages, continuous cell division resolves transcriptional and epigenetic differences equilibrating the differentiation capacity of ips cells derived from different tissue sources (fig. 1). in a different approach, kim. used epigenetic modifiers to homogenize differentiation capacities from ips cells with various origins (fig. 1). therefore, the residual memory of source cytotype is not permanent and epigenetic modification can provide an effective strategy to alter the differentiation capacity of reprogrammed stem cells. residual epigenetic and transcriptional memories cause bioengineered progeny to have a biased differentiation propensity, independent of acquired pluripotency as defined by sporadic three germ layer differentiation capacity. strategies that include continuous passaging or treatment with epigenetic modulators are sufficient to erase cellular memory of the somatic cell origin and ensure unbiased differentiation capacity of bioengineered ips cells strategies to standardize the differentiation capacity of reprogrammed cells. residual epigenetic and transcriptional memories cause bioengineered progeny to have a biased differentiation propensity, independent of acquired pluripotency as defined by sporadic three germ layer differentiation capacity. strategies that include continuous passaging or treatment with epigenetic modulators are sufficient to erase cellular memory of the somatic cell origin and ensure unbiased differentiation capacity of bioengineered ips cells since cells demonstrated to be pluripotent by current standards may display dissimilarities in a subsequent differentiation capacity, propensity for lineage specification may be required to accurately predict the extent of nuclear reprogramming. whether preferential differentiation capacity is an advantage or a detriment depends on the application of the derived ips cells. as for cell types difficult to obtain in vitro, the impact of residual memory may benefit subsequent derivation of differentiated tissues if ips cells are derived from related cell types. on the other hand, standardization of pluripotency will be required for basic biological applications or when a non - related tissue of origin is bioengineered in order to obtain a defined cytotype. in summary, tissue of origin may bias the differentiation potential of ips cells due to residual transcriptional and epigenetic memories that are latent in the pluripotent ground state. distilling down from an array of pluripotency - related genes, four factors were initially demonstrated to be sufficient to re - establish the ground state upon transduction in mouse somatic cells. a slightly different combination was later shown to work in human cells, with two of the factors being maintained as a core (namely sox2 and oct4) and two different transcription factors being interchangeable (either klf4 and c - myc or lin28 and nanog). with refinement of the protocols, the oncogene c - myc, was recognized to be dispensable or replaceable by another family member, low transformation capacity l - myc, limiting the oncogenicity of the derived ips cells. in an attempt to minimize the number of required factors, small molecules have been assayed for downstream effects involved in the ground state resetting process. notably, specific cell types with high intrinsic expression levels of stemness factors have been used in an attempt to simplify the reprogramming process. thus, a targeted strategy to minimize the burden of ectopic transgenes is devised by complementing the factors required for reprogramming ips cells. regardless of the specific factors used in this induction of undifferentiated phenotype, sustained expression has been shown to be necessary for a limited time, reprogrammed cells becoming independent of exogenous transgenes a few weeks following transduction. depending on the expression platform utilized to initiate nuclear reprogramming, persistent expression of stemness factors may be responsible for unintentional secondary effects. in this regard, in vitro endodermal differentiation in the presence of the reprogramming factors beyond the pluripotency induction process has been shown to be impaired when compared to reprogrammed cells from which exogenous transgenes had been excised. indeed, parental ips cells containing a polycistronic vector that encoded the four reprogramming factors showed a diminished capacity to respond to soluble growth factor differentiation cues while their transgene - free progeny responded to the same protocol upregulating key endodermal transcription factors. a similar outcome was observed for ectoderm and mesoderm tissue, in both cases revealing that differentiation was enhanced by excision of the reprogramming factors. indeed, a single factor of the bioengineering kit might have a significant effect on the differentiation capacity of ips cells. in particular, the presence of the oncogene c - myc during the reprogramming process impairs cardiac differentiation capacity in bioengineered pluripotent cells while the absence of this factor leads to reprogrammed progeny with a high cardiogenic propensity indicated by the ability to give rise to cardiomyocytes characterized by sarcomeric structures, calcium currents, spontaneous beating activity, and high cardiac gene expression. an insight into the underlying mechanism has been obtained using trichostatin a, a histone deacetylase inhibitor, which facilitated myocardial differentiation despite c - myc exposure in an ips line showing low levels of cardiac gene expression and beating activity prior to treatment. this study reinforces the importance of the epigenetic acetylation state as a component of the residual memory. considering the data shown in this report another explanation would be the repression exerted by myc on endoderm differentiation pathways that are requited for proper mesoderm differentiation. according to this study, c - myc inhibits primitive endoderm specification by repressing gata6 at the transcriptional level impacting downstream differentiation events linked to mesoderm formation. in summary, exposure and combination of exogenous transgenes used for pluripotency induction may have a direct or indirect effect on the differentiation potential of the bioengineered progeny. designing a complementary strategy to optimize the rate - limiting steps of nuclear reprogramming not only offers advantages for the overall efficiency of ips derivation but has an influence on the quality and differentiation potential of the reprogrammed cells [32, 74 ]. an example of a condition favoring bioengineering is hypoxia. decreasing oxygen levels to 5% creates an environment that provokes a complex re - arrangement of gene expression profile leading to increased induction of reprogramming in human fibroblasts. important to the epigenetic state, histone acetylation and methylation regulate the accessibility of the transcription machinery to the genetic blueprint within the parental cell. in this context, inhibition of histone deacetylase or dna - methyl transferase using epigenetic modifiers valproic acid (vpa) or 5-aza - cytidine (5-aza) has benefited the chromatin remodeling and increased the efficiency of standardized reprogramming protocols [16, 17 ]. characterization of the epigenetic state has revealed a fundamental component in determining the fate of bioengineered cells. this has led to the use of epigenetic modulators such as vpa, 5-aza, or trichostatin a to revert repressive residual epigenetic memory in order to increase the range and reproducibility of tissues derived from a reprogrammed line, homogenizing and improving differentiation potential [32, 72 ]. distilling down from an array of pluripotency - related genes, four factors were initially demonstrated to be sufficient to re - establish the ground state upon transduction in mouse somatic cells. a slightly different combination was later shown to work in human cells, with two of the factors being maintained as a core (namely sox2 and oct4) and two different transcription factors being interchangeable (either klf4 and c - myc or lin28 and nanog). with refinement of the protocols, the oncogene c - myc, was recognized to be dispensable or replaceable by another family member, low transformation capacity l - myc, limiting the oncogenicity of the derived ips cells. in an attempt to minimize the number of required factors, small molecules have been assayed for downstream effects involved in the ground state resetting process. notably, specific cell types with high intrinsic expression levels of stemness factors have been used in an attempt to simplify the reprogramming process. thus, a targeted strategy to minimize the burden of ectopic transgenes is devised by complementing the factors required for reprogramming ips cells. regardless of the specific factors used in this induction of undifferentiated phenotype, sustained expression has been shown to be necessary for a limited time, reprogrammed cells becoming independent of exogenous transgenes a few weeks following transduction. depending on the expression platform utilized to initiate nuclear reprogramming, persistent expression of stemness factors may be responsible for unintentional secondary effects. in this regard, in vitro endodermal differentiation in the presence of the reprogramming factors beyond the pluripotency induction process has been shown to be impaired when compared to reprogrammed cells from which exogenous transgenes had been excised. indeed, parental ips cells containing a polycistronic vector that encoded the four reprogramming factors showed a diminished capacity to respond to soluble growth factor differentiation cues while their transgene - free progeny responded to the same protocol upregulating key endodermal transcription factors. a similar outcome was observed for ectoderm and mesoderm tissue, in both cases revealing that differentiation was enhanced by excision of the reprogramming factors. indeed, a single factor of the bioengineering kit might have a significant effect on the differentiation capacity of ips cells. in particular, the presence of the oncogene c - myc during the reprogramming process impairs cardiac differentiation capacity in bioengineered pluripotent cells while the absence of this factor leads to reprogrammed progeny with a high cardiogenic propensity indicated by the ability to give rise to cardiomyocytes characterized by sarcomeric structures, calcium currents, spontaneous beating activity, and high cardiac gene expression. an insight into the underlying mechanism has been obtained using trichostatin a, a histone deacetylase inhibitor, which facilitated myocardial differentiation despite c - myc exposure in an ips line showing low levels of cardiac gene expression and beating activity prior to treatment. this study reinforces the importance of the epigenetic acetylation state as a component of the residual memory. considering the data shown in this report another explanation would be the repression exerted by myc on endoderm differentiation pathways that are requited for proper mesoderm differentiation. according to this study, c - myc inhibits primitive endoderm specification by repressing gata6 at the transcriptional level impacting downstream differentiation events linked to mesoderm formation. in summary, exposure and combination of exogenous transgenes used for pluripotency induction may have a direct or indirect effect on the differentiation potential of the bioengineered progeny. designing a complementary strategy to optimize the rate - limiting steps of nuclear reprogramming not only offers advantages for the overall efficiency of ips derivation but has an influence on the quality and differentiation potential of the reprogrammed cells [32, 74 ]. an example of a condition favoring bioengineering is hypoxia. decreasing oxygen levels to 5% creates an environment that provokes a complex re - arrangement of gene expression profile leading to increased induction of reprogramming in human fibroblasts. important to the epigenetic state, histone acetylation and methylation regulate the accessibility of the transcription machinery to the genetic blueprint within the parental cell. in this context, inhibition of histone deacetylase or dna - methyl transferase using epigenetic modifiers valproic acid (vpa) or 5-aza - cytidine (5-aza) has benefited the chromatin remodeling and increased the efficiency of standardized reprogramming protocols [16, 17 ]. characterization of the epigenetic state has revealed a fundamental component in determining the fate of bioengineered cells. this has led to the use of epigenetic modulators such as vpa, 5-aza, or trichostatin a to revert repressive residual epigenetic memory in order to increase the range and reproducibility of tissues derived from a reprogrammed line, homogenizing and improving differentiation potential [32, 72 ]. together, these observations lead to the hypothesis that beyond induction of the pluripotency state, the differentiation properties of the engineered cells also need to be carefully characterized and, if needed, standardized. residual memory retained from the original cell source should be considered as a possible limitation for broad differentiation profiles, although it could also be a useful feature when the tissue of interest or a closely related one is readily accessible. optimized reprogramming strategies may resolve the persistent effects due to residual transgene expression while strategies such as continuous passaging and use of epigenetic modulators may be useful to homogenize differentiation capacity despite the tissue of origin used for ips cell production. collectively, nuclear reprogramming strategies designed to achieve both functional pluripotency while promoting tissue - specific predilections will continue to accelerate the focused effort of discovery, translation, and applications for specialized fields such as cardiovascular regenerative medicine. | bioengineered by ectopic expression of stemness factors, induced pluripotent stem (ips) cells demonstrate embryonic stem cell - like properties and offer a unique platform for derivation of autologous pluripotent cells from somatic tissue sources. in the process of nuclear reprogramming, somatic tissues are converted to a pluripotent ground state, thus unlocking an unlimited potential to expand progenitor pools. molecular dissection of nuclear reprogramming suggests that a residual memory derived from the original parental source, along with the remnants of the reprogramming process itself, leads to a biased potential of the bioengineered progeny to differentiate into target tissues such as cardiac cytotypes. in this way, ips cells that fulfill pluripotency criteria may display heterogeneous profiles for lineage specification. small molecule - based strategies have been identified that modulate the epigenetic state of reprogrammed cells and are optimized to erase the residual memory and homogenize the differentiation potential of ips cells derived from distinct backgrounds. here, we describe the salient components of the reprogramming process and their effect on the downstream differentiation capacity of the ips populations in the context of cardiovascular regenerative applications. |
epithelial cells in gastrointestinal (gi) tract are continuously exposed to a lot of stressful antigens because we eat different meals 3 times a day and swallow air pollutant into gi tract. moreover, they are harassed to several kinds of gas produced by commensal bacteria colonized in gi tract. to cope with this very stressful organization and environment, gi mucosa wisely developed various strategies to tolerate stresses, such as generating antioxidant enzymes, increasing level of immune - tolerance, and regulating mechanisms to cope with stress like chaperone genes including heat shock proteins (hsps). hsps are groups of stress - response proteins which are either constitutively expressed or induced through the transcriptional action of heat shock factor (hsf). hsps are classified into four major families according to their biological activities and apparent molecular weights ; hsp90, hsp70, hsp60, and small hsps including hsp27. while hsp60, hps70, and hsp90 are constitutively expressed, hsp70 and hsp27 are induced by various conditions, including heat, oxidative stress, or drug exposure. the type of hsp induced and its level of expression can determine the fate of a cell in response to stress or stimulus, by which hsps may play a cytoprotective role in gastrointestinal tract. for instances, oral administration of geranylgeranylacetone (gga), an antiulcer drug, rapidly induced hsp70 in rat gastric mucosal cells and the induced hsps contributed to the suppression of inflammation accompanied with accelerated healing of ulcer induced by water immersion restraint stress. animal studies have consistently demonstrated that though h. pylori infection delays gastric mucosal healing by disrupting the balance in cell apoptosis and proliferation, decreasing migration of epithelial cells, and decreasing blood flow and angiogenesis within the gastric mucosa, hsps could reverse these limitation and inferiorities in mucosal healing. the general roles of hsp are intracellular cleaning of wasted product due to stress, after which are nominated as molecular chaperone, of which functions are as follows briefly : (1) assisting folding of translated proteins, (2) importing proteins into subcellular compartment, (3) disassembling oligomeric protein structures, (4) inducing proteolytic degradation of unstable proteins, (5) controlling the biological activity of folded regulatory proteins, and (6) endogenous modulation of apoptosis execution [14 ]. interestingly in contrast to these protective roles for mammalian cells, hsps could facilitate cell damage and promote carcinogenesis. moreover, increasing evidences showed that not only mammalian cells have hsps, but also bacteria such as helicobacter pylori (h. pylori) have hsps either to survive against hostile host offense system or to disrupt host defense system. therefore, this bifunctional significance of hsps as worker based on contribution to the strengthening gastric defense system or offender based on weakening gastric defense system besides of molecular mimicry prone to autoimmune in gastric diseases is one of intriguing issues in gastroenterology. here in this paper, we present double - edged roles of hsps in h. pylori or alcohol - associated gastritis, followed with the novel strategy that hsps can be a target for treatment or diagnostic biomarker for predicting the progression of gastric disease all documented with proteomic approach. brief workflow for proteomic approach will also be introduced before hsp - related research in gastric diseases. every patient, even diagnosed with same disease, has different profile of gene or protein expression, a very important starting point of view for tailored medicine. to find out the common profile of a subset of patients with same disease is one of challenging issues from late 1990s. using genomic data originated from human genome project (hgp), we could reload a powerful bullet in our hands to analyze the similarity or difference of gene expression profile of patients, after which it has not taken long to find out that there were a lot more regulation above the simple sequence of genes and their expression such as epigenetic regulation or posttranslational regulation. conclusively, proteomics approach including 2d - page and mass spectrometry is indispensible in order to understand global protein expression and modification profile. using these cutting edge techniques, we could understand the whole protein status at a glance instead of old - fashioned technique of molecular biology which would have consumed a lot more time and efforts and touched the modification of whole protein in a rather easy way [5, 6 ]. one of very useful applications of proteomics is developing clinical biomarker to predict the existence or severity of diseases. potential biomarkers would be suggested by comparing the protein profile of patients with that of normal people, after which we could verify the significance of this biomarker by analyzing large - scaled clinical study. the biologic role of this potential biomarker would be validated by conventional molecular biological technique. if the quantitative level of potential biomarker correlates well with severity of disease or progression of inflammation - carcinogenesis sequence, this marker is not only useful in clinical screening but also in studying pathogenesis of disease. therefore, proteomics research has been developed as a fancy bridge from bench to bed side, especially in understanding diseases which have inflammation - carcinogenesis sequence. before the era of omics, clinician diagnosed the patient with his / her own clinical impression based on medical history and physical examination. this basic technique of taking care of patient was the most fundamental, but very important manner to a clinician. however, as increasing level of understanding pathophysiology of diseases and as increasing capacity of clinical data, this trial - error approach or experience - based manner shows the limitation in individualization of patient care, necessitating the need of dissecting his / her biologic profiles with the technique of genomics, transcriptomics, proteomics, and metabolomics. after routine history taking and physical examination, patient samples such as bloods, tissues, or biofluids would be gathered in gastroenterology clinics and would be transferred to 3 different pipelines, comprising of single nucleotide polymorphism (snp) pipeline, transcriptomics pipeline, and proteomics pipeline. though case - control study is one example of clinical study methods using analyzing correlation between disease status and snp status, whether snp is different between patients ' and controls ' could not confirm that it affects real biologic difference because snp may not involve in transcriptional regulation. we could solve this problem to analyzing whole transcriptional regulations by microarray or protein - array methods, so - called transcriptomics. post - translational modification such as phosphorylation, glycosylation, protein folding, protein trafficking, and protein - protein interaction would be caught by proteomics pipeline. these abundant, ambiguous, and sometimes nonspecific data will be analyzed and validated by statistical significance, after which data will be compared with clinical outcomes. at last using this workflow, we could understand the important pathophysiologic mechanism of diseases, and suggest more validated strategy to individual patient due to statistical evidence (figure 1). gastric surface mucous cells are the first line of defense against insults like ingested foods, nonsteroidal anti - inflammatory drugs (nsaids), alcohol, and h. pylori infection, within which hsps are crucial for the maintenance of epithelial homeostasis during normal cell growth and for survival during and after various cellular stresses, supported with their molecular chaperone and cytoprotective actions like either protecting mitochondria or interfering with the stress - induced apoptotic programme. in order to document the contribution of hsps after h. pylori infection, first we performed two - dimensional electrophoretic analysis in order to check any shifts in hsp profiles after h. pylori infection. as results, h. pylori infection significantly attenuated the expression of hsp70 whereas exposure of cells to noncytotoxic heat shock or geranylgeranylacetone (gga), an hsp inducer, restored hsp70 expression, as well as suppressing the expression of inos, a major inflammatory mediators provoking h. pylori - induced gastric tissue damage. our results suggest that induction of hsp70 confers cytoprotection against h. pylori infection by inhibiting the expression of inos. these results provided important insights into the flux in hsps profiles in response to h. pylori infection and highlighted the cytoprotective role of hsp70 in h. pylori infection. since paradoxically h. pylori have been found to decrease expression of hsps, axsen. investigated whether this phenomenon of hsp downregulation is specific to h. pylori or not. as results, coculture of h. pylori with two gastric carcinoma cell lines reduced expression of hsp70 and, to a lesser extent, hsp60. downmodulation of hsps was not dependent on the presence of the vacuolating cytotoxin (vaca) or the cag pathogenicity island (cag pai) whereas the bacterial pathogen, s. typhimurium, upregulated hsp expression reversely. therefore, though sometimes hsps are thought to function as danger signals during microbial infection, h. pylori - induced downregulation of hsps could be a mechanism of immune evasion that promotes chronic infection. next, in order to verify these attenuations of hsp70, documented as hard worker for enhancing gastric mucosal defense, after h. pylori infection, we have compared the proteomes between h. pylori - not - associated asymptomatic stomach and h. pylori - associated chronic gastritis. very interestingly, one of significant changes was decreased hsp70 level in h. pylori - associated chronic superficial gastritis patients (figure 2(a)), similar finding as noted in the above cellular system. as mentioned above, since hsp70 proteins assist a wide range of folding processes, including the folding and assembly of newly synthesized proteins, refolding of misfolded and aggregated proteins, membrane translocation of organellar and secretory proteins, and control of the activity of regulatory proteins, hsp70 proteins have additional housekeeping functions in balancing cellular homeostasis. decreased hsp70 expression in h. pylori infection has been reported in gastric epithelial cell line and in vivo animal studies. in conclusion, hsps are finely regulated in a response to various extracellular stresses and reversely the disruption of hsps regulation might result in fatal consequence of gastric disease status. these biologic meanings significantly correlated with clinical outcome strongly suggested that hsps are hard worker for gastric defense. then, curiosity arose that how about the changes of other subfamily of hsps, for instance, hsp90 or hsp27 in h. pylori infection ? since hsp90 has been revealed to be critical for intracellular signaling that participates in inflammatory response as well as carcinogenesis, we have investigated a regulatory role of hsp 90 in h. pylori - induced il-8 production, showing that h. pylori stimulated significant phosphorylation of hsp90, but the phosphorylation was diminished by administration of hsp 90 inhibitor, geldanamycin (ga). treatment of ga completely inhibited h. pylori - induced il-8 production through the deactivation of erk1/2 and nf-b. these results subsequently lead to inactivation of ap-1 and nf-b, which are known to be major transcriptional factors of il-8. our investigation provides important insights that hsp90 is involved as a crucial regulator in the production of h. pylori - induced il-8 chemokine and hsp90 inhibitor could be potentially used for the inhibition of h. pylori - provoked inflammation. though hsps seemed to be hard worker for gastric defense, reckless induction of hsps can confront unwanted disaster, leaving the precept role of hsps, exposure of cells to microbial pathogens also induced hsps, which then modulated both innate and adaptive immune responses, led to bad offender to perpetuating gastric inflammation or inducing autoimmune gastritis. h. pylori infection induces autoantibodies that cross - react with human gastric mucosa from infected individuals. candidates for the antigens responsible for molecular mimicry causing autoreactivity include the hspb (hsp60, sometimes called hsp54) or lewis x and lewis y carbohydrate antigens. determined whether apoptosis induced in the gastric epithelium exposed to live h. pylori might occur due to either the elimination of hsp70 expression or deregulation of the heat shock response of the cell. what they have elucidated was that h. pylori infection induces autoantibodies that cross - react with human gastric mucosa from infected individuals. infection with h. pylori induces humoral immune responses against various antigens of the bacterium, among which hsps are immunodominant antigens. all of these results suggested that hsps contributed to h. pylori colonization, facilitated mucosal infection, and promoted inflammation. therefore, under the hypothesis that proteomic approach can provide the insights enable to pull out biomarkers for predicting the progression of gastritis and risk factors for gastric carcinogenesis, we have checked and compared the pulled - out proteomes from asymptomatic cases, symptomatic chronic superficial gastritis (csg), chronic atrophic gastritis (cag) accompanied with intestinal metaplasia (i m), and gastric cancer (gc). gastric inflammation is a well - known example of inflammation - carcinogenesis sequence (figure 2(b)). in an analysis, to simply focused on finding proteins whose expression sequentially increases or decreases as disease progress from h. pylori - associated asymptomatic case to gastric cancer. as results, (figure 2(c)) and mapkk (figure 2(d)) level, the mean levels of which were significantly increased as disease progress from asymptomatic, csg, cag, to gastric cancer. generally, in response to extracellular stress such as heat, oxidative stress, or anticancer agents, the small hsps and hsp70 are induced while hsp90 and hsp60 are constitutively expressed. hsp27 was reported to increase the antioxidant defense of mammalian cells by increasing the level of reduced glutathione, gsh, and decreasing reactive oxygen species (ros). by the way, in spite of these protective effects against cellular stress, increased expressions of hsp27 were also reported in a variety of cancers, for which it was reported that hsp27 induces antiapoptotic activity [4, 1719 ]. therefore, step - by - step increasing expression of hsp27 in progression of gastritis to premalignant condition cancer may be explained by either insufficient protective effect or directly harmful effect of hsp27, all of these plausible mechanisms might be associated with the progression and deepening of gastric inflammation. another other potential biomarker for these aggravations of gastritis was increase in mapkk, core signal for inflammation cascade and carcinogenesis [20, 21 ]. development of gastric mucosa associated lymphoid tissue (malt) lymphoma is thought to be closely associated with host immune reactions to h. pylori. to investigate humoral immune responses in patients with malt lymphoma to antigens shared by h. pylori and human gastric epithelial cells, kawahara. screened sera from h. pylori positive patients with malt lymphoma and other gastroduodenal diseases, all associated with h. pylori infection. immunoblotting of sera from patients with malt lymphoma often detected a band with a molecular mass corresponding to hsp60, and both elisa and immunoblotting showed elevated antibody titres to the recombinant human hsp60, leading to that conclusion that autoantibodies reactive with host gastric epithelial cells are often increased in malt lymphoma, and hsp60 is a major target antigen. therefore, immune responses induced by immunological cross reactivity between h. pylori hspb and human hsp60 in gastric epithelium may be involved in the development of malt lymphoma. finally, hsp90 is a molecular chaperone whose association is required for the stability and function of multiple mutated, chimeric, and overexpressed signaling proteins that can promote the growth and survival of cancer cells since hsp90 client proteins include mutated p53, bcr - abl, raf-1, akt, her2/neu (erbb2), and hif-1. this is why hsp90 has been identified as a critical regulator of oncogenic protein and we have also published that h. pylori infection is also associated with increased activity of these oncogenic proteins in either inflammation perpetuation or proliferative activities. among h. pylori - infected patients, 80% remains asymptomatic along life whereas 10% suffered from associated disease including peptic ulcer and gastritis and less than 1% become the victim of gastric cancer, in which divergence host genetic factor, environmental influence, and bacterial virulence are known to be intercalated (figure 3(a)). although many h. pylori virulence factors have been reported to be pathogenic, we could not discriminately acknowledge those as potential biomarker. as shown in figure 3(b), neither caga nor vaca genotype was not correlated with clinical disease in spite of critical pathogenic contribution in our documentation in spite that the presence of caga is associated with increased risk of gastric adenocarcinoma and that statistical significance exists between bacterial genotype of caga allele, vaca allele, and host disease status. lin. studied to identify gastric cancer - related antigens from h. pylori using proteomic approach and characterize their roles in the development of gastric cancer. as results, the proteins showing higher frequency of recognition in h. pylori - associated gastric cancer group are as follows : threonine synthase, rod shape - determining protein, s - adenosylmethionine synthetase, peptide chain release factor 1, dna - directed rna polymerase alpha subunit, cochaperonin groes (monomeric and dimeric forms), response regulator ompr, and membrane fusion protein. in a similar approach, lin h. pylori hsp60 enhanced migration by gastric cancer cells and promoted tube formation by umbilical vein endothelial cells and triggered the initiation of carcinogenesis by inducing proinflammatory cytokine release and by promoting angiogenesis and metastasis. we also could find that h. pylori hsp27 was increased in bacteria cultured from mucosa of malignant gastric ulcer patient compared to bacteria obtained from mucosa of benign gastric ulcer patient, suggesting that bacterial hsp27 may have roles for bacterial survival or strength to attack host gastric mucosa, explaining functional similarity of mammalian hsps (figure 3(c)). chronic alcohol consumption is highly associated with gastric and ulcer which may progress to gastric cancer. alcohol - induced gastric mucosal injury can be mediated by various cellular molecules such as cyclooxygenase (cox), lipoxygenase (lox), cytokines, and oxygen - derived free radicals [2830 ] whereas polyphenols from green tea were reported to inhibit inflammation, scavenge excess free radicals, and stimulate the regeneration of damaged cells or tissues. based on these backgrounds, we hypothesized that green tea extracts may attenuate alcohol - induced gastric injury. figure 4(a) showed that the gross and pathology of alcohol - induced gastric damage and green tea extract pretreatment dramatically reduced gastric hemorrhage and mucoid cap formation in a dose - dependent manner. with green tea extracts, cox-2, inos levels were significantly decreased accompanied with inhibition of nf-1, and mapk pathway. however, in contrary to our expectation, hsp70 level was unchanged even after green tea extract treatment (figure 4(b)), necessitating further to confirm whether attenuating effect of green tea extract in alcoholic gastritis was not relevant to hsps. to analyze the difference of protein profiles between alcohol - induced control and green tea extract pretreatment group, we performed proteomic analysis. interestingly, we found hsp60 and glucose - regulated protein 58 (grp58) levels were significantly increased in green tea extract, more apparent in the activation of these proteins as documented with acidic shift, suggesting that activation of hsps with green tea was engaged in these protections from alcoholic gastritis rather than the levels of expression (figure 4(c)). grp58 is also a member of er stress response genes, its role is mainly similar with hsps '. this inducible er chaperone may be a diligent worker for coping with alcohol - induced cellular stress. interestingly two opposite points of view regarding the role of hsps also exists in alcoholic gastritis, imposing hsp as worker or offender in alcoholic damage. studied the degree of gastric mucosal damage against 70% ethanol following gga or vehicle treatment in portal hypertensive (pht) rats because pht gastropathy has an increased susceptibility to damage due to noxious factors. ethanol - induced gastric mucosal damage was significantly decreased due to gga treatment in the pht rats, but not in the sham - operated rats, suggesting that hsp70 expression is enhanced in pht gastric mucosa and plays an important role in gastric mucosal protection. on the other hand, tominaga. showed 10% ethanol pretreatment markedly increases gastric hsp90 expression in pht rats. a major clinical problem encountered with the use of nsaids such as indomethacin is gastrointestinal complications. both nsaid - dependent cox inhibition and gastric mucosal apoptosis are involved in nsaid - produced gastric lesions, and this apoptosis is mediated by the endoplasmic reticulum stress response and resulting activation of bax. since hsps have been suggested to protect gastric mucosa from nsaid - induced lesions, we have tested the activation of hsps are engaged in protection from indomethacin induced gastropathy using proteomic approach. nsaids were closely associated with increased phosphorylation of hsp27, after which the levels of hsp27 were significantly decreased through proteasomal degradation. therefore, the way of preserving the hsp27 can be the one of efficient modalities to stomach free from nsaids damages irrespective of cox activity. among several kinds of hsps, hsp90 is a ubiquitous molecular chaperone whose association is required for stability and function of many signaling proteins. client proteins include a wide variety of signal transducing proteins that regulate cell growth and differentiation such as transcription factors, receptors, and protein kinases. recent studies show that tgf- signaling mediators including tgf- receptors, receptor - activated smads, or inhibitory smads are regulated by ubiquitin - mediated downregulation as a means to control signaling. based on these backgrounds, knuesel. demonstrated that smad3 interacts with hsp70 in vivo using a tandem affinity purification and mass spectrometry, which might be the first report indicating that smad3 is a client protein of hsp70 chaperone complex. smad3 turnover is regulated by the chip- (carboxy terminus of hsp70 interacting protein-) dependent degradation. chip is a tetratricopeptide repeat- (tpr-) containing e3 ubiquitin ligase that binds to the molecular chaperones hsc70-hsp70 and hsp90. luo. analyzed the proteomic profiling of smad - interacting proteins using mink lung epithelial cells, mv1lu cells, and showed that hsp70 is one of interacting partners of smad2 indicating that hsp70 possibly helps assemble or facilitate the formation of the complex of smad2 with its partners. tgf- type i and type ii receptors were found to interact with and be stabilized by hsp90. inhibition of hsp90 using small molecule inhibitors leads to increased receptor ubiquitination, indicating that hsp90 is a modifier of smurf2-mediated tgf- receptor ubiquitination. however, still it is not clear whether hsp90 binding to the receptors depends on and regulates the receptor kinase activity. since hsp90 functions as part of a multichaperone complex via association with a set of cochaperone proteins that influence the maturation and stability of client proteins, we have demonstrated that ga, an inhibitor of hsp90 atpase, significantly suppresses tgf- signaling. ga - mediated induction of hsp70 interacts with tgf- type i and type ii receptors and subsequently degraded tgf- receptors through a proteasome - dependent pathway. when we examined the effects of each component of hsp90 chaperone complex on tgf- signaling using specific sirnas, hsp70 played a major role in the ga - mediated inhibition of tgf- signaling. besides chaperoning function of hsps, numerous reports have shown that the endogenous or stress - induced expression of hsps, particularly hsp70, confer cellular protection against a variety of stresses and also against physiological stresses associated with growth arrest or receptor - mediated apoptosis. it has been shown that preexposure to heat shock protects tgf- induced apoptosis of cultured hepatocytes with concomitant induction of hsp70. in addition, gga attenuated tgf--induced epithelial - mesenchymal transition (emt) in renal proximal epithelial cells and enhanced expression of hsp70 using adenoviral infection prevented tgf- induced emt. recently, zhou. also demonstrated that hsp70 inhibits emt by antagonizing the activation and translocation of smad3 through domain specific interaction with smad3. to address whether suppression of hsp70 could sensitize the tgf--induced transcriptional activity and growth arrest in epithelial cell, nci - h292 cells were transfected with hsp70 sirna and examined the tgf--induced reporter activity and cell cycle analysis. as shown in figure 5, suppression of hsp70 resulted in about 2-fold increase in luciferase activity and the tgf- dependent increase in the percentage of cells accumulating in g0/g1. knockdown of hsp70 alone did not lead to increase in g0/g1 phase compared to control sirna. to confirm the physiological role of hsp70 in tgf- signaling, we did perform western blot analyses using lysates from nci - h292 cells transfected with hsp70 sirna. the level of endogenous hsp70 expression was significantly reduced that resulted in a decrease in tgf--induced downregulation of c - myc. these data suggested that endogenous hsp70 acts as a negative modulator in tgf- signaling partially independent of hsp90 activity. however, the exact molecular mechanism underlying the inhibition of tgf- signaling pathway requires further investigation. with the discovery of gastric acids and pepsins in the stomach, the questions about why does the stomach not digest itself in spite of strong lytic weapon ? and how does the stomach preserve its normal integrity under the continuous exposure to melting materials that are secreted ? had been raised. the discovery of gastric mucosal barrier or stunning defense system might be the answers to these questions. secretion into the lumen including bicarbonates, mucus, immunoglobulins, antibacterial substances including lactoferrin, and surface active phospholipids, gastric epithelia, mucosal microcirculation, mucosal immune system, and protective neuron, all these factors are known to contribute to orchestrated artwork of gastric mucosal protection. in the recent years, hsps have been implicated to be an additional factor utilized for the gastric defense mechanisms at the intracellular level. certain hsps are expressed even under nonstressful conditions and play an important role in the maintenance of normal cell integrity, but additionally hsps are generally considered to improve cellular recovery both by either refolding partially damaged functional proteins or increasing delivery of precursor proteins to important organelles such as mitochondria and endoplasmic reticulum, through which hsps might complete efficient mucosal defense mechanisms and achieve ulcer healing, most probably protecting key enzymes related to cytoprotection, conferring hsps as hard worker for stomach. on the other hand, hsps can play as immunogen, inflammation hasting, and even carcinogen, simplified as bad offender especially in h. pylori infection, provoking autoimmune gastritis, atrophy, and cancer promotion. taken together, hsps are blamed of unwanted disasters after h. pylori infection whereas are awarded by faithfulness and royalty to gastric epithelial cells under the continuous attack of h. pylori infection through the achievement of restitution, regeneration, removal of faded cells, and remodeling. bright hope for therapeutics could be feasible through the modulation of bad offender hsps and enforcement of hard worker | heat shock proteins (hsps) have core housekeeping functions in the cells where they are built - in components of folding, signal transduction pathways, and quality control functions for which they proofread the structure of proteins and repair misfolded conformers. helicobacter pylori (h. pylori) infection leads to significant inflammations in the gastric mucosa, which is closely associated with development of either precancerous lesion including chronic atrophic gastritis or gastric cancer in addition to, peptic ulcer disease, and mucosa - associated lymphoid tissue (malt) lymphoma. therefore, the association between h. pylori infection and role of hsp has been focused as an important issue because there had been rather conflicting publications showing that hsps as a good worker for defense against h. pylori infection, whereas hsps as a bad offender contributing to the progression of h. pylori - associated gastric carcinogenesis in addition to aggravation of gastric inflammation. in this paper regarding proteomic discovery of hsps related to h. pylori - associated gastric diseases, we introduce several evidences obtained from proteomic analysis dealing with friend or foe role of hsp in h. pylori infection from a cellular level to human diseases. the implication of hsps in alcoholic or nsaids - induced gastritis and the intervening of hsps in biological changes exemplified with tgf- signaling, key tumor suppressor growth factors regulating inflammation, immune function, and carcinogenesis were further introduced. |
small cell carcinoma of the prostate (scpca), also termed neuroendocrine scpca, was first described by wenk. in 1977. its incidence has been estimated at slightly less than 2% of de novo prostate cancer. small cell carcinomas usually present together with adenocarcinomas. in some cases, neuroendocrine differentiation occurs sequentially, with an initial pattern of conventional adenocarcinoma, which thereafter presents with focal neuroendocrine differentiation while in recurrence after androgen deprivation therapy. in approximately 35% of scpca cases, the clinical phenotype of scpca may be distinguishable from that of typical adenocarcinoma by the common initial presentation of rapidly symptomatic, locally advanced or metastatic disease, occurring frequently with visceral and lytic bone metastases, marked prostatic enlargement and disproportionately low or absent prostate - specific antigen (psa) levels as well as resistance to androgen ablation. these tumors are highly aggressive, with a median survival of 910 months and a 5-year survival of less than 1%. the most typical age at diagnosis is 6170 years, although an age range from 24 to 90 years has been reported. prostatic malignant neuroendocrine cells tend to produce ectopic peptides, with adrenocorticotropic hormone (acth) and calcitonin being detected most frequently in serum. approximately 10% of small cell carcinoma cases present with paraneoplastic syndromes [2, 6 ]. the most common immunohistochemical markers used to diagnose scpca are neuron - specific enolase (nse), chromogranin a (chra), synaptophysin (syn), cd56 and thyroid transcription factor-1 (ttf-1). serum acth, calcitonin, and parathyroid hormone levels may be elevated regardless of the presence of paraneoplastic syndromes. tumor markers such as carcinoembryonic antigen (cea) and cancer antigen 19 - 9 (ca 19 - 9) are also often elevated [3, 6 ]. psa is a more complicated marker of the disease. generally, in the case of adenocarcinoma, the disease burden is strongly correlated with the psa level. however, in patients with mixed tumors or pure scpca, the neuroendocrine component does not secrete psa and, therefore, does not contribute to an elevated psa level, as psa reflects the bulk and activity of the nonmalignant elements in the prostate. given the distinct pathologic and clinical features of the disease and using small cell carcinoma of the lung as a therapeutic model, the treatment for mixed or pure scpca consists mainly of a combined multidrug chemotherapy and radiation therapy to improve local control, with radical prostatectomy as an adjunctive therapy in selected cases [5, 7 ]. chemotherapy regimens have been employed with a reported response rate of 60% without any durable complete remission. we present a case of pure scpca treated with a combined chemo - radiotherapeutic approach. written informed consent was obtained from the patient for the publication of this case report and any accompanying images. moreover, we review the available literature to gain additional insight into the diagnosis, treatment, and prognosis of this disease. in may 2007, a 77-year - old man was referred to our hospital with symptoms of urinary retention and dysuria. his past medical history included cardiac insufficiency. on digital rectal examination, the serum psa level was within the normal range (1.4 ng / ml ; range : 04). he underwent an operation for phimosis, and a catheter was inserted into the urinary bladder. two weeks after the surgery, the patient was admitted to the urology clinic with macroscopic hematuria and catheter occlusion. computer tomography (ct) of the pelvis showed an enlarged prostate with protrusion into the bladder, while a chest ct showed diffuse lung emphysematous microbullae. the ca 19 - 9 level was elevated (96 ng / ml ; range : 137), while the cea level was within normal limits. microscopically, both lobes were diffusely infiltrated by small round neoplastic cells with scanty cytoplasm and a high nuclear to cytoplasmic ratio. immunohistochemically, the neoplastic cells exhibited positivity for pancytokeratin, syn, ttf-1 and cd56 (fig. the histopathological pattern as well as the presence of positive staining for neuroendocrine markers and the absence of pulmonary lesions suggestive of primary pulmonary pathology were the basis for the diagnosis of pure primary scpca. the tumor was staged as t2cn0m0 (2002 american joint committee on cancer (ajcc) staging criteria). the patient was admitted to the radiation therapy department of the university hospital of ioannina in july 2007. the prostate and the regional lymph nodes were included in the irradiation fields. a linear accelerator (6 mv) was used. the daily dose was 1.8 gy and the total dose was 63 gy. in total, 35 fractions were given. after 45 gy to the whole pelvis, a boost dose (18 gy) to the primary site was applied using the shrinkage technique. six chemotherapy cycles (carboplatin, 450 mg / auc 5) were also administered every 21 days concomitantly and consequently to radiotherapy. the patient tolerated this treatment well, without any interruption due to acute side effects. serum psa was within normal limits (0.2 ng / ml), while ca 19 - 9 remained elevated (69 ng / ml ; range : 137). the ct scan revealed an enlarged left hilum with lobular atelectasis as well as multiple nodular bilateral lung metastatic lesions. he was hospitalized because of dyspnea and died few weeks later, as his condition continued to deteriorate. scpca is rare, accounting for 0.52% of all prostatic malignancies [2, 3 ]. adenocarcinomatous elements are present concomitantly in at least half of cases, but prognosis does not appear to be affected by the presence of a non - small cell component as, after recognition of the small cell phenotype, in these cases, survival is less than 1.5 years. additionally, the small cell component may be multifocal and variably distributed through the prostate [3, 7, 9 ]. most patients with scpca are symptomatic at diagnosis in comparison with patients with prostate adenocarcinoma alone. signs and symptoms, in order of frequency, include obstructive, neurologic, and constitutional symptoms, followed by symptoms from paraneoplastic syndromes, bone pain, hydronephrosis, abdominal pain, hematochezia, and hematuria. these tumors have a propensity to metastasize distally to visceral organs, including the liver, bone, lungs, central nervous system, and pericardium, and regionally to the pelvic lymph nodes. the initial hypothesis was that scpca is derived from the neural crest line / amine precursor uptake and decarboxylase cell system, now called neuroendocrine system, a cell lineage that is different from prostatic epithelium. based on the observation that scpca sometimes coexists with adenocarcinoma, it was postulated that scpca is the product of a final dedifferentiation of the typical adenocarcinoma according to the model of divergent differentiation. coexpression of psa in neuroendocrine cells was viewed as supporting evidence for the prostatic epithelial origin of these cells. nevertheless, the cells seem to represent postmitotic cells, a fact that makes it unlikely that these cells suddenly start to proliferate and become a highly aggressive small cell carcinoma. finally, a recent theory proposes a direct origin from a multipotential prostatic epithelial stem cell for scpca, based on the lack of immunohistologic characteristics typical of the usual prostatic epithelial cell (psa expression and androgen receptor positivity) and the extremely high mib-1 labeling index clearly exceeding that of even dedifferentiated adenocarcinomas. the prostatic neuroendocrine cells have regulatory functions and are capable of producing and releasing a wide variety of secretory products like serotonin and various peptides, including the chromogranins, peptides of the calcitonin families, acth, the parathormone - related protein, thyroid - stimulating hormone - like peptides, human choriogonadotropin - like peptides, somatostatin, glucagons, cea, and the bombesin - like peptides [3, 6 ]. nse, chra, ttf-1 and syn are considered representative neuroendocrine tissue markers that are used in the pathologic diagnosis of scpca in addition to a lack of androgen receptor positivity and a lack of psa. it has also been reported that neuroendocrine scpca cells showing an aggressive phenotype exhibit intense staining of vascular endothelial growth factor (vegf). the measurement of serum neuroendocrine markers should be useful for diagnosing and monitoring the patients clinical course, as this constitutes a representative indicator and an objective measure of the neuroendocrine differentiation, reflecting not only the primary tumor cell population but also its associated metastases. nse and chra have been demonstrated as the main serum neuroendocrine markers for the clinical evaluation of scpca. additionally, it has been reported that patients who present with a low serum albumin level and a high serum ldh level at the time of initial diagnosis appear to have inferior survival. because of the rarity of pure scpca, most of our knowledge concerning its diagnosis, treatment and prognosis has been gained from a few single - institution reviews and case reports. therefore, it is impossible to draw definitive conclusions regarding the most effective treatment of this disease. the published studies assessed cases of pure scpca together with cases where scpca coexists with adenocarcinoma. the existing and mostly single - institution experience with scpca and an analysis of the pure scpca cases are summarized in table 1. the role of hormonal therapy in small cell carcinoma remains controversial. in the setting of mixed histologies, hormonal therapy (by orchiectomy, gonadotropin - releasing agonists, or antagonists with the early addition of antiandrogens) should be used according to stage and treatment regimens. for localized disease the timing (neoadjuvant or adjuvant) and duration of hormone ablation in those patients are uncertain., long - term hormonal therapy should be combined with chemotherapy [2, 7 ]. in cases of pure scpca, hormonal therapy is not recommended, as the prostatic neuroendocrine cells are deprived of androgen receptors. whether the androgen ablation therapy should be continued or not in patients with adenocarcinoma whose tumors undergo neuroendocrine transdifferentiation is a crucial matter. considering that prolonged hormonal ablation therapy may enhance the selection and progression of neuroendocrine differentiated, androgen - independent tumor cells through processes of transdifferentiation or clonal selection, in combination with the antiandrogen withdrawal effect, it is recommended that the antiandrogens are discontinued before initiation of chemotherapy. according to small cell lung carcinoma treatment experience, cisplatin and etoposide are the most commonly recommended agents. a recent phase ii trial advocated that the addition of doxorubicin to this regimen caused higher toxicity related to the patients survival outcome. cyclophosphamide, vincristine, taxanes and ifosfamide have also been added to cisplatin in various combinations [2, 13 ]. regarding irradiation, no exact guidelines for total dose and irradiation volume have been given. because of the disease propensity for local and pelvic lymph node relapse, the treatment volume should include the pelvic lymph nodes with a dose between 45 and 55 gy (daily dose 1.8 gy), followed by a boost to the prostate volume reaching in some studies a total dose of 72 gy. although in scpca locoregional treatment is secondary to systemic therapy, in cases of localized or early scpca, several studies suggest that surgical resection with or without external beam radiotherapy should be evaluated further as a treatment strategy for selected patients with nonmetastatic scpca, as it may provide better local control and a potential survival benefit when combined with systemic therapy compared with systemic therapy alone [5, 14 ]. in some cases, the diagnosis of scpca will be incidental to a coexisting adenocarcinoma upon pathological examination of a prostatectomy specimen. adjuvant chemotherapy at least 4 cycles of cisplatin and etoposide should be added to these patients, while adjuvant radiotherapy is implemented at the discretion of the treating physician, based on adverse pathologic features such as involved surgical margins and/or extracapsular extension (pt3a). radiation therapy could also have a role in the treatment of patients with scpca and metastases. its role is palliative, as it may control local symptoms such as complications of brain and bone metastases. transurethral resection of the prostate may be considered for cases with obstructive voiding symptoms that do not respond to chemotherapy and pharmacologic interventions. recently, the neuroendocrine cells became a therapeutic target, which opens additional options for patients with scpca. agents, like somatostatin analogues, neuropeptide - like serotonin and bombesin antagonists, or inflammatory cytokines, like interleukin-6, are under investigation in clinical and laboratory settings. however, trials using somatostatin analogues not only for scpca but also for hormone refractory prostate cancer with or without metastases have attained some success without major adverse effects. the expression of the angiogenic factors vegf and tgf - a in neuroendocrine scpca cells may also be used in the diagnosis, follow - up and targeting of specific molecular sites. additionally, in hormone refractory prostate cell lines, it has been found that vegf - c promotes survival of cancer cells under oxidative stress by the activation of mammalian target of rapamycin and akt a mechanism that could also potentially serve as a novel therapeutic target. scpca presents an aggressive tumor histology that is associated with a high disease - specific mortality. for patients with localized disease, a benefit of the application of local treatment modalities like radiation therapy, in combination with chemotherapy with or without hormonal therapy, seems to be acceptable. further research may lead to advances in the understanding of the neuroendocrine differentiation in prostate cancer, potential integration of treatment modalities and exploration of novel therapeutic targets that would be translated in improved clinical outcome. | primary small cell carcinoma of the prostate (scpca) is a rare pathologic entity with unique clinical features and a poor prognosis. we present a case of a patient diagnosed with pure scpca treated with a combined chemo - radiotherapeutic approach. pathological findings showed that the neoplastic cells exhibited positivity for pancytokeratin, synaptophysin, thyroid transcription factor-1 and cd56. immunostaining for prostate - specific antigen was negative, while serum prostate - specific antigen was within normal limits. we review the available literature to gain additional information about diagnosis, treatment and prognosis of pure scpca. |
congenital heart anomalies (cha) are the most common congenital anomalies and emerge with a fairly constant incidence from 0.8 to 1% per 1000 live births (1,2). given that the cha are leading cause of death among congenital anomalies, their early detection would greatly enhance the therapeutic procedures, and therefore the ultimate outcome of the disease (3). previous methods of cha screening (ultrasonography in the second trimester of pregnancy, postnatal clinical examination) had a low rate of cha detection, and a significant number of children have been released from the maternity hospital with unrecognized cha (4,5,6). this information is even more important if it is seen in the light of today s trend of earlier discharge from the maternity hospital (before 24h), when most of the cha is not manifested. according to data from previous studies, the routine clinical examination fails to diagnose more than half of the children with the cha (5). for diagnostics of cha, in addition to clinical examination, so far have been used electrocardiography and chest radiogram. although electrocardiography and radiogram does not contribute much to diagnosing heart murmur (7,8,9). ultrasonography is a unique approach in the diagnosis of cardiac anomalies, but is considered to be limiting to be used as a screening method for the detection of cha due to the cost of that service. although wrongly considered the leading sign of heart disease, a heart murmur is still in the highest percentage a reason for cardiac treatment (10). the physiological bases of these are benign causes that do not endanger the child. in organic noises in the background auscultation is performed at certain points (ictus, mesocardia, second intercostal space, right and left). the examiner assesses the intensity of the murmur. for the evaluation of the intensity of the murmur is commonly used levine harvey scale. by the same scale as the first stage murmur the murmur of the second degree is the audible also in the other phases of the respiratory cycle. the third degree will be assessed to a moderately loud murmur, with or without a thrill the sound of the fifth degree is a strong and audible over the entire precordium. the sound of the sixth degree is audible even at a distance of 1 cm from the chest wall (11,12). after determining existence of murmur, evaluated is the punctum maximum (strongest place of hearing) and the existence of propagation in the environment. whether based on auscultation there are characteristics of the murmur on the basis of which can be roughly differentiated innocent from pathological. for example, innocent murmur intensity changes with the phases of the respiratory cycle or with change of the body posture. neonates are the most sensitive categories of children and detection of cha in this age is of great importance. heart murmurs in these children may mean a serious heart defect, even some the potentially life threatening (13,14). it may also be a result of the transitional circulation of the newborn or the result of some benign structures. to determine the significance of a heart murmur detected by routine clinical examination in the neonatal and early infancy period. establish justification for cardiology consultation and ultrasound of the heart in infants with a positive auscultation finding the heart. from january 1 to december 31, 2011 on the maternity ward of cantonal hospital bihac was born 1899 babies. retrospective analysis of medical records, determined by the positive auscultatory findings at the heart of a child in 32 cases, with or without other characteristics that contribute to heart disease. the study included children who were moved to the department of neonatology with suspicion of potential life threatening heart defect, as well as children wellbeing, which, after consultation cardiac examination the patients was discharged, with subsequent ultrasound of the heart over a period of 6 weeks after birth. children were examined by ultrasound machine, aloka 2000, with multifrequency probe from 3.5 to 5 mhz. during the study period in bihac cantonal hospital was born 1899 children. of these, 32 children had positive auscultatory findings of the heart, with or without other supporting features of a heart defect. these children are subjected to cardiac treatment and echocardiography. from those, 14 children (43.75%) had a structural defect of the heart, and 18 children (56.25%) had normal or non - significant findings (figure 1). results of the ultrasonography from the total number of live births during the tested year (1899 children), murmurs was registered in 32 neonates. the percentage is 1.68% of the children. in children with positive auscultation finding cardiac evaluation five neonates had a patent foramen ovale (15, 62%), 11 children (34.37%) as a cause of murmurs had aberrant horde in the pulp chamber in left ventricle, 8 neonates had a defect of ventricle compartments (25%) of which are in two children was a perimembranous defect, while in other children it was a muscular ventricular septal defect. two children (6.25%) in the background had a serious heart defect (cyanogen anomaly) (figure 2). of the total number of live births in the studied period, in 32 cases was registered a heart murmur or 1.68%. approximately 1% of newborn children have a heart murmur and the presence of a heart defect as the cause of it, exist is a wide range of 30 to 85% of cases (15,16). in this study although other authors state variations ranging from 0.6 to 1.8%, all depending on the number of small muscular defects of descending barriers involved in the study, as well as other trivial lesions (17). in addition, among cardiologists are not harmonized criteria for differentiation of small atrial septal defect (asd) from the foramen ovale apertum (foa) (18). in this study, the defect of periventricular partition is designated the same as asd measured 6 mm and more. foa was diagnosed in 5 patients (15.62%). from the results we can see that compared to the total number of required consultations, with 14 children (43.75%) basically existed structural defect of the heart. for some of them it was very likely, on the basis of clinical examination that it is a cardiac anomaly. however, the final confirmation is mandatory echocardiography, which is in most cases the last in establishing the diagnosis of cardiac anomalies. such anomalies are not necessarily manifested by the heart murmurs as the first manifestation of heart disease. on the contrary, there is a great danger of releasing such a child from a maternity hospital with unrecognized heart disorder, because the symptoms of some serious heart defects are manifested only after 48h or more (19). between 10 - 30% of child deaths in the first year of life as a consequence of unrecognized cha (20,21). making a diagnosis in such child only after discharge from the maternity hospital has often resulted in poor general condition of the child and poor preoperative condition that is closely linked with poorer postoperative outcome and a number of complications. reference to the normal incidence of vsd s 30 - 35% compared to the total number of cha (22), we can see a larger number of vsd in our study. in addition, eight children with vsd infection, with 6 children (75%) registered a muscular vsd, although usually in 80% of cases are perimembranous vsd. for muscular defects is known that more than half of small defects prone to spontaneous closure (23). in our study we included all septal defects that are diagnosed in the period from birth to the age of 6 weeks of life. this may explain the slightly higher incidence of cha during the test period, and therefore a greater number of muscular vsd. prognosis and significance of early diagnosis in children with vsd infection depend on the location, size of the defect and the degree of ld shunt at the level of the defect. although usually not a life threatening anomaly in the first days of life, it is certainly better to diagnose these types of cardiac anomalies have in the past. as for adequate monitoring of the child and the prevention of septic endocarditis and the optimal time to plan a possible surgical treatment. it is feasible for some anomalies in later life, but it was later followed by a higher rate of mortality and postoperative complications. in addition, we should bear in mind the potential risk of developing pulmonary hypertension, when correction surgery is no longer feasible. of the 56.25% of respondents who did not have a structural defect of the heart, ultrasound was normal in two children (6.25%). 11 children had registered aberrant horde in the pulp chamber of the left ventricle (34.37%). it is a fibromuscular structures that extend through the left ventricular cavity, with no connections with the heart valves. long been regarded as normal structures, although today there is a great interest cardiologist for them, because of their potential association with innocent murmurs (24). he even believes that they may have to do with ventricular arrhythmias. according to some authors, it is possible, because except those containing fibrous and muscular and the conduction tissue. in our study, there are a significant number of children with aberrant and positive auscultation finding of the heart. one study showed an extreme variability of the presence of these structures in echocardiography studies (0.2 to 71%). the wide range is interpreted partly by varying degrees of examiners skill and partly by population based differences (25). a significant number of children with audible murmurs in the neonatal period have a structural defect of the heart. based on the auscultative characteristics of the murmurs for the diagnosis or exclusion of congenital heart anomalies ultrasound of the heart is essential. | introduction : heart murmurs can be functional (innocent) and pathological (organic). although it is not considered a major sign of heart disease, it may be a sign of a serious heart defect. in most cases the noise is initiation for cardiac treatment. is it possible to differentiate on the basis of auscultation innocent from pathological heart murmur ? in this article we present the results of ultrasonography of newborns with positive auscultation finding of the heart in the neonatal and early infancy period.goal:to determine the role of murmurs in the heart detected by routine clinical examination in the neonatal period and early infancy, and to establish the legitimacy of cardiology consultation and ultrasound of the heart.methods:a retrospective review of medical records in the period from january 1 to december 31, 2011 at the maternity ward of cantonal hospital in bihac 1899 children was born. in 32 neonates was registered a heart murmur, in the period from birth up to 6 weeks of life. all children with positive auscultation finding of the heart were examined echocardiography by ultrasound aloca 2000, multifrequency probe from 3.5 to 5 mhz, and used m - mode, 2-d, continuous, pulsed and color doppler.results:of the 32 examined children regular echocardiographic findings had two children (6.25%), aberrant bunch of left ventricle 11 (34.37%), patent foramen ovale 5 (15.62%), atrial septal defect 3 children (9.37%), ventricular septal defect 8 children (25%), cyanogen anomaly 2 children (6.25%), stenosis of the pulmonary artery 1 child (3.12%). we see that 14 children (43.75%) had a structural abnormality of the heart that requires further treatment and monitoring.conclusion:echocardiography is necessary to set up or refute the diagnosis of structural heart defect in children with positive auscultation finding in the neonatal period. |
according to the world health organization, 2010 report, cardiovascular diseases are the first among the top 10 causes of death. an estimated 16.7 million people or 29.2% of total global deaths are due to the various forms of cardiovascular disease (cvd) [1, 2 ]. the direct relation between high blood cholesterol and cvd has been proved. cholesterol is a typical animal sterol ; for example, its content in milk fat is 95%98%. the main source of cholesterol in food comes from animal origin, such as meat, milk, and eggs. milk and dairy products contain relatively high level cholesterol that can elevate the blood cholesterol. first attempts on reducing cholesterol in food go back to early twentieth century. denis and minot determined the cholesterol content of animal and human milks and they suggested the relation between blood plasma cholesterol and food intake. although so many papers were published about the relation of food intake and increasing of blood plasma cholesterol, no serious attempt took place on reducing cholesterol in food until 1960. since the 1960s, large number of physicochemical methods was recommended to reduce cholesterol in food as well as blood cholesterol. cholesterol could be removed in an efficient manner from milk fat up to 90% using supercritical co2 technology. bobby and joseph jr. developed and patented a process for the production of cholesterol - free milk based on extraction of cholesterol from the milk fat globule membranes using an organic polar solvent and without substantial loss of solid milk fat. solvent - free and low cholesterol products were recovered from the reseparated and washed cream fractions. cholesterol removal from dairy product using saponin and diatomaceous earth also was patented by richardson.. they suggested that the process could be useful particularly for raw and pasteurized milks, cream, and butter. in spite of effectiveness of the mentioned methods, some complications exist because of the organic solvents and saponin residues in food and safety problems for human body. the worries about solvent residue and harmful saponin consumption for human health motivated the investigator to find nontoxic and effective substances instead of unsafe materials. in the last years, several studies describing the use of beta cyclodextrin (-cd) and food applications have been published. it has been proved that the -cd molecule can be used as nontoxic and nondigestible molecule to remove cholesterol effectively from milk and animal products for improving their nutritional characteristics. -cd is a cyclic oligosaccharide consisting of seven glucopyranose molecules that are linked together with 14 bonds. the most widespread use of -cd is in cholesterol removal from animal products, such as eggs and dairy products. -cd chiu. removed more than 85% cholesterol content of egg yolk by immobilization of -cd on chitosan beads. the process for preparing low cholesterol dairy product using -cd has been patented by graille.. suggested that the 94.3% of cholesterol content of homogenized milk with 3.6% fat could be removed by addition of 1.5% -cd at mixing temperature of 10c for 10 min of mixing time. the method for removing cholesterol from milk and cream was developed and patented by kwak.. optimization of cholesterol removal in cream using -cd by response surface method was investigated by ahn and kwak. kim and coworkers [2022 ] developed a cross - linked -cd and epichlorohydrin to recycle the cholesterol removal process. they concluded that cross - linked -cd would result in almost 100% effective recycling efficiency. further, this method was applied and optimized in order to remove cholesterol from milk and dairy product and recover the cross - linked -cd by kwak.. recently, dias. investigated butter cholesterol removal using different combinatorial methods with -cd. although many investigations were carried out to demonstrate the feasibility of -cd as excellent substance for removing cholesterol from food including milk, few investigations have been reported on the effect of -cd on physicochemical properties of milk with various fat content. ha. measured the amount of nutrients (lactose, short - chain ffa, faa, and water - soluble vitamins) that were entrapped during cholesterol removal from cream by cross - linked -cd. they concluded that the amount of entrapped nutrients was negligible during cholesterol removal from cream by cross - linked -cd. in spite of this study, the cholesterol removal process by -cd may affect main components and physicochemical properties of milk. the aims of this study are evaluation of the feasibility of -cd in cholesterol removal from raw and homogenized milks with various fat contents and the effect of cholesterol reduction process on main components of milk. commercial raw (unhomogenized) and homogenized milks with 1%, 2.5%, and 3% fat content were purchased from a pegah dairy co. industry as needed (located in mashhad iran). -cd, cholesterol, and 5-cholestane were purchased from sigma chemical co. (st. louis, mo, usa). overall, 100 ml of raw or homogenized milk with various fat contents (1%, 2.5%, and 3%) were separately placed in 500 ml beakers and different concentrations of -cd (0%, 0.5%, 1%, and 1.5%) were added to each of samples. the mixture was stirred vigorously by velp stirrer 700 rpm at two temperature conditions of 8 and 20c for 10 and 15 min. the mixtures were centrifuged with eppendorf centrifuge model 5810 at 112448 g for 15 min. the supernatant containing cholesterol reduced milk was decanted and removed for further measurements. the protein, lactose, fat, solid nonfat (snf), ash, and density were measured using milkoscan device mcc model (milkotronic co., bulgaria). the determination of cholesterol was carried out using hplc - sykam, s1122 (germany) with capillary column symmetry c18, length of 25 cm, diameter 4.6, vol. 5 m, and uv detector 205 nm. accurately 30 ml milk with constant fat content was poured in 250 ml erlenmeyer flask. also, 40 ml of 95% ethanol and 8 ml of 50% koh (w / w) were added to flask. then, the flask was placed on a magnetic heater - stirrer, connected to condenser, and stirred vigorously for 70 min to ensure the saponification reaction was completed. once more, 60 ml of 95% ethanol were added and stirring procedure was continued without heating. the saponified solution flask was topped with stopper and rested to be cooled at room temperature for 24 h. the extraction procedure was carried out by adding 100 ml toluene to saponified sample while stirring for 30 min. the solution was poured into 500 ml decantation funnel without rinsing and then 110 ml of koh were added. the extraction stage was repeated by adding 40 ml of 0.5 n koh solutions. the aqueous solution was discarded and the toluene was washed with 40 ml h2o for three times. the remained cholesterol was dissolved in 5 ml methanol hplc grade and was injected to hplc device. the determination of main components and some physicochemical properties of milk was carried out by ultrasonic milk analysis device. multifactor randomized complete block design (rcbd) was used to analyse the acquired raw data statistically. statistical analysis was performed using sigma stat 3.1, minitab15, and microsoft excel softwares. the cholesterol content of both raw and homogenized milks was significantly (p 0.05) reduced with increasing the -cd. figure 1 shows the cholesterol residues and percentage reduction of cholesterol in treated raw and homogenized milks. however, there were no remarkable differences between the reduction rates of raw and homogenized milks at 0.5% and 1% -cd concentrations (p 0.05). the obtained results in this study showed that cholesterol is effectively removed from milk and dairy product by -cd which is in agreement with other investigators [16, 17, 27, 28 ]. the lipid complexes in homogenized milk are significantly smaller than unhomogenized (raw), and therefore the possibility of cholesterol molecule inclusion by internal cavity of -cd is higher in homogenized milk than in raw one. the cholesterol removal trend was slightly decreased when 1.5% -cd was applied particularly in raw milk. kim. (1999) have suggested that an excess of -cd could compete with itself to bind to cholesterol molecules, and consequently cholesterol adsorption is decreased. therefore, it seems that the concentration of 1% -cd may be sufficiently effective to remove greater than 90% of cholesterol from homogenized milk as shown in figure 1. the -cd was added and mixed with milk samples at two temperatures 8 and 20c for 15 min. the adsorption of cholesterol was significantly increased when -cd was added and mixed at 20c. figure 2 shows the effect of mixing temperature on reduction of cholesterol in treated milks. reported that no difference was found in cholesterol removal at mixing temperature of 4, 10, 15, or 20c, while oakenfull and sihdu disagreed with this result. they reported that 77%, 63%, and 62% cholesterol were removed when milk was treated with 1.0% -cd at 4, 8, and 40c, respectively, during 10 min of mixing. yen and tsui, and kim. also confirmed that the removal of cholesterol with -cd from lard which was stirred at 50c is greater in comparison with the temperature condition of 27 or 40c. actually, our overall results showed that the higher cholesterol removed when mixing temperature was increased as demonstrated in figure 2. this result is in agreement with investigations concerning the effect of mixing temperature on the reduction of cholesterol by -cd that were carried out by other investigators [22, 29, 30 ]. naturally, the aggregations of milk lipoproteins at the mixing temperature of 20c are lower than 8c due to reaching of lipids to their melting points, and consequently there is more chance for the entrapment of molecules in -cd cavities. therefore, we can expect more cholesterol molecules to be trapped in -cd cavities at higher temperatures. figure 3 shows the amount of cholesterol reduction in both raw and homogenized milks in various concentrations of -cd at both temperature conditions of 8 and 20c. we observed that the increase of cholesterol removal depends on amount of -cd in higher temperatures. there were no remarkable statistical differences between cholesterol reduction in both raw and homogenized milk samples at two mixing temperatures of 8 and 20c treated with low concentrations of 0.5% and 1% of -cd while the differences were significant when we applied higher concentration of 1.5% -cd as shown in figure 4. kim. confirmed this result by investigation on cholesterol reduction of lard using high concentration of -cd. the percentage of cholesterol, which was reduced by various concentrations of -cd in different milk fat contents, is shown in figure 4. the highest cholesterol reduction was achieved by 1% -cd followed by 1.5% and 0.5% in 3% fat content of milk. the entrapped cholesterol molecules in -cd cavities were reduced when we applied excess -cd for milk samples with low fat content. the percentage of cholesterol reduction was only 42% when we applied 1.5% -cd, while we achieved 52.1% and 62% with 0.5% and 1% -cd, respectively. the cholesterol reductions by 1% -cd were 60%, 67.25%, and 77.9% for 1%, 2.5% and 3% of milk fat, respectively. the molecules of -cd are linked together, therefore, the ability of cholesterol absorption is reduced. the cholesterol removal processing by -cd on total fat content of milk was investigated as shown in table 2. obviously, the fat content of milk was reduced when cholesterol was removed by -cd because cholesterol molecules are a part of milk lipids. this reduction of fat in homogenized milk samples was more obvious than in raw milk. the fat content of homogenized milk was significantly decreased with increasing the amount of -cd due to smaller size of fat globules in homogenized milk compared with raw milk. the trend of fat decrease in raw milk samples was slower than homogenized with increasing the concentration of -cd. aggregation of fat molecules in raw milk inhibits the inclusion of cholesterol in -cd molecules. ha. [25, 31 ] suggested that the free fatty acids in food may be reduced because they are trapped in -cd molecule cavities.. reported that cheddar cheese fat content made by milk treated by -cd was lower than control milk samples. the cholesterol reduction processing such as stirring, separation, and centrifugation during separation of -cd + cholesterol may affect fat reduction particularly in homogenized milk. the amount of protein was significantly decreased in high concentrations of -cd particularly in homogenized, milk, and there is a direct relation between increasing the concentration of -cd and decreasing the protein content of milk as shown in table 2. suzuki suggested that the bitter taste due to protein hydrolyzate can be removed by 10% -cd. the protein molecules and protein - lipid networks are smaller in homogenized milk than in raw milk. ha. confirmed that the protein content of cream was reduced during reduction of cholesterol by 4%10% -cd due to entrapment of amino acids in -cd cavities. on the other hand, the outer surface of -cd macromolecules has affinity to absorb the negative charges that cover the protein surfaces. consequently, parts of protein together with -cd + cholesterol leave the environment during separation of -cd. the cholesterol reduction processing such as mixing, separation, and centrifugation may affect decrease of milk protein. the nonfat solid content of both raw and homogenized milks was slightly decreased after cholesterol reduction processing. although cholesterol molecules are lipids and are independent to snf, but presence of -cd in milk may influence constituents such as proteins, ions, and lactose. moreover, cholesterol removal operations may have effect on the reduction of nonfat solid content as shown in table 2. the snf was reduced with increasing the amounts of -cd, and it was proved that some constituents of milk may entrapped in the cavity of -cd and leave the environment after separation of -cd. ha. confirmed the decreasing of some nutritional materials during cholesterol removal processing of cream using -cd. the lactose content in both raw and homogenized milks was decreased after cholesterol removal processing. this phenomenon was more obvious when the amount of -cd increased particularly in homogenized milk as illustrated in table 2. [25, 31 ] reported the effect of cholesterol removal using -cd on lactose previously, and they noted that the reduction of lactose is very low and negligible. however, we guess that the decrease of lactose is due to cholesterol reduction processing and the ability to bind lactose to -cd and subsequently exit the milk suspension in association with -cd + cholesterol complex. the density of milk strongly depends on existing of material in milk and is generally decreased when the main constituents of milk are reduced. the density of milk was significantly decreased after removing the cholesterol by -cd because of losing some components of milk after cholesterol removal treatment. decrease of milk density in homogenized milk is more than raw milk as illustrated in table 2. the density of homogenized milk samples was significantly changed from 1.0313 (control) to 1.028 (treated samples) when 1.5% -cd was applied to remove the cholesterol of milk. the effect of cholesterol minimization treating by -cd had no remarkable effect on ash content of treated milk samples. generally, the minerals of milk are sodium, potassium, calcium, and magnesium. these minerals could not be affected by -cd as well as cholesterol removal operation and there was no remarkable effect on ash content of milk. this study depicts the ability of various concentrations of -cd to remove cholesterol from both raw and homogenized fresh milks and their effects on main constituents of milk. undoubtedly, the ability of -cd to exclusively remove cholesterol from milk has been proved and we confirmed these results. however, a few studies reported the effects of cholesterol reduction on nutritional compounds such as protein, lactose, and fat contents of milk. although the -cd molecules are edible and nontoxic and as a results they can be used safely as cholesterol removal agent from milk and dairy products, the effects of cholesterol removal processing are very important. this operations decreased the fat, density, snf, and lactose content of milk. this phenomenon may be due to cohesiveness of these compounds with -cd or existence some excess operations such as filtration and centrifugation during separation of -cd + cholesterol. further investigation needs to demonstrate the quality of milk after cholesterol removal processing and to develop prevention methods of leaving nutritional materials of milk in association with -cd. the -cd molecules are safe and can be used as cholesterol removal agent.the effects of cholesterol removal processing are very important.the cholesterol removal operations can be decreased some main components of milk. | various concentrations (0%, 0.5%, 1% and 1.5%) of -cd were mixed with different fat contents (1%, 2.5% and 3%) of raw (unhomogenized) and homogenized milk at two mixing temperatures of 8 and 20c. the cholesterol residue, fat, protein, lactose, solid nonfat (snf), density, and ash content of milk were measured for each treatment. the results statistically analysed and showed that the cholesterol content of milk remarkably decreased as the -cd was increased particularly in homogenized milk at 20c. however, the reduction rate of cholesterol was decreased when extra -cd was added due to its intermolecular reactions. the maximum cholesterol reduction was achieved at the level of 1% -cd. the fat content, snf, protein, lactose, and density content were decreased with increasing -cd whereas it did not affect ash content. |
key clinical messagealthough rare, eagle syndrome should be always considered in the differential diagnosis in patients with chronic orofacial pain refractory to conventional treatments. treatment is surgery and exeresis of the styloid process via a transoral or cervical approach depending on clinical and radiological features. |
|
replication in e. histolytica is inhibited by aphidicolin [2, 3 ], a specific inhibitor of mammalian, and dna polymerases. additionally, ehmcm2, ehmcm3 and ehmcm5 genes, whose products are part of the helicase complex, have been cloned and characterized [4, 5 ]. although nuclear and dna polymerase sequences are present in e. histolytica genome, dna polymerase encoding genes have not been isolated or characterized and dna replication processes are poorly understood in this parasite. in eukaryotes, replicative dna polymerases are grouped in two families : (1) family a, which includes dna polymerases of animals and fungi, and pol i - like dna polymerases responsible for mitochondrial dna replication in plants and slime mold. (2) family b comprises the, and dna polymerases involved in nuclear dna replication [79 ], archaebacterial, viral, bacteriophage dna polymerases such as those present in phages t4 and rb69 and dna polymerases encoded in fungi and plant mitochondrial plasmids. commonly, the fungal plasmids are linear and they have been frequently found in filamentous fungi. transcription and replication of linear plasmids are initiated in terminal inverted repeats by a plasmid encoded phage - like single subunit rna polymerase and by a dna polymerase of the family b, respectively. replication in these plasmids is thought to occur by a protein - primed mechanism, similar to that described for bacillus subtilis phage phi29. the b dna polymerases are distinguished by the presence of up to six common regions in their amino acid sequences (boxes i to vi). the most conserved regions (i and ii) include aspartic acid residues essential to catalytic polymerase activity. although it has been reported that e. histolytica had a secondary mitochondrial lost, no genes encoding dna polymerase responsible for mitochondrial dna replication have been detected. however, trophozoites carry mitosomes, a mitochondrial cytoplasmic remnant organelle lacking dna [15, 16 ], and crypton and ehko [1720 ], two dna - containing cytoplasmic organelles, with a double membrane. crypton is a 0.5 to 1 m organelle that carries the mitochondrial chaperonin hsp60 [17, 18 ], whereas ehko varies from 0.5 to 5 m and it has the ehpfo enzyme. some authors have suggested that crypton and ehko could be the same structure ; however, their morphological and biochemical characteristics need to be better studied to define this. the mechanism of dna replication and the proteins and genes involved in this process in e. histolytica are unknown. to better understand the dna replication process in this parasite we have initiated the search and study of its dna polymerase genes. here, we report the identification of a gene family (ehodp1, ehodp2, ehodp3 and ehodp4) encoding putative e. histolytica dna polymerases. all of them correspond to the family b, with a high similarity to fungi and plant dna polymerases encoded in mitochondrial plasmids. additionally, in situ pcr assays demonstrated that ehodp1 gene is located in nuclei and in cytoplasmic dna - containing structures. by confocal microscopy using polyclonal antibodies against a recombinant ehodp1 fragment, trophozoites of e. histolytica clone a were axenically cultured in tyi - s-33 medium at 37c and harvested during the exponential growth phase as described. for purification of ehkos, the medium was supplemented with 2 ci / ml [methyl - h]-thymidine (amersham) for 48 hours. to identify a dna polymerase encoding gene, a blast search was performed in the e. histolytica genome databases at the sanger institute http://www.sanger.ac.uk/ and pathema from the j. craig venter institute http://www.jcvi.org/. as query, we used the polypeptide sequence of the gelasinospora sp dna polymerase encoded on mitochondrial plasmids [uniprot knowledgebase (uniprotkb)/trembl accession number (an) o03684 ] and the wu - blast version 2.0 program and blosum62 matrix. dna sequences were translated to proteins with the translate tool at the expasy proteomics server http://www.expasy.org/. blast search for each ehodp polypeptide sequence was done with blastp 2.2.14 algorithm in the uniprotkb at the expasy proteomics server of the swiss institute of bioinformatics using the blosum62 matrix. alignments were performed with clustalw version 1.83 algorithm at the european bioinformatics institute (ebi, http://www.ebi.ac.uk/tools/clustaw2/index.html). cdna was synthesized with 200 u of superscript ii reverse transcriptase (invitrogen) and 40 u of rnasin ribonuclease inhibitor (promega). pcr assays were performed with 3 l of cdna mixture, 400 m dntps, 2 mm mgcl2, 200 nm of specific primers for each gene and 4 u of taq dna polymerase (invitrogen). for ehodp1 gene we used odp1-f (forward), 5-gaagatctgccaatccccacaaaacgtcccac-3, and odp1-r (reverse), 5-ggaattcttattgcggttcgatattttctaagtt-3 primers (tm of 59c), containing the bglii and ecori restriction sites at their 5 ends, respectively. for ehodp2 gene we used the primers odp2-f, 5-atcgtcgaaatacaagacaaaa-3 and odp2-r, 5-tctttgatattcttcatcactgg-3 (tm of 54c). for ehodp3 gene we used odp3-f, 5- tgaaagaagagagaaatacaaag -3 and odp3-r, 5-atcactaactctttcttcccc-3 primers (tm of 54c). (tm of 54c). as an internal control, we used (sense) 5-agctgttctttcattatatgc-3 and (antisense) 5-ttctctttcagcactagtggt-3 actin oligonucleotides (tm of 54c). pcr conditions were ; 94c (5 minutes), followed by 29 cycles at 94c (30 seconds), annealing at specific tm for each pair of primers (60 seconds) and extension at 72c (60 seconds). rt - pcr products were separated by 6% page gels in 0.5 tbe (90 mm tris, 90 mm h3bo3, 2 mm edta, ph 8.3), stained with ethidium bromide and visualized with a uv transilluminator (gel doc documentation system, bio - rad). for densitometry analysis we used the quantity one software version 4.6.1 (bio - rad). a 504 bp dna fragment from contig1 sequence (from 232 to 735 bp) was pcr amplified from e. histolytica total dna using 200 nm of each primer (odp1-f and odp1-r), 400 m dntps, 2 mm mgcl2 and 2 u of taq dna polymerase. amplified dna was purified and cloned into prset a vector (invitrogen) to generate the recombinant prset a - ehodp1 - 504 plasmid (prehodp1). sequencing of cloned dna was carried out using the big dye terminator kit version 3.1 (applied biosystems) in an automated dna sequencer (310 genetic analyzer, applied biosystems). nucleotide sequence data of the ehodp1 gene is available in the genbank database under the accession number eu423197. rehodp1 - 168 polypeptide production was induced with 1 mm isopropyl--d - thiogalactopyranoside (iptg) for 3 hours at 37c. cells were harvested, resuspended in lysis buffer (6 m guanidine - hcl, 0.1 m nah2po4, 0.01 m tris - hcl, ph 8.0) and disrupted by sonication at 4c. recombinant polypeptide was purified under denaturing conditions by immobilized metal affinity chromatography (imac) through a ni - nta agarose column (qiagen) in buffer d (8 m urea, 100 mm nah2po4, 10 mm tris hcl, ph 5.9) and buffer e (8 m urea, 100 mm nah2po4, 10 mm tris hcl, ph 4.5), following the manufacturer 's protocol. then, rehodp1 - 168 polypeptide purification was improved by electroelution from preparative 15% sds - page gels using a model 422 gel electro - eluter (bio - rad). purified fractions, obtained from the ni - nta - agarose affinity chromatography, were analyzed in 2d - gels. isoelectric focusing was performed with zoom strips (linear ph 310 gradient) in an xcell surelock mini - cell system (invitrogen) at 200 v (20 minutes), 450 v (15 minutes), and 2,000 v (30 minutes). second dimension was done through a 15% sds - page with a mini - protean ii system (bio - rad). then, gels were coomassie brilliant blue stained and selected spots were cut and sent to the protein chemistry core facility at columbia university for analysis by mass spectrometry in a maldi - tof system. wistar rats were three times intramuscularly immunized with 15 g of purified rehodp1 - 168 polypeptide mixed with diluted 1 : 10 (v / v) titer max gold (cytrx corporation) in pbs at 15 days intervals. rats were bled before the first immunization to obtain preimmune serum. for western blot assays, purified rehodp1 - 168 polypeptide membranes were blocked with 3% (w / v) nonfat milk in pbs for one hour. immunodetection of his - tagged polypeptide was done by incubation with 0.3 g / ml mouse anti-6his monoclonal antibodies (roche) for 1 hour at 37c. membranes were washed 3 times with pbs, followed by incubation with horseradish peroxidase - conjugated goat anti - mouse igg secondary polyclonal antibodies (zymed) (1 : 2,000) at room temperature (rt) for 1 hour. immunoreactive bands were visualized using 3, 3-diaminobenzidine and 0.025% (v / v) h2o2. for western blot of trophozoite total extracts supplemented with 1 complete protease inhibitors (roche) and ehko - enriched fraction, proteins were separated through 10% sds - page and transferred to nitrocellulose membranes that were treated as mentioned above. then, membranes were incubated with either rat anti - rehodp1 - 168 polyclonal antibodies or preimmune serum (1 : 1,000) overnight at 4c, and revealed as described. trophozoites adhered on cover slips, were paraformaldehyde fixed (4% w / v) at rt (1 hour) and treated with 50 mm nh4cl at 37c (1 hour). then, cells were permeabilized with acetone at 20c (7 minutes), immersed in blocking solution (2% bsa, w / v, in pbs) at rt (2 hours) and incubated with rat anti - rehodp1 - 168 antibodies (1 : 500) at 4c overnight. next, they were washed with pbs, incubated with fluorescein - labeled goat anti - igg rat secondary antibodies (1 : 1,000) in blocking solution at rt (2 hours), washed with pbs, counterstained with 20 g / ml propidium iodide (pi) (fluka) for 5 minutes, and observed through a leika dm - ire2 confocal microscope. as a negative control, cells were treated as above, but incubation with anti - rehodp1 - 168 antibodies was omitted or preimmune serum was used. cells were washed with pbs and resuspended in 8 volumes of buffer a (10 mm edta, 10 mm dtt, 10 mm hepes, ph 7.9) containing 1 complete protease inhibitors (roche) and 250 mm sucrose. then, cells were gently disrupted on ice using a potter homogenizer and centrifuged at 160 g for 10 minutes. the supernatant was centrifuged at 10,000 g for 10 minutes at 4c, and the pellet was resuspended in 15% (v / v) nycodenz (axis - shield) in buffer a and top loaded on a nycodenz discontinuous gradient (30%, 40% and 50%, all v / v). fractions of 0.5 ml were collected with a densiflow ii c system (buchler instruments) and a redifrac 1,000 fraction collector (bio - rad). 100 l aliquots of each fraction were 10% (w / v) tca precipitated and their radioactivity content was determined in a ls6500 liquid scintillation counter (beckman). assays were performed according to protocols included in the in situ - pcr (is - pcr) manual (perkin - elmer). exponentially growing trophozoites were attached to glass slides, washed with pbs at 37c and paraformaldehyde fixed (4% w / v) at rt for 60 minutes. fixed trophozoites were incubated in 20 mm hcl (15 minutes), washed twice in pbs (5 minutes), incubated in 0.01% (v / v) triton x-100 (90 seconds), washed in pbs and treated with 1 g / ml proteinase k at 40c (25 minutes). next, cells were dehydrated in ethanol solutions (30%, 50%, 70% and 100%, v / v) at 4c (5 minutes). for is - pcr, samples were covered with 50 l of reaction mixture containing 200 m dntps, 400 m of each odp1-f and odp1-r primers (described in materials and methods, section 2.3), 4.5 mm mgcl2, 10 u of amplitaq dna polymerase is (perkin - elmer) and 0.1 l of cy5-dctp (amersham). pcr conditions were as follows : one cycle at 94c (3 minutes), followed by 30 cycles of annealing at 59c (60 seconds) and extension at 72c (60 seconds). then, samples were fixed with 2% (w / v) paraformaldehyde at rt (5 minutes), washed with pbs, incubated with 25 mg / ml rnase a (roche) (20 minutes), washed with pbs, counterstained with 20 g / ml pi (5 minutes), and observed through a leika dm - ire2 confocal microscope. is - pcr negative controls were carried out, one without taq dna polymerase and the second containing all the reaction components except for oligonucleotides. e. histolytica has dna - containing cytoplasmic organelles that could be related to mitochondrion. therefore, we performed a blast search in the e. histolytica genome databases using as query several dna polymerase sequences from different organisms, but we did not find any related sequence to them. then, we employed as query the gelasinospora dna polymerase sequence (uniprotkb / trembl an o03684) encoded by the mitochondrial linear plasmid gel - kal. first, we found in the wellcome trust sanger institute database a 3,462 bp orf sequence annotated as contig1, which encodes for a 1,154 amino acid polypeptide with a 135.5 kda predicted molecular mass. this polypeptide sequence displayed 20% to 28% identity and 39% to 44% similarity to organellar dna polymerases of family b encoded in mitochondrial plasmids and 33% identity and 53% similarity to a trichomonas vaginalis putative dna polymerase (table 1). we called this gene e. histolytica organellar - like dna polymerase 1 (ehodp1). then, using the ehodp1 sequence as query we detected at pathema, three other e. histolytica related sequences : ehi_196700/genbank i d : xm_643104 (ehodp2) that has 3,696 bp and encodes for a putative 1,231 amino acid polypeptide (147.7 kda), ehi_132860/genbank i d : xm_644753 (ehodp3) with 3,273 bp and encodes for a 1,090 amino acid polypeptide (129.2 kda) and ehi_164190 (ehodp4) that has 3,897 bp and encodes for a 1,278 amino acid protein (149.5 kda) (figure 1). ehodp1 is 51% identical to ehodp2 and ehodp3, and 63% to ehodp4 and it shows 69%, 67% and 76% similarity to ehodp2, ehodp3 and ehodp4, respectively. the alignment of ehodp1, ehodp2, ehodp3 and ehodp4 protein sequences with other dna polymerases of family b with the clustalw program, showed in ehodp amino acid sequences the presence of i, ii and iii conserved boxes described in dna polymerases from other organisms (figures 2 and 3) [12, 27 ]. boxes i and ii contain part of the catalytic domain, which includes two aspartic acid residues that interact with mg ions. in ehodp1, ehodp2, ehodp3 and ehodp4, the corresponding aspartic acid residues are d1040 and d795, d1093 and d848, d952 and d707, and d1140 and d895, respectively (figures 1 and 3(a)). interestingly, we also identified here two other novel boxes (a and b) in ehodp sequences that we also located in fungi mitochondrial plasmids and in the putative t. vaginalis dna polymerase (figures 1, 2 and 3(b)). in ehodp1, box a (iifkdtlaliptsisnfktffkldgkyekeifpy) spans from i616 to y649, in ehodp2 from i669 to y702, in ehodp3 from i528 to y561 and in ehodp4 from i716 to y749. box b in ehodp1 (fntekyceyyclrdvlvlregflkyk) spans from f697 to k722, while in ehodp2, ehodp3 and ehodp4, box b corresponds to the regions located at f750 to k775, f609 to k634 and f797 to k822, respectively. then, using the simple modular architecture research tool (smart), we found in ehodps the characteristic dna_pol_b_2 (pf03175) domain of organellar and viral dna polymerases of family b (figure 1). in ehodp1 this domain is located at amino acids 570 to 1042 (e value 1.1 10), in ehodp2 at amino acids 621 to 1095 (e value 1.9 10), in ehodp3, at amino acids 480 to 954 (e value 1 10) and in ehodp4 at amino acids 670 to 1142 (e value 4.3 10). in addition, we found in them the 3- 5exonuclease ii domain (figure 3). the presence of boxes i, ii, iii, a and b in the four ehodp polypeptides, conserved in dna polymerases encoded in mitochondrial plasmids, as well as the detection of the 3-5 exonuclease ii domain, strongly suggests that these e. histolytica polymerases constitute a family of putative organellar dna polymerases belonging to family b. to determine if ehodp genes were expressed in trophozoites, we performed rt - pcr assays with specific oligonucleotide pairs for each gene. results showed that the amplified products presented the expected 524, 317, 149 and 376 bp sizes for ehodp1, ehodp2, ehodp3 and ehodp4 genes, respectively (figure 4(a)), suggesting that the four ehodp genes are transcriptionally active. the expression level of each gene was measured by semiquantitative rt - pcr (figures 4(b)4(d)) and data were normalized against the amount of actin transcript simultaneously obtained. we calculated the relative abundance of the ehodp genes considering ehodp1 gene expression level as 100%. thus, ehodp2 exhibited 96.7%, ehodp4 showed 35%, while ehodp3 was expressed only at 3.7%. negative rt - pcr controls with the same rna were performed for each gene in the same conditions, but without reverse transcriptase (figure 4(a)). to determine the cellular location of ehodp1 gene, we amplified by is - pcr a specific dna fragment of this gene in fixed and permeabilized trophozoites. cells were stained with propidium iodide to detect dna - containing organelles (figure 5, pi). through confocal microscope, we observed amplification of ehodp1 dna in both nuclei and cytoplasmic organelles (figures 5(a), 5(b), cy5). merging of fluorescent signals showed the colocalization of dna and the amplification of ehodp1 in both organelles (figures 5(a), 5(b), m). as negative controls, we alternatively performed reactions without taq dna polymerase and without ehodp1 specific oligonucleotides. no fluorescent signals were obtained in these cases (figures 5(c), 5(d), cy5). these results demonstrate that ehodp1 gene is located in nuclei and in cytoplasmic dna - containing structures that may correspond to ehkos [1921 ] or cryptons [17, 18 ], or both. to initiate the characterization of the ehodp gene family, we cloned an ehodp1 504 bp dna fragment to obtain the recombinant plasmid prehodp1 that was used to transform e. coli bl21(de3)plyss cells to produce a histidine - tagged rehodp1 - 168 polypeptide (23.7 kda). electrophoretic analysis of proteins from transformed bacteria revealed the presence of 23 and 33 kda induced bands (figure 6(a)). both polypeptides copurified when extracts from induced bacteria were passed through a ni - nta - agarose column under denaturing conditions (figure 6(b)). then, the recombinant protein was detected by mouse monoclonal antibodies against the 6his tag. antibodies only recognized the 33 kda band (figures 6(c), 6(d)), and they did not react with the 23 kda band. to obtain further data to identify the rehodp1 - 168 polypeptide, we analyzed the purified fraction by 2d gels. both proteins in the fraction presented a closely related isoelectric point to the expected value of 4.5 (figure 6(e)). therefore, we excised the spots from the 2d gel and performed a maldi - tof mass analysis. amino acid sequences indicated that the 33 kda polypeptide corresponded to rehodp1 - 168 (figures 6(e), 6(f)), whereas the 23 kda polypeptide (figure 6(e)) was a histidine - rich bacterial protein, with similarity to a bacterial fkbp - type peptidyl - prolyl cis - trans isomerase. the molecular weight showed in sds - page by rehodp1 - 168 could be explained by the presence of acidic residues in its sequence, which affects electrophoretic migration, as it has been described for caldesmon, tropomyosin and calsequestrin proteins. to search for the presence of ehodps in ehkos, we purified these organelles (figure 7(a)) as described in materials and methods and carried out western blots with rat anti - ehodp1 polyclonal antibodies. as a control, we used trophozoite total extracts obtained at the same time and similar conditions than ehkos and kept at 20c during the ehkos purification process and fresh prepared trophozoite total extracts. the antibodies recognized a 150 kda band surrounded by a fuzzy region (figure 7, line 2) only in fresh trophozoite extracts. in frozen trophozoites extracts they immunodetected two bands of 105 and 70 kda, and in the ehko - enriched fraction antibodies only detected the 70 kda band. no signal was obtained in total protein extracts when preimmune serum was used as a negative control (figure 7(b), lane 5). this difference in the molecular weight may be due to the presence of acidic residues in the protein, although posttranslational modifications can not be disregarded. on the other hand, the 105 and 70 kda bands that appeared in gels could be degradation products of the ehodp1 polypeptide. reported that prokaryotic and eukaryotic replicative dna polymerases are extremely sensitive to proteolytic cleavage, even in the presence of protease inhibitors. they detected major polymerase activity in the 110, 74 and 35 kda polypeptides in extracts of calf thymus, human fibroblasts and hela cells, while in ustilago maydis, drosophila melanogaster and e. coli extracts they detected major activity in 110 and 74 kda bands. these authors suggested that the remarkable similarity in sizes and numbers of polypeptides generated by storage of extracts may result from the conservation of localized amino acid sequences or polypeptide conformations that are particularly susceptible to proteolytic cleavage, generating active fragments of defined sizes. spanos. found a 109 kda band corresponding to active dna polymerase in freshly prepared homogeneous e. coli dna polymerase i, but when they kept this preparation at 20c, they also found the 76 and 72 kda bands. in addition, they observed complete conversion of 109 kda polypeptide to 76 and 72 kda bands on prolonged storage at 20c. therefore, it could be possible that the 105 kda polypeptide detected in frozen trophozoite extracts, had not been detected in the ehko - enriched fraction as a result of an increase in the proteolytic degradation due to the preparations conditions and storage of the ehko - enriched fraction. we carried out the immunodetection of ehodp1 in fixed and permeabilized trophozoites, using the anti - rehodp1 - 168 antibodies. fixed trophozoites were contrasted with pi to stain dna - containing structures. through confocal microscope, interestingly, the anti - rehodp1 - 168 antibodies reacted with structures of 4 m, but they did not stain nuclei (figure 8(a)), giving support to the assumption that ehodp1 protein is located in dna - containing structures that probably correspond to ehkos. merging images confirmed the colocalization of both red and green fluorescent signals in these structures but not in nuclei. as negative controls, we used preimmune serum (figure 8(b)) or we omitted the first antibody (data not shown). in both cases, in this work we report the existence of four genes (ehodp1, ehodp2, ehodp3, and ehodp4) encoding dna polymerases in e. histolytica. proteins encoded by these genes have the pol_b_2 domain characteristic of organellar and viral dna polymerases, which includes the 3-5 exonuclease ii domain and the conserved boxes i, ii and iii, that characterize them as members of family b (figures 13). in addition, these polymerases have two non previously described novel boxes, named here a and b that are shared by dna polymerases of t. vaginalis and by those encoded by fungi mitochondrial plasmids (figures 13). it is known that some dna polymerase encoding plasmids can integrate into mitochondrial dna as a consequence of dna rearrangements produced in the mitochondrial genome. interestingly, different phenotypes have been observed in some fungi such as senescence in neurospora [33, 34 ] or an increase in longevity in p. anserina [35, 36 ] that contain this type of plasmids. additionally, it is known that the dna polymerase encoded in k. lactis pgkl-2 plasmid is involved in the integrity and maintenance of this plasmid. the presence of several genes encoding organellar dna polymerases of the family b has also been reported in the genomes of other organisms. agrocybe aegerita has two pol b sequences, the aa - pol b gene that is potentially functional and a disrupted aa - polb p1 gene. a. chaxingu has two pol b sequences that contain disrupted orfs, which could encode nonfunctional enzymes. orfs encoded by ehodp genes in e. histolytica conserve the catalytic domains, suggesting that they are functional. by rt - pcr we found that all four ehodp genes were transcriptionally active and showed different expression levels in asynchronic cultures (figure 4). in situ pcr experiments showed that ehodp1 gene was located both in the nuclei and cytoplasmic structures that could be either ehkos or cryptons. the finding of ehodp1 gene both in the nucleus and these cytoplasmic structures (figure 5) suggests a possible interaction between them as suggested by solis.. furthermore, ehkos have the nuclear transcription factors ehtbp, ehp53, and ehcbp, and the ehtbp gene was also found in the nucleus and ehkos as we determined for ehodp1 gene in the present work. the genes encoding organellar or viral dna polymerases have also been found in transposable elements named mavericks. mavericks have an average size of 1520 kb and are present in eukaryotic genomes including the t. vaginalis genome. when we aligned the protein sequence of ehodp1 with the amino acid sequence of the dna polymerase encoded in the t. vaginalis mav_tv1.1 maverick element, we found that they have 29% identity and 36% similarity (data not shown). however, there are no reports about the presence of maverick - like elements in e. histolytica, although its genome is rich in transposable elements (nonlong terminal repeats) of lines and sines classes. further studies will define whether e. histolytica has or has not mavericks. additionally, our immunolocalization experiments detected ehodp1 polypeptide in fixed trophozoites. ehodp1 protein was located in cytoplasmic dna - containing structures but not in nuclei, and in an ehko - enriched fraction, that was not tested for the presence of crypton organelles. for this reason we can not discard cross - contamination between both dna - containing organelles. its presence in these organelles and the conservation of the dna polymerase catalytic domain in the protein, suggest that ehodp1 could be involved in their dna replication. we want to note here that due to the similarity in amino acid sequences between ehodp1 and ehodp4 (figure 3), the anti - rehodp1 - 168 antibodies could also recognize the ehodp4 gene product, which was annotated in the e. histolytica genome database while performing the present work. however, we decided to include ehodp4 here to have a broad panorama of the e. histolytica family b dna polymerases related to mitochondrial plasmids. we reported here the presence of a family of four active ehodp genes in the e. histolytica genome, encoding putative organellar dna polymerases of family b. ehodp1, ehodp2, ehodp3, and ehodp4 conserve the 3-5 exonuclease ii and 5-3 polymerization domains and show high similarity to dna polymerases present in fungi mitochondrial plasmids. ehodp1 protein was detected in ehkos suggesting that it could be involved in ehko dna replication. interestingly, the ehodp1 gene was located in nuclei and cytoplasmic dna - containing structures, indicating a close relationship between these organelles. | we report the identification of a family of four active genes (ehodp1, ehodp2, ehodp3, and ehodp4) encoding putative dna polymerases in entamoeba histolytica, the protozoan parasite responsible of human amoebiasis. the four ehodp genes show similarity to dna polymerases encoded in fungi and plant mitochondrial plasmids. ehodp polypeptides conserve the 3-5 exonuclease ii and 5-3 polymerization domains, and they have the i, ii, and iii conserved boxes that characterize them as dna polymerases of family b. furthermore, we found in ehodp polymerases two novel a and b boxes, present also in dna polymerases encoded in fungi mitochondrial plasmids. by in situ pcr, ehodp1 gene was located in nuclei and in dna - containing cytoplasmic structures. additionally, using polyclonal antibodies against a recombinant rehodp1 - 168 polypeptide, and confocal microscopy, ehodp1 was located in cytoplasmic dna - containing structures. |
