Datasets:

danieladeeko
/

proccessed_ccdv

Dataset card Data Studio Files Files and versions Community

Split (3)

train · 120k rows

article stringlengths 0 682k	abstract stringlengths 146 3.69k
splenectomy is the preferred treatment for many hematologic diseases and is a necessary skill for any surgeon. in the early 1990s laparoscopic splenectomy (ls) took shape as a viable alternative to open surgery (os) and quickly became the standard of care for many splenic disorders. previously published data have shown that ls is associated with decreased postoperative pain ; shorter recovery time ; decreased blood loss ; and decreased pulmonary, wound, and infectious complications. a report published in 2009, based on cases recorded in the nationwide inpatient sample (nis) database, demonstrated that from 1998 through 2006 only 8.8% of splenectomies were performed with a laparoscopic approach, with no single year having greater than 12% of splenectomies performed laparoscopically. we used more recent data to update these statistics and identify any trends in the use of ls in the united states. the nis was queried for both oss and lss performed from the beginning of 2005 through 2010. the icd-9 diagnostic and procedure codes that were included covered all splenic diseases, abdominal pain diagnoses (789.00, 789.02, 789.07, and 789.09), and procedure codes (41.5 for splenectomy). laparoscopic peritoneoscopy (54.21) and laparoscopic enterolysis (54.51) were used to capture the laparoscopic cases. we excluded partial splenectomies and those performed for traumatic injury and vascular anomaly and as part of a pancreatectomy. the remaining patients were examined for age, comorbid conditions, and conversion to open splenectomy (cs). we then evaluated for postoperative complications, including deep vein thrombosis, pulmonary embolus, hemorrhage, portal vein thrombosis, postoperative pneumonia, cardiac complications, stroke, shock, renal failure, wound dehiscence, fistula, mortality, and length of stay. the top 8 admitting diagnoses leading to splenectomy were identified (table 1). a bivariate logistic regression was then performed to evaluate for factors that predicted morbidity, mortality, and conversion to an open procedure. statistical analysis was performed with spss (ibm corporation, armonk, ny, usa). statistical significance was calculated with the t test or, as appropriate, with significance set at p <.05. indications for splenectomy other diagnoses include : essential thrombocythemia, myelodysplastic syndrome, abdominal pain, sezary 's syndrome, evans ' syndrome, thrombocytopenias and reticulosarcomas of the spleen. of the total cases, 30,108 (81.4%) patients had an open splenectomy (os) and 4938 (13.3%) had a successful ls. the most common indication for splenectomy was idiopathic thrombocytopenic purpura (itp) with 10,554 (28.5%) cases (ls, 2144 ; os, 7,909 ; cs, 501). in 2007, the highest number of splenectomies was performed (n = 7050) with 1428 (20%) attempted laparoscopically and 420 (29.4%) converted to open.. annual breakdown of splenectomies from 2005 through 2010 the baseline characteristics of the patients were analyzed, and significant differences were found in 13 of the 14 queried factors (table 3). the cs group had significantly higher rates of hypertension (34.95%), diabetes mellitus (18.62%), hyperlipidemia (6.68%), obesity (8.83%), sleep apnea (3.83%), and mild (5.26%) or severe (7.3%) liver disease than those in the other 2 groups. the os group had significantly higher rates of coronary artery disease (7.81%), congestive heart failure (4.78%), smoking (10.74%), copd (7.45%), and chronic kidney disease (3.66%). univariate analysis of baseline characteristics sex was not recorded in the database for some of the patients. the ls group had a lower rate of morbidity (7.37%) when compared to that in the os (10.39%) and cs (14.59%) groups. when compared to os, ls resulted in a significantly lower postoperative incidence of deep vein thrombosis (0.6% vs 0.93%), hemorrhage (2.49% vs 3.31%), portal vein thrombosis (0.12% vs 0.55%), pneumonia (1.34% vs 2.45%), shock (0% vs 0.49%), infection (0.91% vs 1.43%), fistula (0% vs 0.11%), overall morbidity (7.37% vs 10.39%), and mortality (1.32% vs 2.53%). when compared to cs, successful ls results showed fewer postoperative incidences of deep vein thrombosis (0.6% vs 1.28%), hemorrhage (2.49% vs 9.29%), shock (0% vs 0.51%), and overall morbidity (7.37% vs 14.59%). there was no significant difference in the mortality rate between patients who underwent ls and those who had cs (1.32% vs 1.28% ; ns). <.05) and decreased overall morbidity (10.39% vs 14.50% ; p <.05) when compared to those who whose laparoscopic procedure was converted to open. patients who underwent cs had lower rates of postoperative portal vein thrombosis (0.20% vs 0.55%), pneumonia (1.43% vs 2.45%), and mortality (1.28 vs 2.53%) when compared to those who underwent os. length of stay was significantly less in the ls group when compared to that in both the os and cs groups. the results revealed that autoimmune hemolytic anemia (odds ratio [or ] 1.36 ; p =.002), nonsplenic lymphoma (or 1.83 ; p <.001), splenomegaly (or 1.30 ; p =.007), and hemorrhage (or 3.23 ; p <.001) increased the risk for conversion to os (table 4). bivariate logistical regression analysis of factors that led to conversion to open surgery comorbid conditions significantly associated with an increased risk of death were chronic obstructive pulmonary disease (or 2.22 ; p <.005), peripheral vascular disease (or 2.15 ; p <.005), chronic kidney disease (or 2.58 ; p <.005), congestive heart failure (or 4.44 ; p <.005), and severe liver disease (or 5.59, p <.005). smoking, obesity, hypertension, and mild liver disease were not associated with increased postoperative mortality (table 5). bivariate logistical regression analysis of comorbid conditions that increased the risk of mortality postoperative complications that portended an increased risk of death were identified by using bivariate logistical regression. pulmonary embolus (or 1.91 ; p = 0.033), infection (or 2.53 ; p <.005), hemorrhage (or 3.25 ; p <.005), wound dehiscence (or 4.85 ; p <.005), cardiac complications (or 4.98 ; p <.005), and shock (or 11.38 ; p <.005) were found to significantly increase the risk of death after splenectomy (table 6). bivariate logistical regression analysis of postoperative complications that increased the risk of mortality postoperative morbidity associated with the method of splenectomy was analyzed by bivariate logistical regression, and cs (or 2.45 ; 95% ci 2.0582.906 ; p <.005) and os (or 1.61 ; 95% ci 1.4221.817 ; p <.005) were found to increase the risk when compared to ls. although there has been a modest increase in the percentage of lss, the overall rate remains low, relative to other advanced laparoscopic procedures (table 7). the average rate of successful lss during the study period was 13.4% (range, 10.6%16.2%). there was a small but significant increase in the rate of completed lss over the study period. the rate is significantly higher when compared to nis data from 1998 to 2006 (8.8% vs 13.4%, p <.05). published rates of conversion among basic and complex laparoscopic procedures we also found a high rate of conversion from laparoscopic to open surgery. for example, laparoscopic colectomies and laparoscopic bariatric procedures have, at most, a reported conversion rate of 15.8% and 2.2%, respectively (table 7). our data suggest that bleeding and splenomegaly are intraoperative events that can lead to increased conversion, with ors of 3.23 and 1.3, respectively (table 6). in addition, the overall low number of splenectomies being performed may limit the development of the skill and familiarity needed for ls to be performed more often. the data analysis shows that ls was associated with fewer postoperative complications, lower mortality, and a shorter length of stay when compared with the outcomes of os and cs. morbidity was highest in the cs group (14.6%) and was associated with a higher rate of hemorrhage (9.3%). mortality was significantly lower in the ls group when compared to that in the os group (1.32% vs 2.52% ; p <.001). despite the potential for significantly reduced morbidity, mortality, and length of stay a specific reason for this can not be determined from the database, but it may be related to the surgeon 's skill and comfort in performing the procedure, the relative scarcity of splenectomies overall, and the challenging anatomy and pathophysiology that can coexist in a patient. thrombocytopenia and splenomegaly are frequently encountered when performing splenectomy and, although challenging, the ls approach has been shown to be safe and associated with decreased length of stay, transfusion requirements, and mortality compared to those factors with os. we must emphasize that patient safety is paramount, and if the surgeon elects to use an open procedure or converts to open, it should not be viewed as a failure. to increase the number of cases being completed laparoscopically and decrease the conversion rate, we suggest that fellowship - trained, advanced laparoscopic surgeons perform ls in most instances. it has been shown that the addition to a general surgery practice of a physician who is fellowship - trained in minimally invasive surgery increases the proportion of procedures that are completed laparoscopically. the advanced surgical training acquired during fellowship promotes meticulous dissection techniques, as well as a greater comfort level with the minimally invasive approach for more complex procedures and confidence in managing intraoperative complications without converting to open surgery. as the number of fellowship - trained, advanced laparoscopic surgeons increases, we anticipate that more lss will be successfully completed. however, the technical challenges associated with ls can not be underestimated. even in the most experienced hands, this decision obviously requires consideration of the given disease process, individual patient factors, and intraoperative findings. the nis database used in this study (it was redesigned in 2012) is a record of data compiled from discharge and procedural diagnoses across 1000 hospitals of all types and sizes and in all types of locations. it is designed to capture data on a sample of 20% of the patients across the united states. it is dependent on the coders of the institution who base their codes on chart documentation. there is also a lack of standardization among some complications, which contain unquantifiable data such as hemorrhage. although the nis is a robust database, it is retrospective and nonrandomized, thus allowing the data to be marred with selection and input biases. although ls is regarded as the most desired approach, it remains underused for reasons that remain unclear. the rate of conversion to an open procedure in splenectomies is the highest among advanced laparoscopic procedures ; splenomegaly and hemorrhage predict a conversion.	background and objectives : laparoscopic splenectomy (ls) has been shown to offer superior outcomes when compared to open splenectomy (os). despite the potential advantages associated with the minimally invasive technique, laparoscopy appears to be underused. we sought to evaluate the nationwide trends in ls.methods:the nationwide inpatient sample (nis) database was queried for both os and ls procedures performed from 2005 through 2010. partial splenectomies and those performed for traumatic injury, vascular anomaly, or as part of a pancreatectomy were excluded. the included cases were examined for age of the patient and comorbid conditions. we then evaluated the postoperative complications, overall morbidity, mortality, and length of hospital stay.results:a total of 37,006 splenectomies were identified. of those, os accounted for 30,108 (81.4%) cases, ls for 4,938 (13.3%), and conversion to open surgery (cs) for 1,960 (5.3%). the overall rate of morbidity was significantly less in the ls group than in the os group (7.4% vs 10.4% ; p <.0001). the ls group had less mortality (1.3% vs 2.5%, p <.05) and a shorter length of stay (5.6 8 days vs 7.5 9 days).conclusions : despite the benefits conferred by ls, it appears to be underused in the united states. there has been an improvement in the rate of splenectomies completed laparoscopically when compared to nis data from the past (8.8% vs 13% ; p <.05). the conversion rate is appreciably higher for ls than for other laparoscopic procedures, suggesting that splenectomies require advanced laparoscopic skills and that consideration should be given to referring patients in need of the procedure to appropriately experienced surgeons.
the prevalence of overweight among danish children aged 68 years was 15% and 21% among boys and girls, respectively. ideally, the prevention of childhood overweight and obesity should begin as early as possible, which may even be before birth. changes to the intrauterine environment, caused by stress or malnutrition of the mother during pregnancy, may modify fetal metabolism by influencing regulatory hormonal pathways. such disturbances may persist after fetal life and affect the growth and health of the child. psychosocial factors such as maternal distress during pregnancy, physiological or psychological, increase the release of glucocorticoids (cortisol). cortisol may be passed on from the mother to the child through the placenta and potentially affect the developmental processes of the child. expecting mothers who reported higher levels of stress or who worried about their pregnancy were found to have higher levels of salivary cortisol measured in the evening. measures of maternal stress during pregnancy have been associated with later health of the child including the risk of offspring pediatric disease, cerebral palsy, astma (in boys only), and type 1 diabetes, but not with epilepsy or autism. also maternal bereavement due to loss of a relative, either while pregnant or one year before conception, has also been linked to childhood overweight but it is not known if this association is present at lower maternal stress levels. we investigated whether children of mothers, who felt anxious, depressed, stressed, or worried while pregnant, had a higher risk of overweight at 7 years of age. since different hormonal changes during pregnancy may potentially trigger different expressions in boys and girls, we also took into account the sex of the child. the study was based on the danish national birth cohort (dnbc), which was established from 1996 to 2002 where 100,419 pregnancies were enrolled from a total of 92,276 mainly scandinavian women. a description of the enrolment and design has previously been published. computerised telephone interviews at approximately gestational weeks 16 and 30 and when the child was 6 and 18 months old were used to obtain information about prenatal exposures, maternal health, use of medicine, lifestyle, and the health and development of the child. the questionnaires to the women contained a specific protocol for the interviewer to follow to generate uniformity across the different interviewers. a 7-year follow up was completed in spring 2011 and consisted of a web - based or posted questionnaire about the health, lifestyle, and development of the child including weight and height. for the present study, mothers and their offsprings were included if they had participated in the 7-year follow up (n = 53,838). we excluded children with missing data on height, weight, or date of height and weight measurement and children with more than 30 days between measurement of height and weight (n = 4,592). we also excluded twins and triplets (n = 828), and for mothers who participated with more than one child in the cohort, all other children than the firstborn within the study period were excluded (n = 4,814). children born before gestational week 37 (n = 1,723), children born to mothers with diabetes (n = 427), and children whose mothers had not participated in the early and late pregnancy interview (n = 3,690) were also excluded. all participants provided informed written consent and the study was approved by all of the scientific ethics committees in denmark and by the danish national data protection agency. the mothers ' report of feeling anxious, depressed, or stressed during pregnancy was considered the main exposure. it was based on nine questions (table 1) from the second pregnancy interview in approximately gestational week 30 (interquartile range 2933). the six questions about anxiety and depression originated from the validated symptoms checklist-92 (scl-92) [15, 16 ] and had originally five answer categories but only three were used for the women in the dnbc. for each woman, a likert score was generated by summing the scores for each of the three questions for anxiety and depression (not at all = 0, a little = 1, and a lot = 2). the reliability of the questions was assessed using cronbach alpha coefficients. for anxiety and depression the three questions about stress originated from the validated general health questionnaire 60 (ghq60) with an original four answer categories where 0 = better than normal, 1 = same as normal, 2 = worse than normal, and 3 = much worse than normal. it was therefore decided to generate a stress score as follows 1 = not at all, 2 = a little, and 3 = a lot, which had a cronbach alpha of 0.42. a combined measure of distress was generated as a combined added score for all nine questions and had a cronbach alpha of 0.74. for all four variables, the women were divided into two groups according to the cut - off value closest to the 80th percentile thus women exceeding this cutoff will be referred to as feeling anxious, depressed or stressed. however, for anxiety, only 11.7% of the mothers belonged to the high exposure category, because a large group of women had a sum score of 2, which prevented us from using the 80th percentile to define the high exposure category. therefore, being anxious was a less inclusive measurement than measures of depression and stress. maternal worrying was based on two questions : worrying about the birth or worrying about the unborn child. they were asked both in the early and late pregnancy interview and the mother was categorized as worried, only if she answered yes at both points in time. support from surroundings regarded the mothers contact to family members by phone or in person with every day or several times a week categorized as often. socioeconomic status was based on the education and job situation of both the mother and the father and defined as the highest level within the couple. it was categorized in three groups : leaders and parents with higher education was categorized as high, parents with intermediate length of education as intermediate, and unemployed or uneducated parents as low. for each child, the body mass index (bmi) (kg / m) was calculated using the weight and height of the child, which were either measured by the parents, the general practitioner, or the school nurse. it was up to the parents to choose which earlier measured weight and height they would record in the questionnaire and therefore some chose measures taken by the general practitioner at the 5-year health examination. the age span of the children was 58 years with 80% being 7 years old. childhood overweight, was defined by using the sex and age - specific bmi references proposed by cole., where the 95 percentiles at any given age were used as the cut - off point for overweight. the cut - off points for overweight were 17.92 kg / km and 17.75 kg / km for boys and girls, respectively. additional factors associated with childhood overweight were chosen a - priori based on the available literature. information about parity, maternal prepregnancy bmi, smoking and recreational exercise during pregnancy came from the early pregnancy interview. information about gestational weight gain and duration of breastfeeding came from the interview 6 months postpartum. firstly, we examined maternal characteristics according to maternal distress and childhood overweight by using the chi - square test. next, we used multiple logistic regression models to estimate odds ratios for the association between maternal distress and other psycho - social factors and overweight of the children at 7 years of age. in the first adjusted model, we controlled for ; age, parity, prepregnancy bmi, smoking during pregnancy, and socioeconomic status. in a second adjusted analysis, we also controlled for breastfeeding, gestational weight gain and recreational exercise of the mother. for one of the distress variables (anxiety), we found a significant difference in overweight between boys and girls. we therefore added an interaction term to the model so that the results could also be shown separately for boys and girls. results are presented with 95% confidence intervals and p values below 0.05 were considered statistically significant. all analyses were carried out using the statistical computer programme stata (version 10 stata corp, 4905 lakeway drive, college station, tx 77845, usa). distress during pregnancy was reported in 12.3% of the mothers with 11.7% of them feeling anxious, 17.9% depressed, and 20.6% stressed. mothers who were less than 25 years old, singles, smokers, or gained more than 20 kg during pregnancy were more likely to feel anxious or depressed. mothers who had given birth before more often reported feeling depressed and stressed than primiparous mothers. the mean bmi of the children in the study population was mean 15.7 (sd 1.7), and the prevalence of overweight children was 9.9%, 8.7% in boys and 11.5% in girls. mothers who were overweight or obese before pregnancy or had a large gestational weight gain more often had overweight children. also, mothers of overweight children were slightly younger, more often multiparous, smokers, or of medium or low socioeconomic status. further, they were less likely to exercise during pregnancy and they breastfed their children for at shorter period. in the adjusted analyses, we found no association between maternal distress during pregnancy and the risk of overweight in the child (or 1.06 (0.96 ; 1.18)) (table 3). in boys, a modest increased risk of overweight was indicated (or 1.15 (0.99 ; 1.33)) but not in girls (or 0.98 (0.85 ; 1.13)). the same pattern was observed when analysing feelings of anxiety, depression, or stress separately. adding adjustment for breastfeeding, gestational weight gain and recreational exercise of the mother to the model only let to minor changes in the estimates (results not shown). a modest increased risk of childhood overweight was seen in children of mothers who worried during pregnancy about the birth or the health of the child (or 1.10 (1.00 ; 1.22)) and estimates were similar in boys and girls. lack of social support seemed to be slightly protective against childhood overweight (or 0.93 (0.82 ; 1.04)) whereas children of mothers of low or medium socioeconomic status had an increased risk of overweight. only in the analysis of anxiety did we find that the sex of the child seemed to modify the association with childhood overweight (p = 0.05). in this population of women, we did not find maternal distress during pregnancy to be clearly associated with childhood overweight in the offspring at 7 years of age. neither did separate measures for maternal feelings of anxiety, depression, and stress support any association. it was a biologically plausible hypothesis that maternal distress during pregnancy may cause childhood obesity due to alterations of the metabolism of the child (25). studies investigating the associations between prenatal distress and childhood overweight are, however, scarce. in a recent study by li., maternal bereavement, due to loss of a child or husband, was associated with childhood overweight, and most strongly for losses happening before conception than during pregnancy. losing a child or husband causes severe distress and sadness in a pregnant mother, whereas the levels of distress measured in our study were more commonly experienced feelings of anxiety, depression, and stress and not caused by an identified specific event. moreover, the exposure contrast in our cohort may be relatively low due to the healthy nature of the women who were of higher socioeconomic status and had better outcomes than the general pregnant population in denmark. thus, the relatively mild measurement of distress (emotional stress) compared to a more severe type of bereavement may play a role for the contrast of the exposure in this study. on the other hand, in the study by li., the association between bereavement and offspring overweight did not show up until the children were around 10 years of age. so, our finding of little association between distress during pregnancy and overweight of the children at 7 years of age is to some extent in agreement with this study. gender - specific effects may exist as hormonal changes during pregnancy due to maternal distress may lead to different expressions in boys and girls and result in different disease profiles. our study indicated a minor gender difference in the association between maternal distress and childhood overweight as boys had a modest increased risk and girls did not. however, this finding was not statistically significant and needs to be replicated in other data sources. children of mothers who tended to worry during pregnancy had a slightly increased risk of overweight. possibly, the same mechanisms as with maternal distress are at play or it may be that these mothers are more protective of their children. however, a previous study in the same cohort of feelings of distress, covering anxiety, depression, and stress during the first 6-month postpartum did also not find an increased risk of childhood overweight. although parenting strategies may differ depending on levels of distress, it does not seem to be of clinical importance. our results also indicate that children of women with lack of social support had a small decreased risk for overweight. the availability of the dnbc with its prospective design and detailed data collection presented a unique opportunity to study the associations between maternal distress during pregnancy and childhood overweight. due to the large size of the cohort, the statistical precision was high so it should be possible to detect true relevant associations. this may cause misclassification of the exposure, but since the mothers had no knowledge of the later weight status of their child at the time of the pregnancy interview this is not likely to cause serious bias and if so, would most likely underestimate the effect. the classification of distress is important as stressor - specific pathways may differ between the different types of stress. previously studied different types of stress in the same cohort and found emotional stress and life stress, associated with different types of diseases in the offspring. we analyzed both combined and separate measures of maternal distress, which is measured like tegethoff. neither did we find life stress to be associated with childhood overweight in separate analyses. childhood overweight of the child was based on self - reported information from the parents on weight and height of the child, who was measured either by the parents, the general practitioner or the school nurse. we expect some measurement error, but unrelated to the level of maternal distress during pregnancy and therefore it should not cause any serious misclassification bias, but only attenuate the associations under study. this was also supported by a validation study in 1200 children participating in the 7-year follow up, which found no systematic errors. to reach the final study population, we excluded approximately 40% of the women who initially participated in the pregnancy interviews because they did not participate in the 7-year follow up. a recent study found that participants in the 7-year follow up were more often of high socioeconomic status and healthier. we also confirmed this finding in sub analyses of our data and moreover found mothers who reported to be anxious, depressed, or stressed during pregnancy to be less likely to participate in the follow up. we have no data to investigate this, but believe this problem is minor as for similar exposure - outcome associations, based on participation in the 7-year follow up, such bias appeared to be small. the etiology of childhood overweight is still poorly understood. in conclusion, this study in a generally healthy population of scandinavian women did not provide evidence to the hypothesis that prenatal maternal distress causes childhood overweight. further studies with more exact measures of psychosocial distress, continuous measures of distress, and in populations with higher stress levels are needed to perhaps find a threshold as to when more commonly experienced distress in the mother during pregnancy may cause childhood overweight and obesity.	background. maternal distress during pregnancy increases the intrauterine level of glucocorticoids, which may have long - term health consequences for the child. objective. to examine if distress as a combined measure of anxiety, depression, and stress of the mother during pregnancy was associated with offspring childhood overweight at age 7. methods. we performed a cohort study using prospective data from 37,764 women and child dyads from the danish national birth cohort (19962002). at a telephone interview at approximately 30 weeks gestation, the women reported whether they felt anxious, depressed, or stressed. the 95 percentile for body mass index in an international reference defined childhood overweight at any given age. logistic regression was used for the analyses. results. the prevalence of overweight children at 7 years of age was 9.9%. prenatal exposure to maternal distress during pregnancy was not associated with childhood overweight at 7 years of age (adjusted or 1.06 (95% ci 0.96 ; 1.18)). in analyses stratified on sex, a small tendency of overweight was seen in boys (or 1.15 (0.99 ; 1.33)), but not in girls (or 0.98 (0.85 ; 1.13)). conclusions. maternal distress during pregnancy appeared to have limited, if any, influence on the risk of overweight in offspring at 7 years of age.
one of the central challenges to biology is understanding biological information flow such as how genotypes manifest into functional phenotypes. historically, biological experiments have been difficult to conduct leading to a scarcity of data. however, technological improvements in experimental high - throughput measurements have shifted biology to being a data - rich field, driving a need for analytical tools to facilitate the analysis and interpretation of biological data. metabolic engineering applies biological information to genetically modify cellular function, usually toward production of a targeted chemical or protein product. metabolic engineering research requires knowledge of integrated cellular function and molecular detail to be successful. broadly, there are two types of approaches that lead to successful metabolic engineering results : directed designs built upon knowledge or combinatorial screening that leverages high - throughput experimental techniques. within the past fifteen years, computational tools have been developed to leverage biological data in the analysis and design of microbial strains for metabolic engineering and have facilitated prospective metabolic engineering design. these tools began with genome - scale metabolic models that aid in the analysis and prediction of whole cell function and have expanded to include tools for predicting the function of specific dna sequences. here, a brief overview is presented on the development and progression of computational tools that can be applied to metabolic engineering. individual fields of systems biology, synthetic biology, computational biology, or metabolic engineering are expansive enough for multiple reviews. the specific focus of this mini - review is to focus on a subset of tools from systems biology and synthetic biology that can be used in combination to enable prospective in silico strain design. key developments associated with genome - scale metabolic models and algorithms that can be used to computationally propose microbial strain design will be discussed. specific developments in synthetic biology associated with transcriptional and translational control will also be presented and placed within the context of genome - scale modeling and metabolic engineering. systems biology emphasizes data - intensive, integrative analyses that account for extended network function. with the introduction of whole genome sequencing and genomics technologies, one of the first objectives was to develop methods utilizing genomic information to understand and predict phenotypic function. the constraint - based modeling approach was implemented to generate genome - scale metabolic models of some of the first organisms with genome sequences [24 ], demonstrating the conceptual value of this computational approach. the initial genome - scale models were constructed based upon genomic data (sequence information) and biochemical data (reaction stoichiometry) in conjunction with linear programming to apply mass balancing principles to a whole - cell system. the conceptual framework provided a context for analyzing attributes of a cellular system and was shown to be able to predict cellular growth phenotypes. since the initial development of genome - scale models, a wide variety of improvements have been made to address different needs. these range from understanding the underlying structure of networks by using elementary modes or extreme pathways, model - building approaches, and progressively more cellular detail including thermodynamics, transcriptional regulation, and signaling pathways. all of these have contributed to improve the predictive capability and accuracy of genome - scale metabolic models and can be used to study a variety of aspects of cellular systems. here, we are specifically going to focus on the existing tools and challenges associated with genome - scale metabolic models, particularly as they apply to metabolic engineering applications. an overview of computational tools presented here is shown in table 1, which only represents a select subset of the numerous available tools and algorithms that have been developed. a more comprehensive (and continually updated) list of tools associated with constraint - based models is curated online (cobramethods.wikidot.com). using the natural ability of genome - scale metabolic models to simulate the behavior of cellular metabolism one can predict cellular designs for maximizing chemical production. metabolic engineering goals of identifying and modifying pathway fluxes to optimize the production of a desired chemical product align well with the pathway - level predictions that are generated from a genome - scale model. the foundation for this work was demonstrated when it was shown that the constraint - based modeling approach could reasonably predict the cellular growth phenotypes resulting from genetic modifications (gene deletions) in escherichia coli. this quickly led to a demonstration of using a genome - scale model of e. coli to predict strain designs for the over - production of lactic acid, which set the stage for genome - scale models as powerful computational tools for strain design. the first iterations of combining computer - aided strain design with experimental implementation relied on strain designs that incorporated gene deletions. this approach was computationally achievable through the removal of pathways associated with genes (following gene protein reaction relationships) and could be achieved experimentally with established methods for targeted gene deletions using homologous recombination. initial results were promising from the standpoint that the designs improved overall production of the desired chemical, but there was still a quantitative mismatch between the computationally calculated theoretical yield and the experimental yield. the discrepancy between computationally predicted function and actual function led to the development of an algorithm to predict targets for iterative improvement of the experimental strain. by utilizing transcriptomic data of the experimental strain, algorithmic analysis predicted areas of metabolism with the largest difference between the theoretical and experimental function. this analysis predicted specific genes to be targeted for synthetic regulation of gene expression (increased or decreased expression). recently, several developments have occurred in parallel both computationally and experimentally. for constraint - based genome - scale metabolic models, new methodologies and analyses continue to be developed that improve the accuracy of these models to predict cellular phenotypes. one major consideration for genome - scale metabolic models is that the mathematical representation for a biological system is underdetermined and thus, the same cellular phenotype can be reproduced from different underlying flux states / pathway usage. for example, a normal growth phenotype may have numerous proposed flux states that vary in specific pathway use, but produce the same cellular growth rate / product yield. however, once genetic modification of the network is implemented, all of the possible flux states may no longer be functionally equivalent. when considering growth phenotypes at the level of cellular growth, it may not be necessary to explicitly identify the exact flux state of the cell. knowledge of the starting in vivo flux state is important for pathway - specific metabolic engineering design. the problem of identifying in vivo flux states within the context of genome - scale metabolic models has been approached using a combination of high - throughput experimental data and computational algorithms. the initial formulation of this approach used transcriptomic or proteomic data with a human metabolic model to identify tissue - specific metabolic differences. in this approach, the experimental data was translated to a binary present / absent scoring for each individual transcript / protein. the scored experimental data was then algorithmically integrated with the metabolic model framework using mixed integer linear programming (milp) to calculate a flux state that is parsimonious with the experimental data. the underlying principle seeks to maximize the agreement between experimental data and computational fluxes where experimentally present entities can carry flux and experimentally absent entities should have zero flux. the milp approach to experimental data integration and prediction of in vivo flux states has started to be adopted for metabolic engineering purposes. one example of this is the development and analysis of a metabolic model for the cellulolytic anaerobe, clostridium thermocellum. c. thermocellum naturally produces a cellulosome that efficiently breaks down cellulosic biomass in carbohydrate monomers that c. thermocellum can ferment into ethanol and hydrogen as metabolic end - products. thus, c. thermocellum has been a focal organism for biofuel development. after developing a c. thermocellum model that explicitly produces a cellulosome, milp integration of the rnaseq data with the metabolic model helped improve the accuracy of computational predictions and helped identify genetic targets to improve biofuel production. another major improvement in genome - scale metabolic modeling was the explicit inclusion of charge - balancing for biochemical reactions. while the initial formulation of constraint - based models was based upon material balances, reactions were not necessarily charge - balanced without careful curation of individual reactions. this was first implemented with the model for e. coli and has become standard practice for constraint - based model reconstruction. this detailed aspect of the models becomes integral to metabolic engineering especially in cases involving fermentation where restricted energetics lead to higher fluxes and distributions of metabolic end - products need to maintain redox balance for the cell. this was shown to be particularly important for organisms with growth phase shifts such as the commercial organism clostridium acetobutylicum that is central to the acetone c. acetobutylicum goes through distinct acidogenic and solventogenic growth phases with widely different metabolic end - products produced in each phase. critical to understanding and modeling the shift and difference in end - products produced was the development and analysis of proton fluxes for c. acetobutylicum. one of the most recent major conceptual advances in the constraint - based modeling methodology was the formulation of the expression matrix, or e matrix, in e. coli. constraint - based models to this point have been developed using biochemical reaction stoichiometry to form a stoichiometric matrix (s) that provides and establishes a gene the stoichiometric matrix provides the basis for all simulations utilizing flux balance analysis (fba), but considers the metabolic network as an abstraction from the cell where basically any gene product can be produced at any amount with no cellular cost. the e matrix represents a major advancement in detail and prediction as it explicitly accounts for all mechanisms required for transcription, translation, and modification of each gene product. along with adding a new level of mechanistic biological detail, the development of the e matrix enables the prediction of two important aspects of cellular function. one is that the e matrix allows a priori prediction of the transcriptome and proteome directly based upon a genetic sequence. the second major benefit is that cellular costs can be associated with producing each gene product, thus the cellular cost benefit aspect of expressing pathways (e.g. heterologous pathways) can now be considered. based upon the stoichiometric matrix (or even including the expression matrix), standard simulations using genome - scale metabolic models utilize flux balance analysis (fba) as a staple for making predictions of pathway fluxes and phenotypes. this analysis assumes a pseudo - steady state hypothesis and does not explicitly account for any process kinetics. a methodological improvement to fba was the development of dynamic flux balance analysis (dfba). dfba was initially developed considering two different approaches to explicitly integrate kinetics into fba simulations. the first approach was to reformulate the problem to account for metabolite concentrations and the dynamic optimization problems were solved using non - linear programming over the entire designated time period of interest. the second approach discretized the time period of interest into smaller time steps that were solved individually using linear programming with a final integration of time steps. both approaches extended the analytical capabilities of the e. coli model when used to study diauxic growth on glucose. the concept of dfba has been expanded to also explicitly include michaelis menten kinetics for processes where reasonable rate parameters could be found and used as a basis for modeling microbial consortia. designer microbial consortia are gaining interest as a potential means of efficiently utilizing some of the unique capabilities of different microbes. in the cellulosic biorefinery for example, since many of the highly efficient cellulolytic microbes are strict anaerobes and have poor tools for genetic manipulation the process consists of two steps : saccharification by a cellulolytic microbe and fermentation of freed sugars to a metabolic product by a genetically tractable microbe. thus, a single - step consolidated bioprocess (cbp) could conceptually be designed from a microbial consortium with an anaerobic cellulolytic microorganism for the degradation of lignocellulosic material, a supporting facultative anaerobe that can be used to consume oxygen to produce an anaerobic environment and cross - feed off of secreted metabolic end - products to produce a desired chemical product. microbial consortia are often difficult to propagate and stabilize in a laboratory setting making experimental approaches to consortium design difficult. ideally, genome - scale metabolic models can be used to study and predict microbial consortium behavior. while the mass balance conceptual framework of metabolic inputs and outputs is foundational to computational study of microbial consortia, analytical frameworks needed to be developed to interface individual organism models. to date, there have been two noted formulations of constraint - based modeling approaches applied to microbial consortia. the first was an iteration of dfba that modeled a co - culture of c. acetobutylicum and clostridium cellulolyticum. this formulation was used as a basis for studying some of the interactions between the two clostridia to elucidate some of the synergies that arise from co - culture. independently, a separate multi - level optimization computational framework known as optcom was developed as a general and scalable means of studying microbial communities and the interactions within those communities. the optcom framework considers the community by splitting optimization between individual organism fitness considerations and the overall community fitness as a secondary optimization. the optcom framework was later expanded to explicitly incorporate dynamic behavior in the d - optcom framework. the d - optcom framework was initially used to study auxotrophic strains of e. coli and a microbial community composed of geobacter sulfurreducens, rhodoferax ferrireducens, and shewanella oneidensis that reduce uranium. the final analytical component when using genome - scale metabolic models as a tool for microbial strain design is an algorithm that can facilitate the design process. a growing number of algorithms have been developed that expand the predictive capabilities of genome - scale models to simulate different strain design parameters. one of the first strain design algorithms to be developed for use with genome - scale metabolic models was optknock that formulated a bi - level optimization where gene deletions were considered to increase the production of a desired chemical while maintaining cellular growth. underlying the algorithm development was the premise that secretion of a target chemical could be stoichiometrically coupled to growth such that the faster a cell grew the faster the chemical would be produced. e. coli strains designed by optknock to secrete lactic acid experimentally demonstrated that it is possible to couple growth with chemical secretion. subsequent to optknock, several variant algorithms have been developed including optstrain, optorf, optflux, and optforce. in addition to the family of algorithms related to optknock, there have been numerous variant algorithms developed to address computational or algorithmic limitations. emilio was developed as a computationally efficient algorithm