exfoliation syndrome (xfs) is an age - related generalized disease of the extracellular matrix, characterised by the production and progressive accumulation of fibrillar extracellular material in many ocular and extraocular tissues, and is often associated with glaucoma. xfs causing an increase in trabecular outflow resistance is the most common cause of open - angle glaucoma. extracellular fibrillar material is widely present in the skin, lungs, liver, heart, gallbladder, blood vessels, and cerebral meninges. xfs has been reported to be associated with systemic vascular diseases such as hypertension, angina, stroke, myocardial infarction, and abdominal aortic aneurysm [4, 5 ]. xfs also has nonophthalmic manifestations such as hyperhomocysteinemia and sensorineural hearing loss [69 ]. while there are two different epidemiological studies available from the eastern mediterranean (adana province) and middle black sea (tokat province) regions of turkey, no study has been conducted in central anatolia [10, 11 ]. in addition, the relationship of xfs with systemic diseases such as diabetes mellitus (dm), hypertension (ht), coronary artery disease (cad), smoking, and alcohol intake has not been investigated in these previous two studies from turkey. the relationship between cardiovascular diseases and xfs in turkey has been investigated, but there are no relevant epidemiological studies [12, 13 ]. this study was carried out in sivas, a province in the central anatolia region of turkey, with a population of 623,000. sivas has the highest number of villages in the country and is the second largest city of turkey in terms of surface area. besides, it is the second highest city of central anatolia (altitude : 1285 m). the central anatolia region receives one of the lowest amounts of rainfall in the country and has a continental climate. the primary aim of this hospital - based study was to investigate the xfs frequency and its relationship with systemic diseases such as dm, ht, cad, smoking, and alcohol intake. this prospective, single blind, and hospital - based study was conducted at the sivas province numune hospital ophthalmology clinic between may 2013 and october 2013. this study was approved by the cumhuriyet university medical faculty clinical studies ethics committee and carried out in accordance with the principles of the helsinki declaration. cases over the age of 45 years who presented to the clinic were included in the study. a detailed ophthalmic and systemic history of the patients was obtained and a complete ophthalmic examination was performed. this examination consisted of a visual acuity test with a snellen chart, slit lamp examination, intraocular pressure (iop) measurement with the goldmann applanation tonometer, gonioscopy, visual field analysis, and dilated fundus examination. xfs was diagnosed with the presence of exfoliative material on the lens anterior capsule or iris on slit lamp examination. glaucoma was diagnosed with an iop over 21 mmhg, glaucomatous optic nerve damage, visual field defect, previous history of glaucoma surgery, or the presence of a bleb. nuclear, cortical, and posterior subcapsular cataracts were rated with the conventional 04 grading system. age - related macular degeneration (amd) was diagnosed with the findings of this disease on dilated fundus examination. information on ht, dm, cad, smoking, and alcohol intake was obtained from the patients with standard queries. the patients were divided into two groups as an xfs group and non - xfs group according to the presence of exfoliative material. the groups were compared in terms of glaucoma, cataract, amd, phacodonesis, ht, dm, cad, and frequency of smoking and alcohol intake. statistical method. the data were evaluated by means of the spss 20.0 program and the descriptive statistics were evaluated using chi - square, t - test, and logistic regression analyses. the appropriateness of the model used in logistic regression analysis was evaluated with the hosmer - lemeshow goodness - of - fit test and the was 0.95 with p > 0.05. table 1 shows the relationship between xfs and age, gender, and the other related factors. a statistically significant relationship was found between xfs and advancing age in both males and females (p = 0.001, table 2). xfs was found in 140 male patients (14.0%) and in 72 female patients (6.5%) (table 3). the xfs was bilateral in 108 of the 140 male cases (77.1%) and 53 of the 72 female cases (73.6). xfs was bilateral in 161 (75.9%) and unilateral in 51 (24.1%) of the total number of 212 cases. glaucoma was found at a significantly higher frequency in the xfs group than in the non - xfs group. the mean age of the glaucoma cases was 72.0 9.0 years in the xfs group and 62.7 9.9 years in the non - xfs group. the mean iop was 15.02 5.07 mmhg in the xfs group and 14.17 2.80 mmhg in the non - xfs group. this difference between two groups for iop was found to be statistically significant (p = 0.001, table 1). the mean iop in the affected eye (16.85 6.16 mmhg) was found to be significantly higher (14.65 3.82 mmhg) than the other eye in unilateral xfs cases (p = 0.037). the relationship between xfs and cataract, phacodonesis, and amd was found to be statistically significant (p = 0.001). the results are shown in table 1. according to the results of the logistic regression analysis adjusted for age, a strong relationship was found between xfs and glaucoma, cataract, phacodonesis, and amd (table 4). after adjusting for age, the relationship between xfs and age, male gender, and cad was found to be statistically significant (p = 0.001, p = 0.001, and p = 0.016, resp.). it is reported to show a wide variation with a frequency of 0% in eskimos, 0.4% in china, 3.4% in japan, 9.1% in jordan, 16.1% in greece, and 23% in sweden [1419 ]. the xfs frequency in the other two studies conducted in turkey was 7.2% in the eastern mediterranean region in the yalaz. reported an increased xfs frequency with increase in the annual number of sunny days, decreased mean high july temperature, decreased mean january low temperature, and lower elevation above sea level. according to data from the turkey general directorate of meteorology, the mean temperatures of july and january in sivas province were 20.2c and 3.3c, respectively, and the duration of sunshine was 2421 hours / year with an altitude of 1285 meters. however, a high xfs rate has been reported in navajo indians living in arizona at an altitude of about 1500 m. sivas has relatively low july and january mean temperatures and also a relatively high altitude. this study has shown a significant increase in xfs frequency with advancing age along with other studies [1618 ]. xfs was also found to be more frequent in male patients than in females and this difference was statistically significant.. found xfs to be more common in males, but cumurcu. found no relationship between gender and xfs. there are studies reporting a higher xfs frequency in males and in females [18, 19 ]. however, many studies have reported no significant relationship between gender and xfs [16, 17, 22 ]. as in previously reported studies, as 6.9% in xfs patients. the high frequency of glaucoma in this hospital - based study may be due to the regular follow - ups attended by glaucoma patients. similarly a high frequency of glaucoma has been found in hospital - based studies with reported rates of 33.1% by al - bdour. kaljurand and teesalu reported a high frequency of 35.7% for glaucoma in their population - based study although the glaucoma frequency is generally lower in population - based studies [4, 26, 27 ]. there is a well - known relationship between cataracts and xfs [17, 25, 28 ]. regarding the cataract frequency in xfs cases in studies conducted in turkey, yalaz. found a frequency of 84.6% similar to our result while cumurcu. reported a lower rate at 43.6%. similarly, al - bdour. reported a phacodonesis frequency of 7.9% in xfs patients. a statistically significant relationship was found between amd and xfs in our study, similar to other studies [31, 32 ]. the blue mountains eye study reported a significant relationship between xfs and a history of ht, a history of angina or combined angina or myocardial infarction, and a history of stroke. while no relationship was found between xfs and ht or dm in our study, a significant relationship was found with cad. of the studies from turkey, citirik. showed a significant relationship between cad and xfs, but emiroglu many studies have shown a positive relationship between cardiovascular diseases and xfs [4, 3335 ]. furthermore, elevated blood homocysteine levels have been reported to be a risk factor in terms of cardiovascular disease in xfs patients. however, other studies have found no relationship between xfs and cardiovascular disease [3638 ]. in conclusion as far as we are aware, this hospital - based study is the first from turkey to investigate the relationship between xfs and ht, dm, and cad. the frequency of unilateral and bilateral xfs was 10.1% in this hospital - based study. a statistically significant relationship was found between xfs and advancing age, gender, and cad. | aim. the aim of this study was to investigate the frequency of exfoliation syndrome in the central anatolia region of turkey and to evaluate its relationship with cardiovascular and ocular diseases. methods. patients over the age of 45 years who presented to the clinic were included in the study. all cases underwent a comprehensive ophthalmology examination. exfoliation syndrome was diagnosed with the presence of exfoliative material on the lens anterior capsule or iris on slit lamp examination. the patients were divided into two groups as the exfoliation syndrome group and nonexfoliation syndrome group according to the presence of exfoliative material. results. exfoliative material was found in one or both eyes of 212 of the 2103 patients (10.1%) evaluated within the scope of the study. a significant relationship was found between exfoliation syndrome and increasing age and male gender. a significant relationship was found between exfoliation syndrome and glaucoma, cataracts, age - related macular degeneration, and phacodonesis. while no relationship was found between exfoliation syndrome and hypertension or diabetes mellitus, a significant relationship was found with coronary artery disease. conclusion. the unilateral or bilateral exfoliation syndrome frequency was 10.1% in this hospital - based study. a statistically significant relationship was found between exfoliation syndrome and advancing age, gender, and coronary artery disease. |
cartap is a pesticide that was first introduced into the market in japan in 1967. its commercial names include padan, kritap, ag - tap, thiobel, and vegetox. its basic chemical structure is s, s-[2-(dimethylamino)-1, 3-propanediyl ] dicarbamothioate [figure 1 ]. it is used for the control of chewing and sucking pests and results in insect paralysis. it has been categorized as a high - effectiveness, low - toxicity, and low - residue pesticide used in rice and sugarcane fields. it is generally considered to be a safe compound with oral ld50 in the monkey of 100 - -200 mg / kg body weight. however, subsequent studies have shown that ocular instillation can result in diaphragmatic contracture and death in rabbits. we report a case of intentional ingestion of cartap hydrochloride as a suicidal attempt in a farmer which subsequently resulted in severe respiratory failure. a 27-year - old male agricultural laborer from tamil nadu, india, presented with alleged consumption of 50 ml of an unknown poison as an act of deliberate self - harm following a quarrel with his spouse. subsequently, he developed twitching movements of his limbs, urinary incontinence, and altered sensorium. he had a systolic blood pressure of 80 mm of hg, a heart rate of 120/min, and a respiratory rate of 32/min. a gastric lavage was administered followed by a single dose of activated charcoal instilled through the nasogastric tube. the provisional diagnosis made in the emergency department was of an organophosphate poisoning with acute cholinergic syndrome. basic blood investigations including serum electrolytes, creatinine, liver function tests, and complete blood counts were normal. the patient was admitted into the semi - intensive care unit and managed conservatively with fluids and cardiac monitoring. the plan was to use atropine if the patient developed bradycardia or miosis and to repeat serum pseudo - cholinesterase levels after 24 hours. twenty - four hours after presentation, the relatives were able to provide the name and container of the poison which was cartap hydrochloride 4 gm/50% sp. at 24 hours he was subsequently extubated. due to the fact that there is insufficient data regarding effective timing of the antidote, and the significant clinical recovery of our patient cartap has been recognized as an analog of nereistoxin which is a neurotoxic substance initially isolated from the annelid lumbriconereis heteropoda. the other nereistoxin analogs that are in use are bensultap, thiocyclam, and thiosultap. its primary action was earlier considered to be by direct action on and inhibition of the postsynaptic nicotinic acetylcholine receptor (achr) ion channels. due to this action it was believed that cartap hydrochloride would act as a neuromuscular blocker and hence result in respiratory paralysis in the setting of acute toxicity. a study published by liao. challenges this belief based on studies of ocular cartap exposure in mice and its action on the phrenic nerve. the conclusion was that the effect on the diaphragm was not due to neuromuscular paralysis but instead due to persistent diaphragmatic contraction resulting in respiratory failure. cartap may exert this effect primarily by promoting extracellular ca influx and induction of internal ca release. cartap inhibits the [h]-ryanodine binding to the ca2 + release channel in the sarcoplasmic reticulum in a dose - dependent manner. it was hypothesized that cartap - induced contracture was, to a minor extent, a result of inhibition of the sarcoplasmic reticulum ca pump protein ca atpase. inhibition of the atpase would result in the unloading of calcium from the sarcoplasmic reticulum. there have been a few reports of human toxicity in japan and india as part of occupational exposure. acute toxicity of the compound that has been described is nausea, vomiting tremulousness, salivation, spasms, dyspnea, and mydriasis. sodium dimercaptopropane sulfonate (dmps) and sodium dimercaptosuccinate (dms) were discovered to be effective antidotes for acute poisoning of insecticides like scd [sodium ammonium dimethyl-2-(propane-1, 3-dithiosulfate) monohydrate ], nereistoxin, and cartap in mouse models. cysteine was found to be of lower effectiveness and shorter duration of action than these compounds. at present the recommended antidotes for cartap poisoning are an intravenous injection of 100200 mg of l - cysteine or an intramuscular injection of 2060 mg of british anti lewisite (dimercaprol ; 2, 3-dimercapto propanol). it is possible that the effect of calcium binding of these antidotes is central to the antagonistic effects on respiratory depression in cartap toxicity. to the best of our knowledge this is the first reported case of cartap hydrochloride poisoning as a result of deliberate self - harm that manifested with acute respiratory distress and altered sensorium. | cartap hydrochloride, a nereistoxin analog, is a commonly used low toxicity insecticide. we describe a patient who presented to the emergency department with alleged history of ingestion of cartap hydrochloride as an act of deliberate self - harm. the patient was managed conservatively. to our knowledge this is the first case report of cartap hydrochloride suicidal poisoning. cartap toxicity has been considered to be minimal, but a number of animal models have shown significant neuromuscular toxicity resulting in respiratory failure. it is hypothesized that the primary effect of cartap hydrochloride is through inhibition of the [3h]-ryanodine binding to the ca2 + release channel in the sarcoplasmic reticulum in a dose - dependent manner and promotion of extracellular ca2 + influx and induction of internal ca2 + release. this results in tonic diaphragmatic contraction rather than paralysis. this is the basis of the clinical presentation of acute cartap poisoning as well as the treatment with chelators namely british anti lewisite and sodium dimercaptopropane sulfonate. |
briefly, ten american women participated in a randomised cross - over trial, consuming the following treatments : 100 g biofortified cassava ; 100 g biofortified cassava with 15 ml added oil ; and 100 g typical white cassava with 15 ml oil plus a retinyl palmitate (rp) tracer, with 2-week washouts between treatments. rp and bc concentrations in the tag - rich layer (trl) of plasma increased with both biofortified cassava treatments. changes in rp in the trl plasma fraction were combined with fao consumption data to model the daily bc intake and rp formation of african women that could be expected if all of the cassava in their diet was replaced with the variety of biofortified cassava used in our study. cyanide data from the second and third soaking procedures were used to simulate the effects of marginal processing, such as occurs during drought or in populations unfamiliar with cassava, and was also combined with fao consumption data to model the daily cyanide exposure of african women from consumption of the current variety of biofortified cassava. the following procedures were conducted for each woman : height, weight and blood pressure measurements ; pregnancy prescreening ; and administration of health questionnaires. subject demographics and inclusion and exclusion procedures are described in more detail elsewhere. as expected, rp formation from biofortified cassava in these women varied greatly. also as usual, this variation did not depend on demographic characteristics of the subjects such as body weight, bmi or age. this study was conducted according to the guidelines laid down in the declaration of helsinki and all procedures involving human subjects were approved by the university of california, davis institutional review board no. biofortified cassava (gm 905 - 69) bred to contain elevated bc concentrations was provided by the international center for tropical agriculture. typical white cassava, which contained negligible amounts of bc, was acquired from the las montanas supermarket. biofortified cassava was placed on dry ice and air freighted to san francisco, and then transported by road to the western human nutrition research center, davis, ca, usa. the roots were washed, peeled and flash frozen, and then stored in a food - safe freezer at 20c in the metabolic kitchen and human feeding laboratory. before preparation, the roots were thawed overnight at 4c, and then rinsed twice with deionised (di) water. tips from the distal and proximal ends were cut (12 cm) and the peel removed. four volumes of di water were added to the cassava, mixed and changed every 2 h for 8 h. following the last draining, the cassava was rinsed with di water, and simmered (95c) in ten volumes of di water for 30 min, until it was just tender. boiled cassava was drained, cooled and aliquots were stored in 50 ml polypropylene centrifuge tubes wrapped in aluminium foil under n2 at 20c, in a food - safe freezer. as a precaution to preserve carotenoids, all procedures were conducted under dim light to minimise light exposure. briefly, 100 g cassava were mixed with quick - cooking oatmeal (40 g), imitation butter flavouring (05 g), pears canned in light syrup (150 g), salt (05 g), honey (21 g), raisins (189 g) and unfortified rice milk (2455 g). the porridge, total weight 577 g, was microwaved until a temperature of 165f was reached. the first contained no added oil, but had 6 g of fat in the meal. this meal had a very low fat content, representing the fat content from a monotonous staple diet. the second porridge had 15 ml of added oil, for a total of 20 g fat. this meal had a fat content representing a diversified diet. however, the 20 g fat porridge reflects a less typical fat intake for a single meal (breakfast) of 41 %, which is almost half the average daily per capita fat intake for sub - saharan africa. each step of cassava preparation was analysed for cyanogenic glycosides using a la motte cyanide in water test kit (lamotte). cassava preparations (1 g) were added to a 15 ml test tube, were mashed with a mortar, and then mixed with 7 ml of di water by vortexing for 1 min. preparations were left at room temperature (22c) for 20 min and then vortexed for 20 s before filtering through a 02 m pall gelman acrodisc (sigma aldrich) into a lamotte test tube. the water extracts were tested by following the manufacturer 's specifications. to confirm the results, the final prepared samples were analysed by applied specialization and consulting llc, bothwell, wa, using alkaline hydrolysis, distillation and ion chromatography with pulsed amperometric detection. subjects ate a low - fat, low - carotenoid, low - va diet for 7 d prior to each intervention. for the first 4 d, subjects were asked to avoid dark green, red, orange and yellow fruits and vegetables (which are good sources of carotenoids), liver, giblets, herring, va - fortified cereals and multivitamins. for the last 3 d prior to each cassava treatment, subjects came to the western human nutrition research center and were given a take - home diet that was low fat, low carotenoid and low va. each cassava treatment consisted of one large bowl of cassava porridge, described earlier. the subjects ate no other meals that day until dinner time, approximately 105 h later. at dinner time, they were given a low - carotenoid, low - va, low - fat dinner. treatments were randomly assigned, with researchers blinded to the treatments given. blood collection and analysis blood samples were collected from the subjects at baseline and five more times postprandially (at 2, 35, 5, 725 and 95 h). a 1 ml sample of plasma was added to a 22 ml polyallomer ultracentrifuge tube (beckman coulter) and overlaid with a prepared nacl salt solution (density = 1006 this was ultracentrifuged in a beckman coulter optima tlx containing a swing - out rotor type beckman tla 100 ultracentrifuge at 130 000 g for 20 min at 4c. the tube was then placed in a beckman centritube slicer and sliced at a fixed position to isolate the trl plasma fraction. carotenoids and va were extracted from 1 g homogenised samples of the cassava porridges and the pre - test day diet using a liquid liquid extraction was used to isolate carotenoids and va within the trl plasma fraction. methanol (1 ml) was added to the trl plasma fraction, and then compounds were extracted twice with 1 ml hexane. plasma and food sample injections (20 l) were analysed by reversed - phase hplc with electrochemical detection. the system contained an esa model 582 solvent delivery system (dionex (esa)), an esa model 542 autosampler and an esa model 5600 coularray electrochemical detector. carotenoids and retinoids were separated with an esa md-150 column (150 mm 32 mm, 3 m pore size), using a ch30 eppendorf column heater (eppendorf) at 37c. gradient elution was with methanol02 m - aqueous ammonium acetate (90:10, v / v) and methanol isopropanol ammonium acetate (78:20:2, by vol.), at a flow rate of 08 ml / min. cell potentials were set at 400 mv for carotenoids and 700 mv for retinoids. retention times were 32, 126, 148 and 202 min for retinol, echinenone (internal standard), rp and bc, respectively. inter - assay precision was monitored using a spiked pooled plasma sample purchased from utak. subjects were aged 29 (sd 2) years, had a bmi of 231 (sd 7) kg / m and normal cholesterol, tag, glucose, hb and haematocrit. rp concentrations were 87 (sem 135) and 749 (sem 115) nmol h / l for biofortified cassava with added oil, and biofortified cassava without added oil, respectively. initial cyanide concentrations varied from 280 to 551 parts per million (ppm), decreasing to 404 ppm after the second wash and 061 ppm after the third wash. data from the feeding study were combined with fao cassava consumption estimates to model the bc intake, the bc to va conversion and cyanide exposure of african women. equations (1)(3) describe the methodology : (1) rs is the ratio of va formed from ingested bc for the sth subject ; s ranges from one to ten ; it represents each of the ten subjects in the feeding study. rpbs and rprs are the auc (nmol h) of the newly digested rp in the plasma trl fractions for the biofortified and white cassava with rp tracer, respectively, for the sth subject. rp nmol / l plasma 00427 litre kg body weight was used for the sth subject to convert from rp / l to rp / total blood plasma volume prior to calculating auc. mw is the molecular weight of va (2865 g / mol). d is the mean ingested bc dose from the biofortified cassava, which was 2020 g. : (2) vaij represents the va formed (g / d) for the ith individual, where i ranges from one to 5000 to represent the number of simulated individuals ; and for the jth country, where j ranges from one to six to represent each of the six african countries with the highest cassava consumption. at present, only mean cassava consumption data are available for these countries. the mean consumption data used were from the following six african countries : angola (378 g / d), central african republic (371 g / d), congo (763 g / d), mozambique (591 g / d) and nigeria (313 g / d). cj represents the per capita daily cassava consumption (g) consumed in the jth country. y is the ratio of the weight of cooked cassava (g)/raw cassava (g), which was 071. b is the mean bc content of the cooked cassava (g / g). ri is the amount of va formed from the ingested bc, calculated as a sampled ratio derived from a log - normal distribution, which was developed with the means and standard deviations of the log - transformed vector of rs values. rs is described in equation (1) earlier ; for the ith individual, with i representing the number of simulated individual ratios (which are indexed from one to 5000). the number of individuals simulated was increased progressively to 5000 where a stable pattern developed : a 1 % or less change in the means and standard deviations for replicate runs. the log - normal distribution was employed to account for the inter - individual variability of the formation of va from bc in larger groups of women. yjp is the cyanide exposure (mg / kg per d) from consumption of the cassava porridge in the jth country, j ranges from one to six (representing the six african countries with the greatest intakes of cassava) ; and from the pth soak, where p ranges from one to two. this represents the data obtained from the second and third cassava soakings in our preparation procedure. cj represents the daily per capita cassava consumption (g) consumed in the jth country. y is the cooked cassava yield of 071, explained in equation (2) earlier. wp is the cyanide concentration in the raw cassava (mg / kg) after the pth soak. f is a 555 % retention factor for cyanide after the cassava is boiled. the following benchmarks were used in the evaluation of intake estimates (g / d) and exposure estimates (mg / kg per d) : the recommended dietary reference intake for va of 500 g / d for females 1965 years of age ; the safe upper limit (for preformed va) of 3000 g / d ; the rfd for cyanide exposure of 6 10 (mg / kg per d). the ratio of cyanide exposure to rfd was employed in the comparison of exposure for different countries. all computational tasks were performed using the r programming language and environment for statistical computing (r version 2.13.0, http://cran.r-project.org/). the control cassava porridge, representing the cassava currently available for use, contained a negligible amount of bc and thus it was estimated that no va was formed from white cassava. va intake (g / d) estimates from consumption of both types of biofortified cassava porridge (6 g fat and 20 g fat) were compared (fig. 1). generally, the presence of added fat increased the absorption of bc and its conversion to va. however, these differences were non significant, probably due to the small number of subjects tested and the large variations between subjects. 1.distribution of individuals ' daily vitamin a (va ; g in log base 10 scale) intake from consumption of both types of porridge : porridge with 6 g fat () and porridge with 20 g fat (). distribution of individuals ' daily vitamin a (va ; g in log base 10 scale) intake from consumption of both types of porridge : porridge with 6 g fat () and porridge with 20 g fat (). the percentage of each country 's individual daily intake of va (g / d) meeting the fao va recommendations of 500 g / d is presented (table 1). biofortified cassava, fed at the average daily intake of people in the respective countries, is estimated to meet the nutrient recommendations of 91569982 % (6 g fat porridge) and 84849754 % (20 g fat porridge) of the population of these countries, from the lowest cassava consumption (nigeria) to the highest cassava consumption (congo). table 1.summary of individuals meeting vitamin a (va) recommendations and exceeding the upper limit (ul) for preformed vacountryporridge type (g fat)meet recommendations (%) exceed ul for preformed va (%) angola695041354angola2088823112central african republic694861278central african republic2088383040congo699824848congo2097545692ghana698563038ghana2094624376mozambique698903352mozambique2095364644nigeria691560808nigeria2084842540 the number of individuals/5000 100 for each country that met the 500 g / d recommended safe level for va. the number of individuals/5000 100 for each country that exceeded the ul of 3000 g / d for preformed va. summary of individuals meeting vitamin a (va) recommendations and exceeding the upper limit (ul) for preformed va the number of individuals/5000 100 for each country that met the 500 g / d recommended safe level for va. the number of individuals/5000 100 for each country that exceeded the ul of 3000 g / d for preformed va. if the cassava was prepared as in our study, with six soaks and rinses, then there would be no detectable cyanide present in the cassava. the soaking method used in our study was developed so that we could monitor the amounts of cyanide and bc during preparation. it is not a common processing method in africa, although it resembles the common method of soaking cassava in a stream or other sources of running water for several hours. it shows that careful preparation of the biofortified cassava results in a non - toxic product that retains most of its bc. therefore, we estimated the cyanide exposure (g / kg per d) from consumption of the biofortified cassava variety used, as if it were soaked two or three times. although the processing procedures differ, the cyanide residues left after two or three soakings are similar to those left after the common african processing methods of heap fermentation or soaking in still water. after two and three soakings, the cassava retains some residual cyanide (table 2). the ratio (exposure to rfd) values (table 3) demonstrated a marked reduction in cyanide exposure between the second and the third soaking : 13013171 after the second soaking ; and 196479 after the third soaking ; as expected, the lowest exposure would theoretically be in nigeria, the highest in congo. table 2.cyanide residue according to the number of soakings(mean values and standard deviations)cyanide residue (mg / kg)times soakedmean sd 15510682404110306100940250435nd6ndnd, not detected. mg cyanide / kg raw biofortified cassava. table 3.summary of cyanide exposurecountrytimes soakedexposure (g / kg per d)ratio of exposure to rfdangola29431571angola3142237central african republic29251542central african republic3140233congo219033171congo3287479ghana213742290ghana3207346mozambique214742456mozambique3223371nigeria27811301nigeria3118196rfd, reference dose. exposure (g / kg per d) = mg cyanide / kg raw biofortified cassava multiplied by a 555 % boiling retention factor for cyanide multiplied by the consumed cooked cassava yield (g) for each country, all divided by the mean body weight (kg) of the ten subjects. exposure (g / kg per d)/rfd of 6 10 (mg / kg per d). cyanide residue according to the number of soakings (mean values and standard deviations) mg cyanide / kg raw biofortified cassava. summary of cyanide exposure exposure (g / kg per d) = mg cyanide / kg raw biofortified cassava multiplied by a 555 % boiling retention factor for cyanide multiplied by the consumed cooked cassava yield (g) for each country, all divided by the mean body weight (kg) of the ten subjects. exposure (g / kg per d)/rfd of 6 10 (mg / kg per d). this study modelled the effectiveness of bc - enhanced cassava as a means of increasing bc intake in specific african countries with va deficiency. if the current biofortified cassava variety replaced 100 % of the cassava currently consumed, then it would provide sufficient bc to meet the recommended dietary intake of va for almost all women. currently, when the potential impact of a biofortified food on va status is estimated at all, it is by using conversion factors to calculate the mean retinol equivalents or retinol activity equivalents that are formed by the intervention. the conversion factor used by the united states institute of medicine to calculate retinol activity equivalents is 12 g bc:1 g va. if this conversion factor is used to estimate va intake, then individuals eating the average amounts of cassava in angola, central african republic, congo, ghana, mozambique and nigeria would consume 451, 443, 910, 657, 705 and 373 g / d, respectively. 1) should be a superior method of analysis since it addresses inter - individual variation. thus, it estimates the range of va that individuals would attain from this intervention and the number of individuals meeting or failing to meet recommendations. to our knowledge, this is the first distributional analysis of the potential impact of a biofortified food on va status in any population. mean va intake from the consumption of biofortified cassava met dietary recommendations, on average (500 g / d), for the six countries for 96 % of the individuals eating the lower - fat cassava (6 g fat porridge). despite the fact that added oil increased the mean intake estimates of va in every country, it also increased the variability in the amount ingested. because of this increase in variability, the average percentage of people meeting their dietary recommendation actually decreased slightly, to 92 % (20 g fat porridge). thus, the present results suggest that the low intakes of fat typical in africa are sufficient to convert the bc in biofortified cassava to va. our calculations suggest that the amount of va formed from biofortified cassava would greatly exceed recommendations for some women who replaced white cassava with biofortified cassava in their diets (fig. however, the upper limit for va is for preformed va, and not for va formed from carotenoids. although many aspects of carotenoid metabolism remain obscure, it is known that high carotenoid concentrations are poorly absorbed and converted to va. for example, high carotenoid intakes do not cause these acute symptoms even when intakes are prolonged. in fact, carotenoids were originally believed to be essentially non - toxic even at very high dosages, and no upper limit for carotenoids has ever been set. unfortunately, results from the alpha - tocopherol, beta - carotene cancer prevention (atbc) study and the beta - carotene and retinol efficacy trial (caret) lung cancer trials have demonstrated that smokers who ingested pharmacological doses of bc increased their risk for cancer, suggesting that it is useful to take extra caution when consuming higher than recommended carotenoid intakes. because food - based interventions are intended to reach all populations including young children and pregnant women, we believe it is appropriate to take a conservative approach. furthermore, these equations can be used for other nutrients and toxicants, where estimating the upper safe limit of intake is more useful. the present results suggest that food - based interventions in which biofortified cassava is substituted for typical cassava should be monitored for signs of carotenoid overconsumption. fortunately, this can be monitored easily since consuming large amounts of carotenoids can lead to carotenodermia, which appears as a yellowing of the skin. for all the ten subjects, the conversion ratio of bc to va varied 3400 % (03106:1) for the 20 g porridge compared with 900 % (14121:1) for the 6 g fat porridge ; this greater variation is also depicted by a greater interquartile range for the 20 g fat porridge as compared with the 6 g fat porridge (fig. 1). the wide range of conversion ratios of bc to va seen in this study are as expected ; similar ranges are seen in other studies, even those that provide bc as purified supplements instead of food. in fact, subjects living under controlled conditions, with very similar demographic characteristics and health histories, have widely divergent values for carotenoid absorption and conversion. the reasons for this variation are not completely understood, although several genetic polymorphisms appear to be important. since demographic characteristics are not predictive of bc absorption and metabolism, they are not included in our model. this method allowed us to control the detoxification process and ensure that the volunteers in our study consumed no cyanide. popular detoxification methods in africa include heap drying, soaking in running or still water and fermentation. some of these methods, especially garification, remove most of the cyanide from cassava ; although the most common preparation methods leave cyanide residues, which can exceed the who guideline of 10 mg hcn equivalents / kg. for example, 77 % of the cassava chips tested in australia exceeded the guideline, with a mean of 642 mg hcn equivalents / kg. this mean concentration is greater than our cyanide residues after soaking once (table 2). even so, individuals living in congo who prepare cassava by methods that leave cyanide residues similar to our data from soaking cassava twice could be exceeding the rfd by thirty - two times (table 3). these results suggest that cyanide levels in biofortified cassava and its preparations could be a health concern. certain limitations on the bc intake and cyanide exposure modelling must be addressed. per capita data were used in this study and represent the average intake for an entire country, which does not account for inter- and intra - individual variation in eating habits. currently, data on inter- and intra - individual variation of cassava intake for these countries nationwide are unavailable, and there is little information on the range of cassava consumption even at the local level. however, studies show a range of consumption from 0 to 75 % of energy, with means ranging from 15 to > 50 % energy. more studies are required in order to gather detailed food consumption data for african countries which will improve the accuracy of both the va and the cyanide estimates. a second limitation is that this study used ratios of va conversion from ingested biofortified cassava for ten american women. these ratios will most probably differ from those of african women because of differences in the frequency of genetic polymorphisms, microflora, health history, va status and diet. the techniques provided herein can be applied to studies of larger groups of people in africa to increase the accuracy of these ratios. furthermore, the approach outlined in this study is not only suitable for the estimation of the risk benefit from consumption of biofortified cassava, but can also be used to calculate the risk benefit of other dietary interventions. cassava crossbreeding and specific processing have been employed in this study to demonstrate a means of increasing nutrient intake, while minimising exposure to a food component of toxicological concern. the approach used in this study can be used for other foods with similar nutrient toxicological concerns. | vitamin a (va) deficiency causes disability and mortality. cassava can be crossbred to improve its -carotene (bc) content ; typical white cassava contains negligible amounts of bc. however, cassava contains cyanide and its continued consumption may lead to chronic disability. our objective was to estimate the risk benefit of consuming bc - enhanced cassava to increase va intake. a total of ten american women were fed white and bc - enhanced cassava. bc and cyanide data from the feeding study were combined with african cassava consumption data to model the potential daily bc, va and cyanide intakes of african women. if bc - enhanced cassava replaced white cassava in the diets, it could theoretically meet recommended va intakes for the following percentages of individuals from six african countries that consume cassava as a staple crop : angola (95 %), central african republic (95 %), congo (about 100 %), ghana (99 %), mozambique (99 %) and nigeria (92 %). cyanide intake after minimal preparation of cassava could be thirteen to thirty - two times the reference dose (rfd), a toxicological exposure reference, but could be completely removed by extensive soaking. this study demonstrates that consumption of bc - enhanced cassava, processed to maintain bc and remove cyanide, theoretically increases va intakes for african populations and other areas of the world where cassava is a staple crop. |
adipokines are produced mainly by adipose tissue, a dynamic endocrine organ involved in the regulation of various endocrine processes such as glucose and fatty - acid metabolism, energy expenditure, inflammatory response, cardiovascular function, and reproduction [1, 2 ]. in recent years, adipokines have been found to be produced by other organs also, that is, placenta, ovaries, peripheral - blood mononuclear cells, liver, muscle, kidney, heart, and bone marrow [3, 4 ], and have been related mainly to insulin sensitivity, inflammation, and other functions [57 ]. insulin sensitivity and inflammation have been shown to influence both growth [810 ] and ovarian function ; in particular there is wide evidence that polycystic ovarian syndrome (pcos) originates from insulin resistance [1114 ] and from excessive exposure to insulin. excessive exposure to insulin is related to overgrowth and skin lesions, such as acanthosis nigricans, and changes in adipokines, including reduced adiponectin and leptin levels [1, 3 ]. interestingly, certain conditions such as being born small for gestational age are associated with an increased risk of insulin resistance, metabolic syndrome, and poor growth [15, 16 ]. since barker 's theory on the fetal origin of adult disease, it has become clear that the programming of endocrine and metabolic systems is set in utero. in this review we shall focus mainly on adiponectin, leptin, resistin, and visfatin whose functions are to date better studied compared to other adipokines, considering findings in placenta and newborns, and further described knowledge related to childhood and adolescence. adiponectin is a 30 kda secretory protein, which is produced mainly by adipocytes, but also by the placenta, osteoblasts, and cardiomyocytes [8, 1720 ]. it is expressed as a full - length protein or as a smaller and globular fragment ; this latter form is generated by proteolytic cleavage by leukocyte elastase secreted by activated monocytes and neutrophils. the low - molecular - weight isoforms and trimeric isoforms seem to have effects on the central nervous system. adiponectin receptors (adipor1 and adipor2) are integral membrane proteins that are ubiquitously expressed, mediating adiponectin 's function at both the central and peripheral levels. the action mediated by adipor1 is for globular adiponectin, while adipor2 is a receptor for full - length adiponectin. in cultured cells, such as myocytes and hepatocytes, these receptors increase amp kinase (ampk) activities, peroxisome proliferator - activated receptor alpha (ppar - alfa) activities, fatty - acid oxidation, and glucose uptake [22, 23 ]. suppression of adipor1 reduces fatty - acid oxidation, which is mediated by globular adiponectin. suppression of adipor2 increases fatty - acid oxidation which is mediated by full - length adiponectin. in addition, adipors are also decreased in obesity ; several authors have demonstrated that expression of both adipor1 and adipor2 are significantly decreased in muscle and adipose tissue of insulin - resistant mice. these data suggest that adiponectin receptors adipor1 and r2 play important roles also in the regulation of insulin sensitivity and glucose metabolism. functional and genetic studies on adiponectin strongly suggest that reduction in adiponectin levels plays a causal role in the development of insulin resistance (ir), metabolic syndrome, type 2 diabetes, and atherosclerosis. adipokines increase expression of fatty - acid transport and, by activation of peroxisome proliferator - activated receptors (ppars), increase fatty - acid combustion and energy consumption. reductions in plasma adiponectin levels are commonly observed in a variety of states frequently associated with insulin resistance and metabolic syndrome as shown by von frankenberg. who demonstrated that adiponectin levels decrease by increasing the number of metabolic syndrome criteria. obesity is well known to be characterized by a state of low grade chronic inflammation. interestingly, adiponectin has been shown to have an anti - inflammatory action and is reduced in obesity. adiponectin primarily acts modulating macrophage function suppressing tnf - alpha secretion by inhibiting tnf - alpha transcription. this inhibitory action plays an important role on nf - kb activation mediated by tnf - alpha [30, 31 ]. it is well known that il-10 has an anti - inflammatory action and can inhibit production of many proinflammatory cytokines [32, 33 ]. summarizing, low adiponectin in obesity may contribute to explaining inflammation in these patients. leptin is the 167-amino acid product of the human leptin gene (ob gene). it is primarily secreted by the white adipose tissue but is also produced by placenta. leptin secretion is pulsatile and has significant diurnal variations with higher levels in the evening and early morning and shows relationships with other hormones having a circadian rhythm such as cortisol. the relationship between these two hormones is explained by the direct stimulatory action that leptin has on crh. leptin effects are mediated by binding to specific leptin receptors, expressed in the brain and in peripheral tissues such as muscle, liver, adipose tissue, and so forth. there are several isoforms of leptin receptors (obrs), the most important are obra and obrb. different functions of leptin have been described, including mediation of food intake, liver glucose production, gonadotropin secretion, suppression of lipogenesis in adipose tissue, and modulation of immune response [37, 38 ]. leptin levels decrease consistently during starvation : low leptin levels induce complex mechanisms in order to preserve energy, that is, increase in appetite, decrease in thermogenesis, decrease in locomotor activity, inhibiting the hypothalamus - pituitary - thyroid axis, activating the adrenal axis, and inhibiting reproductive function. leptin levels are related to timing of gnrh and lh secretion as shown in some studies that speculate that reduced pulsatility of lh during the night may be related to low leptin levels present during these hours [39, 40 ]. this adipokine may therefore play a critical role in regulating both energy homeostasis and the reproductive system, acting as a signal of energy reserve essential for normal reproductive function. resistin is a 12.5 kda peptide, whose name derives from its ability to resist insulin action. in humans, this adipokine is mainly secreted by peripheral - blood mononuclear cells. there are two different forms of resistin : low- and high - molecular - weight isoforms [8, 42 ]. resistin acts through interaction with toll - like receptor (tlr) 4 in human myeloid and epithelial cells. tlr activation initiates a cascade of intracellular events leading to alterations in several transcriptional and signaling pathways, including nf - kb signaling, and thus is tightly connected with inflammatory responses. resistin was first described as a factor contributing to the development of insulin resistance and diabetes mellitus in humans ; a debate is still ongoing regarding its exact role in obesity, in insulin sensitivity, and in the development of type 2 diabetes mellitus (dm2). many authors indicate a solid association between this adipokine and insulin resistance [45, 46 ]. some data suggest that resistin has a role in inflammatory processes, and resistin seems to directly cause endothelial dysfunction. resistin stimulates secretion of proinflammatory cytokines such as tnf - alpha and il-6 by macrophages through the nf - kb pathway. in mouse and human models, an increase in resistin levels has been described in patients having nonalcoholic fatty liver disease (nafld), and resistin serum levels have been reported to correlate with hepatic inflammation and necrosis. it was previously identified as a protein involved in b cell maturation and is identical to pre - b cell colony - enhancing factor (pbef), described in 1994 as a cytokine produced by lymphocytes, acting on lymphocyte maturation and inflammatory regulation. visfatin acts both as a paracrine and an autocrine agent and is secreted by adipose tissue, but it seems to be expressed also in liver, muscle, kidney, heart, bone marrow, and trophoblast and fetal membranes [52, 53 ]. recently, visfatin was described as a protein with insulin - like functions. in human studies, a positive correlation between visceral adipose tissue and visfatin gene expression was reported, along with a negative correlation between visfatin and subcutaneous fat, suggesting a different regulation of its expression in these different depots. variable results have been obtained regarding the relationship between visfatin and diabetes or insulin resistance with some authors showing increased visfatin levels in type-2 diabetes and pcos patients [55, 56 ]. furthermore, the role of visfatin in ovarian and/or uterine regulation, via insulin sensitivity or through other mechanisms, remains to be demonstrated yet. in table 1 we summarize the site of production and the relationship of the above - mentioned adipokines with inflammation, metabolic and reproductive functions. the above - mentioned cytokines have all been described in the human placenta in recent years and shown to be related somehow to fetal growth and adiposity. in recent years a potential importance of epigenetic changes in some adipokines is arising relative to metabolic programming and might be involved in the regulation of subsequent postnatal growth and puberty. adiponectin is a placental - produced adipokine whose concentrations have been shown to be related to birth weight [8, 59 ]. adiponectin concentrations in cord blood of at - term neonates are two to three times higher than those reported in adults [6062 ]. the mechanisms by which adiponectin levels are regulated in the placental tissue are not yet well defined. in adults, an increase in fat mass is associated with increasing adiponectin levels, whereas weight loss is associated with reduction in adiponectin concentrations. moreover, fat mass seems to act as a negative feedback for adiponectin secretion ; the lack of such negative feedback in newborns could contribute to hyperadiponectinemia. several authors showed a positive correlation between cord blood adiponectin concentrations and birth weight, with higher adiponectin levels in adequate for gestational age (aga) newborns compared to small - for - gestational age (sga) and intrauterine growth restricted (iugr) newborns [6365 ]. adiponectin in placental lysates has been described to be significantly lower in iugr compared with aga newborns and positively correlated with the weight of the placenta, birth weight, and head circumference. in this respect, a study from mazaki - tovi. evaluated adiponectin and leptin levels in twins with discordant and concordant growth : in the discordant twin group, while there was no significant difference in the median cord blood leptin concentrations between sga twins and aga cotwins, adiponectin levels were significantly lower in growth restricted newborns compared with the concentrations observed in the concordant twins which were similar. adiponectin acts as an insulin sensitizing hormone reducing hepatic glucose production and enhancing the insulin - mediated actions of the liver. low adiponectin levels in low birth weight newborns may therefore predict the subsequent development of visceral fat and insulin resistance. moreover, cianfarani. evidenced particularly lower adiponectin levels in sga children who showed postnatal catch - up growth, compared to those who remained small during late childhood, suggesting a potential role of early catch - up growth for subsequent development of metabolic disturbances. regarding large for gestational age (lga) newborns, another study from mazaki - tovi. showed that adiponectin placental and cord blood concentrations were lower in macrosomic newborns than in the aga counterparts. given that fat mass acts as a negative feedback on adiponectin production and given that hypertrophic adipocytes produce less adiponectin, we can consider the low expression of adiponectin in lga as a manifestation of these assumptions. recent studies showed a positive association between adiponectin and birth length, which may be the expression of the insulin sensitizing action of adiponectin on tissues. furthermore, oshima. demonstrated an adiponectin - induced activation of osteoblasts, an action that is likely linked to fetal linear growth. in this context, ibez. recently described that iugr fetuses show a different pattern of adiponectin production, shifted to the high - molecular - weight isoform which is known to be the most closely related isoform to insulin sensitivity. we can assume that this different pattern acts as an insulin sensitizer in the fetus and may promote fetal catch - up growth. another aspect of the expression of this adipokine, which suggests a role for adiponectin in fetal growth, is the inverse correlation described between its serum levels and gestational diabetes or obesity. interestingly, adiponectin gene dna methylation has been shown to be influenced by maternal hyperglycemia [58, 69 ]. bouchard. described lower methylation in the promoter of the adiponectin gene on the fetal side of the placenta in the presence of maternal hyperglycaemia, suggesting that this could contribute to the increased risk of reduced insulin sensitivity, obesity, and diabetes in the offspring in postnatal life. expression of leptin is widespread in fetal and placental tissues and a relationship between umbilical leptin concentrations and fetal growth indexes, such as birth weight, length and head circumference, and bone mineral density, has been established [71, 72 ]. leptin serum concentrations are elevated in the fetus at term, probably acting as a feedback modulator of nutritional conditions and substrate supply. a significant correlation between leptin levels in umbilical cord blood and birth weight of neonates has been described [71, 72 ]. infants born small for gestational age (sga) show lower leptin levels than their appropriate for gestational age (aga) counterparts. described a relationship between low concentrations of leptin and fetuses born at term with intrauterine growth restriction (iugr), whereas macrosomic offspring of diabetic mothers showed high leptin serum concentrations. this latter finding was thought to be possibly related to maternal hyperglycaemia that leads to fetal hyperinsulinaemia, which in turn would cause macrosomia via elevated leptin serum levels. in the same study, the placental expression of leptin in a twin pregnancy in which one baby was normal sized while the other showed growth retardation was evaluated : lower levels of leptin were detected in the samples of the growth retarded twin. found significantly higher leptin levels in large for gestational age (lga) infants than in their aga counterparts. furthermore, leptin has been repeatedly found to be positively related to other factors (i.e., insulin and igf - i) which are well known to be associated with intrauterine growth. new insights into the role of leptin in fetal growth have shown cell and tissue specificity, thus leading to speculate that its role in fetal growth may be cell- and tissue - specific [7375 ].. investigated the changes in maternal leptin levels in pregnancies complicated by preeclampsia : maternal plasma leptin levels were significantly higher than those of the control group and showed a negative correlation with neonatal body weight. furthermore, leptin mrna expression was significantly increased in placenta from women with pre - eclampsia compared to the control group, showing a similar behaviour as other inflammatory cytokines in that condition. plasma leptin levels in affected women who delivered sga newborns were significantly higher than those in women who delivered aga newborns. furthermore, the incidence of sga newborns in women who showed elevated plasma leptin levels was higher than that in women with normal leptin levels. these findings suggested a close correlation between fetal growth restriction and elevated maternal plasma leptin levels. a study comparing pregnancies complicated by gestational diabetes with macrosomic babies and healthy age - matched pregnant women and their newborns concluded that gestational diabetes was associated with a downregulation of maternal th1 cytokines (il2 and ifn gamma) and an upregulation of leptin and inflammatory cytokines. furthermore, during pregnancy characterized by impaired glucose tolerance and gestational diabetes, placental dna methylation was reported to be increased on the maternal side of the placenta and to be related to hyperglycaemia. this was associated with leptin gene methylation in placenta and with increased circulating leptin levels in hyperglycaemic pregnant women. these mechanisms could further confirm why newborns exposed to gestational diabetes mellitus have an increased risk of developing obesity and t2 dm [58, 81 ]. measured resistin expression in maternal adipose tissue, placenta, and fetal membranes and they found out that trophoblastic resistin gene expression was significantly higher in at term placenta than in first trimester placental tissue and that plasma resistin levels in pregnant women were higher than resistin levels in nonpregnant women. high concentrations of resistin in cord blood samples may suggest that this hormone is potentially related to the control of fetal energy expenditure and deposition of adipose tissue. the expression of resistin in the human placenta is higher than that in adipose tissue. it has been hypothesized that placental resistin may have a physiological meaning in the regulation of maternal glucose metabolism by decreasing insulin sensitivity during human pregnancy. resistin in placental lysates has been reported to be positively correlated with placental insulin concentration. in the study from lappas. resistin levels were found to be significantly lower in macrosomic fetuses of diabetic mothers compared to control and to be higher in growth restricted pregnancies compared to normal. maternal and cord blood serum resistin seemed therefore to have a negative correlation with birth weight. resistin is likely to have an inhibitory effect on adipose conversion, acting as a feedback regulator of adipogenesis. in this respect, as to the fetus, one could assume that low resistin levels in serum are related to excessive production of adipose tissue. this idea could explain the negative correlation described between umbilical resistin concentrations and birth weight. however, savino., interestingly, found no correlation between breast milk resistin concentrations and maternal anthropometric measurements. another study from vitoratos. did not show significant differences in umbilical resistin levels between infants born from women with gestational diabetes (gmd) as compared to normal pregnant women. in a recent review of the literature, according to the data from the 11 studies analyzed, there was no association between circulating resistin levels and gestational diabetes. so far, we therefore do not have univocal results regarding the role of this adipokine in determining fetal growth and metabolism in normal and abnormal pregnancies. findings concerning visfatin and its possible relationships with fetal growth are controversial and often inconsistent despite recent findings of high concentrations of visfatin in cord blood which leads to assuming a placental production and relationships with fetal growth. higher visfatin levels have been found in term iugr newborns compared to their aga counterparts. this finding may be linked to the different visceral adiposity or altered visceral adiposity in iugr, which is known to be related to insulin resistance in adulthood. hu. reported that serum visfatin levels were markedly decreased in women with pre - eclampsia compared with normal pregnant women. moreover, the same study showed no difference in bmi between affected and nonaffected women, suggesting that pathophysiology of pre - eclampsia and visfatin levels are bmi - independent. in table 2 we summarize the role of the above - mentioned adipokines in the determinism of fetal and postnatal growth and in the onset of gestational metabolic disturbances such as gestational diabetes. birth weight, insulin sensitivity, and adipokines are involved in puberty and its disorders. puberty is a complex physiological process influenced by different factors, including neuroendocrine circuits and many circulating molecules, some of which still remain unknown. many authors report a relationship between increasing rates of overweight and obesity in childhood and a trend towards an anticipation of pubertal onset, especially in girls. these observations have generated an increasing interest in pinpointing the mechanisms by which pubertal development and reproductive function are influenced by nutritional status. pubertal development is physiologically characterized by an increase in adipose mass and changes in adipose tissue distribution. moreover, several authors reported an increase in serum adipokine concentrations. these biochemical and metabolic modifications seem to be closely associated with the status of insulin resistance observed during this period. adipokines represent an important link between nutritional status and pubertal physiology and several pubertal disorders, such as premature adrenarche, premature pubarche, polycystic ovarian syndrome, and constitutional delay in growth and puberty. fetal programming of the endocrine axis related to intrauterine growth and events occurred during pregnancy may also contribute to the timing of puberty and to the future reproductive capacity. pubertal development disorders influence not only sexual maturity, but also adult height, bone mineral density, and reproductive health. it is well known that many factors such as midparental height, chronic diseases, medications, and pubertal development influence final height. being born sga according to either weight or length is a risk factor for growth and development disorders, as it is described that they are at higher risk of presenting a final height below their midparental height, as well as developing cardiovascular disease, obesity, diabetes, and other metabolic disorders. the mean adult height of individuals born sga was estimated to be approximately 1 sd lower compared to those born appropriate for gestational age (aga). furthermore, adult height is lower in subjects born short for gestational age than in those born light for gestational age [90, 93 ]. most studies on pubertal development in children have explored the relationship between precocious puberty and pubertal growth in children born sga. precocious puberty causes advanced bone maturation, accelerated closing of epiphysis, and may compromise adult height. precocious pubarche and precocious adrenarche have been shown to be more frequent in subjects with a low birth weight [94, 95 ]. puberty is associated with a physiological state of insulin resistance, and conditions as premature pubarche have also been related to reduced insulin sensitivity and shown to be more frequent in subjects born sga [96, 97 ]. furthermore, girls with previous prenatal growth restriction have been described to have more frequently than the general population idiopathic functional ovarian hyperandrogenism and hyperinsulinism at 18 years of age. neville and walker, in a retrospective australian study of 89 children with precocious pubarche, also reported that being born sga according to weight and/or length was an independent risk factor for precocious pubarche, along with prematurity and being overweight / obese. moreover, sga children with precocious pubarche show greater changes in weight sds than aga children. it was suggested that rapid weight gain in childhood might predispose to precocious pubarche in susceptible individuals. most authors agree on the existence of a relationship between being born sga, premature pubarche, and exaggerated precocious adrenarche. the possible causes of this association are thought to be insulin insensitivity, increased central adiposity, increased igf - i levels between the ages of 2 and 4 years and metabolic, and hormonal patterns that are common in sga children with excess weight gain in early childhood. high levels of igf - i and insulin resistance stimulate adrenal androgen secretion and the development of precocious pubarche [94, 95, 97 ]. several studies focused on timing and progression of puberty in children born sga, but the results are difficult to compare due to variations in the definition of sga, criteria of inclusion, and follow - up periods. in a large population study on postnatal growth, 87% of sga children showed full catch - up growth and reached puberty at a normal age. sga children who remained short reached puberty earlier than those who presented catch - up growth [92, 98 ]. persson. studied puberty in children divided according to perinatal risk factors : sga, large for gestational age, short for gestational age, long for gestational age, born prematurely from a pregnancy complicated by pre - eclampsia, and they also considered a group of children without perinatal risk factors. interestingly, in boys the mean age at onset of puberty was similar based on the presence or absence of risk factors, whereas in girls the onset of puberty was earlier in those born short or light for gestational age. interestingly, lazar. reported that both sga children with short stature and aga children with idiopathic short stature enter puberty at a normal age, but sga children show a distinct pubertal growth pattern compared to aga. there is no general agreement on the existence of differences in age at menarche between sga and aga girls. several longitudinal follow - up studies do not find significant differences in the progression of puberty or age at menarche between girls born sga and aga [91, 100 ] while other studies report an earlier age of menarche in girls with fetal growth restriction compared to girls born of appropriate birth weight [95, 101 ]. interestingly, one study evaluated the development of premature aga and full - term sga children, observing that menarche occurred 6 months earlier in the preterm group and 12 months earlier in the sga group with respect to full - term aga controls. the interval of time between onset of puberty and menarche was similar in all groups. if premature pubarche occurs, then menarche before the age of 12 has been reported to be 3 times more prevalent among girls born sga compared with girls with normal birth weight [95, 97 ]. many studies have shown, in animal models, that adiponectin concentrations change throughout pubertal maturation. human data confirm this trend and show differences in the pattern of secretion during puberty between males and females. in healthy lean males, but not in females, adiponectin concentrations significantly decline during pubertal maturation, with lower adiponectin levels being observed in adolescent boys compared with girls. the authors of this study further showed a negative correlation between adiponectin concentrations, testosterone, and dehydroepiandrosterone sulfate serum levels ; however, pubertal stage was shown to be the strongest independent predictor of adiponectin concentrations, followed by body mass index and testosterone. experimental data have shown for testosterone, but not for estrogens, an inhibitory action on adiponectin secretion from adipocytes, confirming a closer correlation between androgens and adiponectin compared with estrogens. data like these may well explain the gender differences reported for this adipokine concentrations in adults, with the lowest adiponectin levels being found in males. according to recent studies focused on female reproductive function, although adiponectin concentrations do not seem to change significantly during the menstrual cycle, it may play a role in oocyte maturation, granulosa cell proliferation and death, and estradiol and progesterone production. many authors are concordant on leptin playing a significant role in the onset and progression of puberty in humans. it is well known that congenital leptin deficiency, due to mutations in leptin gene or leptin receptor gene, cause early - onset obesity and absence of pubertal development. at onset of puberty in healthy boys leptin concentrations rise by approximately 50% even before the increase in testosterone, lh, and fsh and then subsequently decline to baseline values [107110 ]. in addition, nocturnal peaks in leptin secretion before puberty have been demonstrated in both rats and primates [111, 112 ]. all these data imply a role for leptin especially in the onset of puberty [113, 114 ]. leptin concentrations have been shown to rise persistently during puberty also between tanner stages iii and iv. in addition, the same authors showed a significant decrease of soluble leptin receptor concentrations (sob - r) and subsequently a continuous rise in free leptin index (fli ratio between leptin and sob - r) which are more evident during tanner stages i and ii. a rapid fli rise from tanner stage i to ii these observations suggest that fli may be a better predictor of pubertal onset and sexual maturation compared to serum leptin concentrations alone, which conversely reflects more sensitively body composition and could therefore be a better predictor of forthcoming menarche. moreover, recent molecular and genetic data on mouse models support a permissive role for leptin in the normal progression of pubertal development. indeed, numerous studies have shown how leptin may contribute to hypothalamic - pituitary - gonadal regulation, both at the central and gonadal levels. at the central level, leptin has been shown to have facilitatory effects on gnrh secretion ; leptin increases pulsatile activity of gnrh neurons in the hypothalamus in different species and in both sexes. leptin acts both on glutamatergic ventral premammillary nucleus (pmv) neurons and on gabaergic agrp neurons in the arcuate nucleus, with a stimulatory effect for the first ones and an inhibitory effect on the second ones. these groups of neurons are both linked to gnrh and/or kisspeptin neurons, thus modulating the production of gnrh. therefore, leptin may have a crucial role in the control of the hypothalamic - pituitary - gonadal axis through the modulation of these opposite signals according to the nutritional status of the body. it is important to underline that the absence of leptin signal in one of these neuronal groups does not, however, prevent sexual development, suggesting a possible compensating effect of one group of neurons on the other. these observations confirm the role of leptin as a facilitatory agent in sexual maturation and pubertal onset. in addition to its action on the hypothalamus, leptin has also been shown to control gonadal activity. indeed, several authors have demonstrated the expression of leptin receptor in both male and female gonadal tissues ; in particular, the leptin receptor has been found to be expressed in ovarian follicular cells, including granulosa, theca, and interstitial cells, and in leydig cells [116, 117 ]. in vivo and in vitro studies, high leptin concentrations seem to have an inhibitory action on estradiol production and, therefore, block the maturation of dominant follicles and oocytes. leptin also has a similar action in male gonadal tissue, with a dose - dependent inhibitory effect on testosterone production from leydig cells as demonstrated in rats. therefore, leptin would have a bimodal action on the hypothalamic - pituitary - gonadal axis : at low concentrations, such as in starvation states, it would have a permissive threshold effect on the central neuronal circuits and, at high concentrations, on the contrary, as in obese subjects, it would have an inhibitory action on the gonads. no data are available to date as to resistin and visfatin in relationship with pubertal development. concerning gonadal function, there is only one study from rak - mardya. in which the authors suggest a potential autocrine and/or paracrine role for visfatin in the regulation of estrous cycle and ovarian follicles development in porcine. in table 3 we detail the role of adipokines in puberty and pubertal development including key hormonal factors and molecules. premature pubarche is classically defined as the development of pubic hair before the age of 8 years in females and 9 years in males. the most common cause of this phenomenon is a premature activation of the adrenal cortex, a process, known as premature adrenarche, characterized by an increased production of adrenal androgens, especially dhea, dhea - s, and androstenedione. some authors have shown an association between premature pubarche and later development of insulin resistance, dyslipidemia, pcos, and metabolic syndrome (especially in patients born small for gestational age) ; however, in most cases, it represents a variant of normal pubertal development [95, 121 ]. adipokine patterns in girls with premature pubarche have been investigated, with few statistically significant data present in the literature and in some cases with conflicting results. evaluated postprandial adiponectin response in girls with premature pubarche (pp) compared to controls ; this work showed a significantly lower postprandial adiponectin area under the curve in pp girls, even after adjusting for bmi and age. teixeira. studied leptin concentrations in girls with premature pubarche, finding higher leptin levels compared to controls, independent of insulin and androgen concentrations. we are not aware of any studies relating premature pubarche with resistin and visfatin. constitutional delay of growth and puberty (cdgp) is a condition characterized by a delay in the onset of pubertal development, representing a variant of the normal pubertal pattern without a defined endocrine abnormality. data in the literature are overall still scarce, and basically only observational studies are available. leptin concentrations have been reported to be lower in adolescent boys with cdgp compared with regular and early maturers. the authors further described a positive correlation between leptin, bmi, bone age, testicular volume, fsh, lh, and testosterone concentrations confirming previous findings. therefore, sexual immaturity in adolescents with cdgp seems to be characterized, at least in part, by decreased leptin concentrations. polycystic ovarian syndrome (pcos) is one of the most common disorders in females, affecting approximately 15% of women during reproductive age. it is classically characterized by three distinctive features : hyperandrogenism, ovarian dysfunction, and polycystic morphology pattern of ovaries on ultrasound scan. a pivotal role in the pathophysiology of this syndrome considering the importance of the adipokine milieu in modulating insulin sensitivity and hypothalamic - pituitary - gonadal axis, many authors have suggested a central role for adipokines in the development of hyperandrogenism and infertility in pcos. obese women are more prone to developing pcos, and considering that these subjects show per se increased plasma concentrations of adipokines as leptin and lower concentrations of adiponectin, it is difficult to verify an independent effect of adipokines in pcos. the aim of this section is to summarize the role of several adipokines in the pathogenesis of pcos. several studies have reported that adiponectin levels in women with pcos are lower compared to non - pcos controls with comparable bmi. in vitro, adiponectin has been shown to inhibit androgen production, key enzymes involved in androgen pathways, and lh receptor gene expression from theca cells. moreover, in bovine theca cells, the knockdown of adiponectin receptor genes determined an increase in androstenedione secretion. these observations suggested that fat cell metabolism may be linked to ovarian steroidogenesis through adiponectin secretion and that disruption of adiponectin and its pathway may play an important part in the onset of hyperandrogenism in pcos. in addition, several authors have reported a correlation between lower adiponectin concentrations and the insulin insensitivity observed in women with pcos compared with controls. leptin has been thought to play a role in the onset of ovarian dysfunction in obese subjects, as previously mentioned ; hyperleptinemia might interfere with estrogen production and maturation of dominant follicles. however, most authors agree that there are no significant differences in leptin levels in women with pcos compared with controls, even after correction for weight and bmi. table 4 summarizes the main findings published in the literature concerning the relationship between adiponectin and leptin and onset of pcos. the contribution of other adipokines, such as resistin and visfatin, to the pathophysiology of pcos has been largely debated, but there is no conclusive evidence in the literature for a significant role. some authors have studied resistin serum concentrations in pcos, but the results of these studies at this time remain conflicting [125, 131 ]. patients with type 2 diabetes, women with gestational diabetes, and women with pcos tend to have higher plasma visfatin concentrations compared with controls, which would confirm its role in the determinism of insulin resistance and thus a potential role in the control of ovarian steroidogenesis. recent studies have focused on the production of adipokines not only by the adipose tissue but also by other organs such as placenta, ovaries, peripheral - blood mononuclear cells, liver, muscle, kidney, heart, and bone marrow, introducing the concept of a more pleiotropic action of these hormones. the regulation of insulin sensitivity remains, however, central to their action, and tightly related to pre- and post - natal longitudinal growth and weight increase, pubertal development, and pubertal disorders. many of these aspects, however, remain not entirely understood and need further investigation. summarizing the main findings to date consists in adiponectin being an upregulator of insulin and energy balance. leptin mediates mainly food intake, liver glucose production, gonadotropin secretion, suppression of lipogenesis in adipose tissue, and modulation of immune responses. resistin is likely to have an inhibitory effect on adipose conversion, acting as a feedback regulator of adipogenesis and adipose tissue. there is evidence that these adipokines are important in placental and fetal growth, programming of insulin sensitivity, and present relationships with birth weight. pubertal development is physiologically characterized by an increase in adipose mass and changes in adipose tissue distribution. many authors are concordant on a significant role of leptin in pubertal initiation and progression in humans. in healthy lean males, but not in females, adiponectin concentrations significantly reduce during puberty, with lower adiponectin levels in adolescent boys compared to girls. timing and progression of puberty is related to being born small or appropriate for gestational age and preterm or full - term, and size at birth is related mainly to premature pubarche, an earlier onset of pubertal development and menarche, and subsequent development of pcos. some data show that adipokines concentrations are different in most disorders of puberty, although at present data they are not definitive and not always consistent. | adipokines are cytokines produced mainly by adipose tissue, besides many other tissues such as placenta, ovaries, peripheral - blood mononuclear cells, liver, muscle, kidney, heart, and bone marrow. adipokines play a significant role in the metabolic syndrome and in cardiovascular diseases, have implications in regulating insulin sensitivity and inflammation, and have significant effects on growth and reproductive function. the objective of this review was to analyze the functions known today of adiponectin, leptin, resistin, and visfatin from placenta throughout childhood and adolescence. it is well known now that their serum concentrations during pregnancy and lactation have long - term effects beyond the fetus and newborn. with regard to puberty, adipokines are involved in the regulation of the relationship between nutritional status and normal physiology or disorders of puberty and altered gonadal function, as, for example, premature pubarche and polycystic ovarian syndrome (pcos). cytokines are involved in the maturation of oocytes and in the regular progression of puberty and pregnancy. |
the author reports the following conflict of interest : investigator for, consultant for, and/or speaker on behalf of sanofi, merck, boehringer ingelheim, janssen, pfizer, bristol myers squibb. | advances in the therapy of atrial fibrillation (af) have not come easily or quickly, despite the recognized need for significantly better antiarrhythmic agents for af termination and prevention as well as for more user - friendly anticoagulants for the prevention of emboli in patients with af. rather, the road has been only slowly progressive and bumpy. this manuscript will introduce the recent issues with dronedarone, the complex development story for vernakalant, and the appearance of the new oral anticoagulants. each of these three considerations will then be explored in more depth by the invited experts for this mini - thematic issue in current cardiology reviews. |
the economic impact of rising medical malpractice premiums and the cost of associated litigation had reached a crisis level by 2002 in many regions of the united states, including texas.1 the financial and emotional impact of malpractice claims were driving physicians and surgeons away from high - risk specialties as well as from high - risk, litigious, geographic environments.2 in 2003, the texas state legislature enacted comprehensive tort reform laws that included a cap on noneconomic damages in most medical malpractice cases at $ 250,000.3 texas voters subsequently approved a state constitutional amendment supporting this legislation.4 multiple reports have documented dramatic decreases in the cost of medical malpractice premiums across the state for all specialties, along with a decrease in the incidence of medical malpractice claims and lawsuits.1,58 in our own practice, we witnessed a 5-fold decrease in the risk of general surgical malpractice lawsuits and a 55 % decrease in premiums after the implementation of comprehensive tort reform in texas in 2003.7 less evident is whether tort reform achieved its intended goal of increasing access to health care for texas citizens.8,9 we hypothesized that comprehensive tort reform led to significant increases in the total number of physicians practicing in texas and the number of physicians relative to the texas population. to test this hypothesis, we compared the number of licensed physicians by both specialty and geographic location before and after the implementation of comprehensive tort reform. the study was performed using publicly accessible data from the texas medical board (tmb), the united states census bureau / texas state library and archives commission and the texas department of state health services.1012 the tmb is the statutorily directed authority that regulates the practice of medicine in texas. the tmb maintains detailed data with respect to physician demographics, status of practice, location of practice by county, complaints, compliance, litigation and enforcement.10 these data sets are electronically accessible to the public from january 1999 to december 2010. agency statutes have undergone major revisions in recent legislative sessions. in june 2003, the 78th texas legislature passed comprehensive tort reform in house bill 4, which became effective september 1, 2003.3 during the same legislative session, senate bill 104 provided statutory reinforcement and strengthening of the tmb along with additional funding.13 texas consists of 254 separate counties encompassing 268,581 square miles. in 2011, texas counties range in size from a minimum of 127 square miles to a maximum of 6,184 square miles. county populations range from a minimum of 65 people to a maximum of 4.3 million people. county population density in these counties ranges from a minimum of 0.1 person per square mile to a maximum of 2,851 persons per square mile. these tsas were defined in 1989, with geographic divisions along traditional, regional, medical practice referral lines. each tsa is large enough to support at least one regional trauma center. in july 2008, the texas hospital association surveyed hospitals and health systems to measure the impact of medical liability reform (http://www.tha.org/healthcareproviders/issues/tortreform/hospitals%20reap%20benefits%20of%20tort%20reform.pdf). the survey asked five questions : (1) what impact has decreased liability insurance cost had on operations or provision of services ? (2) has the hospital been able to expand services based on decreased hospital liability expense ? ; (3) has the hospital been able to expand emergency or specialized services (trauma, surgery, etc.) due to a larger number of physicians willing to take call or expand their practice ? (4) if your facility has maintained or expanded emergency or specialized services to what extent has declining physician liability expense or a more favorable liability climate in texas contributed ? (5) since september 2003 has your facility found it easier to recruit physicians ? tmb data tables, with respect to number of physicians practicing in texas, and the number and specialty of physicians practicing in each county were retrieved. these data sets were translated into an electronic spreadsheet, microsoft excel 2011 for macintosh. actively practicing, licensed physicians in texas were divided into broad specialty categories : (1) all physicians ; (2) primary care physicians (pcps) (emergency medicine, family medicine, internal medicine, general practice, pediatrics, geriatrics, general preventive medicine, and obstetrics and gynecology) ; (3) obstetrics and gynecology ; and (4) all surgical specialties. the two periods prior to (january 1995december 2002) and following 2003 (january 2004december 2012) were used as pre - tort reform and post - tort reform periods. detailed specialty and demographic analysis was performed comparing the year immediately prior to tort reform, january 2002 to the present time, january 2012. this analysis was done using unadjusted data, data normalized per 100,000 population and data normalized per square mile. these data were analyzed by four geographic subdivisions : the entire state, by tsa, by msa, and by individual county. nonparametric data were analyzed using a chi - square with yates correction for nominal variables. statistical analyses were performed using sas version 9.3 for windows (sas institute, cary, nc), analystsoft, statplus : mac statistical analysis program for mac os v. 2009, microsoft excel, graphpad prism for windows. differences were considered statistically significant if the p value was < 0.05. for repeated measures, the change and rate of change in physicians per 100,000 in the pre - tort period (19952002) and post - tort period were analyzed using three different methods : chi square (sum of repeated annual measures pre - tort and post - tort reform), a linear regression model, and a repeated - measures poisson model. the study was performed using publicly accessible data from the texas medical board (tmb), the united states census bureau / texas state library and archives commission and the texas department of state health services.1012 the tmb is the statutorily directed authority that regulates the practice of medicine in texas. the tmb maintains detailed data with respect to physician demographics, status of practice, location of practice by county, complaints, compliance, litigation and enforcement.10 these data sets are electronically accessible to the public from january 1999 to december 2010. agency statutes have undergone major revisions in recent legislative sessions. in june 2003, the 78th texas legislature passed comprehensive tort reform in house bill 4, which became effective september 1, 2003.3 during the same legislative session, senate bill 104 provided statutory reinforcement and strengthening of the tmb along with additional funding.13 texas consists of 254 separate counties encompassing 268,581 square miles. in 2011, the estimated texas population was 25,674,681. texas counties range in size from a minimum of 127 square miles to a maximum of 6,184 square miles. county populations range from a minimum of 65 people to a maximum of 4.3 million people. county population density in these counties ranges from a minimum of 0.1 person per square mile to a maximum of 2,851 persons per square mile. these tsas were defined in 1989, with geographic divisions along traditional, regional, medical practice referral lines. in july 2008, the texas hospital association surveyed hospitals and health systems to measure the impact of medical liability reform (http://www.tha.org/healthcareproviders/issues/tortreform/hospitals%20reap%20benefits%20of%20tort%20reform.pdf). the survey asked five questions : (1) what impact has decreased liability insurance cost had on operations or provision of services ? (2) has the hospital been able to expand services based on decreased hospital liability expense ? ; (3) has the hospital been able to expand emergency or specialized services (trauma, surgery, etc.) due to a larger number of physicians willing to take call or expand their practice ? (4) if your facility has maintained or expanded emergency or specialized services to what extent has declining physician liability expense or a more favorable liability climate in texas contributed ? (5) since september 2003 has your facility found it easier to recruit physicians ? tmb data tables, with respect to number of physicians practicing in texas, and the number and specialty of physicians practicing in each county were retrieved. these data sets were translated into an electronic spreadsheet, microsoft excel 2011 for macintosh. actively practicing, licensed physicians in texas were divided into broad specialty categories : (1) all physicians ; (2) primary care physicians (pcps) (emergency medicine, family medicine, internal medicine, general practice, pediatrics, geriatrics, general preventive medicine, and obstetrics and gynecology) ; (3) obstetrics and gynecology ; and (4) all surgical specialties. comprehensive tort reform in texas was implemented mid - year in 2003. the two periods prior to (january 1995december 2002) and following 2003 (january 2004december 2012) were used as pre - tort reform and post - tort reform periods. detailed specialty and demographic analysis was performed comparing the year immediately prior to tort reform, january 2002 to the present time, january 2012. this analysis was done using unadjusted data, data normalized per 100,000 population and data normalized per square mile. these data were analyzed by four geographic subdivisions : the entire state, by tsa, by msa, and by individual county. nonparametric data were analyzed using a chi - square with yates correction for nominal variables. statistical analyses were performed using sas version 9.3 for windows (sas institute, cary, nc), analystsoft, statplus : mac statistical analysis program for mac os v. 2009, microsoft excel, graphpad prism for windows. differences were considered statistically significant if the p value was < 0.05. for repeated measures, the change and rate of change in physicians per 100,000 in the pre - tort period (19952002) and post - tort period were analyzed using three different methods : chi square (sum of repeated annual measures pre - tort and post - tort reform), a linear regression model, and a repeated - measures poisson model. when comparing the period after tort reform (20042012) to the period before tort reform (19952002), the rate of increase in texas physicians per 100,000 texas residents was significantly greater (p < 0.01 by chi square and linear regression) (fig. 1). based on the repeated measures poisson model, the ratio of the number of physicians per resident per year increased by year and with tort reform (p < 0.001). prior to tort reform, the increase per year was 0.854 %, 99 % ci (0.854 %, 0.854 %) and after tort reform the increase per year grew by 69 % to 1.45 % (1.45 %, 1.45) and the percentage increase was significantly different from zero both before (p < 0.001) and after (p < 0.001) tort reform.fig. 1total number of licensed physicians per 100,0000 residents before and after tort reform total number of licensed physicians per 100,0000 residents before and after tort reform the absolute growth in texas physicians relative to absolute growth in the texas population before and after tort reform demonstrates a 2-fold greater growth in the post - tort reform period compared to the pre - tort reform period. a detailed comparison between 2002 and 2012 demonstrates the ramifications of these differing growth rates (table 1 : texas now and immediately prior to tort reform and table 2 : the change from 2002 to 2012 by msa). table 1 summarizes the demographic changes from just prior to tort reform to 8.5 years following tort reform. from 2002 to 2012, the texas population increased 21 %, with 88 % of texans residing in a metropolitan area. over this time period, texas metropolitan areas increased in size disproportionately to non - metropolitan areas (23 % vs. 8 % increase in population, respectively). the number of texas physicians increased by 15,611 (44 % increase with a 46 % increase in metro areas vs. a 9 % increase in non - metro areas). this absolute change led to an increase of 30 physicians per 100,000 population (19 % increase, p < 0.01). the non - metropolitan areas of texas had a net increase of 215 physicians ; however, there was no change in the number of physicians per capita in these non - metropolitan areas. twenty - three of 25 msas had both an increase in the absolute number of physicians and an increase in physicians relative to the population being served. twelve of these increases were statistically significant without bonferroni correction (10 with bonferroni correction). in general, the larger msas in central texas had the greatest increase in physicians per capita. no msa had a statistically significant decrease in the number physicians or physicians/100,000 population.table 1texas population and licensed actively practicing physicians in 2002 and 2012area name2002 population2012 population2002 physicians2012 physicians2002 physicians per 100,0002012 physicians per 100,000texas21,779,89326,403,74335,60651,217163194metropolitan18,831,82723,213,57933,12448,520176209non - metropolitan2,948,0663,190,1642,4822,6978485abilene msa159,356167,500283396178236amarillo msa232,215261,345473607204232austin round rock msa1,332,3671,818,7402,3723,924178216beaumont port arthur msa386,433379,176599595155157brownsville arlington msa5,482,7616,955,7949,31114,278170205el paso msa699,557791,3178551,191122151houston - sugar land - baytown msa4,967,3506,280,1389,26113,985186223killeen temple fort hood msa340,234407,4776631,154195283laredo msa208,605270,3811752138479longview msa197,186215,359291365148169lubbock msa254,215277,682700833275300mcallen edinburg mission msa615,343842,34460785399101midland msa117,298133,004175208149156odessa msa122,926135,331185252150186san msa91,17893,477222248243265tyler msa181,819215,243564757310352victoria msa113,205121,587229228202188waco msa217,826238,787383497176208wichita falls msa152,439147,643279297183201table 2change by geographic areapopulation change% population changenet physician change% net physician changechange in physicians per 100,000% change physicians per capitap (bonferroni correction)total texas+4,623,85021 % + 15,61144 % + 3019 % < 0.01 (< 0.01) total metropolitan+4,381,75223 % + 15,39646 % + 3319 % < 0.01 (< 0.01) total non - metropolitan+242,0988 % + 2159 % 00 % 0.88 (ns) abilene msa+8,1445 % + 11340 % + 5933 % < 0.01 (< 0.01) amarillo msa+29,13013 % + 13428 % + 2914 % 0.03 (ns) austin round rock msa+486,37337 % + 1,55265 % + 3821 % < 0.01 (< 0.01) beaumont port arthur msa7,2572 % 41 % + 21 % 0.83 (ns) brownsville harlingen msa+76,70422 % + 10324 % + 32 % 0.74 (ns) college station bryan msa+22,78612 % + 12538 % + 4024 % < 0.01 (0.09) corpus christi msa+19,8425 % + 8110 % + 105 % 0.3 (ns) dallas fort worth arlington msa+1,473,03327 % + 4,96753 % + 3521 % < 0.01 (< 0.01) el paso msa+91,76013 % + 33639 % + 2823 % < 0.01 (< 0.01) houston sugar land baytown msa+1,312,78826 % + 4,72451 % + 3619 % < 0.01 (< 0.01) killeen temple fort hood msa+67,24320 % + 49174 % + 8845 % < 0.01 (< 0.01) laredo msa+61,77630 % + 3822 % 56 % 0.44 (ns) longview msa+18,1739 % + 7425 % + 2215 % 0.08 (ns) lubbock msa+23,4679 % + 13319 % + 259 % < 0.01 (0.09) mcallen edinburg mission msa+227,00137 % + 24641 % 33 % 0.62 (ns) midland msa+15,70613 % + 3319 % + 75 % 0.21 (ns) odessa msa+12,40510 % + 6736 % + 3624 % 0.03 (ns) san angelo msa4730 % + 5827 % + 5628 % < 0.01 (0.2) san antonio msa+374,29821 % + 1,68347 % + 4321 % < 0.01 (< 0.01) sherman denison msa+8,5837 % + 9261 % + 6549 % < 0.01 (< 0.01) texarkana msa+2,2993 % + 2612 % + 229 % 0.35 (ns) tyler msa+33,42418 % + 19334 % + 4113 % 0.02 (ns) victoria msa+8,3827 % 10 % 157 % 0.51 (ns) waco msa+20,96110 % + 11430 % + 3218 % 0.01 (0.34) wichita falls msa4,7963 % + 186 % + 1810 % 0.26 (ns) texas population and licensed actively practicing physicians in 2002 and 2012 change by geographic area tsas are generally larger than the msas. the tsas include rural and frontier counties, and are intentionally aligned along regional referral patterns (fig. 2). by geographic area, the largest is tsa - j (west texas) with 32,447 square miles, while the smallest is tsa - m with 3,884 square miles. by population size, the largest is tsa - e (dallas fort worth area) with 7.3 million people, while the smallest is tsa - k with a population of 162,047. there was an increase of 15,599 physicians (44 % absolute increase and an increase of 30 physicians per 100,000 residents). pcps increased by 6,538 (38 % absolute increase and an increase of 11 pcps per 100,000 ; p < 0.01). ob - gyn physicians increased in absolute numbers by 567 (25 % increase, and an increase of 0.3 per 100,000 ; p = 0.28). surgeons increased by 1,557 (26 % absolute increase, and an increase of 1.1/100,000 ; p = 0.02). twenty of the 22 tsas had an increase in the number of total physicians and physicians per 100,000 population during the period. the greatest increase in physicians relative to the population being served occurred in central texas. the less populous western and eastern borders of texas encountered the lowest growth in the number of physicians per capita.fig. 2geographic boundaries and counties in the 22 texas trauma service areastable 3change in population, physicians and physicians per capita from 2002 to 2012trauma service areapopulation change(%)total physician change (%) per - capita physician change(%)ob - gyn change (%) ob - gyn per - capita change (%) pcp change (%) pcp per - capita change (%) surgeon change (%) surgeon per - capita change (%) tsa - a37,111 (9 %) 113 (19 %) 13 (9 %) 12 (32 %) 1.9 (21 %) 44 (14 %) 3.5 (5 %) 1 (1 %) 1.9 (8 %) tsa - b29,199 (7 %) 103 (12 %) 10 (5 %) 6 (12 %) 2.0 (6 %) 10 (3 %) 7.7 (9 %) 10 (6 %) 0 (0)tsa - c1,272 (1 %) 31 (9 %) 15 (10 %) 1 (6 %) 0.5 (6 %) 23 (14 %) 10.8 (15 %) 6 (10 %) 2.6 (10 %) tsa - d10,113 (3 %) 32 (8 %) 6 (4 %) 5 (25 %) 1.4 (24 %) 29 (14 %) 7.2 (10 %) 4 (5 %) 2.2 (8 %) tsa - e1,521,282 (26 %) 5,112 (53 %) 35 (21 %) 201 (29 %) 0.3 (3 %) 2,133 (47 %) 13 (16 %) 571 (36 %) 2.1 (8 %) tsa - f11,269 (4 %) 50 (12 %) 12 (7 %) 2 (6 %) 0.2 (2 %) 12 (6 %) 7.5 (10 %) 5 (6 %) 0.5 (1 %) tsa - g96,763 (11 %) 278 (23 %) 15 (10 %) 4 (6 %) 0.4 (5 %) 117 (19 %) 4.9 (7 %) 21 (10 %) 0.4 (1 %) tsa - h27,221 (11 %) 145 (69 %) 44 (52 %) 10 (100 %) 3.2 (80 %) 68 (56 %) 20 (41 %) 30 (97 %) 10 (77 %) tsa - i91,969 (13 %) 336 (39 %) 28 (23 %) 27 (42 %) 2.3 (26 %) 180 (45 %) 16 (28 %) 43 (27 %) 2.8 (13 %) tsa - j30,999 (8 %) 89 (19 %) 12 (9 %) 9 (27 %) 1.6 (17 %) 48 (19 %) 6.7 (10 %) 23 (31 %) 4.2 (20 %) tsa - k2,462 (2 %) 58 (24 %) 33 (22 %) 0 (0 %) 0.1 (2 %) 25 (20 %) 14 (18 %) 3 (6 %) 1.4 (5 %) tsa - l70,793 (18 %) 492 (70 %) 79 (45 %) 5 (15 %) 0.2 (3 %) 226 (65 %) 35 (40 %) 68 (65 %) 11 (40 %) tsa - m26,626 (9 %) 118 (27 %) 25 (17 %) 6 (23 %) 1.1 (13 %) 75 (33 %) 17 (22 %) 5 (6 %) 0.7 (2 %) tsa - n31,593 (11 %) 142 (37 %) 32 (23 %) 12 (57 %) 3.1 (41 %) 94 (46 %) 22.9 (31 %) 20 (34 %) 4.3 (21 %) tsa - o510,430 (35 %) 1,595 (65 %) 37 (22 %) 74 (47 %) 0.9 (8 %) 745 (60 %) 16 (18 %) 184 (48 %) 2.5 (9 %) tsa - p404,364 (20 %) 1,711 (43 %) 38 (20 %) 43 (20 %) 0 (0 %) 640 (36 %) 12 (14 %) 179 (29 %) 2.3 (8 %) tsa - q1,170,285 (26 %) 4,478 (52 %) 40 (21 %) 133 (25 %) 0.1 (1 %) 1,740 (45 %) 13 (15 %) 378 (26 %) 0 (0 %) tsa - r135,004 (13 %) 264 (18 %) 6 (5 %) 6 (7 %) 0.5 (5 %) 111 (15 %) 1.4 (2 %) 18 (8 %) 0.9 (4 %) tsa - s9,762 (6 %) 6 (2 %) 12 (8 %) 2 (15 %) 1.6 (20 %) 8 (6 %) 0 (0 %) 5 (13 %) 4 (17 %) tsa - t64,866 (29 %) 38 (21 %) 4.5 (6 %) 3 (18 %) 0.6 (9 %) 24 (26 %) 0.8 (2 %) 4 (13 %) 1.8 (13 %) tsa - u23,285 (4 %) 65 (7 %) 4.9 (3 %) 2 (4 %) 0 (0 %) 36 (8 %) 3.0 (4 %) 14 (9 %) 3.5 (13 %) tsa - v319,726 (30 %) 355 (34 %) 2.4 (2 %) 20 (26 %) 0.2 (3 %) 194 (31 %) 0.4 (1 %) 23 (14 %) 2 (13 %) total texas4,623,850 (21 %) 15,599 (44 %) 30 (19 %) 567 (25 %) 0.3 (3 %) 6,538 (38 %) 11.1 (14 %) 1,557 (26 %) 1.1 (4 %) p < 0.05, chi square with bonferroni correction for repeated measuresfig. 3texas trauma service areas in 2002. those with 150199 physicians per 100,000 are in yellow, and those with greater than or equal to 200 physicians per 100,000 are in greenfig. those with 150199 physicians per 100,000 are in yellow, and those with greater than or equal to 200 physicians per 100,000 are in green geographic boundaries and counties in the 22 texas trauma service areas change in population, physicians and physicians per capita from 2002 to 2012 p < 0.05, chi square with bonferroni correction for repeated measures texas trauma service areas in 2002. those with 150199 physicians per 100,000 are in yellow, and those with greater than or equal to 200 physicians per 100,000 are in green texas trauma service areas in 2012. those with 150199 physicians per 100,000 are in yellow, and those with greater than or equal to 200 physicians per 100,000 are in green responses from a hospital survey came from ten health care systems and ten independent hospitals, representing 176 facilities and more than 31,000 licensed beds approximately 55 % of the private medical surgical hospitals in texas. regarding question 1 on the impact of reduced liability coverage costs on hospital operations : 58 % of hospitals reported using their reduced liability coverage costs to expand patient safety programs ; 51 % reported they used their reduced liability coverage costs to maintain / expand coverage or services for uninsured / underinsured patients ; 46 % have used their reduced liability coverage costs to subsidize the various payment shortfalls (e.g., medicaid) ; 41 % reported they used the savings to meet monthly obligations, improve salaries for nursing personnel, maintain / increase nurse staffing levels, or maintain / expand staff educational opportunities ; 39 % reported using liability savings to maintain / update / add new medical equipment ; while 37 % reported using the savings to establish / increase payments to on - call physicians or expand / update their facility. regarding question (2) : since september 1, 2003 has your facility been able to maintain or expand services (e.g., surgery, primary care, obstetrics) ? sixty - nine percent of the responding hospitals reported that they were able to maintain or expand their services ; 60 % reported that they have been able to maintain or expand cardiothoracic surgery, neurosurgery, orthopedic surgery and plastic surgery ; 50 % reported that they had been able to maintain or expand their emergency department services ; 46 % reported that they have been able to maintain or expand their primary care services ; 36 % reported that they have been able to maintain or expand their ob gyn services ; and 33 % reported that they had been able to maintain or expand their general surgery services. regarding question 3 since sept 1, 2003 has your facility been able to maintain or expand its ability to provide emergency or specialized care services (e.g., trauma, surgery) due to a larger number of physicians willing to take call or expand their practice ? 52 % of the hospitals responded that they have been able to maintain or expand their ability to provide emergency or specialized care services ; 65 % responded that they have been able to maintain or expand their ability to provide services due to a larger number of emergency department physicians willing to take call or expand their practice ; and 52 % responded that they have been able to maintain or expand their ability to provide services due to a larger number of orthopedic and general surgeons willing to take call or expand their practice ; 47 % responded that they maintained or grew services due to a larger number of cardiothoracic surgeons willing to take call or expand their practice ; 34 % reported they had been able to maintain or expand their ability to provide services due to a larger number of neonatologists and ob - gyn physicians ; 30 % reported they had been able to maintain or expand their services due to a larger number of neurosurgeons and anesthesiologists willing to take call or expand their practice ; and, lastly, 21 % reported they had been able to maintain or expand their ability to provide services due to a larger number of neurologists willing to take call or expand their practice. regarding question 4, 80 % of the hospitals indicated that stable / declining physician liability insurance costs or a more favorable liability climate had a impact on the hospital s ability to provide emergency or specialized care services. for question 5, 85 % of hospitals indicated that they found it easier to recruit physicians because of either stable / declining physician liability insurance costs or a more favorable liability climate in texas. fifty - seven percent of hospitals indicated that they found it easier to recruit ob - gyn physicians and general surgeons ; 50 % found it easier to recruit orthopedic surgeons ; 42 % indicated that they found it easier to recruit neurosurgeons ; 32 % of hospitals indicated that they found it easier to recruit anesthesiologists and neonatologists ; 27 % found it easier to recruit cardiothoracic surgeons and neurologists ; and 22 % of hospitals indicated that they found it easier to recruit emergency medicine physicians. in this report we have attempted to paint an accurate description of the landscape before and after comprehensive tort reform in texas. our data show that the period following tort reform was associated with an increase in the number of physicians relative to the texas population. this change occurred across most of the regions of texas, although it was significantly greater in the metropolitan areas and the central geographic areas of the state. five of the 22 tsas had increases in the number of physicians in their regions by more than 50 %. physicians practicing obstetrics and gynecology increased in number, but the increase was flat relative to the increase in the texas population. of note, there was a 27 % increase in ob gyn physicians practicing in the nonmetropolitan areas of texas, although this was not statistically significant. as noted above, the rate of physician growth relative to the population was significant ; however, these data, from a cross - sectional, prospectively maintained, database which was retrospectively reviewed, do not show causation. texas gross domestic product increased significantly over time, which plausibly could also have influenced the increase in the number of physicians. although the economy or other factors may have played a role, we believe it is very likely that tort reform had an effect on the disproportionate net increase in physicians. similar to financial savings, the rate in physician growth does not have to be dramatic to see substantial absolute increases over time. there was also growth of academic medical centers in temple, round rock, el paso and austin. these changes may also have contributed to the increased number of physicians in texas, potentially independent of tort reform. the financial impact of comprehensive medical malpractice tort reform in texas was soon evident to physicians. within 1 year of passage of hb-4, the texas medical liability trust (tmlt), the state s largest carrier, had reduced its malpractice premiums by 17 %.14 the tmlt then cut costs by another 5 % on january 1, 2005. the self - insured university of texas system malpractice plan has reinvested malpractice savings into patient safety and clinical efficacy programs in its academic medical centers. multiple sources have documented decreased filing of medical malpractice lawsuits. in 2003, there were 1108 medical liability suits filed in dallas county. this decreased to 142 cases in 2004 and 184 cases in 2005.5,15 a prior report from our institution showed a 5-fold decrease in the number of malpractice claims and a 55 % reduction in the cost of premiums following tort reform in 2003.7 in may 2006, the american medical association (ama) removed texas from its list of states experiencing a liability crisis, marking the first time the ama has removed any state from its crisis list.16 by 2002, most physicians and health care organizations believed that excess malpractice lawsuits had started to affect the delivery of health care. most felt that physicians had left or avoided geographic areas of texas known as litigious hotbeds, while others totally avoided high - risk procedures.2,15 advocates reported many physicians no longer performed nursing home work and hospitals experienced great difficulty in obtaining physician on - call coverage for emergency rooms, trauma centers, and emergency surgery and obstetrics.17 within 2 years of tort reform, advocates reported that texas had gained 3,000 physicians, including 93 orthopedic surgeons, 91 obstetrician gynecologists, 24 neurosurgeons, 20 pediatric cardiologists, 14 pediatric oncologists and ten pediatric surgeons.2 these reports were consistent with data that states that have enacted medical malpractice tort reform and capped the non - economic award have had an increased supply of physicians, especially in rural areas.6 as of 2011, there appeared to be an influx of practices into the rio grande valley, many in critical medical specialties hardest hit by the liability crisis.17 since 2007, texas has consistently awarded licenses to 60 % more new physicians each year compared to the 3 years preceding tort reform.1,17,18 advocacy groups have estimated there have been an additional 6.4 million office visits secondary to tort reform.8,17,18 according to the department of health and human services, texas ranks tenth nationally in the percentage growth of patient care physicians per capita, up from 23rd just 5 years earlier.8 there is, of course, opposition to comprehensive tort reform in texas.9,19 most opponents are associated with or supported by those in the tort business, but opposition has also come from consumer or public rights advocacy groups. public citizen, a not for profit consumer rights group, published a report in october 2011 entitled, a failed experiment : health care in texas has worsened in key respects since state instituted liability caps in 2003.19 a segment of this report addressed a putative decline in physicians per capita. the authors opted to use a texas department of state health services (dshs) definition of direct patient care physicians that excludes a number of physician groups including medical school faculty, (dshs description : the reasoning behind making these selections is that only direct patient care physicians (not faculty, researchers, etc.) are actually treating patients as opposed to doing administrative work, teaching, or research). from our vantage point, this is, at best, an antiquated notion that excludes very large numbers of practicing physicians from their analysis. as a concrete example, over the past year the faculty of the university of texas health science center at san antonio department of surgery provided approximately 86,000 patient care visits and performed more than 6,000 operations. a significant portion of this care was for patients with limited or no health care funding, or for patients from rural south texas. using the direct patient care physician definition completely excludes this care. using a the definition of all active practicing physicians (as reported in this manuscript), leads to data which support a conclusion directly contrary to public citizen s report. with respect to the non - metropolitan areas of the state, our data and that of the public citizen are in general agreement : there have been absolute increases in physicians, but no change in physicians per - capita in the post - tort reform period. hyman, silver and black describe an in - depth analysis of physician numbers relative to texas population.20 these authors use a similar methodology (direct patient care physician) to the public citizen, thereby excluding very large numbers of physicians who actually provide a significant amount of direct patient care physicians employed or associated with a medical school faculty. for the reasons noted, we believe this methodology does not properly account for physicians providing significant patient care. additionally, the dshs definition has changed over the time period of the study, making interpretation of data using the direct patient care physician definition even more difficult. in short, we believe the simpler and more consistent definition of all active practicing texas physicians is the best way to account for changes in the physician workforce before and after tort reform. most of the reports refuting the benefits of tort reform come from non - health care professionals ; however, there are also dissenting voices in the medical and surgical community concerning potential benefit for the patient.2123 although we do not generally agree with these critics, we do agree that the cost savings and benefits of tort reform should be passed along to the consumers of health care, not simply the providers of health care, and we believe that we have a professional obligation to see that patient care and service improves. each region in the united states has unique challenges and unique strengths with respect to caring for patients. texas has a rapidly increasing population, a tremendous degree of geographic and population diversity, and a high percentage of patients without any health care coverage (25 %). these factors create great challenges to improving access to health care, and highlight the need for developing strategies to recruit and retain physicians into texas. it is highly probable that comprehensive tort reform is one of those strategies that have been successful in improving patients access to health care. to be more specific, we do not believe that tort reform is usually the primary factor that leads to individual physician recruitment or retention ; however, it is clearly a permissive factor, which likely leads to decision making that greatly facilitates physician recruitment and retention. as the hospital survey data demonstrate, those recruiting physicians have found it significantly easier to do so in the post - tort reform period (85 % of responding hospitals). the second point illustrated by the survey data is that access is more than just absolute number of physicians or physicians per capita, it is also about what services physicians provide. fifty - two percent of hospitals reported being able to expand emergency or specialized services due to more physician call availability or physicians willingness to expand their practices. eighty percent of hospitals reported they had been able to expand services due to the improved physician liability climate. in this report we have attempted to paint an accurate description of the landscape before and after comprehensive tort reform in texas. our data show that the period following tort reform was associated with an increase in the number of physicians relative to the texas population. this change occurred across most of the regions of texas, although it was significantly greater in the metropolitan areas and the central geographic areas of the state. five of the 22 tsas had increases in the number of physicians in their regions by more than 50 %. physicians practicing obstetrics and gynecology increased in number, but the increase was flat relative to the increase in the texas population. of note, there was a 27 % increase in ob gyn physicians practicing in the nonmetropolitan areas of texas, although this was not statistically significant. this report has limitations that should be considered in interpreting these data. as noted above, the rate of physician growth relative to the population was significant ; however, these data, from a cross - sectional, prospectively maintained, database which was retrospectively reviewed, do not show causation. texas gross domestic product increased significantly over time, which plausibly could also have influenced the increase in the number of physicians. although the economy or other factors may have played a role, we believe it is very likely that tort reform had an effect on the disproportionate net increase in physicians. similar to financial savings, the rate in physician growth does not have to be dramatic to see substantial absolute increases over time. there was also growth of academic medical centers in temple, round rock, el paso and austin. these changes may also have contributed to the increased number of physicians in texas, potentially independent of tort reform. the financial impact of comprehensive medical malpractice tort reform in texas was soon evident to physicians. within 1 year of passage of hb-4, the texas medical liability trust (tmlt), the state s largest carrier, had reduced its malpractice premiums by 17 %.14 the tmlt then cut costs by another 5 % on january 1, 2005. the self - insured university of texas system malpractice plan has reinvested malpractice savings into patient safety and clinical efficacy programs in its academic medical centers. multiple sources have documented decreased filing of medical malpractice lawsuits. in 2003, there were 1108 medical liability suits filed in dallas county. this decreased to 142 cases in 2004 and 184 cases in 2005.5,15 a prior report from our institution showed a 5-fold decrease in the number of malpractice claims and a 55 % reduction in the cost of premiums following tort reform in 2003.7 in may 2006, the american medical association (ama) removed texas from its list of states experiencing a liability crisis, marking the first time the ama has removed any state from its crisis list.16 by 2002, most physicians and health care organizations believed that excess malpractice lawsuits had started to affect the delivery of health care. most felt that physicians had left or avoided geographic areas of texas known as litigious hotbeds, while others totally avoided high - risk procedures.2,15 advocates reported many physicians no longer performed nursing home work and hospitals experienced great difficulty in obtaining physician on - call coverage for emergency rooms, trauma centers, and emergency surgery and obstetrics.17 within 2 years of tort reform, advocates reported that texas had gained 3,000 physicians, including 93 orthopedic surgeons, 91 obstetrician gynecologists, 24 neurosurgeons, 20 pediatric cardiologists, 14 pediatric oncologists and ten pediatric surgeons.2 these reports were consistent with data that states that have enacted medical malpractice tort reform and capped the non - economic award have had an increased supply of physicians, especially in rural areas.6 as of 2011, there appeared to be an influx of practices into the rio grande valley, many in critical medical specialties hardest hit by the liability crisis.17 since 2007, texas has consistently awarded licenses to 60 % more new physicians each year compared to the 3 years preceding tort reform.1,17,18 advocacy groups have estimated there have been an additional 6.4 million office visits secondary to tort reform.8,17,18 according to the department of health and human services, texas ranks tenth nationally in the percentage growth of patient care physicians per capita, up from 23rd just 5 years earlier.8 there is, of course, opposition to comprehensive tort reform in texas.9,19 most opponents are associated with or supported by those in the tort business, but opposition has also come from consumer or public rights advocacy groups. public citizen, a not for profit consumer rights group, published a report in october 2011 entitled, a failed experiment : health care in texas has worsened in key respects since state instituted liability caps in 2003.19 a segment of this report addressed a putative decline in physicians per capita. the authors opted to use a texas department of state health services (dshs) definition of direct patient care physicians that excludes a number of physician groups including medical school faculty, (dshs description : the reasoning behind making these selections is that only direct patient care physicians (not faculty, researchers, etc.) are actually treating patients as opposed to doing administrative work, teaching, or research). from our vantage point, this is, at best, an antiquated notion that excludes very large numbers of practicing physicians from their analysis. as a concrete example, over the past year the faculty of the university of texas health science center at san antonio department of surgery provided approximately 86,000 patient care visits and performed more than 6,000 operations. a significant portion of this care was for patients with limited or no health care funding, or for patients from rural south texas. using the direct patient care physician definition completely excludes this care. using a the definition of all active practicing physicians (as reported in this manuscript), leads to data which support a conclusion directly contrary to public citizen s report. with respect to the non - metropolitan areas of the state, our data and that of the public citizen are in general agreement : there have been absolute increases in physicians, but no change in physicians per - capita in the post - tort reform period. hyman, silver and black describe an in - depth analysis of physician numbers relative to texas population.20 these authors use a similar methodology (direct patient care physician) to the public citizen, thereby excluding very large numbers of physicians who actually provide a significant amount of direct patient care physicians employed or associated with a medical school faculty. for the reasons noted, we believe this methodology does not properly account for physicians providing significant patient care. additionally, the dshs definition has changed over the time period of the study, making interpretation of data using the direct patient care physician definition even more difficult. in short, we believe the simpler and more consistent definition of all active practicing texas physicians is the best way to account for changes in the physician workforce before and after tort reform. most of the reports refuting the benefits of tort reform come from non - health care professionals ; however, there are also dissenting voices in the medical and surgical community concerning potential benefit for the patient.2123 although we do not generally agree with these critics, we do agree that the cost savings and benefits of tort reform should be passed along to the consumers of health care, not simply the providers of health care, and we believe that we have a professional obligation to see that patient care and service improves. each region in the united states has unique challenges and unique strengths with respect to caring for patients. texas has a rapidly increasing population, a tremendous degree of geographic and population diversity, and a high percentage of patients without any health care coverage (25 %). these factors create great challenges to improving access to health care, and highlight the need for developing strategies to recruit and retain physicians into texas. it is highly probable that comprehensive tort reform is one of those strategies that have been successful in improving patients access to health care. to be more specific, we do not believe that tort reform is usually the primary factor that leads to individual physician recruitment or retention ; however, it is clearly a permissive factor, which likely leads to decision making that greatly facilitates physician recruitment and retention. as the hospital survey data demonstrate, those recruiting physicians have found it significantly easier to do so in the post - tort reform period (85 % of responding hospitals). the second point illustrated by the survey data is that access is more than just absolute number of physicians or physicians per capita, it is also about what services physicians provide. fifty - two percent of hospitals reported being able to expand emergency or specialized services due to more physician call availability or physicians willingness to expand their practices. eighty percent of hospitals reported they had been able to expand services due to the improved physician liability climate. our data demonstrate the post - tort reform period in texas was associated with a significantly increased growth rate of physicians relative to the texas population. the net change was seen across most regions of texas, although it was significantly greater in the metropolitan areas of texas and the central geographic areas of the state. we conclude that tort reform, as implemented in texas, provides a needed framework for improving access to health care. this article is distributed under the terms of the creative commons attribution license which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. | introductiontexas implemented comprehensive tort reform in 2003. we hypothesized that tort reform was followed by a significant increase of physicians practicing in texas.methodsto test this hypothesis, we compared the rate of physician growth prior to and following tort reform, and the number of licensed physicians and physicians per 100,000.resultscomparing before and after tort reform, the rate of increase in texas physicians per 100,000 population increased significantly (p < 0.01). from 2002 to 2012, the texas population increased 21 %. the number of actively practicing texas physicians increased by 15,611 a 44 % increase (46 % metro areas vs. 9 % non - metro areas), an increase of 30 physicians per 100,000 population (p < 0.01). non - metropolitan texas had a net increase of 215 physicians ; however, there was no change in the number of physicians per 100,000. examining the data by trauma service areas (tsas), 20 of 22 tsas had an increase in both number of physicians and physicians per capita, five greater than 50 %.conclusionsthe post - tort reform period in texas was associated with a significantly increased growth rate of physicians relative to the texas population. tort reform, as implemented in texas, provides a needed framework for improving access to health care. |
the presence of endometrial glandular and stromal cells outside the uterine cavity is called endometriosis. endometriosis is one of the most common benign diseases affecting quality of life and fertility of women. endometriosis is diagnosed by visual inspection of the pelvis during laparoscopy and positive histology confirms the diagnosis, but negative histology does not exclude it. the most important one is regurgitation of menstrual blood, but cytokines play a critical role in facilitation of the implantation of ectopic endometrial tissues. numerous data indicate that eutopic endometrial glandular and stromal cells may be functioning differently in women with endometriosis compared to normal endometrium in disease - free women. expression of importin13, a possible marker for endometrial stem cells, compared to secretory endometrium, might support the hypothesis that this disease originates from stem cells. the most prominent symptoms of endometriosis are dyspareunia, dysmenorrhea, pelvic pain, and infertility. some medical treatments have been suggested for endometriosis, including oral contraceptive pills, medroxy progesterone acetate, and gonadotropin - releasing hormone agonists (gnrha). in some studies statins were effective in prevention of endometriotic cells proliferation in vitro. statins are potent inhibitors of cholesterol biosynthesis to reduce serum cholesterol in patients with hyperlipidemia. statins act by inhibiting 3-hydroxy-3-methyl glutaryl coenzyme a (hmg - coa) reductase to block the conversion of hmg - coa to l - mevalonate, a rate - limiting step in cholesterol synthesis. statins were effective in inhibiting the mechanisms of cell proliferation and angiogenesis in experimental models for the development of endometriosis - like tissue [57 ]. in 1 study using a nude mouse model, simvastatin induced a dose - dependent decrease of the number and size of endometrial implants in mice. at the highest dose of simvastatin, the number of endometrial implants decreased by 87% and the volume by 98%. in another study on endometriotic cyst walls and endometrial biopsy in vitro, atorvastatin treatment had no effect on 17e2 levels in endometriotic stromal cell culture supernatant, and concluded that atorvastatin can be used as a treatment for endometriosis in humans. different studies have suggested that the role of statins in inhibition of aromatase activity may represent a new therapeutic option for endometriosis. after approval by ethics committee of tehran university of medical sciences (tums) and after counseling with patients with pelvic endometriosis, we compared the clinical symptoms of patients after prescription of gnrha with simvastatin. this study was conducted as a prospective, randomized, controlled trial to compare the effectiveness of simvastatin with that of gnrha treatment, after surgery for endometriosis, on pain due to endometriosis. in our gynecology ward, all the patients with the laparoscopic diagnosis of pelvic endometriosis were included in the study., the surgeons tried to excise or ablate all the endometriotic implants and performed adhesiolysis. the cause of laparoscopy and the severity of dyspareunia, dysmenorrhea, and pelvic pain were estimated by use of the visual analogue scale test (vas test), with a score of 0 being no pain and 10 being the most severe pain ever experienced. after the operation, the severity of endometriosis was entered into the data collection form as revised according to the american society for reproductive medicine classification for endometriosis. the staging was done intraoperatively by the 2 surgeons who were involved in the operations. following ethics committee approval and obtaining informed consent in cases of simvastatin prescription, we prescribed simvastatin (film - coated tablet simvahexal, 20 mg daily for 4 months) or gnrha (decapeptyl 3.75 mg i m each 28 day period for 4 doses) at the time of discharge. the patients were randomly assigned to either the simvastatin or decapeptyl group (assigned to each group alternately in order of admission). although the patient selection was random, in patients who wanted to become pregnant immediately, we had the obligation to prescribe simvastatin rather than gnrha. each group had 30 patients and we tried to match the two groups for age, the severity of endometriosis and severity of endometriotic pain. we analyzed the data by spss 13, using the ks test (one - sample kolmogorov - smirnov test) for normality of data distribution, levene s test for equality of variances, and independent samples t - test for equality of means for comparing quantitative normal data between the 2 groups, paired sample t - tests for comparing quantitative normal data between before and after treatment in each group and pearson chi - square test for matching and comparing categorical variables between the 2 groups. according to the ks test, we compared the non - normal quantitative data by mann - whitney u nonparametric test between the 2 groups and wilcoxon signed ranks test for comparing before and after treatment data in each group. in these 60 patients, 40 had endometrioma of ovary ; the size of endometrioma was most often 310 centimeters (n=37). in this study, marital status of the 2 patient groups the simvastatin group (s) and the gnrha group (g) was matched (p=0.793), but the difference for presence of endometrioma between the two groups was significant (p=0.045), (table 1). the major reasons for laparoscopy in the simvastatin group were infertility (40.0%) and ovarian cyst (33.3%) and ovarian cyst (40.0%) and dysmenorrhea (30.0%) in the gnrha group (table 2). severity of endometriosis in the 2 patient groups was not significantly different (p=0.253) (table 3). the severity of dyspareunia, dysmenorrhea, and pelvic pain before and after treatment were not significantly different between the 2 groups (table 4). however, after treatment, the severity of dyspareunia, dysmenorrhea, and pelvic pain in the 2 groups was significantly reduced and the difference between before and after treatment in 3 parameters in each group was significant (table 5). none of the patients showed adverse effects of simvastatin and all continued medical treatment for 4 months. the major finding of this prospective, randomized, double - blind trial of simvastatin versus decapeptyl in the treatment of endometriotic pains was that after ablative surgery, prescription of simvastatin or decapeptyl resulted in no significant difference in outcome. laparoscopy is recognized as the first option for diagnosis and treatment of endometriosis, but the rate of pain recurrence after conservative surgery is high. gnrh agonists have long been used successfully in the treatment of endometriosis [1,1115 ], but because of their adverse effects (loss of bone minerals and vasomotor symptoms), physicians need better choices. statins, inhibitors of 3-hydroxy-3methylglutaryl - coenzyme a reductase (hmgcr), have been shown to decrease proliferation of several mesenchymal tissues. actions of statins may be related to decrease in availability of cholesterol, as well as intermediate metabolites of mevalonate pathway downstream of hmgcr. this could be important in non - hormonal and non - surgical treatment of endometriosis. proliferation of endometrial stromal cells has been inhibited with simvastatin in endometrial tissue obtained from 4 women with endometriosis. therefore, it is suggested that simvastatin could potentially be a therapeutic agent for treatment of endometriosis. the in vitro studies demonstrated that simvastatin induced a concentration - dependent inhibition of human endometrial stromal cell proliferation, evidenced by reduced dna synthesis and a decrease in number of viable cells. it has also shown that simvastatin inhibits the proliferation of stromal cells derived from human endometriotic implants in ovaries. simvastatin reduced both the number and volume of endometriotic lesions in nude mice in a dose - dependent manner. about 85% of the mice in the control group developed lesions, whereas 58% of the mice receiving low - dose simvastatin and only 17% of those given high - dose simvastatin had lesions. these findings suggested that the use of statins for treatment of endometriosis can be effective. in our study, after conservative surgical treatment, the result of prescription of simvastatin (20 mg daily for 4 months) was similar to decapeptyl (3.75 mg i m for 4 doses) in control of endometriotic pain. the sample size was small and the study must be repeated with larger sample sizes and with other doses of simvastatin. in addition, none of the patients accepted second - look laparoscopy to evaluate size and number of endometriotic lesions after medical treatment. finally, our study lacked a third group without medical treatment after conservative surgical treatment. the important aspect of this study is that it is the first to evaluate use of simvastatin to relieve endometriotic pains. further investigations without the limitations of the present study should provide more precise assessment of the effects of simvastatin on endometriotic lesions. the study must be repeated with larger sample sizes and with other doses of simvastatin. in addition, none of the patients accepted second - look laparoscopy to evaluate size and number of endometriotic lesions after medical treatment. finally, our study lacked a third group without medical treatment after conservative surgical treatment. the important aspect of this study is that it is the first to evaluate use of simvastatin to relieve endometriotic pains. further investigations without the limitations of the present study should provide more precise assessment of the effects of simvastatin on endometriotic lesions. gnrha is one of the most accepted medical treatments of endometriosis, but the role of statins in endometriosis had been assessed only in vitro or in animal models. our study assessed the effect of simvastatin on symptoms of endometriosis and found that it is comparable with decapeptyl. | backgroundto compare efficacy of simvastatin with gnrha (decapeptyl 3.75 mg) on endometriosis - related pains following surgery for endometriosis.material/methodssixty women with pelvic endometriosis, after laparoscopic diagnosis and conservative laparoscopic surgery, were treated with either simvastatin (n=30) for 16 weeks or decapeptyl (n=30) every 4 weeks for 4 doses.resultsusing vas, the score of dyspareunia, dysmenorrhea, and pelvic pain 6 months after laparoscopic surgery declined significantly in both groups (p=0.001), but the difference between results of the 2 groups was not significant (p>0.05).conclusionsboth treatment modalities showed comparable effectiveness in the treatment of pains related to endometriosis. |
their incidence is rising due to improvements in survival and diagnosis ; nevertheless, our patient is the fourth case reported up to date. therefore, treatment choice is made based on clinical experience and case reports ; notably, the largest case report series was prior to the approval for using tyrosine - kinase inhibitors in thyroid cancer. a 73-year - old lady had dedifferentiated papillary thyroid cancer with ongoing sorafenib. after 9 months on this treatment differential diagnosis included infection, progression of disease and cardiotoxicity. after a comprehensive assessment (echocardiography, computed tomography, pet, magnetic resonance), we found progression of lung disease, and the appearance of heart metastases. after recovering from the basal status, she started on second - line treatment with sunitinib, which was well - tolerated. we should include cardiac metastases in the differential diagnosis of heart failure in cancer patients. sorafenib is the mainstay of the first - line therapy in metastatic thyroid cancer, achieving long - term disease control with good tolerance. sunitinib could be a safe second - line treatment option (not cardiotoxicity related) with promising results. therefore, our report presents a sequence of treatment with tyrosine - kinase inhibitors in metastatic thyroid carcinoma with an encouraging outcome, which deserves further investigation. cardiac metastases from thyroid cancer are a rare entity ; in fact, its frequency reported in historical series ranges from 0 to 2%. the improvements in survival of thyroid cancer patients and current advances in imaging diagnoses have contributed to increase its incidence. nevertheless, after a comprehensive literature review, we found only 15 case reports in the last 35 years [3, 4 ]. thyroid cancer histologic subtypes more prone to develop cardiac metastases are anaplastic thyroid cancer, follicular thyroid cancer, and hrthle cell cancer. to date, there are only 3 case reports of cardiac metastases from papillary thyroid carcinoma, so our patient will be the fourth case. a 73-year - old lady with a personal history of well - controlled high blood pressure and chronic atrial fibrillation on anticoagulant therapy, but with performance status 0 presented with a neck enlargement mass in may 2010. she underwent a total thyroidectomy and therapeutic lymph node neck dissection achieving a complete resection in june 2010. the initial diagnosis was a papillary thyroid carcinoma measuring 5.5 4 4 cm, with regional lymph node involvement (1/4 ; pathologic stage, pt4n1am0). no residual uptake was seen in the post - therapeutic radioiodine-131 whole - body scan. three months after the first operation, the patient presented with a tender lump in the left supraclavicular fossa. the lymph node was excised and the histopathology analysis showed features consistent with dedifferentiated papillary thyroid cancer with a solid, insular and trabecular growth pattern, frequent mitosis and pleomorphic nuclei. immunohistochemical examination demonstrated that the cells stained positively for thyroglobulin, thyroid transcription factor (ttf1), bcl2, e - cadherin, cyclin d1, cd15 and ki-67 (10% ratio) and were negative for calcitonin and hbm45. postoperative treatment with radioactive iodine-131 (i-131) at a dose of 150 mci was advised. after a disease - free interval of 18 months, in may 2011, she had a new relapse in form of isolated cervical lymph node metastases, with a negative 18f - fluorodeoxyglucose - positron emission tomography elsewhere. again, the pathology showed this to be a relapse of her poorly differentiated thyroid carcinoma (pdtc), with papillary features. she completed adjuvant treatment with external beam radiotherapy over the neck and mediastinum (60 gy for 30 fractions). unfortunately, a year later, in may 2012, in a follow - up visit, thyroglobulin level rose to 3,042 ng / ml ; an i-131 scan and a positron emission tomography and computed tomography (pet / ct) were requested ; metabolically active paratracheal lymph nodes and new lung metastases were observed. i-131 rechallenge was indicated at a dose of 178 mci. a partial response and a decrease in thyroglobulin levels (2,580 ng / ml) were obtained. in march 2013, thyroglobulin level reached 9,946 ng / ml and a new pet / ct scan demonstrated progression of her pulmonary and ganglionic disease. at this point, treatment with sorafenib 400 mg orally twice daily was initiated. her disease remained stable for 8 months (thyroglobulin level : 8,298 ng / ml) and the patient did not experience significant side effects (except grade 1 mucositis and hand - foot syndrome). in october 2013, the patient came to the emergency department at this hospital because of progressive dyspnea, irritative cough, pleuritic chest pain, orthopnea and oliguria. on examination, the temperature was 37c, the blood pressure 110/80 mm hg, the pulse 90 beats per minute, the respiratory rate 22 breaths per minute and the oxygen saturation 90% while the patient was breathing ambient air. there were decreased lung sounds with expiratory wheezes bilaterally and crackles at the right base and there was 2 + edema of the legs. hemogram and biochemistry showed mild anemia (hemoglobin 11 g / dl) without any other abnormalities. chest radiography showed a sclerotic lesion in the sixth dorsal vertebra, alveolar diffuse infiltrate in the right lung base, right paratracheal lymph node enlargement, and cardiomegaly. electrocardiogram (ecg) was reportedly normal with no changes compared with the previous one. she was admitted to the hospital with depletive treatment, empirical antibiotics, and steroids, according to the initial diagnosis of acute heart failure, in the context of a likely respiratory infection. symptoms were stabilized and the patient reported clinical improvement ; however, progression of disease could not be ruled out, so a diagnostic procedure was performed. transthoracic echocardiography revealed minimal mitral and tricuspid regurgitation with an estimated left ventricular ejection fraction of 60%. a moderate circumferential pericardial effusion was present without evidence of tamponade ; echodensities along the visceral pericardium were considered to be consistent with the deposition of fibrin or metastases. the assessment was completed with a pet / ct scan and cardiac magnetic resonance imaging (mri) which demonstrated further significant progression in the lungs and confirmed the development of bone and cardiac metastases in the pericardium and the right atrium (fig. 2). due to the evolution after the discharge, and the lack of relevant toxicity at any time during the previous treatment with sorafenib, the patient was very keen on having further treatment. concern regarding morbidity and efficacy of this approach was raised, and sunitinib at a dose of 37.5 mg / day, daily, was initiated in november 2013, with the approval of the committee for high impact drugs. again, therapy was well tolerated with easily manageable adverse effects ; the patient experienced only grade 1 high blood pressure and fatigue. at the time of the last follow - up after 4 months of treatment, the patient 's tumor was stable with respect to size in the imaging assessment ; however, it demonstrated a marked reduction in thyroglobulin level (8,625 ng / ml), and the patient likewise was experiencing continued improvement of her symptoms and a benefit to her quality of life, although one dose reduction was required. unfortunately, 1 month later her general condition started to deteriorate due to new exacerbation of heart failure ; then, palliative treatment for symptom control was decided, with home care support. finally she died in april 2014 due to cardiac congestive failure. cardiac metastases have historically been considered an exceptional event, occurring less than 2% of the time. the three main reasons could be : first, cancers whose route of spread could involve the heart are very scarce. second, the majority of cardiac metastases have indolent behavior or unspecific symptoms that could be attributed to other causes, so its diagnosis has been challenging. third, the availability and accuracy of imaging - based diagnostic systems used to be low compared to today. owing to the facts mentioned above, however, both improvement in cancer treatment with an increased longevity of cancer patients and the development of diagnosis techniques, like cardiac mri, have contributed to the current incidence of cardiac metastases which has increased to slightly above 10%. we can distinguish three groups among cardiac metastases according to its primary tumor origin : uncommon primary tumors that have a high rate of metastasis to the heart (malignant melanoma, malignant germ cell neoplasm, malignant thymoma) ; common tumors that have an intermediate rate of cardiac metastases but account for the greatest number of cardiac metastasis (carcinoma of the stomach, liver, ovary, colon, and rectum), and common tumors with rare metastases to the heart. the incidence and prevalence of thyroid cancer is rising ; actually, it has become the ninth cancer in frequency in the developed countries. over 90% of cases are well - differentiated thyroid cancers (wdtcs), originated from the follicular cells, encompassing papillary and follicular thyroid forms (ptcs and ftcs). the ptc is considered to be potentially curable by using a multimodal treatment, which combines surgery, radioactive iodine, and tsh - suppressive hormonal therapy. nevertheless, 30% of ptcs have a relapse, and the recurrence can be associated to a cell dedifferentiation. it implies a more aggressive biological behavior, characterized by a fast growth and metastatization, loss of the iodine uptake and radiotherapy resistance. this situation was observed in our patient, who presented an early nodal recurrence, resectable, whose pathological report was confirmed as pdtc, with papillary features. pdtc is a well - defined diagnosis entity since the turin experts meeting in 2006, with features and prognosis in between wdtc and anaplastic thyroid carcinomas. de novo, or like in our patient, can be developed from wdtc with the appearance of new genetic alterations, such as point mutations and translocations that increase mitogenesis and cell proliferation. the carcinogenesis in thyroid carcinomas is preceded by unopposed activation of either the mitogen - activated protein kinase pathway (controlled by the genes ret, ras braf) or the phosphatidylinositol-3-kinase pathway. pdtc presents several of these genetic alterations : ras mutations have been observed in 3035% and braf mutations have been found in 45%. tp53 mutations in a range of 2030% and overexpression of tyrosine - kinase receptors, including epidermal growth factor receptor and vascular - endothelial growth factor receptor (vegfr) have been reported as well. table 1 illustrates the prevalence of genetic alterations in regard to the different histological subtypes of thyroid cancer. the current approach is to emphasize the use of new targeted therapies against these potential targets ; so, it supports the use of multikinase tyrosine - kinase inhibitors (such as sorafenib, sunitinib, vandetanib), drugs which may act by blocking several targets (vegfr, ret, braf) instead of classic cytotoxic agents. the efficacy and safety of sorafenib, the first - line treatment for metastatic disease used in our patient, have been proved in three phase ii trials. it has recently been approved by the us food and drug administration in october 2013 on the basis of the results of a phase iii double - blind, randomized, controlled trial, with 417 advanced thyroid cancer patients with iodine - refractory disease. it demonstrated that patients on sorafenib obtained a benefit in median disease - free survival (10.58 vs. 5.8 months) and improvement in overall response rate (12 vs. 1%), with good toxicity profile (hand - foot syndrome and diarrhea). considering all of the above, sorafenib should be the mainstay first - line treatment in metastatic thyroid carcinoma, due to its good results in efficacy and toxicity. our patient presented with stable disease and excellent tolerance during the whole 9 months of treatment, which is consistent with the published data ; notably, our patient 's baseline characteristics were worse than the patients enrolled in the study ; in spite of that, improved clinical outcome persisted. then, she needed to be hospitalized due to worsening dyspnea in the context of the first episode of congestive heart failure. although the chief symptom of dyspnea led us to think first of pulmonary disease, like concomitant respiratory infection which could trigger the congestive heart failure episode, the additional history of our patient demanded consideration of causes of dyspnea that are more likely in a patient with aggressive pdtc treated with radiotherapy and systemic treatment with tyrosine - kinase inhibitors therefore, conditions like cardiotoxicity from sorafenib (table 2), radiation - related complications (pneumonitis or radiation - associated constrictive pericarditis), progression of disease (involving either lungs, heart or both), and malignant pericardial effusion should be ruled out. radiation - related complications were unlikely, and neither the chronology (pneumonitis usually appears 312 weeks after the ending of treatment) nor the radiological findings were consistent with them. cardiotoxicity was ruled out with the preliminary results (ecg without abnormalities and echocardiography with conserved left ventricular ejection fraction) as well. furthermore, the final diagnosis was suggested with some suspicious findings in the initial echocardiography, which were suggesting the existence of metastases in the pericardium and the right atrium, but inconclusive to state it. to achieve the diagnosis confirmation we completed the diagnosis procedure with a pet / ct scan, the optimal imaging technique to evaluate undifferentiated thyroid cancer with loss of radioiodine uptake ability. the mri showed two new sites of disease in the pericardium and the right atrium which were associated with abnormal metabolic activity in the pet / ct. in addition, the pet / ct showed further progression of the disease with new hypermetabolic foci in the lungs and in the thoracic vertebras. in the last comprehensive literature review published in 2011 that covers the last 130 years, 54 patients with cardiac metastases from thyroid cancer were identified, all with poor outcome (survival since cardiac metastasis presentation < 5 months). elective treatment for cardiac metastases the main goal in the majority of cardiac metastasis case reports published to date was to control cardiologic symptoms because of its life - threatening condition and its complex management. contrary to the facts mentioned above, our patient experienced cardiologic clinical improvement just with medical treatment adjustment. therefore, due to the new symptomatic systemic progression, without requiring locoregional control maneuver, systemic second - line therapeutic options were considered for our patient. sunitinib, an anti - vegfr, platelet - derived growth factor receptor, multikinase drug, has shown successful results in three phase ii trials for iodine - refractory thyroid carcinoma in second - line treatment [13, 14, 15 ], achieving partial responses or stabilization of disease, without relevant side effects. owing to its proved activity and its low cardiotoxicity rate, finally we decided to start sunitinib ; a stabilization of the disease with a lack of relevant toxicity was observed in our case after 4 months of treatment. therefore, our case report presents a sequence of treatment with tyrosine - kinase inhibitors in metastatic thyroid carcinoma with an encouraging outcome ; we achieved long - term disease stabilization (over 13 months) with clinical benefit and good toxicity profile, without increasing cardiotoxicity, in spite of the development of heart metastases. there is a need to confirm our experience in prospective studies ; further investigations to establish the optimal sequence therapy in this setting are required. | backgroundcardiac metastases from papillary thyroid carcinoma are very uncommon. their incidence is rising due to improvements in survival and diagnosis ; nevertheless, our patient is the fourth case reported up to date. there are no clinical trials available in this scenario. therefore, treatment choice is made based on clinical experience and case reports ; notably, the largest case report series was prior to the approval for using tyrosine - kinase inhibitors in thyroid cancer.patienta 73-year - old lady had dedifferentiated papillary thyroid cancer with ongoing sorafenib. after 9 months on this treatment, she presented with dyspnea and heart failure. differential diagnosis included infection, progression of disease and cardiotoxicity. after a comprehensive assessment (echocardiography, computed tomography, pet, magnetic resonance), we found progression of lung disease, and the appearance of heart metastases.resultsafter recovering from the basal status, she started on second - line treatment with sunitinib, which was well - tolerated. she achieved stable disease with a decrease in tumor marker levels.conclusionswe should include cardiac metastases in the differential diagnosis of heart failure in cancer patients. magnetic resonance imaging is the gold standard for assessment. sorafenib is the mainstay of the first - line therapy in metastatic thyroid cancer, achieving long - term disease control with good tolerance. sunitinib could be a safe second - line treatment option (not cardiotoxicity related) with promising results. therefore, our report presents a sequence of treatment with tyrosine - kinase inhibitors in metastatic thyroid carcinoma with an encouraging outcome, which deserves further investigation. |
globally, each year, there are in excess of an estimated 120 million cases of gastrointestinal disease and in excess of an estimated 50 million cases of more severe respiratory diseases associated with swimming and bathing in wastewater - polluted coastal waters. since the 1950s, epidemiologic studies have been designed to evaluate the relationship between swimming in point source - impacted beaches and health risks (i.e., gastrointestinal disease, respiratory, eye, nose, and throat illnesses) ; they have concluded that symptoms for all these illnesses were increased in swimmers compared to nonswimmers [2, 3 ]. outbreak reports from the cdc also confirm that illnesses in the usa are occurring from swimming in contaminated waters. the excess illnesses associated with coastal water pollution can also result in substantial economic burdens. a study in orange county, ca, estimated 3.3 million us dollars per year in excess illness costs for newport and huntington beaches associated with bathing in marine waters. swimming - related illness is predominately associated with exposure to microbial pathogens, which may enter the water through point sources such as sewage outfalls. however, recent studies have demonstrated that swimming - related illnesses can occur at nonpoint source beaches [6, 7 ] and even possibly from beach sand contact [810 ]. these developments highlight the ongoing challenge to beach managers and public health professionals in monitoring the beach environment and protecting the health of its users [11, 12 ]. to address this challenge, we provide background information about existing regulations ; describe a possible alternative approach given the existing regulations ; and then apply this alternative approach to a well - studied south florida recreational marine beach to illustrate one possible outcome of the alternate approach. at the us federal level, jurisdiction over recreational waters the cwa provides the us epa with jurisdiction over two approaches for the control of water quality. first, it provides jurisdiction to regulate discharges of pollutants into the waters of the united states. specifically, the cwa regulates discharges that represent point sources of pollution, that is, industrial, municipal, and other discharges via conveyances such as pipes or man - made ditches. second, the cwa provides the authority to set point - of - use standards for surface waters. waterbodies must not exceed contaminant levels beyond allowable values as determined by their designated use (swimming, bathing, surfing, water skiing, etc.). in most situations, the authority to issue discharge permits and to set designated use standards is delegated by the epa to the states, thereby providing the states with the full authority to implement, that is, monitoring compliance, permitting, and enforcement. the beaches environmental assessment and coastal health (beach) act of 2000, an amendment to the cwa, sets forth beach water quality guidelines for 30 eligible states and territories with coasts along the oceans and great lakes. these guidelines include limits for enterococcus in marine waters and for both enterococcus and e. coli in freshwater. a single - maximum value, as well as a monthly geometric mean, is recommended by the act. while all 30 states affected by the beach act follow these guidelines, many states employ unique additional sets of parameters to assess the safety of recreational waters (table 1). in the u.s water monitoring includes measures at approximately 3,000 beaches for fecal indicator bacteria, resulting in 18,500 closures or advisory days in 2009 issued for recreational beaches (figure 1). seventeen of the 30 states under the beach act preemptively close at least some of their beaches after significant rainfall. twenty - eight states vary sampling based on season and sampling more often during the summer months. twenty - two states vary the frequency of sampling based on usage and sample more often at beaches with higher human usage. twenty - five states base the location of their sampling on usage or proximity to a possible source of contamination. two states (massachusetts and hawaii) test waters for pharmaceutical chemicals that would be discharged with human sewage. seven states have predictive models in effect for some of their beaches ; many of which have proven to be more effective than the culture - based monitoring techniques. texas monitors for v. vulnificus in addition to enterococcus and hawaii adds c. perfringens to their microbial testing. new york and rhode island utilize sanitary surveys in their monitoring efforts, taking into consideration environmental parameters (such as tidal stage, wild life, and seaweed). new hampshire has an internet - based system in place where advisories are posted based on self - reported illnesses acquired from swimming at certain beaches. florida monitors its coastal beaches on a weekly basis year round using enterococcus as the fecal microbe indicator. florida applies the 2004 epa 's recreational water quality criteria (rwqc) for a single sample and geometric mean to issue beach advisories. international regulations include those of the world health organization (who) and the european union (eu) [17, 18 ]. the who approach differs from the us traditional monitoring guidelines in that the susceptibility of the beach to fecal pollution (i.e., the likelihood of various fecal sources from reaching the water) is taken into account when determining the monitoring criteria. beaches without a known point source of human fecal pollution are allowed higher levels of fecal indicator microbes than ones which do. the eu regulates the sampling program (frequency of sampling, location of sampling, and time of sampling), including algae and/or their toxins as indicators of human health risk and, most importantly, the requirement of beach water profiles for all beaches in the eu. the beach water profile is a critical addition to the regulation since it requires beaches to be assessed for physical, geographical, and hydrological conditions as well as potential pollution sources. these profiles are to be updated every 2 to 4 years depending on their history (i.e., whether determined to be excellent, good, sufficient, or poor). the proposed method is based upon an alternative approach which takes into consideration existing beach regulations. it is clear that the us regulations focus on contaminant discharges and monitoring for fecal microbe indicator levels, whereas international regulations rely more heavily on the allowable water quality levels, which for the who include an expectation of flexibility based upon susceptibility of the beach. specifically, we propose the establishment of an effective criterion which we call the comprehensive toolbox within an approval process, (ctbap) (figure 2). the ctbap is based upon three steps which include an inventory and two implementation principles. the inventory (a.k.a. comprehensive toolbox, ctb) consists of the methods and tools to address recreational water quality. these include guidance for source identification and prevention, along with guidance for monitoring targets and techniques. the two principles of implementation are flexibility which is to be incorporated into the local beach regulation plan and consistency to provide a consistent level of public health protection at the national level. a consistent national level of health protection implies that the monitoring targets provide the same level of risk, regardless of geographic location. so instead of setting the allowable indicator bacteria level at one consistent value, which is currently practiced through the us regulations, health risks would be set at a consistent level. the underlying theory behind this approach is to allow and expect for state, county, or even beach - specific flexibility, with a national approval mechanism for a nationally comparable level of human health protection. the methods and techniques in the alternative approaches would then be incorporated into the ctb. this national ctb with initial organization at the federal level would create a resource which local teams (consisting of managers and scientists as well as other parties with expertise in the specific local conditions) may use to strategize the local beach management plan that would work best for them. a national ctb, in addition to providing options for monitoring targets and techniques, should also include guidance concerning sampling time, location, frequency, and method ; predictive modeling (forecast and nowcast) ; information on how to communicate beach conditions to beach goers ; sanitary survey methods ; source tracking / tracer study methods ; health risk study techniques to include quantitative microbial risk assessments, epidemiologic studies, self - reporting systems ; pollution prevention methods via infrastructure, community education, animal control, and so forth. this ctb will need to be updated continuously by the national regulatory agency to keep up with the knowledge gained from new advances in the field of recreational water quality monitoring and pollution prevention. specifically to provide flexibility to state and local beach regulators, we recommend (1) an allowable range of targets based upon the susceptibility of the beach to fecal pollution as in the who approach and (2) an allowance for additional measures and controls as in the eu approach. we believe the concept of flexibility can also go further to include allowances for multiple lines of evidence to establish an overall safety level. for example, currently in recreational water quality monitoring, some states include multiple measures, but typically these measures are independent ; if the threshold for either measure is exceeded, then an advisory is issued. another component of the flexibility paradigm would be to allow for a safety assessment based upon integrated lines of evidence. an integrated line of evidence is consistent with the approach used for air quality standards. for example, for air quality standards, multiple constituents are measured, and collectively they are integrated to develop a hazard a similar approach can be included as an option in the ctbap process for developing standards for recreational bathing, where multiple lines of evidence can be used to collectively evaluate the probability of illness. these multiple lines of evidence can include measures of indicator microbes, results from modeling, weather conditions, measures of additional microbes (including possibly pathogens), and other factors. the second principle, that of consistency, establishes a consistent health protection level across the country. one concern in providing too much flexibility to the states is that health protection will not be equal across the nation. the solution for this may be a national and diverse team of experts under a national agency (such as the us epa) which could regularly review the proposed beach regulation plans of the individual states. given the specificity of the beach, the current state of the science, and experiences as well as beach regulation plans of other beaches, this panel will either approve or recommend certain modifications to the beach regulation plan. this will allow for the development of a site - specific plan that is acceptable and comparable to other beach regulation plans. therefore, the baseline used is not a single microbiological criterion, which may give a false sense of equal protection (since recommended indicators perform differently at different beaches and under different conditions), but a single team of expert reviewers who would assess health risk. in order to implement such an approach, beach regulators should be given a reasonable amount of time to develop their beach regulation plans after the release of the ctb by the epa. until then, the traditional criteria may remain in effect. as the number of approved plans increases, the matrix as recommended by these authors would be based on certain factors (such as climate conditions and pollution sources) as well as any other factor that is deemed important by the state and/or local regulatory agency. although this direction of beach regulation is recommended for the upcoming years and decades as science advances rapidly, such an approach will also be more difficult to apply than the traditional approach of beach regulation and requires initially a larger burden on both the local beach regulators and the epa. therefore, the actual implementation of such an approach will depend on when such an approach becomes feasible at the local and national levels. to illustrate some of the aspects of the recommended approach, a well - studied nonpoint source beach is used as a case study. assuming the existence of a comprehensive toolbox as proposed above from which guidance may be derived, along with the local conditions known about this beach, a beach regulation plan may be developed. what follows is a discussion of the different aspects that may be included in such a beach regulation plan which would then be submitted to the national regulatory panel for review and approval. given that the case study beach is well studied, the data from the actual beach may be used in order to guide the development of the proper monitoring techniques / targets and source identification / prevention approaches to be included in the beach regulation plan. regulators for beaches not well studied may need to couple knowledge of their beach with any available studies from similar beaches (similar in terms of pollution sources, geographic region, beach use, resources, etc.) in order to develop their site - specific beach regulation plan. the case study beach is located on virginia key within miami - dade county, florida, usa, geographically classified as subtropical with an average ambient temperature of 24.8c. given the fact that admission is free and that the beach is located in a central location accessible by many of the county 's residents, the beach can become overcrowded especially on weekends and holidays, during hours when the beach is open (between dawn and dusk). extensive evaluation of the vicinity of the study beach did not find contributions from point sources of pollution to this beach (such as sewage outfalls, failing lift stations, and cross connections of sewage with storm drains), or less obvious nonpoint sources (such as septic tanks). this beach is usually in compliance with regulatory monitoring criteria but periodically (i.e., 0.9 times per year averaged from 2002 to 2012) has been placed under a beach advisory due to microbial water quality violations (florida healthy beaches program database). at the study beach, indicator microbe levels vary significantly both spatially (location) and temporally (time) [2426 ], as is frequently observed at other beaches [2730 ]. enterococci, the current microbial target recommended for marine waters and used by regulators at the study beach, varied based on the location of sampling, with higher levels observed near the shoreline and lower levels observed offshore. these spatial differences are hypothesized to be due to enterococci release from the intertidal sand zone where microbes are believed to regrow and persist [3133 ]. temporal variability is driven at the site by a combination of tidal, rainfall, and solar radiation effects [31, 34, 35 ]. given the extensive beach - specific data, it becomes clear that any monitoring target (i.e., such as enterococci) should include a monitoring technique that considers both spatial and temporal variability for the study beach (table 2). if enterococci from the shoreline sand are considered to be related to human health, the monitoring technique should be designed so that this enterococci signal would be the most obvious. this would mean sampling at locations and times where microbial concentrations are expected to be most elevated and during times that people may be exposed to those waters (i.e., during the morning, after peak hightide or rainfall events, and as close as possible to the shoreline). however, if a relationship between enterococci and human health at this study beach is believed to be driven by offshore sources of enterococci, such as inadvertent sewage spills, regulators may consider developing sampling strategies that target these sources. this would entail sampling at locations and times where microbial concentrations from sand sources are expected to be least (i.e., during noon and afternoon, after peak low tide, avoiding sampling after rain events, and sampling offshore possibly at waist deep waters) (table 2). in this case, currently samples are collected in waist deep water which is consistent with a focus on identifying offshore sewage impacts and avoiding the high background levels associated with the nonpoint sources that originate from the intertidal zone. monitoring targets can include microbial, chemical, hydrologic, or another indicator of a health risk, whereas disease endpoints can include gastrointestinal, skin, respiratory, eye, and ear illnesses. the most common disease endpoint evaluated traditionally for recreational swimming is gastrointestinal illness (gi). a common method to compare potential monitoring targets to disease end - points is through epidemiologic studies. this is accomplished through identifying the associations between human health outcomes and monitoring targets. in the vast majority of beaches in the usa, an epidemiologic study specifically for that beach is not available, and therefore epidemiologic studies at similar beaches or other methodologies such as quantitative microbial risk assessment (qmra) may be used to assist in identifying appropriate monitoring targets. at the study beach, a randomized control epidemiology study with comprehensive water microbial and environmental monitoring was completed [6, 34, 37 ]. during the epidemiology study, an increased risk of self - reported skin, respiratory, and gastrointestinal illnesses were associated with recreational bathing. statistically significant associations were observed between (a) skin disease and enterococci levels determined by membrane filtration, (b) skin disease and to 24-hour antecedent rainfall, and (c) respiratory illness and the inverse of water temperature. neither environmental conditions nor microbes evaluated in this study were found to statistically relate to self - reported gastrointestinal illness. however, the results of the study did indicate a possible pattern between gastrointestinal illness and both f coliphage and giardia spp., both being detected on 4 of the 15 total study days (table 3), and both were detected on 3 of the 5 days characterized by the highest excess gastrointestinal illness (see the number represented by asterisk () in table 3). given the principle of flexibility, these targets, f coliphage and giardia spp., should be thus considered as additions to the ctb that is used to assess water quality at this site. with respect to disease end - points, we implement the concept of flexibility through the consideration of multiple health endpoints (table 2), which is based on measured health endpoints from more than one type of illness (e.g., gastrointestinal, skin, and respiratory). with this methodology, regulators are potentially guarding against a wider range of health impacts that may result from bathing, and hence from other pollution sources besides human sewage containing enteric pathogens. however, the multiple health endpoints, when applied to the data available for the study beach, were driven by the increased report of skin illnesses given their predominance relative to other illnesses. therefore, for the case study beach, the multiple health endpoints approach may be considered where one microbial target would be used to assess risks from skin illnesses and another target would be used to assess gastrointestinal illness. although monitoring is an important aspect of beach regulation, source identification followed by source prevention is the key to establishing the safety of the beach environment in a long - term sustainable manner. this focus is also consistent with the jurisdiction of the epa through the cwa to minimize contaminant discharges. however, the beach profiled for the study site did not identify point sources of pollution. instead, several nonpoint sources were identified including rainfall runoff, bather shedding [38, 39 ], dog feces, and sand diffusion [40, 41 ]. such observations are not only observed at the study beach but also at many other beach sites throughout the usa and beyond [11, 15, 42 ]. all of these sources come in contact with the beach sand and/or are directly released from the beach sand. furthermore, analysis of the beach sand at the site has identified potential pathogenic microbes including protozoa, helminthes, fungi, and the bacteria, s. aureus [43, 44 ]. the focus should be thus on remediation of sand sources through multiple means, such as controlling runoff and solid waste control, limiting the number of pets, birds, and minimizing human shedding through the provision of showers. to address the need to remediate nonpoint diffuse sources of contamination, various source identification techniques need to be available to beach regulators in the ctb in order for them to include these techniques in their beach regulation plan. sanitary survey approaches, tracer study techniques, and microbial source tracking methodologies need to be simplified and made more accessible to regulators through inclusion in the ctb. once sources are identified, through the guidance of the ctb, beach regulators can conduct various source prevention techniques as part of their beach regulation plan. the complexity of the beach system, especially that of beaches not dominated by a point source of pollution, implies that more novel and comprehensive approaches will be needed in order to more effectively protect the health of bathers, while at the same time limiting overconservatism which may lead to unnecessary beach closures and economic loss. the ctbap proposes the development of a comprehensive toolbox which provides an inventory of potential monitoring targets, measurement techniques, and guidance for source identification and prevention. the implementation would be based upon principles of flexibility where states are encouraged to identify their own targets as they develop beach management plans and consistency which includes an assessment of the plans at the national level to ensure a consistent level of human health protection. to that end, the specific recommendations for the study beach reviewed here focus on controlling discharges and providing more flexibility for the allowable levels at the point - of - use. the study beach 's main pollution source as described above is the sand which serves as a reservoir for indicator and pathogenic microbes inoculated into the sand by anthropogenic- and animal - related sources. therefore, the continued monitoring of the sand and remediation as needed are recommended to prevent the sand from becoming a source of microbes that constantly contaminates the water via environmental conditions such as tidal action and rainfall. this is in addition to the source prevention techniques mentioned earlier (i.e., runoff diversion and treatment and bather and dog source remediation and prevention) to preemptively limit sand and water pollution. within the confines of the current us regulations, it is understood that the epa has limited authority, including limitations to regulating water only (as opposed to regulating beach sands). within this limitation and given the need to control pollution sources, it is recommended that states, as part of their implementation plans, consider the inclusion of sand measures as part of their monitoring program. ideally beach management plans should include a focus on maintaining sand quality as a means of improving water quality. ideally the ctb, established at the federal level, would acknowledge sand as a potential source and ideally the ctb would also provide guidance for measuring, modeling, and remediating microbes from sand sources. with respect to allowable levels at the point - of - use, no relationship was found at the study site between fecal indicator bacteria and gastrointestinal illness. indicator levels at the site are strongly dictated by environmental conditions which may not be related to the pathogens of concern and hence the lack of health relation. however, given the potential association with skin illness, enterococci should still remain in this beach 's monitoring criterion. therefore, the recommended criteria should include enterococci, with the understanding that an elevation in values may indicate a potential skin illness risk as opposed to a gastrointestinal illness - related health risk. this should then be taken into account by regulators in determining whether or not to place beach advisories based on this indicator alone. if such advisories are placed, it is recommended that the risk communication strategy take into account the potential disease outcome (e.g., recommending freshwater showers after using the beach). enterococci would also be beneficial to evaluate potential sewage contamination from offshore sources ; as such the sampling protocol should include sampling, as explained earlier, where levels would be expected to be low based on sampling time and location (i.e., sampling in waistdeep water during noon or afternoon). high levels in these situations should be taken seriously as they may indicate the influence of other offshore fecal sources of pollution (e.g., from moored boats) besides the expected dominant source of sand diffusion. a study is also recommended for this beach to determine whether the addition of f coliphage and giardia spp. may serve as indicators of gastrointestinal - related illness given the prior limited epidemiologic results, and hence their addition to the monitoring program. this may be accomplished through an approach other than traditional epidemiology studies such as quantitative microbial risk assessments. if further studies warrant their use, f coliphage may be added as a monitoring with enterococci, while giardia spp. the proposed beach regulation plan for point - of - use monitoring would be similar to the existing sampling plan for this beach except with a different understanding of how to use enterococci and interpret its levels, an emphasis on source prevention (e.g., minimize dog fecal contamination, runoff management, solid waste management, etc.), and potential supplementary monitoring (f coliphage and giardia spp.) to assist in predicting gastrointestinal illness. implementation of the comprehensive toolbox within an approval process, for this particular study site would greatly benefit from guidance with respect to minimizing impacts from sand sources, would benefit from guidance in assessing measures of f coliphage and giardia spp., would benefit from guidelines for sample collection and processing, and would benefit from guidelines for assessing nontraditional disease end - points such as skin ailments. these components can be added to the ctb once approved through the federal level review board thereby ensuring a comparable national protection level through this panel. the authors acknowledge that development of a ctbap would require a considerable amount of additional resources. evaluation of state proposals and incorporating the approved methods into a federally maintained ctb requires validation of alternative approaches on a continuous basis, along with consensus building and considerable engagement with the states and beach managers. implementation of the ctbap would thus require a considerable investment in time and resources by both federal and state governments, an investment that could payoff in the long - term through improvements in water quality and ultimately public health. as implied by dwight.,, excess illness costs associated with recreational swimming are on the order of many of millions of dollars per year for two california beaches alone. considering all of the beaches nationally, the payoff could be substantial for investments aimed at improving methods for monitoring and improving water quality at recreational beach sites. | new approaches should be considered as the us environmental protection agency (epa) moves rapidly to develop new beach monitoring guidelines by the end of 2012, as these guidelines serve as the basis by which states and territories with coasts along the oceans and great lakes can then develop and implement monitoring programs for recreational waters. we describe and illustrate one possible approach to beach regulation termed as the comprehensive toolbox within an approval process (ctbap). the ctbap consists of three components. the first is a toolbox consisting of an inventory of guidelines on monitoring targets, a series of measurement techniques, and guidance to improve water quality through source identification and prevention methods. the second two components are principles of implementation. these include first, flexibility to encourage and develop an individualized beach management plan tailored to local conditions and second, consistency of this management plan to ensure a consistent national level of public health protection. the results of this approach are illustrated through a case study at a well - studied south florida recreational marine beach. this case study explores different monitoring targets based on two different health endpoints (skin versus gastrointestinal illness) and recommends a beach regulation program for the study beach that focuses predominately on source prevention. |
more robust estimates of daily climate characteristicsstatistical fitting approachbased on a perfect model approach more robust estimates of daily climate characteristics statistical fitting approach based on a perfect model approach climate indices are widely used across a number of disciplines. they have become an important impact parameter in climate change studies [christenson., 2006 ; zubler., fischer., 2013 ; sillmann., 2013a, 2013b ]. indices offer the possibility to get a more direct quantification of what implications for the environment or certain economic sectors can be expected [della - marta., 2009 ]. many of these indices are based on daily values such as daily maximum temperature or different daily percentiles. for example, wet days are defined as the number of days with a precipitation amount larger than the 90th percentile of the long - term precipitation climatology of this calendar day [klein tank., 2009 ]. hence, for each calendar day the percentile - based thresholds need to be estimated to count the number of events. in order to evaluate the changes of such indices over time due to climate forcings, the number of events in the reference period is compared to the numbers of some future period [zubler., a nice example of an index that gives the user information about its own comfort today and compares it to the comfort in a future climate is the following : the heat stress index combines temperature and precipitation information to draw conclusions about human comfort in a warmer climate, which is more informative than a simple temperature increase [fischer., 2012 ]. furthermore, depending on the index the seasonal forecast of it can be more skillful than simple seasonal means [brands, 2013 ]. often, 30 years (as reference period or hindcast length) or less are available to compute such indices. when calculating such indices based on daily data of about 30 years (e.g., the 90th percentile of precipitation of one particular calendar day), the sample size consists of about 30 values for the observations and each climate model (only in case of seasonal forecasting with an ensemble hindcast data set the sample size is larger). therefore, the expert team on climate change detection and indices (etccdi) [klein tank., 2009 ] suggests using a 5 day moving window centered on the day of interest. however, depending on the region of interest, the daily variability of the parameter of interest (e.g., temperature or precipitation) may be large, which would infer that the sample size is still too small to get a good estimate of the thresholds which define the index. furthermore, daily values are likely to be serially correlated, reducing the effective sample size even further. discuss this issue focusing on inhomogeneities due to sampling problems at the border of the reference time periods. however, when working with seasonal forecasts, the time window considered is limited to the available data ; hence, no borders exist, as the reference period is also the period of interest. plus, depending on the forecast model, only a few months and not the whole year is being forecasted. this means that one is forced to determine the thresholds within the same time window as, for example, the verification or debiasing is being done. when working with long - range forecasts, the bias removal is an important topic [doblas - reyes., 2005 ;, 2012 ; gangsto., 2013 ; hawkins., 2013, 2014a ], especially when a daily bias needs to be removed in order to calculate, for instance, indices based on absolute thresholds (e.g., heating degree days) [piani., 2010 ] in order to remove the bias, the true observed daily climate needs to be known for proper estimation of the bias. again, based on a hindcast period of 30 years or less, the estimate of the mean observed climate is not robust and strongly influenced by day - to - day or weekly variability. fitting the averaged mean climate and therefore smoothing the short - term variability results in more robust estimates of the climate which can then be used to calculate the bias. often, various methods are applied to long - range forecasts in order to improve the forecast skill. however, when applying a quantile mapping or a similar technique [e.g., themel., 2012 ; lafon., 2013 ] or a very sophisticated method as described in piani., all these methods assume that the observed climate is known. however, little information is available on how the observed climate can be estimated properly. also, when debiasing before calculating an index based on a fixed threshold (e.g., tropical nights) in case of long - range forecasts, it is important that a robust bias estimation is established first to ensure that only the bias is removed and not the variability. this study is structured as following : section 2 describes the data and the method, section 3 compares the newly introduced method with the standard method within the perfect model approach ; in section 4 the method is analyzed when using reanalysis data, and section 5 summarizes the conclusions drawn from this study. based on an observational data set or a single model run, the only dimension available to determine a percentile - based threshold or a mean is the time dimension. as introduced above, this sample is often too small. hence, the neighboring points in time (5 days in total) are also included in order to improve the data sample. in order to assess the difference of the estimated threshold between the 5 day moving window (hereafter 5d - fit) as suggested by etccdi and our approach (see below), a perfect model approach (pma) [mller., 2005 ; collins., the pma offers another dimension to sample the data ; besides the time dimension, the ensemble member dimension is added. this provides a large increase in the sample size, which allows for a good estimate of the true climate. european centre for medium - range weather forecasts (ecmwf) 's system4 seasonal forecasting model offers the possibility to explore the true model climate as the combination of 51 members and a total of 32 hindcast years (19812012) results in a sample size big enough to get a good estimate of the daily mean and distribution which is needed for climate index calculations. the number of ensemble members needed to estimate the true climate varies with parameter and region. the noisier (in this case, the larger the daily variability) the climate of the parameter and the region, the more members are needed. hence, the number of ensemble members needed scales with the signal - to - noise ratio of the parameter and the region [deser., 2012 ]. however, with a total number of 1632 years system4 provides a sample large enough for all cases. note that this approach is applicable because of the relatively low skill over most areas over land, hence our region of interest. if the model had perfect skill, the sample size would reduce to the observations as all members would forecast the same [della - marta., ecmwf system4 is a fully coupled atmosphere - ocean forecast system that provides operational seasonal predictions as well as reforecasts in order to evaluate the predictions. details on the ecmwf systrem4 are described in molteni. and http://www.ecmwf.int / products / forecasts / seasonal / documentation / system4/. the reforecasts used in this study in case of the perfect model approach are initialized on 1 november, include 51 members, and consist of 7 months simulations. the example illustrated in section 4 uses the 1 may initialization, also consisting of 51 members and 7 months simulations. following the idea of the perfect model approach (pma), one of the 51 members was used as observations (hereafter observed climate), meaning that the estimate of climate is based on 32 years of data only from that one member (called member x). these were then compared to the full hindcast set which is based on 51 members each with 32 years of data (hereafter true climate). although there may be some random aspects when working with one member, sensitivity tests with other members showed that the general pattern remains very similar. furthermore, when studying one member only, the findings are, in theory, comparable to observations, which offer only one realization and therefore smoothing effects due to averaging might be misleading. climate indices are often defined based on thresholds, e.g., a wet day is defined as the daily precipitation amount larger than the 90th percentile of the long - term precipitation distribution of that day. hence, to determine whether a day is a wet day or not, the threshold of the 90th percentile needs to be defined. as shown in this study, differences exist for thresholds depending on how these are determined. the reason for these differences is the small sample size that is often available when such thresholds are estimated. in order to estimate a certain percentile of a distribution based on the pma, it is assumed that the threshold derived using the full hindcast data set is the true threshold. the same actually applies for a simple measure such as the mean or the standard deviation. in our approach, the mean, for example, for each of the simulated days in the hindcast period of member x, the first estimate (hereafter raw estimate) of the mean is derived by averaging all years of the reference period (32 years) from the hindcast as would be done to determine the mean observed climate ; in case of the thresholds and the standard deviation, the raw estimate is derived by using the distribution of all 32 values of the hindcast period (or reference period). then, in a next step, a statistical fit, the local polynomial regression fitting (loess) which uses neighboring points of the time series x [cleveland and delvin, 1988 ] is used to estimate the true observed mean, standard deviation, and thresholds by smoothing the raw estimate. in order to obtain an optimal fit (hereafter loess - fit), it is important that the fitting method takes into account the annual cycle of the climate and smoothes the short - term variability. hence, basically, a low pass filter needs to be applied to conserve the characteristics of the climate and at the same time reduce the importance of the short - term influences. depending on the parameter and the percentile of interest, the fit needs to be optimized. the goal is to keep as much as possible from the characteristics of the annual cycle but to smooth as much as possible from the short - term variability. this means, the closer to the tail the percentage is, or the smaller a region is, the more noise can be expected, implying that a stronger smoothing needs to be done compared to a mean of a larger area, for instance. the 5d - fit also represents a low pass filter ; however, the amount of smoothing needed in many cases can not be provided by this method. in the examples presented in this study, hence, neighboring points in time of point y are used, weighted by the distance from y. the distance considered, or the size of the neighborhood is controlled by parameter ; thus, controls the amount of smoothing needed for the optimal fit. generally, for < 1 the neighborhood includes proportion of the points, for 1 all points in the time series are used. in this study only values of smaller than 1 were used, varying from 0.25 to 0.5. the same was chosen globally such that the difference to the optimum (here the true the greatest advantage of the loess - fit is that it does not require the specification of a function to fit a model. hence, no assumptions need to be made about the distribution of the data which is often problematic with daily climate data. a caveat, however, is that loess needs a lot of information on the local level. this means, along the daily time series, the data needs to be densely sampled ; hence, a long time record is needed for the best results possible. the loess - fit proves to be a good choice for the fitting of the seasonal cycle as it has been used for this purpose in studies before [cleveland., 1990 ; kunz., 2007 ]. in this study, the mean, standard deviation, 5, 10, and 20% thresholds are computed for member x but also for the whole hindcast ensemble. as mentioned above, all ensemble members and all years offer a large data sample ; thus, no fitting is needed when working with all the data available. these results obtained from the whole hindcast data are considered to reflect the true climate of the model. keep in mind that the true climate does not refer to the true observed climate as this analysis is done with the context of pma. to show the improvement of the loess - fit, the standard deviation and the same thresholds for member x the mean, however, was derived by simply averaging as this is what is usually done. both approaches are then compared to the true climate estimated based on the full hindcast. the four time series in figure1 show for two different grid cells (one within a tropical region and one in the higher northern latitudes to illustrate the cases of low and high daily variability ; within the two regions the grid cells are chosen randomly : the mean (top series) and the 5th percentile (bottom series) over the forecasted period without the first month (november) for surface temperature. shown are the raw estimate, the loess - fit, the true climate and its standard deviation, and in the case of the 5th percentile, the 5d - fit centered on the day of interest. in case of the mean, it is obvious that a simple average over about 30 years is not a robust estimate of the true mean climate as the data are still very noisy. the variability is too large on a daily basis ; a sample size of about 30 is too small. this implies that when correcting the bias on a daily basis, a simple mean of the corresponding calendar day over the reference time period does not provide enough data for a robust estimate of the climatology. the loess - fit of the mean, however, proves to follow the true mean represented by the hindcast mean quite closely. thus, when using a fit to estimate the mean daily climate, the results are very likely to be closer to the true climate than a simple average. (four middle panels) the time - mean absolute difference of the surface temperature (k) to the hindcast mean (true climate) for the mean based on the loess - fit of member x or the raw data for surface temperature (top maps), and the absolute difference for the threshold of the 5th percentile based on the loess - fit or a 5d - fit (bottom maps). (top and bottom) the time series for one particular grid point, the top lines represent the mean, the lower lines the 5th percentile. the black line shows the raw time series of member x, the red line the hindcast mean (true climate), the blue line the loess - fit, and the green line the 5d - fit (only in case of the 5th percentile). (right) the daily variability averaged over the entire forecasted period. when determining thresholds for percentile - based indices toward the tail of the distribution, the differences to the true thresholds increase and the thresholds become noisier. even the 5d - fit does not provide enough data for a robust daily threshold estimation. however, when applying the loess - fit, the time series resembles much more the true one based on the hindcast data as shown in the enlargement of the time series in figure1. expectedly, the loess - fit and the true climate are not identical and can differ from each other. these differences are due to the model 's internal variability and are therefore irreducible [hawkins. the four panels between the time series in figure1 show the global distribution of the absolute differences of surface temperature to the true climate averaged over the forecasted period without the first month (about 175 days). although the difference can not be expected to be zero, the differences for the loess - fit are generally smaller than for the 5d - fit. the numbers vary by region, and generally, the larger the daily variability (shown in the rightmost panel), the larger the differences. hence, the middle to higher northern latitudes show the largest deviations from the true climate as the variability is larger in those regions [mahlstein., 2011 ]. it is not surprising that the differences scale with increasing variability, as a particular member of the model is allowed to vary more from the mean climate in these regions. however, when using the loess - fit the differences are regionally reduced by up to 0.5 k. figure2 shows a zonal mean summary of the absolute difference of the three different thresholds for the 5th, 10th, and 20th percentiles, the mean, and the standard deviation over land only, based on daily values but averaged over the forecasted period (excluding the first month due to model drift and dependencies on initialization). note that the mean is derived by simply averaging over the specific calendar day, the standard deviation, however, was derived based on the 5d - fit. shown are again the absolute differences to the hindcast estimate, hence, the true climate. the full lines show the loess - fit and the dashed lines the 5d - fit (or the average in case of the mean). the threshold is (e.g., 5th percentile), the larger are the differences. however, when leoss - fitting the data instead of using a 5 day moving window to estimate a particular threshold, the differences can be reduced substantially. in seasonal forecasting the standard deviation can be used to recalibrate the forecast to improve the reliability based on the differences found between the observed variability and the modeled one [weigel., figure2 shows that for a robust quality improvement of the forecast, not only the observed mean for the bias correction but also the observed standard deviation needs to be estimated robustly. zonal mean absolute differences of surface temperature (k) between the 5d - fit thresholds and the loess - fit for the mean, standard deviation, 5th, 10th, and 20th percentiles averaged over the forecasted period (excluding the first month). in case of the mean, again, the average is considered and not the 5d - fit. hence, these findings have potentially strong implications for various applications. in case of seasonal forecasting, the bias removal before calculating indices can be an important step to improve the quality of the forecast, especially when indices based on fixed thresholds are used. a biased forecast only uses its actual skill, whereas a proper debiased forecast uses the full potential skill in the forecast [murphy, 1988 ]. this fact becomes even more apparent when analyzing threshold - based indices as a biased forecast is not capable of distinguishing between events and nonevents when biased toward one side. hence, this step potentially increases the skill of a forecast. however, when removing the bias, it is important that only the bias is removed and not part of the daily variability, as would be the case when working with a simple daily average. whether an event, for example, a wet day, happened or not depends on the threshold. a systematic false identification of events, or nonevents, can have skill - relevant consequences in case of seasonal forecast verification (see section 4). the same findings shown in figures1 and 2 apply to precipitation data as illustrated in figure3. as expected, the day - to - day variability is larger in case of precipitation compared to surface temperature. hence, the fitting needs to be done very carefully, especially when the annual cycle has more than one maximum or minimum. such a case would require a stronger dependency on the local environment, hence, a lower term. figure 3 (bottom right) illustrates how large the variability can be for some places. and it also illustrates that, in such cases, member x may deviate from the true threshold, as due to variability, its realization was drier (in this case) than the model climate. the results presented here can also be important for climate change studies, as the situation is quite similar. depending on the question asked, model data are either compared to an observed reference period, or two time periods within the model framework are compared to each other [sillmann., 2013a, 2013b ]. usually, these periods consist of only one model / member ; hence, the sample size is not sufficiently large in order to estimate robust thresholds. zhang. proposes a methodology to improve the threshold estimation for climate trend studies (which was applied by sillmann. [2013a, 2013b ]), taking into account the inhomogeneities in percentile exceedance between estimates within and out of the reference period. the approach presented here can also be applied in climate change studies and can be seen as an alternative as it improves the threshold estimation without a large computational effort. however, our approach does not take into account the boundary issues discussed by zhang.. figure4 shows an example for one specific index, in this case, for wet days. the area in orange (over land only) shows where the loess - fit is as good or better than the 5d - fit when estimating the number of wet days for december - january - february (djf) for one particular year. specifically, the estimated numbers of wet days of the loess - fit and the 5d - fit are compared to the number of wet days estimated from the full hindcast data set for 1 year in djf. however, the results of other years or the mean over the hindcast period look very similar. averaged over all years, 72% of the grid cells are as good as or better than the 5d - fit. furthermore, the area where the loess - fit shows no difference to the estimated number of wet days compared to the full hindcast data set is substantially larger than that compared to the 5d - fit. hence, the loess - fit yields more often the true estimated number of wet days than the 5d - fit. the stippled area in figure4 shows the area that is significantly improved, meaning that in all 32 years used, these grid cells are improved or as good as 5d - fit, which poses a very rigid criteria of significance. the stippled area happens to be the area with the largest variability [mahlstein., 2012 ], which implies that especially for noisy climate data, a fit will yield a better result. the estimated number of wet days from the hindcast (true climate) is compared to the two estimates based on the two analyzed approaches for djf for one particular year. the area in orange shows where the loess - fit is as good or better than the 5d - fit over land only. stippled areas show grid cells where the loess - fit is as good or better than the 5d - fit for all 32 years of the hindcast. the remaining question is how the method introduced above performs outside of the perfect model approach. therefore, the two approaches are compared to each other with the aid of the example of differences in the number of warm nights in the ecmwf re - analysis (era)-interim data set [dee., a warm night is defined as the minimum temperature that is above the 90th percentile of the long - term climatology of minimum temperatures. this index was chosen as it is threshold based depending on the percentile, yet the percentile is still quite moderate. hence, for each day of the year, the 90th percentile was determined based on the loess - fit and the 5d - fit. each approach yields a number of warm nights a year ; the time period considered are 30 years starting in 1981. then, the absolute difference between the numbers of each year were computed and then averaged over the 30 year period. figure5a shows that the mean differences between the two approaches vary regionally but can be quite substantial. globally averaged, the difference is about six nights, which is a difference of about 16% on average. locally, the differences can be quite large which changes the number of warm nights significantly. this implies, that in case of a seasonal forecast verification, quite a large number of events are either false events (false alarms) or false nonevents (missed events). as mentioned above, the false identification of an event, in this case, a warm night, or a false nonidentification can have skill - relevant consequences. to quantify these consequences, the hindcast data set of number of warm nights in june - july - august (jja) based on the system4 may initialization data was evaluated twice ; once against the observed number of warm nights from era - interim based on the 5d - fit, and once based on the loess - fit. the difference in the anomaly correlation can be as large as 20% as shown in figure5b. on average it is around 5%, but for areas with low skill, even this can be substantial. the example shown in figure5b shows an increase in skill of about half of the land area, the actual skill of the loess - fit is shown in figure5c. depending on the characteristics of the variability, the loess - fit of the observed thresholds to identify a warm night can be closer to the model mean climate or further away ; hence, the skill can improve or decline, however, not in a systematic way. for instance, the threshold in the observations for an event without fitting is 10.2, while the fitting yields a threshold of 10.3. whether the skill of the model improves depends solely on the model forecast, whether it forecasted the event or not. if the observed value is 10.25 and the model forecasted an event, without the fitting the model would yield a better skill than with the fitting of the observations. on the other hand, if the model did not forecast an event, the skill is improved when the fitting approach is applied to the observational data. hence, it is important to note that a proper characterization of events in the observations does not result in an overall improvement of the model skill. the method simply helps to quantify the true skill of the model as the reality can be estimated more adequately. or in case of a bias removal the method improves the skill of the model as the bias can be estimated more precisely because the mean observed climate is known to be more precise. the important finding however is that the method of estimating percentile thresholds for indices has skill - relevant consequences. (a) mean absolute difference in number of warm nights a year between the 5d - fit and the loess - fit averaged over the time period 19812010 of the era - interim data set. (b) difference in skill (anomaly correlation) averaged over a 30 year hindcast period (19812010) between the two approaches for jja. positive values indicate an improvement in skill by the use of the loess - fit compared to the 5d - fit and negative a decline in skill. (c) anomaly correlation between system4 and loess - fitted era - interim data for warm nights over the hindcast period 19812010 for jja. (d) difference in skill (anomaly correlation) averaged over a 30 year hindcast period (19812010) between the two approaches for jja for the number of wet days. positive values indicate an improvement in skill by the use of the loess - fit compared to the 5d - fit and negative a decline in skill. this illustrates that also in case of a precipitation - based index the skill is neither improved nor decreased in a systematic manner. depending on the variability, the skill changes according to the better quantification of the events. climate indices are very useful tools to describe the current climate, the forecasted climate, or the expected climate changes in an applied way to users or even the public. indices aggregate information in a nonlinear way, and this information tells more about possible impacts than simple temperature averages, for instance. indices are often based on daily data and/or thresholds. these thresholds often define whether an event happened or not. hence, an accurate estimate of the threshold itself is very important, and therefore, it needs to be estimated carefully. these biases have to be corrected by comparing the model data to observational data covering the same period. this study employs the large sample of historic seasonal forecasts to determine the effect of smoothing the daily climatology by a fitting approach. it is shown that the estimates can be improved and the thresholds are closer to the true ones compared to a 5 day moving window being used in previous studies [klein tank., 2009 ] or a simple average as in the case of the estimation of the mean climate. a fitting procedure such as the loess fitting [cleveland and delvin, 1988 ] reduces the short - term variability substantially by keeping, as much as possible, a complex annual cycle. no particular fitting method is advocated in this study for the simple reason that there is no perfect fitting for all purposes. the fitting needs to be done carefully and can differ depending on the percentile, region, and parameter of interest. however, especially in regions with high variability, a proper fitting approach will yield better results than a moving window. other approaches have been discussed in the literature, such as a monte carlo simulation [zhang., 2005 ], which focuses on homogeneity issues at the border of the reference period. compared to this approach, the fitting approach can be easily applied in long - range forecasting where usually the whole time period available is taken into account and therefore no boundaries exist. alternatively, to increase the sample size, a larger time window could be used, but by doing so it is likely to attenuate the annual cycle of the threshold, which is particularly problematic for extremes. suggest to fit a statistical distribution to the daily data sample in order to get a robust estimate of the threshold. compared to this approach, the method described here is simpler to use as the fitting needs to be done only once and keeps the annual cycle in the focus. this could be an advantage for operational use because of its simplicity or when dealing with large data sets (e.g., cmip5, decadal and seasonal forecasts). generally, the higher the day - to - day variability, the more difficult it is to estimate the true thresholds. however, while the 5d - fit preserves much of the short - term variability, the loess - fit is able to smooth these fluctuations. applied on an index, it shows that the loess - fit distinguishes better between an event and a nonevent. hence, it is recommended to use a fitting approach to estimate thresholds for index calculations. also, for bias removal procedure, it is important to gain good knowledge about the true climate based on which the bias is derived from. based on this information, the calculation of the bias removal can be improved and therefore also the forecast quality. the main advantage of the method presented here is that the loess fitting improves the estimate of the seasonal cycle of daily means or daily thresholds and thus allows for a good comparison between two different reference periods (e.g., observations and models, or model past to model future). | climate indices help to describe the past, present, and the future climate. they are usually closer related to possible impacts and are therefore more illustrative to users than simple climate means. indices are often based on daily data series and thresholds. it is shown that the percentile - based thresholds are sensitive to the method of computation, and so are the climatological daily mean and the daily standard deviation, which are used for bias corrections of daily climate model data. sample size issues of either the observed reference period or the model data lead to uncertainties in these estimations. a large number of past ensemble seasonal forecasts, called hindcasts, is used to explore these sampling uncertainties and to compare two different approaches. based on a perfect model approach it is shown that a fitting approach can improve substantially the estimates of daily climatologies of percentile - based thresholds over land areas, as well as the mean and the variability. these improvements are relevant for bias removal in long - range forecasts or predictions of climate indices based on percentile thresholds. but also for climate change studies, the method shows potential for use.key pointsmore robust estimates of daily climate characteristicsstatistical fitting approachbased on a perfect model approach |
prevention of dental caries is one of the main strategies in contemporary pediatric dental practice. the dental plaque is a structure of vital significance as a contributing factor to at least the initiation of the carious lesion. the major strains of streptococci present in plaque are : streptococcus mutans, streptococcus sanguis, streptococcus mitior, streptococcus milleri and streptococcus salivarius. of these, although mechanical plaque control by tooth brushing is the most dependable and commonly practiced oral hygiene measure, numerous anti - plaque agents have been tried for improving oral health. these agents are capable of preventing bacterial adhesion, colonization and metabolism, and thus affect the bacterial growth. the efficacy of these antimicrobial agents depends on factors like vehicle used, concentration of active agents, substantivity of the agent and duration of the treatment. an ideal anti - plaque agent for regular use in children should not interfere with biologic processes occurring in the mouth, be harmless to oral mucosa, should have low toxicity if accidentally swallowed, and should be both sugar and alcohol free. fluoride is one of the most important and effective components of preventive dental programs in children. sodium fluoride mouth rinses are effective in reducing caries and inhibit carbohydrate utilization of oral microorganisms by blocking enzymes involved in the bacterial gylcolytic pathway. xylitol is a naturally occurring non - cariogenic sugar substitute that can not be metabolized by oral bacteria. xylitol reduces the amount of adherent extracellular polysaccharides, lipoteichoic acids, resulting in the formation of loosely attached bio - films to the tooth surfaces. most in vivo studies have focused on the application of xylitol chewing gums, inextricably combining physicochemical with mechanical effects. although it is incorporated in certain toothpastes, data available on mouth rinses containing triclosan are limited. thus, the aim of this study was to investigate the efficacy of a newly introduced xylitol, sodium fluoride and triclosan containing mouth rinse in reducing the levels of plaque s. mutans and to compare it with that of a 0.12% chlorhexidine mouth rinse. eighty - five normal children aged between 7 and 13 years and residing in an orphanage in bangalore city were screened as part of a routine dental examination. these children had the same dietary pattern and followed similar oral hygiene practices. prior to the study, ethical clearance was obtained from the ethical committee of the institution. to be included in the study, each child had to have a dental caries score (deft / dmft score) equal to or greater than 3. medically compromised childrenchildren with a history of taking antibiotics 3 months prior to and during the study periodchildren undergoing orthodontic treatment or with an intraoral prosthesischildren who could not brush their teeth or rinse on their ownpresence of any intraoral soft tissue pathology medically compromised children children with a history of taking antibiotics 3 months prior to and during the study period children undergoing orthodontic treatment or with an intraoral prosthesis children who could not brush their teeth or rinse on their own presence of any intraoral soft tissue pathology thirty children formed the study group. the authorities of the orphanage were instructed not to take these children for any dental treatment during the study period. at the onset of the study, each child was given a new soft toothbrush and non - fluoridated toothpaste. demonstration of tooth brushing using scrub technique was given to all children by the investigator. they were instructed to brush before breakfast in the morning and after meals in the night. prior to commencement of the oral rinse regime, autoclaved wooden toothpicks were used to take plaque samples from the buccal surface of a noncarious permanent mandibular first molar or a primary mandibular second molar. the samples were taken to the laboratory within an hour, serial dilutions prepared and vortexed. one milliliter of the dilution was inoculated onto mitis salivarius agar and incubated at 37c for 48 hours. colony forming units (cfus) of s. mutans were counted at baseline with the help of a digital colony counter. in this single - blind trial, the children were randomly divided into two groups of 15 children each. group i (study group) was given a mouth rinse containing xylitol (5%), sodium fluoride (0.05%) and triclosan (0.03%) (kidodent mouthwash, indoco remedies ltd, mumbai, india), and group ii (control group) was given a chlorhexidine (0.12%) mouth rinse (nitra hex, micro labs limited, bangalore, india). the children were asked to gather in a large room, where each child was given 10 ml of the mouth rinse and asked to rinse for 1 minute. mouth rinsing was carried out twice daily, half an hour after breakfast and half an hour following dinner, for a period of 21 days under the supervision of the investigator. on the 22 day, prior to breakfast, plaque samples were collected, processed and s. mutans counts were assessed and compared with baseline values. data obtained were subjected to statistical analysis using student 's t - test. in order to ascertain preference of mouth rinse, all the children were asked to taste both mouth rinses at the end of the study. medically compromised childrenchildren with a history of taking antibiotics 3 months prior to and during the study periodchildren undergoing orthodontic treatment or with an intraoral prosthesischildren who could not brush their teeth or rinse on their ownpresence of any intraoral soft tissue pathology medically compromised children children with a history of taking antibiotics 3 months prior to and during the study period children undergoing orthodontic treatment or with an intraoral prosthesis children who could not brush their teeth or rinse on their own presence of any intraoral soft tissue pathology thirty children formed the study group. the authorities of the orphanage were instructed not to take these children for any dental treatment during the study period. at the onset of the study, each child was given a new soft toothbrush and non - fluoridated toothpaste. demonstration of tooth brushing using scrub technique was given to all children by the investigator. they were instructed to brush before breakfast in the morning and after meals in the night. prior to commencement of the oral rinse regime, autoclaved wooden toothpicks were used to take plaque samples from the buccal surface of a noncarious permanent mandibular first molar or a primary mandibular second molar. the samples were taken to the laboratory within an hour, serial dilutions prepared and vortexed. one milliliter of the dilution was inoculated onto mitis salivarius agar and incubated at 37c for 48 hours. colony forming units (cfus) of s. mutans were counted at baseline with the help of a digital colony counter. in this single - blind trial, the children were randomly divided into two groups of 15 children each. group i (study group) was given a mouth rinse containing xylitol (5%), sodium fluoride (0.05%) and triclosan (0.03%) (kidodent mouthwash, indoco remedies ltd, mumbai, india), and group ii (control group) was given a chlorhexidine (0.12%) mouth rinse (nitra hex, micro labs limited, bangalore, india). the children were asked to gather in a large room, where each child was given 10 ml of the mouth rinse and asked to rinse for 1 minute. mouth rinsing was carried out twice daily, half an hour after breakfast and half an hour following dinner, for a period of 21 days under the supervision of the investigator. on the 22 day, prior to breakfast, plaque samples were collected, processed and s. mutans counts were assessed and compared with baseline values. data obtained were subjected to statistical analysis using student 's t - test. in order to ascertain preference of mouth rinse, all the children were asked to taste both mouth rinses at the end of the study. in both groups, there was a significant reduction in the mean s. mutans count at the end of 21 days (p < 0.001). of the 30 children, 83.33% preferred the taste of xylitol, sodium fluoride and triclosan containing mouth rinse, while 16.67% preferred the taste of 0.12% chlorhexidine mouth rinse [figure 1 ]. it is important for these products to be effective and safe for regular use in children. mouth rinses are recommended only for those who have the ability to swish and expectorate without swallowing. most mouth rinses contain alcohol as one of their ingredients and they are also available over the counter. the major side effects of alcohol containing mouth rinses include the presence of oral pain, burning sensation, difficulty of use in patients with oral sensitivity and the risk of accidental alcohol ingestion in children.[1012 ] the extrahepatic metabolism of alcohol has been demonstrated in oral tissue. in the human mouth, aldehyde dehydrogenase (aldh), an enzyme that converts acetaldehyde into a nontoxic acetate compound, occurs less frequently than alcohol dehydrogenase (adh). this imbalance allows for the accumulation in oral tissues of a toxic, reactive and irritating acetaldehyde. due to a point mutation, aldehyde dehydrogenase 2 (aldh2) isoenzyme is deficient in 3050% of asians. these individuals have a genetic inability to remove acetaldehyde and consequently have very high salivary acetaldehyde levels after moderate dose of alcohol. hence, in this study, it was primarily necessary to select two mouth rinses that were alcohol free. in recent times, various polyalcohols, particularly xylitol, have been incorporated in a number of different products for children, including mouth rinses. the nonspecific effect of xylitol is due its non - fermentability, and thus does not encourage bacterial growth. the selective effect on mutans streptococci results in the development of mutant resistant strains which may be less virulent in the oral environment. metabolic cycle in which xylitol is taken into the cell, phosphorylated to xylitol-5-phosphate, split into sugar phosphate phosphatases and the resulting xylitol is expelled from the cell. the ability of plaque to produce acids by the metabolism of sugars is reduced by xylitol. xylitol appears to have a unique effect in reducing adhesion and it is expected that other polyols might not show this clinical effect. the concentrations of ammonia and basic amino acids increase when plaque is exposed to xylitol, resulting in neutralization of plaque acids. the presence of fluoride in this mouth rinse could have also contributed to the reduction of s. mutans in plaque. the effects of fluoride on streptococcal cells are partly ascribed to the inhibition of enolase, one of the series of gylcolytic enzymes. this inhibition decreases the intracellular level of phosphoenolpyruvate (pep), and thus decreases bacterial sugar uptake via pep - dependent phosphotransferase system (pep - pts). in addition, fluoride can directly inhibit bacterial proton - translocating atpase that is considered to partly contribute to the proton excertion out of the cells, leading to acidification of intracellular ph. the dissociation of unionized hydrofluoric acid into h+ and f in the cells also promotes intracellular acidification. analyses of intracellular gylcolytic intermediates revealed that xylitol inhibited the upper part of the gylcolytic pathway, while fluoride inhibited the lower part. this suggests that fluoride and xylitol together have synergistic inhibitory effects on the acid production of mutans streptococci and that xylitol has the potential to enhance inhibitory effects of low concentrations of fluoride. however, fluoride mouth rinses should be reserved for use with children judged to be at moderate or high risk for dental caries. it is also important to select a fluoridated mouth rinse with a fluoride concentration of 0.05% for regular use. the other ingredient present is triclosan, a broad - spectrum antimicrobial, having an anti - plaque potential. triclosan (2,4,4-trichloro 2-hydroxydiphenyl ether) is used to increase the ability of mouthwashes to bind to the oral mucosa, and thus be available for longer periods of time. jenkins. compared the magnitude and duration of salivary bacterial count reductions produced by a single rinse of 0.2% triclosan, 1% sodium lauryl sulfate (sls) and 0.2% chlorhexidine mouthwashes. they found considerable reductions in bacterial counts which remained significant for 3 hours with triclosan and for 7 hours with sls and chlorhexidine. the use of 0.3% triclosan mouth rinse showed significant reduction in salivary mutans streptococci count. hence, the significant reduction in plaque s. mutans observed in our study could be attributed to the synergistic effect of all three constituents, viz. it is an effective anti - plaque agent and is widely available as a mouth rinse. chlorhexidine is a bis - biguanide which is effective against gram - positive bacteria, gram - negative bacteria and yeast. at relatively high concentration, chlorhexidine is bactericidal ; but at low concentration, it is bacteriostatic. low concentrations of chlorhexidine allow cytoplasmic constituents to leak out, while a high concentration coagulates them. it inhibits the membrane atpase and anaerobic process. in a study on 1214-year - old children with high caries risk, 0.12% chlorhexidine mouth rinse was more efficient in reducing mutans streptococci count in saliva, as compared to other mouth rinses. however, it gave more negative findings when taste sensation and side effects were compared. a recent review concluded that due to the current lack of long - term clinical evidence for caries prevention and reported side effects, chlorhexidine rinses should not be recommended for caries prevention. since we found no significant difference between both the mouth rinses, with regard to their efficacy in reducing s. mutans, the use of a low fluoride xylitol based mouth rinse appears to be a suitable choice for regular use in children. also, children preferred the taste of the bubble gum flavored, xylitol - based mouth rinse. since this study was a brief clinical trial on a newly introduced mouth rinse for children, studies of longer duration further research on individual components and their effect on saliva, teeth and remineralization potential would enable clinicians to select an appropriate mouth rinse for use in children. significant reduction inplaque levels of s. mutans was observed with the use of xylitol, sodium fluoride and triclosan containing mouth rinse. | introduction : prevention of dental caries is one of the main strategies in contemporary pediatric dental practice. mouth rinses are widely used as an adjunct to maintain oral hygiene. it is important for these products to be effective and safe for regular use in children.objective:the aim of the study was to investigate the efficacy of a newly introduced xylitol, sodium fluoride and triclosan containing mouth rinse in reducing levels of plaque streptococcus mutans and to compare it with that of a 0.12% chlorhexidine mouth rinse.materials and methods : thirty children were randomly divided into two groups of 15 children each. group i (study group) was given a mouth rinse containing xylitol (5%), sodium fluoride (0.05%) and triclosan (0.03%) and group ii (control group) was given a chlorhexidine (0.12%) mouth rinse. both mouth rinses were alcohol free. mouth rinsing was carried out twice daily, half an hour after breakfast and half an hour following dinner, for a period of 21 days under the supervision of the investigator.results:in both groups, there was a significant reduction in the mean s. mutans count at the end of 21 days (p < 0.001). no significant difference was observed between the two mouth rinses.conclusion:the use of a low fluoride xylitol based mouth rinse appears to be a suitable choice for regular use in children. |
we report two cases - one a fifteen year old child with swelling distal humerus and another a case of a thirteen year old child with pain and swelling proximal tibia. a fifteen year old child presented to department of orthopedics of our institute with complaint of difficulty in moving upper limb and swelling distal humerus. another patient who was a 13 years old male had painful ambulation and swelling in upper tibia. mri followed by core needle biopsy was done in both the patients confirming the mass to be giant cell tumor which is quite rare in this age group. first patient was managed by wide excision and total elbow replacement and second one by curettage, cementation and augmentation with plate - screw construct. it should be considered as one of the differential diagnosis of epiphyseo metaphyseal lesions in pediatric population in spite of its rarity. giant cell tumor (gct) of bone is one of the most common bone tumors of adults encountered by an orthopedic surgeon and radiologist alike. it is a benign aggressive tumor of skeletally mature individuals with incidence peaking in third decade of life []. in skeletally immature individuals giant cell tumour is extremely rare (.8% to 7.5%) with slight female preponderance and epi - metaphyseal location. we hereby report two cases of giant cell tumor in pediatric age group, one of which was managed by wide excision and total elbow replacement and another by extended curettage - cementation and plate - screw augmentation followed by good functional outcome in both the patients. in our orthopaedic oncology clinic we have come across two pediatric patients having giant cell tumor of bone in last two years. first patient was a 15 years old male child presenting to us with history of pain, swelling in right distal humerus for last three months. second patient was thirteen years old male who came with a history of swelling proximal tibia and painful ambulation for last four months. radiologically features of epiphyseometaphyseal lesion, thinned out cortices, physeal destruction and wide zone of transition were noted more so in first patient. keeping in view age of patients and radiological appearance differential diagnosis - of chondroblastoma, brown tumor, aneurysmal bone cyst and giant cell tumor were kept. mri in both patients was suggestive of gct which was confirmed by histopathology examination. clinico - pathological profile of patients both patients had campanacci grade iii giant cell lesions and were managed surgically. as case 1 had cortical breach in multiple planes, large soft tissue component, total physeal destruction, large area of subchondral bone involvement, hence wide resection with total elbow replacement was planned [fig.1 ]. hence this patient was managed by extended curettage, cementation and plate - screw construct augmentation. there was wound dehiscence at six weeks in this patient which was managed by gasrtrocnemius flap [fig.3 ]. a. x ray distal humerus lytic, expansile epiphyseometaphyseal lesion b. islanding of lateral biopsy scar c. skin incision d. resected tumor specimen with cortical breach e total elbow replacement f. follow up x ray. a. coronal t1 m r i expansile isointense to hyperintense epiphysiometaphyseal lesion, thinned and indistinct overlying cortex. b. coronal stir image multi - cystic lesion, fluid - fluid levels along with elbow joint effusion c. axial t1 post gadolinium images intense heterogenous enhancement of the lesion with cortical break and extension into adjacent soft tissue (arrows in c) d. high resolution histopathology slide showing giant cells and stroma with moderate atypia. a extended curettage with burr b. cementation with plate screw augmentation c, d. identical to their adult counterpart, the most common site of pediatric giant cell tumors is around the knee (lower end of the femur and the upper end of the tibia) followed by distal radius and proximal humerus, distal humerus being a rare site. out of two patients presented here the first one had giant cell tumor of right distal humerus and the second one in left proximal tibia. giant cell tumors of bone (gct) are primarily metaphyseal lesions that reach their typical epimetaphyseal location after growth plate closure. open physis is known to restrict gct to an almost exclusively metaphyseal location, while according to some authors an open physis does not prevent gct from penetrating the physis to become epiphyseometaphyseal. in present study too both patients had open physis, still the lesion was epiphysiometaphyseal suggesting a more aggressive behaviour of lesion. the principles of management in pediatric giant cell tumor range from local control without compromising joint function and preservation of physis as much as possible to wide resection and reconstruction, the latter being used only in select group of patients. local control without compromising joint function is achieved with thorough curettage of the lesion aided with a burr (extended curettage). campanacci grade i, ii and even iii lesions especially with no joint invasion, less than 50% metaphyseal destruction and uniplanar soft tissue mass are treated by this modality. many adjuvants and techniques of reconstruction after curettage have been described in literature, but adequate removal of the tumor with extended curettage is a more important predictive factor for surgical outcome rather than the use of adjuvants. autograft, allograft, tantalum, synthetic bone substitutes like calcium phosphate as well as bone cement have been used for filling the cavity after curettage. auto and allografts have drawbacks like limited availability, collapse and infection while use of tantalum with allograft and bone marrow though promising is limited by its high cost. it allows early weight bearing, physical rehabilitation and return to activity by maintaining normal anatomy and providing immediate stability. but frequency of postoperative fractures following extended curettage and cementation is a problem which needs consideration. a study reported fifty - two patients with benign giant - cell tumors treated with extended curettage, cryosurgery with liquid nitrogen and cementation. although the rate of tumor recurrence was low, approximately 25% of the patients had postoperative fractures. metal augments (screws, steinmenn pins and plate - screw constructs) have been advocated to address this problem of postoperative fractures. they provide immediate stability, early weight bearing and postoperative fracture prevention, resulting in better functional outcome and improved musculoskeletal tumor society score (mstss). proximal tibial t plate and screw construct was used in our study in the second patient as metal augment. a coronal t1 mri well defined intermediate signal intensity epiphyseo metaphyseal lesion proximal tibia b. axial t1 fat saturated post gadolinium images showed intense lesion enhancement, cortical break and adjacent soft tissue extension (arrow b) along with patchy enhancement of adjacent bone c. followup x ray. wide resection and reconstruction is opted only in select group of patients with campanacci grade iii lesions with joint invasion, multiplanar soft tissue component and when large area of subchondral bone is involved by the tumor. under in such conditions bone salvagibility by intralesional methods is bound to result in a severe mechanical compromise thereby impairing restoration of skeletal integrity and leading to a severe functional compromise. biological options like hemi - articular and total elbow allografts have been used for reconstruction of the defects following distal humerus tumor resection, but the complication rates are high, hence wide resection and total elbow arthroplasty enables good functional outcome and lower risk for recurrence. biological options like reconstruction with allografts both our patients were campanacci grade iii lesions with first patient having thinned out cortices, cortical breach, total subchondral bone involvement and a large soft tissue component. hence wide resection and total elbow replacement was chosen in this patient while second patient had relatively contained lesion, partial epiphysiometaphyseal involvement, minimal uniplanar anteromedial soft tissue mass and hence was treated with extended curettage, cementation and plate - screw construct augmentation. physeal penetration and destruction by aggressive gct is bound to lead to angular deformities and growth related problems. in adolescents metastasis usually to lung and malignant transformation are other lesser known complications. the frequency of pulmonary metastases in gct has ranged from 1% to 6%. local recurrence has been noted to increase risk of lung metastasis up to as high as six fold especially in grade iii lesions. in the event of lung function compromise due to metastasis, metatatectomy or pulmonary wedge resection recurrence is quite common due to the difficulty in achieving complete clearance because of breached anatomical boundaries by gct along with extension into the adjacent soft tissue. this can be managed by further curettage and cementing, with a minor risk of increased morbidity. although gct is a rare entity in pediatric age group, it mirrors the behaviour of its adult counterparts in terms of location, treatment, recurrence and course of the disease. it must be considered as one of the possible differential diagnosis of epiphyseometaphyseal lesions in pediatric and adolescent population in spite of its rarity. clinical examination, proper imaging including x rays, mri followed by histopathological confirmation is necessary to arrive at accurate diagnosis in pediatric giant cell tumor of bone. serum alkaline phosphatase is an important biochemical marker as its normal levels rule out brown tumor of hyperparathyroidism. modality of surgical management, extended curettage or wide resection is based on parameters like cortical breach, large soft tissue component and extent of subchondral bone involvement. | introduction : giant cell tumors of skeleton are very rare in pediatric and adolescent population. here we report two cases - one a fifteen year old child with swelling distal humerus and another a case of a thirteen year old child with pain and swelling proximal tibia.case report : a fifteen year old child presented to department of orthopedics of our institute with complaint of difficulty in moving upper limb and swelling distal humerus. another patient who was a 13 years old male had painful ambulation and swelling in upper tibia. mri followed by core needle biopsy was done in both the patients confirming the mass to be giant cell tumor which is quite rare in this age group. first patient was managed by wide excision and total elbow replacement and second one by curettage, cementation and augmentation with plate - screw construct.conclusion:giant cell tumour of skeleton is highly uncommon in pediatric age group. it should be considered as one of the differential diagnosis of epiphyseo metaphyseal lesions in pediatric population in spite of its rarity. |
communication in health can contribute to all aspects of disease prevention and health promotion. in order to become successful pharmacists this study was conducted at the university of lagos to assess communication skills of pharmacy students. questionnaires were used for data collection. the questionnaire had two sections - the bio data section and pre - formulated questions on communication skills which has three options and one of these is the best option. a total number of 125 respondents were involved in the study which included 25 students from 200level, 50 from 300level and 50 from 500 level., about 62% picked the best options as their answer while the rest picked other options. there was no statistical difference in the choice of best options between the different levels of study. it can be concluded from the results of this study that majority of pharmacy students at the university of lagos had good communication skills and they will be able to discharge their duties as pharmacists when they eventually graduate. | background : communication skill is the bridge between the pharmacists and the patient. communication in health can contribute to all aspects of disease prevention and health promotion. in order to become successful pharmacists, one needs to possess excellent communication skills to serve clients.this study was conducted at the university of lagos to assess communication skills of pharmacy students.method:the study was descriptive and cross sectional. it was carried out between may and july 2009. questionnaires were used for data collection. the questionnaire had two sections - the bio data section and pre - formulated questions on communication skills which has three options and one of these is the best option.results:a total number of 125 respondents were involved in the study which included 25 students from 200level, 50 from 300level and 50 from 500 level. majority of them were between 18 - 25 years old (89.6%). there were more females (71.2%) than males (28.8%). also most of them were christians (71.2%).among the respondents, about 62% picked the best options as their answer while the rest picked other options. there was no statistical difference in the choice of best options between the different levels of study.conclusions:it can be concluded from the results of this study that majority of pharmacy students at the university of lagos had good communication skills and they will be able to discharge their duties as pharmacists when they eventually graduate. |