for searching through a broader range of possible genetic manipulations. cosmos developed designs for a variety of manipulations, but considered the problem based upon fluxes (and flux modifications). elementary modes were used as the design basis for identifying knockout or overexpression targets in the casop method and relative flux ratios were used as a design criterion for fbratio. the recent algorithms such as k - optforce and dyssco have incorporated process kinetics into the design consideration. using any of these approaches allows the prediction of how genetic modification will impact an organism production of a target chemical. these predictions even provide sufficient detail to identify on a pathway - by - pathway basis the exact flux that is required to achieve the optimal production rate. the challenge has remained in the translation of the computationally predicted strain design (and corresponding optimal flux state) to the in vivo system. in other words, if you can identify exactly what pathways you want to express and exactly what flux you want through each of those pathways, how do you get your cell to exactly match the computational prediction ? experimentally, the rapid development of molecular biology and genetic engineering tools typified by synthetic biology has significantly increased the ability to explicitly design and implement controllable genetic constructs. these improvements were enabled by the technological advances in dna synthesis and rapid, high - fidelity assembly of dna fragments [4345 ]. once genetic circuits could be constructed in an efficient and inexpensive manner with base - by - base specificity, it was possible to interrogate sequence - to - function relationships. while central to the investigation of all biological functions, for metabolic engineering applications this represented a broad advance where finer control over the expression of genes in a given pathway could be designed and implemented. designed developments in synthetic biology have occurred in parallel with systems biology developments (fig. 1) and enable multi - scale approaches to metabolic engineering. the transcriptional process involves a binding event between a dna sequence (promoter) and rna polymerase to initiate polymerization of an mrna. when naturally occurring promoter sequences are analyzed, there are conserved sequence motifs corresponding to regions that physically bind to the sigma subunit of the rna polymerase. sequence variation in the promoter affects transcriptional strength ; however, it has been difficult to predict the binding interaction between a promoter and rna polymerase as it involves binding between dna and a folded protein. some of the early work in this area was empirically based (out of necessity). naturally occurring variations in dna sequences associated with transcription identification of these dna sequences was the basis for constructing and characterizing libraries of transcription - associated dna sequences. in the early stages of the development of synthetic biology and the registry of standard biological parts (parts.igem.org), transcriptional dna parts were created and cataloged allowing for more detailed characterization and use of genetic variants for transcriptional control. the decreased cost of direct dna synthesis further expedited the investigation of sequence variation to function for transcriptional control. base - by - base changes in promoter (or up element) sequences could be accurately synthesized and rapidly tested in synthetic dna constructs. controlled sequence - to - function relationships could then be extrapolated using mathematical correlation methods such as a position weight matrix (pwm). pwms are a mathematical representation of a pattern and were initially applied to biological systems as a quantitative means of investigating conserved dna sequences. recently, pwms have been used to quantitatively describe the sequence - to - function relationship for promoters in e. coli. by dividing promoter sequences into 6 motifs (35, spacer, 10, disc start, initial transcribed region), 60 different promoter sequences were characterized for promoter strength and used to evaluate the influence of specific genetic changes on function. this approach was also applied to a class of transcriptional modulating sequences called up elements, which occur upstream of core promoter sequences. in these cases, thus, with the recent modeling developments, transcriptional control has progressed from empirical understanding to quantitatively modeled predictions that can direct synthetic promoter design to produce a desired level of transcriptional strength. following transcription, translation initiates when a ribosome interacts with a ribosome binding site (rbs) and facilitates the subsequent trna binding to mrna codons to produce polypeptides by the addition of amino acids. of these three steps, translation initiation is the rate - limiting step and within each cell different rates of translation initiation are found due to variation in the dna sequence of the rbs. thus, the functional amount of protein produced in terms of translation is tied to the thermodynamics of rbs recently, a computational approach has been developed to predict translation initiation rates for all start codons in a given dna sequence based upon a thermodynamic calculation of gibbs free energy. this calculation specifically considers the interaction of the 30s ribosomal subunit with a specific mrna sequence. the total change in gibbs free energy (gtot) is overall calculated as the difference in gibbs free energy between the 30s subunit complex bound to the mrna sequence and the 30s subunit and mrna sequence with no interaction. ribosome binding site calculator can be used not only to predict translation initiation rates for existing sequences, but also to design de novo rbs sequences for synthetically controlling translated protein levels. synthetic biology has now developed a complement of experimental and computational tools to design and control individual gene expression levels at both the transcriptional and translational levels. these tools enable a finer level of design control for biological systems and can be implemented for metabolic engineering applications where the production of a desired product is typically linked to carefully balancing multiple pathway fluxes. progress in synthetic biology is providing a suite of molecular - level tools that is a natural complement to network / systems - level analyses. using the natural ability of genome - scale metabolic models to simulate the behavior of cellular metabolism one can predict cellular designs for maximizing chemical production. metabolic engineering goals of identifying and modifying pathway fluxes to optimize the production of a desired chemical product align well with the pathway - level predictions that are generated from a genome - scale model. the foundation for this work was demonstrated when it was shown that the constraint - based modeling approach could reasonably predict the cellular growth phenotypes resulting from genetic modifications (gene deletions) in escherichia coli. this quickly led to a demonstration of using a genome - scale model of e. coli to predict strain designs for the over - production of lactic acid, which set the stage for genome - scale models as powerful computational tools for strain design. the first iterations of combining computer - aided strain design with experimental implementation relied on strain designs that incorporated gene deletions. this approach was computationally achievable through the removal of pathways associated with genes (following gene protein reaction relationships) and could be achieved experimentally with established methods for targeted gene deletions using homologous recombination. initial results were promising from the standpoint that the designs improved overall production of the desired chemical, but there was still a quantitative mismatch between the computationally calculated theoretical yield and the experimental yield. the discrepancy between computationally predicted function and actual function led to the development of an algorithm to predict targets for iterative improvement of the experimental strain. by utilizing transcriptomic data of the experimental strain, algorithmic analysis predicted areas of metabolism with the largest difference between the theoretical and experimental function. this analysis predicted specific genes to be targeted for synthetic regulation of gene expression (increased or decreased expression). recently, several developments have occurred in parallel both computationally and experimentally. for constraint - based genome - scale metabolic models, new methodologies and analyses continue to be developed that improve the accuracy of these models to predict cellular phenotypes. one major consideration for genome - scale metabolic models is that the mathematical representation for a biological system is underdetermined and thus, the same cellular phenotype can be reproduced from different underlying flux states / pathway usage. for example, a normal growth phenotype may have numerous proposed flux states that vary in specific pathway use, but produce the same cellular growth rate / product yield. however, once genetic modification of the network is implemented, all of the possible flux states may no longer be functionally equivalent. when considering growth phenotypes at the level of cellular growth, it may not be necessary to explicitly identify the exact flux state of the cell. knowledge of the starting in vivo flux state is important for pathway - specific metabolic engineering design. the problem of identifying in vivo flux states within the context of genome - scale metabolic models has been approached using a combination of high - throughput experimental data and computational algorithms. the initial formulation of this approach used transcriptomic or proteomic data with a human metabolic model to identify tissue - specific metabolic differences. in this approach, the experimental data was translated to a binary present / absent scoring for each individual transcript / protein. the scored experimental data was then algorithmically integrated with the metabolic model framework using mixed integer linear programming (milp) to calculate a flux state that is parsimonious with the experimental data. the underlying principle seeks to maximize the agreement between experimental data and computational fluxes where experimentally present entities can carry flux and experimentally absent entities should have zero flux. the milp approach to experimental data integration and prediction of in vivo flux states has started to be adopted for metabolic engineering purposes. one example of this is the development and analysis of a metabolic model for the cellulolytic anaerobe, clostridium thermocellum. c. thermocellum naturally produces a cellulosome that efficiently breaks down cellulosic biomass in carbohydrate monomers that c. thermocellum can ferment into ethanol and hydrogen as metabolic end - products. thus, c. thermocellum has been a focal organism for biofuel development. after developing a c. thermocellum model that explicitly produces a cellulosome, milp integration of the rnaseq data with the metabolic model helped improve the accuracy of computational predictions and helped identify genetic targets to improve biofuel production. another major improvement in genome - scale metabolic modeling was the explicit inclusion of charge - balancing for biochemical reactions. while the initial formulation of constraint - based models was based upon material balances, reactions were not necessarily charge - balanced without careful curation of individual reactions. this was first implemented with the model for e. coli and has become standard practice for constraint - based model reconstruction. this detailed aspect of the models becomes integral to metabolic engineering especially in cases involving fermentation where restricted energetics lead to higher fluxes and distributions of metabolic end - products need to maintain redox balance for the cell. this was shown to be particularly important for organisms with growth phase shifts such as the commercial organism clostridium acetobutylicum that is central to the acetone c. acetobutylicum goes through distinct acidogenic and solventogenic growth phases with widely different metabolic end - products produced in each phase. critical to understanding and modeling the shift and difference in end - products produced was the development and analysis of proton fluxes for c. acetobutylicum. one of the most recent major conceptual advances in the constraint - based modeling methodology was the formulation of the expression matrix, or e matrix, in e. coli. constraint - based models to this point have been developed using biochemical reaction stoichiometry to form a stoichiometric matrix (s) that provides and establishes a gene the stoichiometric matrix provides the basis for all simulations utilizing flux balance analysis (fba), but considers the metabolic network as an abstraction from the cell where basically any gene product can be produced at any amount with no cellular cost. the e matrix represents a major advancement in detail and prediction as it explicitly accounts for all mechanisms required for transcription, translation, and modification of each gene product. along with adding a new level of mechanistic biological detail, the development of the e matrix enables the prediction of two important aspects of cellular function. one is that the e matrix allows a priori prediction of the transcriptome and proteome directly based upon a genetic sequence. the second major benefit is that cellular costs can be associated with producing each gene product, thus the cellular cost benefit aspect of expressing pathways (e.g. heterologous pathways) can now be considered. based upon the stoichiometric matrix (or even including the expression matrix), standard simulations using genome - scale metabolic models utilize flux balance analysis (fba) as a staple for making predictions of pathway fluxes and phenotypes. this analysis assumes a pseudo - steady state hypothesis and does not explicitly account for any process kinetics. a methodological improvement to fba was the development of dynamic flux balance analysis (dfba). dfba was initially developed considering two different approaches to explicitly integrate kinetics into fba simulations. the first approach was to reformulate the problem to account for metabolite concentrations and the dynamic optimization problems were solved using non - linear programming over the entire designated time period of interest. the second approach discretized the time period of interest into smaller time steps that were solved individually using linear programming with a final integration of time steps. both approaches extended the analytical capabilities of the e. coli model when used to study diauxic growth on glucose. the concept of dfba has been expanded to also explicitly include michaelis menten kinetics for processes where reasonable rate parameters could be found and used as a basis for modeling microbial consortia. designer microbial consortia are gaining interest as a potential means of efficiently utilizing some of the unique capabilities of different microbes. in the cellulosic biorefinery for example, since many of the highly efficient cellulolytic microbes are strict anaerobes and have poor tools for genetic manipulation the process consists of two steps : saccharification by a cellulolytic microbe and fermentation of freed sugars to a metabolic product by a genetically tractable microbe. thus, a single - step consolidated bioprocess (cbp) could conceptually be designed from a microbial consortium with an anaerobic cellulolytic microorganism for the degradation of lignocellulosic material, a supporting facultative anaerobe that can be used to consume oxygen to produce an anaerobic environment and cross - feed off of secreted metabolic end - products to produce a desired chemical product. microbial consortia are often difficult to propagate and stabilize in a laboratory setting making experimental approaches to consortium design difficult. ideally, genome - scale metabolic models can be used to study and predict microbial consortium behavior. while the mass balance conceptual framework of metabolic inputs and outputs is foundational to computational study of microbial consortia, analytical frameworks needed to be developed to interface individual organism models. to date, there have been two noted formulations of constraint - based modeling approaches applied to microbial consortia. the first was an iteration of dfba that modeled a co - culture of c. acetobutylicum and clostridium cellulolyticum. this formulation was used as a basis for studying some of the interactions between the two clostridia to elucidate some of the synergies that arise from co - culture. independently, a separate multi - level optimization computational framework known as optcom was developed as a general and scalable means of studying microbial communities and the interactions within those communities. the optcom framework considers the community by splitting optimization between individual organism fitness considerations and the overall community fitness as a secondary optimization. the optcom framework was later expanded to explicitly incorporate dynamic behavior in the d - optcom framework. the d - optcom framework was initially used to study auxotrophic strains of e. coli and a microbial community composed of geobacter sulfurreducens, rhodoferax ferrireducens, and shewanella oneidensis that reduce uranium. the final analytical component when using genome - scale metabolic models as a tool for microbial strain design is an algorithm that can facilitate the design process. a growing number of algorithms have been developed that expand the predictive capabilities of genome - scale models to simulate different strain design parameters. one of the first strain design algorithms to be developed for use with genome - scale metabolic models was optknock that formulated a bi - level optimization where gene deletions were considered to increase the production of a desired chemical while maintaining cellular growth. underlying the algorithm development was the premise that secretion of a target chemical could be stoichiometrically coupled to growth such that the faster a cell grew the faster the chemical would be produced. e. coli strains designed by optknock to secrete lactic acid experimentally demonstrated that it is possible to couple growth with chemical secretion. subsequent to optknock, several variant algorithms have been developed including optstrain, optorf, optflux, and optforce. in addition to the family of algorithms related to optknock, there have been numerous variant algorithms developed to address computational or algorithmic limitations. emilio was developed as a computationally efficient algorithm for searching through a broader range of possible genetic manipulations. cosmos developed designs for a variety of manipulations, but considered the problem based upon fluxes (and flux modifications). elementary modes were used as the design basis for identifying knockout or overexpression targets in the casop method and relative flux ratios were used as a design criterion for fbratio. the recent algorithms such as k - optforce and dyssco have incorporated process kinetics into the design consideration. using any of these approaches allows the prediction of how genetic modification will impact an organism production of a target chemical. these predictions even provide sufficient detail to identify on a pathway - by - pathway basis the exact flux that is required to achieve the optimal production rate. the challenge has remained in the translation of the computationally predicted strain design (and corresponding optimal flux state) to the in vivo system. in other words, if you can identify exactly what pathways you want to express and exactly what flux you want through each of those pathways, how do you get your cell to exactly match the computational prediction ? experimentally, the rapid development of molecular biology and genetic engineering tools typified by synthetic biology has significantly increased the ability to explicitly design and implement controllable genetic constructs. these improvements were enabled by the technological advances in dna synthesis and rapid, high - fidelity assembly of dna fragments [4345 ]. once genetic circuits could be constructed in an efficient and inexpensive manner with base - by - base specificity, it was possible to interrogate sequence - to - function relationships. while central to the investigation of all biological functions, for metabolic engineering applications this represented a broad advance where finer control over the expression of genes in a given pathway could be designed and implemented. designed developments in synthetic biology have occurred in parallel with systems biology developments (fig. 1) and enable multi - scale approaches to metabolic engineering. the transcriptional process involves a binding event between a dna sequence (promoter) and rna polymerase to initiate polymerization of an mrna. when naturally occurring promoter sequences are analyzed, there are conserved sequence motifs corresponding to regions that physically bind to the sigma subunit of the rna polymerase. sequence variation in the promoter affects transcriptional strength ; however, it has been difficult to predict the binding interaction between a promoter and rna polymerase as it involves binding between dna and a folded protein. some of the early work in this area was empirically based (out of necessity). naturally occurring variations in dna sequences associated with transcription identification of these dna sequences was the basis for constructing and characterizing libraries of transcription - associated dna sequences. in the early stages of the development of synthetic biology and the registry of standard biological parts (parts.igem.org), transcriptional dna parts were created and cataloged allowing for more detailed characterization and use of genetic variants for transcriptional control. the decreased cost of direct dna synthesis further expedited the investigation of sequence variation to function for transcriptional control. base - by - base changes in promoter (or up element) sequences could be accurately synthesized and rapidly tested in synthetic dna constructs. controlled sequence - to - function relationships could then be extrapolated using mathematical correlation methods such as a position weight matrix (pwm). pwms are a mathematical representation of a pattern and were initially applied to biological systems as a quantitative means of investigating conserved dna sequences. recently, pwms have been used to quantitatively describe the sequence - to - function relationship for promoters in e. coli. by dividing promoter sequences into 6 motifs (35, spacer, 10, disc start, initial transcribed region), 60 different promoter sequences were characterized for promoter strength and used to evaluate the influence of specific genetic changes on function. this approach was also applied to a class of transcriptional modulating sequences called up elements, which occur upstream of core promoter sequences. in these cases, thus, with the recent modeling developments, transcriptional control has progressed from empirical understanding to quantitatively modeled predictions that can direct synthetic promoter design to produce a desired level of transcriptional strength. translation initiates when a ribosome interacts with a ribosome binding site (rbs) and facilitates the subsequent trna binding to mrna codons to produce polypeptides by the addition of amino acids. of these three steps, translation initiation is the rate - limiting step and within each cell different rates of translation initiation are found due to variation in the dna sequence of the rbs. thus, the functional amount of protein produced in terms of translation is tied to the thermodynamics of rbs recently, a computational approach has been developed to predict translation initiation rates for all start codons in a given dna sequence based upon a thermodynamic calculation of gibbs free energy. this calculation specifically considers the interaction of the 30s ribosomal subunit with a specific mrna sequence. the total change in gibbs free energy (gtot) is overall calculated as the difference in gibbs free energy between the 30s subunit complex bound to the mrna sequence and the 30s subunit and mrna sequence with no interaction. this ribosome binding site calculator can be used not only to predict translation initiation rates for existing sequences, but also to design de novo rbs sequences for synthetically controlling translated protein levels. synthetic biology has now developed a complement of experimental and computational tools to design and control individual gene expression levels at both the transcriptional and translational levels. these tools enable a finer level of design control for biological systems and can be implemented for metabolic engineering applications where the production of a desired product is typically linked to carefully balancing multiple pathway fluxes. progress in synthetic biology is providing a suite of molecular - level tools that is a natural complement to network / systems - level analyses. as a field, metabolic engineering leverages the vast diversity of biochemical capabilities found in biological systems to produce a desired product. successful metabolic engineering projects typically balance systems - level strain design and molecular - level detail to modify cell function. as such, metabolic engineering projects often incorporate the most recent biological knowledge and tools as these projects span all levels of biological organization and function within a cell. due to the complexity and multi - scale nature of cellular systems computational modeling methods are instrumental for analyzing and predicting function, fig. 2. for system - level design, genome - scale metabolic models have developed into a robust computational tool for predicting consequences of network modifications on cellular function. building upon the stoichiometric foundation underlying genome - scale metabolic models, numerous improvements have been made in terms of model contents and analytical tools. it is now possible to computationally simulate the major cellular components starting with a genome through mechanistic expression and function of proteins. these simulations can be used for prospective computational design of microbial strains with modified function. depending upon the specific strain design, experimental implementation can involve the combinations of gene deletions, gene additions (heterologous expression), gene knockdown, or gene over - expression. at a molecular - level, it becomes important to understand how best to achieve the desired gene construct and how to experimentally implement the construct to achieve the desired expression level. work in synthetic biology has started to address both of these aspects through the development of molecular tools for the design and synthesis of dna constructs and specific tools for transcription and translation. these molecular - level tools allow dna sequences to be designed to provide desired levels of transcription and translation to achieve desired levels of protein function. furthermore, the designed sequences can then be directly implemented experimentally using dna synthesis and assembly methods. together, it is now possible to approach metabolic engineering projects using multi - scale computational modeling tools to direct all major facets of experimental research. metabolic network analysis and design can be achieved using genome - scale models and optimization algorithms. specific desired pathway fluxes predicted during network analysis can then be individually considered using molecular tools. control of transcription and translation of each individual gene can then be designed and genetically encoded into a synthetic dna construct for implementation in an engineered microbial strain. progressively, the complexity of strain designs that can be implemented will also increase opening avenues for targeting difficult products or processes. synthetic feedback loops or embedded biosensors can be used as built - in control mechanisms for monitoring or triggering cellular processes. controlling the kinetics or throughput of upstream and downstream pathways it may even be possible to completely redesign or refactor) major components of metabolism to more efficiently utilize resource pools to minimize material drains going to biomass. undoubtedly, there will be a growing number of studies that successfully incorporate and utilize systems biology and synthetic biology such as the development of sequence - expression - activity maps (seamaps) that help identify optimal sequences and expression levels.	metabolic engineering modifies cellular function to address various biochemical applications. underlying metabolic engineering efforts are a host of tools and knowledge that are integrated to enable successful outcomes. concurrent development of computational and experimental tools has enabled different approaches to metabolic engineering. one approach is to leverage knowledge and computational tools to prospectively predict designs to achieve the desired outcome. an alternative approach is to utilize combinatorial experimental tools to empirically explore the range of cellular function and to screen for desired traits. this mini - review focuses on computational systems biology and synthetic biology tools that can be used in combination for prospective in silico strain design.
reducing post - operative pain is an important issue in perioperative patient care.the release of proteolytic and inflammatory mediators after surgical manipulation may cause powerful nociceptive impulses that trigger pain (1). the primary phenomenon in inflammatory pain conduction is the stimulation of the spinal cord s n - methyl - dimethyl - aspartate (nmda) receptors to the active forms of glutamate and aspartate amino acids (2). ketamine, a non - competitive nmda antagonist, prevents central sensitization of nociceptors at subanesthetic doses with blocking afferent noxious stimulation (3 - 5) recently, several studies have shown that the pre - incisional infiltration of the wounds with ketamine could reduce mean pain score after surgery, prolong the time before the first analgesic administration and reduce the total amount of analgesics consumed (6). a recent systematic review on perioperative effects of ketamine showed that intravenous administration of ketamine is an effective complementary for postoperative analgesia and that the pain - relieving effects of ketamine are free of the type of intraoperative opioid prescribed, ketamine amount, and timing of ketamine administration (7). however, to our knowledge no study has compared the analgesic effects of surgical site infiltration of bupivacaine - ketamine with that of iv injection of the ketamine alone. the present prospective, randomized study was therefore designed to estimate the analgesic effects of the low doses of iv ketamine or intra nephrostomy tract infiltration of two different doses of ketamine plus bupivacaine on pain score after tubeless percutaneous nephrolithotomy (pcnl) surgery. the present prospective, randomized, controlled clinical trial was performed at sina teaching hospital between july 2011 and may 2012. after being approved by the ethical board committee of tehran university of medical sciences and registered in the iranian registry of clinical trials (irct) website (2013092612695n1), one hundred relatively healthy patients - classified as the american society of anesthesiologists (asa) physical status i - ii -- scheduled for elective pcnl operation, were recruited. in our institution, pcnl is performed in patients with kidney stones more than 2 cm in diameter, stones refractory to extracorporeal shock wave lithotripsy, proximal ureteral stones larger than 1.5 cm in diameter, diverticular stones, and stones producing distal obstruction. patients with a known history of severe hypertension, ischemic heart disease, hyperthyroidism, psychiatric disorders, chronic pain syndrome, renal or hepatic insufficiency, seizure or intracranial hypertension, allergy to ketamine, and drug or alcohol abuse were excluded. after signing an informed consent, two evaluators who were blind to the intra - operative interventions were told to evaluate the patient s pain level using a 10 cm visual analog scale (vas) with 0 standing for no pain and 10 for the worst possible pain. sedation score was also assessed using ramsay sedation scale as following : 1 = patient is anxious and agitated or restless, or both 2 = patient is co - operative, oriented, and relaxing 3 = patient answers to commands only 4 = patient exhibits brisk response to light glabellar tap or loud auditory stimulus 5 = patient exhibits a sluggish response to light glabellar tap or loud auditory stimulus 6 = patient exhibits no response no premedication was prescribed for the patients.the patients were randomized into five equal groups using sealed envelopes, which were prepared by an anesthetic nurse unaware of the objectives of the study. she also prepared and labeled similar syringes containing either normal saline or the study medications as following : 1) 10 ml of saline solution was infiltrated into the nephrostomy tract (group c). 2) 10 ml of 0.25% bupivacaine was infiltrated into the nephrostomy tract (group b). 3) 10 ml of 0.25% bupivacaine plus 0.5 mg / kg ketamine was infiltrated into the nephrostomy tract (group bk1). 4) 10 ml of 0.25% bupivacaine plus 1.5 mg / kg ketamine was infiltrated into the nephrostomy tract (group bk2). 5) 10 ml of saline solution containing 0.5 mg / kg ketamine was administered intravenously (group k). induction of anesthesia was performed with 0.1 mg / kg midazolam, 3 g / kg fentanyl, 4 mg / kg of thiopental sodium. anesthesia was maintained with 1 - 1.5% isoflurane in a mixture of 50% nitrous oxide and oxygen. fentanyl 1 g / kg / hr was administered intravenously to provide an acceptable intraoperative analgesia. during the operation, a ureteral catheter was placed cystoscopically and percutaneous access was obtained while the patient was placed in a prone position. all surgeries were carried out by a single surgeon unaware of the objectives of the study. as for the first four groups, the nephrostomy tract was infiltrated by the surgeon at the end of the surgery. in group k, however, saline solution plus ketamine administered intravenously at the end of surgery by an anesthesiology resident who was not involved in data collection. after extubation, patients were transferred to the post anaesthesia care unit (pacu), where an anesthesiologist and nurse unaware of the study objectives, observed the patients. as the primary objective, pain scores were measured at the time of arrival in the pacu as well as 10, 20, and 30 min thereafter and also postoperatively at 1, 6, 12, and 24 h using a 10 cm vas score. secondary objectives of the study were as following : 1- sedation score was assessed during the first 30 min after arriving to pacu using ramsay sedation scale simultaneously with pain scores. 2- the time between the analgesics infiltration and the first administration of rescue analgesics, as well as total analgesic requirement in the first 24 h of the post - operative period. 3- heart rate, systolic and diastolic arterial pressure, mean arterial pressure, pulse oximeter oxygen saturation, were recorded before the surgery, at five- minute intervals throughout the surgery, at the time of arrival in the pacu, 10, 20, and 30 min postoperatively. rescue analgesia during the first 24 h after the surgery was given intravenously (4 mg, bolus dose of morphine) to a maximum total dose of 20 mg upon patientsdemand for more pain control. the interval between anesthesia induction and the discontinuation of anesthetic drugs was regarded as the anesthesia durationwhereas the interval between the discontinuation of anesthetic drugs and extubation was considered as the time to tracheal extubation. the duration of surgery was defined as the interval between the first surgical incision and the last surgical suture.the duration of pacu stay was determined based on the modified aldrete scoring system (8). the sample size was calculated based on a power calculation to achieve 80% power to detect a 20% difference in the meanvas score values between group c and the other groups, with = 0.05. as a result, 20 patients were required in each group. baseline data were presented as mean standard deviation for quantitative variables and proportions for qualitative ones. there was no significant difference between the five groups with regard to their demographic data, duration of surgery, and anesthesia duration (table 1). patient characteristics and duration of surgery and anesthesia in five groups view it in a separate window notes : values are presented as mean standard deviation or number ; there were no significant differences between five groups. abbreviations : c, control ; b, bupivacaine 0.25% ; bk1, bupivacaine + ketamine 0.5 mg / kg ; bk2, bupivacaine + ketamine 1.5 mg / kg ; k, 10 ml of a saline solution containing 0.5 mg / kg ketamine for iv administration. mean vas scores were significantly lower in the bk1 and bk2 groups compared with groups c, b and k, whereas mean sedation scores upon arrival at the pacu as well as in 10, 20, and 30 min afterwards was lower in the bk2 group (table 2). postoperative mean vas scores were not significantly different at 1, 6, 12 and 24 h between all groups (table 2). there was no significant difference between the five groups regarding pulse oximeter oxygen saturation, heart rate, systolic, diastolic, and mean arterial blood pressure at any point during the surgery and recovery period. comparison of vas scores and sedation scores between groups notes : data are presented as mean standard deviation ; pacu, post anesthesia care unit ; vas, visual analog scale ; abbreviations : c, control ; b, bupivacaine 0.25% ; bk1, bupivacaine + ketamine 0.5 mg / kg ; bk2, bupivacaine + ketamine1.5 mg / kg ; k, 10 ml of a saline solution containing 0.5 mg / kg ketamine for iv administration., statistical significant difference. the mean time to first rescue analgesics administration in the postoperative period was significantly longer in groups bk1 and bk2 compared with groups k, b and c (table 3). the mean of total analgesic requirement in the first 24 h of postoperative period was also significantly lower in groups bk1 and bk2 compared with groups b, k, and c (table 3). also, time to tracheal extubation between the five groups was not statistically different (table 3). values regarding to rescue analgesics and time to tracheal extubation and pacu stay in five groups view it in a separate window notes : values are presented as mean standard deviation ; pacu, post - anesthesia care unit ; abbreviations : bk1, bupivacaine + ketamine 0.5 mg / kg ; bk2, bupivacaine + ketamine 1.5 mg / kg ; c, control ; b ; bupivacaine 0.25% ; k, 10 ml of a saline solution containing 0.5 mg / kg ketamine for iv administration. statistical significant difference. the present study shows that multimodal analgesia using ketamine plus bupivacaine lowers mean postoperative pain scores more than the other groups. results of this study also confirmed that intraoperative nephrostomy tract infiltration of ketamine in combination with bupivacaine not only delays the first demand for analgesic administration but also lessens the total amount of rescue narcotics used for providing analgesia after pcnl surgery. moharari and associates found that administration of ketamine in a mixture with lidocaine gel, compared with lidocaine gel alone, makes rigid cystoscopy more bearable. they concluded that ketamine, due to its peripheral and central nervous system effects, can aleviate pain and therefore result in lower mean vas score (9). some researchers found local infiltration of a combination of bupivacaine (10 mg fixed dose) plus ketamine (0.5 mg / kg) into the surgical wound is more effective compared with the infiltration of each drug alone in pediatric adenotonsillectomy operation (10). local spray of ketamine on the surgical site could reduce postoperative pain in children who underwent tonsillectomy (11). tverskoy (12) found that the infiltration of ketamine and bupivacaine into surgery site during inguinal hernia repair, increases bupivacaine 's analgesic efficacy and its analgesic effect duration. moreover, it has been shown that the administration of iv ketamine is associated with adequate regional anaesthesia in a group of volunteers (13). in this study, mean pain score was higher in those who had received either intravenous ketamine or 0.25% bupivacaine infiltration compared to bk1, 2 groups just at the first 30 min after the end of surgery ; so it can be concluded that addition of ketamine to bupivacaine infiltrate increases its analgesic effects. in the other word, the results of the current study confirm the local analgesic effects of ketamine. they found that either subcutaneous infiltration of 2 mg / kg ketamine or intravenous injection of 1 mg / kg ketamine nearly 15 min before surgical incision could provide an equal adjunctive analgesia during first 24 h after surgery in patients undergoing cholecystectomy (14). it should be noted that the present study only focused on local analgesic properties of ketamine after imposing of noxious stimulus and not its pre - emptive analgesic effects. on the contrary to safavi s study, however, we found that the infiltration of ketamine plus bupivacaine into the nephrostomy tract has a superior effect on postoperative pain control compared with iv injection of low dose ketamine (0.5 mg / kg). it should be added that high sedation level reported in the group bk2 may disfavor this protocol in pcnl surgeries. according to table 2 the mean vas score in patients of group bk2 is lower than bk1 and other groups in recovery period but at the same time the patients in groups bk2 was more sedated and unconscious. the usual dosage of analgesic effect of ketamine by intravenous and caudal administration is less than 1 mg / kg and more ketamine dosage just increase sedation and side effects (15). demonstrated that the number of glutamate receptors, found in primary afferent axons, increases after the induction of inflammation (16). furthermore, the release of neurotransmitters such as glutamate and aspartate into the peripheral tissue is augmented after any type of tissue injury or inflammation (17 - 18). the stimulation of all types of glutamate receptors may induce hyperalgesia and allodynia which are understood as pain (19 - 20). hence, given the above - mentioned facts, the possible mechanism through which the ketamine exerts its local analgesic properties could be understood as the following : the binding of ketamine with nmda receptors may lower the glutamate - induced stimulation of nmda receptor on afferent pathways which are located in the nephrostomy tract. consequently, decreased peripheral pain impulses into the spinal cord ensue and eventually the central sensitization of the pain pathways of the spinal cord may diminish. it is noteworthy to mention that some researchers evaluated the analgesic efficacy of intra - operative infiltration of local anaesthetics alone on post - operative pain levels in pcnl patients. shah and associates conducted a study and found that infiltration of bupivacaine as a single local anaesthetic in nephrostomy tract, is associated with requests for less amounts of analgesics during postoperative period in pcnl surgery (21). goktenand colleagues infiltrated levobupivacaine into the nephrostomy tract and at the same time infused intravenous paracetamol to the patients who were under pcnl operation ; they reported their method as a safe and valuable analgesic technique for the pcnl surgery (22). the results of the current study show that the mean amount of rescue analgesics injected to the patients in group b was about half as much as that in group c, supporting the analgesic efficacy of bupivacaine infiltration in reducing pain following pcnl surgery. however, the analgesic efficacy of combined ketamin and bupivacaine, based on our results, was superior to that of a local anesthetic alone. considering logistic reasons, we failed to assess the relation between serum levels of ketamine and the resulted post - operative analgesic effects. thus, further studies are needed to assess serum concentrations of ketamine and determine serum level - response relationships. moreover, we had to administer rescue analgesia in sufficient amount for all the patients upon their request during post - operative period. thus, mean vas scores evaluated at 1, 6, 12, and 24 h after the surgery were not significantly different between studied groups. it could be concluded that the infiltration of ketamine in combination with bupivacaine, compared with bupivacaine or iv ketamine alone, has better analgesic effects during the recovery period following pcnl surgery.	background : recently, the use of ketamine as a systemic and local analgesic drug in reducing post - operative pain is studied more frequently.objectives:the aim of the present study was to assess the analgesic efficacy of iv ketamine injection inaddition to nephrostomy tract infiltration of ketamine - bupivacaine on postoperative pain relief after tubeless percutaneous nephrolithotomy (pcnl).patients and methods : patients (n = 100), with renal stone who were candidates for pcnl were randomized to five groups with 20 cases in each : group c, 10 ml of saline solution was infiltrated into the nephrostomy tract ; group b, 10 ml of 0.25% bupivacaine was infiltrated into the nephrostomy tract ; group bk1, 10 ml of 0.25% bupivacaine plus 0.5 mg / kg ketamine was infiltrated into the nephrostomy tract ; group bk2, 10 ml of 0.25% bupivacaine plus 1.5 mg / kg ketamine was infiltrated into the nephrostomy tract ; group k, 10 ml of saline solution containing 0.5 mg / kg ketamine was intravenously administered. post - operative pain scores were compared between groups as the primary objective. comparison of sedation scores, rescue analgesic consumption, time to the first rescue analgesics administration, hemodynamic and spo2 values were regarded as the secondary objective. results : mean vas scores in the first 30 min and total analgesic consumption in the first 24 h of post - operative period were significantly lower in groups bk1 and bk2 in comparison with the other groups (p < 0.05). also, time to first rescue analgesics administration was longer in the same groups (p < 0.05). conclusions : infiltration of ketamine plus bupivacaine provides superior analgesic effects in pcnl surgery compared with other methods.