paediatric patients often present to the emergency department with different painful conditions that require immediate surgical interventions. the choice of anaesthetic agent to provide deep sedation and analgesia in these patients varies highly. ketamine has already played a safe and effective role as a sole anaesthetic agent with a few limitations like delayed recovery, emergence phenomenon and nausea and vomiting. subsequently, there is an increase in the use of propofol due to its favourable pharmacokinetics. however, propofol is associated with dose - dependent respiratory depression, hypotension and no intrinsic analgesic property. concomitant opioid use reduces the dose requirements of each other, but the respiratory depression is supposed to be heightened. theoretically, the combination of ketamine and propofol would allow a reduction in dose requirement of each agent, like the combination of fentanyl and propofol. despite a plethora of articles on the ketamine propofol combination, a comprehensive evidence is still lacking probably due to heterogeneity of clinical studies and various study designs.[310 ] among these, a few authors have studied the mixture of ketamine propofol[3510 ] in the form of infusion. to the horizon of our knowledge, only one case series (of four patients) has compared continuous infusion of the ketamine propofol versus fentanyl propofol, where the investigators used propofol infusion alone throughout the procedure in both the groups after the bolus administration of the respective mixtures in the designated groups. this study was carried out to compare the effectiveness and safety of intravenous infusion of the ketamine propofol combination would have more favourable haemodynamics and a better recovery profile than the infusion of the fentanyl propofol combination in case of emergency short surgical procedures in the healthy paediatric patient population. this prospective, randomized, double - blind, active - controlled trial was conducted after getting the permission from the hospital ethics committee. children aged 314 years, of american society of anesthesiologist (asa) physical status ie - iie, posted for emergency short surgical procedures like reduction of fracture dislocation, incision and drainage of abscess and dressing - debridement of wounds, were included in this study. the exclusion criteria were known allergy or contraindication to either study drug, patient's / parent 's refusal, head injury, seizure disorder, psychological disorders, ingestion of psychotropic or sedative medication, congenital heart disease, severe obesity (body mass index > 35 kg / m) and full stomach patients. written informed consent was obtained from the guardian of the patients after proper discussion of the study procedure and risk benefits in the language they understand. fentanyl group compared to with 20% in the ketamine propofol group. considering the level of significance () as 0.05, power of the study (1-) as 80% and expecting an improvement in the incidence of hypotension of about 30% between the two groups, the sample size was estimated to be 40 in each group. considering a dropout ratio of 25%, patients were randomly allocated by the sealed envelope technique to one of two groups pre - operatively, and received either of the following two regimens : in group pk (n=50) : 2 ml of normal saline (pre - induction) and calculated volume of drug from 11 ml of the ketamine - propofol solution for inductionin group pf (n=50) : fentanyl 1.5 g / kg diluted to 2 ml with normal saline (pre - induction) and calculated volume of drug from 11 ml of the propofol solution for induction. in group pk (n=50) : 2 ml of normal saline (pre - induction) and calculated volume of drug from 11 ml of the ketamine - propofol solution for induction in group pf (n=50) : fentanyl 1.5 g / kg diluted to 2 ml with normal saline (pre - induction) and calculated volume of drug from 11 ml of the propofol solution for induction. in case of group pk, a ketamine propofol solution (1:2) was prepared by mixing 1 ml ketamine (50 mg/ ml) with 10 ml propofol 1% (10 mg / ml) so that each milliliter of the ketamine propofol solution was contained of 9.0909 mg propofol and 4.5454 mg ketamine (approximately rounded off to 9 mg of propofol and 4.5 mg of ketamine, respectively). in case of group pf, 10 ml propofol 1% was mixed with 1 ml of normal saline so that each milliliter was contained of 9.0909 mg of propofol (rounded off to 9 mg / ml). the anaesthesiologist who gave the drugs and assessed the parameters was blinded to the study drugs because the drugs were prepared by a separate anaesthesiologist who was not involved in the study procedures, and the colours of the prepared drugs were the same. monitors [electrocardiography non - invasive blood pressure (nibp) and pulse oximeter ] were attached and the baseline values were noted. an intravenous (iv) line was made and infusion with lactated ringer 's solution was started. metoclopramide (0.15 mg / kg) iv were slowly given as premedication, 30 min before starting the procedure. group pk received 2 ml of normal saline iv and group pf was given inj. fentanyl 1.5 g / kg iv, the volume of which was made to 2 ml. both the interventional drugs were given as an initial bolus dose of 1 mg / kg propofol iv (considering the syringes contained only propofol for simplicity). then, infusion was started at the rate of 50 g / kg / min. the level of sedation was assessed at 1-min intervals and the infusion rate was adjusted accordingly with a backup plan provided to the anaesthesiologist to achieve a ramsay sedation scale (rss) score of 6. as soon as the desired level of sedation was achieved, an appropriate size of laryngeal mask airway (lma) was inserted and patients were maintained on spontaneous respiration. an end tidal carbon dioxide concentration (etco2) probe was attached between the lma and the breathing system. increase in heart rate, blood pressure, respiratory rate or body movement on initiation of the surgical procedure was considered as inadequate analgesia and were managed accordingly by increasing the study drug infusion rate, and noted. nibp and heart rate were measured before induction (baseline), after induction and then at every 5-min interval for 15 min and then at every 15-min interval till the completion of the procedures. the patients were also assessed for desaturation or apnoea, which can be defined as a 10% decrease in spo2 when compared with baseline or cessation of respiration for 15 s or more, respectively, and were managed accordingly by assisting ventilation. hypotension was considered when the mean arterial pressure (map) dropped by > 20% of the baseline map and managed accordingly by fluid bolus or vasopressors. bradycardia was defined as heart rate less than 60 beats / min and managed with atropine 20 mcg / kg iv. any movement of the patient suggestive of pain was treated with increase in the study drug infusion rate, and was noted. the study drug infusion was discontinued at the end of the surgical procedure, and total drug consumption was noted. after reaching the rss score of 3, the recovery time (i.e., the time from discontinuation of infusion of the study drug and achievement of rss score of 3) was noted and patients were transferred to the recovery room. the incidence of any episode of post - operative nausea and vomiting (ponv) or any other adverse events (e.g., hallucinations, agitation or pain) were noted by the recovery room anaesthesiologist and were managed accordingly. the patients vital signs were assessed at 5-min intervals for the first 15 min and then at every 15-min intervals. any incidence of desaturation or hypotension was managed by giving oxygen through nasal prong or fluids and vasopressors, respectively. patients were discharged from the recovery room after attaining an aldrete recovery scale score of 9. six patients in group pf and two patients in group pk were excluded due to violation of the study protocol. demographic parameters in our study, hypotension was found in seven patients (14.6%) in group pk compared with 17 (38.6%) in group pf (p=0.009). bradycardia was found in 10 patients (22.7%) in group pf compared with none in group pk (p<0.000). emergence reaction occurred in five of 48 patients (10.42%) in group pk, who were managed with i.v. ponv occurred in five of 48 patients (10.42%) in group pk and in three of 44 (6%) patients in group pf. apnoea occurred in 4.16% patients (two of 48) in group pk compared with 18.18% patients (eight of 44) in group pf (p=0.031) [figure 1 ]. lower etco2 value was observed in group pk than in group pf [figure 2 ]. incidences of adverse events trend of end tidal carbon dioxide concentration values throughout the intraoperative period intraoperative map was significantly higher in group pk than in group pf when compared with baseline. intraoperative map was significantly lower in group pf than in group pk when compared with baseline. although map decreased in both the groups after induction as well as during the intraoperative period, the decrease was much more significant in group pf [table 2, figure 3 ]. intraoperative map between the two groups intraoperative mean arterial pressure between the two groups total drug consumed in terms of calculated propofol was higher in group pf compared with group pk (93.0823.31 mg and 57.7116.97 mg, respectively, p=0.000). recovery times were significantly longer in group pk compared with group pf (10.192.59 min and 8.431.23 min, respectively, p=0.000). but, the time to achieve aldrete recovery scale score of 9 is significantly higher in group pf than in group pk (16.485.42 min and 13.485.04 min, p=0.007) [table 3 ]. in the present study, hypotension occurred in 17 of 44 patients (38.63%) in group pf compared with seven of 48 patients (14.58%) in group pk. propofol combination is thought to act by counteracting the side - effects of each other, preserving the sedative efficacy. the present study also showed that the amount of propofol needed to achieve a deep sedation level was much lower in case of the ketamine akin and colleagues found better maintenance of map without prolonging recovery in the ketamine propofol (3:1) combination group than in the propofol monotherapy group. in the current study, continuous infusion was used to maintain a steady state sedation level. to quantify the level of sedation, the rss score has been used. this score is simple, easy to use and especially useful in any set - up where monitors measuring the consciousness level like electroencephalography (eeg) and bispectral index (bis) are absent. it is difficult to maintain moderate sedation due to inter - individual variation in central nervous system sensitivity and drug - redistribution. antisialogogue was avoided to prevent drying up of bronchial gland secretion and undue increase in dead space. no immediate post - operative adverse events like breath holding, laryngospasm, bronchospasm or peripheral arterial haemoglobin oxygen desaturation have been observed in the present study in spite of not using any antisialogogue. in the present study, improved ventilation (evident by lower etco2 value) was seen in case of the ketamine simultaneous use of etco2 and pulse oximeter helped us to quickly detect the incidences of apnoea and thus prevent any significant desaturation. ketamine and propofol have been shown to be pharmaceutically compatible when mixed together in the same syringe. the mixture of ketamine and propofol into a single syringe in a 1:2 ratio offers a simple and practical approach to medication preparation and use. increased discharged time was found where a higher proportion of ketamine was used. in the present study, the recovery time in group pk was within the acceptable range apparently but was significantly longer than that of group pf. this higher incidence of respiratory depression and hypotension in group pf might have contributed to the late achievement of the aldrete score of 9, because this score consists of parameters like respiration and circulation besides other parameters (activity, consciousness and colour). emergence reactions and vomiting are considered to be significant adverse effects of ketamine usage, occurring more often in adults than in children. although there is a higher incidence of emergence reaction and ponv in group pk compared with group pf, this incidence rate is lower than the usual incidence rate of ketamine alone. this can probably be explained by the counteraction of propofol, with its sedative and antiemetic properties, which reduced the overall incidence rates of both these adverse events of ketamine. recent studies also found no association between the period of fasting and the incidence of adverse events. positive outcome of this study can be expressed in the form of number - needed - to - treat (nnt). while calculating nnt, it was approximately four. therefore, four extra patients in group pf would need to be treated with newer regimen ketamine propofol (1:2) to achieve prevention of hypotension in one patient. propofol combination provides better sedoanalgesia and decreases the incidence of hypotension than the fentanyl - propofol combination. low - dose ketamine fentanyl infusion in paediatric emergency short surgical procedures in terms of haemodynamic stability and lesser incidence of apnoea. although the compatibility of the ketamine propofol mixture in the same syringe has been studied by other authors previously, the physical stability of ketamine - propofol mixtures of different ratios and maintenance of that stability over time are yet to be elucidated. | background : paediatric patients often present with different painful conditions that require immediate surgical interventions. despite a plethora of articles on the ketamine propofol combination, comprehensive evidence regarding the suitable sedoanalgesia regime is lacking due to heterogeneity in study designs.methods:this prospective, randomized, double - blind, active controlled trial was conducted in 100 children, of age 314 years, american society of anesthesiologist physical status ie - iie, posted for emergency short surgical procedures. patients were randomly allocated to receive either 2 ml of normal saline (pre - induction) plus calculated volume of drug from the 11 ml of ketamine propofol solution for induction (group pk, n=50) or fentanyl 1.5 g / kg diluted to 2 ml with normal saline (pre - induction) plus calculated volume of drug from the 11 ml of propofol solution for induction (group pf, n=50). in both the groups, the initial bolus propofol 1 mg / kg i.v. (assuming the syringes contained only propofol, for simplicity) was followed by adjusted infusion to achieve a ramsay sedation scale score of six. mean arterial pressure (map) was the primary outcome measurement.results:data from 48 patients in group pk and 44 patients in group pf were available for analysis. hypotension was found in seven patients (14.6%) in group pk compared with 17 (38.6%) patients in group pf (p=0.009). intraoperative map was significantly lower in group pf than group pk when compared with baseline.conclusion:the combination of low - dose ketamine and propofol is more effective and a safer sedoanalgesia regimen than the propofol fentanyl combination in paediatric emergency short surgical procedures in terms of haemodynamic stability and lesser incidence of apnoea. |
the neck pain and disability scale (npad) was developed in the usa as a comprehensive measure of neck pain and related disability. the 20-item scale measures problems with neck movements, neck pain intensity, effect of neck pain on emotion and cognition, and the level of interference with daily life activities. it has been found easy to complete for patients and simple to score, and it provides a validated measure to evaluate outcomes in patients with neck pain. originally developed in the usa, the npad was translated in various other languages [39 ] including a recently introduced german version. although high levels of reliability and construct validity of the npad original version and translated versions were reported, there is very rare data on the sensitivity to change (the capacity of a measure to detect change in patient status at interest over time) of the npad. when the npad is intended to measure patient change over time, sensitivity to change is a central property, as it is essential to rate the clinical meaningfulness of changes in scores. the aim of this study was to assess sensitivity to change of the npad in a sample of german - speaking subjects from a primary care setting. this is a follow - up survey of patients from a primary care setting in germany with at least one onset of neck pain between march 2005 and april 2006. the study was approved by the local research ethics committee. as part of a project on the quality of medical care in general practice (medvip), a network of 104 general practices has been established. fifteen of these practices within a radius of 30 km around gttingen, a medium - sized town in the middle of germany, were selected for participation and provided anonymised electronic patient data (year of birth, sex, diagnosis). patients were identified via electronic patient records in general practices and included in a list of potentially eligible persons if at least one consultation because of neck pain was documented during the study period. all general practitioners were asked to exclude patients from this list, if they had a neck pain consultation because of a new trauma, were terminally ill, suffered from cancer, were in need of nursing care or had severe cognitive impairment. in addition, patients seen by locums only, patients who had moved to a region outside of the study area or who were not able to speak german were excluded from the study. for invitation to participate in the study, eligible persons were due to data protection regulations directly contacted by the general practitioners offices without transferring names and addresses to the research team. participants received a comprehensive self - administered questionnaire covering socio - demographic information, anxiety, depression, social support, and neck pain at baseline and at 3-month follow - up. the npad is a 20-item measure that was specifically developed for patients with neck pain. it measures the intensity of pain ; its interference with vocational, recreational, social, and functional aspects of living ; and the extent of associated emotional factors. item scores range from 0 to 5, and the total score is the sum of the item scores [possible range 0 (no pain)100 (maximal pain) ]. a valid npad score can be generated if no more than 15% of the items are missing. the npad has been shown to have validity in comparison to other self - reported pain measures as well as supporting constructs of mood and neuroticism. a german version of the npad (npad - d) was developed recently demonstrating good reliability and validity. details on the development and on validity and reliability markers of the npad - d have been reported elsewhere. were measured by the hospital anxiety and depression scale (hads) [1315 ], a widely used, short self - assessment questionnaire mainly asking for psychological manifestations of (generalised) anxiety and depressive mood. possible subscale scores range from 0 to 21. according to the german test manual, patients with a depression score > 8 were considered depressed and subjects with an anxiety score > 10 were considered anxious. perceived social support was measured by the 14-item short form of the social support questionnaire (fragebogen zur sozialen untersttzung ; f - sozu). the items refer to different aspects of perceived social support (emotional and instrumental support and social integration), resulting in a global scale with higher scores indicating better social support (five - point scale : from relevant = 5 to not relevant deficits in social support were defined as having 4 or less points out of a maximum of 5 on the f - sozu scale. age, gender, living with a partner, and education were assessed by single items. persons who had completed more than 10 years at school were considered to have more than basic education. a variable younger age class was defined with six age categories including participants 70, 6069, 5059, 4049, 3039, and 8 were considered depressed and subjects with an anxiety score > 10 were considered anxious. perceived social support was measured by the 14-item short form of the social support questionnaire (fragebogen zur sozialen untersttzung ; f - sozu). the items refer to different aspects of perceived social support (emotional and instrumental support and social integration), resulting in a global scale with higher scores indicating better social support (five - point scale : from relevant deficits in social support were defined as having 4 or less points out of a maximum of 5 on the f - sozu scale. age, gender, living with a partner, and education were assessed by single items. persons who had completed more than 10 years at school were considered to have more than basic education. a variable younger age class was defined with six age categories including participants 70, 6069, 5059, 4049, 3039, and 10 years at school)273 (66%)frequency of neck pain on the day of questionnaire completion229 (56%) on > 100 days in last year150 (41%) constantly in last year107 (27%)medical history has had surgical intervention of the neck7 (2%) has had accidental injury of the neck79 (20%)health - promoting lifestyle physical exercise once or more in a week195 (48%)psychosocial characteristics depressed according to hads depression subscale78 (19%) anxious according to hads anxiety subscale109 (27%) deficit in social support according to f - sozu scale137 (34%)for definition of variables see methodshads denotes hospital anxiety and depression scalef - sozu denotes fragebogen zur sozialen untersttzung (social support questionnaire) baseline characteristics of the sample (n = 411) for definition of variables see methods hads denotes hospital anxiety and depression scale f - sozu denotes fragebogen zur sozialen untersttzung (social support questionnaire) npad - d mean values at baseline were higher (48.2, 95% ci 46.450.0) than npad - d mean values at follow - up (45.8, 95% ci 43.947.7) which corresponds to higher levels of neck pain at baseline. the mean change in the total sample (including both increase and decrease in absolute numbers) in npad - d was 9.4 (95% ci 8.610.2). with the standard deviation of the npad - d at baseline of 18.4 and one hundred thirty - one persons (32%) reported npad - d scores that were increased by the mdc from baseline to follow - up, and the mean change in npad - d for those persons was 10.6 7.5. 191 persons (46%) had npad - d scores at follow - up that were decreased by the mdc, and the mean change in npad - d in this subgroup was 12.3 8.9. seventy - two persons of the total sample reported a decrease in neck pain frequency from baseline to follow - up (19%), and for this subgroup the mean change was 4.1 10.9 (table 2).table 2neck pain and disability scale german version (npad - d) values at baseline and at 3-month follow - up, mean changes and change in external criterion (n = 411)npad - d at baseline (mean sd)48.2 18.4npad - d at follow - up (mean sd)45.8 19.5npad - d absolute change from baseline to follow - up (mean sd)9.4 8.6npad - d at follow - up increased by mdc or more (n, %) 131 (32)npad - d at follow - up decreased by mdc or more (n, %) 191 (46)npad - d change from baseline to follow - up in patients who increased by mdc or more (mean sd)10.6 7.5npad - d change from baseline to follow - up in patients who decreased by mdc or more (mean sd)12.3 8.9patients who reported decrease in pain frequency (non - npad - item) (n, %) 72 (19)npad - d change from baseline to follow - up in patients who reported decrease in pain frequency (non - npad - item) (mean sd)4.1 10.9all changes in scores (increase or decrease) calculated as having the same direction (to assess longitudinal validity of the npad - d as opposed to assessing effectiveness)mdc denotes minimal detectable change33 missing values neck pain and disability scale german version (npad - d) values at baseline and at 3-month follow - up, mean changes and change in external criterion (n = 411) all changes in scores (increase or decrease) calculated as having the same direction (to assess longitudinal validity of the npad - d as opposed to assessing effectiveness) mdc denotes minimal detectable change the srm for the total sample was 1.096 (95% ci 0.9991.193). when restricting the analysis to those persons who changed by the mdc or more, srm values were considerably larger (increase and decrease : 1.389 ; increase : 1.418 ; decrease : 1.389). when the non - npad item as an external criterion was used for identification of persons with decrease, the subgroup of persons who reported a decrease in neck pain frequency according to the non - npad item, however, was small (n = 72) leading to considerable imprecision as measured by the standard deviation of the mean change (table 2). srm values using jackknife technique were marginally smaller with a slightly broader confidence interval than those calculated without resampling (e.g. srm for the total sample 1.002, 95% ci 0.8851.119).table 3standardised response mean (srm) of the neck pain and disability scale german version (npad - d)group of patientsnsrm sd(95% ci)total sample4111.096 1.0(0.999, 1.193)patients who changed by mdc or more (increase or decrease)3221.389 1.0(1.280, 1.499)patients who increased by mdc or more1911.418 1.0(1.245, 1.591)patients who decreased by mdc or more1311.389 1.0(1.531, 1.246)patients who reported decrease in pain frequency (non - npad - item)720.374 1.0(0.609, 0.139)calculated based on absolute values of changemdc denotes minimal detectable change standardised response mean (srm) of the neck pain and disability scale german version (npad - d) calculated based on absolute values of change mdc denotes minimal detectable change table 4 shows the results of the linear regression analysis of the npad - d at follow - up with ameliorating and deteriorating factors for neck pain. those having more than basic education and those in a younger age class consistently reported significantly lower average npad - d scores at follow - up compared to those with basic education and those in an older age class. in contrast, those who were classified to be depressed or anxious or to have deficits in social support reported significantly higher npad - d scores.table 4regression analysis of the neck pain and disability scale german version (npad - d) at follow - up with ameliorating and deteriorating baseline factorsbaseline variablesnpad - dregression coefficient (95% confidence interval)p valueameliorating factors more than basic education (> 10 years at school)7.2 (10.9, 3.5)<0.0001 younger age class1.6 (2.9, 0.3)0.020deteriorating factors depressed according to hads depression subscale2.1 (1.7, 2.5)<0.0001 anxious according to hads anxiety subscale1.9 (1.5, 2.3)<0.0001 deficit in social support according to f - sozu scale5.5 (1.7, 9.2)0.004npad - d denotes neck pain and disability scale german version. independent variable : one baseline variable. adjusted for change in npad - d score by minimal detectable change from baseline to follow - up (for definition of variable see regression coefficient denotes younger age by one age classhads denotes hospital anxiety and depression scalef - sozu denotes fragebogen zur sozialen untersttzung (social support questionnaire) regression analysis of the neck pain and disability scale german version (npad - d) at follow - up with ameliorating and deteriorating baseline factors npad - d denotes neck pain and disability scale german version. assessed at 3-month follow - up derived from linear regression analysis. change in npad - d score by minimal detectable change from baseline to follow - up (for definition of variable see methods) age classes are 70, 6069, 5059, 4049, 3039, regression coefficient denotes younger age by one age class hads denotes hospital anxiety and depression scale f - sozu denotes fragebogen zur sozialen untersttzung (social support questionnaire) table 5 depicts the results of the correlation analysis of the mean difference in npad - d values between baseline and follow - up with clinical prognostic measures that are known to be predictive of neck pain. the mean change in npad - d correlated significantly with the mean change in the hads depression subscale, in the anxiety subscale and in the f - sozu scale. the correlation coefficients were in the direction anticipated : a positive coefficient for the two hads subscales indicates increasing levels of neck pain for subjects with increasing levels of depression or anxiety. a negative coefficient for the f - sozu scale points at increasing levels of neck pain for subjects with decreasing levels of social support.table 5correlation analysis of the mean change in the neck pain and disability scale german version (npad - d) with the mean change in prognostic measures between baseline and 3-month follow - upprognostic measuremean change in npad - dpearson s correlation coefficientsp valuemean change in hads depression subscale0.2034<0.0001mean change in hads anxiety subscale0.14630.0031mean change in f - sozu scale0.12900.0093mean change is defined as baseline score values minus follow - up score valuesnpad - d denotes neck pain and disability scale german versionaccording to hads (hospital anxiety and depression scale) depression subscalef - sozu denotes fragebogen zur sozialen untersttzung (social support questionnaire) correlation analysis of the mean change in the neck pain and disability scale german version (npad - d) with the mean change in prognostic measures between baseline and 3-month follow - up mean change is defined as baseline score values minus follow - up score values npad - d denotes neck pain and disability scale german version according to hads (hospital anxiety and depression scale) depression subscale f - sozu denotes fragebogen zur sozialen untersttzung (social support questionnaire) eighty - one of the 411 persons (20%) who had a valid npad - d score had one or more missing values. sensitivity to change analyses of the subsample restricted to subjects with complete data for all 20 npad - d items revealed no substantially different results. the npad seems to be sensitive to change in neck pain patients from general practice. the npad as measured by the npad - d demonstrated sensitivity to change both in subgroups that were expected to change by different amounts and in the total sample consisting of patients many of whom are expected to change by different amounts. the data presented here are further evidence for the validity of the scale and increase trust in future applications of the npad. psychosocial factors, e.g. depression and anxiety, predict course and prognosis of unspecific neck pain. unspecific neck pain is very prevalent in the general practice population targeted in this study. a common design to assess sensitivity to change is to apply interventions of known effectiveness and compare scale scores with a placebo group. however, there is no convincing evidence for the effectiveness of widely used therapeutic options such as exercise, manipulation and mobilisation, acupuncture, or injection therapies in this patient population [3134 ]. thus, we preferred psychosocial parameters as opposed to clinical markers (e.g. range of motion) to evaluate sensitivity to change for this setting. nevertheless, analyses using clinical markers are useful when evaluating properties of the scale for different settings or in different patient populations. with the scale ranging from 0 to 100, the mdc of 3 represents an excellent value indicating that the npad - d is able to detect very small changes. these results may help to calculate the sample size of future studies aiming to assess the effectiveness of neck pain interventions. the mdc value provided here is a basis for clinicians interpretation of their patients npad values. however, more research on the practicability and utility of self - administered pain scales in busy clinical settings is needed. firstly, of 1,228 eligible persons, only 411 (33%) returned valid baseline and follow - up questionnaires and were thus included in the study. one reason is that persons were identified via routine electronical data which was only possible inside the general practitioners offices. therefore, it was not possible to contact eligible persons more than once, to send any reminder mails, or to analyse differences between participants and non - participants. however, this study was conducted in a relatively large group recruited by a defined algorithm from the whole patient population of various practices. it may, therefore, be largely representative for the typical neck pain patients participating in this kind of studies, and the quite large number of exclusions can be traced back to predefined reasons according to this algorithm (fig. 1). secondly, the population consisted largely of subjects with mild or moderate unspecific neck pain. although this may be expected in this adult population, sensitivity to change should also be tested in populations with severe pain and/or disability. thirdly, we used the german version of the instrument in a german - speaking sample. fourthly, there are various other factors that influence neck pain than those included in this study (e.g. therapeutic interventions) and their effect on the npad has not been investigated. however, this study included several important factors that have been proven to have significant impact on the course and prognostics of neck pain [27, 28 ]. investigating sensitivity to change of the scale by applying therapeutic interventions to one group and comparing their npad values with those of an untreated group has not been subject to this study and should be analysed in other more appropriate settings (e.g. in spine surgery departments). in addition, another popular method to assess sensitivity of change of a measure is the retrospective rating of change. however, this approach has been challenged as among other reasons retrospective judgements of change may be subject to recall bias. so - called response shifts can affect or distort outcome measures in medical or psychosocial research [35, 36 ]. meanwhile, bremerich and colleagues proposed a slightly different german version of the npad. they used a small sample of patients with an assured physical diagnosis accountable for neck pain and treated at a rheumatology clinic. our npad - d version, in contrast, has been developed especially for the use in general practice with a high proportion of patients suffering from unspecific neck pain. although evaluated in different settings with different patients, reliability and validity parameters of both german npad scales were generally consistent ; bremerich. their study demonstrated significant and clinically meaningful differences in npad scores according to clinical parameters. a turkish study investigated sensitivity to change comparing turkish versions of the neck disability index, the northwick park pain questionnaire, the copenhagen neck functional disability scale and the npad. all those scales were highly valid, reliable and sensitive to change as measured by srm values and correlation analyses. srms identified in the present study indicated a good sensitivity to change when being based on statistical criteria for change in the patients health status. however, when applying an external criterion for identifying persons who changed, the srm dropped to a moderate value. firstly, the external criterion was a rough measure of change as it only asks for change in the frequency but not in other dimensions of neck pain. secondly, the analysis was possible only in a small subgroup of patients which resulted in comparably high imprecision of the mean change in this subgroup. this in turn leads to an even smaller srm value. as this study did not focus on non - npad assessment of change in neck pain, future studies should evaluate sensitivity to change in comparison with other more comprehensive external criteria. the scales investigated in the turkish study differed in their acceptability and usefulness with the npad showing good acceptability and a low number of missing values., when making a decision regarding an appropriate scale, researchers and clinicians should consider the scale s ability to measure change when the quality of a questionnaire is critically appraised. in conclusion, the npad seems to be a sensitive measure of neck pain and related disability for use both in clinical and research settings. | the neck pain and disability scale (npad) is a 20-item instrument to measure neck pain and related disability. the aim of this study was to assess sensitivity to change of the npad. a total of 411 participants from 15 general practices in the middle of germany completed a multidimensional questionnaire including the german version of the npad and self - reported demographic and clinical information. sensitivity to change was analysed by linear regression analysis of the npad at follow - up and educational level, age class, depression, anxiety, and deficits in social support, respectively, and by pearson s correlation analyses between mean change in npad at follow - up and mean change in prognostic markers. those having more than basic education (regression coefficient 7.2, p < 0.001) and/or being in a younger age class (2.9, p = 0.020) consistently reported significantly lower average npad scores at follow - up compared to those with basic education and/or a older age class. in contrast, those who were classified to be depressed (regression coefficient 2.1, p < 0.001), anxious (1.9, p < 0.001), or having deficits in social support (5.5, p = 0.004) reported significantly higher npad scores. change in depression, anxiety, and social support scale between baseline and follow - up was significantly correlated with change in the npad score. hence, these data are in the direction anticipated across all baseline factors investigated. in conclusion, the npad seems to be a sensitive measure for use in clinical practice and future studies of neck pain and related disability. |
dna repair enzymes are essential for maintaining the integrity of the dna sequence. unfortunately, very little is known about how these enzymes recognize damaged regions along the helix. structural analysis of cellular repair enzymes bound to dna reveals that these enzymes are able to recognize dna in a variety of conformations. however, the prevalence of these deformations in the absence of enzymes remains unclear, as small populations of dna conformations are often difficult to detect by nmr and x - ray crystallography. here, we used time - resolved fluorescence spectroscopy to examine the conformational dynamics of linear, nicked, gapped, and bulged dna in the absence of protein enzymes. this analysis reveals that damaged dna is polymorphic in nature and able to adopt multiple individual conformations. we show that dna repair intermediates that contain a one - nucleotide gap and bulge have a significant propensity to adopt conformations in which the orphan base resides outside the dna helix, while dna structures damaged by a nick or two - nucleotide gap favor intrahelical conformations. because changes in dna conformation appear to guide the recognition of dna repair enzymes, we suggest that the current approach could be used to study the mechanism of dna repair. |
|
five areas which were found to have the most sex workers included : one in the north, one in the city center, one in the west, one in the east, and one in the south of city. in addition to the city hot spots, subjects were recruited from all districts and areas of tehran to ensure a representative sample. subjects included all female persons of all ages willing to participate, who identified themselves as sex workers (willing to perform sexual acts for monetary compensation). only those who did not complete the interview, for any given reason, were excluded from the study. this sample was calculated with the assumption that 60% have adequate knowledge and acceptable practice towards aids and other stis (based on previous studies, although figures were vaguely presented16) ; with a margin of error of 6% and 95% confidence interval. the sampling method of choice for this study was initially intended to be a respondent driven sampling (rds) method, one of which the initial participants (seeds) are asked to introduce further subjects and the wave propagates. however, after identifying seeds by a variety of methods, such as driving by common meeting places for sex workers in a vehicle, or contacting sex workers that have been previously identified, it was found that most were either reluctant to introduce new subjects, or were not part of a network. this phenomenon forced us to change the sampling technique into a simple convenience sampling method, where 60% of the cases were new seeds. the other 40% were introduced by the known cases, but were less than the number required to engage rds analysis. it was initially intended that different locations and different methods be used to find the initial seeds to engage a wider variety of sex workers of different socio - economical and personal backgrounds. however, after the sampling method was converted to simple convenience method, the diversity of the samples became more important than before. it had to be rationally ensured that the sample contained a reasonably proportionate number of sex workers of a certain socio - economic status. subjects were either identified on the streets (street walkers), or introduced by clients, as some of the sex workers (call girls) had a network of clients and were solely accessible via cell phone. the interviewer proceeded with the interviews, after obtaining written consent in informed consent forms. appropriate questions for the assessment of knowledge and attitudes were written based on previous studies. in addition, it was matched with the who standard questionnaire for hiv in female sex workers which ensured the validity and reliability of the results.17 these were asked of the subjects in an interview after identification. the questionnaire was modified after receiving initial feedback from the first few subjects as a pilot test. participants were offered a monetary fee equivalent to 20 usd ($) for cooperation and 5 $ more for introducing new subjects for the study. the data collected by the designated collection sheets were entered into a database using spss version 11.5 (spss inc., a total of 432 female sex workers were identified, of which 256 (59.2%) accepted to participate in the study and were recruited for participation. the mean age of the subjects was 26.8 6.1 years (ranging from 16 to 45). more than half of the subjects were born in tehran (n = 138 ; 53.9%) and spoke farsi as their mother tongue (n = 133 ; 52.0%). one - hundred and two subjects (39.8%) were never married, 89 (34.8%) were divorced, 39 (15.2%) widowed, and 18 (7.0%) married. the educational status of the women was : 21 (8.2%) elementary, 91 (35.5%) middle school, 68 (26.6%) high school drop - outs, and 76 (29.8%) had a high school diploma or higher. the subjects were selected in a manner that all areas of the city were covered to a reasonably moderate extent ; 25 (9.8%) sex workers worked in the city center, 28 (10.9%) in the north, 97 (37.9%) in the south, 59 (23.0%) in the west, 26 (10.2%) in the east, and 21 (8.2%) did not mention a specific area. when asked to name the stis they recognized, the most frequently named sti was aids with 90.6%, followed by hepatitis (51.6%), gonorrhea (47.7%), syphilis (40.6%), warts (4.7%), herpes (3.9%), and scabies (3.1%). when asked how stis could be prevented, 175 (68.3%) correctly mentioned condom use ; reducing partners (38.6%), informing partners (18.1%), and incorrectly, ocps (7.9%) were also mentioned as the method to reduce the risk of stis. regarding the knowledge of the subjects, the methods of transmission known to the subjects in addition to these, most subjects knew that aids currently has no cure (81.2%) and no vaccine (73.4%), and can not be prevented by using contraceptives (62.1%). only 20.3% knew that there are steps an hiv - positive mother could take that could reduce the possibility of her fetus being afflicted with hiv. most also acknowledged that hiv is transmissible from people who do not know they are hiv - positive (59.4%), proper condom use can reduce the possibility of infection (78.1%), and so can having a single sexual partner (68.8%). only 43.4%, however, knew that an hiv - positive person can seem perfectly healthy. on the other hand, 87.5% recognized that sexual intercourse with drug addicts bears a high risk for hiv infection. knowledge of routes of human immunodeficiency virus (hiv) transmission measuring attitudes of the subjects towards hiv - positive persons, only 45.7% would behave the same with hiv - positive persons as with non - infected persons. as much as 54.3% believed that hiv - positive persons should be kept away from society, 72.3% thought they should have separate medical care centers, 47.3% said hiv - positive children should not be accepted in ordinary schools, and 51.2% thought that hiv - positive persons should not be let into universities. only 29.3% would buy food from an hiv - positive person and 42.6% believed that hiv - positive persons should be introduced to the public, although 52.7% thought an hiv - positive teacher could continue teaching. most (85.2%) would be upset by the death of an aids patient, but only 53.5% would be upset if the patient was homosexual and 41.4% if the patient was a drug addict. a 92.2% were admittedly afraid of aids, and 80.1% knew that they were at risk for aids. a 65.2% would prefer dying over getting infected with hiv and 85.8% would hide the fact if a family member were afflicted with hiv. hiv was related to a lack of ethic morals for 74.6% and a lack of religious morals for 63.7%. sex education was considered a necessity for 76.6%, 91.4% believed it should be included in the school curriculum, and 93.0% believed they needed more information about aids and sexually transmitted infections. the findings of the this study expressed a solid knowledge of stis and aids among female sex workers in tehran, but also a number of extremely important gaps which show that the knowledge was not completely adequate in all areas. the most comprehensive report on sex workers in iran is the report by madani for the ministry of health and medical education.16 this report revealed a number of demographics, including a mean age of 27.6 years, university education in 12.9%, and birthplace outside tehran in 43.1%. the residence of the sex workers in the study was evenly distributed throughout tehran, but slightly more in the eastern and western parts of the city. each sex worker was estimated to be active in this profession for a mean of 5.8 years. most had heard of aids (97.5%), 18.6% believed that a healthy looking person could not be hiv - positive, and 12.7% believed that aids had a cure. condom use was recognized as a preventive measure against aids by 65.3%, and 35.4% thought that having one sexual partner could be considered a preventive measure. demographic data shows similarities between the current study and that of madani.16 the mean age, education, and birth place of the subjects was strikingly similar in the two studies. this can also confirm the sampling of the current study by both the fact that previous findings were repeated, and by the fact that the distribution of subjects was mentioned to be even around the different areas of the city in the madani study. the demographics in our study also demonstrated that the sex worker community in tehran is not a highly educated group, only 29.8% had a high school diploma or higher. this shows that not only should educational messages be directed towards simple uncomplicated messages, but that the problem of awareness for sex workers would probably not be resolved by integrating sex education into high school education. already, sex education is offered as a mandatory course in universities under the name of family planning for cultural reasons, a course that is not attended by most sex workers who do not hold university degrees. methods of transmission were recognized widely, despite some exceptions ; as mentioned in the results fewer than expected realized oral (23.4%) and anal (44.9%) intercourse as the methods of hiv transmission. while many believe sharing food is a method of transmission (46.5%), many did not recognize eyebrow tattoos (37.1%) as a method of transmission. most were afraid of contracting aids (92.2%) and acknowledged that they were at risk for infection (80.1%). further investigations covering qualitative research to identify the gap between knowledge and practice would be highly useful to determine educational needs and interventions for such populations. in addition, the attitude of subjects towards hiv - positive persons was surprisingly highly negative. this may be due to the lack of advertisement campaigns in this regard, until recently. such campaigns, if correctly carried out, can influence these issues profoundly and improve conditions for existing hiv - positive persons. other studies had previously reported very negative attitudes in the general population;1820 however, attitude measurements can be largely dependent on the researchers perspectives and study designs, and at least one study reported positive attitudes towards aids patients, although the provided statements in this study do not appear to be neutral in tone.11 main achievements included the identification and successful communication established with the subjects. the interviewers were capable and made communication with the subjects efficiently to recruit their cooperation. the only unpredictable factor was the fact that the subjects were more easily found in isolation than by referral, which resulted in a change in the sampling structure. the proportion of women that recognized that aids currently has no cure was similar to the figure by madani.16 familiarity with stis was somewhat similar to the findings of the study by ramezani and malek - afzali.21 the number of subjects who knew that an apparently healthy person could be hiv - positive in our study, and studies by hajiabdolbaghi.,6 madani,16 and ramezani and malek - afzali21 was 43.3%, 22%, 18.6%, and 34% respectively, all of which were studies conducted during the past four years. in the end, this study has provided a large amount of data regarding the epidemiology and demographics of the dissemination of information on aids and stis among the sex worker population, a population which is hard to reach and not much is known about the population in itself. perhaps the gaps in our information can be made smaller by conducting qualitative research to find in - depth reasons for certain risky behaviors. this study was funded in part by the 16 emro / tdr small grants scheme for operational research in tropical and other communicable diseases [project i d no sgs08/156 ]. financial support was granted by the following two sources, to whom we are greatly appreciative : (1) world health organization via the tdr program, 2008, grant number sgs08 - 156, and (2) the shahid beheshti university of medical science infectious disease and tropical medicine research center. aak was the manager of the entire project and recipient of the funding grants ; ar was responsible for drafting the initial design proposal, reports, and manuscripts ; aa was the statistical consultant for design and analysis ; mrs was the public health and methodology consultant ; mn was the infectious and tropical disease consultant ; and as was responsible for participant affairs. however, all authors played active parts in each stage of the study and roles overlapped in all domains. | background : the female at - risk population represents a subgroup that is both a crucial determining factor in acquired immune deficiency syndrome (aids) transmission and a gap in the existing literature in iran. the objective of this study was to evaluate the level of sex workers knowledge towards to safe procedures of sexually transmitted infection and aids prevention as well as attitudes towards aids.methods:a sample of 256 female sex workers working in tehran was obtained by a variety of methods. appropriate questions for the assessment of knowledge and attitude were developed based on previous studies.results:the mean age of the subjects was 26.8 6.1 years (ranging from 16 to 45). methods of transmission were widely recognized, despite the exception that few realized oral (23.4%) and anal (44.9%) intercourse as methods of human immunodeficiency virus (hiv) transmission. most subjects knew that aids currently has no cure (81.2%) and no vaccine (73.4%). most also acknowledged that hiv is transmissible from people who do not know they are hiv positive (59.4%), proper condom use can reduce the possibility of infection (78.1%), and so can having a single sexual partner (68.8%). of the participants, 43.4% knew that an hiv - positive person can seem perfectly healthy.conclusions:knowledge towards sexually transmitted infections (stis) and condom use is still inadequate, especially regarding risky behaviors such as anal sex, and attitudes are mainly negative. identifying at - risk populations, hiv - positive sex workers, education and campaigns to change the attitudes towards aids should be regarded a high priority in iran. |
in this study, 20 healthy volunteers with no history of seizures, significant head trauma or other neurologic abnormalities, formed the normal control group. fifteen were male and five were female, and their ages ranged from 24 to 38 (mean, 29) years. twenty - five patients with intractable temporal lobe epilepsy, whose mr imaging diagnosis was unilateral hippocampal sclerosis, comprised the patient group. thirteen were male and 12 were female, and they were aged between 19 and 55 (mean, 30) years. an mr imaging diagnosis of hippocampal sclerosis was based on the presence of either unilateral atrophy or high t2 signal intensity of the hippocampus, or both, by visual assessment. patients with bilateral hippocampal abnormalities or any other abnormalities in addition to hippocampal lesion were excluded. for all mr imaging procedures, a clinical 1.5-t system (signa advantage ; general electric medical systems, milwaukee, wi) was used. for control subjects, the procedure involved conventional spin - echo t1-weighted sagittal and fast spin - echo t2-weighted axial and oblique coronal sequences. for patients, a t2-weighted fast spin - echo sequence with 3-mm - thick sections, and a t1-weighted 3-d spoiled gradient - echo (spgr) sequence with 1.5-mm - thick sections the angle of oblique coronal imaging was perpendicular to the long axis of the hippocampus. in - plane spatial resolution was approximately 1.01.0 mm (matrix, 256256 ; fov, 25 cm). single - voxel h-1 mrs was carried out immediately after acquisition of routine mr imaging, using the same 1.5-t unit. in each control subject, four spectra were obtained from two different sizes of the volume of interest (voi) (6.0 cm = 2.02.01.5 cm, and 2.25 cm = 1.51.51.0 cm). the voi included most of the hippocampal head and parts of its body, the amygdala, the parahippocampal gyrus and csf in the temporal horn. in addition, spectra with voi of 1.0 cm (1.01.01.0 cm) mostly confined to the hippocampal head were obtained in five of the 20 control subjects. in 25 patients, spectra were obtained with a voi of either 6.0 cm (n = 14) or 2.25 cm (n = 11) from the same area as that of control subjects. because the signal - to - noise ratio was low, spectra with a voi of 1.0 cm were not obtained in the patient group. to avoid potential magnetic susceptibility artifacts from the skull base and sphenoid sinus, and contamination by fat in the skull base, spectra were obtained using a point - resolved spin - echo spectroscopy (press) sequence with an echo time of 136 msec, repetition time of 1500 msec, and 128 scans. before spectroscopic measurements, field homogeneity was optimized over the selected voi by observing the h-1 mr signal of tissue water with a spatially selective press sequence. in most examinations, typical full widths at half maximum (fwhm) of 4 - 8hz were achieved. the water signal was suppressed by a frequency - selective saturation pulse at the water resonance. a sweep width of 1000 hz was used with data size of 1024 points, and only the second half of the echo was acquired. following the zero - filling of 4096 points in all free induction decay (fid) data, exponential line broadening (center : 0 msec, half time : 150 msec) was performed before fourier transformation. the metabolite peaks seen on mrs were assigned for n - acetyl aspartate (naa) at 2.0 ppm, for the creatine complex (cr) at 3.0 ppm, and for choline compound (cho) at 3.2 ppm. the metabolite ratios of naa / cho and naa / cr were calculated from the relative peak height measurements obtained on the workstation, and in both control subjects and patients, mean and standard deviation (sd) were calculated for those ratios. in control subjects, mean naa / cho and naa / cr ratios were compared between two different sizes of voi, and between the right and left sides. ninety - five percent confidence levels (2 sds) of naa / cho and naa / cr ratios in control subjects were used as threshold (cut - off) values to determine abnormal naa / cho and naa / cr ratios in patients ; either an naa / cho or naa / cr ratio below the threshold values was interpreted as abnormal. the ability of mrs to lateralize an epileptogenic lesion and to detect bilateral abnormalities was assessed using the visual mr imaging diagnosis as a standard of reference. when the abnormal side seen on mrs was concordant with that seen on mr imaging, lateralization was considered correct. when mrs showed bilateral abnormalities, this was also considered indicative of correct lateralization, regardless of which side was shown by mrs to be more affected. in this study, 20 healthy volunteers with no history of seizures, significant head trauma or other neurologic abnormalities, formed the normal control group. fifteen were male and five were female, and their ages ranged from 24 to 38 (mean, 29) years. twenty - five patients with intractable temporal lobe epilepsy, whose mr imaging diagnosis was unilateral hippocampal sclerosis, comprised the patient group. thirteen were male and 12 were female, and they were aged between 19 and 55 (mean, 30) years. an mr imaging diagnosis of hippocampal sclerosis was based on the presence of either unilateral atrophy or high t2 signal intensity of the hippocampus, or both, by visual assessment. patients with bilateral hippocampal abnormalities or any other abnormalities in addition to hippocampal lesion were excluded. for all mr imaging procedures, a clinical 1.5-t system (signa advantage ; general electric medical systems, milwaukee, wi) was used. for control subjects, the procedure involved conventional spin - echo t1-weighted sagittal and fast spin - echo t2-weighted axial and oblique coronal sequences. for patients, a t2-weighted fast spin - echo sequence with 3-mm - thick sections, and a t1-weighted 3-d spoiled gradient - echo (spgr) sequence with 1.5-mm - thick sections the angle of oblique coronal imaging was perpendicular to the long axis of the hippocampus. in - plane spatial resolution was approximately 1.01.0 mm (matrix, 256256 ; fov, 25 cm). single - voxel h-1 mrs was carried out immediately after acquisition of routine mr imaging, using the same 1.5-t unit. in each control subject, four spectra were obtained from two different sizes of the volume of interest (voi) (6.0 cm = 2.02.01.5 cm, and 2.25 cm = 1.51.51.0 cm). the voi included most of the hippocampal head and parts of its body, the amygdala, the parahippocampal gyrus and csf in the temporal horn. in addition, spectra with voi of 1.0 cm (1.01.01.0 cm) mostly confined to the hippocampal head were obtained in five of the 20 control subjects. in 25 patients, spectra were obtained with a voi of either 6.0 cm (n = 14) or 2.25 cm (n = 11) from the same area as that of control subjects. because the signal - to - noise ratio was low, spectra with a voi of 1.0 cm were not obtained in the patient group. to avoid potential magnetic susceptibility artifacts from the skull base and sphenoid sinus, and contamination by fat in the skull base, spectra were obtained using a point - resolved spin - echo spectroscopy (press) sequence with an echo time of 136 msec, repetition time of 1500 msec, and 128 scans. before spectroscopic measurements, field homogeneity was optimized over the selected voi by observing the h-1 mr signal of tissue water with a spatially selective press sequence. in most examinations, typical full widths at half maximum (fwhm) of 4 - 8hz were achieved. the water signal was suppressed by a frequency - selective saturation pulse at the water resonance. a sweep width of 1000 hz was used with data size of 1024 points, and only the second half of the echo was acquired. following the zero - filling of 4096 points in all free induction decay (fid) data, exponential line broadening (center : 0 msec, half time : 150 msec) was performed before fourier transformation. the metabolite peaks seen on mrs were assigned for n - acetyl aspartate (naa) at 2.0 ppm, for the creatine complex (cr) at 3.0 ppm, and for choline compound (cho) at 3.2 ppm. the metabolite ratios of naa / cho and naa / cr were calculated from the relative peak height measurements obtained on the workstation, and in both control subjects and patients, mean and standard deviation (sd) were calculated for those ratios. in control subjects, mean naa / cho and naa / cr ratios were compared between two different sizes of voi, and between the right and left sides. ninety - five percent confidence levels (2 sds) of naa / cho and naa / cr ratios in control subjects were used as threshold (cut - off) values to determine abnormal naa / cho and naa / cr ratios in patients ; either an naa / cho or naa / cr ratio below the threshold values was interpreted as abnormal. the ability of mrs to lateralize an epileptogenic lesion and to detect bilateral abnormalities was assessed using the visual mr imaging diagnosis as a standard of reference. when the abnormal side seen on mrs was concordant with that seen on mr imaging, lateralization was considered correct. when mrs showed bilateral abnormalities, this was also considered indicative of correct lateralization, regardless of which side was shown by mrs to be more affected. in 20 control subjects, mr imaging revealed symmetry in the size and signal intensity of both hippocampi. representative spectra with three different sizes of voi from the hippocampus of control subjects are shown in fig., signal - to - noise ratios of metabolites decreased as the voi was reduced. in control subjects, the naa peak was usually slightly higher than the cho and cr peaks. with a voi of 6.0 cm, the naa / cho ratio was 1.100.27 (meansd) and 1.100.18 on the right and left sides, respectively, whereas with a voi of 2.25 cm, this ratio was 1.200.42 and 1.100.29, respectively (table 1). with a voi of 6.0 cm, the naa / cr ratio was 1.300.28 and 1.300.22 on the right and left sides, respectively, whereas with a voi of 2.25 cm, the ratio was 1.400.52 and 1.400.77, respectively (table 2). there were no statistically significant differences in either naa / cho or naa / cr ratios between sides, and between different sizes of voi. in five control subjects who underwent mrs with a voi of 1.0 cm, signal - to - noise ratios of the metabolites were lower than those of the larger voi, making it difficult to calculate the metabolite ratios. regardless of voi size (i.e., 6.0 cm or 2.25 cm), the naa / cho ratio in control subjects was greater than 0.8 and the naa / cr ratio was greater than 1.0, with a 95% confidence level. representative spectra from the affected hippocamus and contralateral normal - appearing hippocampus are illustrated in fig. the naa / cho ratio was 0.810.13 (meansd) on the affected side and 0.900.19 (meansd) on the contralateral side. with a voi of 2.25 cm, this ratio was 0.780.22 (meansd) on the affected side and 0.800.15 (meansd) on the contralateral side. with a voi of 6.0 cm, the naa / cr ratio was 0.990.14 (meansd) on the affected side and 1.200.27 (meansd) on the contralateral side and with a voi of 2.25 cm, the ratio was 0.930.15 (meansd) on the affected side and 1.100.25 (meansd) on the contralateral side. naa / cho and naa / cr ratios on the affected side were significantly lower than those on the contralateral side in patients, and than those of control subjects (p <.05) (tables 3, 4). on the contralateral side, these ratios were lower in patients than in control subjects, but the differences were not statistically significant. the distributions of naa / cho and naa / cr ratios on the affected and contralateral sides in both patients and control subjects are shown in figs. 3 and 4.. the correct lateralization rate of mrs was significantly higher when the naa / cho ratio was used as a cut - off value than when the naa / cr ratio was used (64% versus 48%, p <.05). the correct lateralization rate of mrs was lower with a voi of 6.0 cm than with one of 2.25 cm (64% versus 82%, p <.05). mrs was interpreted as bilaterally normal (i.e., false negative) in 28% of cases (7/25) (fig. 6) ; 24% (6/25) on the basis of an abnormal naa / cho ratio, and 20% (5/25) on the basis of an abnormal naa / cr ratio. in 20 control subjects, mr imaging revealed symmetry in the size and signal intensity of both hippocampi. representative spectra with three different sizes of voi from the hippocampus of control subjects are shown in fig., signal - to - noise ratios of metabolites decreased as the voi was reduced. in control subjects, the naa peak was usually slightly higher than the cho and cr peaks. with a voi of 6.0 cm, the naa / cho ratio was 1.100.27 (meansd) and 1.100.18 on the right and left sides, respectively, whereas with a voi of 2.25 cm, this ratio was 1.200.42 and 1.100.29, respectively (table 1). with a voi of 6.0 cm, the naa / cr ratio was 1.300.28 and 1.300.22 on the right and left sides, respectively, whereas with a voi of 2.25 cm, the ratio was 1.400.52 and 1.400.77, respectively (table 2). there were no statistically significant differences in either naa / cho or naa / cr ratios between sides, and between different sizes of voi. in five control subjects who underwent mrs with a voi of 1.0 cm, signal - to - noise ratios of the metabolites were lower than those of the larger voi, making it difficult to calculate the metabolite ratios. regardless of voi size (i.e., 6.0 cm or 2.25 cm), the naa / cho ratio in control subjects was greater than 0.8 and the naa / cr ratio was greater than 1.0, with a 95% confidence level. representative spectra from the affected hippocamus and contralateral normal - appearing hippocampus are illustrated in fig. the naa / cho ratio was 0.810.13 (meansd) on the affected side and 0.900.19 (meansd) on the contralateral side. with a voi of 2.25 cm, this ratio was 0.780.22 (meansd) on the affected side and 0.800.15 (meansd) on the contralateral side. with a voi of 6.0 cm, the naa / cr ratio was 0.990.14 (meansd) on the affected side and 1.200.27 (meansd) on the contralateral side and with a voi of 2.25 cm, the ratio was 0.930.15 (meansd) on the affected side and 1.100.25 (meansd) on the contralateral side. naa / cho and naa / cr ratios on the affected side were significantly lower than those on the contralateral side in patients, and than those of control subjects (p <.05) (tables 3, 4). on the contralateral side, these ratios were lower in patients than in control subjects, but the differences were not statistically significant. the distributions of naa / cho and naa / cr ratios on the affected and contralateral sides in both patients and control subjects are shown in figs. 3 and 4.. the correct lateralization rate of mrs was significantly higher when the naa / cho ratio was used as a cut - off value than when the naa / cr ratio was used (64% versus 48%, p <.05). the correct lateralization rate of mrs was lower with a voi of 6.0 cm than with one of 2.25 cm (64% versus 82%, p <.05). mrs was interpreted as bilaterally normal (i.e., false negative) in 28% of cases (7/25) (fig. 6) ; 24% (6/25) on the basis of an abnormal naa / cho ratio, and 20% (5/25) on the basis of an abnormal naa / cr ratio. in control subjects, naa concentration and naa / cho and naa / cr ratios in the temporal lobe were significantly lower than in other regions of the brain such as the frontal lobe, parietal lobe or thalamus (10, 11). because of this regional variation in metabolite concentrations in normal brain, it is important for lateralization of the epileptogenic foci, that mrs findings should be compared between anatomically similar regions. compared with other regions of the brain, water line width of the temporal lobe was occasionally greater, a fact presumably attributable to the magnetic susceptibility effect arising from the air - tissue interface of the petrous air cells. this increased line width may give rise to significantly poor resolution, insufficient water suppression and low signal - to - noise ratios, and may be one of the factors which limits the applicability of h-1 mrs to temporal lobe epilepsy. signal - to - noise ratios can be improved by use of the press sequence, which is more sensitive than steam (12), and this is the reason why we used this sequence rather than steam. in our study, mean naa / cho and naa / cr ratios of control subjects were 1.10 - 1.20 and 1.30 - 1.40, respectively with no difference between sides. there were no significant differences in either naa / cho or naa / cr ratios between voi sizes of 2.25 cm and 6.0 cm, and on the basis of our results, we used an naa / cho ratio lower than 0.8, and naa / cr lower than 1.0, as cut - off values. recent preliminary reports of single - voxel mrs have described promising but variable results in the evaluation of mesial temporal lobe epilepsy. most mrs studies in patients with this condition have shown a decreased in naa, naa / cr, and/or naa / cho+cr values (13 - 16). some studies showed decreased naa only, without changes in cr or cho (17, 18), whereas others reported increase in both cr and cho (7, 13). common to all studies is lower naa values found in affected temporal lobes of patients than in control subjects. in that naa / cho or naa / cr ratios were lower in the affected hippocampus of patients with hippocampal sclerosis than in normal control subjects, the results of our study are consistent with those of others (13 - 16). a reduction in naa / cho or naa / cr can be interpreted as either decreased naa, reflecting neuronal loss, or increased cho or cr, presumably reflecting gliosis (7, 19), or both. in our study, mean naa / cho and naa / cr ratios in affected hippocampus were significantly lower than those in control subjects, and on the contralateral side, mrs correctly lateralized the lesion in only 72% of cases (18/25). in 28% (7/25), mrs appeared normal (i.e., false positive). this low concordance rate of 72% between mri and mrs might be mainly due to the partial volume averaging effect resulting from the fact that a relatively large voi contained a small part of the atrophied hippocampus and a large portion of adjacent tissue. the correct lateralization rate was lower with a voi of 6.0 cm than with one of 2.25 cm (64% versus 82%), a finding which appears to support the explanation provided by the partial volume averaging effect. this effect may be reduced by using two - dimensional chemical shift imaging, which allows sampling of a smaller voi. in our study, the signal - to - noise ratio of mr spectra obtained with a voi of 1 cm in five volunteers was too low to be analyzed, showing that two - dimensional chemical shift imaging was necessary. in some patients with hippocampal sclerosis in whom a voi of either 6.0 cm or 2.25 cm encompassed not only the hippocampus but also adjacent temporal lobe structures, mrs demonstrated markedly decreased naa / cho or naa / cr ratios, or both. this can hardly be explained by loss or damage of hippocampal neurons only, and likely reflects the widespread damage found in the temporal lobe of these patients. this finding is supported by pathologic studies which showed that neuronal loss and reactive gliosis often extended beyond the hippocampus (1). in our study, findings relating to the contralateral hippocampus in patients with hippocampal sclerosis differ from those described in other reports (7, 20). a previous study stated that the contralateral hippocampus of patients with temporal lobe epilepsy showed mrs features similar to those in control subjects (20). (7), however, reported that naa and cho levels, and naa / cho+cr ratios were significantly lower in the contralateral hippocampus of patients with temporal lobe epilepsy than in control subjects. they also found bilateral abnormalities in 40% of cases (10/25), as seen on mrs. this finding is consistent with the result of a previous study in which bilateral pathology was present in up to 50% of patients with temporal lobe epilepsy (21). even though the significance of bilateral abnormalities is not fully understood, the demonstration of their existence is important if the neurobiology and pathology of epilepsy are to be understood and the patients clinically evaluated. it is not clear how the presence of contralateral abnormalities may affect the outcome of temporal lobe surgery. in our study, bilateral abnormalities were seen on mrs in 24% of cases (6/25), and although the differences were not statistically significant, mean naa / cho and naa / cr ratios of the contralateral hippocampus in the patients with hippocampal sclerosis were lower than those of control subjects. these varied results might be due to selection bias and the small sample sizes of the studies. we think that a limitation of our study is the matter of patient selection ; in only nine was hippocampal sclerosis pathologically proven, and the mri diagnosis of unilateral hippocampal sclerosis was based on visual evaluation only. most previous in vivo mrs studies reported the ratios of metabolite intensities, often using the cr value as an internal reference. in our control subject data, however, cr and cho intensities varied, the former showing great variation. furthermore, the correct lateralization rate of hippocampal sclerosis, and the detection rate of bilateral abnormalities were higher when based on naa / cho ratio than on the naa / cr ratio (64% versus 48%). this might be because cho was higher than cr, secondary to gliosis, although the exact cause is not certain. in conclusion, single - voxel h-1 mrs is an useful and promising diagnostic tool in the evaluation of temporal lobe epilepsy, particularly for the detection of bilateral abnormalities. however, current mrs with semiquantitation using metabolite ratios is of limited value for accurate lateralization of the epileptogenic focus in hippocampal sclerosis. to improve the diagnostic accuracy of h-1 mrs, data acquisition with smaller voxel size but with a higher signal - to - noise ratio, and measurement of the absolute amount of metabolites, | objectivethe purpose of our study was to determine the ability of h-1 mr spectroscopy (mrs) to lateralize the lesion in patients with hippocampal sclerosis.materials and methodstwenty healthy volunteers and 25 patients with intractable temporal lobe epilepsy whose mr imaging diagnosis was unilateral hippocampal sclerosis were included. this diagnosis was based on the presence of unilateral atrophy and/or high t2 signal intensity of the hippocampus. single - voxel h-1 mrs was carried out on a 1.5-t unit using press sequence (te, 136 msec). spectra were obtained from hippocampal areas bilaterally with volumes of interest (vois) of 6.0 cm3 and 2.25 cm3 in healthy volunteers, and of either 6.0 cm3 (n = 14) or 2.25 cm3 (n = 11) in patients. metabolite ratios of naa / cho and naa / cr were calculated from relative peak height measurements. the capability of mrs to lateralize the lesion and to detect bilateral abnormalities was compared with mr imaging diagnosis as a standard of reference.resultsin healthy volunteers, naa / cho and naa / cr ratios were greater than 0.8 and 1.0, respectively. in patients, the mean values of these ratios were significantly lower on the lesion side than on the contralateral side, and lower than those of healthy volunteers (p <.05). the overall correct lateralization rate of mrs was 72% (18/25) ; this rate was lower with a voi of 6.0 cm3 than of 2.25 cm3 (64% versus 82%, p <.05). bilateral abnormalities on mrs were found in 24% (6/25) of cases.conclusionalthough its rate of correct lateralization is low, single - voxel h-1 mrs is a useful and promising diagnostic tool in the evaluation of hippocampal sclerosis, particularly for the detection of bilateral abnormalities. to improve the diagnostic accuracy of h-1 mrs, further investigation, including the use of a smaller voi and measurement of the absolute amount of metabolites, are needed. |
balance is the ability to maintain one s center of gravity with minimum shaking within the basal plane, while postural balance is the ability to continuously maintain equilibrium within the basal plane according to one s center of mass (com) and maintain postural control to cope with diverse motions and external swaying1. balance abilities are complicated functions derived from integration of the nervous and musculoskeletal systems that involve diverse functional factors such as integration of the stimuli emanating from the visual, hearing, and vestibular organs ; proprioceptors and sensory receptors in the central nervous system ; visual spatial cognitive ability ; muscle tone that responds to environmental changes both quickly and accurately ; muscular endurance ; and joint flexibility2. mental practice, which is frequently used to improve balance ability, was recently presented in diverse areas for the purpose of mastering motor skills and improving motor learning3. mental practice is a motor learning method that imparts and improves motor skills and involves imagining movement scenes without making any body movements. gerardin.4 reported that imagining movement scenes and performing exercises identically activated the frontal lobe. although diverse studies on mental practice have been conducted to date, most addressed improving the upper limb functions of stroke patients, while few have examined mental practice as an approach to improving balance ability. therefore, the purpose of the present study was to examine the effects of mental practice on the balance abilities of normal individuals. thirty subjects were randomly assigned to an experimental or control group (n=15 each). the selection criteria utilized were as follows : no history of orthopedic surgery on a lower limb, never taken any drug due to a neurologic problem, and no musculoskeletal system disease. the general characteristics of the study subjects are summarized in table 1table 1.general characteristics of the study subjects (n=30)characteristiceg (n=15)cg (n=15)age (years)21.8 (2.0)22.6 (1.3)height (cm)166.5 (5.4)169.7 (3.3)weight (kg)60.2 (8.1)62.2 (6.5)eg : experimental group ; cg : control group. values are expressed as mean (sd).. the research ethics committee of eulji university hospital approved the study, and all subjects provided informed written consent prior to participating. participants in both groups performed balance training in a seated position on a gym ball for 20 minutes per session, five sessions per week, for 4 weeks. participants in the experimental group also completed a mental practice regimen for 10 minutes before each balance training session. the gym ball exercises included maintaining proper posture in a seated position on a gym ball, laterally moving one s body weight, and moving one s body weight back and forth. for the mental practice sessions, the subjects were allowed to maintain a comfortable seated position on a chair and the laboratory environment was kept dark and as quite as possible. the subjects listened to a voice file describing the imaginary act of maintaining balance in a seated position on a gym ball. during the warm - up stage, muscle relaxing training was implemented for 2 minutes to ensure psychological stability. in the recordings, the first - person viewpoint was used as described by the classification methods presented by mahoney and avener5. during the mental practice exercises, each subject was allowed to maximally feel the sole pressure and proprioceptive sensory information from the ankles, knees, and hip joints when carrying out the weight shift training ; the mental practice was performed for 6 minutes. the cooling down stage was used to direct the subject back to reality and become psychologically stabilized. after the intervention, balance measuring equipment (good balance, metitur, finland) was used to quantitatively measure each subject s balance ability. to measure balance function, the subject was instructed to stand on a triangle platform and maintain a symmetrical posture with the feet shoulder width apart. a visual fixed point was located in front of the subject to minimize head movements. the subject s arms were placed comfortably at the hip joints and the center of pressure (cop) was measured for 30 seconds in the standing posture with the eyes open.. means and standard deviations were calculated for all variables. before the intervention, group differences in general characteristics were compared using the independent t - tests and tests. intragroup comparisons of variables before and after training were conducted using paired sample t - tests. intergroup comparisons of pre- and post - test differences in variables were performed using the independent t - test. intergroup effect sizes were calculated using the cohen d coefficient6, where an effect size 0.8, a large difference. the statistical analysis was performed at the 95% confidence level, and p values < 0.05 were considered significant. table 1 provides a summary of the subjects clinical and demographic features (n=30). the characteristics of the two groups before and after intervention are shown in table 2table 2.pre- versus post - test balance variables in the experimental and control groupseg (n=15)cg (n=15)pre - testpost - testpre - testpost - testmediolateral (mm / s)135.24 (35.62)110.25 (36.58)137.69 (30.24)130.85 (20.31)anteroposterior (mm / s)195.21 (38.21)182.62 (40.21)193.26 (40.13)187.84 (41.74)index of balance function (score)75.43 (12.12)82.64 (8.56)74.23 (7.32)79.35 (6.24)time (s)22.72 (3.52)13.52 (2.54)23.74 (3.62)18.45 (2.45)eg : experimental group ; cg : control group. values are presented as mean (sd). significant difference from pre - test, p<0.05. the experimental group showed significant increments in the mediolateral, index of balance function, and time variables compared to the pre - intervention results (p<0.05). in addition, the control group showed significant increments in the index of balance function and time variables compared to the pre - intervention results (p<0.05). significant intergroup differences were observed for post - training gains in the mediolateral, index of balance function, and time variables (p<0.05). the effect sizes of the gains in the experimental and control groups were high for the index of balance function and time variables (effect sizes=1.12 and 0.86, respectively). mental practice could be described as imagining movements for body activities without any gross motor activity6. mental practice enhances motor skills by facilitating the imagining of proprioceptive senses such as visual, auditory, tactile, motor, olfactory, and taste without any external stimuli. theories that explain the mechanism of mental practice include paivio s theory7, the psychoneuromuscular theory8, and the cognitive symbolio learning theory9. paivio s theory proposes that visually imagining the carrying out of movements promotes cognitive function and motivation7, whereas the psychoneuromuscular theory purports that practicing tasks to be performed in advance using imagination reinforces the neurological pathways necessary to conduct the required movements, thus enhancing one s ability to perform the movements8. on the other hand, the cognitive symbolio learning theory proposes that imagining movements provides opportunities to practice their order and enables advanced planning, thus improving efficiency when the movements are actually carried out9. weiss.10 reported that excitation was observed in the same brain regions during mental practice and physical training, especially the supplementary motor area of the brain during mental practice. based on the results of previous studies, it can be said that the neuromuscular responses that appear when movement performance is imagined are similar to those observed when the movements are actually performed. therefore, imagining the movements that are used to carry out a task reinforces the neurological pathways required to actually perform the movements, thereby improving one s ability to perform them. the results of the present study suggest that balance ability is improved in accordance with the psychoneuromuscular theory. the limitations of the present study are that it was difficult to evaluate whether the imagining practice learning level was appropriate and the intervention period was too short to generalize the results. in addition, subjects could not be controlled after the experimental period and the number of subjects was small. therefore, in future studies, if the experimental intervention period is extended and environmental factors are more thoroughly addressed, positive generalizable results might be obtained. in addition, if visual and perceptive sources of stimuli were applied with the auditory stimulus, the effects of the mental practice exercise might be further enhanced. | [purpose ] this study aimed to examine the effects of mental practice on the balance abilities of normal individuals. [subjects and methods ] thirty subjects were randomly assigned to an experimental or control group (n=15 each). participants in both groups performed balance training in a seated position on a gym ball for 20 minutes per session, five sessions per week, for 4 weeks. members of the experimental group also performed mental practice for 10 minutes before the balance training. after the intervention, balance measuring equipment (good balance, metitur, finland) was used to quantitatively measure balance ability. [results ] significant post - training gains were observed in the mediolateral, index of balance function, and time variables of participants of the experimental group. [conclusion ] the application of mental practice with balance training positively affected balance ability. |
a search for the biological factor responsible for energy balance and signal transduction to the hypothalamus was initiated by studies on animal models. in 1994, a molecular defect in the obese gene (ob), a gene responsible for the obesity phenotype in ob / ob mice was identified using a positive cloning method. ob gene has found on chromosome 6 in mice and on chromosome 7q31.3 in humans and has been shown to encode 4.5 kb - long mrna. the protein encoded by the ob gene has been isolated and named leptin - from the greek " leptos " meaning thin. it has been demonstrated that leptin biological activity strongly depends on its proper interactions with ob - r receptors. ob - r receptor, encoded by db gene has been identified for the first time in a murine vascular plexus using a cloning technique. it is a member of class i cytokine receptors family that, apart from, ob - r consist of gp130 subunit of il-2r, il-3, il-4, il-6, il-7, lif (leukemia inhibitory factor), g - csf (granulocytecolony stimulating factor), growth hormone, prolactin, and erythropoietin receptors. ob - r expressed in six isoforms, is the product of alternative rna splicing of db gene (diabetes gen). according to its structural differences, the receptor 's isoforms were divided into three classes : long, short and secretory. all ob - r isoforms have a similar, extracellular ligand- binding domain located in n - terminus of the protein. the domain is constituted by 816 amino acids and contains four cysteine residues, wsxws motif (trp - ser - x - trp - ser) and a different number of fibronectin iii domains. five isoforms, including the long isoform ob - rb and short ones - ob - ra, ob - rc, ob - rd, and ob - rf, have a transmembrane domain consisting of 34 amino acids. the intracellular domain of the long isoform consists of 303 amino acids at carboxyl terminus, while intracellular domains of short isoforms are shorter and consists of 32 - 40 amino acids. apart from identical extracellular and transmembrane domains, ob - r isoforms (short and long) have the same sequence of the first intracellular 29 amino acids. the length of the further intracellular amino acid sequences depends on the alternative mrna splicing. ob - rb isoform contain additional box 2 and socs (suppressor of cytokine signaling) motifs. a sixth, secreted ob - re isoform, does not contain intracellular and cytoplasmic domains and is secreted to the bloodstream as a soluble receptor (figure 1) [6,8 - 10 ]. cr - cytokine receptor domain, f - iii - type iii fibronectin domains, box 1, 2, 3 - constant, intracellular motifs [according to 7, 8 ]. a long, fully active isoform of ob - rb is expressed mainly in the hypothalamus, where it takes part in energy homeostasis and in the regulation of secretory organs ' activity. ob - rb is also present in all types of immune cells, involved in innate and adaptive immunity (figure 2) [7,9,11 - 14 ]. ob - rb, long isoform of leptin receptor : jak - tyrosine kinases, stat - signal transducer and activator of transcription, socs proteins - cytokine signal transduction inhibitors, p - phosphate residues, cr - cytokine receptor domain, f - iii - type iii fibronectin domains [according to 7, 17 ]. lack of a full - length ob - rb receptor is responsible for the development of the early obesity phenotype in db / db mice and in obese rats. in db / db mice, a short ob - ra isoform with limited activity is synthesized. the mice strain is also characterized by cold intolerance and elevated concentration of glucosteroid hormones. moreover, db / db mice phenotype includes a significantly elevated leptin concentration, with no ability to respond to leptin signal. short leptin isoforms that contain box 1 motif are able to bind jak kinases (janus kinases) and to activate some signal transduction cascades. however, the effect of short isoform activation differs from that of long isoform activation. a short isoform, ob - ra, is the most common ob - r isoform that can be found in many various cells and tissues, including kidney, lungs, liver, spleen, and macrophages. a soluble isoform of the receptor, ob - re, is probably a result of alternative transcript splicing of db gene or a consequence of transmembrane ob - r receptor destruction. circulating ob - re is able to bind serum leptin and to inhibit signal transduction pathways. on the other hand, the receptor can regulate serum leptin concentration and serve as a carrier protein delivering the hormone to its membrane receptors able to transduct the signal into the cell. in normal conditions, only 5 - 25% of all ob - r isoforms are present on the cell surface, whereas the majority of receptors are localized within the cell. after ligand binding, the receptors are internalized into early endosomes via clathrin - coated vesicles. a decrease in ob - rb expression is much higher than changes in ob - ra expression, and short isoform ob - ra is much faster recycled to the cell membrane. relatively weak signal transduction through long ob - rb isoform observed in obese, hyperleptinemic patients is related to delayed receptor expression on the cell surface, which may explain leptin resistance in these patients. the major role in leptin signal transduction through membrane receptors is mediated through jak / stat (signal transduction and activation of transcription) pathway. among all ob - r isoforms, only the fulllength isoform ob - rb is able to fully transduce an activation signal into the cell. ob - rb is considered a fully active receptor, because it contains 3 intracellular motifs necessary to activate the jak / stat pathway. the described motifs are the following : box 1 and box 2 that bind jak tyrosine kinase, and box 3 motif that binds stat transcription factor. additionally, in intracellular domain, ob - rb contains four tyrosine residues (tyr974, tyr985, tyr1077 and tyr1138) that activate intracellular signal transduction pathways (figure 2). after ligand binding to the ob - rb receptor, a cytoplasmic tyrosine kinase jak2 binds to box-1 and box-2 motifs. the activated kinase is autophosphorylated and activates specific tyrosine residues (tyr 985 and tyr1138) in the receptor molecule. next, after tyr1138 phosphorylation, stat proteins bind to box-3 motif. stat proteins (stat1, stat3, stat5, stat6), including the key signal transduction molecule stat3, are phosphorylated on tyrosine residues by jak2 kinases. the process leads to the dissociation of proteins from the receptor, homo- or heterodimerization and translocation of the proteins to the nucleus. in the nucleus, the described proteins serve as transcription factors activating the expression of a suppressor of cytokine signaling 3 (socs-3) or protein tyrosine phosphatase 1b (figure 3) [17,24 - 26 ]. after leptin binding, the ob - rb receptor changes its conformation that leads to jak translocation. jak proteins become activated and start to exert their kinase activity and phosphorylate tyrosine residues of other jak proteins and of ob - rb receptor. tyr1138 phosphorylation allows stat3 protein binding and next, stat proteins become the substrate for jak proteins related to ob - r receptor. stat3 protein phosphorylation leads to dissociation of the protein from the receptor, dimerization and translocation to the nucleus. stat proteins are activated by leptin and depending on the target tissue ; the type of activated protein may differ between various types of target cells. leptin induces socs3 expression by binding to the socs3 sh2 domain with tyr985 or through the inhibition of socs3 dependent jak2 phosphorylation activity. in addition, ptp1b (protein tyrosine phosphatase 1b) is another negative leptin signal transduction modulator that regulates signal transduction through dephosphorylation of jak2. ptpb1 overexpression decreases jak2 phosphorylation and inhibits leptin - induced socs3 and c - fos (proto - oncogene) transcription. mapk kinases (mitogen - activated protein kinase), irs1 (insulin receptor substrate-1), and phosphatidylinositol kinase (pi3k) are important pathways responsible for ob - rb receptor activation by leptin in various cells, e.g., t - cells. the mapk kinase signal transduction pathway is mediated by erk (estrogen receptor) and p38 kinases. it has been demonstrated in osteoblasts that leptin, after activation of ob - rb, induces apoptosis through the activation of mapk, erk1/2-dependent activation of cytoplasmic phospholipase a, and subsequent cytochrome c release and activation of caspases 3 and 9. osmotic stress, heat shock, and cytokines are able to activate another mapk family protein, namely p38. in mononuclear cells, after binding to ob - rb, leptin increases the level of p38mapk phosphorylation. in lps (lipopolysaccharide)-stimulated kupffer cells, leptin significantly increases tnf secretion through the activation of p38 and jnk / mapk (c - jun n - terminal kinase), whereas in smooth muscle cells it is able to induce hypertrophy through the activation of p38 mapk. pi3k is believed to constitute an important common element for signal transduction pathways activated by insulin and leptin and its receptor. in the central nervous system, adipose tissue, liver, and pancreas, leptin induces a similar pathway to that activated by insulin, including pi3kdependent activation of pde3b (phosphodiesterase 3b) and camp (cyclic adenosine monophosphate) reduction. it seems that pi3k / pde3b / camp pathway cooperates with the jak2/stat cascade and is an important element of leptin signal transduction pathways in the hypothalamus. lepr gene (leptin receptor gene) mutations are extremely rare in human and animals. a single nucleotide substitution (g to a) in exon 6 leads to a deficiency in intracellular and transmembrane domain of the receptor. the mutation caused by premature stop codon insertion at the 3 ' terminus of leprb mrna was found in db / db mice, whereas in zucker rats, the mutation was caused by amino acid substitution (gln to pro) at position 269 of the extracellular domain of the receptor. the described mutation resulted in a severe reduction of ob - r expression on the cell surface and limitation in the leptin - receptor binding. obese koletsky rats had a point mutation at 763 position resulting in premature stop codon introduction in the intracellular domain of the receptor that led to a total deficiency in all ob - r isoforms on the cell surface. both zucker and koletsky rats are characterized by morbid obesity, hyperphagia, hyperlipidemia, and numerous hormonal disorders. in humans, a rare mutation caused by a single substitution of g to a in exon 16 was identified. it leads to an abnormal expression of transmembrane and intracellular domains of receptors. as in case of laboratory animals, humans with lepr gene defects it has been demonstrated that the polymorphisms may lead to the impairment of signal transduction from the receptor into the cell through premature ob - ra, instead of ob - rb isoform production, or through a decrease in ob - r expression on the cell surface and limitation in leptin - receptor interactions. lepr gene defects influence the development of hyperphagia, obesity, pubertal development disorders, neuroendocrine system regulation impairment, and diabetes caused by -cell apoptosis in the pancreas. the most commonly seen polymorphism is gln223arg, encoding the extracellular domain of the receptor responsible for leptin binding. glutamine to arginine change may be responsible for an impaired signal transducing capacity of the leptin receptor. a connection between gln223arg polymorphism and breast cancer development and progression has been suggested. genetic interactions between leptin and gln223arg polymorphisms of lepr gene can increase the risk of the development of non - hodgkin lymphoma in obese patients. it also is suggested that the discussed polymorphisms are related to hemodynamic and metabolic disorders found in obese patients. overweight and obesity commonly observed after the management of childhood acute lymphoblastic leukemia also may have to do with the gln223arg polymorphism of lepr gene. | leptin or obesity receptor (ob - r) is a member of class i cytokine receptor family. ob - r, expressed in six isoforms, is the product of alternative rna splicing of db gene. according to its structural differences, the receptor 's isoforms are divided into three classes : long, short, and secretory isoforms. a long, fully active isoform of ob - rb is expressed mainly in the hypothalamus, where it takes part in energy homeostasis and in the regulation of secretory organs ' activity. ob - rb is also present on all types of immune cells, involved in innate and adaptive immunity. short leptin isoforms (ob - ra, ob - rc, ob - rd, and ob - re) that contain box 1 motif are able to bind jak kinases (janus kinases) as well as to activate some other signal transduction cascades. a soluble isoform (ob - re) can regulate serum leptin concentration and serve as a carrier protein delivering the hormone to its membrane receptors and is able to transduce the signal into the cell. jak / stat pathway plays the major role in leptin signal transduction through membrane receptors. among all ob - r isoforms, only full - length isoform (ob - rb) is able to fully transduce activation signal into the cell. |
widely accepted standard therapy for high - risk nb includes 5 to 7 cycles of intensive cytotoxic chemotherapy, surgery, consolidative autologous stem cell transplantation (sct), radiation therapy, and maintenance immunotherapy with anti - gd2 antibodies. such therapy carries considerable toxicity while survival remains generally poor as nb accounts for 15% of deaths attributable to cancer in childhood. immunotherapy, in particular the use of tumor cell - based vaccines, is an attractive way of generating antineuroblastoma immunity and does not increase the toxicity of concurrent radio- or chemotherapy [2, 3 ]. we have generated a series of cell - based vaccines by combining tumor cells with replication - competent hsv oncolytic virus, which have demonstrated a host immune response following intratumor injection. based on these findings, we sought to determine the feasibility of an oncolytic hsv - based whole cell peripheral vaccine against an intracranial tumor. we designed a whole cell tumor vaccine to incorporate the oncolytic il-12-expressing replication - competent hsv-1 m002 into the neuro 2a (n2a) neuroblastoma cell line derived from a / j mice. we have previously described the m002 hsv-1 in detail [2, 4 ]. in brief, the virus is an attenuated human herpes virus mutant deleted for both copies of the 1 - 34.5 gene, restricting virus replication to tumor cells. a genetically concatenated copy of murine il-12 (p35 and p40 subunits, connected by an ires) cdna was inserted into each of the 134.5 loci under an egr1 promoter. cells infected with this virus make physiologic concentrations of il-12, a potent antitumor cytokine that has been shown to enhance the cytolytic activity of natural killer cells and cytotoxic t lymphocytes as well as the development of a th-1-type immune response [511 ]. il-12 has also been shown to produce antiglioma immune activity in two different rodent models and also possesses antiangiogenic properties, an additional potential mechanism for antitumor activity [12, 13 ]. the combination of irradiated tumor cells, oncolytic virus, and local il-12 production forms a multimodal vaccine approach to malignant cns tumors that we now seek to apply to neuroblastoma. in this study, we tested this vaccine against the syngeneic mouse tumor model, neuro 2a neuroblastoma cell line, in a / j mice in both a postimplantation and a premunition prime / boost vaccination strategy. we also examined whether this vaccination strategy could produce a disease - specific sustained immune response to a rechallenge of the same tumor and whether in vitro cytotoxicity against tumor could be demonstrated from spleen cells of vaccinated mice. two groups of a / j mice (n = 10 per group) were vaccinated with either irradiated neuro 2a whole cell (control vaccine (cv)) alone or the complete multimodal vaccine (cv - m002) manufactured as described below. three control groups received no treatment (tumor control), m002 virus intracranial injection (virus control 1), or m002 virus intracranial injection followed by control vaccine injections (virus control 2) (figure 2(a)). mice received 1 10 vaccine cells (in 50 l aliquots) at three, seven, and fourteen days following tumor implantation, inoculated into the gastrocnemius muscle. vaccination was repeated as described for each experiment, using the contralateral gastrocnemius muscle from that previously used. a separate series of studies were undertaken involving vaccination with cv - m002 in mice with intracranial n2a tumors to evaluate tumor infiltration by immune - related cells. in premunition experiment, a prime - boost strategy was employed (figure 3(a)) whereby the first dose of complete multimodal vaccine or control vaccine was administered intramuscularly seven days prior to tumor placement and the second dose seven days after. the rechallenge with syngeneic related (n2a) or unrelated (h6) tumor cells was performed in mice surviving initial n2a tumor implantation after receiving prime - boost vaccination with multimodal cv - m002. this group was challenged again with n2a cells at day 40 after the first n2a challenge and at day 60 with syngeneic h6 tumor cells to investigate specificity of immune response. a / j mice, 68 weeks old, were purchased from jackson laboratories (bar harbor, maine, usa). mice were housed in a pathogen - free environment in the aalac - accredited animal resource center at the university of alabama at birmingham (uab). the uab institutional animal care and use committee approved all protocols specific to this study (apn#080607062). the neuro 2a mouse murine neuroblastoma cell line was originally derived from a spontaneous tumor of the spinal cord in an a / j mouse. we purchased the cell line from the american type culture collection (ccl 131, passage 171). the h6 murine hepatoma of a / j origin was purchased from jackson laboratory, dctd tumor repository (mri bank # j-750). cells were maintained in dulbecco 's modified eagle 's medium mixed 50 : 50 with ham 's nutrient mixture f-12 (dmem / f12) supplemented with 7% fetal bovine serum (fbs) and 2.6 mm l - glutamine (complete medium). the complete multimodal vaccine (cv - m002) was prepared as follows : neuro 2a cells were cultured overnight in 24-well plates at 6 10 cells / well followed by incubation (37c, 2 hours) with the m002 virus at an moi of 5. cells were washed with pbs and resuspended in complete medium and incubated for an additional 30 min. the plate was then irradiated (10 gy) followed by a medium exchange and additional incubation (37c, 24 hours). control whole cell vaccine (cv) consisted of an identical preparation in which the confluent flask underwent incubation procedures that were the same as m002-infected cells and received the 10 gy irradiation dose. supernatants were harvested, clarified by centrifugation, and frozen (20c) for il-12 analysis. production of murine il-12 by the recombinant m002 virus was quantified using a mouse il-12 p70 quantikine elisa kit (r&d system, minneapolis, mn, usa). twelve well plates were seeded with 2.5 10 cells per well for 24 hours and then treated as described above (in preparation of cell vaccine). the supernatants were collected at 4, 12, and 24 hr and analyzed by elisa according to the manufacturer 's protocol. following harvest from log - phase growth in culture, neuro 2a cells (1 10 cells) were injected into the right caudate nucleus in 5 l of serum - free dmem / f12 containing 5% methylcellulose to retard settling during injection. this dose was optimized by parker. to define a median survival of 14 to 25 days. recovered mice were assessed daily for weight and neurologic impairment and were euthanized on a timed schedule as described below, if they either incurred a 20% weight loss from baseline or appeared moribund. if mice were found dead, death was recorded to end on the previous day. h6 syngeneic hepatoma cells at a concentration of 5 10 cells in 200 l serum - free media were implanted in the flank of long - term survivors of a second intracranial injection of neuro 2a (at day 60 after initial n2a introduction). mice were sacrificed if ulcerations were seen or if tumor volume exceeded 25 mm. semiquantitative flow cytometric analysis of brain homogenate from mice euthanized at multiple time points after initial tumor implantation was performed as described by hellums.. beginning at seven days after initial tumor implantation, one mouse was euthanized at 3648 h intervals. the lymphocyte - rich layer was aspirated, washed, and resuspended in pbs - containing fc blocker, followed by directly conjugated monoclonal antibodies from the following panel : cd4 (clone gk1.5, pharmingen), cd8 (clone 53 - 6.7, pharmingen), cd3 (clone 17a2), tcr- (clone gl3), and nk cells (ncam 60). after incubation (60 min, 4c), cells were washed three times and fixed in 1% fresh paraformaldehyde prior to acquisition on an lsr flow cytometer equipped with facsdiva software (bd biosciences, san jose, ca). ten days after the second vaccination with the neuro 2a vaccine described above, spleens were harvested and splenocytes were isolated by density - gradient centrifugation. neuro 2a targets were harvested from culture, counted, and labeled with pkh-26 (sigma - aldrich, st. vaccinated splenocytes and nave splenocytes were incubated with pkh26-labeled neuro 2a cells at 37c for 4 h in effector to target cell ratios of 12.5 : 1, 25 : 1, 50 : 1, and 100 : 1. the vital dye to - pro-3-iodide (molecular probes / invitrogen, carlsbad, ca, usa) was added immediately prior to acquisition on the flow cytometer. paraffin embedded sections of mouse brain were postfixed in neutral buffered formalin followed by antigen retrieval with rodent decloaker (biocare medical, ca, usa). sections were blocked with avidin and biotin blocks for 20 min (avidin biotin blocking kit, biogenex laboratories) followed by the rodent blocker (bio care medical, richmond, ca, usa) and fc receptor blocker (innovex biosciences) for 30 minutes at rt. sections were incubated with rabbit cd3 (abcam) antibodies overnight at 4c following secondary goat anti - rabbit antibodies (biocare medical, richmond, ca, usa) for 30 min at rt. sections were next developed with streptavidin - labeled peroxidase and turbo dab (innovex biosciences, richmond, ca, usa) for 25 minutes and counterstained with hematoxylin. statistical analysis was performed in the uab comprehensive cancer biostatistical and bioinformatics shared services facility. descriptive statistics were used to express data from cytotoxicity assays. the primary endpoint in this study was survival. survival times from tumor induction and from vaccine therapy were recorded in days for each mouse. log - rank tests (mantel - cox and gehan - breslow - wilcoxon) were performed on the survival data to determine the level of significance for any differences observed in treatment groups at the 0.05 level of significance. the median survival times across replications are represented as the median survival for the group. we initially hypothesized that the treatment with n2a tumor cells transduced with hsv1 (m002) encoding murine il12 will demonstrate enhanced antitumor activity compared to m002 alone (or serve as more efficient vaccination vehicle than virus alone). to characterize the n2a tumor cell - based vaccine loaded with the virus, we infected cells with m002 at moi 5 pfu / cell and measured the production of murine il12 in a culture media at 4, 12, and 24 hrs after infection. the mil12 concentration in hsv - il12 infected n2a cells increased in time and reached 3100 pg / ml at 24 hrs (figure 1). an irradiation of m002-infected cells was implemented as in vivo required safeguard against the tumor cells proliferation. an irradiation at 10 gy abolished cell amplification yet, however, still allowed cells to remain metabolically active for a certain time. in infected and irradiated (1 hr after infection) n2a cells, the production of mil12 followed a similar pattern of the il12 increase as detected in nonirradiated cells. importantly, the il12 levels were comparable with nonirradiated infected cultures. cellular vaccine presented by irradiated n2a cells loaded with hsv - il12 was used in our study for peripheral (intramuscular) delivery of the mixture of tumor antigens, conditionally replicative hsv, and murine il12 in an attempt to favorably change generally insufficient immune response to orthotopically implanted tumors. neuro 2a, one of the several clonal derivatives of the c-1300 spontaneous neuroblastoma of a / j mice, has been transplanted in various sites, including intracerebrally, for evaluating multiple therapeutic modalities. macklis and madison implanted c-1300 in the brains of mice, and we have modified this approach for this study principally to use survival as our primary indicator. for the in vivo test of vaccine treatment, a / j mice were randomized into three cohorts : no treatment group, treatment with cell vaccine (cv), and treatment with cv (m002), complete multimodal cell vaccine. vaccination was performed at 3, 7, and 14 days after tumor implantation (figure 2(a), groups 13). in addition, two groups that received m002 viral treatment (groups 4 - 5) were included for comparison : both received single intracranial injection of virus at day 3, whereas the last group followed a boost with two intramuscular (i m) injections of cv. contrary to our initial hypothesis, in vivo testing of hsv - il12 loaded tumor cell vaccine did not result in any therapeutic benefit (increased survival) compared to either untreated group or vaccination with n2a tumor cells alone. in fact, neither the complete vaccine, a combination of irradiated n2a cell vaccine and m002 (cv - m002), nor the n2a cell vaccine alone (cv) conferred a significant survival advantage over untreated controls (figure 2(b)). mice that received three intramuscular injections of complete vaccine showed a median survival of 14 days and there was no advantage over 15 days for untreated tumor - bearing controls and 14.5 days for mice that received the n2a cell vaccine only (p = 0.7154 and 0.1261, resp.). there was no advantage for the complete m002 vaccine over the irradiated whole cell vaccine in this model (p = 0.7199). in these experimental settings, only viral treatment administered either as single intracranial injection at day 3 or followed by 2 n2a injections at days 7 and 14 modestly increased median survival time over untreated animals (20 days, 18.5 days, and 15 days correspondingly) (p = 0.0012). however, the combination of m002+radiated n2a cells provides no additional benefit over m002 alone (p = 0.6126). intracranial neuro 2a tumors present an extremely stringent experimental model with low immunogenicity and rapid growth properties. not surprisingly, both the whole cell vaccinated a / j mice and mice that received the complete m002 vaccine showed no survival advantage over that of tumor - bearing untreated mice as shown in figure 2(b). in order to determine whether an effective adaptive antitumor response still could be induced with tumor cell vaccinations, a second experiment was conducted in which vaccination was performed at 7 days prior to tumor implantation followed by a boost at 7 days following tumor implantation (figure 3(a)). a / j mice were randomized into three groups : the first consisting of tumor - bearing mice that were not vaccinated, a second cohort that received the whole cell neuro 2a prime - boost vaccination regimen (cv), and a third that received the prime - boost vaccination with the complete cv - m002 vaccine. in contrast to vaccine treatment outcomes, a premunition prime - boost strategy conferred a survival advantage for vaccinated a / j mice despite rapid growth pattern of neuro 2a tumors. a significant survival advantage was seen in mice that received the complete cv - m002 vaccine over that of control mice (p = 0.00002) and over that of mice that received the irradiated whole cell vaccine cv (p = 0.04). survival of mice that received the whole cell vaccine was not significantly different from unvaccinated control mice (p = 0.12) as shown in figure 3(b). cv - m002 vaccinated survivors (n = 6) were rechallenged at day 40 with respective orthotropic tumor implantation in the contralateral hemisphere and compared with nave mice that were implanted with the corresponding tumor as a positive control (figure 3(c)). cv - m002-vaccinated mice lived significantly longer than control mice (p = 0.0008). five of six m002 vaccinated mice survived to the experiment endpoint (100 days) (figure 3(d)). vaccine specificity was tested by flank injection of the syngeneic h6 hepatoma cells in cv - m002 surviving mice 60 days following the second intracranial neuro 2a injection (figure 3(c)). h6 tumor cells grew quickly in every mouse achieving a mass larger than 25 mm between seven and 10 days following the flank injections. examination of brains from long - term survivors revealed no evidence of neuro 2a tumor persisting from the second intracranial implantation. these data are consistent with specificity of cv - m002 vaccine against neuro 2a tumors. cv - m002 mice that received premunition vaccinations were serially sacrificed to evaluate tumor infiltration by immune cells. beginning with day + 7 after tumor injection and continuing every 3 days 5, flow cytometric analysis of lymphocyte subsets was performed on brain / tumor - infiltrating lymphocytes at designated time points (figure 4). one mouse from the nonvaccinated group (not shown) and one from the cv - m002 vaccine group were euthanized, and the brain underwent facs analysis to evaluate til response using antibodies against cd3, cd4, cd8, and nk 1.1. an increase in cd4 + t cells was seen initially followed by a cd8 + t cell increase until reaching a peak at day + 38 after tumor injection (figure 4(a)). analysis of nk cells and t cell subsets revealed that nk cell infiltration in the brain is small and with little change in time. all studied t cell subsets (cd3, cd4, and cd8) peaked in numbers at day 17 after tumor inoculation (figure 4(b)). thus, t cells show significant infiltration at day + 17 with the cd4 + subset tapering at day + 24. cytotoxic function of vaccinated and nave mouse splenocytes was examined after a 4-hour incubation followed by the flow cytometry as described above. facs analysis demonstrated a slight but significant (p = 0.04) increase in cytolytic activity of spleen cells from 2 of 3 vaccinated mice against neuro 2a targets when compared with spleen cells from unvaccinated controls. at effector to tumor ratio 20 : 1, lysis of target tumor cells by vaccinated splenocytes reached 55%, 40%, and 30% compared to tumor cell lysis at 22% and 25% shown by nave splenocytes (figure 5). starting day 7 after initial tumor implantation, one mouse from each of the groups vaccinated with (a) complete multimodal vaccine (cv - m002) and (b) control vaccine (cv only) and of those receiving (c) intracranial injection of m002 virus followed by 2 injections of cv (m002 (ic)+cv (i m)) or (d) a single intracranial injection of m002 virus (m002 only (ic)) was killed at 3648-hour intervalsto harvest a brain for ich. paraffin embedded sections of brain tumors with adjacent normal tissues were stained with cd3 ab to detect lymphocyte infiltration (figure 6). some cd3 infiltration was seen in the brain tumors of cv - m002 vaccinated, but not in cv only group ; however, it did not result in difference in overall survival for these two groups. tumor vaccines have been part of clinical trials for many cancers including prostate, renal cell, gastrointestinal stromal, lung, and breast. these trials are based on promising laboratory studies that often use autologous tumor that has been sonicated, lysed, irradiated, and/or transduced with a gene therapy vector. vaccines may require antigen - presenting cells (apc) such as dendritic cells (dc) to initiate a cytotoxic t lymphocyte (ctl) response supplemented with adjuvant immune modulators such as il-12 or gm - csf. vaccine protocols often include a boost injection of the vaccine or of immunomodulators to create a durable immune response to tumor - associated antigens. vaccine trials directed against high - grade brain tumors such as glioblastoma multiforme have incorporated the use of dendritic cells pulsed with tumor lysate [18, 19 ], antibodies to tumor antigen egfrviii, irradiated tumor injected with immunomodulators, and adoptive transfer of immunity of expanded tumor - infiltrating lymphocytes. these trials are based on multiple laboratory models of tumor vaccines that use varied mechanisms in an attempt to induce a specific, durable antitumor immune response. in this report, we have demonstrated the efficacy of an antitumor vaccine utilizing autologous (in our case, syngeneic) tumor cells infected with an oncolytic hsv-1. we demonstrated durability and specificity of this response by showing resistance to intracranial rechallenge with the same neuro 2a tumor cell line but susceptibility to the h6 syngeneic murine hepatoma. these findings were consistent with a durable specific immune response against neuro 2a tumor. in vitro cytotoxicity assays also confirmed that vaccinated splenocytes killed neuro 2a tumor cells. serial facs analysis of whole brain preparations at multiple time points following vaccination also revealed a robust ctl response to the tumor. we chose oncolytic hsv for our vaccine studies because of its demonstrated ability to generate an antitumor immune response. we specifically selected m002, an hsv expressing - il-12, to amplify a more robust t cell response to the tumor. oncolytic hsv has been used as a primary antiglioma agent in g207 and 1716 trials [23, 24 ]. phase i / ii trials of g207 and 1716 have produced some long - term survivors. a vaccine composed of a nonreplicating hsv infected tumor that is irradiated and then presented to dendritic cells has been shown to produce a strong t cell response including the stimulation of tumor reactive ifn- secreting t cells and tumor reactive cytotoxic t cells. il-12 boosts the th1 immune response and stimulates the production of ifn- and tnf-. this combination of irradiated tumor cells infected with a conditionally replication - competent oncolytic hsv may produce a more robust immune response in the context of the stress / danger model of immunity as originally described by matzinger [26, 27 ] based on the expression of stress - related antigens. indeed, malignant and infected cells, including gliomas, express stress - related antigens that are ligands for nkg2d, which functions in the primary immune response of nk and some t cells and is a coreceptor on cd8 + ctl [58, 28 ]. in addition, m002 virus expression of il-12 in the local tumor environment amplifies the immune response as described by parker.. finally, it is generally obvious that prime - boost strategies are impractical as a single approach for most malignancies and especially neuroblastoma as it is impossible to accurately predict its development and characterize a population that would benefit from a preventive vaccine. however, a prime - boost approach could be an important component of a combination approach in patients with minimal residual or undetectable disease provided that the patient 's immune function could be maintained at a healthy baseline or augmented by immune modulators [9, 10 ] such as effector cytokines, checkpoint inhibitors [12, 13 ], and/or adoptive cell therapy. in summary, we have shown that a tumor vaccine incorporating the m002 il-12-expressing virus appears to produce a durable, specific immunization against an aggressive intracranial tumor, although vaccination in a minimal disease state has little if any efficacy. these findings strongly suggest that multimodal vaccine therapy could have an adjuvant role in combination with additional immune modulation for the treatment of high - grade neural tumors. | we designed multimodal tumor vaccine that consists of irradiated tumor cells infected with the oncolytic il-12-expressing hsv-1 virus, m002. this vaccine was tested against the syngeneic neuroblastoma mouse model neuro 2a injected into the right caudate nucleus of the immunocompetent a / j mice. mice were vaccinated via intramuscular injection of multimodal vaccine or uninfected irradiated tumor cells at seven and 14 days after tumor establishment. while there was no survival difference between groups vaccinated with cell - based vaccine applied following tumor injection, a premunition prime / boost vaccination strategy produced a significant survival advantage in both groups and sustained immune response to an intracranial rechallenge of the same tumor. the syngeneic but unrelated h6 hepatocellular tumor cell line grew unrestricted in vaccinated mice, indicative of vaccine - mediated specific immunity to neuro 2a tumors. longitudinal analyses of tumor - infiltrating lymphocytes revealed a primary adaptive t cell response involving both cd4 + and cd8 + t cell subsets. spleen cell mononuclear preparations from vaccinated mice were significantly more cytotoxic to neuro 2a tumor cells than spleen cells from control mice as demonstrated in a four - hour in vitro cytotoxicity assay. these results strongly suggest that an irradiated whole cell tumor vaccine incorporating il-12-expressing m002 hsv can produce a durable, specific immunization in a murine model of intracranial tumor. |
hughes - stovin syndrome is an exceedingly rare disorder characterized by the combination of multiple pulmonary artery aneurysms and deep venous thrombosis ; the cause is unknown. we present a case of a middle - aged man in whom multiple pulmonary aneurysms were demonstrated by ct angiography and dsa. a 40-year - old man was evaluated for bilateral hilar opacities on radiographs by a contrast - enhanced ct of chest. the patient had significant history of bilateral femoral vein thrombosis two years back for which the patient was hospitalized ; the patient also had recurrent episodes of hemoptysis for last one and a half year for which he did not undergo any imaging and which was managed conservatively with antibiotics. the patient had also developed aphthous ulcers in the past year that lasted for two to three weeks. there was no evidence of genital ulcers, uveitis, or skin lesions either historically or on physical examination. cect chest revealed large saccular aneurysms involving the segmental branches of lower lobe arteries bilaterally and right upper lobe artery [figure 1 ]. the bronchial arteries were hypertrophied ; eccentric, organized thrombi were seen in few aneurysms [figure 2 ]. pulmonary angiography was performed through the jugular vein as transfemoral cannulation was not possible because of bilateral femoral vein thrombosis which confirmed the presence of multiple pulmonary artery aneurysms. the possibility of incomplete behcet was also considered as the patient did not fulfill the diagnostic criteria of the complete behcet 's syndrome. the patient was put on topical steroids (as mouth paint for oral ulcers), systemic steroids, and azathioprine (in view of pulmonary vasculitis and aneurysm formation) ; the steroids were subsequently tapered and withdrawn after 6 months (aspirin and anticoagulation were avoided in view of hemoptysis). more than one year of follow up has documented the resolution of oral ulcers without any fresh recurrence ; there has been no fresh episode of deep venous thrombosis. there was no evidence of enlargement of the pulmonary artery aneurysms on follow - up ct scans. contrast - enhanced ct chest shows bilateral pulmonary artery aneurysms arising from lower lobe arteries with organized eccentric thrombi in the wall mip images of ct angiography demonstrate the hypertrophic bronchial artery collaterals in the mediastinum hughes and stovin first described cases of deep vein thrombosis and multiple pulmonary artery aneurysms with mural thrombi. the typical clinical syndrome is characterized by a stage of thrombophlebites, followed by formation and enlargement of pulmonary aneurysm, and the final stage of aneurysmal rupture with massive hemoptysis and death. many investigators considered this entity as an incomplete form of behcet 's syndrome.[13 ] the pulmonary artery aneurysms develop at the sites of prior thrombosis ; weakening of the vessel wall due to inflammation is the likely mechanism. in our patient, eccentric organized thrombi were well visualized in few of the aneurysms on ct angiography. some authors have reported dilated bronchial arteries on dsa ; they believe that hemoptysis likely results from rupture of angiodysplastic bronchial arteries rather than due to rupture of pulmonary arteries. enlarged, hypertrophied bronchial vessels were clearly visualized in our case as well, which we believe was the cause of recurrent hemoptysis in this case. one author has described multiple bronchial artery aneurysms with a hepatic artery aneurysm in one patient. ct angiography not only allows visualization of vessel lumen (like pulmonary angiography), it also depicts the mural thrombus, vessel wall, and mediastinal structures including the hypertrophied bronchial circulation. the treatment of hughes - stovin syndrome is similar to behcet 's disease - steroids alone or in combination with immunosuppressants. our case emphasizes the overlap between the clinical and radiological features of behcet 's disease and hughes - stovin syndrome. | multiple pulmonary artery aneurysms are seen along with venous thrombosis in hughes - stovin syndrome, which many investigators believe is an incomplete form of behcet 's disease. we present a case of hemoptysis with multiple pulmonary artery aneurysms, femoral vein thrombosis, and oral ulcers with emphasis on its ct features. |
the incidence of cervical cancer has shown a continuous decrease in developed countries, including korea, however the worldwide burden of cervical cancer remains critical [1 - 4 ]. most cervical cancer survivors face several challenging issues after completion of their primary treatment ; in particular, second primary cancers have become a critical issue for cervical cancer survivors as treatment outcomes have improved. a second primary cancer may be related not only to a shared etiology but also to a late effect of treatment. treatments for cervical cancer have been continuously evolving, leading to improvements in radiotherapy and surgery in terms of instrumentation and minimally invasive surgical approaches. therefore, updated data on second primary cancers are needed to determine the order of priorities in health care policy and post - treatment surveillance programs. recent reports on second primary cancers after treatment of cervical cancer have focused on the increased risk of cancer. however, premature ovarian failure due to treatment of cervical cancer and the shared radiotherapy field has not been considered or adequately discussed, as this complication may result in a decreased incidence of hormone - dependent cancers and pelvic tumors within the radiotherapy field. poorer survival outcomes in women with a second primary cancer after the diagnosis and treatment of cervical cancer has been documented, although additional investigation regarding detailed survival outcomes according to the type of second primary cancer and survival outcomes from the onset of the second primary cancer is needed in order to obtain better clinical information for such patients. therefore, the objective of this study was to investigate the incidence and survival outcomes of second primary cancers after the diagnosis and treatment of cervical cancer in a recent study cohort. data from the korea central cancer registry from 1993 to 2010 identified 72,805 patients with cervical cancer ; patients within 2 months of their cervical cancer diagnosis were excluded. to avoid potential confusion, secondary cervical and vaginal cancer cases within 5 years of the diagnosis of primary cervical cancer standardized incidence ratios (sirs) and the corresponding 95% confidence intervals (95% cis) of second primary cancers among women with cervical cancer were analyzed to quantify the relative risk compared to women in the general population. these sirs were calculated by dividing the observed number of second cancers by the expected number if the patients in the cohort demonstrated cancer rates equivalent to those for individuals in the general population. the number of person - years at risk (pyrs) was defined from 2 months after the date of the cervical cancer diagnosis to the date of death or the end date of this study, whichever occurred first. for each initial cancer site grouping, the pyrs and observed cases of cancer were stratified according to 5-year age groups and calendar year. cancer incidence rates were computed for each subsite of cancer and according to age and calendar year, and multiplied by the accumulated pyrs to estimate the expected number of subsequent cancers for each stratum. kaplan - meier survival curves were calculated for cervical cancer patients with or without a second cancer. all of the statistical tests were two - sided, and the significance was set at an alpha level of 0.05. mp - sir setting of seerstat 8.1.2 was used for computation of the sirs and their 95% cis. a total of 72,805 women diagnosed with primary invasive cervical cancer were evaluated for a mean follow - up period of 7.34 years (table 1). the mean age at initial diagnosis with cervical cancer was 51.4 years, and the incidence of cervical cancer diagnosis peaked between the ages of 40 to 59 years (49.8%). of the 72,805 women with cervical cancer, 2,678 women (3.68%) developed a second primary cancer ; 0.16% of the women with cervical cancer developed a third or greater primary cancer (n=119). the mean interval from the initial cervical cancer diagnosis to the second cancer diagnosis was 6.3 years, and the mean age at diagnosis with the second primary cancer was 59.4 years. in women with second primary cancer, average age at diagnosis of cervical cancer was higher and follow - up period was longer with statistical significance (p < 0.05). as shown in table 2, the overall sir for a second primary cancer was 1.08 (95% ci, 1.04 to 1.12), and 1.15 (95% ci, 1.08 to 1.22) in women aged < 50 years and 1.14 (95% ci, 1.08 to 1.21) in women at < 60 months after diagnosis of the primary cervical cancer. the most frequent sites of second primary cancers that showed significantly higher sirs for all women were the vagina (9.36), bone and joints (2.70), vulva (2.58), anus (2.42), bladder (2.38), lung and bronchus (2.13), corpus uteri (1.91), and esophagus (1.86). the risk of a second primary cancer was classified according to age at diagnosis with cervical cancer and follow - up period. the risk of a second primary cancer in the bone and joints (3.87), esophagus (2.61), and soft tissue (2.19) increased significantly after a follow - up period 60 months. a leadtime effect was identified for the thyroid, which showed an increase before a follow - up period < 60 months (1.29) and a decrease after a follow - up period 60 months (0.88). the risk of a second primary cancer of the vagina (11.6), corpus uteri (3.00), bone and joints (2.76), anus (2.64), bladder (1.84), and lung and bronchus (1.79) increased significantly in women aged 50 years. in contrast, the incidence of a second primary cancer was significantly decreased for breast (0.82), rectum and rectosigmoid junction (0.74), liver (0.64), and brain and central nervous system (0.54) cancers. diverse patterns of reduction in these second primary cancers were observed depending on the type of cancer. the reduction in breast cancer as a second primary cancer was consistent irrespective of the follow - up period, but only for women aged < 50 years. specifically, sir decreased significantly for women aged 40 - 49 years (0.77) but did not reach statistical significance for women aged 50 - 59 years (0.82) and 60 - 69 years (0.85). for rectal cancers and rectosigmoid junction cancers (rscs), the reduction in incidence was significant only for a follow - up period < 60 months in women aged 50 years. the risk of liver cancer as the second primary tumor was decreased for follow - up periods 60 months and in women aged 50 years. last, a significant reduction in the incidence of a second primary cancer in the brain and central nervous system was observed in women aged 50 years. the 5-year and 10-year overall survival rates from the onset of cervical cancer (fig. 1a) were 78.3% and 72.7% in all women with cervical cancer, respectively. among all women, significantly higher survival was observed in patients aged < 50 years (p < 0.001) ; the 5-year and 10-year overall survival rates were 86.8% and 84.4% for women aged < 50 years and 78.3% and 61.2% for women aged 50 years, respectively. for women with a second primary cancer, the 5-year and 10-year overall survival rates (fig. significantly higher survival was observed in patients aged < 50 years (p < 0.001), and the 5-year and 10-year overall survival rates were 88.6% and 76.8% for women aged < 50 years and 83.2% and 57.8% for women aged a higher 5-year overall survival rate was observed in patients with a second primary cancer, but the 10-year overall survival rate was lower in patients with a second primary cancer (p < 0.001). the 10-year survival rate sharply declined after diagnosis with cervical cancer in the second primary cancer group compared to the no second primary cancer group. the overall survival rates were 86.3% and 95.0% at 2 years, 78.1% and 83.2% at 5 years, and 73.1% and 65.5% at 10 years in the no second primary cancer group and the second primary cancer group, respectively (fig. 2). the 5-year and 10-year overall survival rates from the onset of the second primary cancer (fig. 3a) were 54.9% and 46.7% in patients with a second primary cancer, respectively. significantly higher survival was observed in women < 50 years (p < 0.001), and the 5-year and 10-year overall survival rates were 71.7% and 67.5% for women aged < 50 years and 54.9% and 39.1% for women aged 50 years, respectively. specifically, the 5-year and 10-year overall survival rates from the onset of the second primary cancer (fig. 3b) were as follows : 83.8% and 75.4% for the breast, 56.1% and 53.6% for the rectum, 21% and 21% for the liver, 23.2% and 18.4% for the lung and bronchus, 46.9% and 36.9% for the bladder, and 37.0% and 21.4% for the corpus uteri, respectively. in the current study, the incidence of a second primary cancer after diagnosis and treatment of cervical cancer was increased compared to the general population (sir, 1.08), which is consistent with several previous reports [6,8 - 15 ]. further studies and strategies on the second primary cancer after cervical cancer should be considered in terms of shared etiology with cervical cancer or as a late effect of treatment for cervical cancer. well - known contributing factors for cervical cancer include the human papillomavirus (hpv) and smoking. in the current study, hpv - related cancers, including those of the vagina, vulva, or anus, and smoking - related cancers, such as cancers of the lung and bronchus, bladder, or esophagus cancer were increased. this finding was consistent with previous study results and has been well investigated [6,8 - 15 ]. radiotherapy increased the risk of middle- and lower - portion stomach cancer (odds ratio, 4.20) after a dose 5 gy for cervical cancer, according to a study performed in five western countries. with any radiotherapy for cervical cancer, the risk of stomach cancer increases (sir, 1.31) according to a collaborative study between europe and the united states. however, in the current study, the overall risk of stomach cancer after treatment for cervical cancer was not different from the risk in healthy korean women. this finding may be explained by racial differences and the significantly higher incidence of stomach cancer in korea (fifth ranked cancer ; estimated new cases in 2013, 10,623 ; and age - standardized cancer incidence, 42.1/100,000) compared to the united states (the estimated number of new cases in women in 2013 was 8,370), especially considering that korea has 1/6 the population of the united staes. in the current study, four cancers showed decreased incidence after the diagnosis and treatment of cervical cancer, including breast, rectum, liver, and brain cancers. first, the incidence of breast cancer was significantly decreased after the diagnosis and treatment of cervical cancer (sir, 0.82 ; 95% ci, 0.73 to 0.92). in the case of surgical treatment for cervical cancer, oophorectomy may be incorporated with radical hysterectomy, and ovarian function has been shown to fail early after hysterectomy, even with ovarian preservation. in the case of radiotherapy for locally advanced cervical cancer, the ovaries are ablated because they share the radiotherapy field with the pelvic lymph nodes. after primary treatment for cervical cancer, irrespective of the treatment type, ovarian function deteriorates. therefore, the observed decrease in the incidence of breast cancer as a second primary cancer can likely be explained by decreased ovarian cancer related to cervical cancer treatment. in particular, this reduction was limited to premenopausal women (aged < 50 years) considering the median age of menopause in korean women but was independent of the follow - up period. deteriorated ovarian function with cervical cancer treatment results in a trend of decreasing breast cancer but this does not reach statistical significance. the second type of second primary cancer found to show a decreased incidence was rectal cancer and rsc. rsc decreased significantly until 5 years after the diagnosis and treatment of the initial cervical cancer (sir, 0.66 ; 95% ci, 0.48 to 0.89), whereas at 5 years after the diagnosis and treatment of cervical cancer, the preventive effect for rsc was no longer identified (sir, 0.80 ; 95% ci, 0.63 to 1.01). this finding may be explained by the shared radiotherapy field that may cause ablation of microscopic or early rectal cancer. in contrast, the risk of rectal cancer showed a significant increase (sir, 1.90) after radiotherapy for cervical cancer in women from europe and the united states. first, the follow - up period after the diagnosis of cervical cancer was not considered in that study, and the sir might vary during different periods. second, treatment outcomes after radiotherapy for rsc greatly differ according to racial and ethnic disparities among whites, hispanics, and asians. third, existence of racial disparities in terms of survival outcomes for cervical cancer have been suggested, according to the surveillance, epidemiology, and end results (seer) program data in the united states. therefore, these differences may affect the pattern of second primary cancers in cancer survivors because a second primary cancer can only be identified in cancer survivors. the third cancer found to have a decreased incidence was liver cancer (sir, 0.64 ; 95% ci, 0.51 to 0.80), and this decreasing effect was observed 60 months after diagnosis with cervical cancer. it is difficult to intuitively explain the decreased incidence of liver cancer after the diagnosis and treatment of cervical cancer considering the nature of the treatment for cervical cancer and the etiology of liver cancer. considering the etiology of liver cancer, a certain percentage of liver cancers may be avoided and prevented with the modification of health behaviors, and cancer survivors generally adopt good health behaviors. therefore, the decreased incidence of liver cancer, especially 60 months after the diagnosis of cervical cancer, could be explained by the improved health behaviors in survivors after the diagnosis and treatment of cervical cancer. the fourth type of second primary cancer that showed a decreased incidence was cancer of the brain and central nervous system (sir, 0.54 ; 95% ci, 0.28 to 0.94). the entire expected and observed incidence was less than 25, with an sir of 0.54 (12/22.28). considering that a significant portion of brain tumors are diagnosed based on imaging studies only, some portion of brain tumors might be classified as brain metastasis in women with a history of cervical cancer. poor survival outcomes for second primary cancers have been well investigated, and the current study sought to investigate these survival outcomes from a new perspective. first, we found that the survival outcome was poorer among cervical cancer patients with a second primary cancer compared to cervical cancer patients without a second primary cancer, but only after 10 years or more since the diagnosis of cervical cancer. this delay may be explained by the fact that women with early mortality due to cervical cancer do not have a chance to develop a second primary tumor. second, our study was the first to analyze survival outcomes after the diagnosis of second primary cancer, and detailed survival outcomes after the diagnosis of a second primary cancer were described according to the type of second primary cancer. this information will likely be helpful for discussions with patients about survival outcomes and surveillance. the main weakness of the current study was the limited information on the type of cervical cancer treatment and staging information, which were similar to the disadvantages reported in previous studies [6,8 - 15 ]. another limitation is surveillance bias, which is caused by an effort to detect second cancers in patients with primary cancer. that is, survival (78.3%) and follow - up (7.28 years) of patients initially diagnosed with one primary cancer would be considerably shorter because they could have a more distant stage than patients diagnosed with second primary cancers (survival, 83.2% ; follow - up, 9.07 years). the incidence of a second primary cancer increased after the diagnosis and treatment of cervical cancer, with an sir of 1.08 (95% ci, 1.04 to 1.12). among 72,805 women with cervical cancer, 2,678 (3.68%) developed a second primary cancer. hpv-, smoking-, and treatment - related cancers were frequently identified in the vagina, bone and joints, vulva, anus, bladder, lung and bronchus, corpus uteri, and esophagus. in contrast, the incidence rates of four types of second primary cancers (breast, rectum and rectosigmoid junction, liver, and brain and central nervous system) were significantly decreased. these results suggest the need for conduct of further studies and continued cancer surveillance among cervical cancer survivors. for women with cervical cancer, | purposethis study was conducted to investigate the incidence and survival outcomes of second primary cancers after the diagnosis of cervical cancer.materials and methodsdata from the korea central cancer registry between 1993 and 2010 were reviewed and analyzed. standardized incidence ratios (sirs) of second primary cancers among women with cervical cancer were analyzed. kaplan - meier survival curves were constructed for cervical cancer patients with or without a second primary cancer.resultsamong 72,805 women with cervical cancer, 2,678 (3.68%) developed a second primary cancer within a mean follow - up period of 7.34 years. the overall sir for a second cancer was 1.08 (95% confidence interval, 1.04 to 1.12). the most frequent sites of second primary cancers were the vagina, bone and joints, vulva, anus, bladder, lung and bronchus, corpus uteri, and esophagus. however, the incidence rates of four second primary cancers (breast, rectum, liver, and brain) were decreased. the 5-year and 10-year overall survival rates were 78.3% and 72.7% in all women with cervical cancer, and for women with a second primary cancer, these rates were 83.2% and 65.5% from the onset of cervical cancer and 54.9% and 46.7% from the onset of the second primary cancer, respectively.conclusionthe incidence rates of second primary cancers were increased in women with cervical cancer compared to the general population, with the exception of four decreasing cancers. the 10-year overall survival rates were decreased in cervical cancer patients with a second primary cancer. |
it is produced in the central auditory pathway.[15 ] this symptom is a common phenomenon disturbing millions of individuals worldwide. study of tinnitus has resulted in a number of hypothetical mechanisms and suspected origins in the auditory pathways. most hypotheses postulate that the generation of tinnitus is related to cochlear or acoustic nerve disorders, or central auditory cortices dysfunction and their interactions.[39 ] surgical destruction of the cochlea or the cochlear nerve has been ineffective ; therefore, tinnitus is described as an auditory phantom perception. the perception of tinnitus sensation is thought to trace back to the central mechanism in most cases. it has been speculated that the tinnitus may be a consequence of maladaptive cortical reorganization after an injury in the periphery, analogous to the pathophysiologic model of chronic pain. numerous investigations showed that tinnitus is associated with an increased activity in central auditory system as demonstrated by electrophysiology and neuroimaging studies and with vascular pathogenic changes detected by ultrasonography. single photon emission computed tomography (spect) scanning of the brain reflects regional cerebral blood perfusion. brain blood perfusion scanning has a role in diagnosis, therapeutic management, and follow - up of patients and in researches. spect scanning of the brain with the radioisotope technetium 99 m (tc-99 m) is a nuclear imaging technique providing an objective analytical detection of regional cerebral blood perfusion of the brain. spect was introduced into the medical audiologic tinnitus patient diagnostic protocol (matpp) firstly, as an investigative tool to objectify tinnitus. spect imaging of brain in patients with disabling tinnitus has revealed responsible loci by indicating perfusion asymmetries in cortical areas. in some studies, adjacent perfusion asymmetries involving the frontal, temporal and parietal lobes have suggested an inter - neural network resulting in the transition of the sense to the affected components of tinnitus. there are few studies with low sample size, which have evaluated the brain blood perfusion findings using spect scanning of tinnitus patients and information about the blood flow in the brain, and diagnostic accuracy of this technique in tinnitus patients is extremely scarce. brain perfusion scanning using spect was done to understand the pattern of brain blood perfusion of tinnitus subjects and find the areas which are mostly abnormal in these patients. from january 2006 to may 2008, 122 patients with subjective idiopathic tinnitus and 9 healthy controls were enrolled to this cross sectional study. the subjects were selected from patients who were referred to ent and head and neck research center of rasoul - e - akram hospital (tehran, iran) to evaluate and treat their tinnitus. the inclusion criteria were moderate to severe unilateral or bilateral tinnitus (tinnitus questionnaire score of 44 or more) which permanently lasted for more than 3 months. all subjects had to be healthy, had no ear, mental, and brain disorders and history of invasive therapeutic brain procedures and brain trauma. the pregnant and breastfeeding women and those who had decision to be pregnant, the subjects with history of tinnitus treatment in the last 3 months and alcohol / drug abuse in the last 6 months were not included into the study. all subjects gave written informed consent according to the declaration of helsinki, national committee of ethics in medical research (technology and research deputy of health ministry) and the committee on ethics at the ent and head and neck research center of tehran university of medical sciences, radiation safety and radioactive drug research committee prior to participating in the study. pitch and loudness matching of tinnitus were identified for the affected ear to an external tone presented to the contralateral ear. this task was accomplished using tinnitus evaluation device (tined), which includes 6 channels to reconstruct the most troublesome tinnitus with a similar frequency and intensity. an accuracy of the calibrating equipment shall be sufficient to determine that, the tined is within the tolerances permitted by american standard specification for audiometers, s3.6 - 2004. the subjects had to have loudness matching of tinnitus more than 6-decibel sensation level (db sl) to be included in this study. using tinnitus questionnaire (tq), the severity of tinnitus in subjects was rated to 6 scales. subjects with tq score of 44 or more were considered to have moderate to severe tinnitus. the patients were placed in a quiet, dimly lit room and instructed to keep the eyes open (or use a mask) and the ears unplugged. they were also instructed not to speak, read, or move during 5 min prior to and 5 min post injection. they were asked to think about their tinnitus during the test. a commercial ethyl cysteinate dimer (ecd) each subject received a 15 mci intravenous injection of tracer while they were still lying down. one hour after intravenous injection of 15 mci 99mtc - ecd, spect scanning was acquired (120 projections ; 40 projections per head ; 25 sec / projection). scanning was performed using a dual head smv gamma camera, equipped with a pair of low energy, high resolution collimators. planar and processed spect images were visually assessed by a nuclear medicine physician twice, who was blinded to all other clinical and imaging information. the images were visually graded as normal for no appreciable abnormal activity and abnormal for hyper activity. semi - quantitative evaluation of planar images over the lesion and background areas on the anterior, was also performed by drawing regions of interest (roi) posterior or contralateral hemisphere images without any lesion. geometric means of the contraleteral, posterior and anterior roi values were used for the calculation of lesion - to - background ratio. transverse views with the best visualization of the lesions were selected for roi drawing on the spect images. all activity ratios were classified to determine an intensity of activity as : 1 > normal, 1 1, those were classified as abnormal sites or lesions. the images were stored in dicom format, to be applied in brain anatomical functional images co - registration software (brain afics). spect is inherently a perfusion modality ; therefore, it is sometimes difficult to exactly define the anatomical area with disturbed function. therefore, it is helpful to correlate the relatively coarse spect images to high - resolution anatomic mr images. brain anatomical functional images co - registration software (brainafics), a software system designed in ent and head and neck research center of tums, is capable of registering and fusing unsynchronized positron emission tomography (pet) and spect images with mr images with different dimensions in a subject [figure 1 ]. activity ratio was calculated as follow ; for unilaterally involved subjects ; after localized abnormal area visually, rois were drawn and the count per voxel were compared with the rois in the other side or beside. in bilaterally involved subjects ; count per voxel of the abnormal areas were compared with similar rois on cerebellum (as reference) after fusion, cerebral zones were categorized in 8 regions ; middle temporal, inferotemporal, medial temporal, superior temporal, temporoparietal, frontal, frontoparietal and parietal. after final fusion of images, each image was evaluated and reported by an expert twice. almost all images were reported similarly in both times, but if the assessment was not similar, images were interpreted for third time and the repeated report was considered as main result. the kendalls tau - b correlation confirmed validation of reports (p value normal, 1 1, those were classified as abnormal sites or lesions. the images were stored in dicom format, to be applied in brain anatomical functional images co - registration software (brain afics). spect is inherently a perfusion modality ; therefore, it is sometimes difficult to exactly define the anatomical area with disturbed function. therefore, it is helpful to correlate the relatively coarse spect images to high - resolution anatomic mr images. brain anatomical functional images co - registration software (brainafics), a software system designed in ent and head and neck research center of tums, is capable of registering and fusing unsynchronized positron emission tomography (pet) and spect images with mr images with different dimensions in a subject [figure 1 ]. activity ratio was calculated as follow ; for unilaterally involved subjects ; after localized abnormal area visually, rois were drawn and the count per voxel were compared with the rois in the other side or beside. in bilaterally involved subjects ; count per voxel of the abnormal areas were compared with similar rois on cerebellum (as reference) after fusion, cerebral zones were categorized in 8 regions ; middle temporal, inferotemporal, medial temporal, superior temporal, temporoparietal, frontal, frontoparietal and parietal. after final fusion of images, each image was evaluated and reported by an expert twice. almost all images were reported similarly in both times, but if the assessment was not similar, images were interpreted for third time and the repeated report was considered as main result. the kendalls tau - b correlation confirmed validation of reports (p value 0.05). patients with unifocal and multifocal brain abnormalities did not show different tinnitus severity (p value > 0.05). the subjects with multifocal brain involvement had the lowest mean age than the patients with unifocal or no abnormal area. (45.62 13.98 years vs. 52.75 12.83 years vs. 52.22 9.11 years for multifocal, unifocal and no lesion, respectively ; p value = 0.045). in controls, 3 persons (33.3%) had multifocal abnormalities, and more than one abnormality was seen in 1 hemisphere of 2 (22%) persons. the most common abnormal areas were middle temporal gyrus (30.3% in the right and 37.7% in the left hemispheres) and temporoparietal cortex (24.6% in the right and 13.1% in the left hemispheres) [table 2 ]. from all evaluated tinnitus subjects, 19 (15.6%) had left sided brain perfusion abnormality, 17 (13.9%) had right sided brain perfusion abnormality, and 65 (53.3%) had brain perfusion abnormalities in both hemispheres. statistically significant relation was found between the side of the brain perfusion abnormalities and the side of the tinnitus (p value = 0.027) [table 3 ]. the patients with right hemisphere lesion in spect scanning had the most severe sensation of tinnitus, while the least severity was seen in the patients with left hemisphere involvement (right sided brain abnormality : 12.8 6.1 db sl vs. left sided brain abnormality : 5.8 2.2 db sl vs. bilateral brain abnormality : 7.3 2.7 db sl vs. no brain perfusion abnormality : 7.2 3.03 db sl, p value = 0.006 using anova). site of abnormalities in brain spect scanning results of brain spect scanning in patients with different side of tinnitus. generating peripherally or centrally, tinnitus is believed to be associated with activity in specific cortical regions as shown by pet and spect and functional mri and with vascularity changes. unilaterally increased metabolic activity in the secondary auditory cortex represents a robust finding in tinnitus patients. there is controversy in different studies whether more abnormal side is the left or the right hemisphere. some studies have reported the right hemisphere, but others found the left hemisphere more involved in imaging studies, no investigation has shown bilateral brain involvement in the tinnitus patients. all studies declare that there is no association between the side of tinnitus and dominant side of brain perfusion / function abnormality. in the present study, bilateral brain abnormalities detected by spect scanning were seen in most tinnitus patients, and in contrast to the previous studies, it was associated to the side of tinnitus. right hemisphere was more abnormal in patients with sensation of tinnitus in the right ear, and the patients with left ear tinnitus had more lesions in the left hemisphere, and in patients with bilateral tinnitus, bilateral brain involvement in spect scanning was the most finding. superior and transverse temporal gyrus, middle frontal gyrus, middle temporal gyrus, lateral and medial posterior sites, temporofrontal, paralimbic, anterior middle temporal gyrus and hippocampus are represented as the most common involved areas in different studies. but, based on the results of the present study, the most common involved area was middle temporal (brodmann area 21) which is a secondary auditory cortex, and temporoparietal cortex (brodmann area 22) was the second most common involved part in the brain that is an associative cortex. patients with more severe tinnitus had right hemisphere perfusion abnormality more frequently than the left hemisphere. considering association between tinnitus severity with side of brain abnormalities, it could be concluded that the tinnitus severity may be an important predictor of brain abnormality side with unknown mechanisms, or the pathologic brain perfusion in the right hemisphere cause more severe tinnitus, and vice versa. patients age seems to play an important role in the brain perfusion abnormality, and older patients should be expected to have unifocal abnormality more while younger patients have multifocal brain perfusion abnormalities. relationship between number of brain lesions with age may be due to the negative feedback at the result of more stress in young person about tinnitus as a life threatening condition that leads to more brain involvement and multifocal abnormality. another hypothesis is more plasticity in cortical neurons of young patients that lead to involvement of more areas in younger patients. as other hypothesis, this could be the atrophic effect of tinnitus that results in brain atrophy in older patients with longer duration of tinnitus and actually leads to less brain hyperperfused foci. finally, auditory processing is shifted from the phylogenetically non - classical system, towards the phylogenetically classical auditory system that performs the finer analysis of sounds. the efficiency of synapses that connect auditory input to the non - classical pathways decreases during ontogeny and these synapses become ineffective at the time of adulthood. in the study performed by farhadi m.., 5 mci f18-fdg (fluorodeoxyglucose) was used for metabolic function assessment of 55 tinnitus patients. similar to the present study, the most involved brain regions were reported there to be secondary auditory cortex and associative cortex ; middle temporal gyrus (brodmann area 21) and temporoparietal cortex (brodmann area 22), respectively. in that study, the brain metabolic function was evaluated using radiotracer f18-fdg, while herein, we evaluated the brain perfusion of the subjects using technetium-99 m. brain perfusion in each area may be compatible with function of that area, but these may be differently patterned in tinnitus patients and results in different findings as could be seen herein, in contrast to the findings of the present study, there was no significant association between the side of tinnitus and side of brain metabolic function abnormalities, and between age and metabolic lesions numbers, and also between the tinnitus severity and brain lesion side in the that study. it has to be considered that, these differences may be due to smaller sample size in the mentioned study. although it caused interpretation of tinnitus origin and mechanism unbiased, not considering hearing loss made us unable to categorize the findings on the basis of tinnitus type. intermittent or constant, evoking and inhibiting with and without some sensory - motor pathways may have some association with brain findings but were not involved in the interpretation of the results. although it caused interpretation of tinnitus origin and mechanism unbiased, not considering hearing loss made us unable to categorize the findings on the basis of tinnitus type. intermittent or constant, evoking and inhibiting with and without some sensory - motor pathways may have some association with brain findings but were not involved in the interpretation of the results. abnormalities of the cerebral blood flow are seen in the patients who complain of tinnitus. the most common abnormal foci are middle temporal gyrus (brodmann area 21) and temporoparietal cortex (brodmann area 22), that means the secondary auditory cortex and associative cortex are mostly associated with tinnitus, and the pathophysiology of tinnitus could be there. higher number of abnormal foci in younger patients could be explained with more cognitive and emotional brain centers involvement due to tinnitus or stress, and anxiety of tinnitus in the young patients or atrophic effect of tinnitus or developing process by aging. | background and purpose : tinnitus is associated with an increased activity in central auditory system as demonstrated by neuroimaging studies. brain perfusion scanning using single photon emission computed tomography (spect) was done to understand the pattern of brain blood perfusion of tinnitus subjects and find the areas which are mostly abnormal in these patients.materials and methods : a number of 122 patients with tinnitus were enrolled to this cross - sectional study. they underwent spect and magnetic resonance imaging (mri) of brain, and the images were fused to find the regions with abnormal perfusion.results:spect scan results were abnormal in 101 patients (83%). most patients had bilateral abnormal perfusion (n = 65, 53.3%), and most subjects had abnormality in middle - temporal gyrus (n = 83, 68%) and temporoparietal cortex (n = 46, 37.7%). patients with multifocal involvement had the least mean age than other 2 groups (patients with no abnormality and unifocal abnormality) (p value = 0.045).conclusions : brain blood perfusion pattern differs in patient with tinnitus than others. these patients have brain perfusion abnormality, mostly in auditory gyrus (middle temporal) and associative cortex (temporoparietal cortex). multifocal abnormalities might be due to more cognitive and emotional brain centers involvement due to tinnitus or more stress and anxiety of tinnitus in the young patients. |
terminal restriction fragment length polymorphism (t - rflp) analysis is a microbial fingerprinting technique capable of discriminating microbial communities quickly and relatively inexpensively (13). t - rflp is increasingly used in high - throughput studies of microbial communities in combination with or even in lieu of clone library analysis (4,5). briefly, the method involves pcr amplification of a gene of interest (often 16s rrna genes) with fluorescent dye - labeled primers, followed by multiple single restriction digests done in parallel. the resulting fragments are then separated by capillary electrophoresis with an internal size standard to determine the lengths of the terminal (fluorescently labeled) fragments. each distinct terminal restriction fragment is considered an operational taxonomic unit (otu), thus the choice of restriction enzymes can impact the number of otus observed in each sample and the calculation of diversity statistics. when analyzing uncharacterized and very diverse bacterial communities, sufficient community discrimination can often be accomplished with multiple randomly - chosen tetrameric restriction enzymes (6). however, a brief review of the literature indicates that there is still no standard in even this simplified case. we examined 26 papers (15,726) that were published between 1997 and 2007 and used t - rflp. of those papers, 38% used universal bacterial primers combined with a single restriction enzyme, but the choice of enzyme was not consistent. mspi was used most frequently (four studies), followed by taqi (two studies), and one study each used alui, cfoi, hhai and haeiii. overall, only three of the 26 papers included a rationalization of enzyme selection (1,2,17). an alternate approach to t - rflp can be taken if the microbial community has been characterized (by clone library analysis or by prediction from previous studies) or if a particular taxonomic group is being targeted with specific primers. in this case, a more reasoned choice of restriction enzymes can be conducted. in particular, specific species or microbial taxa of interest to the researcher particularly closely related taxa that may share some restriction sites over 600 type ii restriction enzymes are commercially available, accounting for 262 distinct specificities (27). existing computer programs for assisting in the choice of restriction enzymes include tap - trflp (28), mica enzyme resolving power analysis (http://mica.ibest.uidaho.edu) and trf - cut (29). these programs perform in silico restriction digestions of a predefined sequence database or user - provided sequences, but these results must still be manually examined to determine which enzymes are best suited to discriminate that set of sequences. cleaver (30), a stand alone program, provides the above features as well as the ability to assign sequences to taxonomic groups at multiple levels and to search for enzymes that cut one group but not another group. restriction endonuclease picker (repk) addresses this gap by finding enzymes that are able to discriminate an unlimited number of user - designated sequence groups on the basis of their terminal restriction fragment lengths. if no single enzyme can discriminate all groups, repk reports sets of four restriction enzymes that together are able to differentiate the groups of interest. an important component of repk is this ability to specify the taxonomic rank of sequences to be differentiated, which is particularly useful in the case where a diverse microbial community has been characterized by clone library analysis or there is an existing database of several subgroups of sequences that amplify with the same specific primers. a complete manual and example input files are provided on the repk website (http://rocaplab.ocean.washington.edu/tools/repk). the example shown in figure 1 was prepared using repk v. 1.0, with the following operating parameters (also the defaults) : example sequence file (alignment5.txt), all commercially available type iip enzymes (rebase version 704), taxonomic rank = 1, cut - off = 5, min. fragment length = 75, max. fragment length = 900, stringency = automatic, max. missing groups = 0, max. figure 1.schematic summarizing the processing steps performed by repk using program options detailed in the text, as well as subsets of example input and output files. schematic summarizing the processing steps performed by repk using program options detailed in the text, as well as subsets of example input and output files. the user must provide a trimmed fasta - formatted file with nucleotide sequences beginning at the 5-end of the labeled primer used for pcr amplification and ending at the 5-end of the unlabeled primer. sequence groups can be designated in the description line of the fasta file, by using a delimiter to separate taxonomic rank terms or optionally taxonomic identifications can be prepended to the description line using an output file from rdp - classifier (31). figure 1a shows a subset of the example sequence file provided on the website, alignment5.txt. sequence groups are separated by a single underscore, and in this example taxonomic rank 1 was chosen, corresponding to the genus of these archaea. a selectable list of commercially available enzymes from the latest rebase database (27) is available and is automatically updated on the first day of each month. the enzymes available for selection include primarily type iip enzymes, which have symmetric recognition sequences and cleavage sites. restriction enzymes of type iia (having asymmetric recognition sequences) and type iib (cleaving both sides of the recognition sequence on both strands) are at the present time not supported by repk, although some are included in a separate enzyme file for advanced users willing to perform some manual processing. users should be aware that some enzymes in the rebase database may not be suitable for t - rflp due to methylation specificities or requirements for multiple restriction sites to be present for effective digestion. finally, users can define their own custom enzymes if they are not included in the standard list. the default (all standard enzymes) was used for the example in figure 1. for computational efficiency isoschizomers some of these, the minimum and maximum allowable fragment lengths and the maximum difference in size between two fragments that will still be considered the same fragment, will be dependent on the specifications and resolving power of particular capillary electrophoresis systems. users can also set the minimum threshold for the number of groups each enzyme must be able to discriminate on its own (the enzyme stringency), and the number of groups allowed to remain undifferentiated in the case that no perfect enzyme groups are discovered. sequences are first digested in both orientations by all selected enzymes to find the shortest labeled restriction fragment ; these lengths are output as a table (and a downloadable tab - delimited text file, fragfile.csv), a subset of which is shown in figure 1b. in this example, the sequences were cut by every enzyme except aasi, which resulted in full - length fragments. next, all terminal fragment lengths are binned within the chosen cut - off (here 5 bp) and a binary matrix of pairwise group differentiations is created. bins containing a single sequence group yield a 1, while bins containing more than one sequence group yield a, banii failed to distinguish between sequence groups sulfurisphaera and thermofilum because the difference between their fragment lengths (1 bp) was less than the chosen cutoff of 5 bp (figure 1b). however, asplei did distinguish between those groups because the difference in fragment lengths was 188 bp. it is not necessary for sequences from the same sequence group to have similar fragment lengths (e.g. sulfolobus). fragment lengths outside the boundaries set by the minimum and maximum fragment length options are binned together without regard for their actual lengths, decreasing the number of sequence groups discriminated by those enzymes (e.g. bmii). the enzyme stringency filter is then applied to this matrix, allowing only enzymes that discriminate at least the specified fraction of sequence groups to proceed. the passing enzymes are output as a table (and a downloadable tab - delimited text file, enzmatrix.csv), a subset of which is shown in figure 1c. for computational efficiency, the enzymes are then sorted into enzyme bins that produce identical differentiation patterns, although they may not produce the same terminal fragment lengths. in this example, neoschizomers asplei and glai produce different fragment lengths but the same differentiation pattern so they were grouped together for the final analysis. it is important to note that the enzyme bins are dependent on the particular sequence file and taxonomic rank selected for the analysis. that is, two enzymes may have equal discriminatory power for a particular set of sequence groups but for a different set of sequences, one enzyme may be much better and the two enzymes would be placed in the same bin in the first but not the second case. finally, groups of four enzymes (a set) are logically summed (e.g. 101 + 011 = 111) to determine the coverage of the set, i.e. the number of sequence groups discriminated by the enzymes in the set. if this number is greater than the total number of sequence groups (less than the max. missing groups, here 0) then the set is saved. a score is calculated for each saved set and all saved sets are sorted before the highest - scoring sets are output to a text file, finalout.txt, a subset of which is shown in figure 1d. if more than 10 000 sets are found and the enzyme stringency is set to automatic, it is incremented by 10% (decreasing the number of passing enzymes and thus enzyme sets) and the analysis is repeated. the final output reports and summarizes those enzyme sets that best discriminated the sequence groups. the final output consists of three parts : successful enzyme sets, enzyme picker key, and quick overview. the successful enzyme sets (figure 1d.1) consist of a list of enzyme groups in each set, and a score indicating the frequency with which each set discriminated the sequence groups. a perfect enzyme (one that discriminates 100% of the sequence groups) contributes a score of 1, so four perfect enzymes would produce the maximum score of 4. the enzyme picker key (figure 1d.2) lists the members of each enzyme group, with neoschizomers separated by brackets. each member of an enzyme group produces the same sequence group differentiation pattern but may differ in recognition site, terminal fragment lengths, etc. the quick overview (figure 1d.3) after submission the program generally takes less than 1 min to complete, depending most heavily on the number of sequence groups, the number of enzymes selected and the server load, respectively. the final choice of restriction enzymes is left to the researcher, and is likely to be based on practical factors such as cost, availability, reaction conditions, methylation sensitivity or requirements, star activity and other specifics that are detailed at rebase. an online manual detailing usage and options, bug tracking and the source code (open and accessible under the gnu public license v.2) are available at http://code.google.com/p/repk. the user must provide a trimmed fasta - formatted file with nucleotide sequences beginning at the 5-end of the labeled primer used for pcr amplification and ending at the 5-end of the unlabeled primer. sequence groups can be designated in the description line of the fasta file, by using a delimiter to separate taxonomic rank terms or optionally taxonomic identifications can be prepended to the description line using an output file from rdp - classifier (31). figure 1a shows a subset of the example sequence file provided on the website, alignment5.txt. sequence groups are separated by a single underscore, and in this example taxonomic rank 1 was chosen, corresponding to the genus of these archaea. a selectable list of commercially available enzymes from the latest rebase database (27) is available and is automatically updated on the first day of each month. the enzymes available for selection include primarily type iip enzymes, which have symmetric recognition sequences and cleavage sites. restriction enzymes of type iia (having asymmetric recognition sequences) and type iib (cleaving both sides of the recognition sequence on both strands) are at the present time not supported by repk, although some are included in a separate enzyme file for advanced users willing to perform some manual processing. users should be aware that some enzymes in the rebase database may not be suitable for t - rflp due to methylation specificities or requirements for multiple restriction sites to be present for effective digestion. finally, users can define their own custom enzymes if they are not included in the standard list. the default (all standard enzymes) was used for the example in figure 1. for computational efficiency isoschizomers some of these, the minimum and maximum allowable fragment lengths and the maximum difference in size between two fragments that will still be considered the same fragment, will be dependent on the specifications and resolving power of particular capillary electrophoresis systems. users can also set the minimum threshold for the number of groups each enzyme must be able to discriminate on its own (the enzyme stringency), and the number of groups allowed to remain undifferentiated in the case that no perfect enzyme groups are discovered. sequences are first digested in both orientations by all selected enzymes to find the shortest labeled restriction fragment ; these lengths are output as a table (and a downloadable tab - delimited text file, fragfile.csv), a subset of which is shown in figure 1b. in this example, the sequences were cut by every enzyme except aasi, which resulted in full - length fragments. next, all terminal fragment lengths are binned within the chosen cut - off (here 5 bp) and a binary matrix of pairwise group differentiations is created. bins containing a single sequence group yield a 1, while bins containing more than one sequence group yield a 0, indicating no differentiation between those groups. in the example in figure 1, banii failed to distinguish between sequence groups sulfurisphaera and thermofilum because the difference between their fragment lengths (1 bp) was less than the chosen cutoff of 5 bp (figure 1b). however, asplei did distinguish between those groups because the difference in fragment lengths was 188 bp. it is not necessary for sequences from the same sequence group to have similar fragment lengths (e.g. sulfolobus). fragment lengths outside the boundaries set by the minimum and maximum fragment length options are binned together without regard for their actual lengths, decreasing the number of sequence groups discriminated by those enzymes (e.g. bmii). the enzyme stringency filter is then applied to this matrix, allowing only enzymes that discriminate at least the specified fraction of sequence groups to proceed. the passing enzymes are output as a table (and a downloadable tab - delimited text file, enzmatrix.csv), a subset of which is shown in figure 1c. for computational efficiency, the enzymes are then sorted into enzyme bins that produce identical differentiation patterns, although they may not produce the same terminal fragment lengths. in this example, neoschizomers asplei and glai produce different fragment lengths but the same differentiation pattern so they were grouped together for the final analysis. it is important to note that the enzyme bins are dependent on the particular sequence file and taxonomic rank selected for the analysis. that is, two enzymes may have equal discriminatory power for a particular set of sequence groups but for a different set of sequences, one enzyme may be much better and the two enzymes would be placed in the same bin in the first but not the second case. finally, groups of four enzymes (a set) are logically summed (e.g. 101 + 011 = 111) to determine the coverage of the set, i.e. the number of sequence groups discriminated by the enzymes in the set. if this number is greater than the total number of sequence groups (less than the max. missing groups, here 0) then the set is saved. a score is calculated for each saved set and all saved sets are sorted before the highest - scoring sets are output to a text file, finalout.txt, a subset of which is shown in figure 1d. if more than 10 000 sets are found and the enzyme stringency is set to automatic, it is incremented by 10% (decreasing the number of passing enzymes and thus enzyme sets) and the analysis is repeated. the final output reports and summarizes those enzyme sets that best discriminated the sequence groups. the final output consists of three parts : successful enzyme sets, enzyme picker key, and quick overview. the successful enzyme sets (figure 1d.1) consist of a list of enzyme groups in each set, and a score indicating the frequency with which each set discriminated the sequence groups. a perfect enzyme (one that discriminates 100% of the sequence groups) contributes a score of 1, so four perfect enzymes would produce the maximum score of 4. the enzyme picker key (figure 1d.2) lists the members of each enzyme group, with neoschizomers separated by brackets. each member of an enzyme group produces the same sequence group differentiation pattern but may differ in recognition site, terminal fragment lengths, etc. the quick overview (figure 1d.3) histogram summarizes the frequency with which each enzyme group appears in the printed results. after submission the program generally takes less than 1 min to complete, depending most heavily on the number of sequence groups, the number of enzymes selected and the server load, respectively. the final choice of restriction enzymes is left to the researcher, and is likely to be based on practical factors such as cost, availability, reaction conditions, methylation sensitivity or requirements, star activity and other specifics that are detailed at rebase. an online manual detailing usage and options, bug tracking and the source code (open and accessible under the gnu public license v.2) are available at http://code.google.com/p/repk. we found that researchers often failed to report their rationale in choosing a particular set of restriction enzymes for t - rflp analysis, yet this choice is crucial for resolving the microbial community and interpreting the results. we provide repk in the hope that it will allow microbial ecologists to maximize their ability to discriminate terminal restriction fragments obtained during t - rflp and thereby take greater advantage of this powerful community fingerprinting technique. | terminal restriction fragment length polymorphism (t - rflp) analysis is a widespread technique for rapidly fingerprinting microbial communities. users of t - rflp frequently overlook the resolving power of well - chosen restriction endonucleases and often fail to report how they chose their enzymes. repk (restriction endonuclease picker) assists in the rational choice of restriction endonucleases for t - rflp by finding sets of four restriction endonucleases that together uniquely differentiate user - designated sequence groups. with repk, users can provide their own sequences (of any gene, not just 16s rrna), specify the taxonomic rank of interest and choose from a number of filtering options to further narrow down the enzyme selection. bug tracking is provided, and the source code is open and accessible under the gnu public license v.2, at http://code.google.com/p/repk. the web server is available without access restrictions at http://rocaplab.ocean.washington.edu/tools/repk. |
recently it has been evaluated in metastatic melanoma patients with braf v600e mutation after progression of earlier systemic treatment (phase 2 trial brim2). vemurafenib was also tested in a phase 3 trial (brim3) in previously untreated patients. food and drug administration (fda) in august 2011 and the european medicines agency (ema) in february 2012 for the treatment of metastatic melanoma with braf mutation. updated overall survival (os) results of the brim3 study have been presented at the asco meeting this year. the overall response rate in patients treated with vemurafenib was 57% [5.6% complete response (cr), 51.3 partial response (pr) ] compared with 8.6% (1.2% cr, 7.4% pr) observed in patients receiving dacarbazine (dtic). median progression - free survival (pfs) was also longer in patients treated with the study drug (6.9 vs. 1.6 months ; hr 0.38 ; 95% ci : 0.320.46 ; p < 0.001) as well as median os (13.6 vs. 9.7 months ; hr 0.70 ; 95% ci : 0.570.87 ; p < 0.001). in patients treated with vemurafenib, adverse cutaneous skin carcinoma, keratoacanthoma and skin papilloma james larkin presented results of an open - label, multicenter safety study of vemurafenib in patients with metastatic melanoma. of 1964 screened patients, 914 were enrolled in the study and 834 evaluable for toxicity analysis. 70% of patients received prior systemic treatment due to metastatic melanoma (14% ipilimumab, 2% mek and braf inhibitors). adverse events (aes) were observed in 66% of patients (88% were related to vemurafenib). the most frequently observed any grade aes were arthralgia (31%), rash (29%), fatigue (22%), photosensitivity (21%) and nausea (15%). the most common were rash (3.6%), arthralgia (3.1%) and cutaneous cell carcinoma / keratoacanthoma (4.3%). in 6% of patients treatment was discontinued due to aes (mainly arthritis and abdominal pain). at the time of study analysis 302 patients were evaluable for tumor assessment at week 8 of treatment ; 61% developed objective responses, and 29% stable disease (sd). another active braf kinase inhibitor in the treatment of metastatic melanoma patients is dabrafenib (gsk2118436). results of a randomized, open - label, multicenter phase 3 study (break-3) comparing the efficacy of dabrafenib and dtic in patients with braf v600e mutated metastatic melanoma were presented at the meeting. the study enrolled 250 previously untreated patients. in one study arm patients received oral dabrafenib at a dose of 150 mg twice a day. in the second arm dtic at a dose of 1000 mg / m was administered in three - week intervals. 31% of patients presented greater than 1 ecog performance status and 66% of enrolled patients had stage m1c melanoma. patients treated with the study drug also demonstrated longer median pfs 5.1 vs. 2.7 months (hr 0.30 ; 95% ci : 0.180.53 ; p < 0.0001). the most frequent adverse events observed in patients treated with dabrafenib were hyperkeratosis (37%), headache (32%), pyrexia (28%), arthralgia (27%) and skin papillomas (24%). serious adverse events (saes) included pyrexia (6%), squamous cell carcinoma (6%) and new primary melanoma (2%). a number of clinical trials showed low efficacy of anti - cancer agents in melanoma patients with brain metastases. however, small molecules have demonstrated some efficacy in patients with solid tumors with concomitant brain metastases. dabrafenib in a phase 2 study (break - mb) in patients with braf v600e / k mutation with intracranial lesions demonstrated high clinical efficacy. 127 patients were recruited to one of the two study arms, but only 41 patients reached 8-week disease assessment at the time of interim analysis. patients in cohort a did not receive any prior brain metastasis treatment before entering the trial. patients in group b before enrolment developed intracranial progression following prior brain therapy. unconfirmed overall intracranial response rate (oirr) was 53% in patients with braf v600e mutant in both study cohorts. the unconfirmed oirr in patients with braf v600k mutation was 20% and 50%, respectively, in arms a and b. these preliminary results confirm efficacy of dabrafenib in melanoma patients with intra- and extracranial metastases with acceptable toxicity. trametinib is a reversible, highly selective allosteric inhibitor of mek 1/2 activation and kinase activity. results of a phase 3 (metric) study comparing trametinib with chemotherapy in patients with braf v600/k mutant advanced or metastatic melanoma were presented at the asco conference. 273 patients were randomized in a 2 : 1 ratio to receive trametinib or paclitaxel / dtic. patients with disease progression after chemotherapy were allowed to cross over to the trametinib arm. the overall response rate observed in the study drug arm was 24% compared with 7% in patients treated with chemotherapy. in the group receiving trametinib the median pfs was greater than in the control arm 4.8 vs. 1.4 months (hr 0.44 ; 95% ci : 0.310.64 ; p < 0.0001). analysis of os demonstrated that 81% of patients in the trametinib group were alive after 6 months of follow - up, compared with 67% in the chemotherapy group (hr 0.53 ; 95% ci : 0.300.94, p < 0.01). the most common adverse events observed in patients treated with trametinib were skin rash, diarrhea, edema, hypertension and fatigue. typical adverse events connected with mek inhibitor treatment included chorioretinopathy (< 1%) and decreased ejection fraction (7%). jeffrey weber has presented encouraging results of a phase i / ii study presenting safety and efficacy of dabrafenib combined with trametinib in braf v600 mutant metastatic melanoma patients. the overall response rate observed in the study was 56% with 4 cr, 39 pr, 29 sd and 3 pd. overall pfs was 7.4 months. the most frequently noted saes were pyrexia (6.5%), fatigue (6.5%) and dehydration (6.5%). the combination of dabrafenib and trametinib was associated with a lower incidence of mek inhibitor related rash and braf inhibitor induced hyperproliferative skin lesions when compared to the single agents. encouraging results of a chinese phase ii trial comparing first line treatment of rh - endostatin (angiogenesis inhibitor) plus dtic with dtic alone in patients with advanced melanoma have been presented. patients treated with rh - endostatin plus dtic showed longer pfs 5.0 vs. 1.5 months (95% ci : 2.457.55 ; p = 0.004) and longer os treatment with rh - endostatin combined with dtic was well tolerated, with grade 34 toxicity (mainly elevated transaminase and thrombocytopenia) observed only in 1.7% of patients. a new agent, cabozantinib, has been tested in a randomized phase ii trial in patients with metastatic cutaneous / mucosal (70%) and ocular (30%) melanoma. toxicity of the study drug was comparable to that of other vegfr (vascular endothelial growth factor receptor) tkis (tyrosine kinase inhibitors). interim analysis of a single arm phase ii trial assessing another vegfr tki, pazopanib, and paclitaxel in first - line treatment for unresectable stage iii and iv melanoma demonstrated a 48% overall response rate. grade 3 and 4 hypertension was observed in 28%, transaminitis in 21%, neutropenia in 14% of patients. studies of mtor (mammalian target of rapamycin kinase) inhibitors in two small phase ii studies demonstrated efficacy. in one trial in advanced melanoma patients temsirolimus was combined with bevacizumab and showed pr in 19% and sd in 56% of patients ; the most notable responses were seen in patients with braf wild type tumors. another trial enrolled metastatic melanoma patients to evaluate the combination of everolimus with paclitaxel and carboplatin. ipilimumab is a fully human monoclonal antibody (mab) targeting cytotoxic t - lymphocyte antigen-4 (ctla-4). currently ipilimumab and vemurafenib are the only two new drugs approved for the treatment of metastatic melanoma. (2010) and subsequently in europe (2011) in the second line treatment after failure of chemotherapy (mdx010 - 20 study). (2010) in previously untreated patients with metastatic melanoma. during the asco meeting omid hamid presented the results of the ipilimumab u.s. expanded access program (eap) in patients with unresectable stage iii or iv melanoma. the study also enrolled patients with brain metastases (27%), ocular melanoma (5%) and mucosal melanoma (4%). 906 patients were treated with ipilimumab in a dose of 10 mg / kg every 3 weeks (4 doses induction phase) followed by 10 mg/ kg every 12 weeks (maintenance phase) until progression or unacceptable / unmanageable toxicity of the treatment the most common were diarrhea (10%), colitis (8%), endocrinopathies (4%), and dermatitis (0.8%). incidence of saes such as hepatitis (0.24%), intestinal perforations (0.36%) and drug - related death (0.24%) was consistent with that seen in other trials evaluating 10 mg / kg ipilimumab monotherapy. currently a phase i / ii trial evaluating ipilimumab in combination with vemurafenib is ongoing with the first enrolled metastatic melanoma (braf v600 mutant) patient in november 2011. paul chapman s group demonstrated interesting results of hypersensitivity skin reactions in melanoma patients treated with vemurafenib after previous ipilimumab therapy. the investigators observed drug - related rash associated with vemurafenib in 13 out of 16 treated patients (81%). four patients developed grade 3 maculopapular rash which occurred within 8 days of starting the vemurafenib treatment. they did not progress to life - threatening reactions such as anaphylaxis or stevens - johnson syndrome and did not necessitate discontinuation of vemurafenib treatment. the incidence of grade 3 rash was higher than that observed in patients treated with vemurafenib in the phase iii brim3 trial (25% vs. 8% ; p = 0.02). ipilimumab has also shown some activity in patients with metastatic melanoma and brain metastases, particularly when metastases were small and asymptomatic. results of a phase 2 study of these patients were published recently in lancet oncology. the intracranial response rate was 24% (patients neurologically asymptomatic without corticosteroid treatment) and 10% (patients with neurological symptoms on a stable dose of corticosteroids). activity of ipilimumab and fotemustine in metastatic melanoma patients has been tested in the nibit - m1 trial. 86 patients with asymptomatic brain metastases were enrolled in the study (7 patients had prior whole brain radiotherapy or radiosurgery). patients received 4 doses of ipilimumab 10 mg / kg every 3 weeks plus fotemustine 100 mg / m weekly for 3 weeks, followed by ipilimumab every 12 weeks (from week 24) combined with fotemustine every 3 weeks (from week 9). the immune related (ir) disease control rate (irdcr = cr + pr + + sd using the ir response criteria) was 50% and immune related overall response rate (irorr = cr + pr) was 40%. another trial evaluated the development of brain metastases in metastatic melanoma patients treated with ipilimumab and temozolomide. of 64 enrolled patients (2 with a history of prior brain metastases), 11 (17%) developed brain metastases at a median follow - up of 41 weeks. a new interesting anti - cancer agent is anti - pd-1 (bms-936558, mdx-1106), a fully human mab that blocks the programmed death-1 (pd-1) co - inhibitory receptor expressed by activated t - cells. the study drug was administered intravenously every 2 weeks until pd or cr, for a maximum of 12 cycles. the most common included gastrointestinal (4%), endocrine (2%) and hepatobiliary disorders (1%). of the 20 patients that responded to the treatment, 12 developed a response lasting over 1 year. bms-936558 was also evaluated in combination with a multipeptide vaccine in a phase i study in 30 previously treated patients with metastatic melanoma. patients were vaccinated with mart-1/gp100/ny - eso-1 peptides with adjuvant montanide isa 51 together with bms-936558 (1, 3 or 10 mg / kg) every 2 weeks for 24 weeks, followed by bms-936558 alone every 3 months. responses to the treatment were observed in all study cohorts (1/3/10 mg / kg 2 pr/5 pr/2 pr and 1 sd). immunological tests demonstrated decreased pd-1 receptor on cd4 + and cd8 + lymphocytes and increased ctla4 receptors, and a dose - related decrease in cd8 t - cells while cd4 t - cells increased. investigators from russia presented results of a trial evaluating efficacy of a dendritic cell (dc)-based vaccine in patients with high risk resected melanoma (stage iii and iv). patients (stage iii 46, iv 10) were treated with autologous monocyte - derived dc vaccine primed with autologous tumor lysate, administered intradermally every 26 weeks until disease progression. in the control group 53 patients (stage iii 47, iv at a median follow - up of 22 months disease - free survival (dfs) was significantly longer in patients treated with the vaccine (hr 0.45 ; 95% ci : 0.290.69 ; p < 0.05) although there was no difference in os between the study arms (hr 0.71 ; 95% ci : 0.401.25 ; p = 0.23). the investigators observed a significant correlation between reduction of risk and vaccine - induced strong delayed type hypersensitivity reaction. at the asco meeting investigators reported on a phase 3 trial (optim) evaluating effectiveness of intratumoral injections of talimogene laherparepvec (t - vec) compared with subcutaneous administration of gm - csf (granulocyte - macrophage colony - stimulating factor) in patients with advanced and metastatic melanoma. t - vec (formally oncovex) is an oncolytic hsv1 that selectively replicates in tumors inducing a systemic anti - tumor immune response enhanced by local gm - scf expression. an interesting strategy consisting of cd40 ligand / interferon- matured autologous dc immunized with gp100 antigen hla (human leukocyte antigen) i restricted peptides in patients with metastatic melanoma has been shown. out of 7 treated patients 2 pr were noted and 1 cr with a duration of over 3 years. the investigators demonstrated a significant correlation of il-12 production by dcs with ttp (time to progression). other early phase immunotherapy trials included : intra - lesional administration of tg1042 (adenovirus expressing interferon - gamma) combined with adoptive til (tumor infiltrating lymphocytes) transfer ; tcr - il-2 (t - cell receptor - interleukin-2) fusion protein in combination with cisplatin ; hyperacute - melanoma vaccine combined with pegylated interferon ; and autologous til infusion combined with lymphodepleting chemotherapy and low - dose il-2. | the 2012 asco (american society of clinical oncology) annual meeting has been held once again at the mccormick conference center in chicago, illinois, where asco has booked a 10-year run for the meeting. the meeting was attended by more than 30,000 oncology professionals from around the world. of more than 4500 abstracts published at the meeting, 310 were related to melanoma. here we report the results of the most interesting clinical trials presented at the meeting. apart from updated overall survival (os) results of a phase 3 study evaluating the efficacy of vemurafenib and some new data on ipilimumab (expanded access program [eap ] and treatment of patients with brain metastases) we report on practice changing trials : a phase 3 (break) trial evaluating efficacy of dabrafenib and a phase 3 study (metric) assessing trametinib in the treatment of metastatic melanoma patients. another encouraging treatment strategy is combination of dabrafenib and trametinib evaluated in a phase i / ii study. results of new immune checkpoint targeting by monoclonal antibody anti - pd1 (bms-936558) in an early phase trial in monotherapy or in combination with a multipeptide vaccine in metastatic melanoma patients are presented. also, results of dendritic cell - based vaccine (randomized phase ii trial) immunization in patients with high risk resected melanoma are shown. furthermore, results of other melanoma immunotherapy strategies evaluated in early phase studies are reported. |
wandering spleen (ws) is a rare condition in which the spleen is located anywhere in the abdomen other than in its usual place ; however, other terms are used to describe this clinical entity, including displaced spleen, drifting spleen, floating spleen, pelvic spleen, splenic ptosis, splenoptosis, although it remains enigmatic, the abnormal location of the spleen may be attributed to malformation or total agenesis of the splenic suspensory ligaments because of abnormal development of the dorsal mesogastrium. therefore, the spleen may either drop into the abdominal cavity and be suspended only by extremely flexible ligaments, or float in the abdominal cavity suspended only by its pedicle. in addition, wandering spleen may occasionallyoccur as a result of weakening of the suspensory splenic ligaments by clinical processes such as trauma, pregnancy, and connective tissue diseases. splenic torsion, the major complication of ws, was first mentioned in the german literature in 1885. since then, ws and its clinical aspects have been fully identified, and ws has gradually become a well - known clinical entity.1,2 in this article we report two cases of ws, one of whom presented with torsion. a 21-year - old female was admitted to our emergency department with an acute abdomen. apart from abdominal pain continuing for 36 hours, her medical history was insignificant. physical examination revealed a giant mass located in the left abdominal quadrant, and generalized abdominal tenderness. routine biochemical parameters were normal except for a moderate leukocytosis (16,500/mm) and high c - reactive protein (crp) (80 mg / l). combined abdominal sonography and contrast - enhanced abdominopelvic computed tomography (ct) demonstrated the absence of a spleen in its normal position, with a 15 7 cm solid mass extending from the stomach to the pelvis in the left abdomen that was consistent with ws, and no contrast enhancement within the splenic parenchyma (figure 1). an urgent laparotomy revealed a significantly enlarged, infarcted ws secondary to splenic torsion of 540 (figures 2 and 3). the patient was discharged on the fourth postoperative day, to come back for vaccination two weeks later. a 19-year - old female was seen in our outpatient clinic with enuresis and vague lower abdominal pain of six months duration. she had been treated for urinary tract infection several times within the previous three months. an enlarged ws of 16 6 cm in size extending from the left costal margin to the pelvis was demonstrated on abdominal sonography. contrast - enhanced abdominopelvic ct scan revealed an enlarged ws extending from the greater curvature to the urinary bladder, and a 3 2 cm mass consistent with an accessory spleen (figure 3). because the spleen was enlarged, without any vascular compression, other causes of splenomegaly were investigated. surgical treatment was considered for management after hematological consultation. during exploratory laparoscopy, an enlarged ws with an accessory spleen at its hilum there were dense adhesions between the ws and the urinary bladder. given that the accessory spleen was evaluated to be adequate for further splenic function and the spleen was too enlarged to be replaced in its original position, laparoscopic splenectomy was preferred. ws is a rarely seen birth defect with an incidence of < 0.2%, caused by an unusually long vascular pedicle which allows migration of the spleen from its normal anatomic position, and is most commonly diagnosed in young children as well as in women between the ages of 20 and 40 years. the first clinical description of ws, confirmed by autopsy, was by johannes van horne, a dutch physician, in 1667.24 the clinical presentation of ws may be variable, from an asymptomatic patient to one with mild abdominal pain, signs of acute abdomen, or acute pancreatitis. the most common symptom of ws is abdominal pain caused by either splenic complications or mass effect. splenic torsion, the most important complication of ws, may be either acute - complete or intermittent - incomplete. acute - complete splenic torsion contributes to splenic ischemia in which the patient presents with acute abdominal symptoms, as did our first case. however, intermittent - incomplete splenic torsion may lead to venous congestion and subsequent hypersplenism. therefore, such patients may present with intermittent or sustained vague abdominal pain, and may be found to have biochemical abnormalities because of hypersplenism,5,6 as did our second case. patients with ws may also present with complications associated with other intra - abdominal organs, such as gastrointestinal obstruction secondary to splenic adhesions or a long splenic pedicle, pancreatic necrosis secondary to compression of the pancreatic tail, pancreatitis secondary to displacement of the pancreatic tail into the splenic hilum, bleeding from gastric varices secondary to splenic venous hypertension, and urinary symptoms secondary to compression of the ureters or the urinary bladder. of note, ws may be asymptomatic with or without a palpable intra - abdominal mass, and is diagnosed incidentally.710 the absence of spleen in its normal anatomic position and a presence of an intra - abdominal mass that has similar characteristics with the spleen are major determinants of diagnosis of ws by any imaging modalities utilized. abdominal sonography and doppler scan may not only demonstrate a ws but can also evaluate splenic blood flow to rule out a possible splenic torsion.11,12 contrast - enhanced abdominopelvic ct scan also provides information about the exact location of ws in relation to other intra - abdominal organs, and the viability of the spleen in the setting of a possible splenic torsion.13 other diagnostic imaging modalities include radionuclide scan and mri.14 combined utilization of abdominal sonography and ct provided a correct diagnosis of ws in our both cases. symptomatic patients with ws warrant surgical treatment, but the management of asymptomatic ws remains controversial. however, many authors found a high rate of complications, splenic torsion in particular, associated with conservative treatment.15 since elective surgical treatment have the advantage of preservation of a viable spleen, surgical treatment seems to be the best option in asymptomatic ws. currently, there are two surgical treatment options for ws, ie, splenopexy and splenectomy.1619 each procedure can be carried out by open or minimally invasive surgery. many authors recommend splenopexy in uncomplicated cases, especially in children ; however, in cases of infarction due to splenic torsion, splenectomy seems to be the treatment of choice whether laparoscopic or open, depending on the patient s situation, size of the spleen, and experience of the surgeon. in conclusion, wandering spleen should be borne in mind for patients presenting with a palpable intra - abdominal mass causing acute or intermittent abdominal symptoms. | wandering spleen is a rare clinical condition which presents with a variety of symptoms with abdominal pain, abdominal mass, and acute abdomen. it may also remain silent until diagnosed by a routine imaging study. treatment options may differ depending on the presenting clinical picture. herein we present two cases of wandering spleen treated by splenectomy, with one of them admitted to our emergency clinic with torsion. |
suppression of menstrual periods to provide relief of menstrual - related symptoms has been used in a variety of medical conditions since the availability of steroid hormone therapy. this option has gained legitimacy through its use in treating symptoms, but is now being used more frequently by women for personal preference. a recent cochrane review of trials comparing 28-day and extended cycles found comparable contraceptive efficacy and safety.1 the review found overall discontinuation rates and discontinuation for bleeding problems to be similar. extended cycling resulted in improved headaches, genital irritation, tiredness, bloating, and menstrual pain.1 the term therapeutic amenorrhea was first used in the mid-1960s to describe the suppression of menstrual bleeding in women with hematologic disorders and coagulation defects leading to heavy menstrual bleeding.2,3 a small randomized trial in 1971 in the us compared a high - dose combination oral contraceptive pill, given continuously, with depot medroxyprogesterone acetate (dmpa) or dmpa plus daily conjugated estrogens.3 the differences among these regimens were not significant. when oral contraceptives containing a synthetic estrogen and a progestin were initially developed, an arbitrary regimen comprising 21 days of hormonally active pills followed by 7 days of placebo or a hormone - free interval were devised to mimic the natural menstrual cycle (the pill). it was even the belief of one of the original developers of oral contraceptives, john rock, md, that this cycling would provide a regimen that was acceptable to the pope, as he reasoned that the pill was simply a natural variant of the rhythm method of contraception.4 pope pius xii had approved the pill in 1958 for the treatment of medical conditions such as menstrual pain, given that its contraceptive actions were an john rock s argument that the pill was natural, by virtue of mimicking the normal menstrual cycle,4 was ultimately rejected by pope paul vi in 1968.5 clinicians have used hormonal therapy to suppress menstruation since combination birth control pills were initially developed. continuous hormonal therapy has been used when menstrual bleeding is medically problematic or even life - threatening, such as in patients with aplastic anemia or in bleeding disorders such as thrombocytopenia or severe von willebrand disease. pelvic pain and dysmenorrhea in conditions such as endometriosis or uterine leiomyomata have been managed historically with menstrual suppression as well.6 medical conditions that may benefit from menstrual suppression are listed in table 1. was raised by coutinho and segal in a popular press book of this name, published in 1999.6 these authors cited a variety of symptoms, including dysmenorrhea, bloating, breast tenderness, premenstrual syndrome (pms), nausea, and edema, as well as medical conditions including migraine headaches, endometriosis, epilepsy, and anemia, that could be improved by menstrual suppression. sulak reported that extending the duration of hormonally active pills improved menstrual symptoms including dysmenorrhea, menorrhagia, premenstrual - type symptoms, and menstrual migraines.7 investigators have asked, should monthly menstruation be optional for women ? and have described extended - cycle oral contraceptives as menstrual nirvana.8,9 women s autonomy and the right to choose and regulate their cycles for whatever reason has been a focus of publications and debate.10,11 in 2003, an oral contraceptive pill formulation was approved by the us food and drug administration (fda) with packaging for a dosing regimen that provided 82 days of hormonally active pills, followed by 7 days of placebo. in 2007, a pill providing continuous combined hormonal therapy, 365 days / year, was approved by the fda. the availability of these specific combined oral contraceptive regimens led to greater use of hormonal therapy to reduce the frequency of menstruation, or attempts to eliminate it. prior to this dedicated packaging or an extended regimen, clinicians described to women how to use the traditionally packaged pill formulations by discarding the placebo pills and tailoring the dosing regimen. while there are many medical conditions that are improved with menstrual suppression, healthy women who were prescribed oral contraceptive pills in the traditional fashion have learned that their cycles could be manipulated. prior to the advent of the specifically packaged extended cycle regimens, women would occasionally extend their cycles by a few days to a week to allow for planning special events, vacations, or athletic events. the acceptability of extended cycles has generally been good, with irregular bleeding or spotting being the most common side effect ; bleeding tends to decrease in successive cycles.1215 irregular, unscheduled bleeding with an extended regimen may be unacceptable to some women, leading to discontinuation. a number of polls have cited women s opinions about the frequency of preferred menstrual bleeding. some polls suggest that up to half of women may prefer a menstrual frequency of never, although the acceptability of amenorrhea has cultural determinants and varies widely.16,17 an international study involving women in nigeria, south africa, scotland, and the people s republic of china found that most women dislike menstruation, and in all of the countries studied except the people s republic of china, most women expressed a willingness to try a contraceptive method that induced amenorrhea.18 there remain women who believe it s unnatural or not normal to suppress menses.19 studies in the us and in other countries including germany and brazil have found that many women consider monthly bleeding as reassurance that they are not pregnant.16,20 the efficacy and safety of menstrual suppression has been supported by a number of studies and is recognized in a cochrane database systematic review.1 the cochrane review cites possible improved compliance, greater satisfaction, fewer menstrual symptoms, and less menstruation - related absenteeism from work or school. while no studies have shown differences in the contraceptive efficacy of traditional pill packaging versus extended cycling, the greater suppression of follicular development that has been demonstrated with extending cycling would suggest a theoretical edge in favor of less likelihood of development of a follicle and thus lower risk of ovulation, leading to greater efficacy.21 greater ovarian and endometrial suppression with continuous use has been shown in a randomized trial of continuous versus cyclical oral contraceptives.22 the lack of excessive endometrial proliferation has been described,23 and is reassuring. however, the society for menstrual cycle research maintains a 2007 position statement stating that menstruation is not a disease, and that further research on the potential health risks and long - term safety of cycle - stopping contraception is still needed.24 this review addresses the many medical conditions that may be improved by menstrual suppression, as well as the benefits and potential side effects of various options for the medical suppression of menstruation. while more studies and reviews have focused on the potential benefits of menstrual suppression with the use of combined oral contraceptive pills, other combined estrogen and progestin hormonal delivery systems (patches and rings) have also been used in a continuous fashion, and likely confer similar benefits.2528 new formulations and delivery systems are in development, and some of these options may prove to have similar benefits for menstrual suppression when additional studies are performed to assess non - contraceptive benefits.29 a variety of medications have been used to induce therapeutic amenorrhea, including : extended cycle or continuous use of oral combined contraceptives ; various progestin delivery systems (depot medroxyprogesterone acetate administered intramuscularly [i m ] or subcutaneously, oral progestins, intrauterine systems) ; gonadotropin - releasing hormone (gnrh) analogs, and older drugs such as danazol.30 table 2 summarizes the formulations that have been used in this manner, along with their dosing regimens, limitations, and efficacy in inducing amenorrhea, as well as potential advantages and disadvantages. some of these therapies represent unlabeled use of an fda - approved medication, and clinicians should review the data supporting their use for a specific clinical indication ; such use is not precluded by the fda, and clinicians frequently use drugs for such unlabeled indications when supported by evidence and clinical judgment.31 the primary clinical limitation in virtually all regimens is the inability to perfectly suppress menses from the time of initial dosing. this relates in part to initiation of therapy at varying times in the menstrual cycle, and in varying clinical settings in which the endometrium may have proliferative or secretory histology, and the hypothalamic pituitary most therapeutic options have similar efficacy in menstrual suppression at the end of one year of use, but most also have considerable rates of irregular, unpredictable, or unscheduled bleeding in the initial few months after initiation. rates of amenorrhea reflect amenorrhea in individuals who continued the hormonal method ; irregular, unscheduled bleeding may have resulted in discontinuation, thus artificially raising the reported rates of amenorrhea. this limitation is of variable acceptability to women, and must be described fully with instructions to patients in order to provide a truly informed consent process, and in an effort to prevent premature discontinuation of the therapy. factors that play a part in the selection of an option for menstrual suppression include the route of administration, frequency of use which impacts compliance and satisfaction, the presence of uncomfortable side effects, other effects of administration such as an improvement in acne, and factors such as cost or insurance coverage. clinicians are challenged to work with their individual patients to find a therapy that will be efficacious in suppressing menstrual bleeding when clinical symptoms or medical conditions warrant an attempted induction of therapeutic amenorrhea. menstrual suppression can have considerable benefits in improving quality of life, and in ameliorating menstrual cycle - related exacerbations of menstrual symptoms / molimina as well as underlying catamenial worsening of underlying medical conditions. the most common factor limiting the use of therapeutic measures to effect menstrual suppression is breakthrough bleeding and imperfect rates of amenorrhea, although the experience of other side effects can also be problematic if this has not been adequately explained prior to initiating the therapy. in the past, clinicians have reserved the recommendation of menstrual suppression for severe symptoms or significant disease. with the advent of marketing of extended cycle regimens of combination oral contraceptives directly to consumers, women have become aware of the option to choose menstrual suppression or extended cycles based on their own preferences and experiences of uncomfortable or painful menstrual symptoms. the realities of menstrual suppression and, in particular, the relatively high initial rates of irregular and unscheduled spotting or bleeding need to be understood by both clinicians and by women who may be choosing this option. however, over time, high rates of amenorrhea can typically be achieved, and those who do not achieve complete amenorrhea with medical therapies can often benefit from a marked reduction in menstrual volume. surgical therapies can often be avoided, particularly in younger women who wish to preserve child - bearing capabilities. | menstrual suppression to provide relief of menstrual - related symptoms or to manage medical conditions associated with menstrual morbidity or menstrual exacerbation has been used clinically since the development of steroid hormonal therapies. options range from the extended or continuous use of combined hormonal oral contraceptives, to the use of combined hormonal patches and rings, progestins given in a variety of formulations from intramuscular injection to oral therapies to intrauterine devices, and other agents such as gonadotropin - releasing hormone (gnrh) antagonists. the agents used for menstrual suppression have variable rates of success in inducing amenorrhea, but typically have increasing rates of amenorrhea over time. therapy may be limited by side effects, most commonly irregular, unscheduled bleeding. these therapies can benefit women s quality of life, and by stabilizing the hormonal milieu, potentially improve the course of underlying medical conditions such as diabetes or a seizure disorder. this review addresses situations in which menstrual suppression may be of benefit, and lists options which have been successful in inducing medical amenorrhea. |
the piercing on the middle of the helix in both ears resulted in keloids formation. | key clinical messageear lobe keloids are common following ear piercing and these lesions are conspicuous and cosmetically unappealing. multiple methods including surgery, radiotherapy, anti mitotic agents, silicone sheet, pressure clips, and cryotherapy have been used. the challenge is to have a good cosmetic outcome with minimal recurrence. |
alcohol consumption is a well - known part of the nigerian culture and frequently part of festivals and celebrations and, within the past decade, there are indications that there has been a rapid increase in alcohol production and importation as well as its consumption across all age groups. for the year after 1995, the unrecorded alcohol consumption was estimated to be 3.5 litres pure alcohol per capita for population older than 15 in nigeria. alcoholic consumption continues to experience strong growth in nigeria as a result of the aggressive marketing activities of leading players, and drinking is widely considered a part of social activities ; therefore, most consumers drink unaccompanied. the entry of several new local brews whose alcohol concentration and ingredients are not yet clearly identified has emerged as another public health issue. nigeria 's population of about 160 million continues to grow at an annual rate of 3%. similar to the western world, alcohol is also a factor in a large proportion of injuries and road accidents in nigeria and is also associated with physical health problems. prospective studies among european and north american populations show that alcohol consumption, especially heavy drinking, is associated with pancreatitis, liver cirrhosis, tuberculosis, pneumonia, injuries, malignancies, and psychiatric morbidity [6, 7 ]. therefore, the estimation of prevalence and correlates of alcohol consumption is a systematic prerequisite step in the direction of planning an effective intervention program for the target drinking population. however, there is limited large - scale evidence on prevalence and the correlates of alcohol use in nigeria, particularly in rural provinces where majority of nigerians live. while a review of different local studies conducted in primary health care settings in urban areas highlighted high prevalence of alcohol use and associated factors such as male gender, increasing age, low educational level, and marital status [1, 8, 9 ], there is a need to examine the magnitude of alcohol use and correlates in settings where most nigerians live in order to influence the public health of nigerians. we report here the prevalence and correlates of alcohol consumption and investigate the relationship between alcohol consumption and sociodemographic and associated level of health risks among 1,203 men and women, using cross - sectional data collected during the baseline survey of the effectiveness of assist linked brief intervention on harmful and hazardous alcohol use in two south - west rural communities in nigeria : a non - randomized intervention study. ibadan is the capital of oyo state, nigeria, and it is the third largest city in nigeria. however, we report, herein, baseline measures of hazardous and harmful use with their sociodemographic correlates. the inclusion criteria for the study were both male and female alcohol users of age 15 years and permanent residents of study areas. the exclusion criteria were nonusers of alcohol of age less than 15 years, not willing to intervention, and not a permanent resident of the study areas. we obtained ethical approval for the study from the ethics and research committee of the ministry of health, oyo state of nigeria ; accent was obtained for participants between 15 and 18 years and consent from those over 18 years of age. using systematic stratified sampling method, the selected semirural local governments were lagelu local government (local government a) and akinyele local government (local government b) areas of ibadan. the classification was according to national population commission in nigeria, based on population and fund allocation. all the 11 lga were classified into urban or semirural each during the first stage of the study. there are five urban local governments and six semirural local government areas in ibadan. in the second stage, one local government was randomly chosen from the six semirural local government areas. in the third stage, four enumeration areas were systematically selected as clusters. the fourth stage involved the mapping and numbering of all buildings in each of the selected enumeration areas. all households within each building were serially listed in the form specifically designed for the purpose. after getting the list of the households, all eligible respondents, who were 15 years and above in each household, were selected and were interviewed by chew using the questionnaires including assist after they gave permission / consent. after administration of the sociodemographic questionnaire, participants were also screened with alcohol, smoking and substance involvement screening test (assist). the assist was used to determine the prevalence of alcohol consumption and associated level of harm. the assist was developed by the world health organization for alcohol and drug screening in high prevalence settings. according to the assist manual, a score of 010 for drugs is regarded as lower risk, 1126 as moderate risk, and 27 + as high risk. however, in this study, the level of harm was generated using a mean assist score at all the phases of the study. for the purpose of this study, current alcohol use was regarded as use in preceding 30 days. we used a set of precoded and pretested sociodemographic questionnaires to elicit sociodemographic characteristics from the respondents such as age, marital status, socioeconomic class, and years of education. data on both lifetime and current alcohol consumption were obtained using the assist. for our univariate analysis, the association between sociodemographic variables and both lifetime and current alcohol use was determined using pearson 's chi square statistics. multivariate analysis was carried out using binary logistic regression analysis, using variables that were significant during univariate analysis to determine association with current alcohol use. a total of 1329 youths and adults were selected and invited to participate in this study. out of these, 1213 completed the questionnaires, giving a response rate of 91.3%. at baseline, responses were incomplete in ten questionnaires and so final analysis was carried out on 1203 questionnaires at baseline. the mean age of respondents at baseline was 24.45 9.23 years, 623 (51.8%) were males, 796 (66.2%) were married, 570 (47.4%) had at least some secondary education, 513 (42.6%) were from low socioeconomic country, 598 (49.7%) from low average socioeconomic group, 400 (33.3%) were unemployed, and 516 (42.9%) were christians (table 1). prevalence of lifetime alcohol use was 697 (57.9%), lifetime alcohol use was more prevalent in men p < 0.001, married respondents p = 0.003, respondents with low level of education p < 0.001, respondents of low socioeconomic status, those who were unemployed p = 0.03, and the christians p = 0.001 (table 1). prevalence of current alcohol use was 285 (23.7%) ; current alcohol use increased with increasing age, p = 0.02, was commoner in males, p = 0.003, the unmarried, p < 0.01, those with formal education, p = 0.003, those from low socioeconomic group, p = 0.01, the unemployed p < 0.001, and the christians p < 0.01 (table 2). of current users, strong beer was first choice of beverage in 30.5% of them and other beverages predominantly local cocktails were the least (2.9%) (figure 1). prevalence of current alcohol use was 285 (23.7%), 88 (30.9%) were at low health risk, 161 (56.5%) were at moderate health risk, and 36 (12.6%) were at high health risk (table 3). multivariate analysis revealed that older age group, female gender, high average socioeconomic group, and high socioeconomic group were protective factors, while being unmarried was a risk factor. at 3 months, older age group, female gender, high average socioeconomic group, and high socioeconomic group were protective factors, while being unmarried was risk factor (table 4). this is the report of baseline measures of a single arm nonrandomized intervention study that aimed to determine in semirural community settings the prevalence and correlates of alcohol use as well as the effectiveness of assist linked sbirt on harmful and hazardous alcohol use in the rural youth and adult dwellers and most probably the first in sub - saharan africa. we found that the prevalence of lifetime alcohol use was 57.9% and current alcohol use 27.3% among the participants. our finding was in agreement with the lifetime prevalence of alcohol (56%) by gureje and colleagues, in a multicentre study across all cultures in nigeria. however, our reported current alcohol use is almost twice that reported (14%) by gureje.. this could be a reflection of the difference in the instruments used or in spread of centres used. our self - reported lifetime and current uses are lower than lifetime alcohol use (66.6%) and current use (62.2%) from a study in togo, a neighbouring country. this could be because the permanent mandates commission of the league of nations could not effectively check france and the european companies operating in togo, from importing liquor to the country because of the recognized economic gains from liquor trade for the economy of france and other european countries. we found that current drinking was associated with younger age, male gender, being unmarried, low educational status, low or low average socioeconomic class, christianity, and unemployment. our findings are in line with those of gureje., studies conducted in primary care settings in nigeria, as well as in community. these findings are also consistent with alcohol surveys conducted in togo, a neighbouring country, as well as previous studies in nigeria. in consonance with our study, grittner and colleagues opined that people with lower socioeconomic status (ses) could be more vulnerable to problems related to alcohol consumption. the most common consumed alcoholic beverage is beer and local spirits and this finding contrasts with the 1998 study in ibadan by bennett and colleagues that found palm wine and beer. however, the use of local spirits in this study is in consonance with findings from previous nigerian surveys. factors that mediate these observed patterns of beverage choice may include cost of distilled spirits and advertisement by local brewers. we also found that more than two - thirds of the current drinking population were moderate or high risk drinkers. this is pertinent considering that drinking alcohol is associated with a risk of adverse health consequences such as alcohol dependence, cancers, and injuries [16, 17 ] and, in semirural or rural settings, there is limited access to health care. although some primary care attendees may seek consultation for some of the physical health consequences of hazardous drinking, clinicians who are less likely to screen them for alcohol use talk less of initiating an intervention for their alcohol misuse. the multivariate analyses conducted in this study highlight protective and risk factors for alcohol use among dwellers in two semirural communities and provide important epidemiological data in terms of identification of a population who require special attention in terms of substance use prevention and intervention programs. policies that address poverty and improve socioeconomic indices such as increase in job creation and employment and broadening of social network are likely to impact on the level of alcohol use among dwellers in the rural settings in addition to those in the urban settings. the integration of these policies with evidence based alcohol policies that encapsulate demand control, supply control, and harm reduction will go a long way to reduce risky alcohol use and the adverse consequences of alcohol consumption. we are, however, cautious that a cross - sectional study can not underscore a clear causative inference. furthermore, there is the need for multiround cross - sectional studies to evaluate whether the prevalence of drinkers is increasing and whether those who drink are increasing their consumption intensity. an understanding of these trends will guide health promotion and preventive strategies and further lend support for programmes for screening and brief intervention and more intensive programmatic interventions. one, we did not allocate any diagnosis to the alcohol users ; therefore it was difficult to validate the level of health risk with the diagnosis of alcohol use disorder. also the external validity of the prevalence rates is limited because of diverse sociocultural characteristics of the nigerian population. in conclusion, the prevalence of unhealthy alcohol use is high in a representative sample of semirural communities and correlates include male gender, being unmarried, low educational status, low or low average socioeconomic class, christianity, and unemployment. this should inform policy decisions to address the magnitude of problematic alcohol use in rural settings, where majority of youth and adult in nigeria live. | objective. to determine the prevalence and correlates of alcohol use among a sample of nigerian semirural community dwellers in nigeria. methods. in a single arm nonrandomized intervention study, the assessment of baseline hazardous and harmful alcohol use and associated risk factors was conducted in two semirural local government areas of oyo state, nigeria, with the alcohol, smoking and substance involvement screening test (assist). participants included 1203 subjects 15 years and older, recruited between october 2010 and april 2011. assist score of 010 was classified as lower risk scores, 1126 as moderate risk, and 27 + as high risk. results. prevalence of lifetime alcohol use was 57.9% and current alcohol use was 23.7%. current alcohol use was more prevalent among the younger age group p = 0.02, male gender p = 0.003, unmarried p < 0.01, low educational level p = 0.003, low socioeconomic class p = 0.01, unemployed p < 0.001, and the christians p < 0.01. of the current drinkers, the majority (69.1%) were at either moderate or high health risk from alcohol use. conclusion. alcohol consumption is prevalent in semirural communities in nigeria and the majority of these drinkers are at moderate or high health risk. screening, brief intervention, and referral for treatment for unhealthy alcohol use should be integrated into community care services in nigerian rural communities. |