myosins are a large and diverse family of molecular motors important for cell migration and motility. the human genome encodes 39 myosin genes, subdivided into 12 different classes (berg., 2001, peckham and knight, 2009). the remaining three encode the non - muscle (nm) myosin isoforms 2a, 2b, and 2c, which contribute to cell shape, adhesion, and cytokinesis (mogilner and keren, 2009, vicente - manzanares., 2009). myosin isoforms in the remaining classes contribute to a wide range of functions, including organelle trafficking, membrane tethering, golgi organization, actin organization, and actin polymerization (hartman and spudich, 2012). early studies have shown that 811 different myosin isoforms are co - expressed in epithelial cell lines, leukocytes, liver cells, and myoblasts (bement. some myosin isoforms are expressed widely, whereas others (e.g., myo7a and myo3) are restricted to a small tissue subset (dos and burnside, 2000, hasson., 1995). it has never been determined how variation in myosin expression profile between closely related cell types contributes to a variation in cellular phenotype. modulating myosin expression could help to drive a cell toward a more migratory phenotype and, therefore, metastasis in cancer. here we determined the myosin isoform expression profile in a range of prostate cell lines and in silico and then investigated four of the overexpressed myosin isoforms to uncover how each contribute to the more highly metastatic phenotype of pc-3 cells (pulukuri., 2005). we analyzed myosin expression for all 26 of the non - muscle myosin genes in the three most widely used prostate cancer cell lines : pc-3, du145, and lncap (weber., 2004). pc-3 cells are considered to have a higher metastatic potential than lncap cells (aalinkeel., 2004). class 2 muscle myosin isoforms were excluded because they are not expressed in non - muscle cells. we also analyzed a matched pair of normal (1535np) and cancerous (1535ct) cell lines derived from the prostate of the same patient (bright. a core of 12 myosin genes were expressed in all cell lines tested, as demonstrated by rt - pcr (table s1). however, du145 cells additionally expressed two myosin isoforms, myo7a and myo3, normally only expressed in the cochlea, retina, testis, lung, and kidney (hasson., 1995) or in the retina and pancreas (dos and burnside, 2000) respectively, and, therefore, we did not use these cells in further experiments, although, for completeness, the qpcr analysis on these cells is included (figure s1). expression levels of myo1b, myo1d, myo1e, myo9b, myo10, and myo18a were significantly higher in pc-3 than in lncap cells by qpcr (figure 1a). myo1b and myo10 expression levels were also significantly higher in 1535ct than in 1535np cells (figure 1b). an in silico analysis (figure 1c) showed that myo1b, myo1d, and myo10 levels were significantly higher in metastatic tumors than in benign tissue, suggesting that this trend is also found in vivo. myo1e and myo18a expression levels were also higher in 1535ct cells compared with 1535np cells, although this difference was not significant, and the in silico analysis did not show any significant differences in expression (figure 1c). myo6 expression levels were significantly lower in pc-3 cells compared with lncap (figure 1a), lower in 1535ct than in 1535np cells (figure 1b), and highest in localized medium - grade tumors (figure 1c), as reported earlier (dunn., 2006, myo9b expression levels were increased in tumors compared with benign tissues (figure 1c). levels of myh9, the only non - muscle myosin 2 gene we found to be expressed in prostate cancer cells, did not change at the mrna level (figure 1a) between lncap and pc-3 cells or between normal, tumor, or metastatic samples in the in silico analysis. western blotting for myo1b, nm2a, myo6, myo9b, myo10, myo18a, and nm2a in pc-3 and lncap cells (figures 2a and 2b) showed similar trends in protein expression levels. in pc-3 cells, high endogenous levels of myo10 were associated with a high number of filopodia (figures 2c and 2d), in which myo10 was localized to the tips (figure 2f), as expected from its known role in filopodium formation (berg and cheney, 2002, berg., 2000). in contrast, both filopodium number and myo10 expression levels were low in lncap cells (figure 2c), staining was diffuse, and myo10 was often absent from filopodial tips (figures 2e and 2f). upregulation of myo10 in breast cancer cells has been linked to expression of mutant p53 (arjonen., 2014). however, lncap cells are p53 wild - type, and pc-3 cells are p53-null (carroll., 1993), suggesting that, in this case, there is no link between myo10 overexpression and expression of mutant p53. in du145 cells, which do express mutant p53, myo10 expression is slightly higher, and numbers of filopodia are increased compared with lncap cells (figures s1a and s1b), but both are lower compared with pc-3 cells. myo1b localized to organelles in both cell types (figures 2d and 2e), as expected from its roles in trafficking of endosomes, multivesicular bodies, and lysosomes (cordonnier., 2001, higher myo1b expression in pc-3 cells was associated with an additional localization of myo1b to actin - rich structures at the plasma membrane and filopodia (figure 2d), consistent with an earlier study (tang and ostap, 2001). myo9b and myo18a were both enriched in membrane ruffles / lamellipodia in pc-3 cells (figure 2d), consistent with myo18a s role in modifying actin organization in the lamellipodium (hsu., 2010) and myo9b s role in cell polarity and recruitment of rhogap to the lamellipodium (hanley. the higher endogenous expression levels of myo1b, myo9b, and myo10 in more metastatic cell types / tissue suggested that they all contribute to the cellular phenotype of metastatic cells. we therefore used sirna knockdown (kd) to determine the effects of reducing their expression levels in pc-3 cells on cell morphology and cell migration. we also investigated myo18a because the interaction of myo18a regulates nm2a filaments (billington., 2015) and, therefore, may also influence cell migration and phenotype. sirna - mediated kd for 72 hr significantly reduced expression levels of each myosin isoform in pc-3 cells (figure 3a) and altered their morphology (figure 3b). the spread area of the cells increased up to 3-fold (figure 3c). kd of myo10, but not myo1b, myo9b, or myo18a, also significantly reduced the numbers of filopodia (figure 3d). although the increase in cell area in myo10 kd cells could be explained by the reduction in filopodia, as reported for cos-7 and hela cells (bohil., 2006), it does not explain the increased cell area for myo1b, myo9b, and myo18a kd cells, where filopodia are still present. knockdown of myo9b and myo10 both significantly reduced cell speed 2-fold in a 2d random migration assay (figures 3e and 3f). in contrast, knockdown of myo1b and myo18a did not affect speed in 2d random migration assays (figures 3e and 3f). knockdown of myo18a significantly reduced directional persistence in 2d (figures 3e and 3 g), indicating that these cells are less able to polarize. however, cell migration was inhibited for each myosin in a circular invasion assay (figure 3h) that closely mimics 3d invasion (yu and machesky, 2012). staining for f - actin in circular migration assays (figure 3i) showed an increase in actin stress fibers for cells at the border for each myosin knockdown compared with controls. we also observed distinct changes in the acto - myosin organization following kd of each myosin. control pc-3 cells (figures 4a and 4b) contained few f - actin stress fibers, and nm2a staining was mostly localized to the lamellae. a marked increase in centripetal f - actin fibers running parallel to the plasma membrane in the lamella associated with nm2a filaments was characteristic of myo18a kd (figures 4a and 4b). the appearance of sparse, long stress fibers, associated with nm2a and extended along the length of the cells, was characteristic of myo1b kd (figures 4a4c). a line profile analysis of the frequency of actin bundles in the lamellae of kd cells showed that the frequency of bundles was reduced significantly (2.1 0.1 bundles/m, mean sem, n = 9) compared with controls (2.6 0.2 bundles/m, mean sem, n = 9, p < 0.5%) (figures 4a and 4b), suggesting that the actin cytoskeleton is being re - organized. myo9b kd cells contained a distinctive actin - rich area at the cell periphery from which nm2a was largely absent, in addition to an increase in stress fibers (figures 4a and 4b). myo10 kd cells showed loss of filopodia and the appearance of distinctive actin bundles in the central region of the cell (figures 4a and 4b). changes to the f - actin organization were associated with formation of focal adhesions at the edges of the cells, consistent with a more spread cell phenotype (figure 4c). knockdown of myo1b, myo10, or myo18a did not change phosphorylation levels of myosin light chain (mlc) (figure 4d), suggesting that nm2a is re - organized rather than activated as a result of their knockdown. kd did increase mlc phosphorylation 2-fold in cells, and this is likely to contribute to the actomyosin re - organization observed (figure 4d). these data show that myo10, myo9b, and myo1b are overexpressed in more highly metastatic cell lines and in metastatic tissue. high levels of myo10 in pc-3 cells are linked to high numbers of filopodia, and high levels of myo9b are linked to low levels of stress fibers. both isoforms contribute to a more migratory phenotype, as shown by immunostaining, cell migration, and kd experiments. myo1b and myo18a influence cell morphology and actin organization but have little effect on migration in 2d, whereas all four isoforms inhibit cell migration in invasion assays. therefore, changes in expression of several myosin isoforms may contribute to metastasis in prostate cancer. our finding that myo10-dependent filopodia are likely to be important in prostate cancer agrees with recent similar findings for breast cancer metastasis (arjonen., 2014, cao., 2014) and non - small lung cell cancer (sun., 2015). filopodia are important but not absolutely required for cell migration because myo10 kd cells can migrate in 2d but with a reduced speed, and other cells lacking filopodia can migrate (lundquist, 2009). the increased cell area resulting from myo10 kd agrees with previous findings (bohil., the central actin bundles in myo10 knockdown cells are reminiscent of actin bundles in filopodia. fascin is also required for filopodial formation (vignjevic., 2006), its overexpression results in multiple filopodia (vignjevic., 2006), and fascin levels are also upregulated in prostate cancer (darnel., 2009). myo10 kd may lead to actin bundling in the cell body by excess (non - phosphorylated) fascin. the role of two filopodial proteins, myo10 and fascin, in prostate (and other) cancers suggest that filopodium formation is key for metastasis. myo10 has also been implicated in integrin - mediated adhesion, and any reduction in adhesion resulting from its kd could disrupt signaling to the actin cytoskeleton and, therefore, indirectly result in changes in actin organization. high levels of myo9b expression in pc-3 cells are likely to contribute to their lack of stress fibers and, therefore, to enhanced migration. the rhogtpase - activating domain in myo9b inhibits rho, reducing the downstream activity of rock (rhokinase), thereby increasing mlc phosphatase activity, reducing mlc phosphorylation (reinhard., 1995, wirth., 1996), and, therefore, reducing actin stress fiber formation. knockdown of myo9b is therefore expected to increase mlc phosphorylation and stress fiber formation, as we observed. in agreement with our findings, a previous report has shown that cell migration was reduced and mlc phosphorylation increased in macrophages isolated from myo9b knockout mice (hanley., 2010). myo9b has also been implicated in an increased risk of esophageal cancer (menke., the high levels of myo1b in pc-3 cells and effects of knockdown on 3d invasion, cell shape, and morphology suggest that it, too, has a role in prostate cancer. myo1b has also been implicated in non - small - cell lung cancers (ohmura., myo1b (myr1/mm1 ; gillespie., 2001) regulates actin assembly in vesicular transport (post - golgi carriers [almeida., raposo., 1999 ]), and it maintains cortical tension at the plasma membrane, where it specifically associates with dynamic, non - tropomyosin - containing actin filaments (coluccio and geeves, 1999, tang and ostap, 2001). high endogenous levels of myo1b in more highly metastatic cells might therefore increase cortical tension, allowing cells to move through stiff extracellular matrices in vivo, perhaps explaining why knockdown of myo1b only affects migration in 3d but not 2d. the re - organization of actin and nm2a in myo18a kd cells may arise from its interaction with non - muscle myosin 2 (nm2). nm2 forms short filaments (300 nm long) containing 20 molecules (billington., the assembly / disassembly of non - muscle myosin 2 filaments is dynamic (shutova., 2014) and regulated by many different pathways (vicente - manzanares., 2009). myo18a and nm2a can form mixed bipolar filaments in vitro that are smaller that pure nm2a filaments (billington., 2015). the re - organization of nm2a we observed after knocking down myo18a, without a change to levels of light chain phosphorylation, supports the idea that an interaction between myo18a and nm2a modulates nm2a filament formation and organization in pc-3 cells. therefore, myo1b, myo9b, myo10, and myo18a each contribute to the morphology and migration of more highly metastatic pc-3 cells, with each myosin having a specific effect on actin organization. misregulation of their expression in cells with metastatic potential may allow them to work in concert to generate a torpedo - shaped cell with multiple protrusions that is better able to migrate through a 3d matrix and, therefore, more able to metastasize. many different drugs have now been developed that can inhibit specific myosin isoforms, including those in classes 1, 2, 5, and 6 (bond., 2013). importantly, these results emphasize that myosin not only uses actin as tracks to walk along but that it is able to actively drive actin organization in cells. lncap, du145, and pc-3 cells (from the atcc) were grown in rpmi 1640 medium with glutamax (gibco, life technologies) supplemented with 10% heat - inactivated fetal bovine serum (fbs) and penicillin - streptomycin. 1535np and ct cells (bright., 1997) they were grown in keratinocyte medium (gibco, life technologies) supplemented with 10% heat - inactivated fbs, 1% l - glutamate, antibiotics, bovine pituitary extract, and epidermal growth factor. the antibodies used were as follows : myo6 (h-215, santa cruz biotechnology) ; myo10 (hpa024223, sigma) ; total erk (p44/42 mitogen - activated protein kinase [mapk ], cell signaling technology) ; myo18a, a gift from prof. (chang gung university, taiwan ; hsu., 2010) or from genscript ; nm2a (prb-440p, covance) ; paxillin (sab4502553, sigma) ; myo1b (hpa013607, sigma) ; phospho - myosin light chain (cell signal) ; myo9b (proteintech) ; and glyceraldehyde 3-phosphate dehydrogenase (gapdh) (abcam). hrp - conjugated secondary antibodies and fluorescent phalloidin were from sigma, and fluorescent secondary antibodies were from molecular probes. sigenome smartpool sirna (ge healthcare, dharmacon) was used to silence myosins in pc-3 cells. cells were seeded at a density of 20,000 cells / ml in growth media and allowed to adhere and grow overnight. maximum kd was achieved after 72 hr. the rneasy mini kit (qiagen) rt - pcr was used to detect which myosin isoforms were expressed (table s1). real - time pcr using sybr green was used to investigate the expression levels of expressed myosins (see table s2 for primer sequences). cells were lysed (30 min, 4c) in lysis buffer (150 mm nacl, 0.05 m tris [ph 8 ], 1% triton x-100, and 1 mm edta [ph 8 ] with protease inhibitor cocktail (thermo scientific). lysates were clarified by centrifugation, protein content was quantified by bicinchoninic acid (bca) assay, and then samples were mixed with 2 laemmli buffer for use in protein gels (4%20% or 7.5%) and blots. chemiluminescence detection (supersignal west pico, thermo scientific) used multiple exposures to ensure signal linearity. if required, membranes were stripped using restore western blot stripping buffer (thermo scientific) and re - probed. cells were grown on glass coverslips, fixed with 2% paraformaldehyde in pbs, and stained using standard procedures (swailes., 2006)., cells were plated onto a glass - bottomed 96-well plates, transfected with non - targeting sirna or with myosin kd sirna (three replicates each), serum - starved 48 hr later for 24 hr, and then treated with hepatocyte growth factor (hgf) (25 ng / ml) for filming. a minimum of three fields from each replicate was selected for imaging, over 14 hr at 5-min intervals using differential interference contrast (dic) optics, and a 20 lens (512 512 total pixel size, 2 2 binning) on a deltavision system. cell migration was analyzed using imagej software (mtrackj plugin). to perform the 3d - like circular invasion assay (yu and machesky, 2012), cell - free space was created using cell stoppers (ibidi). after removing the stopper, cells were covered with a thin layer of matrigel (4 mg / ml) and normal medium and allowed to grow and migrate for another 2448 hr. data are presented as mean sd for at least three separate experiments (n 3). a two - way anova was used to compare differences between groups, and statistical significance was accepted for p 0.05.	summarywe investigated the myosin expression profile in prostate cancer cell lines and found that myo1b, myo9b, myo10, and myo18a were expressed at higher levels in cells with high metastatic potential. moreover, myo1b and myo10 were expressed at higher levels in metastatic tumors. using an sirna - based approach, we found that knockdown of each myosin resulted in distinct phenotypes. myo10 knockdown ablated filopodia and decreased 2d migration speed. myo18a knockdown increased circumferential non - muscle myosin 2a - associated actin filament arrays in the lamella and reduced directional persistence of 2d migration. myo9b knockdown increased stress fiber formation, decreased 2d migration speed, and increased directional persistence. conversely, myo1b knockdown increased numbers of stress fibers but did not affect 2d migration. in all cases, the cell spread area was increased and 3d migration potential was decreased. therefore, myosins not only act as molecular motors but also directly influence actin organization and cell morphology, which can contribute to the metastatic phenotype.
since 2009 the international judo federation (ijf) established a world ranking list based on different competitions levels. before the last olympic games the athletes received a specific number of points according to their performance in the following competition : continental open, 100 points ; grand prix, 300 points ; continental championships, 400 points ; grand slam, 500 points ; world masters, 700 points ; world championship, 900 points ; olympic games, 1,000 points. the champion received 100% of these points, while the silver and bronze medalists received 60% and 40% of these points, respectively. as the ranking is dynamic across the season, points scored in the last 12 months are 100% valid, while points obtained in the 1324 months before a given date are reduced to 50%. additionally, nowadays the best five results in the 24 months range plus the performance either in the continental championship or in the world masters are considered. according to the ranking position, the first eight athletes taking part in a specific competition are seeded in the draw. furthermore, the 22 and 14 best ranked male and female athletes area directly classified to the olympic games, respectively (international judo federation, 2016). the olympic games are the most relevant competition for judo athletes (franchini and takito, 2014) and the most traditional nations in this sport need to invest a considerable amount of money to maintain their athletes taking part in the main competitions of the judo world tour (franchini., although the ranking system has been criticized due to the home advantage effect noticed in these competitions (ferreira julio., 2013 ; krumer, 2017) and to its low predictive value for the olympic games performance (franchini and julio, 2015), the fact that the draws are seeded has a strong influence on some countries trying to have a larger number of athletes among the top eight in each weight category. however, little is known concerning the real influence of being seeded on final performance in the olympic games. this information can be valuable to create strategies to optimize athletes participation in the judo world tour competitions and performance in the main judo competition (i.e., olympic games), while avoiding the risk of injury (kim., 2015). additionally, while the first ranked athlete is positioned in the theoretically easier pool, being the number one directs much attention from the opponents as the athlete in such position is normally considered the athlete to be defeated. thus, the main goal of the present study was to calculate the probability based on a bayesian approach to win a medal in the olympic games given the athlete is seeded and to verify if the number one ranked athlete has any advantage compared to other seeded athletes concerning his / her chances to be olympic champion. data from athletes who took part in the london 2012 and rio 2016 olympic games were considered in the present study, totaling 470 male and 307 female judo athletes from seven weight categories for each sex. in these competitions 112 athletes were seeded (eight for each weight category in each sex) and 56 medals were distributed. the main outcome was the probability of getting an olympic medal given the athlete was seeded (i.e., top eight in the world ranking list) compared to nonseeded athletes, as well as the probability of being olympic champion given the athlete was the best ranked compared to the other seeded athletes. thus, the seeded athletes and medal winners were identified in each specific draw during the two olympic games editions where this system was applied (i.e., london 2012 and rio 2016). if the initial probability p(m) of an event m occurring is influenced by a second given event c to happen, then it is possible to calculate an a posteriori probability p(m\|c) called conditional probability. bayesian approach uses the notion of conditional probabilities, but also updates the initial odds with new hypothesis. these new hypothesis work as weights on a weighted average. in short, bayes theorem is stated by : for all i=1, 2,, n. (adapted formula from bussab and morettin, 2010). the first step done by the present study was to calculate the probability p(m1\|c) of getting an olympic medal given the athlete was seeded (i.e., top eight in the world ranking list) compared to nonseeded. the following probabilities were used to calculate p(m1\|c) : p(m1) : initial probability of an athlete, seeded or nonseeded, winning a medal is equal to rn, where r = number of medals at stake ; n = number of competitors ; p(m1c) : probability of an athlete, seeded or nonseeded, not winning a medal is equal to 1-p(m1) ; p(c\|m1) : probability of being a seeded athlete given this athlete won a medal is equal to wr, where w = number of seeded athletes who won a medal ; p(cm1c) : probability of being a seeded athlete given this athlete did not win a medal is equal to lr, where l = number of seeded athletes who did not win a medal. thus, the probability of getting an olympic medal given the athlete was seeded (i.e., top eight in the world ranking list) compared to non - seeded was calculated by : according to the table 1, for example, the probability of an athlete getting an olympic medal, in london 2012, given that this athlete was seeded in the under 66-kg weight category is equal to 0.111 0.5000.111 0.500 + 0.889 0.1870.250. the second step done by the present study was to calculate the probability p(m2\|c) of being olympic champion given the athlete was the best ranked one compared to the other seeded athletes. in this case, the probabilities were not calculated by categories, but among males and females, as well as in london 2012 and rio 2016. to finally calculate p(m2\|c), the following probabilities were previously found : p(m2) : initial probability of the best seeded athlete being olympic champion is equal to os, where o = number of olympic champions ; s = number of seeded athletes ; p(m1c) : probability of the best seeded athlete not being olympic champion is equal to 1p(m2) ; p(c\|m2) : probability of being the best seeded athlete given this athlete was olympic champion is equal to ba, where b = number of best seeded athletes who were olympic champions ; a = number of seeded athletes who were olympic champions ; p(cm2c) : probability of being the best seeded athlete given this athlete was not olympic champion is equal to de, where d = number of best seeded athletes who was not olympic champions ; e = number of seeded athletes who were not olympic champions. thus, the probability of being olympic champion given the athlete was the best ranked compared to the other seeded athletes was calculated by : according to the table 3, for example, the probability of an athlete being olympic champion given that this athlete was the best male seeded in his category, london 2012, is equal to 0.125 0.2000.125 0.200 + 0.875 0.1180.195. the draws of each weight category for each sex and olympic games edition were retrieved from the ijf website (http://www.ijf.org) and these archive data are from open - access. morley and thomas (2005) affirm that there are no ethical issues in analyzing or interpreting these data since they were obtained in secondary form and not generated by experimentation. in addition, athletes personal identifications were replaced by a code, ensuring anonymity and confidentiality. this process was used in previous studies analyzing competitions of the world ranking list (ferreira julio., 2013 ; franchini and julio, 2015 ; franchini., 2016). data from athletes who took part in the london 2012 and rio 2016 olympic games were considered in the present study, totaling 470 male and 307 female judo athletes from seven weight categories for each sex. in these competitions 112 athletes were seeded (eight for each weight category in each sex) and 56 medals were distributed. the main outcome was the probability of getting an olympic medal given the athlete was seeded (i.e., top eight in the world ranking list) compared to nonseeded athletes, as well as the probability of being olympic champion given the athlete was the best ranked compared to the other seeded athletes. thus, the seeded athletes and medal winners were identified in each specific draw during the two olympic games editions where this system was applied (i.e., london 2012 and rio 2016). if the initial probability p(m) of an event m occurring is influenced by a second given event c to happen, then it is possible to calculate an a posteriori probability p(m\|c) called conditional probability. bayesian approach uses the notion of conditional probabilities, but also updates the initial odds with new hypothesis. these new hypothesis work as weights on a weighted average. in short, bayes theorem is stated by : for all i=1, 2,, n. (adapted formula from bussab and morettin, 2010). the first step done by the present study was to calculate the probability p(m1\|c) of getting an olympic medal given the athlete was seeded (i.e., top eight in the world ranking list) compared to nonseeded. the following probabilities were used to calculate p(m1\|c) : p(m1) : initial probability of an athlete, seeded or nonseeded, winning a medal is equal to rn, where r = number of medals at stake ; n = number of competitors ; p(m1c) : probability of an athlete, seeded or nonseeded, not winning a medal is equal to 1-p(m1) ; p(c\|m1) : probability of being a seeded athlete given this athlete won a medal is equal to wr, where w = number of seeded athletes who won a medal ; p(cm1c) : probability of being a seeded athlete given this athlete did not win a medal is equal to lr, where l = number of seeded athletes who did not win a medal. thus, the probability of getting an olympic medal given the athlete was seeded (i.e., top eight in the world ranking list) compared to non - seeded was calculated by : according to the table 1, for example, the probability of an athlete getting an olympic medal, in london 2012, given that this athlete was seeded in the under 66-kg weight category is equal to 0.111 0.5000.111 0.500 + 0.889 0.1870.250. the second step done by the present study was to calculate the probability p(m2\|c) of being olympic champion given the athlete was the best ranked one compared to the other seeded athletes. in this case, the probabilities were not calculated by categories, but among males and females, as well as in london 2012 and rio 2016. to finally calculate p(m2\|c), the following probabilities were previously found : p(m2) : initial probability of the best seeded athlete being olympic champion is equal to os, where o = number of olympic champions ; s = number of seeded athletes ; p(m1c) : probability of the best seeded athlete not being olympic champion is equal to 1p(m2) ; p(c\|m2) : probability of being the best seeded athlete given this athlete was olympic champion is equal to ba, where b = number of best seeded athletes who were olympic champions ; a = number of seeded athletes who were olympic champions ; p(cm2c) : probability of being the best seeded athlete given this athlete was not olympic champion is equal to de, where d = number of best seeded athletes who was not olympic champions ; e = number of seeded athletes who were not olympic champions. thus, the probability of being olympic champion given the athlete was the best ranked compared to the other seeded athletes was calculated by : according to the table 3, for example, the probability of an athlete being olympic champion given that this athlete was the best male seeded in his category, london 2012, is equal to 0.125 0.2000.125 0.200 + 0.875 0.1180.195. the draws of each weight category for each sex and olympic games edition were retrieved from the ijf website (http://www.ijf.org) and these archive data are from open - access. morley and thomas (2005) affirm that there are no ethical issues in analyzing or interpreting these data since they were obtained in secondary form and not generated by experimentation. in addition, athletes personal identifications were replaced by a code, ensuring anonymity and confidentiality. this process was used in previous studies analyzing competitions of the world ranking list (ferreira julio., 2013 ; franchini and julio, 2015 ; franchini., 2016). table 4 presents the probability of seeded athletes to win medals in each olympic games. for males the probability of seeded athletes to win a medal was 41.1% and 42.9%, while for females it was 35.7% and 44.6% at london 2012 and rio 2016, respectively. additionally, the probability of athletes ranked as number one to become olympic champion among the seeded athletes was 19.5% and 36.8% for males and 32.3% and 36.8% for females in london 2012 and rio 2016, respectively. the main findings of the present study was that athletes seeded had a chance of 25.0% to 50.0% for males and between 12.5% to 50.0% for females to win an olympic medal, resulting in an overall probability of around 41.1% when all groups are considered. moreover, being the first seeded athlete (i.e., ranked number one) resulted in an overall probability to become olympic champion of around 31.0% when male and female athletes are grouped. based on this information, it seems relevant to have seeded athletes, but being the top ranked athlete does not seem to result in an expressive advantage to become olympic champion compared to other seeded athletes. as the world ranking list is used as the main criteria to qualify to the olympic games, which is the most prestigious competition to judo athletes (franchini and takito, 2014), and the position in this ranking determines the seeded athletes in each weight category, most athletes take part in four to eight competitions during the year to guarantee their direct qualification to the competition (i.e., top 22 for males and top 14 for females) (franchini., 2016). the competitions comprising the judo world tour are disputed in different countries, although the higher concentration be in europe (ferreira julio., 2013). thus, countries with limited financial resources or with high number of elite judo athletes should consider the specific cost - benefit of conducting such travels specifically to qualify their athletes to the olympic games or focusing on the seeded positions. moreover, the fact that a high number of injuries is observed in high - level judo athletes (kim., 2015), the exposure to a higher number of competition, the interval needed to increase the probability of winning (franchini., 2016), the high physiological demand of judo competitions (franchini., 2013), the fact that many judo athletes lose weight to compete (artioli., 2007)and the training needed to prepare athletes to them (franchini and takito, 2014 ; franchini., 2014) these aspects are especially important, as the ranking position is a poor predictor of the final result during the olympic games (franchini and julio, 2015) and some categories are more balanced than others (krumer, 2017). although the number one ranked athlete is positioned in a theoretically easier pool (as the best ranked athlete to be confronted in the semifinal is the number four, while number two may confront the number three in a semifinal) the probability of becoming olympic champion is not so high. this seems to happen due to the large focus that opponents rely on the top ranked athlete and to the common pressure media and supporters put on these athletes. in summary, the present study used a bayesian approach to determine the probability of seeded athletes to win a medal in the olympic games compared to other athletes and the probability of number one ranked athletes to become olympic champions compared to seeded athletes. as the probability of seeded athletes to get an olympic medal is around 41.1% and the probability of number one ranked athletes to become olympic champions is 31.0%, the cost - benefit of investing human and financial resources to this goal and the athlete exposure to competitions resulting in technical - tactical analysis of the opponent and higher risk of injury should be carefully analyzed when determining the competition calendar to each athlete.	the main purpose of the present study was to calculate the probability based on a bayesian approach to win a medal in the olympic games given the athlete is seeded and to verify if the number one ranked athlete has any advantage compared to other seeded athletes concerning his / her chances to be olympic champion. for this, data from athletes who took part in the london 2012 and rio 2016 olympic games were considered. for males the probability of seeded athletes to win a medal was 41.1% and 42.9%, while for females it was 35.7% and 44.6% at london 2012 and rio 2016, respectively. furthermore, the probability of athletes ranked as number one to become olympic champion among the seeded athletes was 19.5% and 36.8% for males and 32.3% and 36.8% for females in london 2012 and rio 2016, respectively. based on these results the cost - benefit of investing human and financial resources to qualify an athletes among the top eight competitors and his / her exposure to competitions resulting in technical - tactical analysis of the opponent and higher risk of injury should be carefully analyzed when determining the competition calendar to each athlete.
unicystic ameloblastoma (uca) was first described by robinson and martinez, to delineate its less aggressive course compared to solid ameloblastoma. with the exception of age of onset and biologic outcome, the purpose of this report is to present a case of uca showing a pericoronal radiolucency in the primary lesion and multilocular radiolucency in the recurrent lesion. an 8-year old girl presented in march 2005, with a painless swelling on the left side of the mandible of 1 month duration. extra orally, slight asymmetry was noted and intra orally, the swelling was seen extending from mandibular left permanent first molar to the retro molar region. panoramic radiograph showed a unilocular radiolucency between mandibular left first permanent molar and anterior margin of the ramus, enclosing the crown of permanent second molar [figure 1 ]. panoramic radiographic examination of the initial lesion showing a unilocular radiolucency between mandibular left first permanent molar and anterior margin of the ramus, enclosing the crown of the permanent second molar histologically, the incisional specimen was characterized by a cystic lining with ameloblast - like basal cells and stellate reticulum - like overlying cells. the fibrous wall was devoid of odontogenic islands and slightly myxoid in character [figure 2 ]. in april 2005, the post surgical specimen showed same features as incisional biopsy specimen but the fibrous wall showed inactive odontogenic islands [figure 2-inset ]. histopathological examination of the incisional specimen characterized by a cystic lining ameloblast - like basal cells and stellate reticulum - like overlying cells. fibrous wall showing inactive odontogenic rests (h and e stain, 60 ; 240) the patient returned with the complaints of pain and swelling in 2009. intra orally, the swelling was found in the edentulous region in relation to missing second permanent molar. radiographically (panoramic and lateral oblique view radiographs), a multiculocular, soap bubble, radiolucency was found between the anterior border of the ramus and second premolar [figures 3 and 4 ]. the lesion was treated by segmental resection with immediate reconstruction using a low cost stainless steel mandibular plate [figure 5 ]. microscopically, an epithelial lining with intraluminal plexiform growth was observed [figure 6b ]. multiple blocks (soft and hard tissues) and serial sections were evaluated ; however, neither mural component nor infiltration into bony margins was seen. panoramic radiographic examination of the recurrent lesion showing a multilocular, soap bubble, radioluceny between the anterior border of the left ramus and left second premolar lateral oblique view radiograph of the recurrent lesion showing a multilocular appearance between the anterior border of the left ramus and left second premolar low cost stainless steel mandibular reconstruction plate fixed immediately after mandibular segmental resection (a) post surgical radiographic evaluation showing a monocystic lesion with expanded but intact cortical plate and no lower border peroforation. (b) histopathologic examination of a specimen of the recurrent lesion showing an epithelial lining with intraluminal plexiform (h and e stain, 40) uca, strictly, implies not a unilocular radiographic pattern but refers to the monocystic appearance, grossly and microscopically. radiographically, uca can present unilocular, pericoronal and multilocular patterns, each with different age predilection. in the current case, a pericoronal radiolucency was found 4 years earlier (primary) and a multilocular radiolucency 4 years later (recurrent). there is no available information in the literature about the dual radiographic pattern between the primary and the recurrent lesion. in robinson and martinez, series, the mean age for dentigerous radiographic pattern was 19 years and 47 years for non - dentigerous unilocular lesions. on the other hand, eversole, found a mean age of 33 years for multilocular and 19 years for lesions with a unilocular radiographic pattern. these indicate that uca may show multilocular radiographic pattern in older adults rather than children. in the current case, both the primary and recurrent lesions occurred at a lower age. this is not unusual as others have also found uca in children less than 15 years of age.[146 ] in general, uca frequently is found in association with mandibular third molars, while it is less frequently found in relation to permanent second molar or premolars.. according to robinson and martinez, uca may show either ameloblastic type of epithelial lining cells or non - ameloblastomatous epithelium. uca are typed into three subtypes with simple unicystic, luminal and mural categories with implications for difference in biologic behavior. there are a number of views regarding the genesis of uca ; de novo origin, from non - neoplastic odontogenic cyst and cystic degeneration of solid ameloblastoma. in our case, both primary and the recurrent lesion displayed ameloblastic epithelium and both were of simple uca type. a similar finding of identical histology of primary and recurrent lesion was also found by rosenstein. treatment modalities for uca include enucleation, enucleation followed by application of carnoy 's solution, marsupialization followed by surgery, and resection. these surgical techniques offer a success rate of 70%, 82%, 84% and 96%, respectively. several factors are taken in to consideration in the treatment of uca in children ; these include size, location, duration, mural component, psychological impact, control of possible recurrence and scope for follow - up. psychology plays an important role in the decision making because of its negative impact on growth and function. further, the precise histological subtyping of uca or distinction from solid ameloblastoma is often difficult to make, prior to definitive surgery. in view of this, primary lesions are treated by means of conservative procedure ; however, when odontogenic cell rests or mural component are found in the fibrous wall, it would be prudent to resect uninvolved normal bone along with lesional tissue. in our case, odontogenic cell rests were not apparent in the primary lesion and was found only on post surgical evaluation. the short recurrence time in the current case might well be related to the presence of odontogenic rests. the current treatment policy for uca advocates more aggressive measures, even for primary lesion, such as peripheral osteotomy or segmental resection. in conclusion, a case of uca in a child with a dual radiographic pattern is presented.	unicystic ameloblastoma (uca) is a clinical subtype of ameloblastoma that is considered prognostically different. the purpose of this report is to present a case of uca showing dual radiographic pattern in a child. a detailed study of the lesion was carried out in an 8 year old female child who presented to our department of oral and maxillofacial pathology. clinical, radiological and histopathological findings were recorded. in march 2005, a painless swelling in the left side of the mandible was noted, which on radiographic examination showed a unilocular radioluceny enclosing the crown of mandibular left permanent second molar, extending between the left first permanent molar and anterior margin of the ramus. histopathologic diagnosis was uca. the lesion was treated by enucleation. the patient returned with recurrence in 2009, at this time the lesion radiographically presented as a multilocular radiolucency with a soap bubble appearance, extending between the anterior border of the ramus and second premolar. histopathologic diagnosis was uca. the lesion was treated by segmental resection with immediate reconstruction. although a number of treatment modalities are available to treat uca, many factors need to be taken into consideration in the treatment of uca in children.