augmented contractility of postextrasystolic heartbeats has been described almost 130 years ago and later termed postextrasystolic potentiation (pesp). for almost 1 century, pesp was thought to reflect normal cardiac function. however, during the second half of the previous century, an increasing number of reports showed that, measured at the blood pressure (bp) level, pesp is a typical finding in heart failure (hf) patients. there have been attempts to use pesp as a diagnostic test to identify ischemic, but viable, myocardium and elicit pesp by paired pacing to augment cardiac contractility in hf, but these approaches have not led to broad clinical application. the magnitude of systolic calcium transient is primarily determined by the amount of calcium stored in the sarcoplasmic reticulum and by the availability of sarcoplasmic reticulum calcium release channels (ryanodine receptors). pesp and its augmentation in hf can be understood on the basis of the interplay of calciumhandling processes in cardiomyocytes : a premature beat leads to a cellular depolarization and influx of trigger calcium through ltype channels at a time point when a relevant fraction of ryanodine receptor channels is still refractory. resequestration of cytoplasmic calcium into the sarcoplasmic reticulum takes place during the postectopic pause, resulting in a higherthannormal sarcoplasmic reticulum calcium content to be released during the first postectopic beat. thus, the contractility of the first postectopic beat is augmented. in the failing myocardium, the sarcoplasmic reticulum contains less calcium, mostly because of leaky ryanodine receptors and a reduced capacity of the calcium uptake mechanism and partly compensated by upregulation of the plasma membrane sodium calcium exchanger. starting from this lower steady state, the relative increase in sarcoplasmic reticulum calcium content during the postectopic pause is even more pronounced, resulting in a greater amount of pesp than in a normal heart. this association between abnormal intracellular calcium cycling and increased pesp in hf is supported by both animal experiments and modeling studies. we hypothesized that pesp is a surrogate marker for hf at the cellular level that bears prognostic information in cardiac patients. the present study was designed to test pesp as a mortality predictor in myocardial infarction (mi) survivors. the study was a prospectively defined substudy of the autonomic regulation trial (art). between may 2000 and march 2005, consecutive patients were enrolled in the art study (nct00196274 registration at clinicaltrials.gov) at the german heart center and the klinikum rechts der isar (both in munich, germany). eligible patients survived the acute phase of mi, were aged 80 years, in sinus rhythm, and not eligible for implantable cardioverterdefibrillator (icd) for secondary prevention before hospital discharge. mi diagnosis required 2 or more of the following findings : typical chest pain for 20 minutes, creatine kinase above twice the upper normal limit of the respective laboratory, and admission stsegment elevation 0.1 mv in at least 2 limb leads or 0.2 mv in at least 2 contiguous precordial leads. patients were followed for a median of 6.3 years (interquartile range [iqr ], 5.5 to 7.0) with final followup in august 2010. allcause mortality at 5 years after the index mi was prospectively defined as the primary study endpoint. the study protocol was approved by the local ethics committee and all participants gave informed written consent. an independent validation cohort comprised 146 patients suffering from hf and presenting in sinus rhythm at the glasgow royal infirmary (glasgow, uk) between 1995 and 1998. these patients had an average age of 59 years, and 61 presented with new york heart association (nyha) class iii or iv. patients of the art cohort underwent simultaneous 30minute recordings of highresolution ecg (1.6khz sampling of orthogonal xyz leads ; tms international, enschede, the netherlands), and noninvasive arterial bp monitoring using a finger photoplethysmographic device (fms, amsterdam, the netherlands). recordings were obtained in supine resting position after routine morning medications and performed after patients were transferred from the intensive care unit to the ward (median day 7 ; iqr, 5 to 9 days after the index mi). raw signals were reviewed to eliminate artifacts and classify premature beats as sinus or ventricular premature complexes (vpcs). a vpc qualified for pesp assessment if 20% premature, compared to the mean of preceding 5 sinus rhythm intervals, and if followed by 10 consecutive sinus rhythm beats. postvpc bp changes were quantified as the relationship of the first postvpc pulse wave amplitude and the mean of the subsequent 9 pulse wave amplitudes. pesp was defined as present if the first postvpc pulse pressure wave exceeded the mean of the subsequent pulse pressure amplitudes (figure 1). in order to eliminate the influence of fluctuations in bp recordings, a technical threshold was introduced : taking into account that the mean standard deviation of systolic bp (sbp) in 10heartbeat sequences was 2.8% in our data, we defined pesp as present if the postvpc pulse pressure wave exceeded the mean of the subsequent pulse pressure amplitudes by more than 3%. if more vpcs in the same 30minute recording qualified for pesp evaluation, the ratios between the postvpc pulse pressure wave and the mean of the subsequent pulse pressure amplitudes were averaged. we also calculated the numerical ratio of pesp, that is, the relationship between postvpc pulse pressure and the mean pulse pressure of the subsequent sinus beats. determination of pesp based on ecg and bp signals. left panel shows ecg and blood pressure signals of a patient surviving the followup period (upper tracing) and a patient who died 16 months after the index mi (lower tracing). the systolic pressure of the first postectopic beat in the upper tracing is clearly lower than that of the following 9 beats, indicating that pesp is not present. conversely, the systolic pressure of the corresponding beat in the lower tracing is noticeably higher than that of the subsequent beats (pesp is present). right panels show peak systolic pressure of consecutive heart beats before, during, and after ectopic beats in these patients. vpc count was calculated from standard holter recordings as the number of vpcs per hour. the elements of the grace score included age, history of hf, history of mi, serum creatinine at admission, cardiac biomarker status at admission, sbp at admission, pulse frequency at admission, st deviation at admission, and inhospital percutaneous coronary intervention. left ventricular (lv) ejection fraction (lvef) was assessed by lv angiography (n=445 ; 47.3%) or biplane echocardiography according to simpson 's method (n=496 ; 52.7% ; sonos 5500 ; hewlett packard, palo alto, ca), on median day 7 (iqr, 5 to 9 days) after the index mi. grace score and lvef were dichotomized at predefined cutoff values of 120% and 35%, respectively. incomplete revascularization at the time of pesp measurement was defined as remaining stenosis 75% in any of the main coronary vessels after percutaneous coronary intervention (pci). all patients who had less than 4 years of followup were contacted by mail, telephone, or through the attending general practitioner. if none of these channels were successful, the local population registry was contacted to either provide a new address of the patient or confirm that the patient had deceased. patients who could not be reached by any of these channels were considered lost to followup and censored at the time of last contact. the prospectively defined study endpoint was death from any cause within 5 years of the index mi. we first calculated cox 's proportional hazards models with single predictors to evaluate their association with mortality. subsequently, a multivariable cox proportional hazards model was used with all 4 variables to simultaneously assess the independent prognostic value of each mortality predictor. the improvement of goodness of fit, measured by the cox model 's likelihood, upon the addition of pesp to the cox model fixed to lvef, grace score, and vpc counts was assessed in a permutation test framework. linear effect estimates were used in the cox model as a comparison to nonlinear effects by application of fractional polynomials showed no significant improvement in model fit (ie, likelihood). the improvement of risk prediction by inclusion of pesp in the cox model is presented by the integrated discrimination improvement index (idi). threefold crossvalidation was repeated 25 times for an averaged assessment and internal validation of idi values to be expected for external data. in a retrospective analysis, optimal cutoff values for the proportion between the first postvpc pulse wave amplitude and the mean of the subsequent 9 pulse wave amplitudes (termed further the numerical ratio of pesp) were determined from the receiveroperator characteristic (roc) curve at the maximum of the youden index j = sensitivity+specificity1. the corresponding 95% confidence intervals (cis) were determined by standard bootstrap with 5000 repetitions. roc analysis at 5 years was performed to assess corresponding areas under the receiveroperating characteristics curves (aurocs). all statistical analyses were done using ibm spss statistics 20.0 and r 3.0.1 (r foundation for statistical computing, vienna, austria). between may 2000 and march 2005, consecutive patients were enrolled in the art study (nct00196274 registration at clinicaltrials.gov) at the german heart center and the klinikum rechts der isar (both in munich, germany). eligible patients survived the acute phase of mi, were aged 80 years, in sinus rhythm, and not eligible for implantable cardioverterdefibrillator (icd) for secondary prevention before hospital discharge. mi diagnosis required 2 or more of the following findings : typical chest pain for 20 minutes, creatine kinase above twice the upper normal limit of the respective laboratory, and admission stsegment elevation 0.1 mv in at least 2 limb leads or 0.2 mv in at least 2 contiguous precordial leads. patients were followed for a median of 6.3 years (interquartile range [iqr ], 5.5 to 7.0) with final followup in august 2010. allcause mortality at 5 years after the index mi was prospectively defined as the primary study endpoint. the study protocol was approved by the local ethics committee and all participants gave informed written consent. an independent validation cohort comprised 146 patients suffering from hf and presenting in sinus rhythm at the glasgow royal infirmary (glasgow, uk) between 1995 and 1998. these patients had an average age of 59 years, and 61 presented with new york heart association (nyha) class iii or iv. patients of the art cohort underwent simultaneous 30minute recordings of highresolution ecg (1.6khz sampling of orthogonal xyz leads ; tms international, enschede, the netherlands), and noninvasive arterial bp monitoring using a finger photoplethysmographic device (fms, amsterdam, the netherlands). recordings were obtained in supine resting position after routine morning medications and performed after patients were transferred from the intensive care unit to the ward (median day 7 ; iqr, 5 to 9 days after the index mi). raw signals were reviewed to eliminate artifacts and classify premature beats as sinus or ventricular premature complexes (vpcs). a vpc qualified for pesp assessment if 20% premature, compared to the mean of preceding 5 sinus rhythm intervals, and if followed by 10 consecutive sinus rhythm beats. postvpc bp changes were quantified as the relationship of the first postvpc pulse wave amplitude and the mean of the subsequent 9 pulse wave amplitudes. pesp was defined as present if the first postvpc pulse pressure wave exceeded the mean of the subsequent pulse pressure amplitudes (figure 1). in order to eliminate the influence of fluctuations in bp recordings, a technical threshold was introduced : taking into account that the mean standard deviation of systolic bp (sbp) in 10heartbeat sequences was 2.8% in our data, we defined pesp as present if the postvpc pulse pressure wave exceeded the mean of the subsequent pulse pressure amplitudes by more than 3%. if more vpcs in the same 30minute recording qualified for pesp evaluation, the ratios between the postvpc pulse pressure wave and the mean of the subsequent pulse pressure amplitudes were averaged. we also calculated the numerical ratio of pesp, that is, the relationship between postvpc pulse pressure and the mean pulse pressure of the subsequent sinus beats. determination of pesp based on ecg and bp signals. left panel shows ecg and blood pressure signals of a patient surviving the followup period (upper tracing) and a patient who died 16 months after the index mi (lower tracing). the systolic pressure of the first postectopic beat in the upper tracing is clearly lower than that of the following 9 beats, indicating that pesp is not present. conversely, the systolic pressure of the corresponding beat in the lower tracing is noticeably higher than that of the subsequent beats (pesp is present). right panels show peak systolic pressure of consecutive heart beats before, during, and after ectopic beats in these patients. vpc count was calculated from standard holter recordings as the number of vpcs per hour. the elements of the grace score included age, history of hf, history of mi, serum creatinine at admission, cardiac biomarker status at admission, sbp at admission, pulse frequency at admission, st deviation at admission, and inhospital percutaneous coronary intervention. left ventricular (lv) ejection fraction (lvef) was assessed by lv angiography (n=445 ; 47.3%) or biplane echocardiography according to simpson 's method (n=496 ; 52.7% ; sonos 5500 ; hewlett packard, palo alto, ca), on median day 7 (iqr, 5 to 9 days) after the index mi. grace score and lvef were dichotomized at predefined cutoff values of 120% and 35%, respectively. incomplete revascularization at the time of pesp measurement was defined as remaining stenosis 75% in any of the main coronary vessels after percutaneous coronary intervention (pci). all patients who had less than 4 years of followup were contacted by mail, telephone, or through the attending general practitioner. if none of these channels were successful, the local population registry was contacted to either provide a new address of the patient or confirm that the patient had deceased. patients who could not be reached by any of these channels were considered lost to followup and censored at the time of last contact. the prospectively defined study endpoint was death from any cause within 5 years of the index mi. we first calculated cox 's proportional hazards models with single predictors to evaluate their association with mortality. subsequently, a multivariable cox proportional hazards model was used with all 4 variables to simultaneously assess the independent prognostic value of each mortality predictor. the improvement of goodness of fit, measured by the cox model 's likelihood, upon the addition of pesp to the cox model fixed to lvef, grace score, and vpc counts was assessed in a permutation test framework. linear effect estimates were used in the cox model as a comparison to nonlinear effects by application of fractional polynomials showed no significant improvement in model fit (ie, likelihood). the improvement of risk prediction by inclusion of pesp in the cox model is presented by the integrated discrimination improvement index (idi). threefold crossvalidation was repeated 25 times for an averaged assessment and internal validation of idi values to be expected for external data. in a retrospective analysis, optimal cutoff values for the proportion between the first postvpc pulse wave amplitude and the mean of the subsequent 9 pulse wave amplitudes (termed further the numerical ratio of pesp) were determined from the receiveroperator characteristic (roc) curve at the maximum of the youden index j = sensitivity+specificity1. the corresponding 95% confidence intervals (cis) roc analysis at 5 years was performed to assess corresponding areas under the receiveroperating characteristics curves (aurocs). all statistical analyses were done using ibm spss statistics 20.0 and r 3.0.1 (r foundation for statistical computing, vienna, austria). thirteen patients (1.4%) were lost to followup, and 45 additional patients were censored between 4 and 5 years of followup. at 5 years, 72 patients (7.7%) had died. clinical characteristics and therapy data ace indicates angiotensinconverting enzyme ; art, autonomic regulation trial ; cabg, coronary artery bypass grafting ; grace score, composite of age of the patient, serum creatinine, past myocardial infarction, past heart failure, inhospital percutaneous coronary intervention, heart rate, systolic blood pressure, st segment deviation, and positive enzymes ; iqr, interquartile range ; lvef, left ventricular ejection fraction ; mi, myocardial infarction ; nyha, new york heart association functional class ; pci, percutaneous coronary intervention ; stemi, stelevation myocardial infarction. a total of 220 (23.4%) patients exhibited 1 or more vpcs during the 30minute recording suitable for pesp assessment. art indicates autonomic regulation trial ; pesp, postextrasystolic potentiation ; vpc, ventricular premature complex. figure 3a shows cumulative mortality curves for patients classified as pesp present, pesp absent, and pesp not measurable. the probability of death at 5 years was 29.4% in patients with pesp present and 5.8% in patients with pesp absent. the probability of death of patients in whom pesp could not be measured was similar to that of patients with pesp absent (6.3%). for the following analyses, we consequently merged the categories of pesp absent and pesp not measurable. merging these patient categories parallels the classification of heart rate turbulence, the assessment of which also considers patients without suitable vpcs to present with a negative result. a, mortality probability over 5 years in patients stratified according to the presence (red curve) and absence of pesp (green curve). the mortality probability of patients whose recordings lacked vpcs suitable for the quantification of pesp is also shown (gray curve). because there was no significant difference in patients with pesp absent and without suitable vpcs, both subgroups were merged for additional analyses. b, probability of death in patients stratified by the combination of pesp (absent and present) and lvef (35% and > 35%). the numbers of patients at risk in the individual groups at 0, 1, 2, 3, 4, and 5 years are shown below the graphs in the same color coding. lvef indicates left ventricular ejection fraction ; pesp, postextrasystolic potentiation ; vpc, ventricular premature complex. in univariable cox regression analysis, all 4 considered risk factors (ie, pesp, lvef, vpc count, and grace score) were significantly associated with outcome. the presence of pesp was associated with a hazard ratio (hr) of 5.5 (95% ci, 3.2 to 9.4 ; p 35% and pesp absent had a 5year mortality risk of 5.1%. patients in whom only 1 variable was abnormal had mortality risks of 18.2% (lvef 35% and pesp absent) or 23.8% (lvef > 35% and pesp present). when pesp was added to lvef, the idi index was 0.003 in survivors and 0.034 in nonsurvivors (p=0.05 and 0.009, respectively). an internal validation by 3fold crossvalidation, repeated 25 times, resulted in average idi values of 0.003 and 0.034, stressing the robustness of the results. when a highrisk group was defined by use of lvef alone, positive predictive value was 23.0% at a sensitivity level of 27.8% (table 3). the definition of a highrisk group was more precise if lvef and pesp were used in combination : positive predictive value (ppv) remained stable at 23.1%, whereas sensitivity significantly increased to 43.1% (p 35% and pesp absent had a 5year mortality risk of 5.1%. patients in whom only 1 variable was abnormal had mortality risks of 18.2% (lvef 35% and pesp absent) or 23.8% (lvef > 35% and pesp present). when pesp was added to lvef, the idi index was 0.003 in survivors and 0.034 in nonsurvivors (p=0.05 and 0.009, respectively). an internal validation by 3fold crossvalidation, repeated 25 times, resulted in average idi values of 0.003 and 0.034, stressing the robustness of the results. when a highrisk group was defined by use of lvef alone, positive predictive value was 23.0% at a sensitivity level of 27.8% (table 3). the definition of a highrisk group was more precise if lvef and pesp were used in combination : positive predictive value (ppv) remained stable at 23.1%, whereas sensitivity significantly increased to 43.1% (p<0.001). group sizes and numbers of primary endpoints, sensitivities, specificities, and positive and negative predictive values for selected subroups defined by lvef and pesp e indicates number of primary endpoints ; lvef, left ventricular ejetion fraction ; n, size of subgroup ; npv, negative predictive value ; pesp, postextrasystolic potentiation ; ppv, positive predictive value. because the baseline variables presented in table 1 might represent confounders, especially if associated both with pesp and mortality, we tested whether inclusion of these factors in the multivariable cox regression model consisting of pesp, lvef, vpc count, and grace score would reduce the prognostic power of pesp. none of the tested parameters led to a loss of significant association of pesp with mortality when included in the analysis. we conclude that the association of pesp and mortality is not a result of confounding by any of these parameters. hazard ratios for pesp, together with 95% confidence intervals, are shown for multivariable models in which singular additional baseline variables (as indicated) were included in the cox analysis in addition to the baseline model consisting of pesp, lvef, vpc count, and grace score. ass indicates acetylsalicylic acid ; ami, acute myocardial infarction ; cabg, coronary artery bypass grafting ; lvef, left ventricular ejection fraction ; nyha, new york heart association functional class ; pci, percutaneous coronary intervention ; pesp, postextrasystolic potentiation ; stemi, stelevation myocardial infarction ; vpc, ventricular premature complex. the novelty of the concept of pesp as a postmi risk predictor requires independent validation. to our best knowledge, there is only 1 other data set of simultaneous ecgs and continuous bp measurements suitable for both pesp quantification and risk assessment : a scottish cohort of 146 hf patients. during a followup period of 2.71.1 years, pesp could be measured in 105 of these patients ; data in 41 were not suitable for assessment because of the lack of ventricular ectopy during the 10minute recording. figure 5 shows survival analysis of patients with pesp present and absent, including patients in whom pesp was not measurable. the same principal result as in the main study cohort is seen this was confirmed by uni and multivariable cox regression analysis, indicating that presence of pesp was a strong predictor of mortality independent of other established risk predictors (data not shown). figure 6 depicts the mortality probability of patients from both cohorts as a function of numerical ratio of pesp. the optimum cutoff values for numerical ratio of pesp were 1.037 (95% ci, 0.994 to 1.045) and 1.093 (0.985 to 1.124) in the art and scottish cohorts, respectively. thus, the prospective definition of pesp present and absent was well within the 95% ci of both art and scottish cohorts. mortality probability over the followup period in patients stratified according to pesp presence (red curve) and absence (green curve). mortality probability of patients in whom pesp was not evaluable is also shown (gray curve). the numbers of patients of the 2 groups involved in the analysis at 0, 1, 2, and 3 years are shown below the graph in the same color coding. mortality probabilities and their 95% confidence intervals on a continuous scale of a pesp numerical ratio. data from the postinfarction patients included in the art study are depicted in pink, and data from the heart failure patients from the validation study are shown in cyan. the horizontal axis shows the proportion of the first postvpc pulse wave amplitude to the mean of the subsequent 9 pulse wave amplitudes. art indicates autonomic regulation trial ; pesp indicates postextrasystolic potentiation ; vpc, ventricular premature complex. this is the first study that prospectively investigated postextrasystolic bp potentiation as a risk predictor in cardiac patients. the main finding in our data is that pesp was a strong predictor of mortality in postmi and hf patients : in patients with pesp present in the art cohort, mortality was 5fold higher than in the remaining patients. in the multivariable model, which included the grace score, arrhythmia count, and lvef, the highrisk subgroup identified by pesp was small (only 6.6% of the enrolled patients). naturally, our study does not provide data on whether any intervention can reduce this risk. however, because of the small size of the highrisk group identified by pesp, such an intervention would have to be targeted only at a small subgroup of postinfarction patients. the contribution to risk stratification provided by pesp and lvef was complementary : whereas the large subgroup of patients with both pesp and lvef normal was at very low risk of subsequent death (5year mortality risk, 5.1%), this risk was substantial for patients with 1 abnormal parameter, regardless of whether this was lvef (18.2%) or pesp (23.8%). the highest mortality risk was observed in the subgroup of patients with both pesp and lvef abnormal (46.7%). the association of pesp with mortality was consistently observed also in the independent scottish cohort of hf patients. in both cohorts the concept that pesp represents a surrogate for clinical or subclinical hf might be counterintuitive at first sight. it is, however, supported not only by clinical observations, but also by experimental studies as well as by mathematical modeling of calcium cycling processes. for example, a mouse model of depressed lv function induced by overexpression of phospholamban (the major negative regulator of sarcoplasmic reticulum calcium uptake) showed a greater magnitude of pesp, compared to isogenic control mice. if pesp is invasively measured as lv dp / dtmax of the first postectopic beat, a potentiation is observed in both healthy subjects and hf patients, but augmented in the latter. the beattobeat bp changes are determined not only by the contractility of the heart, but also by a vascular component. if pesp is measured as sbp of the first postectopic beat, a potentiation is typically not observed in healthy subjects, but in hf patients. in both of our patient cohorts, the calcium cycling abnormalities underlying pesp may facilitate the generation of both early and delayed afterdepolarizations. consequently, pesp does not only indicate hfrelated abnormalities at the cellular level, but also a propensity to potentially lethal arrhythmias. pesp can be observed either after spontaneous vpcs as it was done in this study or after instrumentally induced vpcs. we foresee a scale of potential clinical applications, including risk assessment in various cardiac conditions, improved patient selection for icd and cardiac resynchronization therapy, and a contribution to the optimization of hf therapy. because the pharmacological modulation of the pathways involved in myocardial calcium homeostasis is a promising approach for the treatment of both systolic and diastolic hf, pesp might become helpful either in selecting patients who will most likely benefit from such treatment or in providing a measurable surrogate of treatment effects. because of the limited number of deaths (especially in the group of patients with vpcs suitable for pesp assessment), the power to assess the association with morespecific endpoints is limited. when we repeated the analyses for the association with cardiac mortality (as adjudicated by an event committee), we obtained practically the same results (not shown here). because of even smaller numbers of sudden cardiac deaths because no independent cohort of mi patients was available to validate our results from the art trial, we used the scottish cohort of advanced hf patients for the validation study. mi was not an inclusion criterion for this cohort, even though 86% had ischemic heart disease. the disparities between the 2 cohorts might be interpreted as a weakness, because the 2 cohorts are not necessarily comparable both in terms of clinical variables and pathophysiology. however, the disparities may be also considered a strong point, because they permit to extend the results of our study to patients with hf of different origin. because we did not systematically assess subsequent icd implantations, we can not provide reliable data on how many of the patients received this therapy during followup. this might have lead to underestimation of the predictive power of pesp in case patients predicted to be at high risk had adequate icd shocks that prevented sudden cardiac death. to make the calculation less noise sensitive, we prospectively decided to relate the first postvpc pulse wave amplitude to the mean of the subsequent 9 pulse wave amplitudes, rather than to the prevpc pulse wave amplitude. when retrospectively using the ratio between the post and prevpc pulse wave amplitudes, the results were practically the same, although reaching slightly lesser statistical significances (likely the result of noise influence). pesp can be observed either after spontaneous vpcs as it was done in this study or after instrumentally induced vpcs. we foresee a scale of potential clinical applications, including risk assessment in various cardiac conditions, improved patient selection for icd and cardiac resynchronization therapy, and a contribution to the optimization of hf therapy. because the pharmacological modulation of the pathways involved in myocardial calcium homeostasis is a promising approach for the treatment of both systolic and diastolic hf, pesp might become helpful either in selecting patients who will most likely benefit from such treatment or in providing a measurable surrogate of treatment effects. because of the limited number of deaths (especially in the group of patients with vpcs suitable for pesp assessment), the power to assess the association with morespecific endpoints is limited. when we repeated the analyses for the association with cardiac mortality (as adjudicated by an event committee), we obtained practically the same results (not shown here). because of even smaller numbers of sudden cardiac deaths because no independent cohort of mi patients was available to validate our results from the art trial, we used the scottish cohort of advanced hf patients for the validation study. mi was not an inclusion criterion for this cohort, even though 86% had ischemic heart disease. the disparities between the 2 cohorts might be interpreted as a weakness, because the 2 cohorts are not necessarily comparable both in terms of clinical variables and pathophysiology. however, the disparities may be also considered a strong point, because they permit to extend the results of our study to patients with hf of different origin. because we did not systematically assess subsequent icd implantations, we can not provide reliable data on how many of the patients received this therapy during followup. this might have lead to underestimation of the predictive power of pesp in case patients predicted to be at high risk had adequate icd shocks that prevented sudden cardiac death. to make the calculation less noise sensitive, we prospectively decided to relate the first postvpc pulse wave amplitude to the mean of the subsequent 9 pulse wave amplitudes, rather than to the prevpc pulse wave amplitude. when retrospectively using the ratio between the post and prevpc pulse wave amplitudes, the results were practically the same, although reaching slightly lesser statistical significances (likely the result of noise influence). a pesp bp pattern is characteristic of a disturbed contractile state of the heart. in this study, | backgroundpostextrasystolic blood pressure potentiation (pesp), the pulse wave augmentation after an extrasystolic beat, is typically enhanced in heart failure (hf) patients. this study prospectively tested the association of pesp and mortality in cardiac patients.methods and resultsconsecutive patients (n=941 ; mean age, 61 years ; 19% female) presenting with acute myocardial infarction were enrolled between may 2000 and march 2005 and followed up until august 2010. the main study outcome was 5year allcause mortality. patients underwent noninvasive 30minute recordings of ecg and continuous blood pressure. pesp presence was based on the ratio between the first postectopic pulse wave amplitude and the mean of the subsequent 9 pulse wave amplitudes. a ratio above 1 was prospectively defined as pesp present. ventricular premature complexes (vpcs) suitable for pesp quantification were present in recordings of 220 patients. pesp was present in 62 of these patients. patients without suitable vpcs were classified as pesp absent.during the followup, 72 patients died. among the 220 patients in whom pesp was measurable, 27 died. under univariable analysis, pesp was a significant predictor of death (p<0.001) as were grace score (p<0.001), left ventricular ejection fraction (lvef) (p<0.001), and the number of recorded vpcs (p<0.001). under multivariable analysis, pesp (p<0.001), grace score (p<0.001), and lvef (p=0.001) were independently associated with outcome. the combination of pesp presence and lvef 35% identified a subgroup of patients with a particularly high mortality of 46.7%. separate validation reproduced the finding in an unrelated population of 146 hf patients.conclusionspesp, which likely reflects abnormalities of myocardial calcium cycling, predicts the mortality risk in postinfarction patients.clinical trial registrationurl : clinicaltrials.gov. unique identifier : nct00196274. |
(1907), is one of over 60 endogenous enzymes present in raw bovine milk (schlimme., 1997). since alp is inactivated by thermal treatment, reduced levels of alp activity are an indicator of adequate milk pasteurization (rankin., 2010). the alp assay is widely used and recognized as the most appropriate indirect method for verifying complete milk pasteurization due to its rapidity and sensitivity (rankin., 2010). the united states food and drug administration (fda) outlines quantitative criteria for alp levels in cheese products (united states food and drugs administration, 2001) ; the levels can be measured with a spectrophotometer and are expressed as micrograms of phenol per gram of cheese (united states food and drugs administration, 2001). in contrast, korea uses a qualitative standard for determining alp levels in pasteurized milk products (korea food and drug administration, 2015), and the results are compared visually against a set of standards (korea food and drug administration, 2015). the results of such a visual colorimetric method can be easily misinterpreted, which poses a huge public health risk, since contaminated milk is an important vehicle for the foodborne transmission of numerous pathogens (klotz., 2008). therefore, the interpretation of the results of alp assays for milk samples should be improved. the aim of this study was to establish quantitative standards for alp in pasteurized milk by using a spectrophotometric method. raw bovine milk was kindly provided by a cow farm located in gyeonggi province and stored at 4 for 1 h. the raw milk was divided into conical tubes in 10 ml aliquots and subjected to heat treatment for 0, 10, 20, 30, and 40 min at 63 using a heat block. the heat - treated milk samples were used to determine alp cut - off values in properly pasteurized milk. the determined cut - off value was verified using seven low - temperature and five ultra - high temperature (uht ; heat treated for 3 sec at 135) pasteurized milk products purchased from a retail market in seoul, korea. in addition, the raw milk was heat treated for 5 min at 95, regarded as high - temperature short - time (htst) pasteurized milk. alp levels in the milk samples were analyzed using a spectrophotometer (multiskan fc ; thermo fisher scientific, usa) following a method outlined in the fda s bacteriological analytical manual (united states food and drugs administration, 2001). two 0.5 ml samples (test and boiled control samples) were mixed with 0.5 ml of distilled water. controls were heated in a boiling water bath for 2 min and then rapidly cooled in an ice bath. five milliliters of 2-amino-2-methyl-1-propanol (amp) buffer substrate were added to both the test and boiled control and mixed by vortexing. test samples and boiled controls were then immediately incubated in a 40 water bath for 15 min. subsequently, the test samples were mixed with 0.2 ml 2,6-dichloro - quinonechloroimide (cqc) catalyst solution. the mixture was immediately placed back in the 40 water bath for 5 min and then cooled in an icewater bath for 5 min. next, 3 ml of butanol was added to the samples and mixed by inverting the tubes six times. the mixtures were chilled in an ice - water bath for 5 min and then centrifuged for 5 min at 2400 g. the butanol (upper) phase was transferred to a new test tube. the alp standard curve was created using a phenol standard solution according to the bam method (united states food and drugs administration, 2001). one gram of pure phenol was added to 1 l of 0.1 n hcl and gently mixed. one hundred microliters of the solution were added to 100 ml of amp buffer, and gently mixed. finally, 0, 0.25, 0.5, 1, 2.5, and 5 ml of the solution were added to 5 ml of amp buffer and then 0.5 ml of water was added to each tube. the phenol standard solutions were incubated in a water bath for 15 min at 40. subsequently, the test samples were mixed with 0.2 ml cqc catalyst solution. the mixture was immediately placed back in the 40 water bath for 5 min then cooled in an ice - water bath for 5 min. next, 3 ml of butanol were added to the samples and mixed by inverting the tubes six times. the mixtures were chilled in an ice - water bath for 5 min and then centrifuged for 5 min at 2400 g. the butanol (upper) phase was removed to a new test tube. the standard curve was plotted as g phenol against absorbance and a linear function equation was calculated. the absorbance of milk samples measured with a spectrophotometer was converted into g phenol / ml values using the standard curve. the g phenol / ml milk value of the boiled blank was subtracted from the corresponding sample providing the final g phenol / ml milk for the sample. the g phenol / ml milk value of each sample was analyzed for statistical significance using a student s t - test. raw bovine milk was kindly provided by a cow farm located in gyeonggi province and stored at 4 for 1 h. the raw milk was divided into conical tubes in 10 ml aliquots and subjected to heat treatment for 0, 10, 20, 30, and 40 min at 63 using a heat block. the heat - treated milk samples were used to determine alp cut - off values in properly pasteurized milk. the determined cut - off value was verified using seven low - temperature and five ultra - high temperature (uht ; heat treated for 3 sec at 135) pasteurized milk products purchased from a retail market in seoul, korea. in addition, the raw milk was heat treated for 5 min at 95, regarded as high - temperature short - time (htst) pasteurized milk. alp levels in the milk samples were analyzed using a spectrophotometer (multiskan fc ; thermo fisher scientific, usa) following a method outlined in the fda s bacteriological analytical manual (united states food and drugs administration, 2001). two 0.5 ml samples (test and boiled control samples) were mixed with 0.5 ml of distilled water. controls were heated in a boiling water bath for 2 min and then rapidly cooled in an ice bath. five milliliters of 2-amino-2-methyl-1-propanol (amp) buffer substrate were added to both the test and boiled control and mixed by vortexing. test samples and boiled controls were then immediately incubated in a 40 water bath for 15 min. subsequently, the test samples were mixed with 0.2 ml 2,6-dichloro - quinonechloroimide (cqc) catalyst solution. the mixture was immediately placed back in the 40 water bath for 5 min and then cooled in an icewater bath for 5 min. next, 3 ml of butanol was added to the samples and mixed by inverting the tubes six times. the mixtures were chilled in an ice - water bath for 5 min and then centrifuged for 5 min at 2400 g. the butanol (upper) phase was transferred to a new test tube. the alp standard curve was created using a phenol standard solution according to the bam method (united states food and drugs administration, 2001). one gram of pure phenol was added to 1 l of 0.1 n hcl and gently mixed. one hundred microliters of the solution were added to 100 ml of amp buffer, and gently mixed. finally, 0, 0.25, 0.5, 1, 2.5, and 5 ml of the solution were added to 5 ml of amp buffer and then 0.5 ml of water was added to each tube. the phenol standard solutions were incubated in a water bath for 15 min at 40. subsequently, the test samples were mixed with 0.2 ml cqc catalyst solution. the mixture was immediately placed back in the 40 water bath for 5 min then cooled in an ice - water bath for 5 min. next, 3 ml of butanol were added to the samples and mixed by inverting the tubes six times. the mixtures were chilled in an ice - water bath for 5 min and then centrifuged for 5 min at 2400 g. the butanol (upper) phase was removed to a new test tube. the standard curve was plotted as g phenol against absorbance and a linear function equation was calculated. the absorbance of milk samples measured with a spectrophotometer was converted into g phenol / ml values using the standard curve. the g phenol / ml milk value of the boiled blank was subtracted from the corresponding sample providing the final g phenol / ml milk for the sample. the g phenol / ml milk value of each sample was analyzed for statistical significance using a student s t - test. raw milk, a highly perishable, potentially hazardous food source, has been recognized as a significant vehicle for the foodborne transmission of many pathogens (rankin., 2010). many regulatory bodies have consequently mandated that milk be subjected to thermal treatment (klotz., 2008). different letters in the same column indicate statistical differences (p<0.05, student s t - test). colorimetric, fluorometric, chemiluminescent, and immunochemical methods have been employed to detect residual alp activity for decades (rankin., 2010). in dairy industry, the colorimetric assay is the most commonly and broadly adopted to verify pasteurization adequacy (rankin., 2010). despite many advantages of being rapid, inexpensive, and convenient, colorimetric alp assays might be unreliable especially in samples with alp levels of near the detection limits, because the interpretation depends on subjective visual assessments of color development (murthy., 1992). consequently, it is needed to develop a more objective methodology to confirm the results of colorimetric alp assays (murthy., 1992). in order to quantify the residual alp level in milk samples, a standard curve was generated using a phenol standard solution (fig. the linear function equation for the alp standard curve was y = 0.0047x + 0.0844 (x, g phenol / ml milk ; y, absorbance at 650 nm) and the correlation coefficient (r) was 0.9916. significant differences were apparent among the levels of residual alp in the milk samples heat - treated for 0, 10, 20, 30, and 40 min. since the legal definition for pasteurization is 63 for 30 min, the cut - off value was set at 2 g phenol / ml of milk, which is just above the alp value of milk samples heat - treated for 30 min. in addition, the mean value of residual alp in htst - pasteurized milk was 0 g phenol / ml milk. the residual alp level of seven commercial low - temperature and five uht - pasteurized milk products was tested using the determined cut - off value. the mean value of residual alp in commercial pasteurized milk products was 0 g phenol / ml milk ; none of the tested milk samples demonstrated levels higher than the cut - off value, suggesting that all tested milk products were properly pasteurized. according to the bam, the quantitative criteria for residual alp in cheese products differ by cheese type (united states food and drugs administration, 2001) ; the maximum levels range from 12 to 20 g phenol / g cheese. this cut - off value is higher than the value determined in the present study. this might be due to cheese containing bacterial starter cultures, which could provide a source of alp (fanni, 1983 ; hammer and olson, 1941). in addition, according to the aoac official methods, the criterion for residual alp in milk is 4 g phenol / ml of cow milk (aoac international, 2000). this is less stringent than the 2 g phenol / ml of milk value determined in this study, suggesting that quantitative criteria could improve the safety of milk products. the results of the present study provide basic information regarding the relationship between the duration of heat - treatment and residual alp levels, which could aid in establishing quantitative criteria for residual alp in milk products, thereby facilitating microbiological quality control of dairy products and improving public health. | the alkaline phosphatase (alp) assay is a rapid and convenient method for verifying milk pasteurization. since colorimetric alp assays rely on subjective visual assessments, their results are especially unreliable near the detection limits. in this study, we attempted to establish quantitative criteria for residual alp in milk by using a more objective method based on spectrophotometric measurements. raw milk was heat - treated for 0, 10, 20, 30, and 40 min and then subjected to alp assays. the quantitative criteria for residual alp in the milk was determined as 2 g phenol / ml of milk, which is just above the alp value of milk samples heat - treated for 30 min. these newly proposed methodology and criteria could facilitate the microbiological quality control of milk. |
the online version of this article (doi:10.1007/s13555 - 016 - 0096 - 7) contains supplementary material, which is available to authorized users. skin has recently been shown to be a cortisol - producing organ and the cortisol controls the skin itself by regulating differentiation process from basal cells to corneal cells [1, 2 ]. topical corticosteroids (tcs) may have some influence on the production of cortisol in the skin and its influence can be associated with some side effects of tcs. there have been many reported side effects with tcs ; topical corticosteroid addiction (tsa) [4, 5 ] which is discussed mainly in atopic dermatitis (ad) [6, 7 ] is one such side effect. as the difference between original ad and tsa is little in the skin manifestation, the conception of tsa has not been widely recognized even among dermatologists. the diagnosis of tsa has been done by the clinical course including ineffectiveness of tcs after prolonged use and severe rebound phenomenon after withdrawal which subsides in months or years without any treatment. the author built a hypothesis that tsa is caused by the suppressed self - production of cortisol in the keratinocytes and conducted an immunohistological study using anti - cortisol antibody in patients with ad. the specimen was fixed by formaldehyde and sent to the laboratory (morphotechnology, co., ltd, sapporo japan). the paraffin - embedded specimens were treated by ph 6 citrate buffer solution for 20 min at 9598 c for the purpose of antigen retrieval. the monoclonal antibody against human cortisol from byorbyt co., ltd (catalogue number : orb79379) was used as the primary antibody. all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1964, as revised in 2013. cortisol in the epidermis was stained homogeneously in healthy individuals by the preliminary study and in all three patients recovered from tsa (fig. 1, case 3, 4, and 5). the histological difference among patients with active and inactive eczema in the three cases was in the existence of spongiosis and parakeratosis.fig. 1three adult patients recovered from tsa. case 3 (upper) : almost normal clinical and histological appearance. note that the eczema is located on the armpit that is the predilection site of atopic dermatitis without tsa. note that the eczema is located on the armpit that is the predilection site of atopic dermatitis without tsa. tsa topical steroid addiction a patient with insistent lesion on the face long after tsw also presented parakeratosis and immature corneal layer while the patient showed normal keratosis in the armpit (fig. 2, the eczema was mild in the armpit in which corneal layer was mature (fig. 1, middle). the lower is the improved appearance after 1 year without resuming topical corticosteroid in case 7. the cortisol staining in the epidermis became homogeneous suggesting the recovery of self - production of cortisol in keratinocytes supplementation for case 4 (upper) and case 7 (lower). the eczema was mild in the armpit in which corneal layer was mature (fig. 1, middle). the lower is the improved appearance after 1 year without resuming topical corticosteroid in case 7. the cortisol staining in the epidermis became homogeneous suggesting the recovery of self - production of cortisol in keratinocytes a child patient with a short history of tcs application (fig. 3, case 1), an adult patient with a long history of tcs application (fig. 3, case 2) and two patients with rebound phenomenon after tsw (fig. 4, case 6 and 7) whose skin manifestations were obviously different from those of typical ad showed patchy defect of cortisol staining in the epidermis. one of the two patients with rebound was re - examined after improvement in 1 year and his epidermis showed homogeneous pattern in cortisol staining (fig. 2, 3the child patient with a short history of tcs application (case 1, upper) and the adult patient with a long history of tcs application (case 2, lower). both showed patchy defect of cortisol staining and prominent parakeratosis with immature corneal layer. case 2 was apparently well controlled by tcs with the epidermis of normal thickness and few inflamed cells in the dermis. case 6 (upper) : diffuse papulo - erythematous lesion that is atypical as atopic dermatitis, but typical as topical steroid addiction. case 8 (lower) : demarcated geographic erythema that is one typical pattern developing after tsw. tsw topical steroid withdrawal the child patient with a short history of tcs application (case 1, upper) and the adult patient with a long history of tcs application (case 2, lower). both showed patchy defect of cortisol staining and prominent parakeratosis with immature corneal layer. case 2 was apparently well controlled by tcs with the epidermis of normal thickness and few inflamed cells in the dermis. case 6 (upper) : diffuse papulo - erythematous lesion that is atypical as atopic dermatitis, but typical as topical steroid addiction. case 8 (lower) : demarcated geographic erythema that is one typical pattern developing after tsw. case 6 and tsw topical steroid withdrawal a patient with rebound phenomenon after tsw whose skin lesion expanded geographically and disappeared as its development showed homogeneous pattern in cortisol staining while parakeratosis with immature corneal layer was prominent (fig. 4, there has been little reported about the histological or immunohistological characteristics of tsa in ad. [8, 9 ] reported that parakeratosis and insufficient corneal layer formation were characteristic in patients with tsa by examining the inconsistent erythema on the face. the finding coincides with our cases (case 4 cheek, case 5, 6, 7, and 8). it is well known that cortisol production from the adrenal gland is suppressed by long - term use of systemic steroids. as far as the skin is also the organ which produces cortisol, its function can be influenced by the long - term application of tcs. the fact that epidermis becomes thin and atrophic after prolonged use of tcs and temporarily thickens after withdrawal can be explained by that mechanism. cortisol production by keratinocytes might work to regulate or moderate the friction between the outer environment and inner immune system by suppressing excessive inflammation or immune reaction. however, prolonged or excessive use of tcs induces skin atrophy which can make barrier function weak. moreover, the decreased self - production of cortisol by the keratinocytes can cause hypersensitivity. the author considers it is one of the mechanisms of tsa or rebound phenomenon after tsw. in this study, a child patient with short - term history of tcs application presented patchy defect of cortisol production in the epidermis as with the adult patients with tsa, while the pattern was homogeneous in a healthy adult individual. the author suspects that the production of cortisol in keratinocytes is immature at early ages before childhood and that is the reason why eczema is developed at such ages and heals naturally with growth. parakeratosis or immature corneal layer formation which remains incontinently long after tsw as in case 4 (cheek) might be associated with another mechanism of tsa because the cortisol staining in the epidermis was homogeneous. however, the possibility that the cortisol production in the epidermis is decreasing in such cases still remains because the immunohistological study was not quantitative. the author admits that the population of the cases is too small to prove the above hypothesis. prolonged application of tcs might suppress the cortisol production of keratinocytes which is poorly developed at the early ages before childhood and completed naturally as to growth. rebound phenomenon after tsw can occur due to the relative insufficiency of cortisol in the epidermis and the immature corneal layer formation. below is the link to the electronic supplementary material. supplementary material 1 (pdf 223 kb) supplementary material 1 (pdf 223 kb) all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1964, as revised in 2013. this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made. | introductionthough topical steroid addiction (tsa) in patients with atopic dermatitis (ad) has been recently discussed as a clinical problem, there are very few studies about its mechanism. the purpose of this study was to elucidate histological and immunohistological characteristics of tsa using anti - cortisol antibody.methodsskin biopsy specimen from eight patients with ad was stained by anti - cortisol antibody (biorbyt, orb79379). subjects consisted of a child patient with a short history of topical corticosteroids (tcs) application, an adult patient with a long history of tcs application, and six adult patients who have experienced topical steroid withdrawal (tsw) and the rebound phenomenon.resultsthe staining in the epidermis by anti - cortisol antibody presented patchy defects in the child patient, the patient with a long history of tcs application, and two patients at the rebound period. parakeratosis with poor formation of corneal layer was obvious in the child patient, the patient with a long history of tcs application, two patients recovered from tsa, and two patients at the rebound period.conclusionprolonged application of tcs might suppress the cortisol production of keratinocytes which is poorly developed at the early ages before childhood and completed naturally as to growth. rebound phenomenon after tsw can occur due to the relative insufficiency of cortisol in the epidermis and the immature corneal layer formation.electronic supplementary materialthe online version of this article (doi:10.1007/s13555 - 016 - 0096 - 7) contains supplementary material, which is available to authorized users. |
resonance light scattering (rls) is an elastic scattering and occurs when an incident beam in energy is close to an absorption band. first established the rls technique to study the biological macromolecules by means of an ordinary fluorescence spectrometer. due to its high sensitivity, selectivity, and convenience, rls studies have attracted great interest among researchers. in recent years, rls technique has been used to determine pharmaceutical [25 ], ion, bacteria, and various biological macromolecules, such as nucleic acids [810 ], proteins [1115 ], and peptide. over the years, numerous analytical methods for cl in a variety of samples have been developed, such as ion chromatography [17, 18 ], near - infrared spectrometry, spectroscopy, ion - selective electrode method, turbidimetric method, and so on. among these methods, the turbidimetric method was popular and regarded relatively reliable for the quantification of cl. although it often provided very accurate results, it suffered from the long experimental time, lower sensitivity, and complexity. partly, because of the lower sensitivity, few of the above methods were applied to determine cl in biological systems. the classical ion - selective electrode method is currently used in food analysis of cl in drinks. nevertheless, these methods similarly suffered from the drawbacks of low sensitivity and inapplicability to low chloride - containing samples. the objectives of this report are to establish a rapid, sensitive, and selective rls analytical method to determine of cl and to develop an alternative standard method for determination of cl in marketing drink. the obtained results were compared with that of the ion - selective electrode method. rls spectra were recorded on a jasco fp-6500 spectrofluorophotometer equipped with a thermostated cell compartment using quartz cuvettes (1.0 cm) (japan). the width of excitation and emission slits was set at 3.0 nm. a bayer rapidchem 744 electrolyte analyzer (uk) was used in the ion - selective electrode detection. the ph measurements were carried out on a phs-3c exact digital ph meter equipped with phonix ag - agcl reference electrode (cole - parmer instrument co., ill, usa), which was calibrated with standard ph buffer solutions. a stock solution containing 355.00 ng ml of cl was prepared by dissolving 0.5850 g of nacl (> 99.99%, sigma co., mo, usa) in doubly distilled water and diluting to 1000 ml. the working solutions were obtained by diluting the stock solution prior to use. a working solution of silver nitrate (169.87 g ml) all other reagents and solvents were of analytical reagent grade and used as purchased. hac and nh3h2o (0.01 mol l) were used to control the acidity, while 0.10 mol l nano3 was used to adjust the ionic strength of the aqueous solutions. an appropriate aliquot of cl working solution was added to 1.0 ml of silver nitrate working solution and diluted to 10.0 ml with water. after standing for five minutes, the solution was synchronous scanned on the spectroflourometer through the wavelength range of 250750 nm. the obtained rls spectra were recorded, and the intensity was measured at 571 nm. the enhanced rls signal of agcl system was represented as i = i i0 (i and i0 are the rls intensity of the system in the presence and absence of cl, resp.). the mineral water, pure water, and green tea commonly found in the supermarket were used as samples. the famous brands such as nongfu spring, laoshan, nestl, robust, watsons, and masterkong were taken into account. these samples were diluted with double - distilled water and sterilized by filtration (0.2 m) before testing. chloride ion in each sample was determined by the above - mentioned procedures by adding a 1.0 ml aliquot of the prepared sample instead of the chloride ion working solution. the rls spectra of cl and agno3 in water were shown in figure 1(a) and (b), respectively. it can be seen that the rls intensity of agno3 solution is quite weak in the whole scanning wavelength region. in contrast, upon addition of trace amount of cl to agno3 solution, a remarkably enhanced rls with a maximum peak at 571 nm was observed under the same conditions (1.0 ml of silver nitrate). the addition of increasing cl to the solution leads to the gradual enhancement in rls intensity, exhibiting a concentration - dependent relationship. the production of rls and its intensity are correlative with the formation of the aggregate and its particle dimension in solution. bearing on this point, we inferred that the cl ion may displace no3 ion in agno3 (aq), forming a new agcl (s) compound that could be expected to be an aggregate. the size of agcl (s) particles may be much less than the incident wavelength, and thus the enhanced light - scattering signal occurs under the given conditions. in this way, the resonance light scattering formula could be applicable to the agcl system. the newly - formed agcl (s) particles may be ascribed to the higher electrostatic attraction between ag and cl than that of the coexistent no3 ion. moreover, the rls is relevant to the size of the formed aggregated species. hence, the ph value and ionic strength may exert certain influence on the attraction strength and the dimension of suspension particles, and thus the rls production and its intensity. the rls intensity of agcl and agno3 solution did not change with the variation of ph in range of 2.011.0. the unexpected observation is that both of the rls intensity of agcl and agno3 system hardly changed with the concentration changes of added nano3 (figures are not presented). the formation process of aggregation particles generally includes three steps : nucleation, crystal growth, and aggregation. the size of the particles is one important factor affecting the rls production and its intensity. to improve the reproducibility of rls intensity of a suspension system however, the agcl system is very stable in 40 minutes and the average deviation of rls signal was found to be lower than 3.80% (figure is not presented). moreover, the addition order of the reagents has little effect on the rls spectra. to gain an insight into the rls selectivity of the agcl for detection of cl in drinks, the interference of some commonly coexistent ions, such as na, zn, ca, fe, mg, al, co3, so3, so4, po4, k, and i, was investigated under the same conditions. the results demonstrated that the co3 and po4 in excess of 1000 folds in concentration relative to cl influenced the rls of agcl (s) particles. this may be due to the formation of extended aggregate around agcl particle cores by the relatively higher negatively - charged ions of co3 and po4. i in the same concentration relative to cl strongly affected the rls signal. however, chloride is a prominent negatively charged ion of the drinks. all concentration of other anions is lower than chloride ion. when the concentration of each ion was the same as or somewhat lower than that of cl, no interference was observed (results were not presented herein). sodium ion (nano3) hardly exerts interference as well as when its concentration reaches to ca. therefore, the tolerance levels of the interference of these coexisting ions in the samples were very high and the assays can be performed without removing them. the detection and quantification limits were calculated as sb + 3s and sb + 10s, respectively, where sb is the average rls signal of ten blank solutions (16.99 g ml of silver nitrate) and s is the standard deviation. when the rls intensity at 571 nm was selected, the detection and quantification limit were calculated to be 0.71 ng ml and 1.42 ng ml, respectively, indicating high sensitivity of this method for the determination of cl. the sensitivity of the rls method is prominently higher than that of turbidimetry (results are not presented). according to the above standard procedure, the calibration curve was obtained by plotting the concentration of cl against the intensity of rls spectrum at 571 nm under the optimum conditions (figure 2). the linear regression equation using the least square method was i = 26.97 + 27.25ccl (ng ml)(r = 0.9989) in the range of 1.428.52 ng ml of cl. the proposed method was applied to determine the concentration of cl in drinks and the results were shown in table 2. to further examine the accuracy of the proposed rls method, the recovery experiments were carried out by adding known amounts of cl to drinks diluted samples (table 3). the recovery results were obtained in the range of 94.08105.63%, which indicated that the proposed rls method is practical to assay the cl in drinks. the proposed method was applied to determine the concentration of chloride ion in drinks and the results were shown in table 2. to verify the veracity and practicality, the samples were analyzed simultaneously by the currently used ise method (table 2). it can be seen that the results determined by the rls method were almost in agreement with those by the ise method. the average rsd of the rls method is 1.01%2.43%, which is some lower than that of ise method (1.23%3.46%), which proved that the rls assay in drinks was practical. these two methods, rls and ise, can give the similar results of chloride ion in drinks (table 2). however, the operations of rls and ise methods were significantly different. as we know, ise method is an electrochemistry analytical method, in which the variation of temperature, fluctuation of voltage, and treatment of electrode may bring on significant influence on the determination though it features high selectivity. | a resonance light scattering (rls) technique to determine chloride ions in drinks was developed. chloride ions were found to bind ag+ forming agcl aggregates that produced intense resonance scattering light. effects of factors such as acidity, ionic strength, and coexistent interferents on the rls of agcl aggregates were investigated. the ph of solution almost did not affect the production of rls and few foreign species interfered with the detection of chloride ions. the resonance scattering light intensity at the maximum peak of 571 nm was linear to the concentration of chloride ions in the range of 1.428.52 ng ml1 with a detection limit of 0.71 ng ml1. to determine the feasibility of the proposed method, some samples of water and drinks were analyzed. the attained results were in agreement with that of ion - selective electrode method. good recovery results were also obtained with the range of 94.08105.63%. the sensitivity and selectivity of the rls method are high enough to determine trace amounts of chloride ions without any significant interference from high concentration of other components such as common anions and cations. |
in sweden, the prevalence of diabetes mellitus has recently been estimated to be 4.4% among the adult population, with type 2 diabetes accounting for approximately 90% of all cases. as diabetes is a major cause of morbidity and premature mortality, the disease has a significant impact on healthcare costs and quality of life (qol) [2, 3 ]. it is well established that adequate glycemic control [glycosylated hemoglobin (hba1c) below 6.57% ] reduces the risk of diabetes - related complications, and this is therefore the key goal in management of type 2 diabetes. insulin is one of the most effective hba1c - lowering interventions and, due to the progressive nature of type 2 diabetes at higher hba1c - levels, insulin may be the only treatment option for many patients. according to the swedish national board of health and welfare s clinical guidelines on management of type 2 diabetes, the first preventive measure to decrease hba1c is lifestyle intervention and later initiation of metformin. when these measures fail to control glucose levels and the hba1c - level rises to 7.5%, treatment with a sulfonylurea (su) or insulin should be initiated. there are alternative approved treatment options that may be initiated before prescribing insulin, if hba1c levels are < 7.5% and the patient does not respond to metformin, including sitagliptins and glp-1 receptor antagonists. however, many physicians choose to initiate insulin before the patient has reached an hba1c level of 7.5%. insulin treatment has a number of disadvantages, such as weight gain, reaction from the injection and hypoglycemia, and in particular during the early period of initiating insulin, patients most likely show psychologic insulin resistance resulting in complications and increased healthcare costs. although there are a number of published studies evaluating the costs of swedish patients with type 2 diabetes [911 ], there are to our knowledge no swedish studies comparing the costs of pre- and post - initiation of insulin. there is also little evidence when stratifying annual medical costs before and after initiation of insulin in patients with hba1c - level of < 7.5%, where other treatment options are still available, versus hba1c - level 7.5%. the aims of this study were to evaluate the healthcare costs of patients with type 2 diabetes initiating insulin on top of metformin and/or su, and to understand if these costs differ if the patient has reached hba1c levels of 7.5% or not. if the results from this study indicate that treatment with insulin on top of metformin is related to substantially higher healthcare costs compared with treatment with metformin and/or su alone, this could be an indication that other oral anti - diabetic drugs (oads) apart from metformin could be favored while hba1c is still below critical levels. this could have an impact both in terms of savings of healthcare resources and on patients qol. this study is a register - based retrospective cohort study including swedish patients with type 2 diabetes who started treatment with metformin and/or su and were later prescribed insulin. the register includes information on patients with type 2 diabetes receiving treatment within the county council from 2003 to 2004 onwards, as well as information on caregiver contacts, laboratory tests (including hba1c values), diagnoses, procedures, prescribed drugs, and demographics. information on filled prescriptions and devices were retrieved from the prescribed drug register, which is a national register held at the national board of health and welfare containing information on all prescribed medicines and pharmaceutical aids dispensed at swedish pharmacies since june 2005. information on mortality during the follow - up period was retrieved from the cause of death register at the national board of health and welfare. the register includes nationwide data since 1961 and includes underlying and contributory causes of death according to the international classification of disease (icd) system. this study included all patients in the diabetes register identified as being prescribed at least one prescription of metformin and/or su from 2003 to 2010 and later prescribed treatment with insulin. patients were excluded from the study if they were being prescribed insulin before june 2005, had an initial diagnosis of type 1 diabetes, had records of prescriptions of oads other than metformin or su prior to the index date, or if they had no records of metformin or su prior to the index date. after approval from an ethical committee, data were extracted from the diabetes register based on the inclusion criteria and linked to the administrative registers at the national board of health and welfare through the patients national registration number. all identifiable data were replaced with new study ids to de - identify the data. for each identified patient, the index date was defined as the date of the first insulin prescription in the diabetes register during the period january 1, 2005 through december 31, 2009. the hba1c level at initiation of insulin used in the stratified analysis was chosen as the last hba1c lab value measured prior to the index date. the aim was to choose a value measured within 1 month and not longer than 3 months before insulin initiation. hba1c was measured using the mono - s method. for conversion to measurements with the dcct / ngsp method, the following conversion formula may be used : hba1c (ngsp) (%) = 0.956 hba1c (mono s) (%) + 1.182 (see e.g., http://www.hba1c.nu/). annual medical costs were computed from the third party payer perspective for healthcare visits, treatment interventions, and procedures (described as drg) and prescriptions of anti - glycemic medications, diabetic devices, and aids. for the purpose of estimating costs incurred in the management before and after the initiation of insulin, unit costs for individual procedures unit costs for healthcare resources were obtained through three different county council lists for costs and calculated as a mean of the three measures (including skane county, vastragotaland region county council and norrlands lans county council) according to swedish standards. these unit costs varied by resource use, and were applied to the resource utilization items, which were used to calculate the overall medical costs of healthcare utilization. costs for prescribed drugs were primarily based on the information from the prescribed drug register including updated information on national costs from the latest reference year. costs were calculated on an individual basis by summing the products of unit costs with quantities of different types of resources consumed and presented as means for all patients. the latest reference year for unit costs was used (sek 2012 ; 1 = 8.4 sek on march 25, 2013). analyses were conducted using patient - level data, but all reporting was on an aggregated level. all data management and statistical analyses were performed using sas 9.2 (sas institute inc., the resource use items available within this study were visits to primary care, outpatient admissions to medical wards, surgeries and procedures through drg - codes, prescription pharmaceuticals, and devices for glucose - monitoring and insulin administration. annual quantities of these resource items during the 12-month post - initiation of insulin were determined for each patient. healthcare costs during the 12-month post - initiation of insulin were estimated by multiplying quantities of resource use by unit costs from published sources. similarly, annual quantities of resource use during the year pre - initiation of insulin were determined for each patient, and corresponding healthcare costs were estimated by multiplying quantities of resource use with unit costs. descriptive statistics on an aggregated level were used to present patient characteristics, resource utilization, and costs for all patients in the dataset. for continuous variables, the arithmetic mean, standard deviation (sd), minimum, and maximum are presented. for categorical variables, the proportions (percentage) in each category are presented. the normality of the distributions was tested employing the shapiro wilks test and by plotting the data. if found not to be normally distributed, means and sd were estimated using the bias corrected accelerated bootstrapping method with replacement. to test differences between costs before and after the index date, a t test was used to measure if the difference between the two costs was separated from zero. there were no missing values in the dataset and imputation of missing data was not necessary. variables describing patient characteristics included age at the index date, sex, height, weight, co - morbidities, hba1c level at the index date, systolic blood pressure at the index date, and diastolic blood pressure at the index date. the estimated healthcare costs were subsequently stratified by hba1c level at index date and statistical tests were used to compare costs pre- and post - initiation of insulin for each hba1c - group separately (group 1 < 7.5%, group 2 7.5%). the register includes information on patients with type 2 diabetes receiving treatment within the county council from 2003 to 2004 onwards, as well as information on caregiver contacts, laboratory tests (including hba1c values), diagnoses, procedures, prescribed drugs, and demographics. information on filled prescriptions and devices were retrieved from the prescribed drug register, which is a national register held at the national board of health and welfare containing information on all prescribed medicines and pharmaceutical aids dispensed at swedish pharmacies since june 2005. information on mortality during the follow - up period was retrieved from the cause of death register at the national board of health and welfare. the register includes nationwide data since 1961 and includes underlying and contributory causes of death according to the international classification of disease (icd) system. this study included all patients in the diabetes register identified as being prescribed at least one prescription of metformin and/or su from 2003 to 2010 and later prescribed treatment with insulin. patients were excluded from the study if they were being prescribed insulin before june 2005, had an initial diagnosis of type 1 diabetes, had records of prescriptions of oads other than metformin or su prior to the index date, or if they had no records of metformin or su prior to the index date. after approval from an ethical committee, data were extracted from the diabetes register based on the inclusion criteria and linked to the administrative registers at the national board of health and welfare through the patients national registration number. all identifiable data were replaced with new study ids to de - identify the data. for each identified patient, the index date was defined as the date of the first insulin prescription in the diabetes register during the period january 1, 2005 through december 31, 2009. the hba1c level at initiation of insulin used in the stratified analysis was chosen as the last hba1c lab value measured prior to the index date. the aim was to choose a value measured within 1 month and not longer than 3 months before insulin initiation. hba1c was measured using the mono - s method. for conversion to measurements with the dcct / ngsp method, the following conversion formula may be used : hba1c (ngsp) (%) = 0.956 hba1c (mono s) (%) + 1.182 (see e.g., http://www.hba1c.nu/). annual medical costs were computed from the third party payer perspective for healthcare visits, treatment interventions, and procedures (described as drg) and prescriptions of anti - glycemic medications, diabetic devices, and aids. for the purpose of estimating costs incurred in the management before and after the initiation of insulin, unit costs for individual procedures unit costs for healthcare resources were obtained through three different county council lists for costs and calculated as a mean of the three measures (including skane county, vastragotaland region county council and norrlands lans county council) according to swedish standards. these unit costs varied by resource use, and were applied to the resource utilization items, which were used to calculate the overall medical costs of healthcare utilization. costs for prescribed drugs were primarily based on the information from the prescribed drug register including updated information on national costs from the latest reference year. costs were calculated on an individual basis by summing the products of unit costs with quantities of different types of resources consumed and presented as means for all patients. the latest reference year for unit costs was used (sek 2012 ; 1 = 8.4 sek on march 25, 2013). analyses were conducted using patient - level data, but all reporting was on an aggregated level. all data management and statistical analyses were performed using sas 9.2 (sas institute inc., cary, nc, usa). the resource use items available within this study were visits to primary care, outpatient admissions to medical wards, surgeries and procedures through drg - codes, prescription pharmaceuticals, and devices for glucose - monitoring and insulin administration. annual quantities of these resource items during the 12-month post - initiation of insulin were determined for each patient. healthcare costs during the 12-month post - initiation of insulin were estimated by multiplying quantities of resource use by unit costs from published sources. similarly, annual quantities of resource use during the year pre - initiation of insulin were determined for each patient, and corresponding healthcare costs were estimated by multiplying quantities of resource use with unit costs. descriptive statistics on an aggregated level were used to present patient characteristics, resource utilization, and costs for all patients in the dataset. for continuous variables, the arithmetic mean, standard deviation (sd), minimum, and maximum are presented. for categorical variables, the proportions (percentage) in each category are presented. the normality of the distributions was tested employing the shapiro wilks test and by plotting the data. if found not to be normally distributed, means and sd were estimated using the bias corrected accelerated bootstrapping method with replacement. to test differences between costs before and after the index date, a t test was used to measure if the difference between the two costs was separated from zero. there were no missing values in the dataset and imputation of missing data was not necessary. variables describing patient characteristics included age at the index date, sex, height, weight, co - morbidities, hba1c level at the index date, systolic blood pressure at the index date, and diastolic blood pressure at the index date. the estimated healthcare costs were subsequently stratified by hba1c level at index date and statistical tests were used to compare costs pre- and post - initiation of insulin for each hba1c - group separately (group 1 < 7.5%, group 2 7.5%). in total, 667 patients initiated on insulin during the study period were identified and extracted from the diabetes register. after removing patients who had been treated with oads other than metformin or su prior to the index date, had a primary diagnosis of type 1 diabetes, had been prescribed insulin prior to the index date, had not been prescribed metformin or su prior to the index date, and had < 365 days follow - up before or after the index date, 100 patients were eligible for the analysis.fig. oad oral anti - diabetic drugs, met metformin, su sulfonylurea, t1 dm type 1 diabetes, t2 dm type 2 diabetes, dr diabetes register, pdr prescribed drug register patient exclusion. oad oral anti - diabetic drugs, met metformin, su sulfonylurea, t1 dm type 1 diabetes, t2 dm type 2 diabetes, dr diabetes register, pdr prescribed drug register patient characteristics are demonstrated in table 1. the mean age of the patients was 64 (sd 10) years, ranging from 35 to 80 years. most patients were men (n = 59, 59%).table 1patient characteristics, all patients (n = 100)patient characteristicsage (years)64 (10) [3589]sex, female41%disease description co - morbidities hypertension49% cardiovascular disease14% hba1c level at initiation of insulin (%) 8 (1.7) [4.114 ] systolic blood pressure (mmhg)141.1 (20.7) [105225 ] diastolic blood pressure (mmhg)80.1 (10.7) [50110]data are expressed as mean (sd) [range ], unless otherwise indicated sd standard deviation patient characteristics, all patients (n = 100) data are expressed as mean (sd) [range ], unless otherwise indicated sd standard deviation there were 41 patients who were initiated on insulin at hba1c levels < 7.5%, and 59 patients at hba1c levels 7.5%. patient characteristics comparing patients with hba1c level < 7.5% and 7.5% at the index date are shown in table 2. patients with hba1c levels < 7.5% were older than those with hba1c levels 7.5% at the index date [67 (sd 7) vs. 63 (sd 11) years, p = 0.051 ]. the mean hba1c level at the index date was 6.7% (sd 0.7%) among the hba1c level < 7.5% group and 8.9% (sd 1.6%) among the hba1c 7.5% group (p = 0.0001). there was also a statistically significant difference between the two groups in terms of diastolic blood pressure [77.2 mmhg (sd 9.1) vs. 82.1 mmhg (sd 11.3), p = 0.018 ]. even though total number of co - morbidities did not differ between the two groups, patients with hba1c levels < 7.5% had a higher number of cardiovascular events (see table 3).table 2patient characteristics comparing patients with hba1c levels < 7.5% and 7.5% at initiation of insulinhba1c < 7.5% (n = 41)hba1c 7.5% (n = 59) p valuepatient characteristics age67 (7)63 (11)0.051 female, n (%) 10 (24)24 (41)0.091 height172 (9)173 (12)0.576 weight85 (16)96 (27)0.477disease description years since index date2.2 (0.9)2.2 (1.2)0.69 years since diagnosis4.2 (0.9)4.2 (1.2)0.691 hba1c level at initiation of insulin, % (sd)6.7 (0.7)8.9 (1.6)<0.0001 systolic blood pressure, mmhg (sd)138.4 (17.9)142.9 (22.4)0.482 diastolic blood pressure, mmhg (sd)77.2 (9.1)82.1 (11.3)0.018data are expressed as mean (sd), unless otherwise indicated sd standard deviationtable 3cardiovascular events stratified by hba1c level at index datepatients with event, n (%) hba1c level at index date<7.5% (n = 41)7.5% (n = 59)hypertension21 (51)39 (66)hypertensive heart and renal disease2 (5)2 (3)angina pectoris4 (10)9 (15)myocardial infarction2 (5)1 (2)ischemic heart disease8 (20)10 (17)heart failure9 (22)5 (8)intracerebral hemorrhage0 (0)3 (5)chronic kidney disease0 (0)2 (3)total4671 patient characteristics comparing patients with hba1c levels < 7.5% and 7.5% at initiation of insulin data are expressed as mean (sd), unless otherwise indicated sd standard deviation cardiovascular events stratified by hba1c level at index date total medical costs for the total cohort, and stratified by hba1c - level, are shown in tables 4 and 5, respectively.table 4total annual per patient medical healthcare costs (sek) before and after 1 year of initiation of insulin (n = 100)cost (sek)pre - index datepost - index date p valuemeansdmeansdhealthcare visits11,79510,36618,28916,955<0.0001 visits to primary care6,8014,53910,4867,202<0.0001 visits to medical ward4,9949,5657,80316,2240.039procedures2,89511,6662,84512,6391.000filled prescriptions2,5401,92910,5225,624<0.0001total costs17,23017,22831,65624,331<0.0001 sd standard deviation t testtable 5total annual per patient medical healthcare costs (sek) before and after 1 year of initiation of insulin stratified by hba1c - level at index datecost (sek)hba1c < 7.5% (n = 41)hba1c 7.5% (n = 59)pre - index datepost - index datepre - index datepost - index datemeansdmeansd p - valuemeansdmeansd p valuehealthcare visits13,80310,07220,02217,1540.11810,40010,42317,08416,856<0.0001 visits to primary care7,5194,12510,0016,1260.0816,3024,77610,8237,898<0.0001 visits to medical ward6,2849,95110,02116,0580.2484,0989,2686,26216,2960.711procedures8524,1115,99318,9720.4534,31514,6856583,5450.289filled prescriptions3,0242,3069,7324,657<0.00012,2031,55111,0716,187<0.0001total costs17,67812,94635,74730,411<0.000116,91819,76928,81318,779<0.0001 sd standard deviation t test total annual per patient medical healthcare costs (sek) before and after 1 year of initiation of insulin (n = 100) sd standard deviation total annual per patient medical healthcare costs (sek) before and after 1 year of initiation of insulin stratified by hba1c - level at index date sd standard deviation the total medical healthcare costs for the entire cohort the year before initiation of insulin (table 4) were sek 17,230 (sd 17,228), and the year after were sek 31,656 (sd 24,331) (p < 0.0001). the highest proportion of costs before the index date was as a result of visits to primary care followed by costs due to visits to medical wards, procedures and medications, whilst the highest proportion after the index date were due to medications, followed by visits to primary care, visits to medical wards, and procedures. when stratifying total medical healthcare costs by hba1c group (table 5), the group with hba1c levels < 7.5% had total medical costs of sek 17,678 (sd 12,946) the year before the index date, and sek 35,747 (sd 30,411) the year after the index date (p < 0.0001). the group with hba1c levels 7.5% had total medical costs of sek 16,918 (sd 19,769) the year before the index date and sek 28,813 (sd 18,779) the year after the index date (p < 0.0001). in patients with hba1c levels < 7.5%, the year before initiation of insulin, the highest proportion of costs was due to visits to primary care, followed by costs due to visits to medical wards, medications, and procedures. the year after the index date, the highest costs were due to medications, followed by costs due to visits to primary care, visits to medical wards, and procedures. in the group with hba1c levels 7.5% at the index date, the year before initiation of insulin, the highest proportion of costs was due to visits to primary care, followed by costs due to visits to medical wards, procedures, and medications. the year after the index date, the highest costs were due to medications, followed by costs due to visits to primary care, visits to medical wards, and procedures. the total medical costs due to health care visits in the entire patient cohort were sek 11,795 (sd 10,366) the year before the index date and sek 18,289 (sd 16,955) the year after the index date (p < 0.0001). the highest proportion of this was due to visits to primary care both before and after the index date [sek 6,801 (sd 4,539) pre - index ; sek 10,486 (sd 7,202) post - index, p < 0.0001 ]. the costs due to visits to medical wards were sek 4,994 (sd 9,565) the year before the index date and sek 7,803 (sd 16,224) the year after the index date (p = 0.039). even though not statistically significant, the costs related to visits to medical wards included visits to physicians and nurses, both before and after the index date. there were no statistically significant differences in mean costs the year before and after the index date due to procedures. there were no statistically significant differences in costs due to health care visits before and after the index date compared with the year before the index date in patients with hba1c levels < 7.5% at the index date (p = 0.118). the mean total medical costs due to health care visits were lower in the group with hba1c levels 7.5% at the index date compared with the group with hba1c levels < 7.5%, both the year before the index date [sek 10,400 (sd 10,423) ], and the year after [sek 17,084 (sd 16,856) ]. the total mean costs the year after the index date were statistically significantly higher than the year before (p < 0.0001). the highest proportion of these costs were due to visits to primary care [sek 6,302 (sd 4,776) pre - index ; sek 10,823 (sd 7,898) post - index, p < 0.0001 ], whereas the costs due to visits to medical wards incurred sek 4,098 (sd 9,268) the year before the index date and sek 6,262 (sd 16,296), the year after the index date (p = 0.711). in the total cohort, there was a statistically significant increase in mean total medical costs related to filled prescriptions the year after the index date [sek 10,522 (sd 5,624) ] compared with the year before the index date [sek 2,540 (sd 1,929) ; p < 0.0001 ]. the highest mean costs related to insulin devices and aids were due to test sticks both before and after the index date [sek 1,447 (sd 1,554) pre - index ; sek 3,342 (sd 3,290) post - index ; p < 0.0001 ] (data not presented in the table). the total mean costs due to filled prescriptions among the hba1c < 7.5% group were statistically significantly higher the year after the index date compared with the year before the index date [sek 3,024 (sd 2,306) pre - index ; sek 9,732 (sd 4,657) post - index ; p < 0.0001 ]. the same statistically significant difference was seen in the group with hba1c levels 7.5% at the index date [sek 2,203 (sd 1,551) pre - index ; sek 11,071 (sd 6,187) post - index ; p < 0.0001 ]. the mean age of the patients was 64 (sd 10) years, ranging from 35 to 80 years. most patients were men (n = 59, 59%).table 1patient characteristics, all patients (n = 100)patient characteristicsage (years)64 (10) [3589]sex, female41%disease description co - morbidities hypertension49% cardiovascular disease14% hba1c level at initiation of insulin (%) 8 (1.7) [4.114 ] systolic blood pressure (mmhg)141.1 (20.7) [105225 ] diastolic blood pressure (mmhg)80.1 (10.7) [50110]data are expressed as mean (sd) [range ], unless otherwise indicated sd standard deviation patient characteristics, all patients (n = 100) data are expressed as mean (sd) [range ], unless otherwise indicated sd standard deviation there were 41 patients who were initiated on insulin at hba1c levels < 7.5%, and 59 patients at hba1c levels 7.5%. patient characteristics comparing patients with hba1c level < 7.5% and 7.5% at the index date are shown in table 2. patients with hba1c levels < 7.5% were older than those with hba1c levels 7.5% at the index date [67 (sd 7) vs. 63 (sd 11) years, p = 0.051 ]. the mean hba1c level at the index date was 6.7% (sd 0.7%) among the hba1c level < 7.5% group and 8.9% (sd 1.6%) among the hba1c 7.5% group (p = 0.0001). there was also a statistically significant difference between the two groups in terms of diastolic blood pressure [77.2 mmhg (sd 9.1) vs. 82.1 mmhg (sd 11.3), p = 0.018 ]. even though total number of co - morbidities did not differ between the two groups, patients with hba1c levels < 7.5% had a higher number of cardiovascular events (see table 3).table 2patient characteristics comparing patients with hba1c levels < 7.5% and 7.5% at initiation of insulinhba1c < 7.5% (n = 41)hba1c 7.5% (n = 59) p valuepatient characteristics age67 (7)63 (11)0.051 female, n (%) 10 (24)24 (41)0.091 height172 (9)173 (12)0.576 weight85 (16)96 (27)0.477disease description years since index date2.2 (0.9)2.2 (1.2)0.69 years since diagnosis4.2 (0.9)4.2 (1.2)0.691 hba1c level at initiation of insulin, % (sd)6.7 (0.7)8.9 (1.6)<0.0001 systolic blood pressure, mmhg (sd)138.4 (17.9)142.9 (22.4)0.482 diastolic blood pressure, mmhg (sd)77.2 (9.1)82.1 (11.3)0.018data are expressed as mean (sd), unless otherwise indicated sd standard deviationtable 3cardiovascular events stratified by hba1c level at index datepatients with event, n (%) hba1c level at index date<7.5% (n = 41)7.5% (n = 59)hypertension21 (51)39 (66)hypertensive heart and renal disease2 (5)2 (3)angina pectoris4 (10)9 (15)myocardial infarction2 (5)1 (2)ischemic heart disease8 (20)10 (17)heart failure9 (22)5 (8)intracerebral hemorrhage0 (0)3 (5)chronic kidney disease0 (0)2 (3)total4671 patient characteristics comparing patients with hba1c levels < 7.5% and 7.5% at initiation of insulin data are expressed as mean (sd), unless otherwise indicated sd standard deviation cardiovascular events stratified by hba1c level at index date total medical costs for the total cohort, and stratified by hba1c - level, are shown in tables 4 and 5, respectively.table 4total annual per patient medical healthcare costs (sek) before and after 1 year of initiation of insulin (n = 100)cost (sek)pre - index datepost - index date p valuemeansdmeansdhealthcare visits11,79510,36618,28916,955<0.0001 visits to primary care6,8014,53910,4867,202<0.0001 visits to medical ward4,9949,5657,80316,2240.039procedures2,89511,6662,84512,6391.000filled prescriptions2,5401,92910,5225,624<0.0001total costs17,23017,22831,65624,331<0.0001 sd standard deviation t testtable 5total annual per patient medical healthcare costs (sek) before and after 1 year of initiation of insulin stratified by hba1c - level at index datecost (sek)hba1c < 7.5% (n = 41)hba1c 7.5% (n = 59)pre - index datepost - index datepre - index datepost - index datemeansdmeansd p - valuemeansdmeansd p valuehealthcare visits13,80310,07220,02217,1540.11810,40010,42317,08416,856<0.0001 visits to primary care7,5194,12510,0016,1260.0816,3024,77610,8237,898<0.0001 visits to medical ward6,2849,95110,02116,0580.2484,0989,2686,26216,2960.711procedures8524,1115,99318,9720.4534,31514,6856583,5450.289filled prescriptions3,0242,3069,7324,657<0.00012,2031,55111,0716,187<0.0001total costs17,67812,94635,74730,411<0.000116,91819,76928,81318,779<0.0001 sd standard deviation t test total annual per patient medical healthcare costs (sek) before and after 1 year of initiation of insulin (n = 100) sd standard deviation total annual per patient medical healthcare costs (sek) before and after 1 year of initiation of insulin stratified by hba1c - level at index date sd standard deviation the total medical healthcare costs for the entire cohort the year before initiation of insulin (table 4) were sek 17,230 (sd 17,228), and the year after were sek 31,656 (sd 24,331) (p < 0.0001). the highest proportion of costs before the index date was as a result of visits to primary care followed by costs due to visits to medical wards, procedures and medications, whilst the highest proportion after the index date were due to medications, followed by visits to primary care, visits to medical wards, and procedures. when stratifying total medical healthcare costs by hba1c group (table 5), the group with hba1c levels < 7.5% had total medical costs of sek 17,678 (sd 12,946) the year before the index date, and sek 35,747 (sd 30,411) the year after the index date (p < 0.0001). the group with hba1c levels 7.5% had total medical costs of sek 16,918 (sd 19,769) the year before the index date and sek 28,813 (sd 18,779) the year after the index date (p < 0.0001). in patients with hba1c levels < 7.5%, the year before initiation of insulin, the highest proportion of costs was due to visits to primary care, followed by costs due to visits to medical wards, medications, and procedures. the year after the index date, the highest costs were due to medications, followed by costs due to visits to primary care, visits to medical wards, and procedures. in the group with hba1c levels 7.5% at the index date, the year before initiation of insulin, the highest proportion of costs was due to visits to primary care, followed by costs due to visits to medical wards, procedures, and medications. the year after the index date, the highest costs were due to medications, followed by costs due to visits to primary care, visits to medical wards, and procedures the total medical costs due to health care visits in the entire patient cohort were sek 11,795 (sd 10,366) the year before the index date and sek 18,289 (sd 16,955) the year after the index date (p < 0.0001). the highest proportion of this was due to visits to primary care both before and after the index date [sek 6,801 (sd 4,539) pre - index ; sek 10,486 (sd 7,202) post - index, p < 0.0001 ]. the costs due to visits to medical wards were sek 4,994 (sd 9,565) the year before the index date and sek 7,803 (sd 16,224) the year after the index date (p = 0.039). even though not statistically significant, the costs related to visits to medical wards included visits to physicians and nurses, both before and after the index date. there were no statistically significant differences in mean costs the year before and after the index date due to procedures. there were no statistically significant differences in costs due to health care visits before and after the index date compared with the year before the index date in patients with hba1c levels < 7.5% at the index date (p = 0.118). the mean total medical costs due to health care visits were lower in the group with hba1c levels 7.5% at the index date compared with the group with hba1c levels < 7.5%, both the year before the index date [sek 10,400 (sd 10,423) ], and the year after [sek 17,084 (sd 16,856) ]. the total mean costs the year after the index date were statistically significantly higher than the year before (p < 0.0001). the highest proportion of these costs were due to visits to primary care [sek 6,302 (sd 4,776) pre - index ; sek 10,823 (sd 7,898) post - index, p < 0.0001 ], whereas the costs due to visits to medical wards incurred sek 4,098 (sd 9,268) the year before the index date and sek 6,262 (sd 16,296), the year after the index date (p = 0.711). in the total cohort, there was a statistically significant increase in mean total medical costs related to filled prescriptions the year after the index date [sek 10,522 (sd 5,624) ] compared with the year before the index date [sek 2,540 (sd 1,929) ; p < 0.0001 ]. the highest mean costs related to insulin devices and aids were due to test sticks both before and after the index date [sek 1,447 (sd 1,554) pre - index ; sek 3,342 (sd 3,290) post - index ; p < 0.0001 ] (data not presented in the table). the total mean costs due to filled prescriptions among the hba1c < 7.5% group were statistically significantly higher the year after the index date compared with the year before the index date [sek 3,024 (sd 2,306) pre - index ; sek 9,732 (sd 4,657) post - index ; p < 0.0001 ]. the same statistically significant difference was seen in the group with hba1c levels 7.5% at the index date [sek 2,203 (sd 1,551) pre - index ; sek 11,071 (sd 6,187) post - index ; p < 0.0001 ]. this study aimed at estimating and comparing annual medical costs the year before and after initiation of insulin (index date) among swedish patients with type 2 diabetes. the study also aimed at estimating these costs stratified by hba1c level at the date of initiation of insulin, based on the recommended cut - off level (hba1c 7.5%). our results demonstrated almost doubled, statistically significant increases in mean annual costs the year after the initiation of insulin compared with the year before. the highest proportion of mean annual medical costs was due to visits to primary care the year before the index date, but shifted to costs due to filled prescriptions the year after. this demonstrates that filled prescriptions of insulin have a significant impact on the total medical costs. the increased costs of filled prescriptions were also due to increased filled packages of devices and aids such as glucose monitoring, injection needles, and lancets. besides filled prescriptions, the increased costs the year after initiation of insulin were also due to increased visits to nurses and physicians, to both medical wards (not statistically significant), and to primary care. as can be expected in a diabetes population, many of the patients in this study had cardiovascular co - morbidities that might explain some of the increased costs the year after initiation of insulin. there were no major differences in demographic and clinical characteristics at the index date when comparing patients with hba1c - levels < 7.5% or 7.5% at the index date. both groups had statistically significant increased mean annual costs the year after initiation of insulin compared with the year before. interestingly, patients with hba1c - levels < 7.5% at the index date had higher total medical costs, both the year before the index date and the year after, compared with the hba1c - level 7.5% group. this might be explained by the higher proportion of major cardiovascular events in this group, but the major increase in costs the year before and after index date was still explained by an increase in filled prescriptions. for both groups, costs were mainly dominated by costs due to health care visits before the index date, whereas costs due to filled prescriptions were more prominent in both groups after the index date. there are a number of published studies assessing the health - related costs in patients treated with insulin. in a german study published in 1997, estimation of costs for insulin treated patients was approximately six times as high as those for patients treated with oads, and 30 times as high as for patients treated with life - style interventions through specific diets. the authors demonstrated that there was a significant increase in blood glucose devices during the 6 months after initiation of insulin, and that the mean 6-month costs increased from 579 to 961. a more recent study conducted in spain in 2011 reported that mean total healthcare costs per patient 6 months before and after insulin start were 639 and 1,110, respectively. mean total costs 6 months after insulin treatment was initiated included costs of hospitalization (31%), insulin (16%), primary care (14%), blood glucose monitoring (14%), specialized care (13%), oads (8%), and other diabetes - related treatments (4%). in a canadian cost - effectiveness study from 2011, basic treatment with metformin the average lifetime cost (direct healthcare cost) was reported to be $ 39,924 for the basic treatment with metformin. the corresponding cost was $ 40,669 for metformin plus su, $ 47,191 for metformin plus dpp-4 inhibitor, $ 47,348 for metformin plus basal insulin, and $ 52,367 for metformin plus biphasic insulin. hence, the incremental cost of adding basal insulin or biphasic insulin to the metformin treatment was $ 7,424 and $ 12,443, respectively. the results in our study demonstrate that increased medical healthcare costs the year before and after initiation of insulin are comparable with the results of previous studies [1619 ]. together these data concur that the initiation of insulin treatment in type 2 diabetic patients increases medical costs, both in terms of increased costs due to filled prescriptions of medications and of devices, but also due to increased costs due to health care visits., our study demonstrated that the highest proportion of costs the year after the index date were due to filled prescriptions (given that our study did not include information on hospitalizations). studies have also demonstrated the relationship between costs and hba1c level. in a study by aagren., from 2011, the relationship between glycemic control, measured by hba1c - level, and short - term healthcare costs was assessed. the population consisted of commercially insured diabetic patients (hba1c level 6%) in the united states ; 34,469 patients with type 2 diabetes and 1,837 with type 1 diabetes. the study concluded that the hba1c - level (and other factors) significantly correlated with diabetes - related short - term medical costs for both patients with type 1 and type 2 diabetes. specifically, a 1%-point increase in hba1c will, on average, lead to a 4.4% increase in diabetes - related medical costs for type 2 diabetes. these results were not comparable with the results in our study, which is probably explained by the higher major cardiovascular co - morbidities in this group. one reason for the difference in results compared to our study might be the selected study population. in our study, costs were calculated for patients who had at least 365 days follow - up both before and after the index date. by using such an approach, patients who had < 365 days usage of metformin or su before the index date, and patients who died before 365 days after the index date, exclusion of these patients might therefore have biased the study population by allowing only patients with less severe disease to be included in the analysis. first, the study sample is very small and limited to one county council and the results might therefore not be generalizable to other parts of sweden. secondly, healthcare utilization is limited to procedures, outpatient visits at medical wards, and primary care visits, and does not account for inpatient and other outpatient care or emergency care. there was also limited information on background data for co - morbidities and body mass index, limiting the possibilities to control for confounders. also, when combining the two data sources, there were some differences between the different registers that led to some uncertainties in the data. furthermore, it is important to recognize that the full clinical and economic benefits of an effective diabetes treatment, such as insulin, in the long run are not fully accounted for in our study. in summary, despite the small sample size, this study demonstrates that mean annual medical costs almost double the year after patients are initiated on insulin. this increase in costs is mainly due to increased visits to primary care and increased drug prescriptions. this study also demonstrates that costs increase the year after initiation of insulin regardless of the hba1c level at initiation of insulin, which could be a rational for other treatment options when hba1c levels are still below the recommended threshold for initiation of insulin. this register - based, retrospective cohort study was designed to evaluate the healthcare costs of patients with type 2 diabetes initiating insulin on top of metformin and/or sulfonylurea (su) in sweden, determine the glycosylated hemoglobin (hba1c)-level at initiation of insulin, and stratify healthcare costs by this hba1c-level.patients were identified from the srmland county council diabetes register ; 100 patients being prescribed at least one prescription of metformin and/or su from 2003 - 2010, and later prescribed insulin, were included.the mean age was 61 years, 59% of patients were male. mean time since diagnosis was 4.1 years and since initiation of insulin was 2.2 years, and the mean hba1c level at index date was 8.0%.total mean costs for the whole cohort the year before initiation of insulin was sek 17,230 (17,228) and the year after was sek 31,656 (24,331) (p < 0.0001).despite the small study sample, this study demonstrates that mean annual medical costs almost double the year after patients are initiated on insulin ; the costs increased regardless of the hba1c level at initiation of insulin, with the largest increase in costs due to increased filled prescriptions. this register - based, retrospective cohort study was designed to evaluate the healthcare costs of patients with type 2 diabetes initiating insulin on top of metformin and/or sulfonylurea (su) in sweden, determine the glycosylated hemoglobin (hba1c)-level at initiation of insulin, and stratify healthcare costs by this hba1c - level. patients were identified from the srmland county council diabetes register ; 100 patients being prescribed at least one prescription of metformin and/or su from 2003 - 2010, and later prescribed insulin, were included. mean time since diagnosis was 4.1 years and since initiation of insulin was 2.2 years, and the mean hba1c level at index date was 8.0%. total mean costs for the whole cohort the year before initiation of insulin was sek 17,230 (17,228) and the year after was sek 31,656 (24,331) (p < 0.0001). despite the small study sample, this study demonstrates that mean annual medical costs almost double the year after patients are initiated on insulin ; the costs increased regardless of the hba1c level at initiation of insulin, with the largest increase in costs due to increased filled prescriptions. johan lundberg is an employee of merck sharp & dohme, a subsidiary of merck & co., inc., owns stock options and stock in merck & co., inc. the analysis in this article is based on previously conducted studies, and does not involve any new studies of human or animal subjects performed by any of the authors. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. | introductionalthough insulin is one of the most effective interventions for the treatment of type 2 diabetes, its disadvantages incur substantial medical cost. this study was designed to evaluate the medical costs of swedish type 2 diabetic patients initiating insulin on top of metformin and/or sulfonylurea (su), and to evaluate if costs before and after insulin initiation differ for patients where insulin is initiated above or below the recommended glycosylated hemoglobin (hba1c) level (7.5%).methodsthis was a register - based retrospective cohort study in which patients were identified from the srmland county council diabetes register. patients being prescribed at least one prescription of metformin and/or su from 2003 to 2010, and later prescribed insulin, were included.resultsone hundred patients fulfilled the inclusion criteria and had at least 1 year of follow - up. the mean age was 61 years and 59% of patients were male. mean time since diagnosis was 4.1 years, and since initiation of insulin was 2.2 years. the mean hba1c level at index date was 8.0%. total mean costs for the whole cohort were sek 17,230 [standard deviation (sd) 17,228 ] the year before insulin initiation, and sek 31,656 (sd 24,331) the year after insulin initiation (p < 0.0001). when stratifying by hba1c level, patients with hba1c < 7.5% had total healthcare costs of sek 17,678 (sd 12,946) the year before the index date and sek 35,747 (sd 30,411) the year after (p < 0.0001). patients with hba1c levels 7.5% had total healthcare costs of sek 16,918 (sd 19,769) the year before the index date and sek 28,813 (sd 18,779) the year after (p < 0.0001).conclusiondespite the small sample size, this study demonstrates that mean annual medical costs almost double the year after patients are initiated on insulin. the costs increased the year after insulin initiation, regardless of the hba1c level at initiation of insulin, and the largest increase in costs were due to increased filled prescriptions. |
voltage - gated sodium (nav) channels are the fundamental generators of electrical impulses (action potentials) in the membranes of excitable cells. these drugs are primarily used in the treatment of central nervous system (cns) disorders, such as epilepsy and neuropathic pain, but are increasingly being scrutinized as potential treatments for neurodegenerative conditions occurring acutely, such as in ischemic stroke, or chronically, as in multiple sclerosis (ms). it exerts a voltage - dependent and frequency - dependent block of na currents. this selectivity is suggested to be the reason for its lack of significant cognitive side effects. other first - generation antiepileptics that act on nav channels include lamotrigine 2, and carbamazepine 3(4) (figure 1). recently, lacosamide 4 was approved for use in partial - onset seizures and neuropathic pain. lacosamide is proposed to act via an unique mechanism of state - dependent blockade of nav channels : stabilizing channels in a slow inactivated state without effects on fast inactivation. compounds with sodium channel modulatory activity. nine nav channel isoforms have been identified, of which, nav1.1, 1.2, 1.3, and 1.6 are predominately found within the cns, whereas nav1.7, 1.8, and 1.9 are located in the peripheral nervous system. nav1.4 is found within skeletal muscle, and nav1.5 is found in the heart. recently, the first x - ray crystal structure of a voltage - gated sodium channel was solved : initially in the closed state and subsequently in two presumed inactivated states. under normal physiological conditions, the channels interconvert between different functional states : the resting state in which the channel pore is closed, an open state in which the channel pore is open and permeable to na, and one or more inactivation states where the pore is open but blocked. recent studies have highlighted the importance of nav1.3, 1.7, 1.8, and 1.9 in various pain syndromes. notably, genetically inherited pain disorders have been associated with mutation of these nav encoding genes. clinically, carbamazepine, lamotrigine, and phenytoin are all used to treat neuropathic pain. the merck, pfizer, astrazeneca, and glaxosmithkline pharmaceutical groups have all independently reported their own series of 1.3-, 1.7-, and 1.9-selective sodium channel modulators for use in neuropathic pain, exemplified here by the benzazepinone compounds from merck pharmaceuticals, such as 5 (figure 1). influx of sodium from the extracellular space during reperfusion plays a major role in excitotoxic neuronal death after cerebral ischemia. block of nav channels can attenuate the primary events that occur in an ischemic attack, most likely by blocking na permeability, resulting in reduced atp depletion and reduced ischemic - induced release of glutamate. a number of drugs, including lamotrigine, bw-1003c87, the local anesthetic lidocaine, and sipatrigine, have all shown neuroprotective effects in animal models of stroke. however, as of yet, these results have failed to translate into beneficial effects in clinical trials. thus, there is a need for drugs with a better clinical efficacy and therapeutic index. treatment of stroke is limited by the fact that administration of treatment in humans only occurs sometime after the onset of the neurodegenerative insult. in contrast, for slowly evolving neurodegenerative conditions, it is possible to treat during or even before individual neurodegenerative episodes occur. carbamazepine (3) is commonly used to alleviate the symptoms of ms, such as spasms, nerve pain, and trigeminal neuralgia, and lamotrigine has been trialled in neuroprotection. research into the potential neuroprotective effects of these compounds is gaining increasing momentum because of a better understanding of the role of nav channels in nerve damage. to understand the role of individual nav channel isoforms in neuroprotection although most of the sodium channel variants are expressed at different levels in the cns, nav1.6 expression is widespread but is more abundant in nerves of the retina, cerebellum, and cortex tissue. in a mature, myelinated axon, nav1.6 tends to cluster and is the predominant isoform at the nodes of ranvier. a significant increase in nav1.6 density can be seen subsequent to nerve fiber injury in traumatic brain injury and multiple sclerosis. mechanical, ischemic, and inflammatory insult can, over time, contribute to this degeneration. shear and stretch forces, despite not destroying the cells or severing the axons can, nonetheless, produce secondary degeneration in brain tissues. rapid tetrodotoxin - sensitive calcium overload occurs in stretch - traumatized axons, which suggests that in neuropathologic conditions structural degradation of the axolemmal bilayer can foster a chronically left - shifted nav channel operation. this points to leaky nav channels playing an important role in determining neuronal cell survival. other nav channel isoforms, namely, nav1.1 and nav1.3, have also been implicated in traumatic brain injury models. overall, there is no clear understanding of the specific contributions of each isoform to the neuroprotective effect ; we anticipate that investigations of the action of well - characterized compounds will aid in this regard. previous work by this group designed a class of voltage - dependent sodium channel modulators based on the indazolyloxadiazolyl scaffold. further development of analogues around this scaffold has now identified a series of imidazolylethylindazoles with good neuroprotective effects. following assessment of sodium channel isoform selectivity and functional activity, a candidate molecule, cfm6104, 6 (figure 1), was tested in an in vivo optic neuritis (inflammation of the optic nerve) mouse model of ms and found to prevent the consequent loss of retinal nerve cells. in our previous investigations, we demonstrated that aminomethyloxadiazolylindazoles had good neuroprotective activity. if the amino group was protected as a boc group, then the activity was generally lost. however, exploration of alternative groups to the indazole n1/n2 benzyl revealed a boc - protected intermediate (vide infra) with surprising neuroprotective activity. this molecule exhibited a different sar profile to the previous series with lower cytochrome p450 inhibition. we therefore carried out a detailed investigation of the neuroprotective activities of this series. key objectives were to maintain the neuroprotective activity and to improve the metabolic stability to allow evaluation in vivo. the synthesis of 3-[3-tert - butoxycarbonylaminomethyl-1,2,4-oxadiazol-5-yl]indazole 7 (scheme 1) has been previously described. this compound was utilized as a key synthetic intermediate for the production of a further series of compounds. the stereoselective synthesis of alkyl n1- and n2-heteroaromatic - substituted compounds (scheme 1) was carried out using a cesium- or potassium carbonate - mediated alkylation of an alkyl halide - functionalized heteroaromatic compound (n1), 8, or a mitsunobu reaction with an alcohol - functionalized heteroaromatic compound (n2), 9. boc removal was performed using trifluoroacetic acid, triisopropylsilane, and water to yield the free amines 10 and 11. the benzamides were formed via a coupling reaction between the free amine and r - substituted benzoic acid in the presence of dmf, hatu, and dipea at room temperature. this reaction occurred at various efficiencies (975%) across the range of substituted oxadiazolylindazoles and substituted benzoic acids. the sulfonamide analogues were formed by reaction of the free amine with r - substituted benzene sulfonyl chloride in the presence of sodium carbonate at room temperature with reaction efficiencies of 2439%. activity against sodium channels was assessed using a radioligand binding assay using [h]sipatrigine as the ligand and by patch - clamp electrophysiology on cloned human channels. the in vitro neuroprotection assay was an adaptation of an original study by fowler and li. in this system, rat hippocampal slices are subjected to oxygen - glucose deprivation, and the subsequent progression to cell death is monitored by determining their atp levels. nav channel isoform activity was determined using an automated patch - clamp system against hnav1.1hnav1.8/3 expressing cells. t - cell immunosuppressive activity was assessed using a simple contact hypersensitivity model that detects t - cell proliferation to oxazolone in lymphnodes. in vivo neuroprotection was evaluated in an optic neuritis model using double - transgenic mice expressing both a thy1-promoter - driven cyan fluorescent protein restricted to retinal ganglion cells and a myelin oligodendrocyte glycoprotein t - cell receptor (tcr). following injection of bordetella pertussis toxin, the mice develop subneurological experimental autoimmune encephalomyelitis (eae) and optic neuritis in the optic nerve, which then leads to retinal ganglion cell loss secondary to axon damage. initial testing with n1- and n2-functionalized tert - butyl carbamate - protected analogues showed encouraging results in the [h]sipatrigine binding and neuroprotection assays (table 1). benzyl - functionalized molecules 14 and 15, reported in previous work, are shown for comparison. a combination of reasonable potency (20 m) and > 30% neuroprotection identifies active compounds. results are normalized to the effect of ttx and are based on the mean of at least three experiments. replacement of the benzyl group with substituted and nonsubstituted heteroaromatic groups showed a general decrease in the ability of the compounds to displace the radioactive ligand, with the notable exceptions of the ethylimidazole analogues 16 and 17 (table 1). other side chains with weakly basic pyridyl moieties, 18 and 19, demonstrated moderate binding and neuroprotective activity, whereas nonbasic heterocycles 20 and 21 or bulkier groups 22 and 23 displayed weak binding or low neuroprotection. in the previous series, a free amine group led to a general increase in the neuroprotection by the benzylindazole analogues (e.g., compounds 24 and 25 ; table 2). that trend was not observed here. the modest neuroprotection observed for the imidazole and pyridine analogues was removed with free amines such as 26 and 27. the neutral side chains ethylthiophene 30, methylisoxazole 31, and substituted benzyls 32 and 33 all showed good binding and modest neuroprotection. results are normalized to the effect of ttx and are based on the mean of at least three experiments. these results supported the idea that the activity observed for the indazoles substituted by basic heterocycles at the n1 position was not following a similar sar pattern to the original series and required a lipophilic group at the oxadiazolylmethylamine. when the free amine analogues were functionalized with a benzamide group at the amine moiety, the neuroprotection and the radioligand - displacement ability of some of the analogues was improved, with moderate to good levels of binding observed for n1 and n2 imidazole analogues 6 and 34 (table 3). thus, it appeared that a benzamide group could mimic the action of the tert - butyl carbamate. methylpyridyl analogue 35 showed modest binding, whereas ethylthiophene 36 and methyloxazole 37 were essentially inactive. results are normalized to the effect of ttx and are based on the mean of at least four experiments on the basis of these encouraging effects, a new set of n1 and n2 imidazole analogues was designed and synthesized to see if improved binding and neuroprotective activity was achievable. the new set of n1 and n2 ethyl-2-imidazoles (compounds 3864, table 4) showed a range of activity, with most showing good ability to displace the radioligand [h]sipatrigine, and a range of neuroprotective activity, many with moderate to good neuroprotection. in the n1-substituted series, all but one of the 11 new analogues had a binding ic50 90%). five benzamide and sulphonamide analogues that were fluorine- or chlorine - substituted at the 4, 5, and 6 positions on the indazole ring were also tested to see if this modification could arrest the rate of metabolism. the only compound with moderately increased stability was the co-3-ocf3ph - substituted benzamide, 42. similarly, substitution of the benzamide or changing to a sulfonamide did not provide much improvement in the metabolic stability of the n2 analogues of benzamide 34. interestingly, however, substitution at the 4 position with the amide group, nhcoch3, in both the sulfonamide 64 and benzamide 34 analogues gave significant improvement in stability, with turnovers of 54 and 45%, respectively, after 40 min. unfortunately, these 4 position - substituted nhcoch3 compounds were also some of the most inactive compounds in the neuroprotective assay. compounds 6 and 51 were examined by patch - clamp electrophysiology to determine their effects on sodium channel isoforms (table 6 and figure 2). compound 6 showed preferential activity for the inactivated state (figure 2a) but little discrimination between subtypes. the block of nav1.1, 1.3, and 1.6 is implicated in the pharmacological basis of neuroprotection (vide supra), and activity was noted against these isoforms consistent with the compounds ability to displace radiolabeled sipatrigine (table 6). compound 51 showed good activity in both the radioligand - displacement and neuroprotection assays, and this is reflected in its potent block across the range of isoforms. it blocks many of the isoforms at an order of magnitude lower concentration than 6, with its most potent block against the nav1.5 sodium channel, an isoform found primarily in cardiac muscle. there also appears to be less functional selectivity compared to 6 (figure 2b). the potency of 51 against nav1.1, 1.3, and 1.6 when compared to 6 may account for the observed increase in neuroprotection seen with this compound (table 6). detail of activity of 6 (a) and 51 (b) against the nav1.6 isoform. blue triangles are block of the inactivated state, red circles are block of 10 hz current, and black squares are block of tonic current. the ratio of ic50 a / c and b / c illustrates the degree of functional selectivity for the inactivated state. compound 6 was selected for detailed in vivo evaluation on the basis of its mix of properties : in vitro sodium channel activity, activity against the neuronal nav isoforms, functional selectivity, and stability in rat liver microsomes. the influence of 6 was assessed in vivo in wild - type and myelin oligodendrocyte glycoprotein - specific t - cell receptor transgenic mice (figure 4 ; 5). first, 6 was examined for t - cell immunosuppressive activity, as the eae model of ms is well - known to be t - cell - dependent. rather than use transgenic mice where all t - cells have the same specificity, a contact - hypersensitivity model was used because it is known to be predictive in identifying in vivo immunosuppressive doses for eae studies. doses of 6 ranging from 550 mg / kg were administered intraperitoneally (i.p.) from day 1 to day 2, and the in vivo induced proliferative response was assessed in the draining lymph nodes 3 days (the peak time of t - cell proliferation) after the sensitization to the contact - sensitizer oxazolone on day 0. there was no evidence suggestive of any inhibitory effect of sensitization based on cell numbers within the lymph nodes or based on a per cell proliferative response (figure 3). importantly, this study demonstrated that the drug was well - tolerated and there was no apparent toxicity. we next sought to assess whether 6 could exert a neuroprotective effect and limit the amount of axonal and nerve loss that results as a consequence of t - cell autoimmunity within the cns. following the development of optic neuritis in our model mice, demyelination was augmented following injection of 250 g of z12 rat igg2b demyelinating antibody on day 14. retinal ganglion cell survival following treatment of animals with 5 mg / kg i.p. 6 was assessed on day 21 postinduction in retinal flatmounts (figures 3a, b and 4). it was found that 6 increased ganglion cell survival (p < 0.02) and reduced the mean retinal loss from 914 117 to 1298 77 cells / mm compared to 1653 89 cells / mm in a group of age - matched control animals without optic neuritis (figure 4). this study suggests that this class of compounds may have some utility in controlling the accumulation of nerve loss that occurs in diseases such as ms. mice received epicutaneous application of 25 l of 2.5% oxazolone (ox) in acetone olive oil (aoo) 4:1 on day 0 on the dorsum of the ear. injections of either vehicle (dmso / cremophor / phosphate buffered saline, 1:1:18) or 6 from day 1 to day 2. on day 3, the draining auricular lymph nodes were removed from three mice and pooled, and a single - cell suspension was made. lymph node cells were counted, and 5 10 cells per well, in triplicate, were cultured overnight at 37 c. t - cell proliferation was assessed using the celltiter 96 aqueous cell proliferation assay, which uses a mts tetrazolium compound that is bioreduced by live cells. retinal ganglion cells in the retina of mice (a) before or (b) after the development of optic neuritis. differences between vehicle and drug - treated controls were assessed using student s t test. during ms, nav channels are redistributed along demyelinated nerves, which can help to restore function to some extent but leaves them vulnerable to excessive sodium entry. our strategy was to develop compounds with good activity toward sodium channel inhibition, in particular against the neuronal isoforms nav1.1, 1.3, and 1.6, but, most importantly, which could also display neuroprotective capabilities in an in vitro hippocampal slice assay system. the selection of a candidate molecule for in vivo studies was based on a balanced assessment of properties, principally sodium channel activity, neuroprotection, and in vitro stability. the use of the hippocampal slice model, measuring atp levels and tuned for sodium channel blockade, was key in ensuring an appropriate functional effect. in general, the series was found to exhibit poor stability in rat liver microsomes in vitro, with 6 being a notable exception that allowed us to test this paradigm in vivo. there are reports on the metabolism of 1,2,4-oxadiazoles, and this may be the site of the metabolic fragility. studies detailing the pharmacokinetics and localization of 6 to brain and spinal cord lesions in other eae models are published elsewhere. sodium channel blockade with 6 in vivo was found to be neuroprotective, preventing retinal ganglion cell loss in optic neuritis in this refined eae model. in this case, the mechanism of neuroprotection is unlikely to be due to peripheral immunosuppression that prevents disease from developing. there was no evidence of t - cell immunosuppression seen here in a paradigm that can detect immunosuppressive doses of drugs even following a single dose. furthermore, in our hands, overt immunosuppression does not affect the development of disease in conventional eae using a similar delivery of sodium channel - blocking compounds including phenytoin, sipatrigine, carbamazepine, and oxcarbazepine, which is in contrast to some studies where immunosuppression of sodium channel blockers delivered in the drinking water was noted. neuroprotection with 6 is most likely to occur at the level of the axon or nerve and perhaps through inhibition of microglial activity, which are probably central to the pathogenesis of progressive ms. therefore, blockade of sodium channels could result in neuroprotective effects on immune and nonimmune components that may drive progressive nerve loss in ms. neurodegeneration accumulates slowly over time and therefore allows a larger time window for treatment onset compared to acute conditions such as stroke. lesions in ms can develop throughout the neuroaxis but are common within the optic nerve, where optic neuritis is often an initial sign of disease. the visual pathway is the most accessible part of the human nervous system, and optic neuritis in ms is considered to be an ideal tissue to study the effect of neuroprotective treatments in ms and is being targeted in a number of studies. amiloride and phenytoin are currently in phase ii clinical trials for the treatment of optic neuritis in ms (nct01802489, nct01451593). we chose to utilize an optic neuritis model for in vivo evaluation of neuroprotection in this study. recently, lamotrigine was examined in progressive ms, but it did not appear to inhibit the development of brain atrophy, which was the primary outcome measure, although significant effects of slowing of walking deterioration were noted. there is a clear need to evaluate better tolerated and more effective neuroprotective agents. the chemical series described here may provide a platform for the development of pharmaceutical agents for the treatment of ms and other neurological diseases. all compounds were at least 95% pure as assayed by lcms (electrospray positive). the preparations of analogues 6 and 51 are shown below, and the preparation of the remainder of the analogues is provided in the supporting information. to a solution of r - substituted benzoic acid (0.10 g, 0.82 mmol) in dmf (5 ml) were added hatu (0.34 g, 0.9 mmol, 1.1 equiv) and diisopropylethylamine (0.23 g, 0.31 ml, 1.8 mmol, 2.2 equiv), and the solution allowed to stir for half of an hour at room temperature under nitrogen. the amine (0.9 mmol, 1.1 equiv) was then added, and the brown solution was allowed to stir overnight. the dmf was removed in vacuo, and the resulting crude oil was dissolved in ethyl acetate and washed with water, 1 n hcl, 1 n nahco3, and brine. the organic phase was then dried over magnesium sulfate, and the solvent was removed in vacuo. the crude oil was purified using flash chromatography, eluting with 10% methanol in dichloromethane. to a solution of the appropriate amine (0.22 g, 0.71 mmol, 1 equiv) in water (10 ml) was added r - substituted benzene sulfonyl chloride (0.78 mmol, 1.1 equiv). the solution was allowed to stir, and saturated sodium carbonate(aq) was added gradually to adjust the acidic ph to 8. the white precipitate was filtered off, washed with diethyl ether, and dried in vacuo. h nmr (300 mhz, dmso) 9.27 (t, j = 5.7 hz, 1h, nh), 8.13 (d, j = 8.1 hz, 1h, arh), 7.92 (d, j = 6.7 hz, 2h, arh), 7.64 (d, j = 8.5 hz, 1h, arh), 7.617.41 (m, 4h, arh), 7.417.27 (m, 2h, arh), 7.02 (s, 1h, arh), 6.71 (s, 1h, arh), 4.96 (t, j = 5.8 hz, 2h, ch2), 4.73 (d, j = 5.7 hz, 2h, ch2), 4.55 (t, j = 5.8 hz, 2h, ch2). c nmr (75 mhz, cdcl3) 170.1, 168.9, 166.5, 140.8, 137.2, 133.7, 131.5, 129.3, 128.4, 127.7, 127.4, 127.3, 123.7, 121.5, 120.3, 119.6, 110.5, 49.7, 45.7, 35.3. hrms (tof ms es) calcd for c22h20n7o2 (mh), 414.1678 ; found, 414.1668. h nmr (300 mhz, cdcl3) 8.18 (s, 1h, nh), 8.09 (d, j = 8.4 hz, 1h, arh), 7.99 (d, j = 7.7 hz, 1h, arh), 7.95 (s, 1h, arh), 7.81 (d, j = 8.6 hz, 1h, arh), 7.547.30 (m, 5h, arh), 6.69 (s, 1h, arh), 6.30 (s, 1h, arh), 5.37 (t, j = 5.5 hz, 2h, ch2), 4.82 (d, j = 5.1 hz, 2h, ch2), 4.55 (t, j = 5.5 hz, 2h, ch2).c nmr (75 mhz, dmso) 237.95, 168.13, 167.26, 164.96, 151.20, 148.34, 147.35, 137.33, 135.81, 130.68, 128.25, 127.08, 126.41, 125.70, 124.15, 122.28, 119.96, 119.79, 119.23, 118.23, 53.29, 45.60, 35.20. hrms (tof ms es) calcd for c25h30n10o5 (mh), 498.1501 ; found, 498.1500. six to eight week old male and female wild - type and double - transgenic c57bl/6-cg - tg(thy1-cfp)23jrs.tg (tcra2d2,tcrb2d2)1kuch / j mice were used from stock bred at queen mary university of london. founder mice were originally obtained from jackson laboratories, bar habor, me, usa). these transgenic mice express both a h-2a - restricted t - cell receptor (v3, v11) specific for myelin oligodendrocyte glycoprotein residues 3555 and a neuronally restricted thy1 (cd90)-promoter - driven expression of cyan fluorescent protein, which is only present in the retinal ganglion cells within the retina. mice were maintained on a 12 h light / dark cycle with controlled humidity and temperature and housed as described previously. the reporting of most aspects of the experimental design, which conform with the arrive guidelines, has been described previously. all animal studies were approved by the queen mary ethical review panel and the united kingdom government home office inspectorate. these studies conformed to the united kingdom animals (scientific procedures) act 1986 for the use of animals in research. mice (n = 34/group) received epicutaneous application of 25 l of acetone / olive oil (4:1, aoo) or 25 l of 2.5% oxazolone (ox, sigma - aldrich, poole, uk) on day 0 on the dorsum of the ear. on day 3, the draining auricular lymph nodes were removed, and a single - cell suspension was made. lymph node cells were counted, and 5 10 cells / well, in triplicate, were cultured overnight at 37 c/5% co2 in 200 l of rpmi-1640 medium supplemented with 10% heat - inactivated fetal calf serum, l - glutamine, sodium - pyruvate, and antibiotics as described previously. t - cell proliferation was assessed using the celltiter 96 aqueous non - radioactive cell proliferation assay according to the manufacturer s instructions (promega, southhampton, uk). optic neuritis was induced in c57bl/6-cg - tg(thy1-cfp)23jrs.tg(tcra2d2, tcrb2d2)1kuch / j transgenic mice. subclinical eae in the absence of paralytic disease was induced following administration of 150 ng of bordetella pertussis toxin (sigma - aldrich) in phosphate - buffered saline. optic neuritis within the optic nerve was augmented following the injection of 250 g of z12 rat igg2b mouse myelin oligodendrocyte - specific demyelinating antibody on day 14. animals were injected daily from day 021 of the experiment with 5 mg / kg i.p. animals were killed on day 21 postinduction, and eyes were enucleated and immersed in 4% paraformaldehyde (sigma - aldrich) in pbs (ph 7.4) overnight. the retinae were dissected, and the cornea, sclera, lens, hyaloid vasculature, and connective tissue were removed in 2 normal - strength pbs. four radial incisions were cut around the retina, and flatmounts were mounted onto slides and coverslipped with antifade glycerol (citifluor ltd., the retinal flatmounts were imaged by fluorescent microscopy, retinal ganglion cell density was calculated by counting cyan fluorescent protein - expressing retinal ganglion cells using stereology software with a fractionator probe, and the number cells in the four quadrants around the optic nerve head was counted. the parametric data was assessed using student s t test, incorporating tests for equality of variance using sigmastat software (systat software, inc., san jose, ca, usa). | a series of imidazol-1-ylethylindazole sodium channel ligands were developed and optimized for sodium channel inhibition and in vitro neuroprotective activity. the molecules exhibited displacement of a radiolabeled sodium channel ligand and selectivity for blockade of the inactivated state of cloned neuronal nav channels. metabolically stable analogue 6 was able to protect retinal ganglion cells during optic neuritis in a mouse model of multiple sclerosis. |
as stated by fdration dentaire internationale, forensic odontology is the branch of dentistry which, in the interest of justice, deals with proper handling and examination of dental evidence and with the proper evaluation and presentation of dental findings. forensic dentistry is important for human identification, especially when conventional methods can not be applied, usually due to advanced decomposition, carbonization or fragmentation of the body. in accidents or natural disasters involving severe trauma and fire, the use of fingerprints, facial recognition methods can be difficult or even impossible. in such cases, a post - mortem record is created by a forensic dentist to identify the victim by determining the age, stature, ancestry, sex and socio - economic class, where the body has been mutilated and the extremities or head amputated from the trunk. one of the main goals of forensic anthropology is to determine the identity of a person from the study of some skeletal remains. in the last few decades, anthropologists have focused their attention on improving those techniques that allow a more accurate identification. before making a decision on the identification, it is necessary to follow different processes that let them assign a sex, age, human group and height to the subject from the study of bones found. different methodologies have been proposed, according to the features of the different human groups of each region. in the identification of unknown human remains, stature and the method of using teeth and skull measurements has several advantages as the anatomical landmarks are standard, well developed and easy to locate. an estimate must then be made based on the known relationship of the remains to stature and gender. teeth form an excellent material for anthropological, genetic, odontologic and forensic investigations. amongst all the teeth, the mandibular canines are found to exhibit greatest sexual dimorphism. with this background in concern with the forensic odontology, paleontology and esthetic dentistry, we undertook this study with the aim to investigate and correlate height and gender from anthropometric and odontometric data of the skull. a relationship of height of a person with the maxillary extent and circumference of skull and identifying gender with the combined mesiodistal (md) width of maxillary anterior teeth with the statistical aid of regression analysis of these variables was done. the study was conducted in the department of oral and maxillofacial pathology and microbiology, i.t.s center for dental studies and research, muradnagar, ghaziabad (up) with the representative study subjects of 60 patients as 30 males and 30 females in the age group of 15 - 25 years. complete set of fully erupted, periodontally healthy teethpresence of non - carious, non - worn teeth with no dental history of any crown restorationscomplete set of intact and satisfactorily aligned maxillary anterior teethno history or clinical evidence of cleft palate, orthognathic surgery or traumano history or clinical features suggestive of endocrinal disorders, metabolic disorders, developmental disorders and history of prolonged illness. complete set of fully erupted, periodontally healthy teeth presence of non - carious, non - worn teeth with no dental history of any crown restorations complete set of intact and satisfactorily aligned maxillary anterior teeth no history or clinical evidence of cleft palate, orthognathic surgery or trauma no history or clinical features suggestive of endocrinal disorders, metabolic disorders, developmental disorders and history of prolonged illness. stature correlation to skull and jaw dimensions was done for the possibility of estimating height in forensic investigations. after obtaining informed consent from the subject selected, measurements of the maxillary extent of the skull was obtained using rakosi jarabak analysis on the lateral cephalograph of 8 ' by 10 ' radiographic films. the maxillary extent of the skull was derived as the linear distance between the anterior nasal spine to the posterior nasal spine as shown in figure 1. measurements of md widths of the six maxillary anterior teeth on the cast were done. the greatest md crown widths of the maxillary anterior permanent six teeth were measured between the anatomic contact points of each tooth on either side of the jaw, using digital vernier calliper as shown in figure 2. maximal fronto - occipital circumference was measured by placing a nonstretchable plastic tape (calibrated in millimeters) just on the occipital prominence and the supraorbital ridges, while viewing the subject laterally also to ensure proper placement of the tape. in cases of some hairstyles in males, we drew the tape tightly and compressed the hair as much as possible. in cases of females, we asked the subjects to lift their hair in the occipital area and the tape was placed against the skin and not over the lumps of hair. maxillary extent using rakosi jarabak analysis on lateral cephalographs mesiodistal crown widths of the maxillary anterior permanent six teeth using vernier calliper in order to define sexual dimorphism and the morphometric criteria for mandibular canines, the intercanine distance, right and left mandibular canine width were observed on study casts as shown in figures 3 and 4 of same 60 study subjects (m : f::30:30) selected above. intercanine distance using vernier calliper right and left mandibular canine width using vernier caliper further the mandibular canine index was calculated as : the mandibular canine index was calculated and the readings obtained were subjected to statistical analysis to derive conclusions and sexual dimorphism in right and left mandibular canines. comparisons were made between the measurements recorded with respect to the gender using statistical mean, standard deviation, range and student 's t - test. combined data, male and female data were analyzed separately for linear regression of height to the parameters recorded. complete set of fully erupted, periodontally healthy teethpresence of non - carious, non - worn teeth with no dental history of any crown restorationscomplete set of intact and satisfactorily aligned maxillary anterior teethno history or clinical evidence of cleft palate, orthognathic surgery or traumano history or clinical features suggestive of endocrinal disorders, metabolic disorders, developmental disorders and history of prolonged illness. complete set of fully erupted, periodontally healthy teeth presence of non - carious, non - worn teeth with no dental history of any crown restorations complete set of intact and satisfactorily aligned maxillary anterior teeth no history or clinical evidence of cleft palate, orthognathic surgery or trauma no history or clinical features suggestive of endocrinal disorders, metabolic disorders, developmental disorders and history of prolonged illness. stature correlation to skull and jaw dimensions was done for the possibility of estimating height in forensic investigations. after obtaining informed consent from the subject selected, measurements of the maxillary extent of the skull was obtained using rakosi jarabak analysis on the lateral cephalograph of 8 ' by 10 ' radiographic films. the maxillary extent of the skull was derived as the linear distance between the anterior nasal spine to the posterior nasal spine as shown in figure 1. measurements of md widths of the six maxillary anterior teeth on the cast were done. the greatest md crown widths of the maxillary anterior permanent six teeth were measured between the anatomic contact points of each tooth on either side of the jaw, using digital vernier calliper as shown in figure 2. maximal fronto - occipital circumference was measured by placing a nonstretchable plastic tape (calibrated in millimeters) just on the occipital prominence and the supraorbital ridges, while viewing the subject laterally also to ensure proper placement of the tape. in cases of some hairstyles in males, we drew the tape tightly and compressed the hair as much as possible. in cases of females, we asked the subjects to lift their hair in the occipital area and the tape was placed against the skin and not over the lumps of hair. maxillary extent using rakosi jarabak analysis on lateral cephalographs mesiodistal crown widths of the maxillary anterior permanent six teeth using vernier calliper in order to define sexual dimorphism and the morphometric criteria for mandibular canines, the intercanine distance, right and left mandibular canine width were observed on study casts as shown in figures 3 and 4 of same 60 study subjects (m : f::30:30) selected above. intercanine distance using vernier calliper right and left mandibular canine width using vernier caliper further the mandibular canine index was calculated as : the mandibular canine index was calculated and the readings obtained were subjected to statistical analysis to derive conclusions and sexual dimorphism in right and left mandibular canines. comparisons were made between the measurements recorded with respect to the gender using statistical mean, standard deviation, range and student 's t - test. combined data, male and female data were analyzed separately for linear regression of height to the parameters recorded. the descriptive statistics for the measurements of the four parameters was recorded in the study subjects. table 1 shows that the sample of 60 subjects presented with a mean height of 1616.17 mm with a standard deviation of 64.87. the mean circumference of the skull is 534.55 mm with a standard deviation of 18.52. the md width of upper anterior is 50.13 mm with a standard deviation of 6.694. the distance from anterior nasal spine to posterior nasal spine is with a mean value of 54.92 mm and standard deviation of 6.95. the anova of linear regression analysis of height and its predictors (i.e., three parameters) was found to be statistically significant with the p value of 0.001. descriptive statistics the inferential statistics of the parameters recorded using anova linear regression analysis on linear regression analysis, the regression equations were derived [table 3 ]. maxillary extent was found to be statistically significant predictor of height with p = 0.027 and the circumference of the skull as a highly significant predictor with p = 0.004. on linear regression analysis the regression equations were derived as the constants listed in the table the inferential comparative statistics of canine index using karl pearson 's coefficient correlation [table 4 ] shows the mean value, which evidenced that the left canine index was higher in female than male having less standard deviation of 0.022. karl pearson 's coefficient correlation established that the left canine index for female was statistically significant by t - test with p = 0.025. mass fatality incidences represent a big challenge in the identification of deceased victims. in such circumstances it necessitates putting a hierarchy system of forensic science. estimation of stature, as part of the identification process has a long history in physical anthropology. when the body has been mutilated, it is common to have the extremities or head amputated from the trunk. an estimate must then be made based on the known relationship of the remains to stature. in the present study, estimation and correlation of height and gender from odontometry and anthropometric data of the skull was done. in cases, where identification has to be performed based on skeletal remains, the literature, however, is lacking in the derivation of height from anthropometry of the skull along with odontometric parameter. osteometry seems to be the preferred technique in the identification process with several advantages as the anatomical landmarks are standard, well defined and easy to locate. the estimation of living stature from long bones is based upon the principle that the long bones correlate positively with the stature. since this is true, parts of each bone should also be related to stature even though they may not correlate as highly. furthermore, adding the odontometric and craniometric parameters elevated the correlation with the stature estimation. the study of the tooth is a non - destructive and simple process which can be applied to both living and deceased persons, in contrast to other time consuming, expensive, less reliable and destructive methods, which may not be acceptable for ethical, religious, cultural or scientific reasons. further, procedures such as digitization of lateral cephalograph analysis avoid the bias inherent in observer subjectivity and improve reliability, accuracy and precision. canine teeth are a good candidate for sex determination because they are often present in old age. they are less likely than other anterior teeth to suffer wear as a result of age or any particular work. based on the above background, this study was conducted to develop a method for stature and gender determination and their correlation using odontometry and skull anthropometry based on the relationship between various morphological variables of teeth and skull measurements using advanced and more reliable procedures. introna. in 1993 discussed correlations between cranial diameter and height in the same age group as in the present study, but other parameters were not undertaken. chiba and terazawa in 1998 conducted head and skull measurements for height estimation but did not include gender determination, which is a preliminary unit of an investigation procedure. estimated the height of a person from teeth and skull but again lacked the critical gender determination in individual recognition. the present study provides a statistically valid technique to achieve accurate clues of stature as well as conspicuous need of gender determination from an individual 's fragmentary remains. in the present study, it was observed that circumference of skull and maxillary extent was statistically significant in correlation to height. while in contrast to past studies, mesiodistal dimension of anteriors was found to be statistically insignificant. in contrast to rare past studies, the present study takes into account maxillary extent, which is never taken into account as one of the parameter in stature determination using rakosi jarabak analysis. rakosi jarabak analysis is considered to be a crucial and precise analysis of skull dimensions in lateral cephalometry. on analysis, the three parameters i.e. anterior nasal spine- posterior nasal spine, ans - pns (maxillary extent), mesiodistal dimension of anteriors, circumference of skull corresponded with the variation in height by a highly significant correlation. in respect to gender determination, garn and lewis (1967), lysell and myrberg (1982) concluded that the mandibular canine demonstrated the greatest sexual dimorphism amongst all teeth. lew and keng in 1991 showed same results in their study on ethnic chinese population. hashim and murshid in 1993 studied the age group of 13 - 20 years found that only the canines in both jaws exhibited a significant sexual difference. (1999) concluded that the left mandibular canine with 7.7% followed by the right mandibular canine with 6.2% shows the maximum sexual dimorphism. further, when these parameters were measured intraorally, they were found to be statistically insignificant. omar, azab in 2009 demonstrated that maxillary canine showed greater sexual dimorphism than mandibular canine in variable age groups. this was contradictory to the present study as they did not take into consideration the age dependant wearing away of the tooth. gorea, sharma in 2010 observed the effectiveness of intercanine distance in their study for predicting the sex. their study considered intercanine distance in contrast to the present study and found that intercanine distance was greater in males for both the jaws. they also lacked in even distribution of patients in each age group. in the present study for gender determination, the left mandibular canine index was found to exhibit greater sexual dimorphism with a highly statistically significant p value of 0.025, however, the right mandibular canine index was found to be statistically insignificant. in the emerging field of forensic odontology, skull anthropometry including maxillary extent, mesiodistal dimension of anteriors and circumference of skull are beneficial for stature estimation. in concern with gender determination, which is a preliminary investigation in genetic, legal and forensic odontology, paleontology, left mandibular further research is warranted with larger samples in the direction of definite improvement in the accuracy of stature estimation from odontometry. we recommend studies on cadavers and skulls without soft tissue covering as well as assessment of the effect of aging on the regression coefficients in stature estimation. | background : when the body has been mutilated, it is common to have the extremities or head amputated from the trunk. in concern with forensic odontology, an estimate must have been made based on the correlation of osteometry along with odontometry in determining sex, race and stature.objective:the objective of this study is to investigate and correlate height and gender from odontometry and anthropometric data of the skull.materials and methods : the study was conducted in the department of oral and maxillofacial pathology and microbiology, i.t.s center for dental studies and research, muradnagar, ghaziabad (up) with the representative study subjects of 60 patients as 30 males and 30 females in the age group of 15 - 25 years. the selected parameters were measured and then correlated to investigate stature and gender from odontometry and anthropometric data of the skull.results:on linear regression analysis, the selected parameters were found to be statistically significant predictor of height. it was also established by karl pearson 's coefficient correlation that the left mandibular canine index for female was statistically significant to show sexual dimorphism.conclusion:in the emerging field of forensic odontology, skull anthropometry, odontometry exhibits stature determination and strong sexual dimorphism. |
medullary thyroid carcinoma (mtc) is a neuroendocrine tumor derived from parafollicular cells of the thyroid gland. the first description of its major histological features and characterization as a separate entity was done in 1959 by hazard.. it was then rapidly recognized that this carcinoma had distinctive clinical features, in that mtc was found to be associated with pheochromocytomas and other tumors, an association now known as multiple endocrine neoplasia type 2 (men2). the identification of familial cases led to the conclusion that many mtcs were probably hereditary. in 1966, subsequently, calcitonin provocation tests with calcium and/or pentagastrin were used to identify individuals susceptible to familial mtc, and those individuals were offered prophylactic thyroidectomy. activating mutations of the rearranged during transfection (ret) proto - oncogene were described for the first time in patients with familial forms of mtc in 1993 [8, 9 ]. since then, several germline ret proto - oncogene mutations have been found in almost 100% of hereditary mtcs. additionally, somatic ret proto - oncogene mutations have been found in approximately 40% of patients with sporadic mtc [10, 11 ]. these discoveries created new paradigms for the management of mtc : (1) the identification of germline ret proto - oncogene mutation carriers would allow the removal of the thyroid cells at risk for transformation early in life (this paradigm is perhaps the most perfect example of primary cancer prevention in humans to date), (2) the identification of several hidden familial medullary thyroid cancers, and (3) the abnormally activated ret gene might become a target to treat patients with advanced sporadic and hereditary mtc. our goal in this paper is to describe the molecular pathways associated with mtc tumorigenesis and emerging therapies against this disease (figure 1). malignant neoplasms have the capacity to invade the surrounding normal tissue and metastasize to distant sites. molecules that are responsible for growth and other fundamental cell functions are frequently mutated in cancers. an example of such molecules is the tyrosine kinase (tk) receptors (figure 2). tk receptors are membrane - spanning proteins with large n - terminal extracellular domains that act as ligand - binding sites and intracellular domains that catalyze the transfer of the phosphate of adenosine-5-triphosphate (atp) to hydroxyl groups of tyrosines of target proteins. tks control a wide range of fundamental processes of cells such as the cell cycle, proliferation, angiogenesis, differentiation, motility, apoptosis, and survival. the ret receptor is a transmembrane protein constituted by extracellular, transmembrane, and cytoplasmatic domains. the extracellular domain has a stretch of approximately 100 amino acids that are similar to members of the cadherin family of ca2dependent cell adhesion molecules. the binding of calcium to this cadherin - like domain is needed for conformational changes necessary for the interaction with different glial cell line - derived neurotrophic factor ligand family members (gdnf, neurturin, artemin, and persephin). these ligands in conjunction with a ligand - specific coreceptor (gfr 14) activate ret. these ligands or coreceptors are not always needed for ret activation. following ret activation these residues serve as docking sites for adaptor proteins that link the receptor to the main signal transduction pathways. for instance, tyrosine 1015 is a binding site for phospholipase c that activates protein kinase c (pkc). other examples are given by the phosphorylated tyrosine 981 which is responsible for src activation upon ret engagement and the phosphorylation of tyrosine 1062, several adaptor or effector proteins are recruited including shc, frs2, dok family proteins, insulin receptor substrate 2, and enigma. then, various pathways that regulate cell survival, differentiation, proliferation, and chemotaxis are activated, including ras - extracellular signal - regulated kinase (erk), phosphatidylinositol 3-kinase (pi3k)-akt, p58 mitogen - activated protein kinase (mapk), and jun n - terminal kinase (jnk) (figure 3). mutated ret is expressed in derivatives of neural crest cells, including hereditary and sporadic mtc and pheochromocytoma. these mutations are referred to as gain - of - function, because they lead to either a constitutively active tk or decreased specificity of the tk for its substrate. the most frequent clinical presentation is that of a thyroid nodule. up to 75% of patients with palpable mtc have nodal metastases in the central and ipsilateral neck compartments, and 47% of patients with palpable mtc have nodal metastases in the contralateral neck. somatic mutations occur in 30% to 40% of cases [10, 11 ]. exon 16, codon 918 atg acg mutation is the most common somatic mutation in sporadic mtc. this mutation is associated with larger tumors and a more advanced disease stage at diagnosis. hereditary mtc is preceded by c - cell hyperplasia and is usually bilateral and multicentric. hereditary forms of mtc are caused by germline ret proto - oncogene mutations and occurs as part of the men2 syndromes. men2a is characterized by mtc in almost 100% of gene carriers, pheochromocytomas, and parathyroid tumors. the most common mutations in men2a occur in one of six cysteine residues (codons 609, 611, 618, 620, 630, and 634) in the ret extracellular domain. the most frequently mutated residue found in patients with men2a is cysteine 634, in which removal of one - half of an intramolecular disulfide bond allows formation of an intermolecular disulfide bond with a second mutant molecule, thus leading to constitutive receptor dimerization. there are three variants of the syndrome : (1) men2a with hirschsprung disease, (2) men2a associated with cutaneous lichen amyloidosis, and (3) familial mtc, in which mtc is the only manifestation. familial mtc ret - mutation affects the extracellular cysteine - rich region and the tk domain. these mutations, unlike men2a, are in the tk domain and lead to an activated monomeric form, thus altering substrate specificity. the pi3k / akt cascade has been shown to be important in the pathogenesis of men2b in cell lines. it is one of four homologous transmembrane receptors (the others are her-2/erbb-2, her-3/erbb-3, and her-4/erbb-4) that mediate the actions of different growth factors, such as epidermal growth factor, transforming growth factor-, and neuregulins. the binding of ligands to these receptors induces egfr homo- and / heterodimer formation, kinase domain activation, and phosphorylation of specific tyrosine residue that serve as docking sites for molecules that lead to the activation of several cascades, including the mapk and pi3k pathways. egfr oncogenic activation can occur due to several mechanisms : excess ligand or receptor expression, activating mutations, failure of inactivation, or transactivation through receptor dimerization. to date, two major types of egfr - targeting agents exists monoclonal antibodies and small - molecule atp - competitive tk inhibitors (tkis) [35, 36 ]. pki166, a potent egfr kinase inhibitor, also decreases ret autophosphorylation and signaling in cell extracts despite lacking an effect on ret kinase activity. pki166 was tested in clinical trial in patients with mtc amongst others. however, due to liver toxicities the development of this drug was halted. aee788, another egfr kinase inhibitor, inhibits ret - induced growth at concentrations below its half maximal inhibitory concentration (ic50). a study of 153 primary and metastatic mtc samples revealed that although egfr mutations were rare, egfr expression was higher in metastatic sites than in primary tumor sites. mtc samples associated with ret 883 and 918 mutations had a significantly lower number of egfr polysomes and a tendency toward less egfr immunopositivity compared with samples associated with other ret mutations. therefore, it is speculated that the most aggressive ret mutations are less dependent on egfr activation, thereby explaining why egfr inhibitors are less effective in codon 918-mutated cell lines than in codon 634-mutated cell lines. the vascular endothelial growth factor (vegf) family of growth factors stimulates angiogenesis, endothelial cell proliferation, migration, survival, and vascular permeability by various tk receptors : vegfr-1, vegfr-2, and vegfr-3. there are several ligands for vegfrs : vegf - a (vegf) binds to both vegfr-1 and vegfr-2 ; vegf - b and placenta growth factor bind to only vegfr-1 ; and vegf - c and vegf - d are specific ligands for vegfr-3. angiogenesis is one of the essential alterations in cell physiology that predispose to malignancy in many tumors, and it is fundamental in tumor growth and metastasis. many molecules have been implicated as positive regulators of angiogenesis, including vegf, hepatocyte growth factor, interleukin-8, and platelet - derived growth factor (pdgf). activation of this receptor leads to a cascade of different pathways, including plc -pkc - raf - mek - mapk and pi3k - akt. lymphangiogenesis is also involved in tumor biology, and since lymphatic vessels arise from blood vessels, some of the angiogenic mechanisms are also used in this process. vegf - c and vegf - d stimulate both angiogenesis and lymphangiogenesis and link both processes. vegfr-3 is expressed mainly in lymphatic endothelial cells and is thought to be primarily involved in lymphangiogenesis. mtc has at least twofold expression when compared with normal thyroid tissue of vegf and vegf - r2. there is also an up to 20-fold increased expression of vegf - c and vegf - r3 in metastatic mtc. overexpression and activation of vegfr-2 in mtc correlate with metastasis. the c - met (met) proto - oncogene codes for the tk receptor of the hepatocyte growth factor. deregulated activation of met confers unrestricted proliferative, antiapoptotic, cell motility / migration, invasive, metastatic, and angiogenenic properties to cancer cells. silencing the endogenous met proto - oncogene, which is overexpressed in tumor cells, has been proven to impair the invasive growth in vitro, to decrease the generation of metastases in vivo, and to promote the regression of already established metastases. met and hepatocyte growth factor coexpression has been seen in a subset of mtc tumors and is associated with multifocality in mtc. may induce other tks compensatory activation. therefore, simultaneous inhibition of different activated tks may be the best way to approach mtc (table 1). to date, systemic targeted therapy for mtc has been administered in the context of clinical trials or has consisted of off - label use of drugs approved for other solid tumors. in this section, it inhibits vegfr-2, vegfr-3, ret, and to a lesser extent egfr and vegfr-1. the 4-anilinoquinazoline docks to the atp binding pocket of ret kinase, inhibiting it. at pharmacologically relevant doses, vandetanib inhibits tumor cell proliferation, survival, and angiogenesis without leading to direct cytotoxic effects on tumor or endothelial cells. in 2002, vandetanib was shown to inhibit the kinase activity of nih - ret / c634r (men2a) and nih - ret / m918 t (men2b) oncoproteins in vitro and to inhibit ret / men2b phosphorylation and ret / men2b - dependent mapk activation in vivo in nih - ret / men2b. two years later, a panel of point mutations targeting the ret kinase domain in men2 and sporadic mtc was screened for susceptibility to vandetanib. most of the mutant oncoproteins (ret / e768d, ret / l790f, ret / y791f, ret / s891a, and ret / a883f) were sensitive to vandetanib, while mutations substituting valine 804 either to leucine or to methionine (as occur in some cases of men2a) rendered the ret kinase significantly resistant. this is probably due to steric hindrance, because the val804gly mutation increased the sensitivity of ret to vandetanib. mice carrying a ret c634r mutation from a sporadic human mtc treated with vandetanib had inhibition of tumor growth. both egfr and vegfr-2 have been shown to be phosphorylated in tt and mz - crc-1 cells and inhibited by vandetanib. yet, in the presence of active ret, neither plays a prominent role in tt cell proliferation. however, when ret activity is inhibited, overstimulation of egfr is able to partially replace ret through a partial rescue of the mapk pathway. in such scenario, the inhibition of egfr by vandetanib these data support the idea that dual inhibition of ret and egfr is important, as it may overcome the risk of mtc cells ' escaping from ret blockade through compensatory overstimulation of egfr. in phase i clinical studies of patients with solid tumors (not including mtc), doses of vandetanib up to 300 mg / day were well tolerated, and adverse effects were generally mild and controlled with either dose adjustments or symptomatic therapy. the most common adverse events were rash, diarrhea, fatigue, asymptomatic qtc prolongation, proteinuria, and hypertension. since qt prolongation was note as an adverse event, patients should have ekg and electrolytes at baseline and at regular intervals during the course of treatment. in a phase ii study, 30 adult patients with unresectable, locally advanced, or metastatic hereditary mtc received 300 mg / day of vandetanib. the primary endpoint was the objective response rate (orr) according to the 2000 response evaluation criteria in solid tumors (recist) guidelines. objective partial responses (prs) were observed in 20% of patients, and the median duration of pr was 10.2 months. additionally, 53% of patients had stable disease (sd) for a median of 24 weeks. in another trial of vandetanib at 100 mg / day (or up to 300 mg / day in cases with disease progression), patients with similar disease characteristics achieved similar results (orr 68%). both trials showed a 50% reduction in calcitonin and carcinoembryonic antigen levels from baseline. however, the reduction in calcitonin levels did not correlate with the degree of tumor growth inhibition. it seems that ret activity is required for ligand - induced calcitonin gene expression. in that sense, carcinoembryonic antigen levels may be a better marker of tumor response to vandetanib. of interest, there was no apparent association between specific ret germline mutations and response to treatment (no patients with 804 ret mutation were included). other phase i and ii studies are ongoing to determine the effectiveness of vandetanib in sporadic mtc and its safety and efficacy in children and adolescents. data on vandetanib have been presented to the united states food and drug administration (fda), including results from the largest randomized, double - blind, placebo - controlled trial, which was conducted in 331 patients with advanced unresectable or metastatic mtc, study d4200c00058. this trial showed that median progression - free survival (pfs) was 11 months longer in the group randomly assigned to vandetanib and 45% had an orr. as the drug seems to be effective in stabilizing symptomatic and/or progressive disease, it will likely become the first fda - approved drug for mtc. nuclear factor b (nf-b) activation can block cell - death pathways and contribute to the oncogenic state by driving proliferation, enhancing cell survival, and promoting angiogenesis and metastasis. nf-b has a high baseline activity in mtc cell lines through ret - induced phosphorylation, ubiquitination, and proteosomal degradation of inhibitors of nf - kb (ikb), which allows nf-b to enter the nucleus and bind to the dna. bortezomib inhibits proteosome - mediated ikb degradation in mtc cells, resulting in its accumulation and thus preventing nf-b translocation to the nucleus, thereby leading to apoptosis. a phase i / ii trial of the combination of vandetanib plus bortezomib is currently recruiting patients (http://www.clinicaltrials.gov/). sorafenib is a small tki that targets ret, vegfr-2, vegfr-3, flt3, pdgfr-, kit, and the raf family serine / threonine kinases raf-1 and braf. it inhibits the growth of ret - driven tumors by a combination of activities that target ret - dependent thyroid cancer cell proliferation and vegf - dependent tumor angiogenesis. in vitro, sorafenib inhibits ret signaling and the growth of ret - transfected fibroblasts and human thyroid cancer cells that harbor ret / ptc and ret / men2 oncogenes. sorafenib has been shown to significantly reduce tumor growth in nude mice with xenograft tumors derived from mtc cell lines. sorafenib has been investigated in four phase i trials with different doses and administration schedules. a dose of 400 mg orally twice daily was found to be safe and generally well tolerated, and the most frequently reported drug - related adverse events were fatigue, anorexia, diarrhea, rash / desquamation, and hand - foot syndrome. hand - foot syndrome is characterized by painful erythematous lesions that affect the palmo - plantar surface. it is the most common reported adverse effect in patients taking the multikinase inhibitors like sorafenib and sunitinib. the lesions are pronounced on the pressure points on the palms and the soles but can also affect the margins of the feet and skin between fingers and toes. these lesions are not life threatening but significantly impair the quality of life requiring dose reduction or even discontinuation of the drug.severe hematological, cardiovascular, hepatic, and renal toxic effects were not reported. treatment - related hypertension was reported in 5% to 11% of patients in all four phase i trials. sorafenib demonstrated evidence of antitumor activity by inducing disease stabilization in patients with refractory tumors, a finding that was consistent with the results of preclinical studies. because of the role of ret signaling in mtc and the antitumor activity exhibited by sorafenib in preclinical and in vitro studies, mtc was recognized as a potential target for sorafenib. in a small 2007 pilot study that included five patients with metastatic mtc with excessive calcitonin secretion, calcitonin secretion was decreased by > 50% in all patients after 3 months of treatment, and all patients were free of calcitonin - related symptoms. after 6 months of therapy, one patient had a complete response (cr), and patient had a pr. sorafenib was administered orally at a dose of 400 mg twice daily continuously in a larger, open - label phase ii study in patients with histologically confirmed metastatic or locally advanced mtc. patients were monitored regularly with physical examination and biochemical and radiologic testing. in the event of any significant drug - related adverse event, the drug was withheld and restarted at a lower dose of 400 to 600 mg / day with dose re - escalation as tolerated. of the 15 evaluable patients in this study, all showed some degree of tumor shrinkage. one patient achieved pr ; 14 patients had sd, eight of whom had sd 15 months ; and one patient had clinically progressive disease. most patients had decreased calcitonin levels 2 months after treatment initiation, but they did not correlate with the degree or duration of response as assessed using recist. sorafenib has been approved by the fda for treatment of renal cell and hepatocellular carcinoma. therefore, sorafenib is an option for patients with advanced mtc who are not eligible for clinical trials. farnesylation is a type of lipid modification that is critical for the biological functionality including several signal transduction proteins. farnesyltransferase inhibitors target multiple pathways, including the ras pathway, and are among the first systematically investigated drugs in oncogene - targeted therapy. ras genes encode proteins involved in cell proliferation, differentiation, and adhesion and apoptosis regulation. at least three associated genes (h - ras, k - ras, and n - ras) are present in mammalian cells. of all human tumors thyroid cancer has mutations in all three ras genes. in in vitro studies, tipifarnib inhibited the growth of several human tumor cell lines, and in in vivo studies, tipifarnib was shown to inhibit colon and pancreatic cancer xenografts in a dose - dependent manner. the antitumor effects were mainly due to decreased cell proliferation, antiangiogenesis, and apoptosis. a phase i trial of tipifarnib in combination with sorafenib in patients with advanced malignancies included 15 patients with thyroid cancer, eight of whom had mtc. three of the six patients who reached first restaging had prs, whereas the others had some minor regressions and hence sd lasting from 12 to 16 months. ret mutational analysis in these six patients revealed ret mutations ; thus, it is unclear whether the response to sorafenib and tipifarnib was entirely due to ret inhibition by sorafenib. in a previously reported case, the rate of response rate to combination therapy was higher than that reported for sorafenib alone. it should be noted that the ret pathway is complex and the ret kinase can activate a cascade of signaling pathways. tipifarnib can also affect various other pathways, including akt and map / erk, and may have acted synergistically to produce the clinical response. the fda has not approved tipifarnib because of its inferior outcomes in phase iii trials in patients with other malignancies. however, the data from trials of thyroid cancer so far seem encouraging, and studies combining various oncogene - targeted therapies are needed. preclinical studies have shown that activating ret mutations in v804 (v804l and v804 m) causes resistance to various structural classes, including vandetanib. mutations in v804 slightly affect ret susceptibility to sorafenib, thus indicating that a structurally different inhibitor may be used to overcome the mutational resistance to a particular tki. this might be clinically significant as a recent study showed ret v804 m (19.6%) is a prevalent cause of hereditary mtc. sunitinib is a derivative of indolinone and inhibits the activity of many tks, including vegfr, pdgfr, kit, and ret. sunitinib exerts antitumor activity by affecting cell proliferation and survival in cancers in which these receptors are involved. its inhibitory effect on vegf and ret makes this drug a rational choice for treating mtc. in a phase ii study of sunitinib in patients with progressive thyroid cancer that included six patients with mtc, results from another phase ii study that included only patients with progressive mtc also showed responses. among the 23 patients evaluated, eight (35%) achieved pr, with a median response duration of 37 weeks, and 13 (57%) had sd, with a median response duration of 32 weeks. a trial using a lower dose of 37.5 mg / day in a continuous manner included six patients with mtc. the most common drug - related adverse events were fatigue, diarrhea, palmar - plantar erythrodysesthesia, neutropenia, and hypertension. sunitinib has been approved by the fda as the treatment of renal cell carcinoma and is therefore available for use in selected patients with mtc not enrolled in a clinical trial. cabozantinib (xl184) is a small molecule that inhibits met, vegfr-2, ret, kit, flt-3, and tie-2. in the context of mtc, preclinical data have demonstrated that xl184 can inhibit the proliferation of cells harboring activated ret. in 2009, results of a phase i trial that included 37 patients with mtc revealed that 44% of patients achieved at least 30% reduction in tumor size, and 29% of patients confirmed pr. there was no correlation between ret mutation status (either germline or somatic) and tumor response. side effects included fatigue, diarrhea, appetite loss, weight loss, hair hypopigmentation, and hypertension. other effects, such as elevated aspartate aminotransferase, alanine aminotransferase, lipase elevations, palmar / plantar erythema, and mucositis, were dose dependent. because of the noted antitumor effects of xl184, a phase iii clinical trial called the efficacy of xl184 in advanced medullary thyroid cancer (exam) is recruiting patients (http://www.clinicaltrials.gov/). the purpose of the study is to evaluate pfs with xl184 compared to pfs with placebo in subjects with unresectable, locally advanced, or metastatic mtc. recently, in addition to giving xl184 a generic drug name, fda had granted xl184 an orphan drug designation for treatment of follicular, medullary, and anaplastic thyroid carcinoma, and metastatic or locally advanced papillary thyroid cancer. e7080 inhibits vegfr-1, vegfr-2, vegfr-3, kit, fgfr1, pdgfr, and to a lesser extent egfr. this drug has been shown to be a potent inhibitor of in vitro angiogenesis in human small cell lung cancer via inhibition of vegf / vegf-2 and the stem cell factor / kit signaling pathways. via dual inhibition of vegfr-2 and vegfr-3, e7080 has also been shown to decrease lymphatic vessel density in the primary tumors of vegfc - overexpressing mda - mb-231 mammary fat pad xenograft models as well as within the metastatic nodules in the lymph nodes of nude mice. in phase i trials, e7080 caused hypertension and proteinuria, which were the major dose - limiting toxic effects. other observed adverse events included thrombosis, tachycardia, febrile neutropenia, and thrombocytopenia. a phase ii trial to evaluate the safety and efficacy of oral e7080 in medullary and iodine-131-refractory, unresectable differentiated thyroid cancers is ongoing (http://www.clinicaltrials.gov/). the primary purpose of the trial is to determine the effect of e7080 on the objective tumor response rate according to recist. have shown that it is a potent inhibitor of vegfr-1, vegfr-2, vegfr-3, pdgfr- and, and kit. the antineoplastic activity of pazopanib is primarily due to its effect on the angiogenic pathways. phase ii studies of pazopanib for mtc are ongoing research on mtc over the last 55 years has led to a good understanding of the genetic defects and altered molecular pathways associated with its development. multikinase inhibitors have shown good results in terms of stabilizing disease, and this year will probably see the approval of a drug for advanced unresectable or metastatic mtc, which would represent a new chapter in the history of this disease. the challenge for the years to come is to discover more effective ways to target multiple key pathological pathways as well as the identification of the individuals who will benefit the most. | research on medullary thyroid carcinoma (mtc) over the last 55 years has led to a good understanding of the genetic defects and altered molecular pathways associated with its development. currently, with the use of genetic testing, patients at high risk for mtc can be identified before the disease develops and offered prophylactic treatment. in cases of localized neck disease, surgery can be curative. however, once mtc has spread beyond the neck, systemic therapy may be necessary. conventional chemotherapy has been shown to be ineffective ; however, multikinase inhibitors have shown promise in stabilizing disease, and this year will probably see the approval of a drug (vandetanib) for advanced unresectable or metastatic disease, which represents a new chapter in the history of mtc. in this paper, we explore newly understood molecular pathways and the most promising emerging therapies that may change the management of mtc. |
an association among obesity, high levels of fasting triglycerides, elevated fasting plasma insulin levels, impaired glucose tolerance, hypertension, and cardiovascular disease (cvd) has been recognized since the early 1960s. these major risk factors tend to cluster in many individuals, suggesting a common etiology that has been variously termed syndrome x, insulin - resistance syndrome, and metabolic syndrome (ms). current estimates indicate that the age - adjusted prevalence of metabolic syndrome is roughly 24% among u.s. although it has been studied extensively in adults, much less is known about metabolic syndrome in youth. current estimates indicate that roughly 4% of us adolescents have a metabolic syndrome, based on the results of a previous study. a recent study showed a prevalence of 6.8% among the us college - aged students. the prevalence of obesity is increasing substantially, and obesity is one of the major contributors to the incidence of various diseases due to its pathophysiological link to other cardiovascular risks such as hypertension and diabetes. a recent study in nepal reported that a high incidence of dyslipidemia and abdominal obesity could be a major contributor to ms. studies from eastern mediterranean countries indicate that obesity has reached an alarming level among children and adults. consequently, the incidence of noncommunicable diseases (ncd) is very high and accounts for more than 50% of total death in the east mediterranean region (emr) [6, 7 ]. a study of saudi children and adolescents concluded that obese saudi children and adolescents have multiple risk factors associated with metabolic syndrome. this study aimed to estimate the prevalence of metabolic abnormalities among saudi college students in riyadh, saudi arabia, and to investigate the association between different indicators of body composition and these abnormalities. a cross - sectional study was conducted with a total of 501 college students aged 1826 years (383 males and 118 females) from the colleges of medicine and nursing at the king saud bin - abdulaziz university for health sciences, national guard health affairs, in riyadh, saudi arabia. students enrolled in the college of medicine (male students) and the college of nursing (female students) from 2009 to 2010 were considered the target population of this study. all measurements were conducted in college clinics and performed twice by a trained team from march 2010 to august 2010. body weight was measured using a seca 634 digital electronic platform scale (birmingham, uk) with precision to 0.1 kg according to a standardized procedure (lightly dressed, without shoes). standing height was measured to the nearest 0.1 cm with the use of a stadiometer. students were classified as follows : underweight (q3. for the quantitative data, student 's t - test was used to compare the sample means. pearson 's chi - squared test was used to compare the categorical data. the chi - squared test for linear trend was used to establish whether the increasing quartiles of wc and whtr were associated with increased prevalence and number of metabolic abnormalities. odds ratios were calculated with a 95% confidence interval for the likelihood of a student to have a metabolic abnormality according to the different quartiles. the first quartile groups for wc, whtr, and bmi of q3 of wc versus q3 of whtr versus q3 of wc versus q3 of whtr versus < q1 was 7.5. this significant association between abdominal obesity and ms abnormalities is because both ms and increased abdominal fat are related to a reduction of adiponectin, an adipocyte - derived hormone with antiatherogenic and anti - inflammatory properties. once again, this finding was the same for all other metabolic abnormalities except the fasting plasma glucose level. in a recent study of us college - aged students, wc was independently associated with three of the ms components (hld - c, tg, and sbp) after partialling out the effect of physical activity. in a previous study among saudi geriatrics, wc was a powerful independent predictor only of hypertension risk, while whc was a good predictor only of diabetes risk. it has been reported that wc was better than bmi as a predictor of cvd risk factors and metabolic abnormalities [2931 ]. in this study, assuming students with 3 or more abnormalities had ms, the prevalence of ms was 7.8%. this prevalence increased from 3.1% in nonobese to 26.1% among obese students based on bmi, from 3.4% to 20% based on wc, and from 1% to 17.7% based on whtr measures (figure 4). this finding showed that bmi, wc, and whtr were equally predictive of cvd risk. this result is consistent with the results from a 2007 meta - analysis that suggested that measures of overall obesity (bmi) and measures of central obesity (whr and wc) performed equally well in predicting the incidence of type 2 diabetes. whtr was suggested as the best indicator of hypertension, diabetes and dyslipidemia by some investigators [3335 ], while wc was suggested as the best for the prediction of diabetes and hypertension. however, this study found that fasting plasma glucose levels were not significantly associated with any of these obesity indicators. ethnic differences in body composition rules and constants are also important, especially in relation to being overweight or obese. first, the study used a cross - sectional design that did not allow for the assessment of the temporality of the relationship between body composition measures and metabolic abnormalities, especially that other confounding factors such as physical activity and dietary habits were not adjusted for proving this association. a longitudinal study with repeated measures of body composition and metabolic abnormalities second, measurements of hdl - c, tg, hormone, and biomarker levels, which are known to be involved in the pathogenesis and identification of ms in saudi college students, were not included in the present study. these excluded measurements may have led to an underestimation of the prevalence of ms abnormalities. however, aside from this possible underestimation, the validity of the conclusion with regard to study 's individual parameters is preserved. the overall results of our study provide an evidence for the presence of ms components among saudi college students. bmi, wc, and whtr were all suitable indicators that could be used to predict metabolic parameters. although this association has already been studied in the literature, yet the data of this study is instructional given the understudied young saudi population. the prevalence of metabolic abnormalities and obesity and the observed association of adiposity with these abnormalities calls for increased efforts towards clinical preventive services to identify and control existing metabolic abnormalities among students. additionally, the development and implementation of college health programs that promote healthful behaviors, including increased physical activity, eating balanced diets, and avoidance of adult weight gain, are needed to help reduce the burden of noncommunicable diseases among saudi students and the broader saudi community. | aim. (i) to estimate the prevalence of the metabolic abnormalities among saudi college students in riyadh, saudi arabia, and (ii) to investigate the association between different indicators of body composition and these abnormalities. methods. a total of 501 college students participated in a cross - sectional study. anthropometric assessments, bp measurements, and biochemical assessment were done. metabolic abnormalities were identified. results. applying bmi, 21.9 % and 20.6% of students were classified as overweight and obese, respectively. central obesity was prevalent in 26.9% and 42.2% of students based on wc and whtr, respectively. other metabolic abnormalities were hypertension (23.6%) and abnormal fpg level (22.6%). three or more abnormalities were prevalent in 7.8% of students and increased significantly to 26.4%, 20%, and 17.6 in obese subjects based on bmi, wc, and whtr, respectively. with the exception of abnormal fpg, prevalence of individual metabolic abnormalities as well as the number of these abnormalities significantly increased with increasing bmi, wc, and whtr (p < 0.001 each). conclusion. our findings provide evidence for the presence of ms in saudi college students. central adiposity contributes to the high incidence of individual ms components. college health programs that promote healthful lifestyle and avoidance of adult weight gain are recommended. |
patients suffering from chronic kidney disease can be classified according to kidney function along a continuum from mild renal dysfunction to irreversible kidney failure. patients with kidney failure require renal replacement therapy (rrt), either a kidney transplant or dialysis, to maintain life. worldwide, at the end of 2004, 1 800 000 patients were receiving rrt. of those patients 77% were on dialysis and 23% were living with a functioning kidney transplant. the global average prevalence for dialysis was 215 patients per million population, although significant regional variations existed. by the year 2010, it is expected that the number of dialysis patients will approach two million. because the worldwide incidence of kidney failure continues to rise and treatment is costly, the global burden of illness is growing. while kidney transplantation has important economic implications, it is beyond the scope of this review. a large volume of literature exists on the topic of kidney transplantation and its economic impact. readers are referred to other review articles for more information [24 ]. for patients treated with dialysis, alternative modalities are haemodialysis (hd) and peritoneal dialysis (pd). in the united states, the incidence of hd has increased sevenfold since 1978, while the incidence of pd peaked in 1995 and has since declined. in 2005, there were over 97 000 incident hd patients and 7000 incident pd patients. the prevalent population of hd patients was over 314 000 and the prevalent population of pd patients approached 26 000. in other parts of the world, the utilization of dialysis modalities varies. among large nations, the highest utilization of pd around the world is in mexico, where it is estimated that 72% of prevalent dialysis patients were on pd in 2005 (based on data from state of jalisco). in contrast, in luxembourg, no prevalent dialysis patients are reported to receive pd. among large nations, worldwide, at the end of 2004, hd was used to treat 89% of dialysis patients while 11% were treated by pd. economic factors play a vital role in the sequence of events that leads to the choice between hd and pd and, thus, are the starting point for our review. we then examine the relationship between dialysis modality and employment status because kidney disease often affects the working population. we also identify and discuss the costs of dialysis and key cost drivers for hd and pd, followed by an overview of the relative costs of dialysis modalities in different regions of the world. when asked in surveys, physicians respond that financial considerations (i.e. profit status or facility reimbursement) are not among the primary considerations used in guiding patients to a particular modality [811 ]. in fact, reimbursement structure has been called the ultimate controlling force in the establishment and maintenance of home dialysis. financial and reimbursement issues have been identified as the most important non - medical factors in dialysis modality selection in countries around the globe. in general, where there is no facility reimbursement for pd, or where there is little or no physician reimbursement for pd, utilization is very low. in contrast, in countries with equal or higher reimbursement or payment for pd, utilization is much higher. for example, mexico is unique in the developing world in that the utilization of pd is 70%. an important reason for the higher utilization of pd in mexico is that it has been the modality with the best financial support from the social security system and the public health institutions. over the last few years a trend can be observed in a number of countries to increase the funding of hd services, especially satellite hd centres, which are smaller and often located closer to a patient 's home. the recent decrease in utilization of pd noted in mexico may be related to this trend. additionally, in the growing sector of private - care dialysis, physicians receive direct payments for hd but not for pd. in certain countries, there is interest in revising the reimbursement structure in a way to provide incentives for home - based as well as more frequent therapies, including pd and home hd. in the canadian province of ontario, prior to that time, reimbursement was based on a fee - for - service system, with rates for in - centre hd that were sevenfold higher than those for home or community - based hd or pd. this change in reimbursement structure arguably contributed to a stabilization of an ongoing reduced utilization of pd and non - hospital - based hd in ontario, while the utilization of pd continued to decline in other parts of canada. in hong kong, the government long ago removed the upper age limit of 55 years for subsidizing home dialysis consumables and continues with a pd first policy. in japan, reimbursement for hd is being decreased, and the japanese ministry of health and welfare is promoting home healthcare. a similar situation is present in taiwan where the bureau of national health insurance (bnhi) has reduced points for hd but maintained those for pd in an effort to increase pd utilization. historically, home dialysis was more common in the united kingdom (uk) than it is today. this had been related to resource constraints and reduced access to hd services in some communities. thus, a stimulus for preferential use of home continuous ambulatory peritoneal dialysis (capd) had existed, as access to hd services was limited in some regions. renal clinicians were able to transfer a significant portion of the resource responsibility for capd patients to general practitioners who could, at that time, prescribe capd therapy. however, since april 1995, general practitioners have not been permitted to prescribe capd fluids. more significantly, over the last several years, following publication in 2002 of a national institute for clinical excellence (nice) guideline, there has been a significant expansion of access to hd services as a result of a capital development programme in which 60 million were to be invested between 2000 and 2006 by the government for expansion of access to, in particular, satellite hd services. during this period, a national service framework was published to define standards of dialysis care and establish good practice markers and support balanced access to all dialysis modalities in england. medicare policy in the united states provides incentives to private insurers, dialysis facilities, patients and physicians for home dialysis options. these include waiver of the 90-day medicare coverage waiting period, additional add - ons to the capitated, or composite, rate for home training, home training supervision fees for physicians, the availability of a training exception rate and an alternative reimbursement option referred to as method ii reimbursement. unlike patients using the much more common method i reimbursement, method ii patients do not receive their home supplies and equipment from their dialysis provider directly. rather, they receive them from an independent supplier who bills medicare for actual supplies used on a reasonable charge basis using local prevailing rates up to a capitated maximum that varies by modality. more recently, the centers for medicare and medicaid services (cms) modified the physician monthly capitated payment system to improve care quality in a manner that they believe provides an incentive for home dialysis therapy. physicians are required to personally evaluate in - centre hd patients at least once each month but receive payment based on three tiers of patient contact, one visit, two or three visits or four visits per month. they may use physician extenders, such as a physician 's assistant, clinical nurse specialist or nurse practitioner, to evaluate patients for the second through fourth visits. cms believes that the incentive for home dialysis is provided by not requiring a monthly evaluation visit for home patients, not specifying a required visit frequency and fixing the physician payment rate for home dialysis patients at 2% below the rate paid for two to three evaluation visits for in - centre hd patients. unfortunately, evidence published both prior to and after implementation of this policy does not support the supposition that increased dialysis patient visit frequency results in improved clinical outcomes [2224 ]. just prior to implementation of the new policy, plantinga and colleagues reported results of a prospective cohort study that found that the frequency of patient physician contact was not associated with improvements in patient survival, hospitalization rate, quality - of - life or patient - rated care. following implementation of the new policy, mentari and associates compared outcomes in over 2000 patients between 12 months prior to implementation of the policy to 7 months after implementation. despite a doubling of patient physician contact, from 1.52 before to 3.14 visits per month after policy implementation, they found no associated change in hospital admissions or days, quality - of - life, patient satisfaction or numerous markers of quality outcomes. anecdotally, some suggest that the lower maximum monthly reimbursement opportunity for physicians caring for home dialysis patients compared to in - centre hd patients does not align with published evidence suggesting that patients receiving home dialysis, either pd or hd, have superior outcomes as measured by survival, quality - of - life and patient satisfaction. resource availability also influences dialysis modality selection. when centre hd capacity is high, there is a strong incentive to use the capacity rather than place the patient on an alternative dialysis therapy that does not use it. more recent approaches that lease or place the hd hardware and sell the supplies at a premium, thus integrating the hardware cost into the supply cost, are increasingly common. such an approach may be noted in environments with distinctly separate budgets for capital investment and supplies or therapy management services and in which there are specific constraints on expanded capital investment. the inverse may also be found. finally, a current trend noted in many parts of the world is the growth of satellite hd centres. these centres are often self - care or limited care and are most frequently small units built in convenient locations closer to patient homes to allow easier access to hd. there is a significant reduction in workforce participation among patients with renal dysfunction aged 1864 years. a conservative estimate of lost productivity from workforce non - participation associated with renal dysfunction in 1994 was $665 million. a number of cross - sectional analyses have examined the relationship between dialysis modality and employment status. most studies have found that pd patients are more likely to be employed than hd patients. however, because of the cross - sectional nature of the research, it is difficult to conclude whether dialysis modality influenced employment status, or whether employment status had an influence on the choice of dialysis modality [2629 ]. a multi - centre, prospective study in the netherlands followed 359 patients for 12 months. no relationship between treatment modality (hd or pd) and employment status was observed. they also concluded that most patients who have a job at the start of dialysis keep working. finally, the authors suggested that treatment modality does not influence the ability to maintain employment, but employment may influence the choice between hd and pd. another study utilized a simultaneous probit model to account for the potential endogeneity between treatment choice and employment. data were analysed from wave ii of the united states renal data system 's dialysis morbidity and mortality study. the authors concluded that pd has a causal effect on dialysis patients ability to participate in the labour force ; however, the magnitude of the effect is small in absolute terms and much smaller than the effect implied by previous cross - sectional research, in which endogeneity was ignored. in a naive model ignoring endogeneity, pd patients were 60% more likely to be employed than hd patients ; however, in a two - stage model accounting for endogeneity, the relative increase in the probability of working for pd patients compared to hd patients was only 14.7%. the authors further stated that most of the effect of pd on employment arises from endogenous selection of pd by patients who wish to maintain employment, rather than from the ability of pd to ease work scheduling. dialysis modality and employment status includes patients currently employed or in school or who routinely perform household tasks. no association between treatment modality and loss of employment when adjusted for demographic, clinical variables and sf-36 summary scores. relative probability of employment when dialysis modality is treated as an exogenous variable in a model that does not account for endogeneity. relative probability of employment when dialysis modality is treated as an exogenous variable in a model that accounts for endogeneity. when asked in surveys, physicians respond that financial considerations (i.e. profit status or facility reimbursement) are not among the primary considerations used in guiding patients to a particular modality [811 ]. in fact, reimbursement structure has been called the ultimate controlling force in the establishment and maintenance of home dialysis. financial and reimbursement issues have been identified as the most important non - medical factors in dialysis modality selection in countries around the globe. in general, where there is no facility reimbursement for pd, or where there is little or no physician reimbursement for pd in contrast, in countries with equal or higher reimbursement or payment for pd, utilization is much higher. for example, mexico is unique in the developing world in that the utilization of pd is 70%. an important reason for the higher utilization of pd in mexico is that it has been the modality with the best financial support from the social security system and the public health institutions. over the last few years a trend can be observed in a number of countries to increase the funding of hd services, especially satellite hd centres, which are smaller and often located closer to a patient 's home. the recent decrease in utilization of pd noted in mexico may be related to this trend. additionally, in the growing sector of private - care dialysis, physicians receive direct payments for hd but not for pd. in certain countries, there is interest in revising the reimbursement structure in a way to provide incentives for home - based as well as more frequent therapies, including pd and home hd. in the canadian province of ontario, prior to that time, reimbursement was based on a fee - for - service system, with rates for in - centre hd that were sevenfold higher than those for home or community - based hd or pd. this change in reimbursement structure arguably contributed to a stabilization of an ongoing reduced utilization of pd and non - hospital - based hd in ontario, while the utilization of pd continued to decline in other parts of canada. in hong kong, the government long ago removed the upper age limit of 55 years for subsidizing home dialysis consumables and continues with a pd first policy. in japan, reimbursement for hd is being decreased, and the japanese ministry of health and welfare is promoting home healthcare. a similar situation is present in taiwan where the bureau of national health insurance (bnhi) has reduced points for hd but maintained those for pd in an effort to increase pd utilization. historically, home dialysis was more common in the united kingdom (uk) than it is today. this had been related to resource constraints and reduced access to hd services in some communities. thus, a stimulus for preferential use of home continuous ambulatory peritoneal dialysis (capd) had existed, as access to hd services was limited in some regions. renal clinicians were able to transfer a significant portion of the resource responsibility for capd patients to general practitioners who could, at that time, prescribe capd therapy. however, since april 1995, general practitioners have not been permitted to prescribe capd fluids. more significantly, over the last several years, following publication in 2002 of a national institute for clinical excellence (nice) guideline, there has been a significant expansion of access to hd services as a result of a capital development programme in which 60 million were to be invested between 2000 and 2006 by the government for expansion of access to, in particular, satellite hd services. during this period, a national service framework was published to define standards of dialysis care and establish good practice markers and support balanced access to all dialysis modalities in england. medicare policy in the united states provides incentives to private insurers, dialysis facilities, patients and physicians for home dialysis options. these include waiver of the 90-day medicare coverage waiting period, additional add - ons to the capitated, or composite, rate for home training, home training supervision fees for physicians, the availability of a training exception rate and an alternative reimbursement option referred to as method ii reimbursement. unlike patients using the much more common method i reimbursement, method ii patients do not receive their home supplies and equipment from their dialysis provider directly. rather, they receive them from an independent supplier who bills medicare for actual supplies used on a reasonable charge basis using local prevailing rates up to a capitated maximum that varies by modality. more recently, the centers for medicare and medicaid services (cms) modified the physician monthly capitated payment system to improve care quality in a manner that they believe provides an incentive for home dialysis therapy. physicians are required to personally evaluate in - centre hd patients at least once each month but receive payment based on three tiers of patient contact, one visit, two or three visits or four visits per month. they may use physician extenders, such as a physician 's assistant, clinical nurse specialist or nurse practitioner, to evaluate patients for the second through fourth visits. cms believes that the incentive for home dialysis is provided by not requiring a monthly evaluation visit for home patients, not specifying a required visit frequency and fixing the physician payment rate for home dialysis patients at 2% below the rate paid for two to three evaluation visits for in - centre hd patients. unfortunately, evidence published both prior to and after implementation of this policy does not support the supposition that increased dialysis patient visit frequency results in improved clinical outcomes [2224 ]. just prior to implementation of the new policy, plantinga and colleagues reported results of a prospective cohort study that found that the frequency of patient physician contact was not associated with improvements in patient survival, hospitalization rate, quality - of - life or patient - rated care. following implementation of the new policy, mentari and associates compared outcomes in over 2000 patients between 12 months prior to implementation of the policy to 7 months after implementation. despite a doubling of patient physician contact, from 1.52 before to 3.14 visits per month after policy implementation, they found no associated change in hospital admissions or days, quality - of - life, patient satisfaction or numerous markers of quality outcomes. anecdotally, some suggest that the lower maximum monthly reimbursement opportunity for physicians caring for home dialysis patients compared to in - centre hd patients does not align with published evidence suggesting that patients receiving home dialysis, either pd or hd, have superior outcomes as measured by survival, quality - of - life and patient satisfaction. resource availability also influences dialysis modality selection. when centre hd capacity is high, there is a strong incentive to use the capacity rather than place the patient on an alternative dialysis therapy that does not use it. more recent approaches that lease or place the hd hardware and sell the supplies at a premium, thus integrating the hardware cost into the supply cost, are increasingly common. such an approach may be noted in environments with distinctly separate budgets for capital investment and supplies or therapy management services and in which there are specific constraints on expanded capital investment. finally, a current trend noted in many parts of the world is the growth of satellite hd centres. these centres are often self - care or limited care and are most frequently small units built in convenient locations closer to patient homes to allow easier access to hd. there is a significant reduction in workforce participation among patients with renal dysfunction aged 1864 years. a conservative estimate of lost productivity from workforce non - participation associated with renal dysfunction in 1994 was $665 million. a number of cross - sectional analyses have examined the relationship between dialysis modality and employment status. most studies have found that pd patients are more likely to be employed than hd patients. however, because of the cross - sectional nature of the research, it is difficult to conclude whether dialysis modality influenced employment status, or whether employment status had an influence on the choice of dialysis modality [2629 ]. a multi - centre, prospective study in the netherlands followed 359 patients for 12 months. no relationship between treatment modality (hd or pd) and employment status was observed. they also concluded that most patients who have a job at the start of dialysis keep working. finally, the authors suggested that treatment modality does not influence the ability to maintain employment, but employment may influence the choice between hd and pd. another study utilized a simultaneous probit model to account for the potential endogeneity between treatment choice and employment. data were analysed from wave ii of the united states renal data system 's dialysis morbidity and mortality study. the authors concluded that pd has a causal effect on dialysis patients ability to participate in the labour force ; however, the magnitude of the effect is small in absolute terms and much smaller than the effect implied by previous cross - sectional research, in which endogeneity was ignored. in a naive model ignoring endogeneity, pd patients were 60% more likely to be employed than hd patients ; however, in a two - stage model accounting for endogeneity, the relative increase in the probability of working for pd patients compared to hd patients was only 14.7%. the authors further stated that most of the effect of pd on employment arises from endogenous selection of pd by patients who wish to maintain employment, rather than from the ability of pd to ease work scheduling. dialysis modality and employment status includes patients currently employed or in school or who routinely perform household tasks. no association between treatment modality and loss of employment when adjusted for demographic, clinical variables and sf-36 summary scores. relative probability of employment when dialysis modality is treated as an exogenous variable in a model that does not account for endogeneity. relative probability of employment when dialysis modality is treated as an exogenous variable in a model that accounts for endogeneity. recent analyses in the united states have reported the medicare payments to compensate for a year 's treatment of a dialysis patient to be about $ 67 000. employer group health insurance payment is much higher at $ 180 000 per year. medicare expenditures for end - stage renal disease (esrd) claims increased 11.2% in 2004, to $19 billion. employer group health plan expenditures for esrd increased to $ 390 million in 2004, representing a 56% increase compared to the previous year. in europe, although dialysis patients make up. from 1990 to 2010, treatment costs for the global maintenance dialysis population are expected to rise from. the costs of dialysis around the world can vary widely according to many local market conditions, including local production and distribution factors, import duties, the presence or absence of local suppliers and purchasing power. hd machines typically cost $18 000 to $ 30 000 each, but the machines have a 5- to 10-year life cycle, and, in a weekly schedule, three to six patients can be treated on one machine. the cost of dialyzers for hd ranges from $ 1000 to $ 5000 per year. other items that factor into the cost of hd are additional facility costs such as maintenance and utilities, and the costs of transportation to and from the hd facility. in contrast, the economics of pd are driven primarily by variable, or disposable, costs, such as the costs of solutions and dialysis tubing, and pd exhibits a near constant economy of scale. a review of the literature determined that the cost of pd materials ranges from $ 5000 to $ 25 000 annually. however, they may be leased or provided, in which case their actual cost is bundled into the cost of solutions and materials purchased through the same company. comparison of supply costs alone may result in inaccurate assessment of the absolute cost of the various dialysis therapies. that said, supply - related issues do impact provider costs of both dialysis modalities. for hd, provider costs can be affected by the choice of the dialyzer membrane prescribed and whether or not the dialyzer is used only one time or is reused. a key issue influencing the apparent daily cost of pd is that some new dialysate solutions are priced at a premium relative to the standard glucose solutions. when comparing dialysis treatment costs on a procurement basis only, misleading conclusions may be reached. for example, when one standard bag of dialysate is replaced with the newer solution icodextrin, the net daily cost for that patient 's dialysis treatment might appear to increase in some countries. however, such an increase in daily therapy cost may be more than offset if the alternative would have been transfer and maintenance to a more expensive dialysis treatment, such as hd, as documented later in this manuscript. budget impact models and markov analysis have reported that such extension of time on pd therapy lowers the total costs of care over time by deferring the need for hd, which is generally found to be a more expensive treatment alternative. such analyses underscore the need to evaluate dialysis treatment costs as a total therapy rather than simply thinking of dialysis costs as the procurement expense of the supplies. additionally, this example demonstrates the value of considering the cumulative costs of dialysis over a patient 's therapy lifetime rather than for a limited discrete segment of time. additional costs associated with dialysis are physician fees, medications, laboratory and other diagnostic investigations and hospitalizations. for example, in the united states in 2004, medicare spending for erythropoiesis stimulating agents was 10% of total medicare spending for all esrd care services. medication costs with pd are typically less than those with hd. less erythropoietin is required because anaemia is less severe. more inexpensive forms of vitamin d tend to be used (oral or subcutaneous versus intravenous), and less parental iron is required because patients are less likely to have treatment - related blood losses. room costs and in - patient dialysis costs account for nearly half of the cost of hospitalizations for dialysis patients. some evidence suggests that hospitalization costs are lower for pd than for hd due to a reduced number of hospital days per year ; however, a comprehensive literature review indicates that hospitalization costs are similar for hd and pd, although the reasons for hospital admission differ. the primary causes of hospital admission in patients receiving pd are peritonitis and cardiovascular disease [3944 ]. conversely, in patients receiving hd, the primary causes for hospitalization are access issues, thrombosis and infections. rates and duration of hospitalization by modality may vary in different regions of the world, so caution should be used in generalizing research results. the cost of treating patients with chronic kidney disease who ultimately progress to esrd begins to increase in the last 6 months immediately prior to starting dialysis, peaks in the first month of dialysis, and generally reaches a plateau by month 6 of dialysis. one reason for this is that mortality is high during the first 6 months of dialysis, and patient treatment is more expensive in the period immediately prior to a terminal event. also, start - up costs occur with all dialysis modalities and result in higher costs for the first year of dialysis compared to subsequent years. a peritoneal catheter must be inserted for pd and a vascular access, fistula, graft or temporary catheter must be established for hd. finally, start - up costs for capd and home hd include patient training and so also contribute to the cost of modality switches because they are incurred with each change in modality. when considering a patient lifetime approach, it has been shown that total payer expense over a 3-year period is lowest when patients are started on pd and maintained on it for at least year 1 of the 3-year period. a key factor influencing when patients are either referred late to a nephrologist 's care or must urgently initiate dialysis without a planned access, they are generally sicker, require longer hospitalization and are nearly always started on hd. patients who are referred earlier to a nephrologist have an extended time prior to starting rrt during which access may be planned and placed, and patients may be objectively educated about their treatment choices. patients who have been exposed to pre - dialysis modality education are more likely to choose pd over hd [4951 ] and therefore contribute to lower societal and payer dialysis expense in most countries, as discussed below. the growing kidney failure population and high cost of rrt have led to early economic evaluations of the medical technology. some propose that few other medical technologies have had their costs and outcomes assessed so regularly and widely. one factor to consider in reviewing the economic assessments of dialysis modalities is the perspective taken for the analysis. relevant perspectives include : patient, dialysis facility or provider, physician, payer, dialysis manufacturing industry, government and society as a whole. the costs to payers, facilities and physicians are most likely to affect practice patterns such as modality selection. costs to society and patients or families are less likely to influence practices. depending on the perspective of the analysis, different costs or expenses may be relevant. a previous analysis found that many dialysis economic evaluations fail to include costs that are relevant for the stated perspective. costs are generally described in four categories : direct medical costs, direct non - medical costs, indirect costs and intangible costs. direct medical costs of dialysis include staffing costs, physician fees or salary, costs of dialyzers and tubing in hd, costs of solutions and tubing in pd, costs associated with radiology, laboratory and medications, capital costs of hd machines and pd cyclers, costs of hospitalizations and costs of outpatient consultations from other specialties. direct non - medical costs may vary widely in different parts of the world but tend to be highest in more developed economies. direct non - medical costs include building costs, facility utilities and other overhead costs. these costs are difficult to estimate but are important elements of an economic evaluation of dialysis modalities. additionally, an activity - based cost analysis is the most appropriate cost approach to apply when comparing modality expenses between home and centre - based therapies. activity - based cost analysis apportions costs according to the proportional share of a particular cost element used by patients on different modalities. however, in practice it appears that this method is not applied by a number of dialysis centre managers. intangible costs are the costs associated with pain, suffering and impairment in quality of life (qol), as well as the value of extending life. likewise, indirect costs, or productivity losses for patients and their families or caretakers, rarely have been assessed and incorporated in dialysis economic evaluations. while it is true that the mean age of the kidney failure population is increasing and that many patients are past the age of retirement when they start dialysis, indirect costs still represent a potentially important element of dialysis economic evaluations. this is particularly true in health systems are dependent upon employee and employer contributions to fund medical care. additionally, such a social system generally will pay a disability income to non - working patients in addition to their medical care payment or reimbursement. the majority of studies that compare dialysis modalities have focused solely on costs, rather than cost - effectiveness or cost - utility. in part, this may be because survival and qol outcomes for hd and pd are generally considered to be similar. however, without large, randomized, prospective clinical trials comparing patient survival and other outcomes between the various dialysis modalities, quality cost - effectiveness or cost - utility evaluations are not possible. in the clinical literature, a number of observational studies provide conflicting survival results, with some demonstrating a survival advantage for hd [5355 ], others finding a survival advantage for pd [5659 ] and still others showing equal or mixed survival outcomes between modalities [6062 ]. to a great extent, these disparate findings are explained by differences in study methods. when evaluated according to modern evaluation and statistical standards, only comparisons of incident patients are appropriate and adjustments must be applied for comorbid conditions. the most recent survival assessments of patients from four of the world 's leading dialysis registries, canada, denmark, the netherlands and the united states, find that overall survival is similar between the modalities but that there may be differences in select patient subgroups. in the qol literature, most research indicates that pd and hd patients have similar qol, regardless of whether qol is measured by a generic or disease specific measure or whether it is measured by a health profile or health preference instrument [6467 ]. however, some evidence suggests that pd may offer an advantage in qol over hd [6871 ], while other research has found that hd may be superior to pd in certain qol domains. a north american literature review concluded that pd is less expensive than hd and that the difference in cost is dramatic when the pd program is relatively large and well run. annual costs for hd patients ranged from $48 000 to $69 000, while annual costs for pd patients ranged from $34 000 to $47 000. in general, reports from western europe are in agreement with the north american findings. a review of the literature found that in - centre hd was about twice the cost of capd in france and 30% more expensive than capd in italy and the uk. another review of the western european literature also concluded that, with the exception of home hd, pd is less costly than hd. however, that review noted that the magnitude of the cost difference between dialysis modalities is difficult to determine due to deficiencies in the available evidence. many publications fail to adequately describe their methodology or to include all relevant cost components. a multi - national survey of asian nephrologists conducted in 2001 suggests that hd is generally more expensive than pd in the developed asian countries of hong kong, singapore, taiwan and japan. however, the extent of cost savings with pd varies by region. according to the survey results, the ratio of costs for hd compared to pd ranged from a low of 0.991.09 in japan to a high of 1.422.39 in hong kong. capd requires less technology than hd, so it would seem particularly well suited for developing nations. in poorer countries, though, labour is relatively inexpensive, while the cost of imported equipment and solutions is high. costs are often considered as related only to supplies rather than assessed as a total therapy. therefore, there is often a perception that pd is more expensive than hd in developing countries. to reduce costs, patients may be placed on outdated straight - line systems and sometimes transfer sets may be reused. however, high peritonitis rates increase the cost of pd treatment even further, and dropout rates are high. the lack of well - conducted economic evaluations in developing countries makes it difficult to accurately understand the true economic environment for dialysis care. a systematic review of the world literature on reports of dialysis economics and cost - effectiveness was recently published. kidney failure is a disease with high resource demands on every health care system in the world. the literature supports a perception that the driving forces of patient modality selection are intricately linked to payment and reimbursement mechanisms in any society. as such, it is critical that any analysis of economics related to dialysis therapy must start with a clear understanding of the perspective from which the analysis is conducted and, therefore, interpreted. all relevant costs for a given perspective must be included in the analysis whenever possible, and may include expenses both directly and indirectly related to the provision of the dialysis service. examples include facility, hardware (dialysis machine and water treatment), medical and non - medical personnel, hospitalization and complication management, access creation and management, disposable material, pharmaceutical, diagnostic, transportation and social costs. additionally, indirect costs and intangible costs may have a greater contribution in some countries. there are many complex and interrelated direct flows of money between participants in the care chain, including the patient, the physician, the provider of the dialysis service and any hospital facility supporting the patient 's extended care needs plus health care product suppliers and medical distributors. indirectly, kidney failure causes a societal burden in that patients otherwise able to work and contribute to society become disabled, thus reducing societal tax income and increasing disability disbursements once working - age patients are no longer able to continue working. the impact of kidney failure on workplace productivity is substantial, with many patients becoming unemployed even before starting dialysis. patients who are employed have a greater tendency to select pd rather than hd ; however, the choice of dialysis modality has not been proven to independently affect a patient 's ability to maintain employment. when considered from the perspective of society or a payer, such as a health care funding authority or a principal insurer, the resource demands of a kidney failure patient are best considered over the course of that patient 's cumulative remaining lifetime. consideration of the cost - effectiveness of equivalent treatment alternatives as measured by effectiveness, safety and quality may then be balanced with their respective budget impact to the primary payers. a lower cost treatment alternative will extend available resources to allow improved treatment for more patients and will lower the lifetime treatment cost burden of an individual patient and the diseased population to society. in practical terms, this suggests that home dialysis alternatives should be preferentially selected when clinically and socially appropriate for the individual patient. such an approach has been advocated and the funding benefits have been documented using an analysis of us medicare data. unfortunately, in a majority of health care systems, this approach is not followed, particularly in the case of private - care services. from the perspective of society, health care should be aligned for greatest efficiency as measured by the ability to provide the highest quality care to the largest number of patients. when a treatment is equally effective and safe for patients, yet least costly to the principal payer, incentives that drive downstream care decision makers and providers to preferentially select that same therapy to be the initial treatment option are prudent. appropriate alignment of incentives throughout the downstream care system may not occur because cost drivers for pd and hd differ ; pd is driven primarily by variable costs while hd is driven more by fixed costs. in developed nations, hd is generally more expensive than pd to the payer. in some developing and emerging economies, mainly due to inexpensive labour and high imported equipment and solution costs, pd is perceived to be more expensive than hd despite the lack of confirmatory prospective economic evaluations. however, the costs of dialysis differ by region and additional research is needed, particularly in the developing world. when reviewing dialysis economic evaluations, key factors that significantly influence their interpretation include the perspective taken for the analysis and the cost components included in the comparison. these include expenses both directly and indirectly related to the provision of the dialysis service as previously described. additionally, indirect costs and intangible costs may have a more or less significant contribution to economic evaluations in different economies. in most regions of the world, an analysis of total therapy expenses reveals that home dialysis is a lower cost option than in - centre dialysis and pd is a lower cost modality than hd, particularly when comparing capd to in - centre hd. the actual cost of each modality may be affected by supply expenses, such as dialyzers for hd and solutions for pd, but the absolute impact of such elements can only be discovered by economic analysis that would concurrently evaluate the influence of those supply factors on overall patient outcomes. unfortunately, cost - effectiveness and cost - utility studies based on randomized prospective clinical trials comparing home to in - centre dialysis modalities are unavailable and are unlikely to take place, as most patients do not wish to leave their modality choice to chance. as health systems continue to shrink, in even developed countries, resource intensive therapies such as treatments for patients with kidney failure will need to find new efficiencies. renal transplantation, while the most clinically and financially effective approach for kidney failure patients, is unlikely to become significantly more available in the near future in most countries. healthcare systems have historically supported resource intensive treatments because the previously more common fee - for - service approach rewarded utilization of expensive services such as dialysis in general and hd in particular. today, the approach to healthcare reimbursement is changing in many parts of the world to either a capitated system or one using a global budget. as these become more routine, incentives should be optimized to better support efficient treatment option alignment. when dialysis modalities are selected, economic factors such as financing, reimbursement and resource availability do not appear to be wholly independent from clinical considerations when modality selection recommendations are discussed with patients. the rate of pd utilization appears to be positively associated with equal or higher reimbursement or payment for pd. when centre hd capacity is high, there is a perceived and actual incentive to utilize that capacity, rather than to place patients on alternative modalities such as a home dialysis treatment option. further research is needed to allow direct comparison of the complete expenses of the various dialysis modalities applied in a given region. combined with a population risk - factor - adjusted prospective selection of the best outcome modality treatment and practice alternatives, future dialysis resources application may become more efficient. de charro does not hold any shares for companies related to nephrology but has consulted for and conducted research supported by baxter grants. elizabeth tschosik is a consultant for icon clinical research life sciences group, which received funding for this manuscript through a grant from baxter healthcare corporation. les noe is an employee of icon clinical research life sciences group, which received funding for this manuscript through a grant from baxter healthcare corporation. | the worldwide incidence of kidney failure is on the rise and treatment is costly ; thus, the global burden of illness is growing. kidney failure patients require either a kidney transplant or dialysis to maintain life. this review focuses on the economics of dialysis. alternative dialysis modalities are haemodialysis (hd) and peritoneal dialysis (pd). important economic factors influencing dialysis modality selection include financing, reimbursement and resource availability. in general, where there is little or no facility or physician reimbursement or payment for pd, the share of pd is very low. regarding resource availability, when centre hd capacity is high, there is an incentive to use that capacity rather than place patients on home dialysis. in certain countries, there is interest in revising the reimbursement structure to favour home - based therapies, including pd and home hd. modality selection is influenced by employment status, with an association between being employed and pd as the modality choice. cost drivers differ for pd and hd. pd is driven mainly by variable costs such as solutions and tubing, while hd is driven mainly by fixed costs of facility space and staff. many cost comparisons of dialysis modalities have been conducted. a key factor to consider in reviewing cost comparisons is the perspective of the analysis because different costs are relevant for different perspectives. in developed countries, hd is generally more expensive than pd to the payer. additional research is needed in the developing world before conclusive statements may be made regarding the relative costs of hd and pd. |
participants were selected from the cardiovascular health study (chs), a large, prospective, population - based study in the united states designed to investigate the underlying causes of cardiovascular disease in older men and women. the chs recruited participants from 4 communities : forsyth county, nc (36.1 north, 80.3 west) ; sacramento county, ca (38.5 north, 121.4 west) ; washington county, md (39.6 north, 77.8 west) ; and pittsburgh, pa (40.4 north, 80.0 west). the cohort consisted of 5,201 adults recruited in 19891990 and an additional 687 african - american participants recruited in 19921993. of these 5,888 participants, 4,692 ambulatory participants had complete exam data in 19921993 (the baseline assessment for the current study). serum 25-hydroxyvitamin d (25(oh)d) concentrations were not measured in 1,424 participants who had prevalent cardiovascular disease or stroke (one or more of the following : coronary heart disease, congestive heart failure, claudication, atrial fibrillation, pacemaker, implantable cardioverter defibrillator, stroke, or tia), determined by medical records, ecg findings, and self - report. further exclusions were insufficient serum volumes for vitamin d assay to be performed (7 drinks / week ; men > 14 drinks / week ]), and significant depressive symptoms (score 8 on the revised 10-item center for epidemiologic studies depression scale). cox proportional hazards models were used to assess the associations between baseline serum 25(oh)d and the risk of incident all - cause dementia and ad. participants were considered at risk for dementia from baseline (19921993) and were censored at death or the end of follow - up in june 1999. all - cause dementia included ad cases, and analyses for ad were censored for non - ad dementia. we analyzed serum 25(oh)d using clinically relevant cutpoints : 7 drinks / week ; men > 14 drinks / week ]), and significant depressive symptoms (score 8 on the revised 10-item center for epidemiologic studies depression scale). cox proportional hazards models were used to assess the associations between baseline serum 25(oh)d and the risk of incident all - cause dementia and ad. participants were considered at risk for dementia from baseline (19921993) and were censored at death or the end of follow - up in june 1999. all - cause dementia included ad cases, and analyses for ad were censored for non - ad dementia. we analyzed serum 25(oh)d using clinically relevant cutpoints : < 25 nmol / l (severely deficient), 25 nmol / l to < 50 nmol / l (deficient), and 50 linear trends across categories were tested by entering 25(oh)d groups into models as a continuous rather than a categorical variable. in basic adjusted models, we controlled for age and season of blood collection. in fully adjusted models, we controlled for education, sex, bmi, smoking, alcohol consumption, and depressive symptoms. to investigate any threshold, we used multivariate adjusted penalized smoothing spline plots. eight outlying participants with 25(oh)d concentrations between 170 and 283 nmol / l were excluded due to imprecision at the extreme end of the distribution (none developed dementia during follow - up). in secondary analyses, 25(oh)d concentrations were standardized to have a mean of 0 and an sd of 1 to aid interpretation. because 25(oh)d concentrations were positively skewed, they were normalized using a log transformation. we repeated the main analyses to include adjustments for health conditions that have been identified as potential mediators for the association between serum 25(oh)d concentrations and dementia risk : diabetes (american diabetes association guidelines : using oral hypoglycemic agents or insulin, or plasma fasting glucose 7.0 nmol / l) and/or hypertension (3 categories ; no hypertension : systolic < 140 mm hg and diastolic < 90 mm hg ; treated hypertension : hypertensive medication ; untreated hypertension : systolic 140 mm hg or diastolic 90 mm hg with no hypertensive medication). we also adjusted for ethnicity (white / black) and examined potential interactions with ethnicity in separate models, although it is recognized that this may represent overadjustment. in a further analysis, we adjusted for socioeconomic status indicators : annual income (< $ 12,000, $ 12,00024,999, $ 25,00049,999, $50,000, missing) and usual lifetime occupation (professional / technical / managerial / administrative, sales / clerical service, craftsman / machine operator / laborer / farming / forestry, housewife, other / missing). multivariate adjusted logistic regression models were used to investigate the cross - sectional association between serum 25(oh)d and prevalent all - cause dementia (n = 69) and ad (n = 34). in sensitivity analyses, we excluded participants who developed all - cause dementia (n = 12) and ad (n = 6) within 1 year of baseline to remove the possibility that any association observed was determined by these early converters. p values were 2-sided throughout, and the type i error rate for statistical significance was set at 0.05. analyses were performed using stata se version 12 (statacorp, college station, tx) with the exception of the spline plots, which were fitted in r version 2.15.1 (www.r-project.org). table 1 displays baseline characteristics for the study population included in the main prospective analyses. participants were followed up for a mean of 5.6 years (sd 1.6, median 6.1, range 0.18.4). during 9,317.5 person - years of follow - up, 171 participants developed all - cause dementia and 102 developed ad. the risk of developing both all - cause dementia and ad was significantly higher in participants who were either 25(oh)d deficient or severely deficient (table 2). in minimally adjusted models, those who were deficient had about a 51% increased risk of all - cause dementia, whereas the increased risk for those who were severely deficient was about 122%. the strength of the association observed for incident ad was similar to that observed for all - cause dementia. additional adjustment for potential confounders did not alter the pattern of results, and there was a linear trend across groups in all analyses, suggesting a monotonic association. kaplan - meier plots for unadjusted rates of incident all - cause dementia and ad show clear differences in risk by 25(oh)d concentrations after 23 years of follow - up (figure 1). multivariate adjusted smoothing spline plots suggest that the risk of all - cause dementia and ad markedly increases at 25(oh)d concentrations below 50 nmol / l (figure 2). baseline characteristics of 1,658 chs participants by serum 25(oh)d concentration cox proportional hazards regression models of incident all - cause dementia and alzheimer disease by serum 25(oh)d concentration models adjusted for age, season of vitamin d collection, education, sex, body mass index, smoking, alcohol consumption, and depressive symptoms. the multivariate adjusted risks for incident all - cause dementia and incident ad reduced by 18% (hazard ratio [hr ] = 0.82, 95% confidence interval [ci ] : 0.700.97, p = 0.02) and 20% (hr = 0.80, 95% ci : 0.650.99, p = 0.04), respectively, for each 1 sd increase in log - transformed 25(oh)d. additional adjustment for diabetes or hypertension did not change the pattern of results for either incident all - cause dementia or ad, suggesting that these conditions are unlikely to mediate the observed associations (table 3). adjustment for ethnicity attenuated the main results slightly but did not change the overall pattern of results, and there were no significant interactions (table e-1 on the neurology web site at neurology.org). additional adjustment for income and occupation did not change the associations either (table e-2). the odds of prevalent all - cause dementia and ad at baseline in participants who were severely 25(oh)d deficient were 36 times higher than those with sufficient 25(oh)d, with a linear trend across groups (table e-3). after excluding participants who developed all - cause dementia and ad within 1 year of baseline, the multivariate adjusted hrs in participants who were severely 25(oh)d deficient and deficient compared to participants with sufficient 25(oh)d concentrations were 2.42 (95% ci : 1.334.39) and 1.54 (95% ci : 1.062.28) for incident all - cause dementia (p for linear trend = 0.001) and 2.36 (95% ci : 1.085.16) and 1.69 (95% ci : 1.042.73) for ad (p for linear trend = 0.007). cox proportional hazards regression models of incident all - cause dementia and alzheimer disease by serum 25(oh)d concentration with additional adjustment for potential mediators we have conducted what is to our knowledge the first large, prospective, population - based study to examine vitamin d concentrations in relation to a comprehensive adjudicated assessment of dementia and ad. we observed a strong monotonic association between 25(oh)d concentrations and the risk of both incident all - cause dementia and ad. this association was robust to adjustment for a range of potential confounders and the exclusion of dementia cases that occurred within a year of baseline. the 2 previous studies that have investigated vitamin d and incident dementia have produced conflicting results. the first found that severe vitamin d deficiency was associated with non - ad dementia but not ad risk. the second found that severe vitamin d deficiency was associated with ad but not vascular dementia risk. however, the first study incorporated a small sample of high - functioning women (n = 40), and the lack of association with ad may reflect limited statistical power. the second study relied on registry data for dementia diagnoses, which may have resulted in considerable misclassification. our results establish that low 25(oh)d concentrations are linked to an increased risk of incident all - cause dementia and ad, and they are consistent with studies suggesting a link with cognitive impairment and cognitive decline. few studies have examined potential mediators of this association, although there was no evidence in the present study or the inchianti study for mediation by diabetes or hypertension. a threshold below which the risk of dementia increases markedly has previously been hypothesized to lie in the 2550 nmol / l range. the optimal level of vitamin d for general health remains controversial, with the institute of medicine recommending 50 nmol / l and the endocrine society recommending 75 nmol / l. a post hoc analysis of the women 's health initiative randomized controlled trial discovered that a relatively low dose of vitamin d (400 iu) in combination with calcium (1,000 mg) did not protect against dementia over a mean follow - up period of 7.8 years in women who had relatively high serum vitamin d levels at baseline (mean of 49 our results clarify that the threshold above which older adults are unlikely to benefit from supplementation with regard to dementia risk is likely to lie in the region of 50 nmol / l when 25(oh)d concentrations are measured using lc - ms. this therefore adds to the ongoing debate regarding optimal vitamin d levels for different health outcomes. a number of potential mechanisms linking low vitamin d levels with the risk of dementia have been identified. vitamin d receptors are expressed throughout the brain, including areas involved in memory such as the hippocampus and dentate gyrus. similarly, the enzyme that synthesizes the active form of vitamin d, 1-hydroxylase, is produced in several cerebral regions. the active form of vitamin d, 1,25dihydroxy - vitamin d3 (1,25-d3), regulates neurotrophin expression, such as nerve growth factor, neurotrophin 3, and glial - derived neurotrophic factor, and the survival, development, and function of neural cells. in vitro, vitamin d stimulates macrophages, which increases the clearance of amyloid plaques, a hallmark of ad. a recent study found that amyloid- induction of induced nitric oxide synthase, part of the inflammatory process of ad, is dependent on the disruption of the vitamin d - vitamin d receptor pathway. vitamin d supplementation ameliorates age - related decline in learning and memory in aged rats. in addition meta - analyses establish that 25(oh)d deficiency is associated with an increased risk of incident stroke, particularly ischemic stroke. a cross - sectional study of 318 elderly adults found that 25(oh)d deficiency was associated with increased white matter hyperintensity volume and a greater number of large vessel infarcts. in summary, low vitamin d concentrations may increase the risk of dementia and ad through both neurodegenerative and vascular mechanisms. the study sample was relatively diverse as it was population - based and included white and african - american men and women. a recent systematic review raised the possibility that the consistent observational associations between vitamin d levels and a wide range of health conditions may simply reflect reverse causation. however, in this study reverse causation is made less likely by the fact that participants were ambulatory and relatively healthy at baseline (their outdoor activity was not likely to be limited by impaired function linked to the onset of dementia). the long follow - up and exclusion of prevalent dementia and incident dementia occurring within a year of baseline also make reverse causation less likely. all - cause dementia and ad in the chs were diagnosed by a committee of neurologists and psychiatrists using a comprehensive range of data, including neuroimaging, according to international criteria (nincds - adrda). while the chs is multiethnic, it did not incorporate people of hispanic or other ethnicities. due to the exclusion of participants with cardiovascular disease and stroke at baseline, there were few cases of incident vascular dementia (n = 15). it was therefore not possible to investigate the relationship between vitamin d concentrations and incident vascular dementia due to a lack of statistical power, and further research is necessary to investigate generalizability to older adults with vascular dysfunction. in a cohort with a greater burden of vascular and metabolic dysfunction the representativeness of our final sample may have been reduced due to the inability to include participants with insufficient serum volume for 25(oh)d measurement (n = 945) as well as those lost to follow - up (n = 596). it is possible that the delay between obtaining the blood samples in 19921993 and measuring 25(oh)d concentrations in 2008 could have introduced measurement error ; however, this is unlikely to have introduced systematic bias. despite the wide range of information (including repeat neuroimaging) available to the committee diagnosing all - cause dementia and ad, a degree of misclassification is still likely. in particular, many cases of ad may actually reflect a mixture of pathologies, so caution should be exercised when considering potential mechanisms. as with all observational studies, unmeasured confounding is possible, and our findings do not in themselves demonstrate a causal relationship. we found a strong association between baseline vitamin d concentrations and the risk of incident all - cause dementia and ad over a mean of 5.6 years of follow - up in ambulatory older adults free from vascular conditions at baseline.. it would be useful to conduct prospective studies to investigate the association between vitamin d concentrations and incident vascular dementia and neuroimaging abnormalities. our findings support the hypothesis that vitamin d may be neuroprotective and that sufficiency in the context of dementia risk may be in the region of 50 nmol / l. this information is likely to prove useful in improving the design and reducing the cost of randomized controlled trials investigating whether vitamin d supplements can be used to delay or prevent the onset of dementia and ad in older adults. littlejohns : drafting and revising the manuscript for content, study concept and design, analysis and interpretation of data, and statistical analysis. henley : revising the manuscript for content, study concept and design, analysis and interpretation of data, and statistical analysis. fried : revising the manuscript for content, interpretation of data, acquisition of data. kestenbaum : revising the manuscript for content, interpretation of data, acquisition of data, obtaining funding. kuller : revising the manuscript for content, interpretation of data, acquisition of data. langa : revising the manuscript for content, interpretation of data, acquisition of data, obtaining funding. dr. lopez : revising the manuscript for content, interpretation of data, acquisition of data. dr. kos : revising the manuscript for content, study concept and design, analysis and interpretation of data. soni : revising the manuscript for content, study concept and design, analysis and interpretation of data, statistical analysis. llewellyn : drafting and revising the manuscript for content, study concept and design, analysis and interpretation of data, acquisition of data, statistical analysis, study supervision and coordination, obtaining funding. the chs was supported by contracts hhsn268201200036c, hhsn268200800007c, n01 hc55222, n01hc85079, n01hc85080, n01hc85081, n01hc85082, n01hc85083, n01hc85086, and grant hl080295 from the national heart, lung, and blood institute, with additional contribution from the national institute of neurological disorders and stroke. additional support was provided by ag023629, ag20098, ag15928, and hl084443 from the national institute on aging. additional support was also provided by nirg-11 - 200737 from the alzheimer 's association, the mary kinross charitable trust, the james tudor foundation, the halpin trust, the age related diseases and health trust, and the norman family charitable trust (to d.j.l.). this report presents independent research supported by the uk national institute for health research (nihr) collaboration for leadership in applied health research and care (clahrc) for the south west peninsula. none of the funding sources had any role in the design of the study ; in the analysis and interpretation of the data ; or in the preparation of the manuscript. the views expressed in this publication are those of the authors and not necessarily those of the nhs, the nihr, or the department of health in england. the nih was involved in the original design and conduct of the chs and in the data collection methods. | objective : to determine whether low vitamin d concentrations are associated with an increased risk of incident all - cause dementia and alzheimer disease.methods:one thousand six hundred fifty - eight elderly ambulatory adults free from dementia, cardiovascular disease, and stroke who participated in the us population based cardiovascular health study between 19921993 and 1999 were included. serum 25-hydroxyvitamin d (25(oh)d) concentrations were determined by liquid chromatography - tandem mass spectrometry from blood samples collected in 19921993. incident all - cause dementia and alzheimer disease status were assessed during follow - up using national institute of neurological and communicative disorders and stroke / alzheimer 's disease and related disorders association criteria.results:during a mean follow - up of 5.6 years, 171 participants developed all - cause dementia, including 102 cases of alzheimer disease. using cox proportional hazards models, the multivariate adjusted hazard ratios (95% confidence interval [ci ]) for incident all - cause dementia in participants who were severely 25(oh)d deficient (< 25 nmol / l) and deficient (25 to < 50 nmol / l) were 2.25 (95% ci : 1.234.13) and 1.53 (95% ci : 1.062.21) compared to participants with sufficient concentrations (50 nmol / l). the multivariate adjusted hazard ratios for incident alzheimer disease in participants who were severely 25(oh)d deficient and deficient compared to participants with sufficient concentrations were 2.22 (95% ci : 1.024.83) and 1.69 (95% ci : 1.062.69). in multivariate adjusted penalized smoothing spline plots, the risk of all - cause dementia and alzheimer disease markedly increased below a threshold of 50 nmol / l.conclusion : our results confirm that vitamin d deficiency is associated with a substantially increased risk of all - cause dementia and alzheimer disease. this adds to the ongoing debate about the role of vitamin d in nonskeletal conditions. |