nurse turnover is a costly problem that will continue as healthcare faces the impending nursing shortage ; a new generation of nurses enters the workforce, and incentives provided to nurses to work for institutions increase. a variety of factors influence the retention of nurses in adult care settings, including work satisfaction, group cohesion, job stress, and work schedule. again, recruitment, retention, turnover, and development of quality care in nursing are global issues within the health care setting. although the definition of turnover varies according to different literature, employee turnover is defined as the ratio of the number of workers that had to be replaced in a given time period to the average number of workers, and generally viewed as the movement of staff out of an organization. employee job satisfaction is the fulfillment, gratification, and enjoyment that comes from work. it is not just the money or the fringe benefits, but the feelings employees receive from the work itself. the most used research definition of job satisfaction is by locke who defined it as a pleasurable or positive emotional state resulting from the appraisal of one 's job or job experiences. implicit in locke 's definition is the importance of both effect, or feeling, and cognition, or thinking., it is defined simply as how people feel about their jobs and different aspects of their jobs. it is the extent to which people like (satisfaction) or dislike (dissatisfaction) their jobs. wikipedia also defines job satisfaction as a pleasurable emotional state resulting from the appraisal of one 's job, an affective reaction to one 's job, and an attitude towards one 's job. the ability to produce, the quality of the work, the opportunity to learn and express creativity, the sense of pride in their profession, the recognition for a job well done, the ability to work well in a team, the social satisfaction derived from relationships at work, the opportunity to experience personal growth and the rewards from a physically supportive work environment, and autonomy are all factors that impact job satisfaction [1, 8 ]. intrinsic factors are those internally derived and include personal achievement, sense of accomplishment, and prestige. extrinsic factors are those derived from factors in the practice environment and include pay and benefits, working conditions, and resources. to study job satisfaction edwin a. locke 's range of affect theory is arguably the most famous job satisfaction model. the main premise of this theory is that satisfaction is determined by a discrepancy between what one wants in a job and what one has in a job. further, the theory states that how much one values a given facet of work (e.g., the degree of autonomy in a position) moderates how satisfied / dissatisfied one becomes when expectations are / are not met. when a person values a particular facet of a job, his satisfaction is more greatly impacted both positively (when expectations are met) and negatively (when expectations are not met), compared to one who does not value that facet. it is a very general theory that suggests that people have innate dispositions that cause them to have tendencies toward a certain level of satisfaction, regardless of one 's job. this approach became a notable explanation of job satisfaction in light of evidence that job satisfaction tends to be stable over time and across careers and jobs. this theory states that satisfaction and dissatisfaction are driven by different factors motivation and hygiene factors, respectively. an employee 's motivation to work is continually related to job satisfaction of a subordinate. motivation can be seen as an inner force that drives individuals to attain personal and organization goals. motivating factors are those aspects of the job that make people want to perform, and provide people with satisfaction, for example, achievement in work, recognition, and promotion opportunities. hackman and oldham proposed the job characteristics model, which is widely used as a framework to study how particular job characteristics impact job outcomes, including job satisfaction. the model states that there are five core job characteristics (skill variety, task identity, task significance, autonomy, and feedback) which impact three critical psychological states (experienced meaningfulness, experienced responsibility for outcomes, and knowledge of the actual results), in turn influencing work outcomes (job satisfaction, absenteeism, work motivation, etc.). the happier people are within their job, the more satisfied they are said to be. the most common way of measurement of job satisfaction is the use of rating scales where employees report their reactions to their jobs. questions relate to rate of pay, work responsibilities, variety of tasks, promotional opportunities in the work itself, and coworkers. all nursing associations and unions report a deteriorating quality of work - life for nurses. quality of work - life is widely believed to be one of the most important factors in recruitment and retention, thus having an impact on the current and the future supply of nurses. to deal with the problem, the range of issues includes appropriate workload ; professional leadership and clinical support, adequate continuous professional education, career mobility and career ladders, flexibility scheduling and deployment, professional respect, protection against injuries and diseases related to the work place, and good wages. peru stated that a major challenge for national, regional, and local governments is the implementation of strategies to reduce maternal mortality and chronic child malnutrition so as to create conditions for sustainable development. achieving these results requires not only adequate implementation of health services but also placing the right people in the right places, obtaining a fair distribution of health professionals in different regions, according to the different health needs of the population (toronto call to action towards a decade of human resources in health for the americas, 20062015). this means confronting common problems in the management and development of human resources, including limited development of health personnel competencies, health personnel in remote areas who lack access to training opportunities, poor coordination with training institutions whose training does not meet regional needs, training programs carried out in settings different from the actual work context, no performance evaluation based on competencies, and high turnover rates for trained staff. job satisfaction 's consequence can be discussed from different points of views ; maslow suggests that employees will always tend to want more from their employers. when jobs are secure they will seek ways of satisfying social needs and if successful will seek the means to the ultimate end of self - actualization. employees who are satisfied with their work tend to remain in their jobs. intuitively, it is easy to link patient safety and patient satisfaction to employee satisfaction. a happy employee is focused on their professional tasks, without being distracted by a negative environment, which leads to better performance. for example, the georgia quality initiative, which began in 2003, has identified that long term care (ltc) facilities with happy employees have fewer patient falls, and fewer residents with acquired pressure ulcers and acquired catheters. there is also statistically valid evidence that shows a strong relationship between patient satisfaction and employee satisfaction. nurses who were not satisfied at work were also found to distance themselves from their patients and their nursing chores, resulting in suboptimal quality of care. dissatisfaction with work can cause poor job performance, lower productivity, and staff turnover and is costly to organizations. the relationship between job satisfaction and performance was found to be even higher for complex (e.g., professional) jobs than for less complex jobs. in addition, most importantly there is growing evidence of the association between health care workers ' job satisfaction and the outcome of health care. stress and illness contribute to poor clinical judgment, risking harm to patients ; stressed workers are vulnerable to injury and have a higher absenteeism rate. although some turnover can revitalize an organization, a high voluntary turnover rate can have negative consequences. these include costs associated with recruitment and orientation of new nurses, loss of experienced nurses, periods of short staffing accompanied by overtime for remaining rns, or use of temporary agency staff who are less familiar with the setting than employees, and potential for increase in adverse patient outcomes. career opportunities and training afford individuals the prospect of further developing themselves and growing within the ranks of their career. they also acknowledge experience and time dedicated to nursing, which provides much - needed recognition in the field of nursing. low wages, lack of resources to work effectively, limited career opportunities, and limited educational opportunities are other important factors. because of insufficient staffing levels nurses become frustrated with their inability to complete their work to their professional satisfaction, and they experience difficulties in meeting patient 's needs. once the comparison of the gap between capabilities needed in the organization and those existing in employees is identified, then training and development activities must be designed. the focus throughout this is providing guidance to employees and creating awareness of career growth possibilities within the organization. for many individuals, continuing to enhance their capabilities and knowing that there are growth opportunities in the organization may lead to greater job satisfaction and longer employment with that organization. the relationships of nurses with physicians may be very positive, but it also results in some of the most stressful encounters for nurses. because this stress plays a key role in job satisfaction, when these relationships lack respect and trust, the result is a difficult working environment and potential for ineffective patient care. interpersonal relationships always are the result of actions by both parties, and both are responsible for their success. as supplementary to this the result of the survey of more than 10,000 nurses in texas shows 82% of staff nurse and 77% of nursing directors had experienced verbal abuse in their practice and verbal abuse was responsible for 1618% of the turnover rate of staff nurse and 1842% of the turnover rate for directors of nursing. according to herzberg two - factor theory of job satisfaction, people are made dissatisfied by a bad environment, but they are seldom made satisfied by a good environment. investigating possible changes over time in sources of dissatisfaction revealed that factors related to the work environment rather than individual or demographic factors were still of most importance to nurses ' turnover intentions. the differences found to occur across work settings necessitates analysis of job satisfaction at ward level, and the contribution of qualitative methods to develop more insight that is detailed is emphasized. predictors of registered nurse (rn) turnover have included intent to leave, nurse job dissatisfaction, salary, fewer years on the job, not enough time to do the job well, and demographic characteristics (male, unmarried, nonwhite, and no children living at home are more likely to leave). according to rambur intent to leave for reasons associated with job dissatisfaction was higher than leaving for reasons associated with career advancement or situational reasons across all educational preparations. in addition to improved patient satisfaction, other benefits of measuring and improving employee satisfaction include reduced turnover, associated reductions in training costs, identifying cost - saving opportunities, curbing absenteeism, strengthening supervision, evaluating patient - service issues, assessing training needs, streamlining communication, benchmarking the facility 's progress in relation to the industry, and gauging employee 's understanding of, and agreement with, the facility 's mission. today 's global nursing shortage is having an adverse impact on health systems around the world. a major initiative by the international council of nurses (icn) yielded important information regarding the shortage and solutions to it. these are organized into five priority areas : policy intervention ; macroeconomics and health sector funding ; workforce planning and policy, including regulation ; positive practice environments ; retention and recruitment (includes migration) ; and nursing leadership. international momentum is building, providing the opportunity to bring attention to these issues and to take action. the rapid expansion of training and health service institutions creates a major gap in terms of human resource for health (hrh) as trainers, service providers, and managers. moreover, the health policy of ethiopia emphasizes training of community based task - oriented frontline and midlevel health workers. as a mechanism to retain health workers, the policy supports developing an attractive career structure ; remuneration and incentives for all categories of workers within their respective systems of employment have been considered. the 2006 who estimates indicate that ethiopia has one of the lowest health workers per population ratio of the 57 crisis countries with one health worker for every 4,050 people, and the highest estimated shortage of 152,040 health workers needed to reach the target 2.3/1000 ratio. to deal with this the g8 endorsement of the agenda for global action (aga) has been mapped six recommendations against the problem based on study done on four sub - saharan countries. from that, aga 3 and 4 are about scaling up health worker education and training, retaining an effective, responsive, and equitably distributed health workforce. the nurse workforce in sub - saharan africa (ssa) is a significant component of its health workforce, perhaps more than on other continents. nurses constitute 4560 percent of the entire health workforce with nurses responsible for a broad range of services. generally, the nurse to physician ratio is much higher in ssa than on other continents which is between 20 : 1 and 11.6 : 1 in tanzania and ghana, respectively, to a low ratio of 2 : 1 and 2.5 : 1 in madagascar and central africa republic. while the ratio of nurses to doctors may be high, the ratio of nurses to population in ssa tends to be much lower than in most other regions of the world. in the study undertaken in united state at different times, the national turnover rate for hospital nurses was 12% in 1996, 15% in 1999, and 26.2% in 2000. in the study done specifically in north central west virginia, job satisfaction significantly correlated with context, structure, and attitudes variables even though age was not correlated with job satisfaction. in a study conducted in kuwait to assess nurse job satisfaction they found significant relationship of job satisfaction with marital status with positive. however, a higher level of education qualification showed an invasive relationship with job satisfaction which is also supported by larrabee.. but other nurse researchers indicated younger nurses with less work experience, lower professional titles, and lower working positions experienced lower levels of emotional exhaustion which is positively related to job satisfaction and negatively to intention to turnover. 's who was said rns with more years of experience had highest job satisfaction, lowest burnout, and were less likely to leave [26, 27 ]. age of worker was also considered as one influencing factor of job satisfaction and turnover. in a study done in china, for 2030-year - old nurses, work satisfaction and for the 4150-year - old nurses, work satisfaction and group cohesion was predictive of anticipated turnover. for the nurse who is 51 or older, there were no significant predictors of turnover [1, 25 ]. in canada turnover of nurse in relation to years of service was that 30% of new nurses left their jobs in the first year and 57% resigned in their second year. for american nurses, overall nursing experience was significantly related to intention to leave (f(9,38) = 2.64, p = 0.02). nurses with less than 1 year experience and between 10 and 11.5 years experience were significantly less likely to indicate intention to leave than those with 11.5 years experience (p values 0.8. were communicated overviews regarding nurse job satisfaction, its impact on health care delivery system, about effective data collection methods, and ethical issue during data collection. the pi and two recruited supervisors were responsible for supportive supervision on the spot and checking questionnaire on daily basis. the responses in the completed questionnaire were coded and entered into a data entry template. bivariate analyses between dependent and independent variables were performed using chi - square () and binary logistic regression. the correlations between the variables measured on an interval scale analyzed computing the product - moment correlation coefficients (i.e., pearson 's r) (table 9) which showed the intensity and direction of the relationships between the variables. in this study, hierarchical regression analyses were done to formulate models that best predict nurse job satisfaction and intention to leave the organization. the tape - recorded qualitative data were transcribed and translated to english under selected themes based on the question guides and summarized manually. ethical approvals for the study were obtained from ethical review committee (erc) of the college of public health and medical sciences, jimma university and hawassa university. official letters that were obtained from nursing department were delivered to sidama zonal health department and hawassa referral hospital. the letters of approval and cooperation obtained from the zonal health bureau were presented to all woreda health departments then to the selected health institutions. informed consent was taken orally from each participant before start of data collection (qualitative) and oral consent from quantitative participants. confidentiality was assured by indicating they are not requested to write their name on the questionnaire and by assuring that their responses will not in any way be linked to them. in addition, they have been told they have the right not to participate and withdraw from the study. the findings will be presented to the jimma university scientific community in a defense and the result submitted to the department of nursing college of public health and medical sciences. the findings will also be communicated to the local health planners and other relevant stakeholders at national, regional, and zonal levels to enable them to take and apply research recommendations during their planning process. publications in peer - reviewed, national, or international journals will also be considered. out of proposed 278 samples, 242 nurses were involved making the response rate to be 87%. the mean (sd) age of the participants was 28.13 (6.27) years (28.35 6.79 for females and 27.67 4.98 for males). from total study participants 131 (54.1%) were single and 94 (38.4%) have work experience of 2 years to 5 years. the highest reported place of assignment of nurse in both health center and hospitals was opd 65 (26.9%), pediatrics (13.6%) and mch (13.2%), orderly. however, most of nurses working at opd come from health centers. in the study, 20 bsc nurses and 3 bsc midwives were involved while the rest were diploma graduates 219 (90.5%). from those diploma nurses 162 (66.9) were clinical nurse professionals. this study tried to look at the level of overall job satisfaction of staff nurses based on the eight subscales of job satisfaction. the lowest levels of job satisfaction were reported for benefits and salary (mean = 1.76) followed by satisfaction level for promotion (m = 2.0), and the highest levels of satisfaction were obtained from work environment and group cohesion (m = 3.15) followed by autonomy (m = 3.02). the internal reliability estimates in this sample (crombach 's alpha) ranged from 0.64 to 0.86. leadership relationships were not significantly associated with institution of respondent, sex, marital status, and educational qualification. however, strongly significant associations were seen with intention to leave the organization (p < 0.05), employment opportunity (p < 0.05), working unit (p < 0.05), job security and salary (p < 0.05), and professional training (p < 0.05) and working unit shows significant association with leadership relationship of nurse in their institutions. out of 242 respondents, 101 (45.5%) were dissatisfied with administration support for their work while 92 (38%) of respondents answered that they were satisfied with this aspect. by the level of recognition given to their work, similar proportions of the nurses were dissatisfied 99 (45.9%) and satisfied 94 (40.1%). generally, 138 (57.1%) of the study participants were satisfied with leadership relationship in their institutions. one woreda health bereau head said monthly we encourage them to have regular meeting in which all staffs discuss their problem in case team, this make their relation with their head smooth.. monthly we encourage them to have regular meeting in which all staffs discuss their problem in case team, this make their relation with their head smooth.. none of sociodemographic variable show significant association with level of promotion available in the institutions. the intention to leave the organization was also not significantly associated with level of promotion available in the organizations. as shown in table 3, by the level of support for continuing education 166 (68.6), opportunity for professional growth and support for personal growth 174 (74.9%) and development through education and training 143 (59.1%) were reported as dissatisfying. generally only 100 (41.3%) of nurses were satisfied with the level of promotion available in the facility. out of dissatisfied 142 nurses 97 (68%) were from health center while 45 (31.7%) were from hospital (figure 3). autonomy subscale was significantly associated with institution of work whether it is hospital or health center (p < 0.05) and working unit (p < 0.05). actually more dissatisfied with autonomy nurses were from hospital. however, the level of autonomy was not significantly associated with age, sex, marital status, work experience, educational qualification, and employment opportunity. hundred and six (43.8%) nurses were satisfied about the level of autonomy in nursing care decision at the work, while 106 (43.8%) were dissatisfied. regarding the level of support available to be fully accountable for already made decision, 102 (42.1%) of them were satisfied and 80 (33.1%) were responding as they were dissatisfied while the rest 60 (24.8%) kept neutral position. similarly, almost the same proportions were satisfied 96 (39.7%) and dissatisfied 99 (40.9%) with the freedom they have in using their own judgment in the work setup. generally, most of the workers were dissatisfied on general autonomy level 128 (52.9%) of which 83 (64.8%) were from health center while 45 (35.2%) were from hospital. in one health center head from aleta wando woreda said in all case teams where nurses are assigned they did what they like without intrusion of any body and they refer or treat as they like in all case teams where nurses are assigned they did what they like without intrusion of any body and they refer or treat as they like (4) work environment and group cohesion (table 4). from sociodemographic variable only institutions of respondents were significantly associated with working environment and group cohesion subscale (p < 0.05) ; the rest (age, sex, marital status, educational qualification, unit of assignment, and year of experience) were not significantly associated. the result from the survey demonstrates that 109 (45%) nurses were satisfied with working environment allowing them to make autonomous nursing care decision while 46 (19.0%) of respondents answered neutral and 87 (36%) were reporting dissatisfaction. for the level of the working environment enabling the feeling accountable for the decision they have already made, 112 (46.3%) considerable number 51 (21.1%) is still kept in neutral position regarding satisfaction level of the working environment enabling the feeling accountable for the decision they have already made. regarding the level of adjustment of working environment that suits the patient 's need in practice 117 (48.3%) of nurses were satisfied, while 48 (19.8) kept neutral state about the issue. one - third of respondents were dissatisfied with the level of working environment encouraging them to make adjustment on work to suit patient 's need. most of nurses 104 (43.0%) were dissatisfied with the stimulating action of the working environment while only 86 (35.5%) were satisfied with it. as shown from bar graph below, one hundred and five (43.4%) of study participants reported as they have been satisfied with the level of working environment allowing them to expand their scope of practice while comparably around 97 (40.1%) were not satisfied on this aspect of the work. regarding environmental provision of high level of clinical competence, 108 (44.6%) of them were satisfied while 90 (37.2%) were reporting they were not satisfied. most of staff nurses were satisfied with relationship among staffs in working environment 147 (60.7%) and by the level of staffs influencing one another positively in the working setup 135 (55.8%). we are too happy about relationship among us we respect one another as staff member, we invite help from one another if any confusion..i think this is one powerful think we hope to stay in the hospital because no one want to leave love and joy additionally the majority of nurses were satisfied with relationship with physician 110 (45.5%) while 81 (33.5%) of respondents answered that they were not satisfied with the relationship. generally 132 (54.5%) of study participants were satisfied with working environment and group cohesion subscale while 110 (45.5%) of them were dissatisfied with it. qualitatively, most of informants consider the working environment and group cohesion subscale in the direction of intimacy between them. almost all are happy and reported all staffs are satisfied with the level of relationship, helping one another and socializing among staffs. only sex (p < 0.05) and institution of work (p < 0.05) were significantly associated with professional training subscale ; the rest (age, educational status, marital status, working unit and working experience) were not significantly associated. by the level of training opportunities available in their institutions the majority 130 (53.7%) of nurses were not satisfied while only 62 (25.6%) of nurses repored satisfaction and the rest 50 (20.7) were neither satisfied nor dissatisfied. again 106 (43.8%) of nurses were dissatisfied with the appropriateness of the training available for enhancing nursing job performance while only one - third 78 (32.3%) of them reported that they were satisfied. in other aspect 121 (50.0%) of nurse were dissatisfied with the level of orientation to new staff coming to the institutions while only 80 (33.1%) of nurses were satisfied with the level of orientation. research is too important in clinical patient care so as to have evidence based practice but most of staff nurses were not satisfied with the level of participation on research activity 150 (60.0%) while only 54 (22.3%) were satisfied. first as for short term in - service training one nurse from health center said when one training came to health center we sit for discussion to select appropriate and relevant person for the specified training in this aspect all staffs are happy in the second aspect they see with respect to continuous education, one unit head nurse said previously staffs are few in number and round for further education was frequent now further education become difficult.. we worried about that they said no curriculum designed for those 10 graduated nurse we do the job without hope that is the most dissatisfying aspect of job regarding promotion available in our hospital generally by the professional training subscale 106 (43.8%) of study participants were scoring above the mean (satisfied) while 136 (56.2%) were scoring below the mean (dissatisfied). (6) benefits and salary (figure 6). regarding the benefits and salary subscale with sociodemographic variables overall satisfactions of respondents were not significantly associated with benefits and pay subscale as shown in table 5, more than three - fourth of respondents were dissatisfied with appropriateness of salary composition for their employment 196 (81.0%), while only 26 (10.7%) respondents answered with their satisfaction. comparably most of respondents were dissatisfied with the level of employee benefits in organization and pay in relation to cost in their living area 180 (74.4%) and 183 (75.6%), respectively. one health center head said we nurse are not considered well in salary adjustment last time but other profession fevered during that.. we nurses now ignore the level payment and satisfaction we found from it and we consider only satisfaction we get from our job byitself most of nurses 188 (48.8) were dissatisfied with the level of sense of value given for what they do in their working organizations. again by the consideration given to their personal need from the organization 50 (20.7%) feel satisfied, 63 (26.0%) kept neutral, and 129 (53.3%) responded they were dissatisfied. almost half 126 (52.1%) of respondents were dissatisfied with the level of consideration given to their opinion and suggestion for change in the work setting or practice while only 60 (24.8%) of them were satisfied. significant number of study participants 103 (42.6%) were satisfied when 90 (37.2%) of nurses responded they were dissatisfied by peer recognition of work. in qualitative part, informants are happy about recognition level given from the staffs and administrative bodies. most of respondents answered consistently that they have meeting with staffs in which good performers were recognized and those low performers were given their correction measure after implementation of the new reform bpr. one nurse was automatically dismissed from the hospital without stepwise disciplinary method made frustration to the staffs most of the nurses 94 (38.8%) were happy about the easiness of finding another job if they may quit the current one while 87 (36.0%) of them were dissatisfied with the chance. given their age, educational level, and economical condition, comparably 90 (37.2%) and 92 (38.0%) were satisfied and dissatisfied with the chance attaining suitable job in another organization, respectively. regarding the level of easiness to find another alternative job 104 (43.0%) of nurse were dissatisfied while 80 (33.1%) were satisfied and 58 (24.0%) maintained neutral position. generally talking, nurses were satisfied with perceived alternative employment opportunity 141 (58.3%), while 101 (41.7%) of nurses responded that they were not satisfied with the opportunity. it 's not the issue of age and sex, it is the matter of competence, if one have good skill and competence i think he can join everywhere if she / he loses his / her current job i perceive still nurses have good opportunity to work another health center head said since most of health center activity covered by nurses still we want to have more nurse for our institutions if possible and this also holds similar condition for other health center also there are plenty of job to find in contrary to this one respondent said i think the opportunity holds two aspects, for those graduated from private and for those from governmental institutions, usually the former kept less chance of attaining job easily study participants 115 (47.5%) of them scored below mean which means they are dissatisfied with their overall aspect of job, while the rest 127 (52.5%) scored above satisfaction level. in in - depth interview one respondent say i think nurse takes satisfaction from their performance or from relation with client apart from other aspect like administration and level of support for education and incentive and generally they are somehow satisfied regarding the level of overall satisfaction in - depth interview participants said that males are more satisfied than females but regarding the level of turnover intention, they ranked as first. one health center head said as known most of staff professional are females but according to our context i think males are performing well and satisfied more than female on job as known most of staff professional are females but according to our context i think males are performing well and satisfied more than female on job generally, regarding job satisfaction subscale four of them were reported as satisfying aspects of the job by the majority of respondents ; these were leadership relationship 138 (57.0%), work environment and group cohesion subscale 132 (54.5%), recognition at work subscale 122 (50.4%), and perceived alternative employment opportunity subscale 141 (58.3%). as shown from figure 8, the age of respondent increases as the level of satisfaction on job increase. accordingly, the level of satisfaction for the age group of 2030 years was 48.7% for 3149 years 59% and for age group of 4150 years 10 (83.3%). these results were consistent and supported by qualitative result. out of 242 respondents 204 (84.3%) respondents have workmate who leaves the organization. for their departure from the organization they point out to the problem of low salary 113 (46.7%) and lack of opportunity for further education 54 (22.3%). regarding the awareness of study participant regarding where the leavers are working now 94 (38.8%) of them are in the same profession (nursing practice or teaching) and most of them are working different profession like in ngo or others 109 (45.0) (figure 9). from 242 respondents regarding their intention to leave the current work in the coming one year and their alertness on looking other alternative job, 121 (50%) of them responded their readiness to leave the organization. from those reported to leave the organization 105 (61.8%) were looking for a job in the same profession while 52 (30.6%) were looking for a job in another profession. as we see from the table the job satisfaction dimension shows significant correlation with each other (0.190.51) and was correlated with the total (overall) satisfaction score (0.430.66). intention to leave the organization was significantly associated with marital status (p < 0.05), whether nurses were assigned to health center or hospital (p < 0.05), autonomy (p < 0.05), working environment and group cohesion (p < 0.05), and by the level of professional training available in the institutions (p < 0.05). intention to leave the organization was not significantly associated with variables like age, sex, educational qualification, working experience, and benefits and salary, while there was significant association with employment opportunity (p < 0.05) ; overall nurse satisfaction with their work (p < 0.05), and leadership relationships in the organizations. intention to leave the institutions is generally has significant association with overall satisfaction of nurses on their current work (p < 0.05). in multivariable logistic regression of sociodemographic variables, working experience of staff, age, institutions, sex, and working unit of nurses were the significant predictors of overall satisfaction of workers (table 10). this model of parameter estimate scored the hosmer and lemeshow test of model fit [= 12.25, df = 8, p = 0.13 ] with prediction capacity of 66.5%. accordingly those workers having work experience of 2 year to 5 years were 75% less likely to be satisfied with overall job context (aor : 0.25 [95% ci : 0.09, 0.67 ]), (p < 0.05), compared to those having work experience of 6 months to one year. those served 510 years in the profession have 78% less likely to be satisfied with overall aspects of the job (aor : 0.22 [95% ci : 0.06, 0.75 ]) (p < 0.05) compared to those served for 6 months to one year. another one from working unit said that those assigned at maternity unit are 7 times more likely to be satisfied with overall aspects of work compared to those working in medical unit (aor : 7.0 [95% ci 2.0524.05 ]), (p < 0.05). actually, all are satisfied more than medical ward even though the prediction was not significant. females were less likely to be satisfied with their work by 47.4% compared to those respective male nurses (aor : 0.53 [95% ci : 0.28, 0.99 ]) (p < 0.05). those having an age of 3140 years are satisfied with work threefold more compared to age categories of 2030 years (aor : 3.51 [95% ci : 1.05,11.73 ]), (p < 0.05). by far the age group of 4150 years is also 15 times more likely to be satisfied than that of 2030 years (aor : 15.133 [95% ci : 1.971, 116.160 ]), (p < 0.05). in binary logistic regression, statically significant predictors were identified from job satisfaction subscale for fitting overall job satisfaction model (table 12). accordingly, the first three most powerful predictors of overall job satisfaction are those satisfied with leadership relationship in the organization (cor : 25.56 [95% ci : 12.7751.15 ]) (p < 0.05), those satisfied with level of autonomy at work (cor : 23.57 [95% ci : 11.8746.80 ]) (p < 0.05), and those satisfied with training subscale (cor : 18.96 [95% ci : 9.5937.47 ]) (p < 0.05), provided that the effects of other variables were not in the model of predictions (figure 2). to see the effect of job satisfaction subscale (covariate) on overall satisfaction of nurse 's multivariable regression model was fitted. the model got higher prediction capacity (95.5%) with negelkerke r square of 0.908 which means 90.8% of outcome variable was explained by this model and hosmer and lemeshow test of = 6.12, df = 8, and p = 0.63. subscale only benefits and salary were insignificant predictors of overall workers job satisfaction (aor : 3.61 [95% ci : 0.6818.97 ]) p = 0.129 and were rejected in the second step of backward regression method. those satisfied with perceived employment opportunity in the market were 12 times more likely to have satisfaction with their current job (aor : 11.88 [95% ci : 2.6453.49 ]), (p < 0.05). similarly those satisfied with working environment and group cohesion at work were 27 times more likely to be satisfied with overall aspects of their job (aor : 26.63 [95% ci : 4.26166.19 ]), (p < 0.05) (see table 11). socio demography as predictors of intention to leave the organization, all variables were fitted to the model and the model with hosmer and lemeshow test of model fit (= 9.39, df = 8, p = 0.31) with overall 67.4% prediction ability. while different covariates were controlled, the only significant predictors of intention to leave were marital status and working institutions. as shown below those who are single are 2.6 times more likely to leave the organization compared to those who are married (aor : 2.56 [95% ci : 1.275.13 ]), (p < 0.05). nurses who have been working in hospital are 2.49 times more likely to have intention to leave their work than their colleagues working in the health center (aor : 2.19 [95% ci : 1.12, 4.30 ]), (p < 0.05). actually, this finding is supported by finding from in - depth interview. one health center head said everybody looks after good incentive but turnover tends to be higher among single than those married because those single had no nothing to worry about because they are single nevertheless, consistently higher turnover intentions which were reported from in - depth interview were among male, lower age, and those working in rural area. all job satisfaction subscale variables those significant in bivariate logistic regression were fitted to stepwise multivariate logistic analysis. unfortunately only working environment and group cohesion subscale was significant predictor of worker intention to leave their current work. in fact this model scored negelkerke r square of 0.19 and hosmer and lemeshow test = 29.16, df = 8, (p < 0.05) with 72.7% specificity with 64.46% of sensitivity on prediction. as shown in table 13, workers who are satisfied with current work were 75% less likely to leave their current work (or : 0.25 [95% ci : 0.120.51 ]), (p < 0.05). from all job satisfaction subscale, only promotion subscale was not a significant predictor in bivariate analysis, thus excluded from the model. as stated above workers who are satisfied with overall aspect of their work were 70% less likely to have intention to leave their current working organizations provided that the effect of other factors that can influence nurse intention to turnover were not in the model. those satisfied with working environment and group cohesion were 75% less likely to leave their current organization. finally job satisfaction of nurse was significantly predicted by leadership relationship, promotion, autonomy, working environment and group cohesion, training, recognition at work, and employment opportunity. working environment and group cohesion subscale were the only significant predictors of intentions to turnover. this study aims at examining the factors influencing nurse job satisfaction and their intention to leave the organization. this is important because organization need qualified nurse and want to understand how to retain and develop competent staff compositions. nurse job satisfaction and intention to turnover were predicted with many job satisfaction subscales while intention to leave the organizations was only predicted by working environment and group cohesion. the mean age of male was 27.67 4.98 and that of female was 28.35 6.79, which implies that the population of nurse working in sidama zone are young. regarding the effect of age on job satisfaction and intention to leave the data with qualitative and quantitative study part was significantly correlated with overall job satisfaction positively (figure 7) (p < 0.05 ; r = 0.18) which is supported by findings from greece army hospital increase in job satisfaction of army rns was predicted by older nurses p = 0.001, r = 0.363, by more experienced ones with more years at work p = 0,004, r = 0.326. but in other directions results contradict with the study of stone. and of the study done in nurses of china hospitals, which says younger nurses with less work experience, lower professional titles experience lower levels of emotional exhaustions, which is positively related with job satisfaction and negatively with intention to turnover [25, 29 ]. actually one health center head said those newly graduated nurse were highly motivated for working and they have higher satisfaction with their jobs in terms of intent to leave the organization, age correlated insignificantly with intention to leave the organization while their correlation was negative. another literature review of nurse turnover concludes that there is an inverse relationship between age and turnover. nursing is one of numerous professions in which one sex comprises the clear majority of workers while gender difference reported as factor for job satisfaction and nurse turnover. in a study done on nurses working at four army hospitals and one university hospital in northern greece in 2007, they found that men civilian rns were significantly more likely to be very satisfied (p = 0.037), while this study also supports these results as female nurses are 47.4% less likely to be satisfied with their current job aspect. even though sex is significantly able to predict overall job satisfaction, there is no finding showing significance difference between male and female on intention to leave the organization as it is also supported by the work of rambur.. again this study identifies that those workers with work experience of 25 years was 75% less likely to be satisfied with overall job context (or : 0.25 [95% ci : 0.09, 0.67 ]), (p < 0.05), compared to those having work experience of 6 months to one year. those having work experience of 5 years to less than 10 years were 78% less likely to be satisfied with overall aspect of job (or : 0.24 [95% ci : 0.060.96 ]) (p < 0.05) compared to those having work experience of 6 months to one year. in contrary to this in a study done on community hospital nurses found that rns with more years of work experience reported higher job satisfaction, lowest levels of burnout, and were less likely to leave their positions. this difference may be because of difference in sociodemographic difference in study area and it indicates further investigation of the relationship of job satisfaction and intention to leave the organization with work experience. as one informant of in - depth interview said as years of experience goes on the chance of attaining marriage increases and as the same time they will tied with social relationship and they tend to stay there. the quantitative data analysis shows insignificant association of work experience with job satisfaction and intention for turnover. in a study done in macao, nurses with less than five years ' work experience were 4.62 times more likely to leave than nurses with 10 + years ' (p < 0.05) work experience. even though it was not explained well there is controversial result found from this study regarding job experience and age of worker. in one direction the level of satisfaction increases as age of nurses increases, while the overall satisfaction decreases as their level of expertise or experience increases in other directions. a conscious decision should be taken to put in place leadership programmes for nurses including mentorship and coaching programmes, succession planning, carefully planned deployments to increase exposure to diverse leadership environments, recognition, and reward for expertise and excellence. a leader 's behavior or leadership style may influence the subordinates ' level of job satisfaction. studies have been carried out to determine how leadership behaviors can be used to influence employees for better organizational outcome. leadership that values staff contribution promotes retention, evidenced by consistent themes in the literature relating to autonomy, good working relationships, and a management style that facilitates rather than directs. from the study participants 57% reported that they were satisfied with current style of leadership. those satisfied with leadership were 23 times more likely to be satisfied with overall job aspect (aor : 23.30 [95% ci 5.017108.215 ]) (p < 0.05) and 29% less likely to leave their current organization (aor : 0.710 [95% ci : 0.3521.433 ]) p = 0.34. leadership relationships were significantly, strongly, and positively correlated (n = 242), r (242) = 0.66, (p < 0.05), with overall satisfaction of nurse. this result is supported by research done on jordanian nurse and they found positive correlation of (n = 55), r (55) = 0.91, p < 0.05, between transformational leadership and job satisfaction and the predictor, transformational leadership accounted for an estimated 80 percent of the variance of job satisfaction. the slight difference in correlation power may be because of the difference in socio demographic difference between two study areas, which probably affects their perception of leadership relationship. job satisfaction of worker is good in organization autonomy in the area of practice were kept. in greece, one study found the lack of significant influences of autonomy and professional growth might be identified as dissatisfies. most of worker were dissatisfied 128 (52.9%) with general autonomy level in their institutions while we found strong positive correlation (n = 242), r (242) = 0.65, (p < 0.05), with overall job satisfaction and negative correlation (n = 242), r (242) = 0.23, (p < 0.05), with intention to leave the organization. nursing education and training play an important role in the production of well - trained and properly groomed nurses. career development and life - long learning activities in nursing promote job satisfaction, increased retention of nurses, and enable continued provision of high - quality care. in this study the mean score for promotion subscale is (2 0.8) in which only 100 (41.3%) were satisfied and the rest 142 (58.7%) scored dissatisfaction with promotion available in their respective institutions. this result is comparable with findings of south african hospital nurses which was (2.59) for their career development opportunities. lack of career advancement opportunities and unsupportive hospital policies and practices on palestinian nurse contributed to their job dissatisfaction. those satisfied with promotion were 16 times more likely to be satisfied with their job (aor 16.28 [95% ci : 2.7197.6 ]) (p < 0.05) than those dissatisfied. in addition, satisfaction with promotion was the only work related variable to make a significant contribution to the prediction of turnover intention for rns. however, promotion subscale is not a significant predictor of intention to leave the organization (aor : 1.39 [95% ci : 0.732.64 ]) p = 0.322. similarly, in this study those dissatisfied with training and promotion have lower level of job satisfaction and have positive correlation with intention to leave the organizations. job satisfaction would be higher in work environment in which supervisors and subordinates consult together and individuals are involved with peers in decision making and task definition [50, 51 ]. in the area where practice environment that enables nurses to fulfill their expectations and communication between nurse and physician are good, the level of nurse turnover was low [49, 52 ]. working environment and group cohesion was the only significant predictor of intention to turnover from all job satisfaction subscale. this finding supported by the work of joshua - amadi (2003) ; it said low pay, poor work environment such as high workload and low social support, and high level of stress are among the reasons indicated by nurses for leaving nursing. those satisfied with working environment and group cohesion were 75% less likely to leave their current organization (aor : 0.25 [95% ci : 0.120.51 ]) (p < 0.05) and 26. 6 times more likely to be satisfied with their job (aor : 26.63 [95% ci : 4.2616.20 ]) (p < 0.05). again working environment and group cohesion were negatively correlated with intention to leave (n = 242), r (242) = 0.37, (p < 0.05) and positively with job satisfaction (n = 242), r (242) = 0.61, (p < 0.05). recognition of staff can be one of the easiest, cost effective strategies to retain experienced mature nursing staff. one study on the identification of factors that influence nurse job satisfaction by a cross - sectional study of secondary data of south carolina hospital, ma., found that 48% of nurses who held their job more than one year were very or somewhat dissatisfied with the recognition they receive. the slight difference may be attributed to sampling, size, and difference in sociodemographic characteristics of two populations. promoting and advocating for a culture that encourages recognition at workplace might help in retaining staff and researcher from jordan found that the correlations between intention to stay at work and recognition for outstanding / excellent performance and recognition for achievements were (r = 0.21, p < 0.01) and (r = 0.23, p < 0.01), respectively. that is, nurses who perceived having more recognition for their outstanding performance or their achievements reported a higher level of intention to stay at work than nurses with less recognition. likewise this study found nurses who are satisfied with recognition level of their institutions were less likely to leave their current organization (r = 0.19, r (242) p < 0.01) and have more satisfaction with their job (r = 0.59, r (242) p < 0.05) compared to those dissatisfied with level of recognition. more powerfully those who are satisfied with recognition were 39 times more likely to be satisfied with overall aspect of job and 56% less likely to leave their current organization provided that the effect of other variable is not in the model. scored means for benefit and salary subscale for this study and study done in south africa were 1.76 and 2.02, respectively. in both cases, nurses were dissatisfied with this subscale. additionally, benefit and salary subscale was the least powerful predictor of job satisfaction (cor : 9.64 [95% ci : 0.50,1.87 ]), (p < 0.05) and intention to turnover (aor : 0.969 [95% ci : 0.50,1.867 ]), p = 0.925. satisfaction with salary and benefit subscale was showing positive and significant correlation with overall job satisfaction (r = 0.46 r (242), (p < 0.05)) and negative and significant correlation with intention to turnover (r = 0.13 r (242), (p < 0.05)). supplementary to this, macaon nurses who scored as unsatisfied with pay and benefits were 4.14 times more likely to leave than nurses who scored as satisfied (p < 0.001). the difference may be because of difference in sociodemographic characteristics. in fitting of benefit and salary as predictor of intention to leave, the variable was rejected from the multivariable regression model in the second step by the software because of insignificance. this implies that to retain more qualified nurse increasing only salary may not be effective measure because other powerful factors are there. in contrary to this most of an qualitative study participants of in - depth interview report most of workers in health center were leaving because of their dissatisfaction with benefit and pay. the study results support herzberg and maslow 's theories which identified recognition, achievement, the nature of the work, responsibility, and advancement as characteristics that are strong determinants of job satisfaction and burnout. results from the survey demonstrate that although nurses are generally satisfied, discrepancies were masked between levels of satisfaction with different aspects of their work, between nurses with different biodemographic characteristics. the differences in satisfaction were identified in all aspect of the work satisfaction : recognition, promotion, work environment and group cohesion, leadership relationship, benefit and salary, perceived employment opportunity, and autonomy. the biggest dissatisfaction levels were identified in benefit and salary subscale, promotion and professional training subscale. a slightly higher than half (52.5%) of the nurses working in sidama zone are satisfied and half of the nurses already have a plan to leave (50%) their organizations and they are looking for alternative jobs. in south africa intention to leave the jobs was reported as (40%) while satisfaction level for uganda was 48.7%. the slight difference may be attributed to difference in sociodemographic characteristics among countries. again, as they hold greater work experience their likelihood of dissatisfaction was increased which will cause crises for the health care delivery system. low job satisfaction was significantly related to intention to leave the profession and results in a higher chance of considering other employment opportunities [56, 57 ]. major predictor of intent to leave was job dissatisfaction, and the major predictor of job satisfaction was psychological empowerment. more relevantly identified from model those dissatisfied with their job were more likely to have intention to leave their organizations. the focus on healthy work environments began in clinical settings with the goals of improving patient safety, enhancing the recruitment and retention of nurses, and promoting excellence in clinical practice. more importantly healthy and supportive work relationships have been shown to be related to higher nurse intention to remain employed. as this study clearly shows the final predictor of intention to leave was working environment and group cohesion and those satisfied with working environment and group cohesion were 75% less likely to have intention to turnover, in china also similar findings were reported by li.. in canada with qualitative descriptive study, from identified eight thematic categories reflecting factors nurses described as influencing their intentions to remain employed emerged from focus groups ; the first two were relationships with coworkers, and condition of the work environment. in the same study, nurses said the nature and quality of these relationships were the most important reasons that they stayed employed, and others identified that negative or unsatisfying coworker relationships were a strong impetus for leaving their jobs. as indicated above and by different literature knowing the most influential factors of job satisfaction and intention to turnover is important to strengthen the staff retention activities. as we maintain the more qualified and satisfied nurse we can gain good quality of care, great patient satisfaction, minimum job related side effect, and we also save the life. strength. this study is like eye opening to our country to indicate the importance of the nurse job satisfaction and its determinant factors to the health care delivery system. it is also able to indicate relevance of the issue with retention of nurse, as the issues are important in nursing labor management. lower understanding and sense of value for research were identified at different levels during data collection. because the data collection was overlapping with national election time, it was difficult to have cooperation letter from woreda health department. because of this and three times visit we were enforced to leave two woredas from the study. as this study assesses the factors influencing job satisfactions and intention to turnover and the title was not previously addressed in our country it will be a great impute for the professional growth in the country. generally, following points were identified from this thesis.in study, some of qualitative and quantitative data were not supporting each other.population of staff nurse of sidama zone public health facilities were younger (mean age 28.13 (6.27)).age, institutions of work, sex, working unit, and work experience were significant predictor of job satisfaction while only institutions and marital status were significant predictors of intention to leave the organization.most of staff were satisfied with leadership relationship (57.0%), work environment and group cohesion (54.5%), recognition at work (50.4%), and perceived alternative employment opportunity (58.3%).most of staff nurses report promotion (41.3%), autonomy (47.1%), professional training (43.8%), and salary and benefit subscale (34.3%) as dissatisfying job aspects.generally, 52.5% of nurses working in sidama zone public health facilities were satisfied with their current jobs.the final predictors of overall satisfaction were autonomy, leadership relationship, promotion, working environment and group cohesion, professional training, recognition at work, and perceived employment opportunity.the final predictor of intention to turnover was working environment and group cohesion.overall job satisfaction was positively and significantly correlated with job satisfaction subscale.intention to turnover was negatively and significantly correlated with job satisfaction subscale and overall satisfaction of nurses. in study, some of qualitative and quantitative data were not supporting each other. population of staff nurse of sidama zone public health facilities were younger (mean age 28.13 (6.27)). age, institutions of work, sex, working unit, and work experience were significant predictor of job satisfaction while only institutions and marital status were significant predictors of intention to leave the organization. most of staff were satisfied with leadership relationship (57.0%), work environment and group cohesion (54.5%), recognition at work (50.4%), and perceived alternative employment opportunity (58.3%). most of staff nurses report promotion (41.3%), autonomy (47.1%), professional training (43.8%), and salary and benefit subscale (34.3%) as dissatisfying job aspects. generally, 52.5% of nurses working in sidama zone public health facilities were satisfied with their current jobs. the final predictors of overall satisfaction were autonomy, leadership relationship, promotion, working environment and group cohesion, professional training, recognition at work, and perceived employment opportunity. the final predictor of intention to turnover was working environment and group cohesion. intention to turnover was negatively and significantly correlated with job satisfaction subscale and overall satisfaction of nurses. if we are interested in promoting nurse retention, we need to focus on modifying aspects of the eight significant subscales affecting nurses overall job satisfaction and intention to turnover rather than on modifying nurses. nurse retention challenges and obstacles may be less about nurses and more about the organizations in which they work. retention may be promoted by developing and implementing strategies that manage one or more of these determinants so that nurses are more satisfied with those aspects of work. finally based on study findings and entire research process, we would like to recommend the bodies as follows. for zonal health bureau and woreda health office as most of staff are frustrated regarding benefit and salary issue we would like to strengthen further intervention regarding the issue to further motivate the staff.recording and documentations of important human resource file and accessibility of their information should be improved by maintaining periodic relay of information to zonal level.as most of staff were satisfied with level of recognition in their respective institutions, the zonal and woreda health office should maintain the continuity of the activity by the previously employed method.some woredas face the problem of responsible bodies to run some office work while the head is out. thus, woreda health office should further exercise the issue of delegation of activity.health center head, woreda health department, and zonal health office should intervene with further advancement of working environment by further investigation and identification of aspect of environment and group leading them to leave the organization.the zonal health office should talk and enforce all concerned stakeholders to uphold the educational opportunity for nurses.as most of the study participants were holding diploma they were complaining from the absence of curriculum to continue further education ; the woreda health department by integrating with relevant parties should create awareness and clear the confusion there among staff nurses.try to foster the understanding and participation of staff nurses to research by encouraging them to participate in the research. as most of staff are frustrated regarding benefit and salary issue we would like to strengthen further intervention regarding the issue to further motivate the staff. recording and documentations of important human resource file and accessibility of their information should be improved by maintaining periodic relay of information to zonal level. as most of staff were satisfied with level of recognition in their respective institutions, the zonal and woreda health office should maintain the continuity of the activity by the previously employed method. some woredas face the problem of responsible bodies to run some office work while the head is out. health center head, woreda health department, and zonal health office should intervene with further advancement of working environment by further investigation and identification of aspect of environment and group leading them to leave the organization. the zonal health office should talk and enforce all concerned stakeholders to uphold the educational opportunity for nurses. as most of the study participants were holding diploma they were complaining from the absence of curriculum to continue further education ; the woreda health department by integrating with relevant parties should create awareness and clear the confusion there among staff nurses. try to foster the understanding and participation of staff nurses to research by encouraging them to participate in the research. for staff nurses. have creative eye ! as most of nurses were answering that they were not participating in the research, we would like to recommend them to create team and exercise research activity because every practice is expected to be evidence based. it was difficult to get consolidate and summarized data nursing professional in the country with available method of information searching. thus, the ethiopian nursing associations (ena) with ministry of health should support and encourage large scale human resource study in order to have the exact figure of the professional in the country, to investigate the real problem of nurses in the country and deal with the issue with the concerned bodies. most of in - depth interview participants were not comfortable regarding educational opportunity and absence of curriculum to accept 10 program staffs ; thus ministry of health in collaboration with ministry of education should deal with the issue.	background. workplace turnover is destructive to nursing and patient outcomes as it leads to losing competent and qualified nurses. however, developments of coping strategies demand a clear understanding of workplace variables that either motivate nurses to remain employed or lead them to leave their current jobs. objective. this study was designed toassess factors influencing job satisfaction and intention to turnover among nurses in sidama zone public health facilities, in southern ethiopia. method. cross - sectional study design was carried out on 278 nurses using both qualitative and quantitative data collection methods from may 12 to june 05, 2010. result. a total of 242 nurses were interviewed giving a response rate of 87%. nearly two - third (68.6%) of the participants were female, and the mean age was 28 (6.27) years for both sexes. all job satisfaction subscale except benefit and salary subscale were significant predictors of overall job satisfaction. satisfactions with work environment and group cohesion (aor : 0.25 [95% ci : 0.12, 0.51 ]), single cohesion (aor : 2.56 [95% ci : 1.27, 5.13 ]), and working in hospital (aor : 2.19 [95% ci : 1.12, 4.30 ]) were the final significant predictors of anticipated turnover of sidama zone nurses. conclusions. more than any factors managers should consider the modification of working environment and group cohesions rather than trying to modify nurses to retain and maintain more experienced nurses for the organizations.
development into adulthood has, at its origins, strands of dna inherited from two parents combined with endogenous or external environmental influences. yet it is well known now that siblings or twins adopted away at birth share very similar physical, personality and mental traits with their close biological relatives. on the other hand, it is also known that changing the prenatal and perinatal environment of a fetus and infant can have a long - lasting effect on the developed adult and even their offspring. it is in this context that we try to unravel the genetic mechanism that leads to high risk for schizophrenia, particularly given the last decade of progress that has led us into a new era of human genome research. early genetic studies (; reviewed in) led to several false starts and inconsistent chance findings of gene variants associated with schizophrenia and linkages to specific chromosomal regions. these studies culminated in the presence of over 2,000 reports in the current literature examining allelic associations to schizophrenia and well over 50 genes that are claimed to have positive associations. in fact, almost every chromosome arm has a reported linkage to schizophrenia (reviewed in [4 - 6 ]). schizophrenia is a lifetime brain disorder detectable in late adolescence to early adulthood that particularly affects the higher cortical centers for complex learning, memory and communication with others. people with this illness frequently hear disturbing voices that are not there and have multiple delusionary perceptions that prevent them from functioning in society on a daily basis. it has long been established through epidemiological studies of families, twins and adoptees to be highly heritable. however, its inheritance does not follow any mendelian pattern. once schizophrenia had been accepted as one of the so - called ' complex ' genetic disorders and it had become clear that simple methods that were useful for studying the inheritance of mendelian disorders were not leading to clear candidate genes, other study designs came into fashion. these included examination of differential patterns of inheritance for imprinting and anticipation effects [7 - 10 ], examining linkage in genetically isolated cohorts [11 - 14 ], and searching for ' intermediate phenotypes ' or ' endophenotypes ' to use as alternative variables in linkage analyses. none of these have yet been successful in definitively finding a gene defect linked to schizophrenia. general conclusions from the literature are that (i) neither imprinting nor anticipation have major roles in schizophrenia genetics ; (ii) the genetic isolate studies thus far have not yielded any findings that are clearly different from the studies on heterogeneous outbred populations ; and (iii) no endophenotype has currently been found that seems to be more heritable than the clinical diagnosis of schizophrenia itself. nevertheless, there can be optimism for future progress towards uncovering a genetic mechanism for schizophrenia because of the parallel and rapid progress in the field of molecular genetics and the recent discoveries of novel genetic processes. it remains clear from consistent and accepted observations among clinicians that schizophrenia clusters heavily in some families, whereas in others it seems to be a sporadic occurrence ; sometimes it appears in two successive generations, frequently without having occurred in previous generations, and thus it seems more horizontal in inheritance than vertical in these cases. there are a few speculative hypotheses that emerge from these observations : (i) that environmental effects on gene expression could be a key ; (ii) that other epigenetic effects on expression of genes, perhaps endogenous effects (effects within ones own body), may be taking place ; or (iii) that there are many rare variants that occur by deletions or insertions in active regions of crucial genes, and that these may lead to schizophrenia, having a major effect in specific families or simply occurring sporadically. the hypothesis that rare variants of crucial genes have a role in schizophrenia has received much attention recently in three major publications of genome - wide copy - number variations (cnvs ; table 1) [20 - 22 ] and at least one specifically examining copy number in several candidate genes. these papers were preceded by success in locating some pathological cnvs consistently associated with autism (for example,). if cnvs are relevant to autism, it is a reasonable assumption that they could be important in other major serious mental illnesses. following this logic, walsh and colleagues published an initial finding on a relatively small set of two us cohorts, one a clinic population from the northwestern usa and the other a tertiary referral population of unusual childhood onset cases. tertiary referral in this case means another doctor has referred the case, usually because it is a difficult case that does not respond to the usual treatments. in both cohorts the number of large deletions was significantly greater in the patient groups than in controls, but no one deletion or mutation stood out. comparison of three recent genome - wide searches for cnv differences between large cohorts of people with schizophrenia and control populations there is an overlap in authorship and perhaps a minor overlap in samples between these papers and. abbreviations : ceph, centre d'etude du polymorphisme humain genotype database ; cgh, comparative genomic hybridization ; cos, childhood onset ; dsm - iv, diagnostic and statistical manual of mental disorders, 4th edition ; icd-10, who international classification of diseases ; snp, single nucleotide polymorphism ; vcfs, velocardio facial syndrome. this study was only a very preliminary attempt to confirm the same group 's past speculation that the genetic basis for schizophrenia is multiple rare mutational events, perhaps in genes of relevant neuronal pathways. most recently, the work of walsh and colleagues was followed by two highly publicized multicenter large international combinations of cohorts that both examined whether cnvs were more prevalent in schizophrenia than would be expected by chance. although increases in cnvs were suggested, overall the amount of excess was minimal (1.14 in one report) and only mentioned as ' nominal ' in the other but clearly less than the over three - fold increase observed by walsh and colleagues studying a much smaller cohort. sutrala and colleagues in the uk studied cnvs using a similar comparative genomic hybridization method to that used in the other studies, but with oligonucleotide probes rather than the bacterial artificial chromosome (bac) clones, and they were thus able to detect smaller deletions than those found in the previous studies. they did not do a whole genome - wide screen, however, but rather focused on sequences in 891 different candidate genes, and they failed to find any associations with schizophrenia. thus, if rare mutational events account for the genetics of schizophrenia, this is likely to be only a minor contributing mechanism and will not explain the majority of the inheritance of schizophrenia. although in some instances consistent cnv findings have emerged that seem to be interesting (such as chromosomes 1q21.1 and 15q13.3, which have associated deletions in two studies or the uncovering of a cnv in the region associated with velocardio facial syndrome (vcfs), which is frequently implicated in schizophrenia), other findings might not be replicated, or their locations might not be consistent with any gene that is known to be relevant to brain functioning or associated with schizophrenia. these findings should therefore be taken with considerable caution at present, as it is too early to determine whether any of the observed candidate cnvs will be confirmed as an important schizophrenia risk factor. alternatively, the presence of cnvs might eventually become important as a new - found mechanism for complex genetic and psychiatric disorders. certainly, any cnv apparently associated with illness will first need to be verified in large family - based studies to determine whether it segregates with illness within families. there has long been a debate as to whether all of schizophrenia is inherited or whether a proportion of cases with no apparent family history of illness could be sporadic. although environmental factors have been assumed to cause sporadic cases, the alternative could certainly be de novo germline mutations, such as cnvs. when considering schizophrenia, we need to question whether the cnv hypothesis is consistent with what we know about the nature of the illness. can multiple rare variants be an explanation for a disease with worldwide and unchanging incidence and prevalence rates, with sex differences in clinical presentation, with the characteristic delayed age of onset, outcome and familial patterns, with the response to neuroleptic drugs, with the consistent brain structural anomalies across groups of patients worldwide and with the many reported environmental risk factors ? finally, is there any other disease model for this mechanism that would be relevant to schizophrenia ? we continue to hope that the genetic basis for schizophrenia will be clarified in the near future by novel technology and ultimately by complete gene sequencing. once the mechanism is established there is optimism that new medications will be developed to target the relevant pathways uncovered.	the search for a genetic basis for schizophrenia has taken a new turn recently with the publication of three reports of various rare copy - number variations that are associated with schizophrenia. while some of the findings may simply disappear as spurious reports, others remain interesting : that is, deletions in the velocardiofacial syndrome region of chromosome 22, and regions of chromosome 1q21.1 and 15q13.3. these results will gain greater significance if future validation in family studies shows their segregation with illness within families, and when it is understood how the genes containing these variants affect the underlying neurochemistry and neuropathology characteristic of schizophrenia.
	formylglycine generating enzyme (fge) performs a critical posttranslational modification of type i sulfatases, converting cysteine within the motif cxpxr to the aldehyde - bearing residue formylglycine (fgly). this concise motif can be installed within heterologous proteins as a genetically encoded aldehyde tag for site - specific labeling with aminooxy- or hydrazide - functionalized probes. in this report, we screened fges from m. tuberculosis and s. coelicolor against synthetic peptide libraries and identified new substrate sequences that diverge from the canonical motif. we found that e. coli s fge - like activity is similarly promiscuous, enabling the use of novel aldehyde tag sequences for in vivo modification of recombinant proteins.
at the most basic level, the brain may be viewed as a vast network of nerve cells (neurons) with specialized projections (dendrites and axons) connected to each other at junctions known as synapses, through which signals are passed from one neuron to the next. as early as the 19 century, well before the exact nature of signals conveyed by neurons and synapses was understood, changes in the ability of one neuron to drive another were hypothesized to underlie the formation of new associations and the learning of new tasks. years later, donald hebb rephrased these ideas in his influential monograph organization of behavior, suggesting that when one neuron repeatedly takes part in driving a second neuron some growth process or metabolic change takes place at synapses that increases the efficiency of the first neuron in driving the second. inspired by hebb 's writings, countless attempts have been made to uncover the nature of these much of this work has focused on dendritic spines ; the tiny door - knob shaped protrusions that extend from the dendrites shafts, mainly because these are the postsynaptic components of most excitatory synapses in the mammalian central nervous system (cns). as it is commonly assumed that persistent changes in synaptic connectivity ultimately require structural changes, many studies have focused on the structural remodeling of dendritic spines, or more specifically, on changes in spine numbers, densities, sizes, and shapes. only during the last decade, however, with the development of tools for long - term imaging of individual spines in intact brains, have these ideas been directly addressed. this commentary will focus on a subset of studies published over the last two years. for more comprehensive reviews, see [4 - 6 ]. imaging of dendritic spines over many days and weeks in adult animals (mainly mice) has revealed that the majority of dendritic spines are quite persistent (reviewed in [4 - 6 ]). yet, these studies also reported that new dendritic spines form and others disappear at rates of a few percent per day. furthermore, experimental manipulations that caused partial deprivation of sensory input (trimming certain whiskers or monocular deprivation) were shown to significantly affect various aspects of spine remodeling [4 - 8 ]. importantly, these changes were found to correlate, in some cases, with functional changes in the imaged neurons. for example, in the binocular region of the mouse, monocular deprivation was shown to be associated with both increased responsiveness to light in the other (spared) eye and increases in the number of dendritic spines of layer 5 pyramidal neurons within the same region. similarly, in mouse cortical regions that respond equally to neighboring whiskers, whisker trimming in a checkerboard pattern was associated with both increased responsiveness to the spared whisker and an increase in the fraction of new spines of layer 5 pyramidal neurons that became persistent rather than disappearing. other recent studies have gone further and directly examined relationships between spine remodeling and behavioral learning. in two such studies, mice were trained to perform new motor tasks (e.g., single seed reaching or remaining on an accelerating rotating rod) and (two - photon) microscopy was used to examine if learning the skill was associated with changes in dendritic spine remodeling not seen in untrained mice. both studies revealed that by the end of the first 1 - 2 days of training, the number of new spines in particular brain regions had nearly doubled in comparison with untrained mice. however, continuous training was subsequently followed by increased rates of spine elimination, and after 1 - 2 weeks, total dendritic spine numbers did not differ between trained and untrained animals. remarkably, amongst trained animals behavioral performance correlated well with the numbers of new spines formed shortly after training (and with the extent of pre - existing spine elimination). in both studies it was shown that training - associated changes in dendritic spine remodeling were regionally specific, with changes confined to specific cerebral cortex regions concerned with limb movement. however, similar degrees of spine remodeling could be induced in cortical regions concerned with sensory input (from whiskers) in mice exposed to enriched environments. a common finding in many of these studies is that the experimental manipulations used did not seem to increase the rate at which transient spine precursors were generated. instead, they seemed to increase the fraction of new spines that became persistent, as if learning a new task or adapting to altered sensory input favors the stabilization of particular transient spines associated with that function. this feature is most strongly illustrated in a recent study performed in juvenile zebra finches as they learn to imitate a here it was shown that (a) higher levels of spine turnover were correlated with a greater capacity for song imitation, and (b) hearing the tutors song led to dendritic spine stabilization and enlargement that was associated with enhanced synaptic activity in the corresponding brain regions. a fascinating facet of these studies is the observation that later re - exposure of trained animals to the previously learned task or the same sensory deprivation did not lead to any particular dendritic spine remodeling. on the other hand, spine remodeling processes similar to those observed during acquisition of the original tasks the aforementioned studies seem to indicate that a strong correspondence exists between sensory adaptation or task learning and spine remodeling. an implicit, somewhat nave perhaps, interpretation of the aforementioned studies is that the dendritic spines that appear following experimental manipulations represent newly formed connections between functionally relevant neurons and the imaged neuron and that these synapses embody stronger connections between these neurons. for example, in the case of monocular deprivation, it might be surmised that the new dendritic spines mediate additional connections from neurons carrying information from the spared eye and thus enhance the input from that eye. in support of this idea, electron - microscope - based analysis indicates that new spines can form additional connections with the same presynaptic neurons. this interpretation thus implies that the new connections become major determinants of altered postsynaptic functionality, if not immediately, then with time, as part of a process often referred to as consolidation. the problem with this interpretation is that the very same studies show that the correspondence between spine remodeling and functional changes (sensory adaptation or task learning) is not complete. for example, while restoration of binocular vision after monocular deprivation is followed by complete recovery of function in the binocular region, the new spines that formed during the deprivation period are not eliminated. furthermore, a second round of monocular deprivation does not lead to a second wave of spine formation even though functionally, responses to the spared eye are enhanced again (and even more than the first time). finally, while structural remodeling is observed in corresponding layer 5 pyramidal neurons in the cerebral cortex, it is not observed for layer 3 neurons despite the fact that these neurons exhibit robust functional ocular dominance shifts. similarly, while measured responses to spared whiskers correlate well with increased dendritic spine persistence in some (the septal) regions of the corresponding cerebral cortex, in adjacent regions, no particular spine remodeling was observed even though responses to trimmed whisker deflection dropped by 68% (!). one possible and quite straightforward explanation for the incomplete correspondence between spine remodeling and neuronal function is that it reflects experimental constraints. in all these studies, this leaves open the possibility that spine remodeling recorded in superficial layers is merely a faint echo of much more vigorous dendritic spine remodeling occurring in deeper layers (e.g., in layer 4, where major thalamocortical inputs terminate). if this is not the case, however, one is left to conclude that major changes in functionality can occur without corresponding changes in dendritic spine turnover or spine numbers in the same region., structural changes might occur at inhibitory synapses, which typically do not form on dendritic spines and thus would be missed. finally, even though pre- and postsynaptic structural measures typically correspond well with each other, structural remodeling may be, in some cases, more prominent presynaptically (reviewed in). presynaptic remodeling is particular noteworthy here because hebb originally suggested that synaptic remodeling occurs in presynaptic knobs (not dendritic spines), which he describes as rather irregular thickening[s ] in the unmyelinated part of an axon near its ending, where it is threading its way through a thicket of dendrites and cell bodies. hebb writes : when one cell repeatedly assists in firing another, the axon of the first cell develops synaptic knobs (or enlarges them if they already exist) in contact with the soma of the second cell soma refers to dendrites and body or all of the cell except the axon). at present, there is no conclusive information that unequivocally supports or refutes any of these alternative types of structural changes. perhaps the observed structural changes do not necessary involve the immediate upstream suspects (which would be, in the case of monocular deprivation for example, neurons carrying information from the spared eye) and are instead part of more complex reconfigurations of distributed networks, akin to the cell assemblies postulated by hebb. alternatively, perhaps, lady macbeth 's argument, that what is done can not be undone holds true here and that once structural changes occur, they are not rapidly reversed after the forces that induced them are removed. in fact, hebb writes on this matter : cajal (among others) conjectured that the change at the synapse in learning is an amoeboid outgrowth of the cell which might need very little time for its occurrence. hebb then speculates : an amoeboid outgrowth would be reversible ; but the mere absence of the electrochemical influence which produced the outgrowth might not act as forcefully and promptly as its presence. so it is possible to assume that synaptic decay occurs slowly and perhaps is never quite complete. finally, a glum possibility that can not yet be disregarded is that spine formation and elimination in the experiments described above are merely by - products of little functional significance that appear in the wake of other changes of greater functional importance that do not happen to be under the proverbial lamppost in imaging - based experiments. hebb points to an alternative to new synapse formation, that is, a change in the size of existing synapses : the greater the area of contact the greater the likelihood that action in one cell will be decisive in firing another. indeed, in some of the aforementioned studies (but see) changes in dendritic spine head size were observed to correlate well with functional changes in the imaged tissue. as dendritic spine head size and synaptic strength show a direct correlation (reviewed in), perhaps spine size rather than spine addition and removal is a more functionally relevant measure of dendritic spine remodeling. yet this form of remodeling is not entirely without problems either. firstly, spine head size tends to change not only in response to specific activity patterns but also spontaneously, even when activity is suppressed or eliminated entirely. such spontaneous remodeling, acting over long - enough time scales, could drown functionally relevant spine remodeling events in a sea of functionally irrelevant ones. secondly, spine size is also sensitive to overall activity levels - a factor that can not be ignored in the interpretation of data obtained in sensory deprivation paradigms. finally, even changes in dendritic spine size directly induced by acute, specific activity patterns in an in vitro preparation have been shown to gradually revert over a few days. the old notion that synaptic remodeling, and in particular spine remodeling, underlies important forms of adaptation and learning has been greatly substantiated by the elegant experimental approaches developed over the last decade. yet the same approaches have also pointed to puzzling discrepancies that have yet to be resolved. perhaps further development of tools that would allow for long - term imaging of both pre- and post - specializations, inhibitory and excitatory synapses, and at all cortical layers will resolve some of these discrepancies. alternatively, it might be prudent to listen carefully to hebb 's words on two crucial issues : the uniqueness of synapses and the importance of population thinking. starting with the former, hebb undoubtedly favored synapses as loci for changing connectivity within cell assemblies. yet he also writes : there is certainly no direct evidence that this is so and the postulated change if it exists may be metabolic, affecting cellular rhythmicity and limen [i.e., threshold ] ; on the latter hebb writes : at each synapse there must be a considerable dispersion in the time of arrival of impulses, and in each individual fiber a constant variation of responsiveness ; and one could never predicate a determinate pattern of action in any small segment of the system. in the larger system, however, a statistical constancy might be quite predictable. in this spirit, the prevailing view of neurons as history - independent point functions connected to each other through unique, history - dependent and dynamic synapses should, perhaps, be expanded to a more inclusive view that considers large populations of synapses and neurons with rich history dependencies at multiple levels and time scales, where structural changes in dendritic spines are only one of many types of changes that take place during adaptation and learning processes [24 - 27 ]. given his inspiring concepts concerning cell assemblies and their statistical properties, hebb would probably agree.	the notion that synaptic remodeling underlies certain forms of learning is one of the main tenets of hebb 's inspiring theories dating from the 1940s. until recently, however, direct evidence for tight relationships between synaptic remodeling and behavior has been scarce. fascinating data from recent studies on the remodeling of postsynaptic structures known as dendritic spines indicates that such relationships might be more complex than initially expected.
preeclampsia, a unique human pregnancy disorder, is characterized by the development of new hypertension and proteinuria after 20 weeks of gestation in patients free from any clinical disease. but it is not only hypertension and proteinuria ; preeclampsia is a multiorgan disease in which the target organs are the endothelium, brain, liver, kidneys (glomerular endotheliosis) and the coagulation system. delivery still remains the only curative treatment in cases of severe preeclampsia, but is not always advantageous for the fetus. management decisions concerning patients with preeclampsia must be individualized and should balance the maternal risks of continued pregnancy against the fetal risks associated with induced preterm delivery. preeclampsia is a major cause of maternal and fetal mortality and morbidity, and remains amongst the biggest challenges in obstetrics, but its precise etiopathogenesis is still unclear. the placenta, as the interface between the mother and fetus, regulates fetal growth and development. its functions are determined by vascular development and blood flow, which depend on proper trophoblast growth and differentiation. according to the most recent hypothesis, preeclampsia results from impaired placentation early in the beginning of the pregnancy, leading to placental hypoxia and dysfunction. there are differences between the placental findings in early and late onset preeclampsia, but it is difficult to determine whether these are qualitative, indicating different diseases, or simply quantitative differences within the same disease. it has been suggested that the onset, clinical manifestations, severity, and progression of preeclampsia are affected by the maternal response to placentally derived antiangiogenic factors that lead to the imbalance between angiogenic and antiangiogenic factors. nitric oxide (no) regulates the placental blood flow and actively participates in trophoblast invasion and placental development. one theory (of many) suggests that clinical manifestations of preeclampsia caused by failure of the placental vasculature and endothelial malfunction, including insufficient nitric oxide synthesis or no bioavailability, may contribute to increased blood pressure, systemic vascular resistance, and sensitivity to the pressors [4,1013 ]. nitric oxide, initially described as an endothelium - derived relaxant factor (edrf) is the smallest biologically active molecule produced by endothelial cells, and plays many important functions in basic life processes. nitric oxide is the key transmitter for the endothelium - dependent regulation of the vascular tone and it regulates blood pressure, abolishes the toxic activity of superoxide ions, inhibits the adhesion and activation of platelet aggregation, and acts as an anticoagulant and antiatherogenic substance. nitric oxide contributes to the vasodilatation of blood vessels and to the decrease in vascular resistance observed during normal pregnancy. nitric oxide is produced in intact endothelial cells by endothelial no synthase (enos) as the key enzyme from l - arginine. preeclampsia is associated with impaired uteroplacental adaptations during pregnancy and abnormalities in the endothelial nitric oxide synthase (enos)-nitric oxide pathway. however, the mechanism associated with the alteration of nitric oxide formation in pregnancies complicated by preeclampsia is not well understood. animal studies suggest that hyperhomocysteinemia affects the blood vessel wall and causes a change in the endothelium and smooth muscle proliferation. it may be a cause of changes and lesions in endothelial cells due to vascular fibrosis, which results in the activation of thrombogenesis, alterations in the coagulation system, and enhanced platelet activation it has also been postulated that hyperhomocysteinemia may contribute to the development of placental microvascular diseases and preeclampsia, which adversely affect the endothelium. asymmetric dimethylarginine (adma), an endogenous inhibitor of endothelial no synthase (nos), has been linked to endothelial dysfunction. in addition, preliminary evidence has suggested that hyperhomocysteinemia leads to endothelial dysfunction and an accumulation of adma. the aim of the present study was to evaluate the alterations of maternal serum concentrations of endothelial nitric oxide synthase (enos), asymmetric dimethylarginine (adma), and homocysteine in women with pregnancies complicated by early and late onset severe preeclampsia in comparison to healthy normotensive pregnant women. in total, 115 pregnant patients diagnosed with severe pre - eclampsia according to the criteria published in the national high blood pressure education program working group report on high blood pressure in pregnancy (acog 2002), and 65 healthy normotensive women with uncomplicated pregnancies in their 3 trimester were included in the study. preeclamptic patients were divided into early onset preeclampsia (before 34 + 0 weeks of gestation ; the epre group, n=62) and late onset preeclampsia (after 34 + 0 weeks of gestation ; the lpre group, n=53) groups. preeclampsia was diagnosed by an increased blood pressure of > 140 mmhg systolic and > 90 mmhg diastolic in women who were normotensive before 20 weeks of gestation accompanied by proteinuria, defined as the urinary excretion of > 0.3 g protein in a 24-h specimen. severe preeclampsia was diagnosed based on the following criteria : systolic blood pressure > 160 mmhg, diastolic blood pressure > 110 mmhg, and proteinuria > 5 g / in a 24-h period. in addition, patients were considered to have severe preeclampsia if they had 1 or more of the following clinical manifestations : renal abnormalities (oliguria), hematologic abnormalities (thrombocytopenia and microangiopathic hemolysis), hellp syndrome (hemolysis, elevated liver enzymes, low platelet count and right - upper quadrant pain), or neurologic symptoms (headache, visual disturbances and seizures). none of the pregnant patients with preeclampsia were affected by chronic hypertension or renal disorders and/or proteinuria before pregnancy, and all were normotensive before the 20 week of pregnancy. preeclamptic patients were admitted to the department of obstetrics and perinatology in the university hospital in lublin because of the symptoms of the disease, but without signs of labor. the control group consisted of 65 healthy normotensive pregnant patients with singleton uncomplicated pregnancies, without any renal, cardiac, or vascular diseases, with normal laboratory tests and appropriate - for - gestational - age weight infants (the control group). all arterial blood pressure measurements in the control group of pregnant patients were normal and did not exceed 135/85mmhg, and none of the patients had proteinuria. no participants smoked, used caffeine or alcohol, or had a history of endocrinological disease, diabetes, pre - pregnancy cardiovascular disease, or hypertension. pregnant women with multiple pregnancies were also excluded from this study. the blood pressure (bp) of all the participants was measured at rest. the body mass index (bmi) of the patients was calculated as kg / m. serum samples were collected from patients immediately after the diagnosis, before administering any medication, and from controls at their routine visits. the research protocol, including the consent form, was approved by the institutional ethics committee for the protection of human subjects from the medical university in lublin, and informed consent for peripheral blood sampling was obtained from all participants. blood samples collected from the patients were allowed to clot and then were centrifuged at 1500g for 15 min and the serum samples were stored at 70c until assayed. commercially available enzyme - linked immunosorbent assay (elisa) system kits (human sandwich elisa kit, axis - shield diagnostics ltd, uk) were used according to the manufacturer s recommendations, to determine the maternal serum homocysteine concentrations. the endothelial nos3 levels were measured in the maternal serum samples using a commercially available elisa kit according to the manufacturer s instructions (human endothelial nitric oxide synthase 3 kit made by usc life science inc., the asymmetric dimethylarginine levels from maternal serum were evaluated using a sandwich elisa assay according to the manufacturer s instructions (human adma sandwich elisa kit, immundiagnostik ag, stubenwald - allee ba, bensheim). analysis of variance (anova) tests were used to test differences between the 3 independent groups. a statistically significant effect in anova was followed up with post - hoc tukey s test in order to assess differences between groups. blood samples collected from the patients were allowed to clot and then were centrifuged at 1500g for 15 min and the serum samples were stored at 70c until assayed. commercially available enzyme - linked immunosorbent assay (elisa) system kits (human sandwich elisa kit, axis - shield diagnostics ltd, uk) were used according to the manufacturer s recommendations, to determine the maternal serum homocysteine concentrations. the endothelial nos3 levels were measured in the maternal serum samples using a commercially available elisa kit according to the manufacturer s instructions (human endothelial nitric oxide synthase 3 kit made by usc life science inc., the asymmetric dimethylarginine levels from maternal serum were evaluated using a sandwich elisa assay according to the manufacturer s instructions (human adma sandwich elisa kit, immundiagnostik ag, stubenwald - allee ba, bensheim). analysis of variance (anova) tests were used to test differences between the 3 independent groups. a statistically significant effect in anova was followed up with post - hoc tukey s test in order to assess differences between groups. there were no statistically significant differences in parity, maternal age, weight, and height in patient profiles between the groups. maternal bmi values were higher in both groups of patients with pregnancy complicated by preeclampsia than in the control group, but these differences were not statistically significant. systolic and diastolic blood pressure and mean arterial blood pressure were higher in both study groups of pregnant women with early and late onset preeclampsia than in the control group. the mean systolic blood pressure values were 167.4316.69 mmhg in the epre group, 169.1318.25 mmhg in the lpre group, and 113.569.60 mmhg in the control group. the mean diastolic blood pressure values were 111.6710.60 mmhg in the epre group, 109.069.14 mmhg in the lpre, and 72.249.43 mmhg in the healthy controls. the mean arterial pressure values were 130.2211.64 mmhg in group of early onset preeclampsia patients, 129.0610.92 mmhg in patients with late onset preeclampsia, and 85.669.63 mmhg in the healthy controls. our results show that the serum concentrations of homocysteine and adma were increased in both groups of women with preeclamptic pregnancies. the highest levels were observed in the patients with early onset preeclampsia, but the differences between groups of preeclamptic patients with early and late onset of preeclampsia were not statistically significant. the mean values of maternal serum homocysteine were 11.4284.158 mol / l in the epre group, 10.0462.795 mol / l in lpre group, and 7.8352.482 mol / l in the control group (figure 1). mol / l in the group of late onset of preeclampsia, and 0.4880.111 mol / l in the control group (figure 2). one important conclusion of our study is that we did not find a statistically significant decrease of enos concentrations in either group of preeclamptic women compared to the healthy women with uncomplicated pregnancies from the control group. the preeclamptic women had slightly lower levels of maternal serum endothelial nitric oxide synthase than in normotensive pregnant women, but these differences were not statistically significant. the mean values of maternal serum enos were 154.327155.308 u / ml in women with pregnancies complicated by early onset preeclampsia, 156.247127.019 u / ml in patients with late onset preeclampsia, and 217.744265.114 u / ml in the healthy pregnant controls (figure 3). during a normal pregnancy, spiral artery remodelling reduces maternal blood flow resistance and increases uteroplacental perfusion to meet the requirements of the fetus. it has also been observed that enos in the mother and in the fetus contribute to uteroplacental vascular changes and increased uterine arterial blood flow. whereas preeclampsia is associated with impaired uteroplacental adaptations during pregnancy and abnormalities in the endothelial no synthase (enos)-no pathway, it is unknown whether enos deficiency plays a causal role there. it has also been suggested that disturbances in the homocysteine - adma - no pathway may be at least partly responsible for the etiology of preeclampsia and could be regarded as markers for the severity of the disease. homocysteine inhibits the expression and activity of dimethylamino dimethyl hydrolase (ddah), the enzyme hydrolyzing and degrading adma to citrulline and dimethylamine. because of this metabolic relation, it has been suggested that adma is a mediator of endothelial dysfunction in hyperhomocysteinemia. in the present study we found significantly increased maternal serum concentrations of homocysteine and asymmetric dimethylarginine in pregnancies complicated by early and late onset preeclampsia compared to uncomplicated pregnancies. the higher levels of homocysteine and adma in patients with early onset preeclampsia may suggest a relationship between the levels of these factors and the time of the clinical manifestation of preeclampsia. they may also suggest that higher levels of maternal serum homocysteine and adma correlate with the severity, and may determine the earlier clinical onset of the disease. in contrast, endothelial nitric oxide synthase did not show any significant differences between normal and preeclamptic pregnant women. our results regarding the elevated adma and homocysteine levels in preeclamptic pregnancies compared to uncomplicated pregnancies are in agreement with several other studies. rizos. observed significantly elevated adma concentrations in the second trimester in pregnancies that later developed preeclampsia. lpez - quesada. found significantly higher homocysteine levels in preeclamptic women. similar findings were observed by wang., who demonstrated elevated levels of maternal plasma homocysteine in preeclamptic pregnancies and in pregnancies with a suspected fetal compromise and umbilical or placental vascular disease. they concluded that elevated plasma homocysteine plays a role in the pathogenesis of the vascular disease in the uteroplacental circulation in placental insufficiency, and it in turn may suggest vascular lesions in the maternal uteroplacental bed in preeclampsia and fetal growth restriction. similar results concerning higher homocysteine levels in preeclamptic women and their positive correlation with asymmetric dimethylarginine concentrations were presented by mao.. these authors suggested that the altered homocysteine - adma - no signalling pathway may be responsible for the etiology of preeclampsia. our findings are in disagreement with results from the study by siroen., who observed similar levels of adma in women with preeclampsia compared to normotensive pregnant women. however, they observed higher adma levels in women with a clinical worsening of preeclampsia with impaired condition of liver and kidneys, which are organs responsible for the elimination of adma. reported increased levels of adma in relationship to the laboratory parameters of liver and kidney dysfunction and the clinical picture of systolic and diastolic blood pressure, the birth weight of infants, and the weight of the placenta. on the basis of these studies, siroen drew far - reaching conclusions, suggesting a causal role of adma in the development of renal failure and liver and placental insufficiency.. showed that lowering blood pressure in early pregnancy is accompanied by a significant decrease in the plasma concentrations of asymmetric dimethylarginine. however, there was an increase in circulating blood levels of adma, and they reached higher levels than in non - pregnant subjects. holden confirmed the role of both asymmetric dimethylarginine and nitric oxide in the sequence of changes in blood pressure observed in both normal and preeclamptic pregnancies. our data are similar to those of sthlinger., who showed that the homocysteine induced increase in adma is associated with a reduction in ddah activity, and that adma accumulation is associated with a temporally related decline in ddah activity. these authors observed a reduced release of no by endothelial cells in hyperhomocysteinemia, and suggested that impairment of the enos pathway by ddah inhibition could have biological implications beyond the vasculature. suggested that hyperhomocysteinemia is a risk factor for atherosclerosis, and is associated with endothelial dysfunction. however, it has been observed that hyperhomocysteinemia may also impair endothelial function through a mechanism largely independent of the pathway of adma / ddah, and without elevating adma, probably through the inhibition of endothelial nitric oxide synthase activity by protein kinase c or oxidative inactivation of no, induced by dysregulation of renal cellular antioxidant enzymes. found that hyperhomocysteinemia causes tissue - specific decreases in ddah expression without altering plasma adma levels in mice, but with endothelial dysfunction. hyperhomocysteinemia may result in vasomotor dysfunction, because the amended structure and biomechanics of blood vessels and enhanced thrombosis are considered to be independent risk factors for metabolic and cardiovascular disease. the mechanism of vascular damage by homocysteine has not been fully explained, but the importance of vascular smooth muscle cell proliferation and vascular remodelling leading to thrombosis and atherosclerosis should be considered. during normal pregnancy, physiological homocysteine levels are reduced secondary to hormonal changes and kidney, liver, and placental metabolism. according to de falco., hyperhomocysteinemia during pregnancy could be responsible for placental abnormalities, which may be the cause of these very serious pregnancy complications. suggested that hyperhomocysteinemia was associated with an approximately 2- to 3-fold increased risk of pregnancy - induced hypertension, abruption of the placenta, and intrauterine growth restriction. elevated levels of adma and unchanged levels of enos in pregnancies complicated by severe preeclampsia suggest that the nitric oxide deficiency in this pregnancy disorder results not from a reduced level or activity of enos, but from elevated levels of asymmetric dimethylarginine, an endogenous enos inhibitor. these authors also noted the lack of enos expression in vascular terminal villi and a weak expression in the endothelial cells of villous vessels in placenta from normal pregnancy. this location showed intense expression of enos in both types of vessels in placentas from pregnancies complicated by preeclampsia. in contrast, beinder. observed similar placental level of enos activity in patients with pregnancy complicated by preeclampsia and healthy pregnant women with pathological and normal blood flow in the umbilical cord. however, they observed a lower activity of endothelial nitric oxide synthase where the uterine and placental vessels meet and increased uterine artery resistance in preeclamptic women compared to healthy pregnant women. nasiell and schiessl found significantly increased placental expression of endothelial nitric oxide synthase in pregnancies complicated by preeclampsia. our findings are also in disagreement with the results of kim., who found lower expression of enos in the syncytiotrophoblast, reduced concentrations of l - arginine, and unchanged adma in the serum of women with pregnancies complicated by preeclampsia. no synthase plays a very important role in the physiology and pathology of the placental circulation ; nitric oxide produced by endothelial nitric oxide synthase is an important regulator of cardiovascular physiology. no appears to be an antiatherogenic agent, thus adma may be a common mediator of endothelial dysfunction. in addition, studies have shown that adma is not only a risk factor for atherosclerosis and a marker of endothelial injury, but it can also play an important role in the progression of renal damage [4143 ]. homocysteine has an inhibitory effect on adma metabolism, leading to increased adma concentrations in hyperhomocysteinemia in preeclamptic women. finally, this study suggests that lowering the increased homocysteine levels may be helpful in the therapy of vascular disturbances in preeclampsia and may be associated with the down - regulation and impaired bioavailability of no that results from higher levels of adma, an endogenous endothelial nitric oxide synthase inhibitor. larger scale prospective studies are needed to determine the impact of therapies aimed at decreasing serum homocysteine and adma levels. our results confirm the key role of elevated levels of homocysteine and asymmetric dimethylarginine in the development of preeclampsia. the higher levels of homocysteine and adma observed in patients with early onset preeclampsia may suggest a relationship between the levels of these factors and the time of clinical manifestation of preeclampsia. they may also suggest that higher levels of maternal serum homocysteine and adma correlate with the severity, and may determine the earlier clinical onset of the disease. elevated levels of adma and the unchanged levels of enos in pregnancies complicated by severe preeclampsia lead to the conclusion that the nitric oxide deficiency in this pregnancy disorder result not from a reduced level or activity of enos, but rather from elevated levels of asymmetric dimethylarginine, an endogenous enos inhibitor. our results also suggest that adma and homocysteine reduction may be a goal in the prevention and treatment of preeclampsia, but expanded studies are needed to develop new perspectives into this topic. studies with larger populations will yield more informative results for understanding the etiological determinants of preeclampsia.	backgroundthe aim of this study was to determine the maternal serum concentrations of enos, adma, and homocysteine in preeclamptic pregnancies.material/methodsthe study was carried out on 62 patients with pregnancy complicated by early onset and 53 patients with late onset preeclampsia. the control group consisted of 65 healthy normotensive pregnant patients. the serum enos, adma and homocysteine concentrations were determined using elisa assays.resultsour study revealed elevated levels of homocysteine and adma in the serum of women with preeclampsia. the highest levels were observed in patients with early onset preeclampsia, but the differences between both groups of preeclamptic patients with early and late onset of preeclampsia were not statistically significant. both groups of preeclamptic women had slightly lower levels of maternal serum endothelial nitric oxide synthase than in normotensive pregnant women, but these differences were not statistically significant.conclusionsthe higher levels of homocysteine and adma observed in patients with early onset preeclampsia may suggest that higher levels of maternal serum homocysteine and adma correlate with the severity, and may determine the earlier clinical onset of the disease. the elevated levels of adma and the unchanged levels of enos in preeclamptic pregnancies suggest that no deficiency in this pregnancy disorder results not from a reduced level or activity of enos, but from elevated levels of adma, an endogenous enos inhibitor. the lowering of increased levels of homocysteine and adma may be helpful in therapy of vascular disturbances occurring in preeclampsia.