halitosis is the general term used to describe any disagreeable odour in expired air, regardless of whether the odorous substances originate from oral or non - oral sources. other names used are fetor ex ore, fetor oris, bad or foul breath, breath malodour, and oral malodour. results from previous studies suggested that even though there are several causes of bad breath including those resulting from a systemic or nasopharyngeal pathology or condition, the main source of most halitosis is the oral cavity. non - oral sources of breath odour are generally related to systemic problems and/or medications including conditions such as diabetes, liver and kidney disorders, and pulmonary disease. some medications, especially those that reduce salivary flow such as antidepressants, antipsychotics, narcotics, decongestants, antihistamines, and antihypertensive drugs contribute towards non - oral sources of breath odor. systemic conditions and medications can contribute to breath problems, but the majority of bad breath originates in the oral cavity. bacterial putrefaction by gram - negative anaerobic bacteria, particularly those residing on the posterior dorsum of the tongue, utilize sulphur containing amino acids, primarily cysteine and methionine to produce volatile sulphur compounds (vscs) which lead to halitosis. other organic components e.g., organic acids, indole / skatole, putrescine, cadaverine may be involved in the production of halitosis. hydrogen sulphide (h2s), methyl mercaptan (ch3sh), and dimethyl sulphide [(ch3) 2s ] have been identified as the predominate vscs responsible for oral malodor. while the tongue is considered the primary source of vsc production, other dental problems can generate these offensive gases. dental conditions such as gingivitis, periodontal disease, gross carious lesions, and poor oral hygiene have been shown to contribute to bad breath. however, when dental disease is the source of oral malodour, treatment of the condition will often eliminate the problem. the oral health care providers of a country are responsible for enhancement of oral health of the entire nation and they can only do so if they have sound oral health themselves. as there is not much data available on the oral hygiene practices and oral malodour in dental students of india so the study was aimed at assessing the oral hygiene practices of the future dentists who hold the responsibility of maintenance of oral health of the entire nation. oral malodour is a characteristic finding in poor oral health so this parameter was assessed to evaluate oral hygiene. the other objectives of the study were to find out if there is any difference between the oral hygiene and self reported halitosis amongst male and female dental students. a questionnaire based study was carried out at gain sager dental college and hospital after taking approval from the institutional ethical committee. final sample consisted of 277 (200 female and 77 male) dental students as more number of female students is enrolled each year as compared to males. the sample consisted of equal distribution of male and female students from second year (69 students), third year (70 students) fourth year (69 students) and dental interns (69 students). a self - administered questionnaire was developed to assess the prevalence of oral hygiene habits including brushing, flossing, tongue cleaning, use of mouthwash, self - perception of oral health, awareness of bad breath, timing of bad breath, caries and bleeding gums, dryness of mouth, smoking habits, and tongue coating. the questionnaire was distributed all the dental students in the mentioned institution with permission and co - operation of the head of the institute and the respective head of the departments. the identity of the students was not disclosed and the confidentiality of the identity was assured to them. sufficient amount of time of 10 minutes was provided for the filling up of the questionnaire. the data was entered into statistical package for social sciences (spss) version 16.0 and was utilized for data analysis. chi - square test was used for comparisons among male and female students and to correlate the oral hygiene practices, smoking habit, presence of dry mouth, dental caries, bleeding gums and tongue coating to the prevalence of oral malodour. the significance level (p value) the questionnaire was distributed all the dental students in the mentioned institution with permission and co - operation of the head of the institute and the respective head of the departments. the identity of the students was not disclosed and the confidentiality of the identity was assured to them. sufficient amount of time of 10 minutes was provided for the filling up of the questionnaire. the data was entered into statistical package for social sciences (spss) version 16.0 and was utilized for data analysis. chi - square test was used for comparisons among male and female students and to correlate the oral hygiene practices, smoking habit, presence of dry mouth, dental caries, bleeding gums and tongue coating to the prevalence of oral malodour. the significance level (p value) out of a total of 381 students, 290 students filled the questionnaire and responded. all the respondents were in the age range of 19 - 25 years with a mean age of 21.2 years. 40.8% of individuals brushed only once a day, 57.4% brushed twice and 1.4% brushed three times, whereby a very few (4%) brushed four times a day. also the difference in result between males and females was not statistically significant. 69.9% used one tooth brush for less than 3 months, 25.4% for less than 6 months and 5.1% for more than 6 months with no statistically significant difference among male and female students. 93.5% dental students claim to clean their tongue daily but only 44.7% of them use a tongue cleaner to do so while the others (55.3%) use a toothbrush for this task. this result was found to be statistically significant when comparison was done among the male and female students (p = 0.017) (p 0.05) [figure 1 ]. prevalence of self assessed presence of dry mouth, dental caries, coating over the tongue and bleeding gums amongst dental students almost 58% of male and 40% of female students had self - perceived bad breath [figure 2 ]. the difference in data was statistically significant (p = 0.007) (p < 0.05). the majority of students, 84.4% male and 88.6% female, experienced bad breath after waking up [table 2 ]. almost 15% of female and 11% of male students experienced bad breath while they are hungry and 7.6% of females and 20% males experience halitosis during thirst. some students also perceive halitosis while working, talking to other people and when they are tired. prevalence of self perceived halitosis amongst dental students timing of self - perceived bad breath during the day it was found that students who brush twice daily experience less halitosis as compared to students who brush once daily. students who changed their brush within three months experienced less halitosis as compared to ones who changed their brush within 6 months or after six months [table 3 ]. 44.5% of students with a habit of tongue cleaning, 53% of students using a dental floss and 50.6% of students using a mouthwash experience oral malodour. this result showed statistical significance (p = 0.026) presence of dry mouth was directly correlated to presence of halitosis with high statistical significance (p = 0.001). it was more prevalent among those who had decayed lesions as compared to filled lesions. also, 53% of dental students with tongue coating or tongue deposits and 55.6% of students with bleeding gums reported halitosis [table 4 ]. correlation of halitosis to oral hygiene practices being followed by dental students correlation of halitosis to smoking, dry mouth, caries, bleeding gums and coating over tongue a recent study of united states dentists reported that chronic bad breath was diagnosed by 41% of practicing dentists in one week. studies conducted in japan, sweden and france have also reported the prevalence of oral malodor in the population. from such studies it can be concluded that halitosis is a problem that is perceived in different cultures and societies of the world. in spite of the wealth of information on the condition, identification of the actual cause in many studies, including ours, the assessment of malodour relies on the subject 's self - perception. many professionals do not consider this method to be reliable because it is subjective, and obviously, the method is not standardized among participants. nevertheless, despite its shortcomings, this method has been the most commonly used organoleptic technique of evaluating malodour. in our study the health care professionals such as dental students were studied for the prevalence of halitosis by correlating it to oral hygiene practices being followed by the students, the oral conditions such as dental caries, dryness of mouth, smoking, bleeding gums and tongue coating. it suggested that students who brush their teeth with a frequency of at least twice daily, changed their brush within 3 months, used a tongue cleaner to clean their tongue on a regular basis and used a mouthwash had lesser prevalence of halitosis as compared to the ones who did not follow such oral hygiene practices. the oral hygiene practices were better among the female students [table 1 ] and also the prevalence of self reported oral malodor was less in the female dental students [figure 2 ]. dry mouth is also major con related with oral malodor. in our study, almost 21% males and 14% females reported of dry mouth. it has been suggested that a reduced saliva flow during sleep favors anaerobic bacterial putrefaction, giving rise to so - called morning breath, a transient condition which disappears after a meal. the presence of halitosis in individuals with dry mouth was supported with statistically significant result in our study (p = 0.001) [table 4 ]. in an estimated 10 to 30% of the population in the united states the problem of dry mouth remains more persistent and halitosis persists throughout the entire day. halitosis was most prominent soon after waking up in most of the individuals (87%) who complaint of self perceived oral malodor. this can be attributed to the reduced salivary flow at night or to the lack of brushing habit at night. more males as compared to females experience halitosis while talking to other people and while they are thirsty. this difference in result was statistically significant (p = 0.007, p = 0.042) and can be due to better oral hygiene habits and less prevalence of bleeding gums, tongue coating and dry mouth in the female dental students. smoking has been defined as an extrinsic cause of oral halitosis. in our sample, many people try to overcome halitosis, this halitosis may be present in the strong smokers breath, and a history of smoking has been implicated in decreasing olfactory sensitivity. the prevalence of bleeding gums was almost equal among males and females in this study. dental caries and periodontal diseases are potential factors contributing to the bad breath. in the present study dental caries and periodontal disease such as bleeding gums showed correlation with the oral malodour but the result was not statistical significance. it has been seen in table 4 that prevalence of halitosis was more in presence of decayed carious lesions as compared to filled carious lesions. the presence of tongue coating was recognized in almost 105 males and 4% of female students. miyazaki. suggested oral malodor in younger generations could be ascribable mainly to tongue coat deposition. furthermore, a positive correlation between levels of vsc on the tongue 's dorsum surface and whole oral malodor has been demonstrated. indicated several vsc producing bacteria have the ability to colonize on the coat of the tongue in periodontally healthy subjects. it was also suggested oral malodor could be related to not only the amount of tongue coating but also the colonization of p. gingivalis in the coating. eli. concluded in a recent study that the self - perception of breath odor is a multifactorial, psycho - physiological issue related closely to one 's body image and psychopathological profile. reported information should be carefully evaluated, due to the limitation of the reliability of the questionnaire surveys. from our study we conclude that female dental students maintained better oral hygiene practices than male dental students and had less prevalence of halitosis as compared to the male student population. there is room for considerable improvement in the oral health behavior of both the male and female dental student groups with a particular emphasis on the former as they are role models for their patients and the public at large.. they can not be role models for their patients until they maintain good habits themselves. this can be done by greater emphasis during their undergraduate dental training could improve their oral self - care behaviors. in can be concluded from our study that poor oral hygiene habits and presence of conditions such a dryness of mouth, bleeding gums, dental caries and coating or deposits over tongue tend to influence the prevalence of halitosis. | objective : the present study was undertaken to determine the prevalence of oral hygiene practices, smoking habits and halitosis among undergraduate dental students and correlating the oral hygiene practices, oral health conditions to the prevalence of self perceived oral malodour.materials and methods : a self - administered questionnaire was distributed among 277 male and female students. a questionnaire was developed to assess the self - reported perception of oral breath, awareness of bad breath, timing of bad breath, oral hygiene practices, caries and bleeding gums, dryness of the mouth, smoking and tongue coating.results:the results indicate female students had better oral hygiene practices. significantly less self - reported oral bad breath (p = 0.007) was found in female dental students (40%) as compared to their male counterparts (58%). it was found that smoking and dryness of mouth had statistically significant correlation with halitosis (p = 0.026, p = 0.001). presence of other oral conditions such as tongue coating and dental caries and bleeding gums also showed higher prevalence of halitosis in dental students.conclusion:a direct correlation exists between oral hygiene practices and oral health conditions with halitosis. females exhibited better oral hygiene practices and less prevalence of halitosis as compared to male students. |
the 21st century will witness even more rapid ageing than did the century just past and governments, private sector as well as civil society should work together to give answers to the social and economic challenges we will all be facing. edad&vida (age and life) (http://www.edad-vida.org) is from 2001 the meeting point of private companies, elderly associations and academic institutions, who work together to give an answer to the needs of elderly people and to promote initiatives to improve their quality of life in a responsible and sustainable way. our raison dtre is promoting the joint responsibility and balance between the public sector and the private initiative, with the aim of responding to the economic and social challenges of an ageing population. in this sense, some of the recommendations of edad&vida to the public administrations are : a stable and clear legal frame - work for the private initiative to make the necessary investment efforts ; the health and social care integration ; an offer of quality services to the elderly people and the accreditation system to guarantee this quality ; a fair correlation between costs and prices paid ; the long - term care system sustainability through co - payment etc. edad&vida foundation is a reference and pioneer institution in spain and in europe and fosters the dialogue and co - operation among public and private sector as well as elderly associations and academic institutions with the aim of improving the quality of life of elderly people. | introductiondemographic change and population ageing are global processes without precedent. the 21st century will witness even more rapid ageing than did the century just past and governments, private sector as well as civil society should work together to give answers to the social and economic challenges we will all be facing.descriptionedad&vida (age and life) (http://www.edad-vida.org) is from 2001 the meeting point of private companies, elderly associations and academic institutions, who work together to give an answer to the needs of elderly people and to promote initiatives to improve their quality of life in a responsible and sustainable way. our raison dtre is promoting the joint responsibility and balance between the public sector and the private initiative, with the aim of responding to the economic and social challenges of an ageing population. in this sense, some of the recommendations of edad&vida to the public administrations are : a stable and clear legal frame - work for the private initiative to make the necessary investment efforts ; the health and social care integration ; an offer of quality services to the elderly people and the accreditation system to guarantee this quality ; a fair correlation between costs and prices paid ; the long - term care system sustainability through co - payment etc.conclusionsedad&vida foundation is a reference and pioneer institution in spain and in europe and fosters the dialogue and co - operation among public and private sector as well as elderly associations and academic institutions with the aim of improving the quality of life of elderly people. |
calcific uremic arteriolopathy (cua) or calciphylaxis is a syndrome of painful skin necrosis and vascular calcification with high morbidity and mortality. it occurs primarily in patients with end - stage renal disease [1, 2 ]. though generally a rare syndrome, it is increasingly described in subjects undergoing renal dialysis. calciphylaxis has also been described in subjects with normal renal function including primary and secondary hyperparathyroidism [3, 4 ]. a common factor linking non - renal - failure - related presentation of the same disease is elevated parathyroid hormone with or without elevated calcium - phosphate product leading to calcification of small vessels. the consequences of these are significant mortality of 80% principally from multiple end organ damage due to ischemia and infarction commonly complicated by infection ; sepsis being the principal cause of death [13 ]. thus, traditional care addresses the calcium - phosphate - pth axis : substituting calcium with non - calcium as phosphate binders, strict dietary phosphate control, cautious vitamin d analogs, calcimimetics, and surgical parathyroidectomy if necessary. newer approaches focus on intravascular and tissue mineralization : dissolution of calcium deposits with the use of sodium thiosulfate, altering osteoprotegerin, and nf-b pathways with bisphosphonates [4, 5 ]. recently, single agent treatment such as sodium thiosulphate and hyperbaric oxygen has yielded various successes in care of calciphylaxis [57 ]. furthermore, favourable outcome was recorded in limited reports on cua using cinacalcet or parathyroidectomy to achieve targeted normalised calcium, phosphate, and parathyroid hormone levels [8, 9 ]. yet usefulness of these agents in the form of combination therapy has not been fully explored [10, 11 ]. the aim of the study was to review all cases of cua seen in the last five years and determine its clinical course in the setting of multimodality care. all patients diagnosed to have cua at the townsville hospital, australia, from april 1, 2006, to march 31, 2011, were retrospectively studied. data collected included age, gender, onset of dialysis to diagnosis of calciphylaxis, duration of the skin lesion, and outcome defined as completely or partially healed skin lesions or death of a subject. in all subjects, calciphylaxis trigger agent(s) were ceased all the patients were on oral erythropoietin for anemia in addition to iron infusion in 2 patients. biochemical profile of subjects with cua at diagnosis and within 6 months on multimodal care was recorded. these included corrected calcium, phosphate, albumin, calculated calcium - phosphate product, and parathyroid hormone. the patients included in this study were reviewed by the vascular team, and a second opinion was obtained from a dermatologist. all lesions had a punch biopsy performed across the ulcer edge, but if the specimen was insufficient to demonstrate calciphylaxis, then a wedged biopsy was performed to confirm the diagnosis. all biopsies were analysed by the same pathologist ; the diagnostic criteria used were medial calcification of dermal small and medium - sized arterioles and arteries, intimal fibroblastic and endothelial proliferation associated with ischemic necrosis of subcutaneous adipose tissue, and epidermal ulceration. medium - sized arteries with medial calcific sclerosis (monckeberg 's medial calcific sclerosis) with no intimal or endothelial proliferation were excluded from the study. the patients ' wounds were managed by clinical occupational and nurse therapist with specialist interest in wound healing and compression therapy. the dry necrotic lesions were gently hydrated to promote a moist wound environment, encouraging autolytic debridement and cell migration. an atraumatic dressing (silicone coated, mepitel) and nonadherent absorbent pad were applied as secondary dressings. after autolytic debridement, a conformable silver polymembrane was applied and retained with light tubular support bandage. if the wound was infected, antibiotics were administered based on microscopy, culture, and sensitivity results following deep wound swab and blood cultures with input from the infectious disease specialist. to improve wound healing, methods used in lowering calcium - phosphate product and parathyroid hormone included emergency parathyroidectomy, use of non - calcium phosphate binders meq / l) and the dialysis - dose was increased from 8 l dialysate / day to 12 l / day. oral prednisolone 50 mg once daily was administered in 2 patients due to contraindication to parathyroidectomy and refusal to use sodium thiosulphate (sts). twenty - five grams of sts (100 ml of a solution at 25% sts) were infused three times per week in 3 patients for 1 to 3 months. there were no signs, symptoms, or electrocardiographic evidence of hypocalcaemia at any time during the course of sts therapy. there was no discernible effect of each thiosulphate infusion on any of the plasma chemistry values or any other adverse effects such as metabolic acidosis or haemorrhagic complications. wound response to the treatments was monitored clinically and by serial photography comparing before and after progress. in addition, patients were followed up in outpatient clinics to determine if the healed skin lesion relapsed or to determine cause of death had the patient died. treatment for comorbidities was provided and followed up by the appropriate subspecialties. once discharged from the hospital, patients were followed up weekly by the clinical occupational therapist and by nephrologists 3 times a week at the renal dialysis session looking for relapse of the calciphylaxis. comparison of biochemical profile was made at and within 6 months after the diagnosis of cua with overall results depicted as mean standard deviation, where applicable. over the five - year period, we recorded 6 cases of cua out of 201 subjects who had regular haemodialysis sessions at the unit as shown in table 1. of the 6 subjects, two - third was females. infection was demonstrable in all subjects as revealed by wound swab microscopy, culture, and sensitivity. the commonest organism isolated was pseudomonas aeruginosa in 4 subjects, namely, patient 1, 4, 5, and 6. modalities of treatment of the calciphylaxis apart from wound care and administration of antibiotics in all included cinacalcet in patient 1, 3, and 6 ; prednisolone was used in patient 3 and 4, while parathyroidectomy was emergently done in patient 2 and 3 with marked hyperparathyroidism and progressive disease despite medical therapy. following the parathyroid surgery, whereas patient 2 had her wounds completely healed and remained in remission for 32 months, patient 3 did not respond to the parathyroidectomy and died 5 months later of sepsis. below knee amputation was performed in only one subject, patient 5, who did not respond to local wound care, antibiotics, hyperbaric oxygen therapy, and administration of sodium thiosulphate. the cua reoccurred rapidly within one week of the surgery which was complicated by sepsis following withdrawal of further treatment including haemodialysis. side effects of the treatments offered were assessed, but none of the patients developed any untoward effects to prednisolone, cinacalcet, sts, or hyperbaric oxygen therapy. overall, combination therapy for cua was offered in the form of dual in 4 subjects, triple and quadruple in one subject each as detailed in table 3. these include ischemic heart disease in subject 1 and 4 though patient 2 and 4 both died suddenly, and autopsy confirmed myocardial infarction as a cause of death. other comorbidities apart from diabetes in all but 2 patients, hypertension occurred in subject 1 and 5. closer look at the survival details revealed only one patient is alive, the rest died mainly within 9 months of diagnosis of cua. the histology of the skin biopsy of the patients was analysed histologically as depicted in figure 1. the defining histological characteristic found in all the cases was extensive calcification of small and medium - sized vessels of the dermis and subcutis layer with typical calcific thrombogenic microangiopathy. the deposition of calcium in the media was either segmental or circumferential and was accompanied by intimal hyperplasia, fibrosis, and thickening with smooth muscle fibre atrophy. table 2 shows mean biochemical profile of subjects with cua at diagnosis and within 6 months after. calcium - phosphate product was similar in both groups, while serum parathyroid hormone was significantly lower after the diagnosis. figure 2 shows completely healed ulcers of calciphylaxis in patient 4 who had been on treatment for ischemic heart disease. she was on the following oral agents : aspirin 100 mg, clopidogrel 75 mg, nicorandil 20 mg, isosorbide mononitrate 120 mg, frusemide 40 mg, atenolol 50 mg, candesartan - hydrochlorothiazide 16/12.5 mg, atorvastatin 40 mg, and amlodipine 10 mg all were given once daily. daily wound care and oral with prednisolone were commenced to which she responded dramatically within one month and the lesions completely healed by second month as shown in figure 2. sadly, she died suddenly and autopsy confirmed myocardial infarction as the cause of death. on the other hand, patient 1 had painful bilateral legs lesions which progressed rapidly within a month with involvement of genitalia and breast. the patient declined further care and died of sepsis a week later following discontinuance of active treatment including haemodialysis. other causes of esrf recorded include chronic glomerulonephritis and obstructive uropathy in one subject each, respectively. the skin lesion partially healed in one subject and failed to heal in the 3 who died of overwhelming sepsis. on the other hand, the 2 subjects with successfully healed wounds died of myocardial infarction 1 to 2 years later. all except one patient died within an average of 9 months from the diagnosis of the skin lesion ; in line with others observation [1, 2 ]. recently, reports have shown high survival rate and complete wound healing with the use of single agent therapy including sodium thiosulphate, hyperbaric oxygen, cinacalcet, and parathyroidectomy [59 ]. surprisingly, such benefit was not evident in our subjects on multiagent treatment in the form of dual, triple, or quadruple therapies, similar to kyritsis. observation, but in contrast to better outcome noted by arenas. and by baldwin and colleagues [11, 12 ]. it is interesting to note that though single or multiple - agent therapies aimed at lowering calcium - phosphate product have shown some positive results in treatment of calciphylaxis, to - date no standard management is universally accepted to treat this condition. nonetheless, non - calcium - containing phosphate binders, bisphosphonates, the calcimimetic cinacalcet, and vitamin d analogs have been used with this intent. for instance, pamidronate, a bisphosphonate used singly or in combination with other agents, has been reported to respond favourably in subjects with calciphylaxis [4, 14 ]. similarly, by lowering serum parathyroid hormone, cinacalcet has also proved to be beneficial in care of cua. furthermore, emergency parathyroidectomy has been used in the treatment of patients with cua associated with hyperparathyroidism refractory to medical therapy ; however, case series have shown variable results [1, 9, 16 ]. other treatment modalities include hyperbaric oxygen therapy which has been found useful in management of cua by improving tissue oxygenation and promoting wound healing [7, 17 ]. similarly, sodium thiosulfate increases solubility of calcium deposits in cua with enhanced wound healing. the success of sodium thiosulfate therapy alone or in combination with other agents in patients with calciphylaxis has been described in several case reports and case series [5, 18, 19 ]. despite the observation by others of favourable outcome using multiple agents in care of cua, we recorded high mortality even after successful wound healing. the factors attributable to the poor prognosis of cua in our series are not clear. possible reasons for the high mortality include delayed diagnosis due to low index of suspicion emanating from alternative diagnosis, including more common diabetic skin ulcer and osteomyelitis ; both conditions may coexist with the calciphylaxis itself. furthermore, other skin lesions such as vasculitis may mimic calciphylaxis clinically including painful nonhealing ulcers due to ischemia which might have led to delayed diagnosis. however, with the high index of suspicion of cua in our cohort makes it less likely as a contributing factor. on the other hand, site of cua lesion has been reported to have prognostic value. some authors believe proximal localization of the lesion to have worse prognosis [1, 21 ]. interestingly, only 2 of our subjects had proximal involvement yet 83% of them died despite multi - interventional approach ; in agreement with others findings [1, 2 ]. five of the 6 subjects studied had at least 3 other diseases apart from the cua to cope with. nonuremic calciphylaxis tends to have a less ominous course compared to those with esrf [3, 4 ] in support of high mortality in our study in which all the subjects had renal failure from various aetiologies on haemodialysis. the major limitation of our study was small sample size which limits power to detect associations reflecting relative rarity of this condition in clinical practice. furthermore, the biochemistry profile presented was limited to at the time of diagnosis and within 6 months after and did not address daily changes which may have occurred in the course of followup of the subjects. nonuniformity of treatment of calciphylaxis also makes it hard to conclude outcome as poor as reported. furthermore, contribution of other risk factors of ischemic heart disease was not assessed in spite of myocardial infarction being one of the common causes of death in the study population. lastly, it is important to note that there is a limitation to retrospective studies in general. observations derived from such studies may contain some missing information and thus may serve as a stimulus to further prospective work to clarify findings. the present work must be interpreted in the knowledge of the defects inherent in such studies. despite these, our result is consistent with other reports [2, 10 ]. the study has further suggested calciphylaxis, a syndrome with high mortality irrespective of mode of care. in conclusion, prognosis of cua in subjects with esrf remains poor in spite of combination therapy and multimodality of wound care. | background. calcific uremic arteriolopathy (cua) or calciphylaxis though generally noted for its high mortality, recent case reports have shown promising results using single agent therapies. however, it is not clear whether combination therapeutic agents will improve course of the disease. objective. to determine clinical outcome in subjects with cua on multimodal treatment. methods. all patients with end - stage renal failure (esrf) at the townsville hospital, australia, from april 1, 2006, to march 31, 2011, with diagnosis of cua were retrospectively studied. results. six subjects with cua (4 females and 2 males) were on various combination therapeutic agents comprising sodium thiosulphate, hyperbaric oxygen, prednisolone, cinacalcet, and parathyroidectomy in addition to intensified haemodialysis, specialist local wound care, and antibiotics. the wounds failed to heal in 3 patients while 5 of the 6 subjects died ; cause of death being sepsis in 3 and myocardial infarction in 2. conclusion. prognosis of cua remains poor in spite of multimodal combination therapy. further prospective studies on a larger population are needed to verify our findings. |
iodine is an essential component of thyroid hormones and critical to normal brain development in newborn infants and children. iodine nutrition in the united states is considered to be sufficient for most populations despite significant reductions in urinary iodine values between the early 1970s and the early 1990s. the 2001 - 2002 us national health and nutrition examination survey (nhanes) results suggest that iodine nutrition has stabilized, but levels are barely above the recommendation for the average which means that a significant number of people remain at risk. women of childbearing age and pregnant women are widely accepted as high - risk groups for inadequate iodine intake, but there is valid concern that additional high - risk groups remain [3, 4 ]. three cases of iodine deficiency as a result of restrictive diets in children have been reported in the literature [57 ]. this case report illustrates a unique case of iodine deficiency in the us and suggests the need for a greater emphasis on promoting and evaluating the nutritional adequacy of the diets of children with multiple food allergies or perceived food allergies or sensitivities. he had developmental delay diagnosed at approximately 2 years of age and was thought to have some form in the autism spectrum. his family history was positive for a brother with life - threatening peanut allergies. his past medical history was significant for multiple food allergies, including four anaphylactic episodes. he was tested at 6 months of age and was found to be allergic to peanuts and soy. additional allergy tests determined allergies to soy, eggs, dairy, wheat, seafood, peanuts, legumes, white potatoes, corn, spinach, and strawberries. the patient had a nutrition evaluation with a registered dietitian at this time, which did not reveal any significant nutrition concerns. at age 10, due to concerns about iodized table salt containing cornstarch, the family switched to using sea salt. his diet is further restricted from citrus fruits, pork due to concern regarding additives, and beef due to potential processing with milk. his current dietary intake includes almost exclusively chicken and turkey, rice cakes, apples, applesauce, apple juice, bananas, raisins, blueberries, carrots, broccoli, sweat potatoes, olive oil, and sea salt. multivitamins are avoided due to bulking agents, which sometimes contain cornstarch. on initial examination, he had no signs or symptoms of hyperthyroidism or hypothyroidism. the right lobe measured 7.4 4.0 2.6 cm for a total volume of 41 cc. the left lobe measured 7.8 3.2 2.9 for a total volume of 38 cc. his thyroid function was as follows : free triiodothyronine (free t3) 476 pg / dl (normal 335480), free tetraiodothyronine (free t4) 0.2 ng / dl (normal 0.82.0), total tetraiodothyronine (total t4) 1.6 g / dl (normal 4.510.0), and thyrotropin (tsh) 16.5 iu / ml (normal 0.504.50). a 24-hour urine collection for iodine was less than 10 g (normal 100460 g / specimen). specific dosing information for treating iodine deficiency was difficult to find since prevention is strongly encouraged. the dietary reference intake for males 913 years is 120 g daily and the tolerable upper intake level is 600 g daily. in dosing potassium iodine, the saturated solution of potassium iodine contains 50 mg or 50.000 g per drop. this form of iodine replacement was chosen to avoid allergic reaction to other ingredients that may be included in other multivitamin - mineral supplements. the patient was treated with one drop of 10% solution potassium iodine in the allergists ' office to provide 5 mg of iodine. after the patient tolerated this, the dose was increased to 15 mg per day because of the slow response to his thyroid function tests. after three months of supplementation, his thyroid function tests have normalized and his goiter has decreased dramatically in size to almost normal. the patient 's iodine intake is maintained on a supplement containing 3.6 mg iodine taken once per month and urinary iodine is being monitored. in the us, iodized table salt is considered to be a primary food source for iodine. other food sources include saltwater fish, seaweed, and to a lesser extent egg yolks, dairy products, commercially baked breads, meat, and poultry. iodination of salt is not mandatory in the united states, and recent tests of iodized table salt samples found that 53% did not meet the us food and drug administration 's recommendation for iodine levels. additionally, americans have reduced their overall salt consumption for health reasons such as preventing hypertension ; are using designer table salts more frequently, such as sea salt or kosher salt which do not contain significant amounts of iodine ; and are consuming a significant amount of processed and fast foods which may not be prepared with iodized salt. the iodine content of dairy products and commercially baked bread is dependent on the use of iodophors (iodine containing substances, such as dairy cleansers or bread dough conditioners) in processing, making iodine levels in these foods highly variable [10, 11 ]. iodine in meat and poultry is also highly variable depending on the amount of iodine added to animal feed. only 50% of adult multivitamins, 45% of children multivitamins, and no infant liquid multivitamins contain iodine. furthermore, only 1/3 of over - the - counter and 2/3 of prescription prenatal vitamins contain iodine. with all of these factors present, valid concerns regarding iodine intake remain for high - risk groups despite the most recent nhanes report. this patient developed severe iodine deficiency disorder (idd) due to his extremely restricted dietary intake from multiple food allergies, particularly the elimination of seafood and finally iodized salt. food allergies occur in an estimated 68% of children, and perceived prevalence of food allergy may lead to the use of some form of elimination diet in an estimated 20% of children. children with multiple food allergies have been found to be shorter than those with one food allergy and to have less than adequate intakes of calcium, vitamin d, and vitamin e. the use of allergy formulas may help to supplement iodine in children with multiple food allergies (see table 1), but additional supplementation may still be necessary depending on the restrictions of the diet. additionally, quantities sufficient to prevent iodine deficiency are often difficult to consume by small children. children with multiple food allergies or those following elimination diets due to a perceived food allergy should have regular nutrition assessments by a registered dietitian. another evaluation after the elimination of iodized salt at age 10 may have identified a lack of iodine in the diet. these children should also be added as a high - risk group for idd in the us. in presenting this case study at a recent regional pediatric endocrinology meeting, concerns were raised regarding an increase in newborn tsh values among infants born in the state. similar results have been found across the us and coincide with declining urinary iodine status of pregnant women. in a recent study by moleti., maternal iodine insufficiency was significantly lower in women consuming iodized salt for at least 2 years compared with women consuming iodized salt upon becoming pregnant. these results further stress the importance of adequate iodine intake prior to and during pregnancy and the potential long - term consequence to children born to iodine insufficient mothers. the national academy of sciences recently made the recommendation for the addition of iodine to all prenatal vitamins, and the american thyroid association also recommends daily iodine supplementation for all pregnant and lactating women. public health efforts for adequate iodine nutrition should be increased in all children and pregnant and breastfeeding women, particularly among high - risk populations and anyone who does not use iodized salt or consume seafood regularly. research efforts should focus on the effects of suboptimal iodine nutrition in high - risk groups and identification of additional high - risk groups. continued and routine monitoring of iodine nutrition in the us may also prove prudent given the limited number of iodine rich food sources. | severe iodine deficiency results in impaired thyroid hormone synthesis and thyroid enlargement. in the united states, adequate iodine intake is a concern for women of childbearing age and pregnant women. beyond this high risk group iodine deficiency is not considered to be a significant problem. this case report describes a 12-year - old male with severe iodine deficiency disorder (idd) resulting from restricted dietary intake due to multiple food allergies. we describe iodine replacement for this patient and continued monitoring for iodine sufficiency. children with multiple food allergies, in particular those with restrictions to iodized salt and seafood, should be considered high risk for severe iodine deficiency. |
risk factors for development of gastrointestinal (gi) toxicity in patients receiving non - steroidal anti - inflammatory drugs (nsaids) for arthritis or other musculoskeletal diseases include1 - 5) prior history of complicated or uncomplicated ulcers ; increased age ; multiple nsaid use ; high nsaid dose ; concomitant use of corticosteroids or anticoagulants including acetylsalicylic acid6) ; concomitant helicobactor pylori (h. pylori) infection7,8) ; comorbidities, such as significant cardiovascular disease ; female gender9 ; and severe rheumatoid arthritis. most global and domestic guidelines for clinical practitioners recommend the use of either a cyclooxygenase-2 (cox-2) selective agent or a nonselective nsaid with co - prescription of gastroprotective agents in patients with the risk factors3 - 5). the aim of this study was to describe the patterns of use of nsaids for arthritic knees in clinical practice in korea, particularly focusing on the co - prescription of gastroprotective agents for patients with or without the risk factors for gi toxicity or adverse gi events. a survey was performed in the ambulatory of 82 hospitals (62 university and 20 general hospitals) where 111 physicians, members of the korean knee society, had prescribed nsaids to relieve symptoms and signs of arthritic knees for more than three consecutive months. this cross - sectional observational study was performed on a single day between august and october 2009, although the exact date of study was different among the survey sites. all the patients were 20 years old, had been taking oral nsaids for more than three consecutive months, and required additional prescription of nsaids for symptomatic relief of their arthritic knees. a self - administered questionnaire was completed by each of the 2,000 patients who fulfilled those inclusion criteria and by the physicians to get the information of the recent and current prescriptions. the questionnaire for the patient included questions on the risk factors for gi adverse effects, such as age, gender, general condition, any history of peptic ulcer with or without hemorrhage or perforation, concomitant use of anticoagulants or corticosteroids, concomitant h. pylori infection, and comorbidities, such as significant cardiovascular disease. it also included questions about the status of the affected knee joint and any adverse gi symptoms. the data from the questionnaires filled up by the physicians were analyzed to investigate the prescribing habits of nsaids and gastroprotective agents and to determine whether the physicians took any gi symptoms and the patient 's own risk level into consideration when they prescribed medicine. the patients were stratified according to the risk of developing adverse gi events by using the standardized calculator of risk for events (score) tool. the score had been developed at stanford university1) and become the base of the treatment guidelines for the use of nsaids that was disseminated by northern california health maintenance organization (hmo). the score tool assigned points for six patient factors including age, gender, morbidity, gi problems, and rheumatoid. whereas the hmo classification categorized patients as level 1 or lowest risk (1 - 15 points), level 2 or intermediate risk (16 - 20 points), and level 3 risk (21 points or greater)9) we classified the patients into low risk (1 - 10 points), moderate risk (11 - 15 points), high risk (16 - 20 points), and very high risk (21 points or greater) of developing serious gi complications. of the 2,000 patients who completed the questionnaire, 1,960 met the eligibility criteria based on the rules for inclusion and exclusion. fifty - six per cent of the subjects were more than 65 years of age and 76% were female. one hundred and sixty patients (8%) were at very high gi risk, and 785 patients (40%) were considered at high risk for adverse gi events (table 2). among the patients in a high or very high risk group, 321 patients (34%) had a prescription of cox-2 inhibitors, 331 patients (35%) nonselective nsaids without co - prescription of gastroprotective agents, and 293 patients (31%) nonselective nsaids plus gastroprotective agents (table 3). this means, among 542 high or very high - risk patients taking nsaids without the co - prescription of gastroprotective agents, 331 patients (61%) were given non - selective nsaids instead of selective nsaids. whether the patients had adverse gi symptoms or not did not affect the proportion of patients taking selective nsaids (table 4). overall, a gastroprotective therapy was performed in 805 (41%) patients and only less than half of the patients were given coprescription of gastroprotective agents regardless of the presence or absence of gi symptoms and irrespective of the level of risk for nsaid - induced gastropathy (table 5). among the patients using the preventive drugs, 255 (32%) patients received rebamipide whereas histamine2 (h2)-receptor antagonists (h2ra) were coprescribed for 191 (24%) patients (table 6). the symptoms of gi toxicity include both annoying maladies, such as dyspepsia or disgust, and serious events, such as gi ulcers with hemorrhage or perforation. despite all global and domestic guidelines recommending the use of either a cox-2 inhibitor or a nonselective nsaid with co - prescription of gastroprotective agents for patients who are at risk of developing gi toxicity, almost thirty - five percent of the patients at high or very high risk took nonselective nsaids without co - prescription of gastroprotective agents in this study. besides, more than half of the patients complaining of gi symptoms were not given co - prescription of gastroprotective agents, and only a quarter of the patients complaining of gi symptoms were given prescription of selective cox-2 inhibitors in this study. overall, only less than half of the patients were given coprescription of gastroprotective agents regardless of the presence or absence of gi symptoms and irrespective of the level of risk for nsaid - induced gastropathy. there have been disparities between medication guidelines and government 's reimbursement policies which may modify the enthusiasm of some practitioners for gastroprotection. with regard to gastroprotective agents, proton pump inhibitor (ppi) or misoprostol has been widely recognized as the most effective one10). ppis including omeprazole, lansoprazole11), and esomeprazole12) significantly reduced symptomatic ulcers among patients receiving nsaids. however, one must also consider potential complications of the long - term ppi use including acceleration of corpus atrophy and, possibly, its role in hip fractures, pneumonia, and pseudomembranous colitis8). it has been shown that the incidence of peptic ulcers associated with nsaid use can be reduced by cotherapy with the synthetic prostaglandin misoprostol. however, poor tolerability is a major limitation of the drug. in a clinical trial13), 27.5% of misoprostol - treated patients withdrew prematurely from the study due to adverse events, most of which were gi complaints including abdominal pain and diarrhea. although most global and domestic guidelines recommend the use of ppi or misoprostol for gastroprotection3 - 5), other options that might reduce the risk for nsaid - related upper gi complications are also available. symptomatic low risk patients without evidence of blood loss may switch to another nsaid (or coxib) or receive treatment with antacids or h2ra10). selective cox-2 inhibitors (coxibs) are safer to the gi tract than traditional nsaids. however, current prevention strategies for patients who need nsaids should also take into account the presence of cardiovascular (cv) risk factors, as coxibs and probably post traditional nsaids increase the incidence of serious cv events2) there have been several reports that cox-2-inhibitor users did not have a reduced risk of a gi bleed compared with patients using nonselective nsaids14). currently, it is accepted that the choice of an nsaid should be determined by the need to balance each patient 's gi and cv risks. several trials with less potent cox-1 inhibitors showed significant reductions in endoscopic gastric ulcers and erosions10,15,16). the development of cox-2-selective inhibitors and the formation of other new, safer inhibitors should broaden the range of options. although acid inhibitors may relieve symptoms, they have not been proven to reduce gi complications, among h2ra, only high dose of famotidine has been recognized as a gastroprotective agent in most official guidelines. recent improvements in the understanding of nsaid - induced damage and new gastroprotective agent development17) would provide an opportunity for effective anti - inflammatory with reduced gi complications. in summary, strategies for reducing the risk for nsaid - related gi complications remain underused even in high - risk patients and patients with gi symptoms. thus, the physician prescribing nsaids for arthritic knees should determine the level of patient 's own risk for nsaid - induced gastropathy, monitor any developing gi symptoms, and be willing to prescribe gastroprotective agents for the patient, in order to prevent serious adverse events. also, the ultimate choice of therapy for a particular patient depends on several things including risk factors, the preferences of the patient and the physician, and cost10). the physician prescribing nsaids for arthritic knees should monitor any developing gi symptoms or the level of patient 's own risk for gastropathy, and be willing to add gastroprotective agents for the patient in order to prevent serious adverse events. | purposethe aim of this study was to describe the patterns of use of non - steroidal anti - inflammatory drugs (nsaids) for arthritic knees in clinical practice, particularly focusing on the co - prescription of gastroprotective agents for patients with risk factors for adverse gastrointestinal (gi) events.materials and methodseach cross - sectional cohort was a group of outpatients visiting 111 physicians who had prescribed nsaids for the patients ' arthritic knees for more than three consecutive months. a self - administered questionnaire was completed by each patient and physician.resultsnine hundred and forty five patients (48%) of the whole 1,960 patients belonged to the group with a high or very high risk for nsaid - induced gastropathy determined by northern california health maintenance organization guidelines. overall, only less than half of the patients were given co - prescription of gastroprotective agents, regardless of the presence or absence of gi symptoms and irrespective of the level of risk for nsaid - induced gastropathy.conclusionsthe physician prescribing nsaids for arthritic knees should monitor any gi symptoms and the patient monitor anylevel for nsaidinduced gastropathy, and be willing to add gastroprotective agents as necessary in order to prevent serious adverse gi events. |
interleukin-29 (il-29) is the main cytokine among three members of interferon lambda family (ifn-s), also known as type iii ifns, including ifn-1, ifn-2, and ifn-3 (or il-29, il-28a, and il-28b, resp.). the activity of il-29 is determined in part by the distribution and expression of its specific il-28 receptor alpha chain (il-28ra). il-28ra is widely expressed by ranges of cells including epithelial cells, hepatocytes, fibroblasts [1, 2 ], and immune cells, such as plasmacytoid dcs, macrophages, th17 cells, and nk cells [36 ]. the most studied biological role of ifn-s is its antiviral activity, but recent investigation starts to uncover a unique role of ifn-s in and beyond innate antiviral immunity [4, 7 ]. il-29 can induce antiproliferative and antitumor properties [8, 9 ], inhibit il-13 release in t cells, and stimulate il-6, il-8, and il-10 production in macrophages and il-4 and il-13 in mast cells. a recent study showed that il-29 is able to indirectly affect nk cells by regulating il-12 in macrophages. moreover, our recent studies have demonstrated that il-29 levels are higher in peripheral blood mononuclear cells (pbmcs) and serum and synovium from rheumatoid arthritis (ra) patients when compared to healthy individuals. recombinant il-29 enhances il-6, il-8, and matrix - metalloproteinases (mmps) production in ra fibroblasts and promotes ra inflammation. il-29 has also been shown to contribute to other immune diseases, such as systemic lupus erythematosus (sle) [11, 12 ], asthma, and psoriasis. however, the role of il-29 in inflammatory diseases remains largely unexplored and whether il-29 is involved in the pathogenesis of osteoarthritis (oa) is unclear. oa is one of the most common disorders and has traditionally been classified as a noninflammatory arthritis ; however, increasing evidence shows that synovitis and the immune system are also active players in oa development and progression. for examples, oa synovial fibroblasts (fls) contribute to oa pathogenesis by producing inflammatory cytokines such as tumor necrosis factor- (tnf-), il-1, and chondrolytic mediators such as mmps ; fls - derived il-1 and tnf- induce cartilage degradation. in addition, fls can mediate the innate immune response by responding to both inflammatory cytokines and toll - like receptor (tlr) ligands. we have shown that il-29 enhanced ra inflammation and mediated tlr activation in ra fls [1, 2 ]. oa and ra share some similarities in pathogenesis, such as chronic inflammation, synovial hyperplasia, articular destruction, and abnormal immune response., we examined the potential role of il-29 as a proinflammatory cytokine in oa disease. this study, for the first time, showed that il-29 was higher in blood and synovium from oa patients when compared with healthy controls (hc). recombinant il-29 increased the expression of proinflammatory cytokine in oa fls in vitro and promoted cartilage degradation in coculture of oa fls and cartilage explant ex vivo. finally, our studies revealed that the effect of il-29 on oa fls was likely mediated by nf-b and mapk signaling pathway. our present data support the hypothesis that il-29 may contribute to synovial inflammation and cartilage degradation in oa. recombinant human il-29 and il-1 were purchased from peprotech (rocky hill, nj, usa) ; rabbit anti - human il-29/il-28r polyclonal antibody and mouse anti - human cd68 monoclonal antibody were purchased from abcam (cambridge, ma, usa) ; mouse anti - human fibroblast growth factor - basic (fgf-2) monoclonal antibody was purchased from millipore (billerica, ma, usa) ; pe anti - human il-28r was purchased from biolegend (san diego, ca, usa) ; donkey anti - rabbit igg - r and goat anti - rabbit igg / tritc were purchased from santa cruz biotechnology (santa cruz, ca, usa) ; dylight488-conjugated affinipure donkey anti - mouse igg, peroxidase - conjugated sheep anti - rabbit secondary antibody, and peroxidase - conjugated sheep anti - mouse secondary antibody were purchased from jackson immunoresearch (west grove, pa, usa) ; human il-29 antibody was purchased from r&d systems (minneapolis, mn, usa) ; human il-29 enzyme - linked immunosorbent assay (elisa) reagent kits were purchased from adlitteram diagnostic laboratories (san diego, ca, usa) ; mmp-3 elisa kit was purchased from uscn life science inc. (wuhan, china) ; safranin o staining kit was purchased from sciencell research laboratories (carlsbad, ca, usa) ; primerscriptrt reagent kit was purchased from takara (dalian, china) ; power sybr green pcr master mix was purchased from applied biosystems (carlsbad, ca, usa) ; phospho - stat antibody sampler kit, phospho - c - jun n - terminal kinases (jnk), phosphoextracellular signal - regulated kinases (erk), phospho - p38, phospho - akt, phospho - p65, phospho - ib, and -actin antibody were purchased from cell signaling technology (beverly, ma, usa) ; tissue culture reagents including dulbecco 's modified eagle 's medium (dmem) and fetal bovine serum (fbs) were purchased from gibco (carlsbad, ca, usa). synovium and cartilage samples were harvested as surgical waste from 10 patients with end - stage symptomatic knee oa at the time of surgery for total knee replacement. blood samples were collected from 30 oa patients and 30 hc. the general characteristics of both patients and controls subjects are summarized in tables 1 and 2. oa diagnosis was determined by clinician assessment according to the american college of rheumatology (acr) criteria. usage of human tissues was approved by the ethical committee of the first affiliated hospital of nanjing medical university, and informed consent was obtained from all patients. blood samples were collected from peripheral veins and were processed within 1 h to provide serum for elisa analysis and pbmc for rna extract. knee synovial tissues (5 oa and 3 hc samples) were used for immunohistology analysis, and the remaining 5 oa synovial samples were prepared for cell culture experiments. synovial tissue was minced and digested with 1% collagenase ii at 37c for 4 h. oa fls were cultured in dmem medium supplemented with 10% fetal bovine serum (fbs), 100 u / ml penicillin, and 100 g / ml streptomycin at 37c in a humidified atmosphere of 5% co2 in air. purity of oa fls was determined by flow cytometry stained with antifibroblast marker (fgf-2). cells were used for further experiments if > 95% cells were positive for fibroblast marker. il-28r expression on cell surface was measured using flow cytometric analysis. in brief, oa fls (1 10) were harvested, blocked with 1% bovine serum albumin (bsa) for 30 min, and then stained with pe - conjugated il-28r for 25 min at room temperature in the dark. after washing 3 times with pbs, positive cells were determined using a bd facscalibur flow cytometer and cellquest software (bd biosciences). cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt) assay following our published procedures. briefly, oa fls (5 10) were incubated in a 96-well, flat - bottomed culture plate in a final volume of 200 l / well culture medium with il-29 (1, 10, and 100 ng / ml) for 72 h in a humidified atmosphere (37c at 5% co2). next, 20 l of cell proliferation reagent wst-1 was added to each well and incubated for a further 4 hours. after incubation, the absorbance was measured at 450 nm using an elisa plate reader (biotek, winooski, vt, usa). oa fls were stimulated with il-29 (1, 10, and 100 ng / ml) in the presence or absence of il-29 blocking antibody (1000, 2000, and 3000 ng / ml) for 48 h. after incubation, cells were collected for gene expression analysis by real - time pcr. in another set, oa fls were treated with 100 ng / ml il-29 for 0 min, 20 min, 40 min, and 60 min, respectively. oa cartilages were obtained from knee joint tissue and submerged in a solution with betadine and pbs (1 : 3) for 10 min and then rinsed with pbs with no any trace of betadine. after freeze - thaw three times at 80c to kill any live cell within the tissue, cartilages were stored at 20c and ready for use. oa fls were cultured in 24-well plate until being 90% confluent and changed to fresh dmem medium. then, the cells were treated with il-29 (1, 10, and 100 ng / ml) and il-1 (20 ng / ml, positive control). thawed cartilage tissues were diced to similar size and placed to each well including oa fls and il-29. cartilage, oa fls, and il-29 or il-1 were coincubated in dmem medium at 37c in a humidified incubator (5% co2/air). after 72 h incubation rna was transcribed into cdna in a 20 l mixture containing 1 g of total rna and primescript rt master mix (takara) according to the manufacturer 's instructions. quantitative real - time pcr was performed on applied biosystems 7900 ht instrument (applied biosystems, ca, usa) following our published procedures. human il-29 and mmp-3 in serum or culture supernatants were measured by elisa according to the manufacturer 's instructions. paraffin - embedded synovial tissues were sectioned, dewaxed, rehydrated, and stained following our published procedures. each slide was evaluated by one of the authors under the microscopy (nikon, japan). tissue sections were scored for staining of the lining on a 0 to 5 scale as reported. for each section, the number of positively stained cells was counted in 20 fields. after sectioning and deparaffin, the slides were stained with the safranin o staining kit to examine the cartilage loss according to the manufacturer 's instructions. in brief, the slides were stained in 0.1% fast green solution for 10 min, rinsed in 1% acetic acid for 15 sec, and stained in 0.1% safranin o staining solution for 30 min. after dehydration in ethanol and clearing in xylene, the slides were mounted and observed under microscope (nikon, japan). scored data were pooled, and the mean sem was calculated. for cells immunofluorescence staining, oa fls were seeded on cover slips and stained following our published procedures. briefly, oa fls were fixed in 4% paraformaldehyde for 10 min and permeabilized with 0.3% triton x-100 in pbs for 5 min. then, the cells were incubated with anti - human il-28r antibody overnight at 4c. after washing, the cells were further incubated with goat anti - rabbit igg / tritc for 1 h in room temperature. finally, the cells were washed and incubated with dapi staining solution for 1 - 2 min and analyzed by fluorescence microscopy (nikon, japan). il-28r was stained in red and nuclei were stained in blue. for tissue double immunofluorescence labeling, sections were incubated with a mixture of primary antibodies (rabbit anti - il-29 pab, mouse anti - cd68, or fgf-2 mab) at 4c overnight. after washing, the slides were further incubated with a mixture of donkey anti - rabbit igg - r and dylight488-conjugated donkey anti - mouse igg for 1 h. finally, the slides were washed and incubated with dapi staining solution for 35 min. images were acquired and processed digitally under the fluorescence microscopy (olympus, japan). the contained positive cells were stained in yellow and nuclei were stained in blue. for western blotting assay, cellular proteins were resolved by 8%10% sodium dodecyl sulfate - polyacrylamide gel electrophoresis (sds - page) and were transferred to polyvinylidene fluoride membranes (millipore, bedford, ma, usa). nonspecific interactions were blocked with 5% skim milk for 2 h and were then probed with phospho - stat 1/2/3/4/5/6, phospho - akt, phospho - p38, phospho - erk, phospho - jnk, phospho - p65, and phospho - ib. the signals were visualized with super signal west dura chemiluminescent detection reagents following the manufacturer 's directions (thermo fisher scientific inc., rockford, usa), and protein bands were scanned and quantified with the gel - pro analyzer software (bio - rad, ca, usa). the relative quantification of target proteins was calculated by comparison of the bands density levels between samples with image j software. all data were expressed as mean sem and analyzed with graphpad prism 6 software (graphpad software, la jolla, ca, usa). differences between two groups were performed with student 's t - test for parametric data and mann - whitney u test for nonparametric data. a p value of < 0.05 was considered significant. to investigate whether il-29 was involved in the pathogenesis of oa, we first examined the expression of il-29 mrna and its receptor il-28ra in pbmc. real - time pcr analysis revealed that mrna expression of il-29 and il-28ra was significantly higher in oa pbmcs when compared to hc (p = 0.0012 and 0.0017, resp. ; figures 1(a) and 1(b)). in serum, elisa analysis showed that il-29 was significantly higher in oa (25.26 3.34 pg / ml) than in hc (5.61 0.71 pg / ml, p < 0.0001 ; figure 1(c)). next, we assessed the expression and localization of il-29 and il-28ra in synovial tissues from 5 oa patients and 3 hc with immunohistochemical analysis. as shown in figure 2, il-29 and il-28ra are strongly expressed in the lining layer of oa synovial tissues (figure 2(a)), and semiquantitative analysis indicated that il-29 and il-28ra were significantly increased in oa synovium compared to hc (p = 0.0045) (figure 2(b)). because macrophages and fls are the major effector cells for inflammation in the infiltrated oa synovium, we next examined whether macrophages and fls can produce il-29 using double immunofluorescence staining. the specific antibodies against cd68 and fgf-2 served as markers for macrophages and fibroblasts, respectively. as shown in figure 2(c), il-29-positive cells were stained in red whereas cd68- or fgf-2-positive cells were stained in green, and positive cells for containing il-29 with cd68 or fgf-2 were shown in yellow. as expected, il-29 was strongly expressed in macrophages and fibroblasts in oa synovium, suggesting that these cells might be the important cellular sources of il-29 in oa synovium. immunofluorescence staining showed that il-28ra was expressed in oa fls (figures 3(a) and 3(b)), implying that oa fls may be the important target of il-29. il-29 at 1, 10, and 100 ng / ml did not affect the viability of oa fls after 72 h treatment (figure 3(c)). as shown in figure 4, il-29 induced a dose - dependent upregulation of il-1, il-6, il-8, and mmp-3 mrna in oa fls following 48 h incubation. furthermore, the action of il-29 on these cytokine expressions in oa fls was abolished by addition of il-29 blocking antibody at the concentration of 2000 and 3000 ng / ml. il-29 can stimulate proinflammatory cytokines expression in oa fls as shown in figure 4, and chronic inflammation is a major driver of ongoing cartilage damage and joint degeneration in oa pathogenesis. therefore, we chose a coculture model of oa fls with ex vivo cartilage explant to examine the influence of il-29 on cartilage degradation. after 72 h culture, safranin o / fast green staining of the cartilage in the coculture showed that glycosaminoglycan (gag) depletion (mean sem) was significantly greater in il-29 (100 ng / ml) (477.4 22.0 m) or il-1 (20 ng / ml) (717.4 20.9 m) treated conditions than that in the medium alone (154.4 7.1 m), indicated by the less intense red staining for safranin o and gag depletion deeper (figures 5(a) and 5(b)). in oa, cartilage damage is predominantly mediated by mmps and its specific inhibitors, the tissue inhibitors of metalloproteinases family (timps), most notably by mmp-1, mmp-3, mmp-13, and timp-1. we examined the ratio of mmp-1, mmp-2, mmp-3, and mmp-13 to timp-1 in the oa fls after 72 h coculture and found that il-29 could significantly upregulate mmp-1/timp-1, mmp-2/timp-1, mmp-3/timp-1, and mmp-13/timp-1 ratio at a dose - dependent manner in oa fls. we also measured mmp-3 levels in supernatant at 72 h incubation in this experiment. consistent with our finding in oa fls monocultures, there were higher levels of mmp-3 in oa fls / cartilage coculture system in response to il-29 at 100 ng / ml when compared to nontreatment control (figure 5(c)), similar to that stimulated by il-1 (20 ng / ml). these data imply that il-29 promotes cartilage degradation by stimulating protease production in oa fls. oa fls were stimulated with il-29 and the activation of downstream signal transduction pathways including canonical jak - stat and noncanonical mapk, akt, and nf-b pathways was evaluated (figure 6). following stimulation of oa fls for 20 min, 40 min, and 60 min with il-29 (100 ng / ml), phosphorylation of stat 1 (tyr701) and stat 5 (tyr694) ; jnk, erk, and p38 ; and p65 and ib was significantly increased when compared to nontreatment controls. no change in phosphorylation of stats 2 (tyr690), 3 (tyr705), and 6 (tyr641) and akt was observed in response to il-29. phosphorylation of stat 3 (ser727) and stat 4 (tyr693) was not detectable in oa fls. oa has traditionally been classified as a noninflammatory arthritis ; however, the accumulating evidences demonstrate that joint inflammation and synovitis play a critical role in the pathogenesis of oa. our study for the first time showed that il-29, a novel member of type iii interferon family, (i) was upregulated in blood and synovial tissues in patients with oa ; (ii) enhanced inflammation of oa fls and promoted cartilage degradation ; and (iii) activated mapk and nf-b signaling pathway. in the first case, we demonstrate an essential role of il-29 in inflammation in oa fls. we found that il-29 was abnormally elevated in pbmc, serum, synovial fluid, and synovium in oa patients. within the joint, il-29 and its receptor were located at fls and macrophages, two main cell types in the inflamed synovium responsible for the inflammation and cartilage and bone damage in the joint. abnormal il-29 was also found in ra, sle, gastric cancer, or other diseases. similar to ra, in this study, we did not find a significant correlation between il-29 in serum and oa disease activity (data not shown). the lack of a significant association may be due to the limited sample size and most of the patients having end - stage symptom of knee oa. thus, further prospective studies including a larger sample size and oa patients in early and late disease are needed to determine whether il-29 can serve as a biomarker for systemic inflammation and oa disease activity. we have reported that il-29 contributed to synovial inflammation by stimulating production of proinflammatory cytokines in ra fls. the proinflammatory effects of il-29 have also been shown on pbmc by upregulation of ifn - inducible protein-10 (ip-10), monokine induced by ifn- (mig), ifn--inducible t cell chemoattractant (i - tac / cxcl11), and il-8 [11, 18 ] and on t cells by downregulating th2 polarization and cytokine production [15, 19, 20 ]. soluble inflammatory factors such as cytokines are central to most inflammatory processes, and several cytokines have been implicated in oa pathogenesis including il-6 and il-8, tnf-, and il-1. indeed, our data showed that il-29 stimulated inflammatory cytokines il-1, il-6, and il-8 and production in oa fls, indicating that il-29 may contribute to oa inflammation. recent epidemiological studies on large number of oa patients suggested that an inflammatory synovium / synovitis was linked to increased cartilage damage and pain. fls, the major cellular constituent of the synovial membrane, are the main contributors to the inflammation and cartilage degrading mmp overproduction within the arthritic joint [11, 12, 22 ]. proinflammatory cytokines derived from fls including il-6 and il-8, tnf-, and il-1 could increase the production of mmps leading to cartilage damage. our data also showed that mmp-3 mrna was significantly increased in fls upon il-29 treatment ; hence, we further address the interaction between il-29, inflammation, mmp production, and cartilage degradation. the second novel finding of this study is that il-29 plays a critical role in cartilage degradation in oa. we used a coculture system to establish a direct link between il-29 and cartilage degradation. in this model, fls were cultured with oa cartilage explant to model inflammation - induced mmp production and cartilage degradation. our data showed that il-29 enhanced mmps / timp-1 ratio in oa fls and then resulted in marked increased gag depletion in cartilage. taken together, our data suggest an important role for il-29 in regulating cartilage degradation by driving cytokine and mmp production in oa fls. il-29 is thus capable of modulating one of the most important processes driving tissue degeneration in oa pathogenesis. it has been suggested that il-29 elicits signal transduction via activation of the canonical jak - stat pathway and other alternative pathways including akt and the mitogen - activated protein kinase (mapk) in a panel of cells [2325 ]. however, the ability of il-29 to trigger the pathways could be cell - type specific or altered in cells. the present study is the first to report the signal transduction pathways in response to il-29 in oa fls. in these cells phosphorylated stats form various homodimers and heterodimers, translocate to the nucleus, and induced il-29-specific biological activities, such as antiviral protection, antiproliferative response, and antitumor activities. and the most prominent biological function of il-29 resides in their ability to induce antiviral state in cells ; thus, the canonical jak - stat signal pathway is the major pathway involved in il-29-induced antiviral action, whereas the effect of il-29 on proinflammatory cytokines production in oa fls may be one key point for studying oa pathogenesis. it is therefore hypothesized that alternative signaling pathways could be more important in oa fls after il-29 stimulation. indeed, il-29 induced strong nf-b and mapk (p - jnk, p - erk, and p38) signal transduction in oa fls. however, whether these pathways are involved in il-29 mediated effects on oa fls has to be investigated in the further study with the inhibitors of these pathways. recent studies suggested that inhibitors of the above two pathways have received more attention in animal model studies and clinical trials in oa patients. collectively, our present data combined with these reports suggested that il-29-mediated inflammation was the pivotal function of il-29 in oa pathogenesis and inhibition of il-29 would be a potential therapeutic target in oa disease. in summary, this study provides the first evidence that il-29 is dysregulated in oa patients and may contribute to synovial inflammation and cartilage degeneration during oa pathogenesis by production of proinflammatory cytokine. further studies of the immunoregulatory effects of il-29 and its underlying molecular mechanism are warranted to understand the pathological role of il-29 in oa disease. | we have recently shown that il-29 was an important proinflammatory cytokine in pathogenesis of rheumatoid arthritis (ra). inflammation also contributes to the pathogenesis of osteoarthritis (oa). the aim of this study was to investigate the effect and mechanism of il-29 on cytokine production and cartilage degradation in oa. the mrna levels of il-29 and its specific receptor il-28ra in peripheral blood mononuclear cells (pbmcs) were significantly increased in oa patients when compared to healthy controls (hc). in the serum, il-29 protein levels were higher in oa patients than those in hc. immunohistochemistry revealed that both il-29 and il-28ra were dramatically elevated in oa synovium compared to hc ; synovial fibroblasts (fls) and macrophages were the main il-29-producing cells in oa synovium. furthermore, recombinant il-29 augmented the mrna expression of il-1, il-6, il-8, and matrix - metalloproteinase-3 (mmp-3) in oa fls and increased cartilage degradation when ex vivo oa cartilage explant was coincubated with oa fls. finally, in oa fls, il-29 dominantly activated mapk and nuclear factor-b (nf-b), but not jak - stat and akt signaling pathway as examined by western blot. in conclusion, il-29 stimulates inflammation and cartilage degradation by oa fls, indicating that this cytokine is likely involved in the pathogenesis of oa. |
patients with chronic obstructive pulmonary disease (copd) experience significant overall symptom burden, comparable to that observed in patients diagnosed with cancer.1 this symptom burden can be associated with impairments in health - related quality of life (hrqol),24 impaired functioning,5,6 and higher direct7 and indirect costs.79 copd treatments have shown effectiveness in reducing breathlessness and improving hrqol.1017 however, some patients continue to experience dyspnea despite treatment.18,19 moreover, this is critical given that recent studies suggest that the copd - associated burden is increasing globally and costs are increasing in tandem.20,21 the european lung white book estimates that, copd is responsible for 150,000 deaths and 1,691,000 disability - adjusted life years lost in europe, thus reinforcing the tremendous burden that copd exerts on society at large.22 in europe, copd is estimated to be responsible for 48.4 billion in health care costs and lost productivity each year, including an estimated 25.1 billion in indirect costs alone.22 of all the symptoms of copd, dyspnea is the most dominant and defining one.1 dyspnea is defined as a subjective experience of breathing discomfort that consists of qualitatively distinct sensations that vary in intensity.23 the discomfort associated with dyspnea has been shown to affect hrqol and health status.2427 in recognition of the prominent role of dyspnea in the assessment and management of copd, the global initiative for chronic obstructive lung disease (gold) strategy recommends the use of patient - reported severity of dyspnea as part of the patient classification system. the international group recommends the routine use of screening measures, such as the copd assessment test28 or the modified medical research council (mmrc)29 scale, to assess dyspnea among patients. such assessments require individuals to report the degree of activity that results in breathlessness (eg, walking up a flight of stairs) and correlate well with health status30 and longer assessment measures.31 despite the importance of self - reported dyspnea in the classification and treatment of copd, the degree of variation in burden in patients with symptomatic copd and the possible correlates of burden remain unclear. this is particularly true on an international level, whereby there exists a paucity of large - scale representative studies. the aim of this study was to characterize patients in europe currently being treated for copd according to their level of dyspnea in terms of sociodemographics, hrqol, work productivity impairment, and health care resource use assessed by patient reports. data were derived from the 5-eu 2013 national health and wellness survey (nhws ; n=62,000). the survey sample was representative of adults in france, germany, italy, spain, and the uk, in terms of age and gender ; all the data were self - reported. the protocol for the nhws was reviewed and approved by essex institutional review board (lebanon, nj, usa ; protocol number kh - nhes - eu13), and all respondents provided informed consent. in the current study, respondents aged 40 years and currently receiving prescription medication for copd, emphysema, and/or chronic bronchitis (hereafter referred to as copd) were included. patients with asthma were excluded from the selected group to ensure that dyspnea was a symptom of copd in the respondents rather than attributable to asthma. participants were categorized into lower and higher dyspnea groups using an item based on the mmrc scale and the gold categorization (mmrc levels 01 vs 2 ; see table 1 for the exact statements). sociodemographic and health characteristics included age, gender, body mass index (bmi), current smoking status, and years since copd diagnosis. the nhws asks respondents to indicate the conditions they have been diagnosed with from a list of conditions, and these were used to calculate the charlson comorbidity index (cci).32 health status of respondents was assessed through the revised short form-36 health questionnaire (sf-36)v2.33 this instrument is designed to report on eight health concepts (physical functioning, role physical, bodily pain, general health, vitality, social functioning, role emotional, and mental health). two summary scores were also calculated : physical component summary (pcs) and mental component summary (mcs) scores. the current study used the standard norm - based scores for both the individual health concept scores and the two - component summary scores as calculated by the scoring software provided by the scale developer. these scores have a mean of 50 and a standard deviation (sd) of 10 for the us population (no pan - european norms are available for scoring, and scores based on the us norms are commonly presented regardless of country).33 higher scores indicate better hrqol. the sf-6d preference - based health utility was also calculated from the responses to the sf-36v2 using uk general population values.34 the sf-6d index has interval scoring properties and yields summary scores on a theoretical scale of 01, with 1 indicating full health. impairment in work and non - work daily activities due to health in the past 7 days was assessed using the general health version of the work productivity and activity impairment questionnaire.35 employed respondents provided data for absenteeism (percentage of work time missed), presenteeism (percentage of impairment while at work), and overall work productivity loss (an estimate that combines absenteeism and presenteeism). all respondents indicated their level of activity impairment (percentage of impairment in daily activities because of health ; this refers to non - work activities and does not specifically refer to physical activity). health care resource use was captured by the number of health care provider (hcp) visits, emergency room (er) visits, and hospitalizations in 6 months prior to the survey. lower and higher dyspnea groups were compared on sociodemographic characteristics, general health characteristics, length of copd diagnosis, and outcomes by using an independent sample t - test for continuous variables and the chi - square test for categorical variables. subsequently, a series of regression analyses were conducted to compare the outcomes of the two dyspnea groups while adjusting for covariates. covariates included country, age (as a continuous variable), gender, marital status (married or living with partner vs not married), completion of a university degree (yes or no), employment status (full - time, part - time, or self - employed vs unemployed), household income (median split within country), bmi category (underweight, normal weight, overweight, obese, or decline to answer), smoking (current smoker, former smoker, or never smoked cigarettes), alcohol use (any vs none), exercise (self - reported as the number of days in the past month with vigorous exercise for 20 minutes ; coarsened to 0 vs 1 day), cci (continuous), and length of copd diagnosis (continuous). linear models were used for hrqol outcomes, and generalized linear models with a negative binomial distribution and a log - link function were used for outcomes that were not normally distributed, including work and activity impairment as well as health care resource use. data were derived from the 5-eu 2013 national health and wellness survey (nhws ; n=62,000). the survey sample was representative of adults in france, germany, italy, spain, and the uk, in terms of age and gender ; all the data were self - reported. the protocol for the nhws was reviewed and approved by essex institutional review board (lebanon, nj, usa ; protocol number kh - nhes - eu13), and all respondents provided informed consent. in the current study, respondents aged 40 years and currently receiving prescription medication for copd, emphysema, and/or chronic bronchitis (hereafter referred to as copd) were included. patients with asthma were excluded from the selected group to ensure that dyspnea was a symptom of copd in the respondents rather than attributable to asthma. participants were categorized into lower and higher dyspnea groups using an item based on the mmrc scale and the gold categorization (mmrc levels 01 vs 2 ; see table 1 for the exact statements). sociodemographic and health characteristics included age, gender, body mass index (bmi), current smoking status, and years since copd diagnosis. the nhws asks respondents to indicate the conditions they have been diagnosed with from a list of conditions, and these were used to calculate the charlson comorbidity index (cci).32 health status of respondents was assessed through the revised short form-36 health questionnaire (sf-36)v2.33 this instrument is designed to report on eight health concepts (physical functioning, role physical, bodily pain, general health, vitality, social functioning, role emotional, and mental health). two summary scores were also calculated : physical component summary (pcs) and mental component summary (mcs) scores. the current study used the standard norm - based scores for both the individual health concept scores and the two - component summary scores as calculated by the scoring software provided by the scale developer. these scores have a mean of 50 and a standard deviation (sd) of 10 for the us population (no pan - european norms are available for scoring, and scores based on the us norms are commonly presented regardless of country).33 higher scores indicate better hrqol. the sf-6d preference - based health utility was also calculated from the responses to the sf-36v2 using uk general population values.34 the sf-6d index has interval scoring properties and yields summary scores on a theoretical scale of 01, with 1 indicating full health. impairment in work and non - work daily activities due to health in the past 7 days was assessed using the general health version of the work productivity and activity impairment questionnaire.35 employed respondents provided data for absenteeism (percentage of work time missed), presenteeism (percentage of impairment while at work), and overall work productivity loss (an estimate that combines absenteeism and presenteeism). all respondents indicated their level of activity impairment (percentage of impairment in daily activities because of health ; this refers to non - work activities and does not specifically refer to physical activity). health care resource use was captured by the number of health care provider (hcp) visits, emergency room (er) visits, and hospitalizations in 6 months prior to the survey. lower and higher dyspnea groups were compared on sociodemographic characteristics, general health characteristics, length of copd diagnosis, and outcomes by using an independent sample t - test for continuous variables and the chi - square test for categorical variables. subsequently, a series of regression analyses were conducted to compare the outcomes of the two dyspnea groups while adjusting for covariates. covariates included country, age (as a continuous variable), gender, marital status (married or living with partner vs not married), completion of a university degree (yes or no), employment status (full - time, part - time, or self - employed vs unemployed), household income (median split within country), bmi category (underweight, normal weight, overweight, obese, or decline to answer), smoking (current smoker, former smoker, or never smoked cigarettes), alcohol use (any vs none), exercise (self - reported as the number of days in the past month with vigorous exercise for 20 minutes ; coarsened to 0 vs 1 day), cci (continuous), and length of copd diagnosis (continuous). linear models were used for hrqol outcomes, and generalized linear models with a negative binomial distribution and a log - link function were used for outcomes that were not normally distributed, including work and activity impairment as well as health care resource use. a total of 768 respondents met the inclusion criteria, of whom 245 (32%) were categorized in the higher dyspnea group. those in the higher dyspnea group were less likely to be employed (p=0.004), more likely to be obese (bmi 30 kg / m ; p=0.005), less likely to have exercised in the previous month (p0.05 ; table 4). total hcp visits and hospitalizations did not differ according to the level of dyspnea in unadjusted comparisons, although regression indicated an association of greater dyspnea with more self - reported er visits (p0.05 ; table 4). total hcp visits and hospitalizations did not differ according to the level of dyspnea in unadjusted comparisons, although regression indicated an association of greater dyspnea with more self - reported er visits (p<0.05). in the current study, approximately one in three patients currently using a prescription medication for copd reported levels of dyspnea consistent with symptomatic copd according to gold strategy (mmrc 2). more severe self - reported dyspnea was associated with significant impairments in general hrqol and work productivity, and these decrements in hrqol exceeded the 5-point threshold generally considered as the minimally important difference (mid) for general health, physical functioning, role emotional, role physical, and social functioning components of the 8-factor health profile. in addition, both the mcs and pcs scores exceeded the mid of 3 points, with adjusted difference in pcs score being more than twice the mid.33 impairment in daily activities was also markedly greater among patients with higher dyspnea, by 18% in absolute terms, and nearly 50% in relative terms. finally, those with higher dyspnea also reported higher rates of er visits compared to those with lower dyspnea after adjustment for covariates. the proportion of patients with significant dyspnea observed in this study is comparable or slightly lower than that in the european countries included in the continuing to confront copd survey.36 this survey included respondents not using a prescription for copd and did not exclude individuals with comorbid asthma, suggesting that it could have included some individuals whose dyspnea would have been resolved with medication or may be attributable to asthma. these new data suggest that the high rate of dyspnea among copd patients is present despite treatment and is not attributable to asthma. a recent study has shown that dyspnea can be a strong predictor of mental and physical outcome components of hrqol, even more so than the objective measures of lung functioning.37 indeed, a meta - analysis of the correlation between factors associated with disease - specific hrqol as measured by the st george s respiratory questionnaire among copd patients indicated dyspnea as one of the key correlates of hrqol,38 and the general relationship between dyspnea and hrqol has been demonstrated in a variety of studies ranging from longitudinal studies incorporating interviewer - administered scales39 as well as the mmrc and other self - report scales.25,4042 a particular contribution of the current study is the assessment of the relationship between dyspnea and the full 8-factor health profile of the sf-36v2, in addition to the more commonly reported summary measures derived from the instrument. the generic, rather than disease - specific, nature of the sf-36v2 also provides measures that can be compared across conditions, providing context to the nature and extent of the impairment relative to other diseases. the demographic characteristics of patients with copd did not differ markedly based on severity of dyspnea, although individuals who reported higher levels of dyspnea tended to be more often obese and were less likely to be currently employed. as such, the decrements in outcomes associated with dyspnea observed in the unadjusted comparisons are not likely to be due to group differences in personal characteristics. the groups continued to differ after adjustments for a broad range of sociodemographic and health characteristics, including bmi, comorbid medical conditions, and exercise, but as weight gain and lack of exercise may actually be the result of lower levels of physical activity due to dyspnea, the adjusted comparisons may be overly conservative. while the current study provides important insight into the experience of copd sufferers in europe using a large - scale representative survey, it is important to note the study limitations. the cross - sectional design of this study did not allow for causal attributions, although it seems much more likely that dyspnea is responsible for the decrements in hrqol than vice versa, and the relationship between dyspnea and hrqol remained after controlling for covariates. likewise, previous longitudinal research suggests dyspnea leads to lower hrqol across multiple domains.39 furthermore, the survey methodology employed did not enable patients diagnosis of copd to be confirmed, nor was information on patients treatment history or objective measures of lung functioning available. it is also possible that some of the dyspnea experienced by patients is attributable to conditions other than copd, such as congestive heart failure, though congestive heart failure was reported by a small minority of the respondents (11% and 4% of those with and without dyspnea, respectively ; data not presented) and was included in the regression analysis through the cci. these limitations, as well as the possible recall bias among the study participants, suggest caution in drawing firm conclusions. the findings of this study highlight the need for a complete assessment of dyspnea in patients with copd. this is important, as this symptom is associated with notable impairments in the patients ability to function across a multitude of hrqol domains. this is especially important in the context of patients with copd because, many european patients in the current study continued to experience dyspnea despite being treated with a prescription medication for it. the results of this study suggest that many patients experience higher levels of dyspnea despite treatment and that additional therapies and/or more intense treatment regimens should be considered. | objectivedyspnea is a defining symptom in the classification and treatment of chronic obstructive pulmonary disease (copd). however, the degree of variation in burden among symptomatic copd patients and the possible correlates of burden remain unclear. this study was conducted to characterize patients in europe currently being treated for copd according to the level of dyspnea in terms of sociodemographics, health - related quality of life, work productivity impairment, and health care resource use assessed by patient reports.methodsdata were derived from the 5-eu 2013 national health and wellness survey (n=62,000). respondents aged 40 years who reported currently using a prescription for copd were grouped according to their level of dyspnea as per the global initiative for chronic obstructive lung disease guidelines and compared on health status (revised short form 36 [sf-36]v2), work impairment (work productivity and activity impairment questionnaire), and number of health care visits in the past 6 months using generalized linear models with appropriate distributions and link functions.resultsof the 768 respondents who met the inclusion criteria, 245 (32%) were considered to have higher dyspnea (equivalent to modified medical research council score 2). higher dyspnea was associated with decrements ranging from 3.9 to 8.2 points in all eight domains of the sf-36 health profile after adjustment for sociodemographics, general health characteristics, and length of copd diagnosis ; mental component summary scores and short form-6d health utility scores were lower by 3.5 and 0.06 points, respectively. adjusted mean activity impairment (55% vs 37%, p<0.001) and number of emergency room visits (0.61 vs 0.40, p=0.030) were higher in patients with greater dyspnea.conclusionmany european patients with copd continue to experience dyspnea despite treatment and at levels associated with notable impairments in the patients ability to function across a multitude of domains. these patients may benefit from more intense treatment of their symptoms. |
in stroke patients with upper extremity paralysis, the affected arm can remain nonfunctional even at 6 months after disease onset in 66% of the surviving stroke patients1, 2. inappropriate motor unit recruitment appearing after stroke onset reduces the motor neuron firing rate, and increased muscle tone may cause severe paralysis3, 4. limited motor function of the upper extremity, and subsequent non - use and contracture may cause changes in the mechanics and biomechanics of the muscles over time5,6,7. nuclear chain fibers of the muscle spindle, responsible for the changes in muscle velocity, depend on the velocity of movement and hyperexcitability during a quick passive stretch to increase the tension level more and more. in contrast, the tendon, which softens the muscle contraction and adjusts the excessive muscle tone, is unable to function normally8. excessive muscle tone may affect the gross movement patterns caused by abnormal motor control. in addition, increased muscle tone significantly correlates with the limit of upper extremity motor function9, reduction in daily living activities10, and prolonged length of hospital stay11. data obtained by the biomechanical investigation of increased muscle tone would not only identify prognostic variables of functional recovery in stroke patients, but would also be helpful for promoting self - exercise to reduce the risk of hypertonia8. in addition, increased muscle tone has been identified as predicting the motor function of the upper extremity within 12 months after stroke onset12. a study of the correlation between recovery and increased muscle tone of the upper extremity in stroke patients suggested that the patients whose motor function of the upper extremity became relatively weaker within 48 hours after stroke onset would be 12.8 times more likely to experience hypertonia within 6 months than the patients with normal motor function8. in addition, the patients with severe arm paresis were > 10 times more likely within a month13, and > 22 times more likely within a year post - stroke to experience hypertonicity10. our previous study defined muscle tone as the degree of resistance during passive movement in 8 different directions13. however, this definition is too limited to determine in which muscle the hypertonicity might occur, and would have influenced the external validity of the study because patients without paralysis and patients with severely limited motor function of upper extremity were included as study subjects. furthermore, a 1 year follow - up study of stroke patients demonstrated the difficulty of predicting the risk of hypertonicity and identifying the patients whose hypertonicity could be prevented10. earlier prospective studies targeted chronic - stroke patients with disability from stroke for more than 12 months who showed little recovery of motor function. their findings were limited because the relationship between the motor function of the upper extremity and muscle tone was unclear. in addition, chronic - stroke patients do not recover functionally after spontaneous recovery and are likely to experience non - use syndrome as a result of long - time non - use, even though they learn how to acquire motor skills with the affected arm8, 10. however, few studies have investigated how the major impairments of chronic - stroke patients are related to the recovery of upper extremity motor function. this study investigated whether the degree of upper extremity motor function was discriminative in predicting the risk of hypertonia in chronic - stroke survivors who had experienced disability from stroke for more than 12 months, and analyzed the correlation between arm motor function and hypertonia to determine is predictive validity. forty - six chronic stroke patients were recruited and screened by research assistants using the following criteria. the participants were chronic stroke patients who were diagnosed with stroke for the first time > 12 months previously, who : 1) scored 24 or more in the mini - mental state examination, 2) had no secondary deformation due to musculoskeletal disease in the upper extremities, 3) had no unadjusted diabetes mellitus, 4) were able to flex their affected wrist joint 10 and actively move 2 fingers14, and 5) had no shoulder subluxation of a distance less than half of a fingerbreadth when the humeral head of the affected arm and subacromial space were palpated by the index finger without traction in a sitting posture15, 16. because upper extremity pain might have affected the examination results, a discrimination test of the pain degree was conducted through external rotation and abduction of the shoulder joint by placing the palm on the back (hand - behind - neck test)15, 17. a research assistant instructed participants to express their degree of pain verbally based on a numerical rating scale when their affected arm was moved passively18. pain of 5 on a visual analog scale in the hand - behind - neck test was considered the threshold value of probability and subjects reporting pain 5 were excluded from this study17, 19. forty - three chronic stroke patients who fulfilled the criteria participated in the study. the baseline characteristics of our subjects are shown in table 1table 1.characteristics of the participantscharacteristicsvaluesgender (male / female)23/20age (years)57.887.92duration after stroke (months)15.213.32affected side (left / right)24/19subtype of stroke (infarction / hemorrhage)29/14the values are presented as mean sd or mode. all the participants provided their signed informed consent after receiving an explanation of the purpose and procedure of the study. the values are presented as mean sd or mode the elbow flexor tone was assessed using the modified ashworth scale (mas). in most cases, a stroke patient s muscle tone is difficult to evaluate because abduction and external rotation of the shoulder joint decreases regardless of the presence of upper extremity muscle tone. therefore, the elbow flexor tone was selected because spasticity of the elbow flexor is common in stroke patients8, 15. for the test, the forearm was placed in the supine position with the patients sitting comfortably. to determine the scope of movement of the forearm, the assessor instructed the participants to relax comfortably when the elbow joint was fully stretched. thus, this study used a dichotomous variable 0 for mas 1 ; 1 for mas 1. muscle tone increased significantly when the patients with mas>1held an object and then released it compared with the patients with mas of 0 or 1. this value has a high inter - rater reliability (weight =0.770.96) and intra - rater reliability (weight =0. the motor recovery of the upper extremity was evaluated using the fugl - meyer (fm) assessment. the score for the upper extremity has a total possible score of 66, and the scores for the wrist and hand have a total possible scores of 24 ; their reported inter - rater (r=0.94) and intra - rater (r=0.99) reliabilities are also high21. the action research arm test (arat) was used to measure the limit of motor function in the affected arm. the inter - rater reliability of the test is r=0.99, and its test - retest reliability is r=0.9822. to help the subjects understand each examination, they were given verbal instructions or demonstrations 2 times, after which their sessions began with 2 minutes rest time between each session. pearson s correlation coefficient was calculated to investigate the correlation between variables, and the receiver operating characteristic (roc) curve was used to identify the cutoff values that could predict increased muscle tone (elbow flexor hypertonicity was mas1) for all examination tools. examination accuracy was measured by the area under the roc curve (auc) and classified as non - informative (auc=0.5), low accuracy (0.524 points). the effect is very high when d1.2, high when d > 0.8, and moderate when d has a value between 0.6 and 0.8. the correlations between hypertonia and the arm motor function variables are shown in table 2table 2.correlations between hypertonia and arm motor functionvariableshypertonia(mas1)fm - u / efm - wrist / handfm - ue0.72fm - wrist / hand0.34 0.78arat0.41 0.72 0.62significant, p24 score) ; arat : action research arm test (0=15.50 score, 1=>15.50 score) ; fm - wrist / hand : fugl meyer - wrist / hand (0=5.5 score, 1=>5.5 score). fm - ue was most influential in elbow flexor spasticity (mas1), and the probability that it would be higher than mas1 was 0.764 times greater in the subjects with fm - ue cutoff values 24 than in the subjects with fm - ue cutoff values > 24. the correlation between mas and arm motor function according to the fm - ue cutoff value is shown in table 5table 5.correlation between mas and arm motor function according to the cutoff value of fm - uevariablesfm - ue cutoff value(>24 score)(n=23)fm - ue cutoff value(24 score)(n=20)(mas 1)13 (56.52%)1 (5%)12.932(mas 1)10 (43.48%)19 (95%)fm - wrist / hand (5.5 score)4 (17.39%)18 (90%)22.572fm - wrist / hand (> 5.5 score)19 (82.61%)2 (10%)arat(15.50 score)1 (4.35%)18 (90%)31.823arat (> 15.50 score)22 (95.65%)2 (10%)significant, p24 score)(n=23)fm - ue cutoff value(24 score)(n=20)tcohen dfm - wrist / hand (score)11.136.742.802.025.314 1.27arat (score)35.7014.287.506.138.186 1.56significant, p 1.2 (very large), > 0.8 (large), 0.6 0.8 (moderate). fm - ue : fugl meyer - upper extremity ; fm - wrist / hand : fugl meyer - wrist / hand ; arat : action research arm test. the effect size was cohen s d1.27, suggesting that the better the proximal part function, the better the distal part function. mas : modified ashworth scale ; fm - ue : fugl meyer - upper extremity ; fm - wrist / hand : fugl - meyer - wrist / hand ; arat : action research arm test significant, p24 score) ; arat : action research arm test (0=15.50 score, 1=>15.50 score) ; fm - wrist / hand : fugl meyer - wrist / hand (0=5.5 score, 1=>5.5 score) significant, p 1.2 (very large), > 0.8 (large), 0.6 0.8 (moderate). fm - ue : fugl meyer - upper extremity ; fm - wrist / hand : fugl meyer - wrist / hand ; arat : action research arm test severe upper motor neuron damage not only slows down motor recovery but also aggravates characteristics such as hyperexcitability23. in stroke patients, increased muscle tone negatively correlates with motor function24. in the present study, elbow flexor tone was found to negatively correlate with fm - ue (r=0.72), fm - wrist / hand (r=0.34), and arat (r=0.41). in most stroke patients, the range of motion of abduction and external rotation in the shoulder decreases regardless of upper extremity muscle tone8, 15, and the gross movement patterns of shoulder flexion and internal rotation, forearm pronation, and elbow, wrist, and finger flexion make normal movement difficult12. in particular, excessive elbow flexor tone reduces the stability and mobility of the wrist and makes fine finger movement difficult5. previous studies have demonstrated that poor motor function predicts the risk of hypertonia8, 23. in the present study, the cutoff values for upper extremity motor function assessments that can predict hypertonia were identified as 24 for fm - ue, 5.5 for fm - wrist / hand, and 15.5 for arat. as a reference point that can predict the risk factors for hypertonia, the probability of mas1 is high for elbow flexor spasticity, and the auc were all at 76% or more, which was satisfactory. a previous study suggested that patients with fm - ue18 within 48 hours after stroke are 12.8 times more likely to experience hypertonicity (mas 1) within 6 months after onset than patients with fm - ue>186. using this cutoff value (fm - ue 18), a significant difference that could predict the risk of hypertonia fm - ue 18 could distinguish patients with increased hypertonicity (mas 1) with 68% sensitivity, which is lower than the 82% sensitivity of fm - ue 24, and could distinguish patients without hypertonicity with 64% specificity, similar to the 65% specificity of fm - ue 24. therefore, fm - ue 24 was used as the cutoff value to distinguish chronic - stroke patients with increased elbow joint flexor muscle tone, and these patients also had poor motor function of the upper extremity, because the gross movement patterns including internal rotation of the shoulder and flexion of wrist and finger appeared when holding or manipulating an object with their hands. limited arm motor function in chronic - stroke patients can increase the risk of severe hypertonia, but various factors such as individual physical characteristics, specific treatment, and life habits can also influence muscle tone5. in addition, the subjects had experienced disability due to stroke for 15.21 months on average after onset, but the motor function of the upper extremity had improved through self - effort and treatment. our fm - ue cutoff value was 6 points higher than that of a previous study indicating that spontaneous recovery can no longer be expected in patients with disability for 15 months after stroke onset ; however, because the effect size of the intervention and spontaneous effort is high, their condition can be improved. by examining the risk of hypertonia using the cutoff value of arm motor function in the present study, elbow joint flexor hypertonicity (mas1) was found to be most influenced by fm - ue, and when the fm - ue cutoff value was 24, it is likely to increase with a probability of 0.764 times (odds ratio) compared with subjects with fm - ue cutoff values > 24. fm - wrist / hand and arat are largely used to examine the distal upper extremity and thus can not be used to predict the risk of hypertonia. the subjects showed difficulty with hand functions such as manipulation, grip, pinch, and release ; therefore, their fm - ue, fm - wrist / hand, and arat scores were lower. in fm - ue, the scores of the forearm, wrist, and hand (finger)-related items were not high, suggesting that the characteristics of the tool used to examine the distal upper extremity are most influential for elbow flexor tone. in the examination of upper extremity motor function, most subjects showed relatively high wrist joint and elbow flexor tone and, in particular, it is said that appropriately releasing an object is more difficult than gripping or holding an object25. for the upper extremity function, the fingers, hand, and wrist need to cooperate and selectively adjust. the muscle paralysis caused by central nervous system damage is more influential in distal than proximal parts and delays recovery26. fm - wrist / hand and arat showed significantly lower scores in predicting elbow flexor spasticity. elbow flexor spasticity is a common phenomenon, and excessive elbow flexor tone prevents appropriated coordination of elbow extension, inhibiting the stability and movement of the hand and wrist. when elbow joint flexor hypertonicity is present, sophisticated movement of the hand is impossible due to the lack of stability in the elbow joint. in addition, the rubrospinal tract is responsible for the arm stability, external support, and arm strength use to control the hand, and the corticospinal tract also plays a role in elbow flexion. thus, it provides the basic background that enables sophisticated movements such as holding, gripping, and manipulating because it regulates the stability of the elbow and wrist and harmonious coordination with the extensors. recovery after stroke is more rapid in the proximal than in the upper distal parts, seemingly because the elbow subluxation, impingement syndrome, supraspinatus tendinitis, and biceps tendinitis that commonly occur in stroke patients is influential in elbow flexor spasticity. given that the coordination of elbow flexors and extensors in the movement of upper distal parts is an essential factor for forearm, wrist, and finger movements, it can be deduced that elbow flexor spasticity has a negative impact on upper extremity movement in stroke patients, and rotator cuff muscle and elbow extensor weakening form the upper extremity flexor pattern. when muscle tone is mas 1, muscle resistance during passive stretch increases more than for mas of 0 or 1, and the mechanical characteristics of the muscle change due to reflex hyperexcitability that may lead to contracture5, 8. therefore, the elbow flexor is clinically useful for examining the muscle tone of the upper extremity8. an appropriate elbow flexor tone makes coordination with the elbow extensor possible, provides stability to the joint s distal parts, and allows appropriate wrist and finger movements27. moreover, better motor function in the proximal parts of the upper extremity means there is less risk of increased muscle tone and better motor function in the distal parts of the upper extremity. better stability in the proximal part of the shoulder (fm - ue>24) implies a lower elbow flexor tone and better distal part function of the upper extremity. the sample size was too small to generalize the results, and there were limitations in the definition of spasticity and determining whether elbow flexor hypertonicity reflects the typical characteristics of upper extremity muscle tone. however, given that coordination of the elbow flexors and extensors is an essential factor in forearm, wrist, and finger movement, it can be said that elbow flexor spasticity negatively influences the upper extremity movement of stroke patients. therefore, further studies need to quantitatively investigate the impact of shoulder subluxation and pain degree on muscle tone and study the correlation between elbow flexor activity and amplitude and the muscle tone as well as analysis of upper extremity movement biomechanics. | [purpose ] muscle tone is known to predict the motor function of the upper extremity within 12 months after onset in stroke survivors. the aim of this study was to investigate whether motor function of the upper extremity can predict the risk of hypertonia in chronic stroke survivors, and to analyze the correlation between the two variables to determine the predictive validity. [subjects and methods ] forty - three chronic stroke survivors were assessed using the modified ashworth scale (mas) for elbow flexor tone, the fugl - meyer assessment of the upper extremity (fm - ue), and the action research arm test (arat) for upper extremity motor recovery and function. [results ] elbow flexor tone (mas1 +) increased by 0.246 compared with the baseline muscle tone even at month 12 and appeared to negatively affect the motor function of the upper extremity. the cutoff value for predicting muscle tone (mas1 +) was 24 for fm - ue and 15.5 for arat. fm - ue had the biggest impact on elbow flexor tone (mas1 +), and the risk of elbow flexor hypertonia (mas1 +) increased 0.764-fold for a cutoff value of fm - ue24 compared with a cutoff value of fm - ue>24. [conclusion ] the results show that the most important variable for predicting muscle tone of the elbow flexor in stroke survivors is the fm assessment of the upper extremity. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.