glomus tumor is a rare benign tumor arising from neuroarterial plexus concentrated beneath the nailbed usually in women of age group 20 - 40 yrs. the plexus is an arteriovenous anastomosis functioning without intermediary capillary bed, we report a case of glomus tumor affecting the nailbed of left little finger with characteristic periodic, spontaneous excruciating pain and temperature related algesia for the last 6 months. patient was operated for excision of the tumor making her completely pain free after resection oftumor. opd with complaints of pain, cold algesia, and point tenderness on the radial side of base of the nailbed of left little finger for the last 6 months. diagnosis was delayed despite the patient having sought the advice from different clinicians a number of times before coming to us. pain used to occur on accidental touching of tender spot, cold water immersion ; excruciating at times, making the patient faint. on physical examination clinical diagnosis of glomus tumor was made, which was confirmed on mri as the plain x - ray was non - contributory. most of the glomus tumors are benign, which are amenable to cure with complete surgical excision. rarely, if the lesion exceeds 2 cm malignant transformation of the tumor must be suspected unless proven otherwise. delay in clinical diagnosis due to dithering on the part of the clinician unnecessarily prolong the suffering in the patient which can be greatly helped by m.r.i in clinching the diagnosis early. the glomus tumor is a rare benign neoplasm that arises from the neuroarterial structure called a glomus body. theglomus body is a specialized neuroarterial receptor composed of efferent arteriole, an anastmotic sucquethoyer canal, afferent venule. this accounts for 1 % to 4.5 % of all tumors encountered in the hand. the normal glomus body is located in the stratum reticulare of the skin throughout the body, but is more concentrated in the digits. the glomus tumor usually affect a person of age between 30 to 50 years, although no age is exempt. the patient with glomus tumor seeks medical attention early, but the tumor itself is too small to be identified on physical examination. although the classic triad of moderate to severe pain, temperature algesia, and point tenderness (loves pin test) are invariably present to help reach a definitive diagnosis, yet dithering on the part of treating clinician is the main cause of delay in treatment. but advent of mri and its interpretations will help tide over this problem as well. the tumor mass is usually less than 7 mm in dimensions, which can rarely be picked up on plain radiography as bony erosion underneath the lesion but can be picked up on mri in every case [8, 9 ]. glomus tumor is a well circumscribed mass consisting of small vessels surrounded by glomus cells (fig. glomus cells have round to oval nuclei, pale eosinophilic cytoplasm and clearly defined cell margins. mitotic figures and pleomorphism if present represents malignancy making it a malignant glomus tumor which is a rarer entity. round to oval nuclei, pale eosinophilic cytoplasm and clearly defined cell margins surrounding small vessels. glomus tumor is a well circumscribed mass consisting of small vessels surrounded by glomus cells (fig. glomus cells have round to oval nuclei, pale eosinophilic cytoplasm and clearly defined cell margins. mitotic figures and pleomorphism if present represents malignancy making it a malignant glomus tumor which is a rarer entity. round to oval nuclei, pale eosinophilic cytoplasm and clearly defined cell margins surrounding small vessels. opd with complaints of pain, cold algesia, and point tenderness on the radial side of base of the nailbed [fig. diagnosis was delayed despite the patient having sought the advice from different clinicians a number of times before coming to us. pain used to occur on accidental touching of tender spot, cold water immersion ; excruciating at times, making the patient faint. on physical examination clinical diagnosis of glomus tumor was made, which was confirmed on mri as the plain x - ray was noncontributory complete resection of tumor was done surgically [fig. patient was fully relieved from her agonizing pain [fig. 4 ] to the extent that the patient repeatedly expressed her sincere gratitude to the treating surgeons. she lamented for having waited and suffered the agony for six months. glomus tumor usually is a benign condition which responds favorably to a complete excision leading to cure, with low incidence of recurrence. thorough interrogation, meticulous history taking and physical examination invariably clinch the diagnosis although mri can be done to confirm the diagnosis. on mri glomus tumor is a vascular entity, which is typically dark on t1 [fig. although this signal pattern can be present in any vascular tumor on mri, the location of the tumor, its small size are salient features characteristics of the glomus tumor. most of the glomus tumors are benign, which are amenable to cure with complete surgical excision. rarely, if the lesion exceeds 2 cm malignant transformation of the tumor must be suspected unless proven otherwise. delay in clinical diagnosis due to dithering on the part of the clinician unnecessarily prolong the suffering in the patient which can be greatly helped by m.r.i in clinching the diagnosis early. on the face of strong clinical suspicion of glomus tumor with no radiological findings, m.r.i can help confirming the diagnosis and hence modality of choice in early diagnosis	introduction : glomus tumor is a rare benign tumor arising from neuroarterial plexus concentrated beneath the nailbed usually in women of age group 20 - 40 yrs. the plexus is an arteriovenous anastomosis functioning without intermediary capillary bed, we report a case of glomus tumor affecting the nailbed of left little finger with characteristic periodic, spontaneous excruciating pain and temperature related algesia for the last 6 months. mri helped in clinching the diagnosis at an early stage. patient was operated for excision of the tumor making her completely pain free after resection oftumor.case presentation : a 40-year - old female patient came in ortho. opd with complaints of pain, cold algesia, and point tenderness on the radial side of base of the nailbed of left little finger for the last 6 months. diagnosis was delayed despite the patient having sought the advice from different clinicians a number of times before coming to us. pain used to occur on accidental touching of tender spot, cold water immersion ; excruciating at times, making the patient faint. on physical examination clinical diagnosis of glomus tumor was made, which was confirmed on mri as the plain x - ray was non-contributory.conclusion:most of the glomus tumors are benign, which are amenable to cure with complete surgical excision. rarely, if the lesion exceeds 2 cm malignant transformation of the tumor must be suspected unless proven otherwise. delay in clinical diagnosis due to dithering on the part of the clinician unnecessarily prolong the suffering in the patient which can be greatly helped by m.r.i in clinching the diagnosis early.
the importance of postoperative complications as a significant contributor to the increasing cost of health care in the united states is difficult to understate given that complications are the strongest indicator of full in - hospital costs per patient. preventing postoperative complications will not only improve quality of patient care, but is now fiscally incentivized by the provisions of the affordable care act, which sanctions penalties toward hospitals that fail to achieve standards for hospital readmissions. risks for postoperative complications after spine surgery include older patient age, congestive heart failure and/or history of heart attack, preoperative neurological problems, history of spinal wound infection, corticosteroid use, history of sepsis, classification of 3 or higher according to the american society of anesthesiologists (asa) physical status classification, and lengthened surgery times. anterior lumbar interbody fusion (alif) carries a unique and complication profile compared to other lumbar fixation techniques. the unique morbidity profile reflects risks inherent to anterior retroperitoneal access that involves greater exposure of vasculature, visceral organs, the genitourinary system, and soft tissue. alif can be utilized to treat a wide variety of indications for degenerative pathologies of the lumbar spine. these pathologies may include spondylolisthesis, degenerative disc disease, degenerative lumbar scoliosis, pseudoarthrosis, adjacent segment disease, and other indications that may result in instability of the lumbar spine and chronic lower back pain. the literature cites numerous advantages to an anterior approach over a posterior approach in interbody fusion surgery including improved access to the anterior column, which allows for complete discectomy and increased ability to place a large interbody fusion device. taken together, these benefits have been shown to contribute to higher fusion rates and improved clinical outcomes. there have been very few significant multicenter studies evaluating short - term postoperative complications following alif procedures. the american college of surgeons national surgical quality improvement program (acs - nsqip) is a continuing effort to produce a prospective multicenter registry tracking relevant outcomes of patients undergoing surgical procedures. given the unique safety profile associated with anterior access, the present study aims to establish rates of surgical and medical complications following single - level alif and identify key predictors of medical and surgical complications utilizing the large, multicenter, and validated nsqip database. this nationwide database collects more than 300 variables on patient characteristics, comorbidities, perioperative features, and 30-day postoperative complications and mortality of patients undergoing surgical procedures across a wide range of participating hospitals. surgical procedures are captured by current procedural terminology (cpt) codes, and specific diagnoses can be identified by international classification of diseases, ninth edition (icd-9) codes. the asc - nsqip website (http://www.ascnsqip.org) summarizes the sampling process and patient and hospital inclusion and exclusion criteria. the most recent interrater reliability audit, as a metric of data quality, identified an overall disagreement rate of 2% for listed variables. the cpt code 22558, interbody fusion utilizing the anterior technique, in a single lumbar level, was used to identify all cases of alif. patients with cpt code 22585, signifying additional levels, was used to exclude cases in which multilevel surgery was performed. additionally, only patients undergoing alif with concurrent cpt code 22851, signifying intervertebral cage technique, were included. patients with concurrent posterior or transforaminal lumbar interbody fusion were excluded utilizing the cpt codes 22612, 22630, 22633. the outcomes variables were surgical and medical complications occurring within the recorded 30-day postoperative period. surgical complication comprised occurrence of at least one of the following variables : superficial surgical site infection (ssi), deep incision ssi, organ space ssi, or wound disruption. similarly, occurrence of postoperative medical complications comprised occurrence of at least one of the following : pneumonia, unplanned intubation, ventilator dependence > 48 hours, worsening renal insufficiency, acute renal failure, urinary tract infection, stroke, myocardial infarction, sepsis, or septic shock. given the unique exposure of vasculature associated with anterior access, transfusions of red blood cells up to 72 hours postoperatively was included as a medical complication to create a more complete composite variable that would more comprehensively reflect postoperative adverse effects. diabetes was defined by diabetes reliant on either oral medication or insulin. increased operative time was defined by operative time greater than the 75th percentile (247 minutes) of all cases. anemia was defined by preoperative hematocrit 48 hours, worsening renal insufficiency, acute renal failure, urinary tract infection, stroke, myocardial infarction, sepsis, or septic shock. given the unique exposure of vasculature associated with anterior access, transfusions of red blood cells up to 72 hours postoperatively was included as a medical complication to create a more complete composite variable that would more comprehensively reflect postoperative adverse effects. diabetes was defined by diabetes reliant on either oral medication or insulin. increased operative time was defined by operative time greater than the 75th percentile (247 minutes) of all cases. anemia was defined by preoperative hematocrit 10% weight loss (1.6% vs 0.2%, p =.030), requiring preoperative blood transfusions (3.2% vs 0.5%, p =.002), and sepsis (3.7% vs 0.5% p 4 units (or = 7.12, 95% ci = 1.43 - 35.37, p =.016) were significant predictors of surgical complications. abbreviations : or, odds ratio ; ci, confidence interval ; prbcs, packed red blood cells. longer operative times (or = 4.25, 95% ci = 2.90 - 6.24, p 10% weight loss prior to surgery (or = 6.79, 95% ci = 1.01 - 45.93, p =.049), and more severe asa classification (or = 2.18, 95% ci = 1.54 - 3.11, p 10% weight loss (1.6% vs 0.2%, p =.030), requiring preoperative blood transfusions (3.2% vs 0.5%, p =.002), and sepsis (3.7% vs 0.5% p 4 units (or = 7.12, 95% ci = 1.43 - 35.37, p =.016) were significant predictors of surgical complications. abbreviations : or, odds ratio ; ci, confidence interval ; prbcs, packed red blood cells. predictors of surgical complications from multivariable logistic regression analysis. on multivariable analysis, longer operative times (or = 4.25, 95% ci = 2.90 - 6.24, p 10% weight loss prior to surgery (or = 6.79, 95% ci = 1.01 - 45.93, p =.049), and more severe asa classification (or = 2.18, 95% ci = 1.54 - 3.11, p 29 and 29 and 3 as a risk factor for morbidity, mortality, and hospital readmissions across surgical procedures and specialties. in a review of 24 774 patients from the veterans affairs nsqip undergoing spinal decompression and fusion, asa class 3 (or = 1.45) and asa class 4/5 (or = 1.66) were significantly associated with wound infections. in one of the largest studies to date, hackett, in a study of 2 297 629 patients conducted through nsqip across a number of surgical specialties, demonstrated increasing risk of medical complications and mortality with each successive asa class > 1. surgical complications were less frequent, and significant predictors included diabetes mellitus, chronic preoperative steroid use, and blood transfusion. diabetes has been identified by a systematic review and meta - analysis as an independent risk factor for ssi in a number of surgical procedures including spinal surgeries. though the precise mechanism by which diabetes increases surgical complication risk is not agreed upon, it has been suggested that hyperglycemia during or after surgery may be responsible. however, a number of studies have indicated that diabetes may also act to increase risk for surgical complications through its role in instigating secondary conditions such as vascular changes and white cell dysfunction. thus, the association may result from poor wound healing via ineffective immune response to foreign pathogens. optimizing glycemic control in patients with diabetes mellitus is an important point of preoperative intervention in these. similarly, rami found that surgical patients with extensive preoperative glucocorticoid use are at higher risk of a variety of complications including both medical complications such as venous thromboembolism and surgical complications such as wound occurrence. in a review of 635 265 patient cases sourced from nsqip, ismael found that patients undergoing treatment plans involving chronic steroid use were at significantly higher risk for superficial ssi, deep ssis, organ / space ssis, and wound dehiscence. this is consistent with the findings of the present study, which included all of these variables in its examination of surgical complications. outcomes that are more granular and specific to alif, such as genitourinary complications like re, neurovascular complications, injury to visceral organs, or subsequent need for abdominal hernia repair following alif, are not provided within the nsqip database. moreover, other key risk factors such as previous alif, prior abdominal surgery, or segmental level of surgery are not included as variables in nsqip. incomplete data entry in patients who were missing complication outcomes was excluded. despite these limitations, this is the largest study to date elaborating on rates of complications following alif and key modifiable preoperative risk factors. alif is associated with a unique complication profile as compared to other approaches that do not require anterior access. the present study establishes rates of surgical and medical complications following single - level alif based on large multicenter data. importantly, the data elaborates on key risk factors to better identify high - risk patients. overall rate of complications was 14.5%. patients with preoperative anemia, weight loss, corticosteroid dependence, or are at risk for perioperative transfusions may benefit from medical optimization prior to alif to minimize postoperative morbidity.	study design : retrospective cohort study.objective:the objective of the study was to determine rates of medical and surgical postoperative complications following anterior lumbar interbody fusion (alif) along with their associated predictors.methods:using the american college of surgeons national surgical quality improvement database, patients who underwent single - level alif surgery from 2006 to 2013 were identified. the 30-day rate of postoperative medical and surgical complications along with associated risk factors were evaluated by multivariable logistic regression.results:in total, 1474 patients were included in the analysis. the overall rate of complications was 14.5%. the medical complication rate was 12.7%, while the surgical complication rate was 2.8%. predictors of surgical complications were diabetes (odds ratio [or ] = 2.79, 95% ci = 1.20 - 6.01, p =.009), corticosteroid dependence (or = 4.94, 95% ci = 1.73 - 14.08, p =.003), and preoperative transfusion of > 4 units (or = 7.12, 95% ci = 1.43 - 35.37, p =.016). predictors of medical complications were longer operative times (or = 4.25, 95% ci = 2.90 - 6.24, p 10% weight loss prior to surgery (or = 6.79, 95% ci = 1.01 - 45.93, p =.049), and more severe american society of anesthesiologists classification (or = 2.18, 95% ci = 1.54 - 3.11, p <.001).conclusions : the present study determines postoperative medical and surgical complications among patients undergoing alif. the risk factors elucidated in this study indicate that clinical practices to curtail complications should be targeted toward patients with preoperative anemia, weight loss, corticosteroid dependence, and toward those at risk for perioperative transfusions.
the diffuse sclerosing variant of papillary thyroid carcinoma (dsv - ptc), first described by vickery. in 1985, is a histological variant of ptc. it is characterized by diffuse involvement of one or both thyroid lobules with prominent squamous metaplasia, numerous psammoma bodies, and dense sclerosis in intratumoral areas together with a background of lymphocytic infiltration. extensive lymphovascular invasion indicates frequent metastasis. because of the early spread of dsv - ptc dsv - ptc is a major subtype of ptc in young patients, with a higher female predominance (male : female ratio, 1:7.5). however, the frequency of dsv - ptc is 0.35.5% among ptc [4, 5, 6 ]. we herein report a 15-year - old female patient with estrogen receptor (er)- and progesterone receptor (pgr)-positive dsv - ptc with paratracheal lymph node metastasis in whom recurrence in the right cervical lymph nodes was diagnosed 7 years after the first operation. a 15-year - old female patient with no medical or family history of thyroid tumors consulted an otolaryngological clinic for evaluation of an anterior neck swelling. a thyroid neoplasm was suspected, and she was referred to kansai medical university takii hospital. diffuse enlargement of the right thyroid gland with many small calcifications was detected by ultrasonography (fig. however, lymph node swelling of the right neck was detected 7 years after the operation and reexcision was performed. during the treatment course, her serum t3, t4, and tsh levels were within the reference ranges and autoantibodies were not detected. on macroscopic examination, the tumor, which had been located in the right lobe, was 22 mm along its major axis without formation of a dominant mass. the tumor showed a papillary growth pattern with distinct fibrosis, severe lymphocyte infiltration (fig. 3c) ; all characteristics of dsv - ptc were frequently seen. in high - power fields, many of the tumor cell nuclei exhibited a ground - glass appearance, frequent grooves, and pseudoinclusions (fig. tumor invasion extended outside the capsule and reached the mesenchymal tissue, and lymph node metastasis was notable. 4a, b), and the cells were positive for epithelial membrane antigen, cytokeratin 7, thyroglobulin, e - cadherin, and -catenin. reduced membranous staining and increased cytoplasmic staining of e - cadherin were notable (fig. however, the tumor cells were negative for cytokeratin 20, bcl-2, c - kit, wilms tumor antigen 1, cd56, chromogranin a, synaptophysin, and androgen receptor. the ki-67 and p53 indices were both < a 15-year - old female patient with no medical or family history of thyroid tumors consulted an otolaryngological clinic for evaluation of an anterior neck swelling. a thyroid neoplasm was suspected, and she was referred to kansai medical university takii hospital. diffuse enlargement of the right thyroid gland with many small calcifications was detected by ultrasonography (fig. however, lymph node swelling of the right neck was detected 7 years after the operation and reexcision was performed. during the treatment course, her serum t3, t4, and tsh levels were within the reference ranges and autoantibodies were not detected. on macroscopic examination, the tumor, which had been located in the right lobe, was 22 mm along its major axis without formation of a dominant mass. the tumor showed a papillary growth pattern with distinct fibrosis, severe lymphocyte infiltration (fig. 3c) ; all characteristics of dsv - ptc were frequently seen. in high - power fields, many of the tumor cell nuclei exhibited a ground - glass appearance, frequent grooves, and pseudoinclusions (fig. tumor invasion extended outside the capsule and reached the mesenchymal tissue, and lymph node metastasis was notable. 4a, b), and the cells were positive for epithelial membrane antigen, cytokeratin 7, thyroglobulin, e - cadherin, and -catenin. reduced membranous staining and increased cytoplasmic staining of e - cadherin were notable (fig. however, the tumor cells were negative for cytokeratin 20, bcl-2, c - kit, wilms tumor antigen 1, cd56, chromogranin a, synaptophysin, and androgen receptor. dsv - ptc is a subtype of ptc and is characterized by diffuse enlargement of the thyroid gland and numerous scattered microcalcifications (a so - called snowstorm appearance) on ultrasonography. histologically, dsv - ptc is characterized by papillary growth of atypical cells, similar to conventional ptc with prominent fibrosis, numerous psammoma bodies, frequent squamous metaplasia, and dense infiltration of lymphocytes [2, 3, 8, 9 ]. in addition, dsv - ptc shows a strong tendency for invasion and metastasis, and metastatic lesions have been frequently reported in lymph nodes, lungs, bones, and brain [10, 11 ]. although lymph node metastasis was seen, multifocal tumor emboli in lymphatic channels at the primary site were unremarkable. immunohistochemical studies have been performed on dsv - ptc [12, 13, 14, 15, 16, 17, 18, 19 ]. immunohistochemically, p63 expression in foci of squamous metaplasia is the hallmark for distinguishing between dsv - ptc and conventional ptc [3, 12 ]. ptc cells are positive for thyroid transcription factor-1, thyroglobulin, and -catenin [12, 18 ]. in addition, positive localization of e - cadherin is decreased in the cell membrane and relocation to the cytoplasm occurs. therefore, it is easy to conclude that the decrement in the membrane level of e - cadherin may promote increased potency of invasion and/or metastasis of dsv - ptc. because dsv - ptc is characterized by aggressive growth, it has been thought to be associated with a poor prognosis. in contrast, although the recurrence - free survival rate of dsv - ptc is lower than that of non - dsv - ptc, there is no difference in the overall survival rate [3, 19, 20, 21 ]. the reason for the dissociation between the clinical course and survival should be further investigated. dense accumulations of s-100 protein - positive dendritic / langerhans cells, usually in areas of lymphocytic infiltration and between tumor cells, correlate with a benign clinical course. thyroid cancer nuclei are sex hormone receptor positive [14, 15, 16 ], and er and pgr expression is demonstrated mainly in differentiated thyroid cancer nuclei. however, overexpression of er and pgr in thyroid cancer suggests their role in carcinogenesis. in small t1-differentiated thyroid cancer, er positivity and androgen receptor expression are associated with a more aggressive phenotype. because the present case was er and pgr positive and androgen receptor negative with accumulation of s-100 protein - positive dendritic / langerhans cells, a prognostic prediction based on these markers was complex. more reliable markers, which are necessary in order to determine prognosis, must be investigated. in the present case, although the macis (metastases, age, completeness of resection, invasion, size) score was 7.85 (table 2), the 20-year survival rate after surgery was estimated as 56%. strict follow - up is desired in such cases. in the present tumor, strong infiltration of lymphocytes with a germinal center although approximately 30% of patients with dsv - ptc have positive antithyroid antibodies as part of hashimoto 's thyroiditis, autoimmune antibodies were not detected in the present case. interestingly, hrthle cells are reportedly absent in dsv - ptc, including in the present case [2, 12 ]. taken together, diagnosis of dsv - ptc seems to be possible using ultrasonography and histological investigation. in conclusion, we herein reported a case of er- and pgr - positive dsv - ptc. although survival remains unpredictable, further studies are necessary to identify good markers with which to predict the prognosis of dsv - ptc. this paper is the first to report er- and pgr - positive dsv - ptc. the authors declare no potential conflicts of interests with respect to the authorship and/or publication of this article.	the diffuse sclerosing variant of papillary thyroid carcinoma (dsv - ptc) is a relatively rare tumor. we herein report the case of young woman with dsv - ptc who developed cervical lymph node recurrence 7 years after the initial surgery. a 15-year - old female patient with no medical or family history of thyroid tumors developed a thyroid neoplasm in the right lobe. right thyroidectomy and regional lymphadenectomy were performed, and the tumor was diagnosed as dsv - ptc. she was followed up as an outpatient. seven years after the surgery, cervical lymph node recurrence developed. on microscopic examination, the thyroid tumor showed a papillary growth pattern with numerous psammoma bodies and distinct fibrosis. immunohistochemically, the tumor cells were estrogen receptor and progesterone receptor positive with reduced membranous expression of e - cadherin and were intermingled with s-100-positive dendritic / langerhans cells. dsv - ptc is characterized by a strong tendency for invasion and metastasis. thus, accurate diagnosis is clinically important, and a morphological and immunohistochemical understanding of dsv - ptc is necessary.
brainstem vascular malformations can be classified as arteriovenous malformations, venous malformations, cavernous malformations, or capillary telangiectasias. on pathological examination, capillary telangiectasias are a distinct type of vascular malformation, characterized by multiple thin - walled vascular channels, interposed between normal brain parenchyma. it has been postulated that telangiectasias are acquired lesions, caused by other underlying venous anomalies., numerous case reports of presumed brainstem capillary telangiectasias have appeared ; usually pathological confirmation is absent. the fact that most capillary telangiectasias are found incidentally on mr imaging confirms the suggested clinically benign course in general, although a histopathologically proven, clinically aggressive case in an infant has been described. we performed a pubmed search of the literature and found 26 cases to date [58 ]. all but one of these cases were thought to be symptomatic, including symptoms of vertigo, tinnitus, hearing loss, ataxia, limb paresthesias, and monocular ptosis. basilar - type migraine, previously called basilar migraine or bickerstaff migraine, is a migraine variant first described by bickerstaff in 1961. being a very rare migraine variant, the exact incidence and prevalence are unknown. although various criteria for the diagnosis have been applied over the years, fully reversible symptoms resulting from brainstem dysfunction are essential for the diagnosis. a recent study found the median age of onset to be 17 years and a female - to - male ratio of 3.8:1. an 18-year - old woman presented to the outpatient clinic with a history of unilateral headaches, accompanied by phonophobia, but no photophobia, nausea, or vomiting. these headaches had increased in frequency over the last 6 months from once per year to about three times per week, typically lasted several hours, and were alleviated by sleep. the headache was frequently preceded by visual symptoms, such as flickering or black spots, in both visual fields. the patient had not used painkillers for these attacks, because in her opinion, these headaches were not severe enough to justify the use of medication. furthermore, this patient experienced a single episode of vertigo, followed by sudden loss of consciousness with a duration of about 10 min. no jerks, urinary incontinence, or tongue bite were present. on regaining consciousness, no confusional state was present, but patient noted the most terrible headache ever. several days later, an attack of vertigo without hearing loss occurred, with alternating paresthesias in all limbs, followed by the same terrible headache. for these a clinical diagnosis of basilar - type migraine was made, since the patient fulfilled the international headache society (ichd - ii) criteria. magnetic resonance imaging (mri) showed focal areas of hyperintensity in t2-weighted spin echo images, hypointensity in t2 -weighted gradient echo images, and enhancement in postcontrast t1-weighted images (fig. 1). the diagnosis was revised to secondary headache attributed to cranial vascular disorder (ichd - ii 6), since one of the criteria for basilar - type migraine is that it can not be attributed to another disorder. she was treated with propranolol 80 mg per day as prophylactic treatment and acetaminophen 1,000 mg during attacks. during follow - up, she reported excellent response to the propranolol, with no new basilar - type migraine attacks for 12 months.fig. 1postcontrast axial and sagittal t1, arrows pointing towards mr - suggested capillary telangiectasia postcontrast axial and sagittal t1, arrows pointing towards mr - suggested capillary telangiectasia although no pathologic confirmation is available in our patient, we believe the radiological abnormality found on mri to be a capillary telangiectasia. this is supported by the absence of significant changes in a follow - up mri scan. the association with clinical symptoms remains unproven, although a clinical picture of peculiar attacks of prolonged loss of consciousness due to pontine telangiectasia has been described in the literature. another paper describes a case of basilar - type migraine associated with calcifications in the pontine tegmental nuclei. as this case illustrates, mr imaging of the brain should be considered if a rare cause of primary or secondary headache is suspected on clinical grounds. follow - up imaging seems only to be warranted in presumed symptomatic lesions, although the added value remains debatable, since no therapeutic interventions are available. regarding preventive treatment for basilar - type migraine, some experts prefer divalproex - sodium or verapamil instead of propranolol because of the concern of limitation of compensatory vasodilatory mechanisms. in our opinion no contraindication for propranolol exists in this patient because of the assumed causal relationship between the capillary telangiectasia and her clinical symptoms. with respect to acute treatment, there seems to be consensus against triptans because of concern over the potential for cerebral vasoconstriction and the uncertainty of the mechanism of basilar - type migraine, although evidence proving this causality is lacking. in conclusion, with this case report we provide some further evidence that pontine capillary telangiectasia might cause a clinical picture resembling basilar - type migraine.	a case of presumed pontine capillary telangiectasia in an 18-year - old woman with a clinical diagnosis of basilar - type migraine is reported. since both are very rare diagnoses, this case provides some evidence to suggest that pontine capillary telangiectasia might cause a clinical picture resembling basilar - type migraine.
renal cell carcinoma (rcc) can metastasize to any location in the body, and distant metastases are common, being present in 30% to 40% of patients with metastatic disease. the most common sites affected are the lungs (76%), regional lymph nodes (ln) (66%), bone (42%), and liver (41%). however, only 1.5 to 3.5% of rcc patients show solitary metastasis, and only 1% have metastasis confined to the head and neck. moreover, cases of metastatic rcc with a non - identifiable kidney mass are extremely rare. here, we report a case of metastatic rcc in only a supraclavicular ln with no evidence of a primary kidney lesion. a 69-year - old man presented with a 2-week history of a progressively enlarging supraclavicular mass in april 2009. written consent was obtained from the patient for publication of the study. upon physical examination, his body temperature was 37.3, blood pressure 130/90 mmhg, and pulse rate 75/min. a head and neck examination revealed a palpable firm, fixed, non - tender, 8 cm - sized mass in the right supraclavicular area with no other evident lymphadenopathy, and an abdominal examination revealed no palpable mass. his complete blood cell count, chemistry findings, and renal functionwere normal. urine dipstick and microscopy tests revealed no hematuria or abnormal cells. computed tomography (ct) of hematoxylin and eosin staining revealed that tumor cells were polygonal with clear cytoplasm and vesicular nuclei with prominent nucleoli (fig. immunohistochemical staining showed that tumor cells were positive for pancytokeratin (1 : 300, leica, newcastle upon tyne, uk), vimentin (1 : 200, dako, glostrup, demark), and cd10 (1 : 100, leica) (fig. 2b), but negative for thyroid transcription factor 1 (1 : 300, leica), cytokeratin 7 (1 : 600, neomarkers, fremont, ca), cytokeratin 20 (1 : 150, dako) and hepatocyte specific antigen (1 : 50, leica). based on these findings, a diagnosis of metastatic clear cell rcc was made, after which the patient underwent abdominal / pelvic ct (fig. 3b). the results revealed no tumor in either kidney, and no further metastatic lesions ; accordingly, he was diagnosed as having metastatic rcc in a supraclavicular ln only, without an identifiable kidney mass. the patient was initially treated with radiotherapy (4,000 cgy administered in 15 fractions over a period of 3 weeks), which induced tumor shrinkage, after which he was administered sunitinib (50 mg / day consecutively for four weeks followed by two weeks off per cycle). after two cycles, a follow - up ct scan revealed that the supraclavicular ln had markedly decreased in size (fig. the acute toxicity (grade 3 hand - foot syndrome, asthenia, and grade 2 thrombocytopenia) led to dose reduction (25 mg / day consecutively for four weeks followed by two weeks off). after 20 months of sunitinib under the reduced dose, no tumor progression was observed. repeated follow - up abdominal / pelvic ct for 20 months has revealed no evidence of a primary renal tumor. the most common metastatic sites of rcc are the lungs, regional ln, bone, and liver, and it is uncommon for rcc to present a solitary metastasis at an unusual site. the mechanism of metastasis to unusual sites has not been clearly explained, but the mechanism of solitary metastasis of rcc to the head and neck region (an unusual site) is explained as follows. batson 's paraspinal plexus is a rich, valve - less venous anastomosis with prevertebral, vertebral, and epidural systems, and this rich venous system offers little resistance to the spread of tumor emboli. accordingly, the vertebral venous plexus offers a means of bypassing the pulmonary venous system and facilitates metastasis in the head and neck region without lung involvement. metastases that do not follow normal hematogenous flow patterns may also be explained by a right - to - left heart shunt, spontaneous regression of lung disease, or microscopic seeding of lung parenchyma. moreover, non - identifiable kidney lesions are extremely rare in metastatic rcc. in such cases, the disease presents as carcinoma of an unknown primary form with a clear cell neoplasm. however, diagnostic pathology has improved remarkably, and the routine use of electron microscopy and immunohistochemistry and the emerging field of molecular genetics are enabling more precise diagnoses. differential diagnoses in malignant neoplasms composed of clear cells include hepatocellular carcinoma, adrenal cortical carcinoma and clear rcc. hepatocellular carcinoma is positive for cytokeratin, epithelial membrane antigen (epithelial markers), and hepatocyte specific antigen, but negative for vimentin, whereas adrenal cortical carcinoma is positive for vimentin, but negative for epithelial markers. rcc is positive for epithelial markers, vimentin, and cd10, similar to the neoplastic cells in our case. a number of previous case reports have also described cases of metastatic clear cell renal carcinoma without a primary renal mass. in the case of metastatic rcc, no renal tumor was observed initially, but a renal tumor did appear after two years. bhatia. also reported a case of cutaneous facial rcc with no known primary tumor. it is not known why the primary lesion remains occult, but it may be involved or too small to be detected. nevertheless, these lesions could be silent renal tumors ; therefore, close monitoring is essential. as in our case, patients with single site involvement (brain, liver, subcutaneous tissue, bone, intestine, ln, or others) should be treated using aggressive local therapy such as resection, radiation therapy, or both, because a minority enjoy long - term, disease - free survival. in addition to definite local therapy, these patients should also receive systemic therapy based on one of the newer regimens because they seem to confer better survival. in our case of solitary metastasis in a supraclavicular ln, radiation therapy was applied and systemic therapy was performed with sunitinib, which is a standard treatment for metastatic rcc. as a result, the patient has been well for the last 20 months without disease progression. sunitinib is a multitargeting receptor tyrosine kinase inhibitor of vascular endothelial growth factor and of platelet - derived growth factor receptor. in a recent phase iii trial, progression - free survival was found to be longer and quality of life to be better for patients with metastatic rcc treated with sunitinib than for those treated with interferon-. not infrequently, clinicians and pathologists encounter malignant neoplasms composed of clear cells that have sources and natures that can not be determined by conventional morphological studies. therefore, immunocytochemical staining for cytokeratin, epithelial membrane antigen, vimentin, and fat are of considerable diagnostic help in rcc. this case report suggests that even in the absence of a primary kidney lesion, clinicians must consider the possibility of metastatic rcc when evaluating patients with clear cell carcinoma from an unknown primary site. furthermore, if only one metastatic site is present, a local modality such as surgical resection or radiotherapy should be applied, and if necessary, systemic treatment like sunitinib added.	although metastasis is relatively frequent in cases of renal cell carcinoma (rcc), metastasis in the cervical or supraclavicular lymph node (ln) is relatively rare. moreover, cases of metastatic rcc with a non - identifiable kidney mass are extremely rare. here, the authors report a case of metastatic rcc in a supraclavicular ln without a primary kidney lesion. a 69-year - old man presented with a progressively enlarging right supraclavicular mass. incisional biopsy of the affected supraclavicular ln was performed, and histological examination revealed metastatic rcc. however, no tumor was found in either kidney, despite various examinations. the patient was treated with radiotherapy followed by sunitinib. after three months on sunitinib, a follow - up computed tomography scan revealed that the supraclavicular ln had markedly decreased, and after 20 months, the disease had not progressed. this case suggests that, even when there is no primary kidney lesion, clinicians must consider the possibility of metastatic rcc when evaluating patients with clear cell carcinoma with an unknown primary site.
in the last 30 years, there have been pronounced increases in the use of antidepressants,13 which are now the third most commonly prescribed medication class in the usa.4 although newer antidepressants (beginning with the selective serotonin reuptake inhibitors) are effective and generally well - tolerated for treating a number of psychiatric disorders,510 the explosive growth in the use of antidepressants continues to raise questions related to their effectiveness, side effects, and cost.1113 clinical trials have been adequate to establish antidepressant efficacy and to quantify the incidence of common treatment - emergent adverse effects ; however, these data are limited by poor external validity.14 large, randomized, comparative effectiveness studies may partially overcome this limitation,15 but they are unlikely to have sufficient power or duration of follow - up needed to detect outcomes that are infrequent or require a long time to develop.16 furthermore, such trials typically exclude vulnerable but clinically important populations in which antidepressant use may be substantial (such as pregnant women and medically ill persons), and can not address questions about antidepressant prescribing and use at the population level. thus, many important questions related to antidepressant use, safety, and effectiveness must be evaluated outside of clinical trials using rigorously designed observational studies.17 the medical records linkage system maintained by the rochester epidemiology project (rep) contains data on essentially all sources of medical care available to and utilized by the olmsted county, minnesota, population,18 and is therefore a potentially valuable resource for studying the use and effects of medications in a well - defined population. rep records of inpatient and outpatient medical care encounters allow identification of a phenotypically well - defined cohort, longitudinal follow - up of cohort members, and ascertainment of exposures, endpoints, and confounding variables.19 in particular, rep prescription records may provide objective, detailed, reliable, and relatively low - cost measures of drug exposure for large numbers of individuals that are not subject to recall bias (similar to other computerized prescription records20), or systematic exclusion based on socioeconomic or clinical factors.21 however, because these records were collected during routine medical care and not for research purposes, they are subject to misclassification.22 in pharmacoepidemiologic studies, exposure misclassification can introduce biases that can not be overcome using statistical adjustment or other data analytic techniques. other authors have shown high concordance between computerized prescription records and patient self - report of medication use2326 or medical record review.23 2730 however, validation of rep prescription records of antidepressants or other medication exposures has not been performed. in addition to minimizing the risk of misclassification of medication exposures, the ability to identify incident (new) users of antidepressants and other medications is crucial for conducting pharmacoepidemiologic studies of drug effectiveness or safety. studies of prevalent users of study medications may underestimate effects related to drug initiation, particularly effects that occur early in the course of treatment. we therefore conducted a study to validate a computer algorithm designed to identify new antidepressant users in automated rep antidepressant prescription records, using manual medical records review as a gold standard. the study sample was drawn from the full enumeration of all individuals residing in olmsted county, minnesota, between january 1, 2011, and december 31, 2012, identified using the rep census31 (n=149 629). all individuals who had given permission for their medical records to be used for research and were aged 6 years or more on the date of their first qualifying study drug prescription (index date) were considered eligible for the study. we developed a computer algorithm designed to identify all potential new users of antidepressant medications (see online supplementary table s1) in the population during the study period. the list of study drugs in online supplementary table s1 represents all antidepressant drugs approved for clinical use in the usa during the study period. the algorithm required the exclusion of antidepressant prescriptions during the 6 months preceding the index date, including absence of drugs that were prescribed more than 6 months before the index date but were continued during the 6-month period. the estimated days of exposure for a given antidepressant that was prescribed preceding the 6-month period was determined using the date, days of supply, quantity dispensed, and number of refills for each prescription. from the total pool of new antidepressant users defined by our algorithm, we selected a random sample of 200 subjects stratified by age group (1.0. we hypothesized that the misclassification rate of prevalent antidepressant use as new use would decrease with increasing duration of residence in olmsted county, minnesota, prior to the index date. therefore, we recalculated ppv estimates after restricting the sample to subjects who resided in olmsted county, minnesota, for at least 1 year preceding the index date. the study sample was drawn from the full enumeration of all individuals residing in olmsted county, minnesota, between january 1, 2011, and december 31, 2012, identified using the rep census31 (n=149 629). all individuals who had given permission for their medical records to be used for research and were aged 6 years or more on the date of their first qualifying study drug prescription (index date) were considered eligible for the study. we developed a computer algorithm designed to identify all potential new users of antidepressant medications (see online supplementary table s1) in the population during the study period. the list of study drugs in online supplementary table s1 represents all antidepressant drugs approved for clinical use in the usa during the study period. the algorithm required the exclusion of antidepressant prescriptions during the 6 months preceding the index date, including absence of drugs that were prescribed more than 6 months before the index date but were continued during the 6-month period. the estimated days of exposure for a given antidepressant that was prescribed preceding the 6-month period was determined using the date, days of supply, quantity dispensed, and number of refills for each prescription. from the total pool of new antidepressant users defined by our algorithm, we selected a random sample of 200 subjects stratified by age group (1.0. we hypothesized that the misclassification rate of prevalent antidepressant use as new use would decrease with increasing duration of residence in olmsted county, minnesota, prior to the index date. therefore, we recalculated ppv estimates after restricting the sample to subjects who resided in olmsted county, minnesota, for at least 1 year preceding the index date. a total of 9773 (6.5% of 149 629) subjects met the computer case definition of antidepressant new user, from which 200 cases were selected at random, with sampling stratified by age and sex. medical records were not reviewed or adjudicated for one subject because of a change in authorization for use of medical records for research and one subject because of a data coding error (figure 2). the sample was predominantly caucasian and middle - aged, with an approximately equal sex distribution (table 1). demographic and clinical characteristics of the study sample these subjects were randomly selected among all non - users of an antidepressant drug in 20112012. maoi, monoamine oxidase inhibitor ; snri, serotonin - norepinephrine reuptake inhibitor ; ssri, selective serotonin reuptake inhibitor ; tca, tricyclic antidepressant. all residents of olmsted county, minnesota, who had given permission for their medical records to be used for research and were 6 years of age between january 1, 2011 and december 31, 2012 were considered eligible for this study. the study sample consisted of 198 subjects electronically identified as new antidepressant users, as detected by our computer algorithm. a random sample of 200 subjects were electronically identified as new antihistamine users from the total pool of subjects who did not meet our computer algorithm definition of new antidepressant user. of the 198 new users, 161 were confirmed as new users after manual medical records review, resulting in a ppv of 81.3% (95% ci 76.4% to 87.0%). a total of 37 cases were misclassified, 36 of which were due to misclassifying prevalent users as new users, that is, evidence of antidepressant use was identified within 6 months of the index date based on review of medical records (table 2). we could not confirm new or prevalent use of an antidepressant in the medical records of one case. thus, the ppv for prevalent use of antidepressants on the index dates was 99.5% (197/198, 95% ci 97.2% to 99.9%). ppv estimates did not vary significantly by age stratum or sex, although numerically lower ppv estimates were observed for males relative to females, and persons aged 65 + years relative to those aged 1864 and those under the age of 18 years (table 2). ppv estimates also did not differ significantly by general indication (psychiatric, non - psychiatric) or antidepressant prescriber specialty (non - physician, primary care physician, psychiatrist, non - psychiatric specialty physician ; data not shown). comparison of electronically defined new users of an antidepressant medication versus manual review of medical records time periods (1, 1.5, or 2 years) refer to the period of days immediately preceding the index date for which there was no evidence of antidepressant exposure. further restriction to participants with standardized antidepressant dose ratio 1.0 improved ppv estimates to 90.8% (95% ci 85.1% to 94.4%) for the 1-year window, to 90.8% (95% ci 85.0% to 94.6%) for the 1.5-year window, and to 90.8% (95% ci 85.0% to 94.6%) for the 2-year window. requiring a minimum of 1 year of olmsted county residence prior to the index date and further restriction to participants with standardized antidepressant dose ratio 1.0 improved the ppv estimate to 90.6% (95% ci 85.1% to 94.2%). restriction to participants with standardized antidepressant dose ratio 1.0 improved the ppv estimate to 89.5% (95% ci 80.6% to 94.6%) for males and to 93.2% (95% ci 85.9% to 96.8%) for females. restriction to participants with standardized antidepressant dose ratio 1.0 improved the ppv estimate to 93.9% (95% ci 83.5% to 97.9%) for subjects aged < 18 years, to 92.0% (95% ci 83.6% to 96.3%) for subjects aged 1864 years, and to 85.4% (95% ci 71.6% to 93.1%) for subjects aged 65 + years. ad, antidepressant ; ppv, positive predictive value. after restricting the sample to cases in which the standardized antidepressant dose ratio was 1.0 on the index date (n=165), 150 cases were confirmed as new users (ppv 90.9%, 95% ci 85.5% to 94.4%) (table 2). all 15 misclassified cases were prevalent antidepressant users. extending the time windows preceding the index date to 1, 1.5, or 2 years resulted in incrementally greater reductions in the number of potential new antidepressant users, with only modest increases in the ppv (table 2). expanding the time windows preceding the index date and restricting the cohort to cases with standardized antidepressant dose ratios 1.0 on the index date resulted in ppv estimates of 90.8%. requiring at least one continuous year of olmsted county, minnesota, residence prior to the index date of the 139 856 subjects who did not meet the algorithm definition of new antidepressant user, a total of 3975 were classified as potential new antihistamine users. from these subjects, we derived a random sample of 200 users stratified by age and sex, in a manner identical to that used to define the random sample of potential new antidepressant users. medical records were reviewed manually for all 200 cases, three of whom had evidence of antidepressant use in the 6 months preceding the first qualifying antihistamine prescription, yielding a false negative rate of 0.015 (or 1.5%) and npv estimate of 98.5% (95% ci 95.7% to 99.5%). our sampling scheme was based on first identifying a random sample of new antidepressant user and non - user cases based on the computer algorithm. as such, we were unable to directly calculate algorithm sensitivity, which would require a random sample of the entire population subsequently classified as antidepressant new users and non - users according to manual medical record review. however, as a secondary approach, and making a number of assumptions, we have provided a crude estimate of algorithm sensitivity based on data from our study (see online supplementary appendix). a total of 9773 (6.5% of 149 629) subjects met the computer case definition of antidepressant new user, from which 200 cases were selected at random, with sampling stratified by age and sex. medical records were not reviewed or adjudicated for one subject because of a change in authorization for use of medical records for research and one subject because of a data coding error (figure 2). the sample was predominantly caucasian and middle - aged, with an approximately equal sex distribution (table 1). demographic and clinical characteristics of the study sample these subjects were randomly selected among all non - users of an antidepressant drug in 20112012. maoi, monoamine oxidase inhibitor ; snri, serotonin - norepinephrine reuptake inhibitor ; ssri, selective serotonin reuptake inhibitor ; tca, tricyclic antidepressant. all residents of olmsted county, minnesota, who had given permission for their medical records to be used for research and were 6 years of age between january 1, 2011 and december 31, 2012 were considered eligible for this study. the study sample consisted of 198 subjects electronically identified as new antidepressant users, as detected by our computer algorithm. a random sample of 200 subjects were electronically identified as new antihistamine users from the total pool of subjects who did not meet our computer algorithm definition of new antidepressant user. of the 198 new users, 161 were confirmed as new users after manual medical records review, resulting in a ppv of 81.3% (95% ci 76.4% to 87.0%). a total of 37 cases were misclassified, 36 of which were due to misclassifying prevalent users as new users, that is, evidence of antidepressant use was identified within 6 months of the index date based on review of medical records (table 2). we could not confirm new or prevalent use of an antidepressant in the medical records of one case. thus, the ppv for prevalent use of antidepressants on the index dates was 99.5% (197/198, 95% ci 97.2% to 99.9%). ppv estimates did not vary significantly by age stratum or sex, although numerically lower ppv estimates were observed for males relative to females, and persons aged 65 + years relative to those aged 1864 and those under the age of 18 years (table 2). ppv estimates also did not differ significantly by general indication (psychiatric, non - psychiatric) or antidepressant prescriber specialty (non - physician, primary care physician, psychiatrist, non - psychiatric specialty physician ; data not shown). comparison of electronically defined new users of an antidepressant medication versus manual review of medical records time periods (1, 1.5, or 2 years) refer to the period of days immediately preceding the index date for which there was no evidence of antidepressant exposure. further restriction to participants with standardized antidepressant dose ratio 1.0 improved ppv estimates to 90.8% (95% ci 85.1% to 94.4%) for the 1-year window, to 90.8% (95% ci 85.0% to 94.6%) for the 1.5-year window, and to 90.8% (95% ci 85.0% to 94.6%) for the 2-year window. requiring a minimum of 1 year of olmsted county residence prior to the index date and further restriction to participants with standardized antidepressant dose ratio 1.0 improved the ppv estimate to 90.6% (95% ci 85.1% to 94.2%). restriction to participants with standardized antidepressant dose ratio 1.0 improved the ppv estimate to 89.5% (95% ci 80.6% to 94.6%) for males and to 93.2% (95% ci 85.9% to 96.8%) for females. restriction to participants with standardized antidepressant dose ratio 1.0 improved the ppv estimate to 93.9% (95% ci 83.5% to 97.9%) for subjects aged < 18 years, to 92.0% (95% ci 83.6% to 96.3%) for subjects aged 1864 years, and to 85.4% (95% ci 71.6% to 93.1%) for subjects aged 65 + years. after restricting the sample to cases in which the standardized antidepressant dose ratio was 1.0 on the index date (n=165), 150 cases were confirmed as new users (ppv 90.9%, 95% ci 85.5% to 94.4%) (table 2). all 15 misclassified cases were prevalent antidepressant users. extending the time windows preceding the index date to 1, 1.5, or 2 years resulted in incrementally greater reductions in the number of potential new antidepressant users, with only modest increases in the ppv (table 2). expanding the time windows preceding the index date and restricting the cohort to cases with standardized antidepressant dose ratios 1.0 on the index date resulted in ppv estimates of 90.8%. requiring at least one continuous year of olmsted county, minnesota, residence prior to the index date also did not improve the ppv estimate (table 2). of the 139 856 subjects who did not meet the algorithm definition of new antidepressant user, a total of 3975 were classified as potential new antihistamine users. from these subjects, we derived a random sample of 200 users stratified by age and sex, in a manner identical to that used to define the random sample of potential new antidepressant users. medical records were reviewed manually for all 200 cases, three of whom had evidence of antidepressant use in the 6 months preceding the first qualifying antihistamine prescription, yielding a false negative rate of 0.015 (or 1.5%) and npv estimate of 98.5% (95% ci 95.7% to 99.5%). our sampling scheme was based on first identifying a random sample of new antidepressant user and non - user cases based on the computer algorithm. as such, we were unable to directly calculate algorithm sensitivity, which would require a random sample of the entire population subsequently classified as antidepressant new users and non - users according to manual medical record review. however, as a secondary approach, and making a number of assumptions, we have provided a crude estimate of algorithm sensitivity based on data from our study (see online supplementary appendix). we validated an algorithm for identifying new antidepressant users in rep prescription records using manual review of medical records as a gold standard. in the sample studied, the ppv was 81.3%. restricting the sample to cases in which the standardized antidepressant dose ratio on the index date was 1.0 resulted in a marked increase in the ppv (90.9%), whereas extending the time windows preceding the index date to 1, 1.5, or 2 years resulted in only modest improvements in the ppv at the expense of incrementally greater loss of potential new antidepressant users. requiring a minimum of 1 year of olmsted county residence did not increase the ppv estimates. over the last 40 years, the rep has successfully provided the facilities and data for over 2000 descriptive, case control, and cohort studies.18 strengths of the rep are well - documented, and include the ability to link nearly all medical records and other sources of healthcare data for the entire population of olmsted county, minnesota. only recently, however, has the rep medical records linkage and indexing system also included detailed and complete automated drug prescription information.19 33 historically, drug prescription information was available in the original medical records, but intensive efforts and expense on the part of investigators were required to manually abstract pertinent data related to individual drug prescriptions. therefore, the new electronic prescription records may provide reliable, efficient, and low - cost data suitable for population - based studies of medications.20 however, there are several challenges involved with the use of automated prescription data. because rep and other computerized prescription records are typically collected during routine medical care and not for research purposes, they are subject to misclassification.16 22 prior studies have investigated the concordance between computerized pharmacy records and patient self - report data2326 or review of medical records.23 2730 nearly all of these studies focused on validation of prescription records for elderly persons who were health maintenance organization or medicaid beneficiaries. mckenzie validated oregon medicaid pharmacy claims data for antidepressants and other psychotropic drugs in a cohort of 900 adult nursing home residents using medical chart review as a gold standard. the ppv for antidepressant exposure was 93.8%, with a high correlation between the average daily antidepressant dose in the pharmacy claims data and medical records (r=0.810.84, depending on the algorithm used). shorr and colleagues validated tennessee medicaid pharmacy claims data for tricyclic antidepressant use against medication administration records for 9452 adult nursing home residents.28 there was high concordance (8588%) between medicaid files and medical records with regard to antipsychotic drug use. although no data were presented for antidepressants, the authors reported that the degree of agreement between medicaid files and medical records for antidepressant use was similar to that for antipsychotic use. finally, johnson and vollmer documented a ppv of 76% for automated outpatient prescription records of psychotropic medications (including antidepressants) using an in - home assessment as a gold standard for 83 frail elderly health maintenance organization enrollees.25 our study is the first systematic attempt at validating automated rep prescription data for any specific medication class. using this data source, zhong previously reported that antidepressants were the second - most frequently prescribed drug group in the entire olmsted county, minnesota, population in 2009 (n=18 028, 13%), and the most commonly prescribed drug class in the 3040-year - old population (n=6310/37 927, 17%). however, the zhong study described prevalent use of antidepressants and did not focus on the start of new medication use (incident use). our data confirmed the validity of rep prescription records for identifying both prevalent and incident antidepressant users. our validation efforts began with the goal of developing an algorithm for identifying new antidepressant users. prevalent users have, by definition, persisted in their use of a medicine and have presumably tolerated and perceived benefit from it.17 37 this can significantly impact the validity of study findings from mixed prevalent and incident user cohorts by underestimating effects that occur relatively soon after drug initiation, over - emphasizing the effects of long - term medication use, over - representing persons with good adherence, and potentially over - estimating favorable treatment outcomes.38 furthermore, studying drug effects in prevalent users permits adjustment only for potential confounding factors assessed after study drug exposure.17 adjustment for these factors may lead to an underestimation of study drug effect if the factors are influenced by study drug exposure and are on the causal pathway between the study drug and the outcome of interest.17 rep prescription data have several potentially important advantages. the rep data systems permit access to data on prescription records and health conditions for an entire geographically defined population, making it unique among data sources in the usa.39 because rep is based on a geographically defined population, it is not subject to healthy beneficiary bias that may be encountered in managed - care systems or referral bias that may be present in drug exposure registries.40 41 rep data are not limited by socioeconomic factors (as is the case with medicaid data), age (medicare data), healthcare provider type, or insurance status.39 importantly, rep prescription data are linked to the complete medical records of each cohort member, thus enabling precise ascertainment of the intended antidepressant indications and future investigations of the immediate and delayed effects of antidepressants on a variety of health outcomes (including conditions or effects not adequately captured by diagnostic codes, such as changes in laboratory results or non - specific symptoms), as well as investigations linking prescription data with genetic variants (population - level pharmacogenetics studies) and cost data (cost outcome studies). the completeness and accuracy of data on medication exposure is known to vary across data sources,16 and these factors have a direct influence on the ppv and generalizability of our approach to other data sets. concerning completeness, the rep infrastructure includes prescription data from outpatient settings (including office - based and hospital - based outpatient practices),33 as well as information on self - reported use of over - the - counter medications and alternative therapies for some cohort members. concerning accuracy, our results suggest that a high proportion of antidepressant new user cases identified by our algorithm will be true cases ; however, a more acceptable level of predictive value was reached only after eliminating cases with standardized doses that exceed the usual starting doses of a given drug for specific indications. of the 37 misclassified cases, the generalizability of our approach to other drug classes and other data sources requires further investigation. first, our study focused on validating antidepressant exposures in a single random sample of olmsted county, minnesota, residents and involved the testing of an algorithm designed for use in rep prescription data. second, although the olmsted county population captured by the rep system is large, it may not be large enough for adequately powered studies of rare outcomes related to a given drug exposure. third, our definition of new antidepressant prescribing was conservative, based on an assumption that all antidepressant prescriptions written prior to the index date were filled and the entire medication supply was used as directed. fourth, we were unable to verify whether antidepressant prescriptions were filled or that the medicines were ingested. finally, our objective was to test an algorithm that would identify potential but not established new antidepressant users ; therefore, our sampling scheme began with classification of new antidepressant use and antidepressant non - use based on the computer algorithm definition. we did not draw a random sample of cases from the underlying population and subsequently classify them as new antidepressant users or non - users based on medical record review. this approach permitted direct calculation of the ppv, consistent with our study objectives, but only an indirect calculation of sensitivity. however, we provided a crude estimate of sensitivity based on a random sample of new antihistamine users with no evidence of antidepressant exposure, after making a number of assumptions. the new antihistamine users represented a small proportion of the total number of persons in the population not meeting the definition of new antidepressant user (3%). although we do not expect the antihistamine users as a group to be substantially different than the entire population of patients not meeting the algorithm definition of new antidepressant user, our sensitivity estimate should be interpreted with caution. in conclusion, we validated a computer algorithm designed to identify new users of antidepressants in comprehensive prescription records for a geographically well - defined population in the usa. the algorithm had an overall ppv of 81% that increased to 91% after exclusion of cases in which the standardized antidepressant dose ratio on the index date exceeded a value of 1.0. our results confirm that rep prescription records can be used to identify prevalent and incident users of antidepressants in this population.	objectivewe validated an algorithm designed to identify new or prevalent users of antidepressant medications via population - based drug prescription records.patients and methodswe obtained population - based drug prescription records for the entire olmsted county, minnesota, population from 2011 to 2012 (n=149 629) using the existing electronic medical records linkage infrastructure of the rochester epidemiology project (rep). we selected electronically a random sample of 200 new antidepressant users stratified by age and sex. the algorithm required the exclusion of antidepressant use in the 6 months preceding the date of the first qualifying antidepressant prescription (index date). medical records were manually reviewed and adjudicated to calculate the positive predictive value (ppv). we also manually reviewed the records of a random sample of 200 antihistamine users who did not meet the case definition of new antidepressant user to estimate the negative predictive value (npv).results161 of the 198 subjects electronically identified as new antidepressant users were confirmed by manual record review (ppv 81.3%). restricting the definition of new users to subjects who were prescribed typical starting doses of each agent for treating major depression in non - geriatric adults resulted in an increase in the ppv (90.9%). extending the time windows with no antidepressant use preceding the index date resulted in only modest increases in ppv. the manual abstraction of medical records of 200 antihistamine users yielded an npv of 98.5%.conclusionsour study confirms that rep prescription records can be used to identify prevalent and incident users of antidepressants in the olmsted county, minnesota, population.
infantile tremor syndrome (its) is a clinical syndrome of acute or gradual onset of mental and psychomotor changes, pigmentary disturbances of hair and skin, pallor, and coarse tremors in malnourished children aged between 5 months and 3 years. it has been primarily reported from india and south east asia and has also been reported from other developing countries in asia and africa. various nutrient deficiencies (e.g. vitamin b12, magnesium [mg ], zinc [zn ], vitamin c, etc. clinically the presence of tremor has been attributed to structural and functional alterations of extrapyramidal system, but routine neuroimaging studies with computed tomography (ct) scan and magnetic resonance imaging in past revealed non - specific structural changes in its. here, we report a classical case of its with a rare association of thin corpus callosum. to the best of our knowledge, a 5.5-month - old female infant presented with pallor for 1-month, tremors of hands and feet for 2 days and delayed development. there was no history suggestive of fever, bleeding, rash, lymphadenopathy, hepatosplenomegaly, jaundice, or seizures. the child was born at term gestation with no antenatal, natal, or postnatal complications. the child weighed 5.5 kg, had a length of 66 cm and head circumference of 41.5 cm. on physical examination, the child had sparse hair, pallor, and hyperpigmented knuckles [figure 1 ]. there were coarse tremors in all four limbs, the perioral and periorbital region in awake as well as sleep state [video 1 ]. there was increased tone in all 4 limbs, but no paresis of limbs or cranial nerve palsies. investigations revealed anemia (hemoglobin = 6.6 g%), mean corpuscular volume (mcv) (103.7 fl), mean corpuscular hemoglobin (mch) (38 pg), mch concentration (37.4%), with normal leucocyte count (11,400/mm), and platelets (4 lakh / mm). serum b12 level was 202 pg / ml (200900 pg / ml) and serum folic acid was 6.3 ng / ml (521 ng / ml). cerebrospinal fluid (csf) examination revealed no red blood cells or neutrophils, normal protein, sugar, and sterile cultures. ct scan of the brain revealed cerebral atrophy with thin corpus callosum [figures 2 and 3 ]. dull looking facial expression along with hypopigmented sparse hairs and pallor in a child of infantile tremor syndrome computed tomography scan showing diffuse cerebral atrophy computed tomography scan showing diffuse cerebral atrophy along with thin corpus callosum based on the clinical features, child was diagnosed as its. initially, we have given her propranolol, b12, mg, and multivitamins, but there was no improvement in her condition. then, we started carbamazepine after 4 days and a dramatic response was observed after 7 days, as appetite improved, tremors disappeared during sleep and decreased in amplitude in the awake state. after 1-month of follow - up, the child is active, gaining weight (6 kg), hemoglobin has improved (9.4 g%), and tremors stopped. after 2 months of follow - up, propanol and carbamazepine have been tapered and stopped. a classical picture of its is a plump looking infant between 6 and 18 months with the presence of malnutrition. dark pigmentation is present over dorsal aspects of hands, nail folds, feet, knees, ankles, buttocks, and axillae. they are more prominent in distal parts of limbs, head, face, and tongue. there is presence of anemia, which may be macrocytic, microcytic, or normocytic. malnutrition, vitamin and mineral deficiency (e.g., mg and zn), infections, toxins, degenerative brain disease, enzyme defects (e.g., tyrosine) all have been postulated as the causation of its. among various theories, it is usually seen in children who are exclusively breast - fed for prolonged periods by vegetarian mothers. the low levels of vitamin b12 and its transport protein transcobalamin ii (tc ii) in the csf maybe responsible for the neurological features of this syndrome. it is usual to find direct or indirect evidence of associated other nutritional deficiencies such as protein, vitamins a, d, c, and b - complex and other micronutrients. its is essentially a clinical diagnosis with peripheral smear suggestive of anemia (mostly megaloblastic anemia, macrocytosis (mcv > 95), hypersegmented polymorphs, and megaloblastic bone marrow). vitamin b12 levels in the mother may also be low suggesting low levels in the breast milk. most reports have shown normal neuroimaging findings or cerebral atrophy, ventricular prominence and/or prominence of the subarachnoid space, pontine myelinolysis, and cerebral hyperintensities. in our case, thin corpus callosum is usually present in premature babies and is associated with poor neurological outcome and neuropsychological performance, but our case was delivered at term gestation and her antenatal, natal, and postnatal course was uneventful. to the best of our knowledge multivitamins, vitamin c, iron, protein, zn, and mg supplements may also be necessary. if the tremors are severe, phenobarbitone or carbamazepine may be required to decrease the intensity. initially, there is a gradual reduction in the amplitude and severity, and then the tremors become intermittent and finally stop. propranolol and chlorpromazine	infantile tremor syndrome (its) is a clinical disorder characterized by coarse tremors, anemia and regression of motor and mental milestones, presenting in malnourished children aged between 5 months and 3 years. few reports of neuroimaging abnormalities in children with its are present. the most common finding of neuroimaging in its is cerebral atrophy with ex - vacuo enlargement of ventricles and subarachnoid space, some recent reports also showed pontine myelinolysis and cerebral hyperintensities. we did not find any report of thin corpus callosum associated with its in the literature.
systemic lupus erythematosus (sle) is a chronic multisystem autoimmune disease and is considered to be caused by complex interactions between genetic risk, environmental, and hormonal factors that result in an immune dysregulation, and autoantibody production ensued [13 ]. epidemiological studies reported that sle is more common in asians (46.7/100 000) than in caucasians (20.7/100 000), and ethnicity also influences the age of onset and severity of its manifestations [4, 5 ]. the precise aetiopathogenesis of sle is still unclear ; however, the search for genes and molecular interactions that influence disease has promoted our understanding of pathogenesis and genetic contributions to autoimmunity in sle. genetic association studies and recent advances in the field of single nucleotide polymorphisms (snps) have been highly successful in identifying several loci associated with disease susceptibility [7, 8 ]. the ctla-4 molecule has a suppressive effect on t - cell activation and might contribute to maintain immune tolerance by blocking cd28-dependent t cell activation through interactions with its ligand cd80/86 on antigen presenting cells. the ctla-4/b7 complex can compete with the cd28/b7 complex and convey an inhibitory influence to the t cell affecting t cell development, cytokine production, and immune reactions. ctla-4 would, therefore, be an important negative regulator of t - cell responses, and its dysregulation has the potential to affect the pathogenesis of sle by altered activation of t cells to self - antigens [9, 10 ]. the ctla-4 gene is located within the risk region on chromosome 2q33, and several polymorphisms have been reported in this gene. however, only few of them have been studied for association with sle susceptibility, of which, two are located within the promoter region : a t / c change at position 1722 and an a / g transition at position 1661 [1113 ]. the former could alter transcription factor binding sites whereas the latter may alter the potential response element for myocyte enhancer factor 2 (mef2). hence, allelic variations of these two sites might lead to a differential susceptibility to sle resulting from unbalanced or inefficient immune responses. although ctla-4 polymorphism has been shown to be associated with a number of autoimmune diseases, including sle, graves ' disease, multiple sclerosis, and type 1 diabetes, the associations have not been always replicated in different populations [11, 12, 15 ]. recent studies showed that the ctla-4 polymorphism plays an important role in sle in some populations, which has not been confirmed in chinese. using a case - control study design, we have investigated the role of ctla-4 polymorphism at positions 1661 and 1722 on sle susceptibility in our chinese sle population in central china 's hubei province. a total of 148 patients (17 males and 131 females) meeting the 1997 revised criteria of the american college of rheumatology (acr) for sle were recruited from renmin and zhongnan hospitals of wuhan university, wuhan, china. controls were 170 healthy volunteers with no history of autoimmune disease, collected for a case - control study. the study was approved by the hospitals ' ethics committee of wuhan university, and all subjects were consented to participate in the study. dna from patients and controls was extracted from peripheral blood with dna flash kit 2.0 (haigene biotechnolgy co., ltd. the polymorphisms at positions 1661 and 1722 were analyzed by pcr - rflp (polymerase chain reaction - restriction fragments length polymorphism), using the specific oligonucleotide primers (sangon, shanghai, china), 5ctaagagcatccgcttgcacct3 and 5ttggtgtgatgcacagaagcctttt3. pcr amplification conditions were carried out as follows : initial denaturation at 94c for 5 minutes, then thirty cycles at 94c (15 s), 60c (30 s), 72c (45 s), and one final extension at 72c for 8 min. the products of the pcr were digested with bvbi or msei at 37c for 4 h, and then were analyzed by 2% agarose gel electrophoresis stained with ethidium bromide. after resolving, the 1722 t / c polymorphism was determined by detecting a 486 bp digested fragment (t allele) or two fragments of 270 and 216 bp (c allele) ; (figure 1). the 1661 a / g polymorphism was determined by detecting a 486 bp fragment (g allele) or two fragments of 347 and 139 bp (a allele) ; (figure 2). the chi - square test with yates correction and fisher exact test were used to compare genotypes and alleles frequencies. the odds ratio (or) was calculated to measure the strength of the association observed. the genotypic frequencies for the two sites tested were not found to be deviated from those predicted from hardy - weinberg equilibrium in both sle patients and controls. genotype and allele frequencies of the 1722 t / c and 1661 a / g polymorphisms are shown in tables 1 and 2. the frequency of the t allele on the 1722 snp was significantly increased in sle patients : 57.8% versus 40.6% in controls (p < 0.001, or = 2.002). while the detected c allele frequency in the controls was significantly elevated in comparison with that in the sle patients (59.4% versus 42.2%). the frequencies of t / t homozygotes and t / c heterozygotes were also significantly higher in patients than in controls (28.4% versus 17.1%, p = 0.016, or = 1.926 ; 58.8% versus 47.1%, p = 0.037, or = 1.605). conversely, the frequencies of c / c homozygotes was considerably higher in controls than in patients (35.8% versus 12.8%, p < 0.01, or = 0.263). we observed no significant difference in the distribution of the alleles and genotypes for the 1661 site between patients and healthy subjects. notwithstanding the convincing evidence that ctla-4 polymorphism plays an important role in susceptibility to sle, several studies have observed a significant association of sle with ctla-4 gene polymorphisms [12, 13, 1719 ]. while on the contrary, other studies showed a lack of association with that genetic variation [2022 ]. thus, investigating the frequencies and distribution of variants ctla-4 gene across populations are essential for understanding disease association and discovery of population differences, especially for chinese as they have a much higher sle prevalence than the europeans [4, 5 ]. the interval encompassing the ctla-4 locus on chromosome 2q33 has been reported to show linkage to sle in two genome - wide association studies (gwas) [23, 24 ]. a very recent gwas has confirmed that variation in the ctla-4 gene has been associated with a genetic risk of sle. although, this polymorphism may has not yet reached stringent thresholds of lupus gwas performed in some chinese cohorts, however, the association has been observed in multiple independent studies in various ethnic populations including asian [12, 13, 1719, 2326 ], and there is strong biological evidence sufficient to conclude that ctla-4 polymorphism confers susceptibility to sle through its crucial functions in t cell activation / regulation [11, 24, 25, 2730 ]. recently, a gwas study confirmed an sle susceptibility locus at chromosome 2q32.3 in chinese population that is near the region 2q33 which encodes the genes for ctla-4. as polymorphisms that are near each other have a tendency to be inherited together, something worth further pursuit in future studies. in asian people, positive associations of the ctla-4 polymorphism with sle were reported in korean and japanese while no such association was found in malaysian population. significantly, a meta - analysis by lee. found a close association between sle and exon 1 at + 49 of ctla-4 gene, especially in asians. liu. did not observe an association of ctla-4 polymorphism with sle in taiwanese, but suggested that it is possible that this polymorphism could affect some specific clinical features. this discrepancy with the findings of the current study may be partially attributed to the variations among chinese living in different geographical regions. the results of this study confirm the involvement of ctla-4 polymorphisms at the promoter 1722 on sle susceptibility in the chinese population. our findings are in agreement with the results of other ethnic groups demonstrating the influence of this polymorphism in the susceptibility to sle. on the contrary, the genotypic frequencies for the 1661 site were not found to be significantly different between patients and controls. other studies on 1661 polymorphism in korean with sle also could not find a positive correlation. in addition, no overall associations were seen between this polymorphism and sle in african - americans. being inexplicit, despite the short distance between the two locations, only 1722 promoter region polymorphisms was associated with sle, while the other 1661 is not. this possibly due to some functional differences between the two sites on regulatory properties of this promoter might affect basal promoter activity and gene expression. polymorphisms in promoter regions may affect the gene expression quantitatively or qualitatively by altering transcription factor binding sites or other controlling domains. the significant increase in the c allele observed in the controls is assumed to play a protective role against sle in chinese. on the other hand, the t / t and t / c genotypes of 1722 t / c polymorphisms were associated with higher risk to have sle. hudson. studied ctla-4 polymorphisms at positions t / c 1722 in korean population and found that t allele was more frequent in sle patients while c allele was decreased in the controls and suggested that the c allele could contribute protectively to sle in the korean population. in contrast, fernandez - blanco. found that the c allele of the 1722 t / c snp was associated with sle susceptibility in the spanish sle patients. however, another study did not find any significant association between the genetic polymorphisms at the 1722 t / c snp of the ctla-4 gene and spanish sle patients. although there were significant associations in two of the three studies described above. however, a published meta - analysis study did not unveil a significantly increased odds ratio for this polymorphism. takeuchi. also reported a slight increase in the allele frequency of 1722 c in japanese patients with sle compared to the controls, but the difference was not statistically significant. because there are relatively few studies, it is difficult to explain the contradictories at the promoter 1722 polymorphism in sle, but they may be due to a different genetic background and a possible role for racial and ethnic influences in the pattern of haplotypes on the ctla-4 locus between various populations in sle predisposition [4, 5 ]. variations in associations among populations may be also related to difference in patient characteristics or the distribution of other risk factors that interact with ctla-4 concerning sle. moreover, genetic evidence suggests that genetic heterogeneity, a common phenomenon in complex diseases, are responsible for a considerable portion of this variability. we believe that there is not sufficient research on ctla-4 polymorphisms to identify and demonstrate the role of these important genetic variants that confer susceptibility to sle susceptibility among different populations. whereas some polymorphisms on the ctla-4 gene have been analyzed in various populations for investigating an association with sle, only one of these, the ctla-4 a / g polymorphism at position + 49 in exon 1, has been widely studied, mainly in european populations. accordingly, we expect that the results of our study to reinforce the interest of focusing on analyzing the role of ctla-4 polymorphism in increased susceptibility to sle. furthermore, an elevated level of soluble ctla-4 in sera has been described in sle, with a positive and significant correlation between plasma sctla-4 concentration and sle activity [28, 29 ]. besides, the therapeutic use of ctla4ig which is a soluble fusion protein that interferes with t cell activation by inhibiting the b7/cd28 costimulatory interaction, appears to delay or extenuate disease development in experimental models of lupus. in this way, the results observed should provide new postulates for the immunological role of this costimulatory molecule in the pathogenesis of sle and should facilitate recent advances in the exploration of therapeutic agents targeting t - cell activation in this disease. other polymorphisms have also been described in the promoter region (658 and 318), the ct60 (a / g), and at the 3-end of the gene as well as the microsatellite (at)(n) in the 3-untranslated region (3-utr) of the ctla-4 gene. nevertheless, the reported results have been inconsistent across different ethnic populations [12, 38 ]. hence, further explorations of these polymorphisms are needed in order to more fully examine sle associations with ctla-4 locus in chinese population. allelic and genotypic frequencies may vary between the populations ; therefore, disease association studies and interpreting their results offer a possible route to understanding the influence of these genetic variants on disease aetiology and potentially to the development of new treatments. ctla-4 polymorphism at positions 1722 was significantly associated with sle and may be a risk factor for sle susceptibility in chinese. our results concur with the majority of those published supporting the important influence of ctla-4 polymorphisms in the susceptibility to sle. nevertheless, further study in terms of the functional analysis of polymorphisms on the ctla-4 gene needs to be done, and larger population studies in different ethnic groups should be performed in the future.	several variants of ctla-4 have been reported to be associated with susceptibility systemic lupus erythematosus (sle) ; however, findings have been inconsistent across different populations. using a case - control study design, we have investigated the role of ctla-4 polymorphism at positions 1661 and 1722 on sle susceptibility in our chinese sle population in central china 's hubei province. samples were collected from 148 sle patients and 170 healthy controls. polymerase chain reaction restriction fragments length polymorphism (pcr - rflp) was used to analyze the genotypes of the two sites. statistically significant difference was observed in genotypes for 1722, but not for 1661. the frequency of the t allele on the 1722 snp was significantly increased in sle patients : 57.8% versus 40.6% in controls (p < 0.001, or = 2.002). while the detected c allele frequency in the controls was significantly elevated in comparison to that in the sle patients (59.4% versus 42.2%). on the contrary, no association was found between sle and ctla-4 polymorphism at position 1661.
the genus campylobacter contains fifteen species, of which campylobacter jejuni is the most commonly clinically isolated, in association with invasive diarrheal colitis. fetus (c. fetus) is an opportunistic organism that causes nonintestinal infections with vascular tropism. it has been implicated in various systemic infections, including endocarditis, mycotic aneurysms, septic thrombophlebitis, pneumonia, and neonatal sepsis.1,2 lower respiratory infection caused by c. fetus has been described as febrile lobar pneumonia, occurring in the absence of gastrointestinal disease, that tends to occur in splenectomized patients.3 patients with underlying chronic debilitating illness, eg, diabetes, thalassemias, malignancy, cardiac conditions, or cirrhosis, are at increased risk for c. fetus bloodstream infections.3,4 the virulence of c. fetus is thought to be mainly related to its production of a high - molecular - weight surface protein, which acts as a microcapsule with high affinity to the vascular endothelium;2 blaser reported that c. fetus strains were serum resistant, which explains the high affinity of the organism to endothelial tissues.2 we present a case of pneumonia accompanied by bacteremia caused by c. fetus, in an infant who was suspected to have another undiagnosed comorbidity. a 5-month - old baby was admitted to the hospital with a 2-day history of a high fever, influenza - like symptoms, and a dry cough but no gastrointestinal or neurological symptoms. the vital signs were : temperature 39.1c, respiratory rate 40 per minute, blood pressure 80/50, and oxygen saturation 98%. bronchopneumonia was clinically diagnosed based on radiological findings, and intravenous cefuroxime was empirically initiated. the fever did not resolve, while respiratory specimens and stool did not grow any significant isolate on the corresponding bacteriological media. the patient was previously noted as a case of undiagnosed failure to thrive and scheduled for cardiology assessment since the family history suggested the possibility of a congenital heart disease. the microbiology laboratory noted a positive blood culture bottle, which initially did not yield an organism in gram staining. there was also no growth found on the routine subculture media in the first day. however, after 48 hours, scanty growth was detected, which was oxidase negative and had a microscopic appearance of gram - negative coccobacilli. then, further clinical data obtained from the attending physician suggested a possible chronic morbidity that could predispose the patient to an opportunistic pathogen ; the colonies were subcultured on multiple laboratory media, including skirrow s media, which were incubated microaerophilically at 25c, 27c, and 42c for 48 hours. heavy growth was detected on skirrow s media at both 25c and 37c but not at 42c, with the typical colonial morphology of campylobacter (figure 1). the vitek 2 system (biomrieux inc., craponne, france) gave 99% identification accuracy of the colonies obtained from the skirrow s media but failed to identify the organism grown on routine blood culture plates. sensitivity testing was done using the vitek 2, which showed susceptibility to ampicillin, cefuroxime, chloramphenicol, gentamicin, and imipenem. imipenem was recommended, and the patient remained afebrile from the second day of imipenem treatment, then was discharged in asymptomatic condition 18 days post - identification of the organism, after completion of 22 days of antimicrobial therapy. there was no relapse found at 6, 12, and 18 months following discharge, but the child was diagnosed to have a ventricular septal defect at a subsequent cardiology clinic visit and investigations. a remarkable clinical feature of c. fetus is the potential to cause bacteremic illness, which may or may not have a focus of infection.5 this can be explained by the lack of c. fetus specific opsonizing antibodies and effective phagocytosis in susceptible patient groups.2 bacteremia due to c. fetus has been rarely reported, reflecting an underestimated frequency and difficulties in laboratory identification, where it is grown in nonfavorable metabolic conditions. these inherent difficulties as well as the sporadic nature of the infection have contributed to lack of understanding of the disease. experimental utilization of the recently developed pathogenesis model for c. fetus would enable elaboration of some of its clinical aspects in systemic infections.6 the source of c. fetus infection in patients often remains unknown. as in this case, gastrointestinal manifestations might be absent, and the organism is very rarely isolated in stool.7 in this particular case, the stool was consistently negative for campylobacter. a history of contact with domestic animals and poultry is also not common. despite the lack of epidemiological association, the typing methods suggest that the organism is transmitted through contaminated food to the gastrointestinal tract then to the circulation before being subsequently deposited in tissue foci.7 the reservoir of c. fetus can be zoonotic or environmental since the organism may survive for 24 hours in liquids and up to 3 weeks in the soil. this infant, who was exclusively breastfed, initially presented with a respiratory illness that might be attributed to the same organism since c. fetus has been reported to cause pneumonia,8,9 but the respiratory isolation media may not have favored its growth ; subsequent respiratory samples aiming at isolating c. fetus on selective media at microaerophilic conditions failed to grow the organism. thus, it can be interpreted either that such samples were collected following antimicrobial therapy or that the child might have had a viral respiratory infection along with c. fetus primary bacteremia. nosocomial spread of c. fetus has been described, necessitating strict enteric infection control measures in the admitting unit.3 the optimal antimicrobial treatment of this microorganism has not been determined in prospective comparative studies, and evidence is solely based on cohorts and case series. although the in vitro testing generally reveals extreme susceptibility to multiple antimicrobials, it is recommended to treat c. fetus bacteremia with parenteral carbapenem, which maintains powerful anti - campylobacter activity and prevents relapse.1 therapeutic failure or relapses were described following the use of other agents, despite in vitro sensitivity.10,11 the minimal inhibitory concentration of imipenem is 0.06 g / ml compared with 4.0 g / ml for penicillins.10 the use of cephalosporins is not advised, even in the case of susceptibility, since their bactericidal activity is weaker than that of other agents.11,12 ciprofloxacin - resistance was also encountered in c. fetus.13 gentamicin has been found to show very low minimum inhibitory concentrations for c. fetus, and a recent report from quebec did not identify gentamicin - resistance among a large cohort of c. fetus strains.14 on the basis of anecdotal clinical experience and microbiological data, gentamicin can be used in a combination regimen to eradicate severe c. fetus endovascular infections. the duration of treatment for c. fetus - related bacteremia is not well defined, but a minimum of 3 weeks of treatment has been suggested to avoid relapse.11 patients need to be followed for the potential of recurrence with fatal septic shock, even in immune - competent hosts.5 although this patient was cured and did not show relapse at 6, 12, and 18 months follow - up, the relapsing nature of the illness and the mortality following relapse due to c. fetus bacteremia is reported to be as high as 30% this can be reduced significantly when the infection is timely diagnosed, illustrating the importance of communication between clinician and the laboratory in early detection.1,8,13 the difficulty of identifying an organism from a sample type for which it is not routinely analyzed calls for a more collaborative multiteam approach, when treating a patient with undiagnosed illness. are easily identified organisms in routine processing of stool, but they are difficult to spot in blood cultures, where the incubation conditions are not microaerophilic., which are proposed in secondary investigation of relevant clinical samples, when the routine specimen protocols fail to identify a common etiological pathogen. mortality is associated with cancer, splenectomy, use of fluoroquinolones, and the lack of secondary clinical manifestations of bacteremia;14 none of which were present in the described case. the condition was diagnosed by microbiological examination of a blood culture following correlation with clinical data. this report illustrates the difficulties in identifying an organism infrequently implicated in bloodstream infections of high - risk groups and the importance of laboratory readiness to provide an alternative identification algorithm based upon clinical needs. this review also calls for a greater liaison between the treating physician and clinical microbiologist, to optimize the management of a potentially life - threatening condition. for optimal health care, such cases need to be addressed in a patient - centered, multidisciplinary clinical environment.	bacteremia due to campylobacter spp. is rarely reported, and campylobacter fetus is the species most commonly exhibiting vascular tropism, as occurred in this case report describing the diagnosis of c. fetus bacteremia in an infant presenting with respiratory tract infection. a 5-month - old baby, with undiagnosed failure to thrive, presented to the acute care service with a high fever and respiratory symptoms of 2 days duration. the initial clinical and laboratory diagnosis suggested bacteremia, but there was difficulty with recovery and identification of the organism from blood. subsequent laboratory testing confirmed c. fetus as the etiological agent. campylobacter isolated from blood culture bottles may give atypical laboratory features, rendering its identification challenging. thus, such an infrequent species might be underestimated in frequency, and it should be considered in diagnostic laboratories, when a gram - negative organism with atypical findings is encountered in respiratory samples or blood culture bottles.
adoptive immunotherapy, particularly adoptive transfer of antigen - specific cytotoxic t lymphocytes, has shown some success in clinical trials for treating both cancer and viral infections [15 ]. however, due to resident tolerance within the tumor environment the most robust ctl must be stimulated for highest efficacy. delivery of antigen genes into dendritic cells (dcs) or precursor monocytes (mo) allows for the stimulation of robust antigen - specific ctl. however, there are a variety of improvements that might be made to further enhance ctl stimulation. one obvious course is the delivery of th1-response interferons / cytokine genes into immune cells for their continuous expression. interferon gamma (ifn-) is an important th1 response interferon / cytokine involved in ctl generation and function and might be used to enhance ctl stimulation. in addition, ifn- may have other non - t cell - associated attributes as it is believed to stimulate expression of hla class i and ii molecules. however, overall ifn- is strongly linked to the induction of th1 response, the generation of ctl. of all the th1 response interferons / cytokines ifn- correlates most strongly with the th1 response [911 ] as, in fact, many laboratories study t cell expression of ifn- as a substitute for carrying out ctl killing / chromium release assays [12, 13 ]. moreover, ifn- plus il-12 appears to act cooperatively in the generation of a very strong th1 response [14, 15 ]. ifn- may also partially overcome low activation and expansion rates of low - avidity ctl [16, 17 ]. as with most of the th1-response - associated chemokines, thus, gene delivery of ifn- will likely be very useful in generating a robust th1 ctl response. while ifn- gene delivery would seem to be beneficial for generating robust ctl, it is unclear which cells should specifically express this cytokine for maximum ctl stimulation. while activated t cells naturally express ifn-, it has been shown that ifn- is able to significantly affect dc maturity and function as well as dc precursor mo and macrophage (m) phenotypes [1921 ]. thus it is unclear which immune cell type should express this cytokine during the initial stimulation of the cd8 + ctl. two general approaches are available, transducing the dc (paracrine delivery) which stimulate the responder t cells, or the t cell themselves (autocrine delivery). here we demonstrate that ifn- autocrine gene delivery resulted in significantly higher cea - specific ctl killing compared with paracrine delivery or exogenous ifn-. the sw480 colorectal adenocarcinoma cell line was obtained from the american tissue culture collection (atcc). a carcinoembryonic antigen- (cea-) positive lymphoblastoid cell line (cea+ lcl) was generated by transfecting an hla - a2 positive lcl cell line with a cea plus neomycin resistance gene (neo) expression plasmid and selection with 1 mg / ml g418 for two weeks. peripheral blood mononuclear cells (pbmcs) from five hla - a2 positive healthy donors were separated by routine ficoll gradient method. all blood donors gave informed consent in writing, and the study protocol conformed to the ethical guidelines of the 1975 declaration of helsinki as reflected in a priori approval by our human research internal review board. the hla haplotype of all donors was compatible with sw480 cells (hla a2) and other cells used as controls. human cea and ifn- cdnas were amplified by reverse - transcription polymerase chain reaction (rt - pcr). trizol reagent (invitrogen) was employed to isolate total rna from sw480 cells and pha - stimulated primary human t lymphocytes, respectively. subsequently, the total mrna was separate from the total rna using oligotex mrna isolation kit (qiagen). after the first - strand cdna was generated, pcr amplification for each of the cdna was carried out using the following primer pair : cea : 5-accatggagtctccctcg-3 and 5-ctatatcagagcaacccc-3 that amplify the sequence from nucleotides 112 to 2223 ; ifn- : 5-ttctctcggaaacgatg-3 and 5-ggcaggacaacca ttac-3 that amplify the sequence from nt 94 to 622. cea and ifn- cdna were inserted in the downstream of p5 promoter of an aav vector, respectively, as described previously. the raavs were generated, purified, and tittered as described previously [24, 25 ]. after freshly isolated pbmcs (5 10) were cultured for two hours in aim - v medium, the nonadherent cells were removed. the remaining adherent mos were infected immediately with 1 10 encapsidated genomes (eg)/ml of aav / cea virus or aav / cea plus aav / ifn- virus. after four hours the medium / virus solution was removed and the cells were finally fed with the medium containing recombinant human gm - csf (immunex, 800 iu / ml). at day 2, to induce the maturation of mo into dc, recombinant human il-4 and tnf- (r & d systems.) were added to the medium at 1000 iu / ml and 20 ng / ml, respectively. finally, at day 6 the dcs were mixed with cd3 + t cells. briefly, pan t cell isolation kit ii (miltenyi biotec) was employed to isolate cd3 + t cells from the nonadherent cells from the pbmc according to the kit instruction. at day 5 the cd3 + t cells (1 10) were infected with 1 10 eg / ml of aav / ifn- virus and cultured with 20 ng / ml of il-2. the total dnas were isolated from the raav - infected or uninfected dc or t cells using dnazol reagent (invitrogen) according to supplier 's protocol. chromosomal integration of the aav / cea genome was studied by vector - chromosome junction pcr amplification and southern blot analysis, as previously described. at day 4 of mo / dc culture and dc - t cell culture, isolation and amplification of the mrna pcr amplification for the tfiib cdna was performed using the primer pair : 5-tgtctgttgtgtcttgttgc-3 and 5-taggctatgtacaacagg c-3 that amplify the sequence from nt 319 to 1310. at day 6 of mo / dc culture and day 4 of raav infection of cd3 + t cells, briefly, cells were incubated with the fitc- or pe - labeled monoclonal antibodies recognizing the following antigens, respectively : cea, ifn-, and il-2 (bd pharmingen). control irrelevant isotype - matched fitc- or pe - conjugated monoclonal antibodies were also obtained from bd pharmingen. a facscalibur flow cytometer (becton - dickinson) was used for data acquisitions. at least ten thousand events were counted for each sample. at day 5 - 6 of dc culture the mature dcs were harvested and mixed with cd3 + t lymphocytes (ratios from 20 : 1, t : dc) in aim - v medium, respectively. some t cells were untransduced while others were previously infected with aav / ifn-. mixtures were cultured in aim - v containing il-2 (20 iu / ml) and il-7 (20 ng / ml). exogenous ifn- was used at 100 u / ml. at 7 - 8 days postaddition to dc the cells were harvested and analyzed further. after 6 days the nonadherent dcs were harvested (> 95% viable as assessed by trypan blue exclusion) and the cells counted and distributed. for the analysis of dc a panel of fitc- or pe - labeled monoclonal antibodies recognizing the following antigens was used : cd14, cd40 (chemicon international), hla - dr, cd80, cd8, cd86, and isotype - matched antibodies (bd pharmingen). stained cells were assayed by fluorescence activated cell sorting (facs) for these cd markers according to the routine method. for the analysis of activated t cells, at day 8 of the mixed cell culture the stimulated t cell populations were analyzed for their surface markers with immunofluorescence staining by flow cytometry. a panel of fitc- or pe - labeled monoclonal antibodies recognizing the following antigens was used : cd4, cd8, cd25, and cd69 (bd pharmingen). at day intracellular staining assay was performed to analyze the expression of ifn- in the t cells according to the method described above. fitc - labeled anti - ifn- monoclonal antibody (bd pharmingen) was used. after the cd3 + t cells were mixed with the dc on day 6, each group of mixed cells was inoculated into wells of a 96-well cell culture plate. there were 5 10 cells (200 l) in each well. after the mixed cells were cultured for 8 hours in 37c, 5% co2, h - tdr incorporation test was carried out according to the routine method. ctls were generated from 3 donors. at day 14 (day 8 of t cell : dc coincubation), chromium-51 (cr) release assay was used to analyze the killing activity of ctl elicited by aav / cea - transduced and control dc against the target cells as previously described. briefly, the ctl cells and cr - labeled target cells were mixed (20 : 1) and incubated for 6 hours at 37c with 5% co2. to determine mhc / hla class i restriction of ctl killing anti - mhc class i monoclonal antibodies were used to block cytotoxicity. the cr - labeled targets were preincubated with mouse antihuman mhc class i antibody (serotec) for 1 hour before the cr release assay was performed. the mouse antihuman mhc class ii antibody (serotec) was also used as a control. the cea gene, a common adenocarcinoma tumor marker, was cloned from colorectal adenocarcinoma cell line sw480 and ligated down - stream of the aav p5 promoter within a fully gutted aav2-based vector (dl3 - 97). raavs were generated as described previously [24, 25 ] and used to transduce dc and t cells at efficiencies above 85%. our approach for transducing dc has been to infect freshly adherent peripheral blood monocytes with raav, to treat these cells with gm - csf alone for one day, and then add il-4 to induce their differentiation into dc [24, 25, 28 ]. this technique has proven to be very effective in generating specific antigen - presenting dc and cytokine - expressing dc [24, 25, 28 ]. one issue in the field of aav - based gene therapy is the form of latency of the aav proviral dna within the transduced primary cells. in vitro tissue culture transduced cell lines often display a chromosomally integrated provirus, while in vivo transduced cells often show the latent raav dna as an episomal element. to address this issue chromosomal dna from the transduced t cells and dc were analyzed for integrated aav / ifn- provirus by pcr amplification of vector - chromosome junctions by using one primer directed towards the vector and another directed towards the alu i repetitive chromosomal element. products were then agarose gel electrophoresed, southern blotted, and p - dna probed for vector sequences. as shown in figures 2(a) and 2(b) this technique clearly demonstrates some level of chromosomal latency in both dc and cd3 + t cells.. figures 3(a) and 3(b) show that the resulting raav / ifn- provirus does express by rt - pcr analysis, in both dc and t cells. to observe both the transduction efficiency and protein expression of ifn- we carried out an intracellular staining analysis of transduced and untransduced dc and t cells. the transduction efficiency of dc by aav / ifn-, as shown in figure 4(a) (dc) and figure 4(b) (t cells), approached 90%. this agrees with our earlier studies with other transgenes, but it must be noted that t cells which were not transduced with aav / ifn- displayed a high background expression of 48%. in any case, we infect dc with either the aav / cytokine vector at day 0 or the t cells on day 5 just before their addition to the cea antigen loaded dc. dcs (mo) were always loaded by infection with aav / cea on day 0. we examined the dc on day 6, as shown in table 1, for surface expression of cd14, cd40, cd80, cd83, and cd86 by facs and found that cd80, cd86, and cd83 were upregulated by raav infection as shown previously. the addition of exogenous ifn- further upregulated these markers, but the use of aav / ifn- had a more profound effect. we further observed the resulting expression level of il-12 and il-10 in dc by these various treatments, as shown in figure 5. dcs were treated with exogenous ifn- or aav / ifn-. a high il-12/il-10 ratio reflects the likelihood that these dcs would stimulate a more robust th1 ctl response ; however both treatments gave a similar ratio. secretion of ifn- from dc (and t cells) was also measured by elisa. ifn- secretion from aav / ifn- transduced dc, with or without aav / cea transduction, shown in figure 6, was similar. expression rose from 68 to 80 hours postinfection and then remained stable out to 92 hours. however, it is noteworthy that aav / ifn--infected t cells secrete more ifn- than aav / ifn--infected dc. a robust mhc / hla class i - restricted th1 ctl response is most consistent with a high cd8 : cd4 ratio. the resulting cell population stimulated by the various dc treatments was analyzed by facs and the results listed in table 2 upper panel. the cd8/cd4 ratio in t cell populations was higher when these cells were stimulated by aav - transduced dc than with mock - treated dc (table 2). however t cells derived from aav / ifn--treated dc had a slightly higher cd8/cd4 ratio, consistent these cells having slightly higher cd80, cd83, and cd86 expression (table 1), and slightly lower il-10 expression (figure 5). however, the direct treatment of t cells by aav / ifn-, stimulated by aav / cea - loaded dc, resulted in t cell populations with the highest cd8/cd4 ratio (7.9) (table 2 lower panel). a robust th1 ctl response is also consistent with a high ifn-/il-4 expression ratio. again, the resulting t cells generated from any aav - transduced dc had a higher ifn-/il-4 expression ratio than by mock treated dc (table 2 upper panel). however, the direct treatment of t cells with aav / ifn- delivery, stimulated by aav / cea loaded dc, resulted in t cell populations with the highest ifn-/il-4 ratio (18.3) (table 2 lower panel). moreover, a robust th1 ctl response is also consistent with a high proportion of cd69+/cd8 + t cells. yet again, the direct treatment of t cells by aav / ifn-, stimulated by aav / cea loaded dc, resulted in t cell populations with the highest percent of cd69+/cd8 + t cells (91.3%) (table 2 lower panel). finally, a robust th1 ctl would also be consistent with low cd25+/cd4 + treg cell numbers. again, the direct treatment of t cells by aav / ifn, stimulated by aav / cea loaded dc, resulted in t cell populations with the lowest percent of cd25+/cd4 + treg cells (17.1%) (table 2 lower panel). taken together these data suggest that aav / ifn autocrine - delivery into t cells offers the most powerful th1-t cell population as measured by the cd8/cd4 ratio, ifn-/il-4 ratio, highest percentage cd69 +, cd8 + cells, and lowest percent cd25 +, cd4 + cells. the generation of responder ctl involves both the proliferation of cd4 + helper t cells as well as proliferation of the cd8 + t cells themselves. to test the level of t cell proliferation we carried out the standard protocol for the generation of antigen - specific ctl. however, in addition to loading the dc with the antigen (aav / cea) we also added the delivery of aav / ifn- into dc or t cells. proliferation of cd3 + t cells was measured by the incorporation of 3h - tdr, and the results are shown in figure 7. it appears that the use of ifn- in any form offered no advantage to that of the stimulation of proliferation by aav / cea - loaded dc. overall t cell proliferation is relatively equal among all treatments (figure 7), while the cd8/cd4 ratio increases (table 2) when t cells are aav / ifn--infected. having characterized the aav / ifn- transduced dc and t cells we then assayed the resulting ctl for their ability to kill a genetically altered cea - positive lymphoblastoid cell line (lcl) which was hla a2-matched with blood donors. to do this we carried out the experiment depicted in figure 1 and tested for sw480 cell target killing using the standard cr release assay, and the results are shown in figure 8(a). as can be seen the highest level of cea - directed killing results from aav / ifn- autocrine delivery into t cells, a 49% increase over aav / cea - only control. killing was blocked by polymorphic anticlass i antibody, but not by anticlass ii. the high killing that results from aav / ifn- autocrine treatment is fully consistent with the highest cd8/cd4 ratio, highest ifn-/il-4 ratio, highest percentage cd69 +, cd8 + cells, and lowest percent cd25 +, cd4 + cells. the higher killing may be attributed to the higher cd8 + t cell number due to higher cd8/cd4 ratio of t cells in aav / ifn--treated bulk t cell cultures versus the lower ratio generated from aav / ifn--treated dc, 84.6%/10.7% versus 56.5%/22.5%, respectively (table 2). we also utilized cea+ lcl cells as a target and, again, aav / ifn- autocrine delivery into t cells resulted in ctl with the highest killing of cea+ lcl, shown in figure 8(b). while ifn- has multiple actions which promote th1 response [710 ], it was unclear which immune cell type should best express this cytokine. this study demonstrates that only a specific approach of ifn- gene delivery, autocrine delivery, results in a cd3 + t cell population with higher killing ability. this was not fully anticipated as ifn- affects the phenotype of both dc and t cells. for dc ifn stimulates significantly higher mhc class ii, cd86, and slightly higher cd80 levels [3032 ]. ifn- also stimulates higher il-12 expression and dc maturation [3032 ]. comparing dc from ifn knockout mice and normal mice, ifn- expression by dc normally ifn- expression in dc is dependent upon t - bet, but in this study we have circumvented this need by expressing it from the cmv promoter within the aav backbone (aa). moreover, nk and nkt cells are believed to be the major sources of ifn- for induction of macrophage maturation. paracrine ifn- expression by dc is believed to stimulate t cells to autocrine express their own ifn-. however, ifn- also has pronounced effects on t cells as well. while ifn- inhibits the formation of th2 cells, its expression directly correlates with the formation of th1 response and ctl killing, as mentioned earlier, so much so that ifn- secretion is used as a substitute for antigen specific killing assays [12, 13 ]. yet ifn- appears needed for the activity of unusual cd8(+)lap(+)foxp3(+) treg cells. thus, there is some evidence that ifn- may ultimately turn off the th1 response that produces it. our purpose for these studies was to further analyze the mechanism of action of ifn- and to optimize ex vivo generated anticancer ctl for adoptive therapies in cancer. while the adoptive transfer of ex vivo manipulated dendritic cells (dcs) appears mostly ineffective in anticancer therapies, the adoptive transfer of ex vivo generated anti - cancer cd8 + mhc class i - restricted cytotoxic t lymphocytes (ctls) seem to be a more promising treatment therapy [39, 40 ]. while this study demonstrates that ifn- is best delivered and expressed via the autocrine route in the generation of antigen - specific cd8(+) ctl, it should be pointed out that the basal levels of natural ifn- expression also remain present and we are simply augmenting the level of ifn-. thus, our interpretation of this data is that most likely the maximum effective ceiling of ifn- expression and effect in dc had been reached, while the effective ceiling of ifn- expression and effect in t cells had not been. another advantage of ifn- overexpression in ctl would be its known ability to upregulate mhc class i molecules, allowing for enhanced recognition of antigen expressing tumor cells. yet the practicality of the autocrine approach for certain th1 response cytokines is questionable as the endogenous expression of certain cytokines in th1 t cells may be problematic. while bone - related granulomatous lesions and degeneration of cartilage was observed, there were no serious hyperproliferative cellular elements seen in the bone marrow, spleen, or lymph nodes. thus, the adoptive transfer of ifn--over expressing t cells in clinical trials may be further considered. in fact we observed no advantageous proliferation by the t cells (figure 7). moreover, if further work suggests that there are serious side effects of ifn- overexpression in t cells, then the inclusion of a suicide gene within the vector, such as herpes thymidine kinase gene, would allow for the elimination of these cells when needed. this head - to - head comparison of ifn- overexpression in dc versus t cells was done with the purpose of enhancing th1 cd8(+) ctl response. however, these data also give us information as to the primary mechanism of action of ifn- on th1 immune response may be through endogenous t cell expression. yet further analysis is needed to determine whether it is the cd4(+) or cd8(+) t cell which is the primary vehicle through which ifn- acts. cell ratio studies (table 2) suggest that it is the cd8(+) t cell. ultimately dna microarray analysis of the t cell 's transcriptome and proteomics analysis are warranted to fully understand how high ifn- expression affects the cell 's phenotype.	the adoptive transfer of antigen - specific cytotoxic t lymphocytes (ctl) shows promise in the treatment of cancer and infectious diseases. we utilize adeno - associated virus-(aav-) based antigen gene - loaded dendritic cells (dcs) to stimulate such antigen - specific ctl. yet further improvements in ctl stimulation and killing may result by gene delivery of various th1-response interferons / cytokines, such as interferon (ifn-), as the delivered gene can continuously produce that interferon. however which immune cell type should optimally express ifn- is unclear as the phenotypes of both dc and t cells are enhanced by it. here, we used aav to compare and contrast ifn- gene delivery into dc or t cells, and versus the addition of exogenous ifn-, for stimulating carcinoembryonic antigen-(cea-) specific ctl. it was found that aav / ifn- delivery into t cells (autocrine) resulted in t cell populations with the highest cd8(+)/cd4(+) ratio, highest ifn-(+)/il-4(+) ratio, highest cd69(+),cd8(+) levels, and lowest cd4(+)/cd25(+) levels, all consistent with the strongest th1 response. most importantly, aav / ifn- transduction of t cells resulted in antigen - specific t cell populations with the highest killing capabilities, 49% above other treatments. these data strongly suggest that aav / ifn- autocrine gene delivery into t cells is worthy of further study towards maximizing the generation of antigen - specific anticancer ctl killers.
dermatophytosis is a group of skin fungal infections caused by dermatophytes (or ring worms), which invade and attack keratinized tissues. typical symptoms of these infections include inflammation or redness of the infected part, brittleness and fissures of the nails, and loss of hair from the affected parts. a large number of antifungal agents such as griseofulvin, azole derivatives, allylamines and morpholines are used in the treatment of dermatophyte infections. however, they have been shown to exhibit adverse side effects such as gastrointestinal disturbances, cutaneous reactions, hepatotoxicity and leucopoenia. in addition to such adverse effects, the acquired resistance to certain antifungals, and the high cost of synthetic drugs limit the treatment of dermatophytosis. because of their biodegradable nature, the demand for natural drugs has been increasing, and therefore, the development of antifungal agents from local raw material is still a necessity. this is particularly true in the cases developing countries, which have high levels of their populations. coula edulis bail (olacaceae), locally known as african walnut, is a commonly occurring medicinal plant in africa. it can be found in the top canopy of forests as well as the lower story, and has no special soil requirements. ethnobotanical studies indicate that the stem and fruits of c. edulis are commonly used in west africa for the treatment of stomach ache and skin diseases. the bark of the plant is used to produce rinses or enemas for loin pains or kidney problems. moreover, antibacterial and anti - yeasts activities of c. edulis extracts have been shown in previous studies. to the best of our knowledge this study, therefore, was undertaken to first evaluate the antidermatophytic activity of the ch2cl2-meoh (1:1 v / v) extract, fractions and compound isolated from the stem bark of c. edulis, and then to assess the toxicological risk of its extract upon consumption. general experimental procedures for structure elucidations melting points (uncorr) were determined on a kofler apparatus. ultra - violet (uv) spectra were measured with a uv-210 pc, uv - vis scanning spectrophotometer (analytikjena). proton nuclear magnetic resonance (h - nmr) spectra were recorded in cdcl3 using a bruker avance 500 mhz nmr spectrometer and trimethylsilyl (tms) as an internal standard. thin layer chromatography (tlc) were carried out either on silica gel gf254 pre - coated plates (analytical tlc) or on silica gel 60 pf254 containing gypsum (preparative tlc), with detection accomplished by spraying with 50% h2so4 followed by heating at 100c, or by visualizing with a uv lamp at 254 and 366 nm. gas chromatography - mass spectrometry (gc - ms) data were obtained with an agilent 6890n network gc system/5975 inertl mass selective detector at 70 ev and 20c. the gc column was a cp - sil 8 cb lb, fused silica capillary column (x, film thickness 0.25 m). the initial temperature was 50c for 1 min, and was heated at 10c / min to 300c. the carrier gas was helium at a flow rate of 1.2 ml / min. the stem bark of c. edulis was collected from buea (south - west region of cameroon) in january 2008. the plant material was identified at the cameroon national herbarium in yaound where a voucher specimen (19357/hnc) was conserved. extraction, fractionation and isolation previously dried and powdered stem bark of c. edulis () was extracted with dichloromethane - methanol (1:1) () for 48 hours. the filtrate was concentrated under reduced pressure at 40c using rotary vacuum evaporator to give a brown paste crude extract (). one hundred and four grams () of this extract was then subjected to fractionation as previously described. briefly, the crude extract was subjected to a column chromatography with silica gel 40 (particle size 0.2-) as stationary phase. the column was successively eluted with hexane, hexane - ethyl acetate and ethyl acetate - methanol gradients. one hundred and seventy one (171) fractions of 250 ml each were collected and combined on the basis of their thin layer chromatography (tlc) profiles to afford eight main fractions : f1 (1 - 59), f2 (60 - 122), f3 (123 - 124), f4 (125 - 126), f5 (127 - 138), f6 (139 - 149), f7 (150 - 156) and f8 (157 - 171). fraction f2 () was purified on a silica gel 60 (0.063-,) column () to give glucosterol (28 mg). fraction f3 () was rechromatographed on a silica gel 60 (0.063-,) column giving a mixture of sterols and fatty acids (32 mg). identification of the compounds the structure of the isolated compound was established on the basis of spectroscopic analysis (ir, uv, h nmr) and by comparison of the data with those reported in literature. the mixture of sterols and fatty acids was identified by gas chromatography - mass spectrometry (gc - ms) after saponification and methylation of fatty acids. the separated compounds were identified by comparisons of their mass spectra to those of compounds registered in nist 89 and wiley 237 spectral libraries of gc - ms instrument. the microorganisms used in this study included four strains of dermatophytes, namely : trichophyton mentagrophytes e1425, trichophyton terrestre e1501, microsporum gypseum e1420 and epidermophyton floccosum e1423 obtained from (france), and one clinical isolate of microsporum audouinii characterized in our laboratory. these fungi were grown at room temperature (252c) and maintained on sabouraud dextrose agar (sda, biomerieux). in vitro antidermatophytic test the antidermatophytic activities of the crude ch2cl2-meoh (1:1 v / v) extract, fractions and pure compound from c. edulis were evaluated using the agar dilution method as reported by kuiate and co - workers. stock solutions of the test samples (100 mg / ml) were prepared using a 10% solution of dimethylsulfoxide (dmso, mehr). from these stock solutions, dilutions (in melted sabouraud dextrose agar, sda, biomerieux) were made to give serial two - fold dilutions with concentrations ranging from 0.312 to 5 mg / ml. the petri dishes (diameters) were filled with samples containing sda to a final volume of 10 ml. the petri dishes were then inoculated at their centre with a disk (diameters) cut from the periphery of 10 days - old cultures. the test and the negative control petri dishes were incubated at room temperature for 10 days. the radial growth of each fungus was recorded every day at the same time and the percentages of inhibition were calculated using the following formula : where dc was the diameter of colony of negative control culture and dt was the diameter of colony of test culture. each assay was repeated trice. the minimum inhibitory concentration (mic) was defined as the lowest concentration that prevented a visible growth of fungal strain. the inhibited fungal discs from the extract treated dishes were sub - cultured in a fresh medium, and revival of their growth indicated fungistatic effect, while absence of any growth indicated fungicidal effect. experimental animals in this study, 72 swiss albino mice (36 males and 36 females ; 78 weeks old ; 20) and 50 wistar albino rats (25 males and 25 females ; 68 weeks old ; 120) were used. they were bred in the animal house of the department of biochemistry, university of dschang, cameroon. the animals were housed two or three per cage in elevated wire mesh cages, and were provided with standard animal food, grower s mash (grand cereals ltd, jos - nigeria) and water ad libitum. acute toxicity study this study was carried out on swiss albino mice (males and females) as described by emerson and co - workers. stock solution of crude extract (0.8 g / ml) was prepared using 1% aqueous solution of dmso. mice in subgroup 1 (control) were given (oral gavage) 1% aqueous solution of dmso (1 ml per bw) while those of subgroups 2, 3, 4, 5 and 6 were administrated 2, 8, 16, 24 and 28 g / kg bw of crude extract, respectively. all the animals were fasted for 18 hours prior to the extract administration. after a single dose administration, the survived mice were closely observed for two weeks, and were monitored daily for behavioral changes, signs of toxicity and the latency of death. the median lethal dose (ld50) sub - acute toxicity study fifty wistar albino rats (25 males and 25 females) were used. rats in subgroup 1 (control) were given daily administration of 1% dmso (1.5 ml per bw) by oral gavage, while those of subgroups 2, 3, 4 and 5 were given 25, 50, 100 and 200 mg / kg bw of the crude extract, respectively for four weeks. the body weight of each rat was determined during the acclimatization period, once before the commencement of vehicle or extract administration, once every day during the administration period, and once on the day of the sacrifice. the relative body weight (rbw) of each animal was calculated as follows : rbw = absolute body weight of one time interval (g)100bw of raton the first fay of administration (g) food and water consumptions the amounts of food and water consumed (ac) were measured daily from the quantity of food and water supplied and the amount remaining after 24 hours as followed : ac (in g or ml)=total amount of food / water given amount of food / water remaining. twenty - four hours after the last administration, rats were anesthetized with chloroform vapor, and blood samples were collected through cardiac punctures using heparinized and non heparinized centrifuge tubes. the heparinized blood was used for the total red blood cell (rbc) and white blood cell (wbc) counts, and heamatocrit. the non heparinized blood samples were allowed to clot before centrifugation (4000 rpm at + 4c for 10 min) to obtain serum samples, which were assessed for alanine aminotransferase (alt), aspartate aminotransferase (ast), glucose, creatinine, total cholesterol and protein levels by standard methods using relevant kits (biosystem reagents and instruments). immediately after the blood collection, the liver, lung, heart, spleen and kidneys were carefully dissected out, blotted, observed macroscopically and weighed immediately using a sartorius electronic balance. the relative organ weight (row) of each animal was then calculated as follows : row = absolute - organ weight g100body weight of rat on day of sacrifice (g) organs tissues were thawed and homogenized 20 times (w / v) by homogeniser in ice - cold tris - hcl kcl buffer (ph 7.4). the homogenate samples were centrifuged at 6000 rpm for 30 min, and the supernatants were then used for enzyme and total protein assays using the method cited above. statistical analysis statistical analysis was carried out using statistical package for social science (spss, version 12.0). group comparisons were performed using one way anova followed by waller - duncan post hoc test. the experiments were carried out observing the welfare of animals as recommended by world health organization (who). moreover, all procedures involving animals were carried out in strict compliance with the rules and regulations of local ethics committee. one known compound : 3-o--d - glucopyranoside of sitosterol (1), and a mixture of -sitosterol, stigmasterol and n - hexadecanoid acid (2) were isolated from ch2cl2 : meoh (1:1) extract of c. edulis stem bark (figure 1). antidermatophytic activity the results of the antidermatophytic activities of the crude extract, fractions and compounds from c. edulis are presented in tables 1 and 2. it appeared that the extract and fractions f2 and f3 were able to prevent the total growth of all studied microorganisms at the concentrations examined (table 1). fraction f3 showed the best antidermatophytic activity (mic=0.621.25 mg / ml), as compared to that of the crude extract (mic=1.25 - 5 mg / ml) or other fractions (mic=1.25->5 mg / ml). however, none of the samples tested was as active as the reference antibiotic, griseofulvin (mic=0.001 - 0.020 mg / ml) (table 2). chemical structures of 3-o--d - glucopyranoside of sitosterol (1) and a mixture of -sitosterol, stigmasterol and n - hexadecanoid acid (2) the percentage inhibitions (%) of fungal growth by the crude extract of stem bark of coula edulis and the fractions from the extract at the concentration of 5 mg / ml against the tested dermatophytes. values signified by different letters (a - f) are significantly (p < 0.05) different from each other. minimum inhibitory concentration / minimum fungicidal concentration (mic / mfc) (in mg / ml) of the crude extract of coula edulis stem bark and fractions and compounds isolated from the extract against the tested dermatophytes. m ; microsporum, t : trichophyton, e : epidermophyton.1 : 3-o--d - glucopyranoside of sitosterol ; 2 : -sitosterol, stigmasterol and n - hexadecanoid acid. nt ; not tested the results of the acute toxicity study indicated that female mice were more tolerant than male ones to oral administration of the crude extract. for doses up to 16 g / kg bw, the animal s reaction to pinch and noise were reduced. all animals developed diarrhea within 3 hours after the administration of doses 16 g / kg bw. none of the treated mice survived within 48 hours after the administration of 24 and 28 g / kg bw in males and females, respectively. the calculated ld50 values were 16.80 and 19.60 g / kg bw for male and female mice, respectively. variation of relative body weight of rats as a function of the duration and dose of coula edulis ch2cl2/meoh (1:1) stem bark extract. daily amounts of food and water consumed as affected by doses of coula edulis ch2cl2/meoh (1:1) stem bark extract during sub - acute toxicity study. for the same parameter and sex, values bearing asterisk () are significantly different (p<0.05) to the control and other groups. general symptoms, body and organ weight changes no death did occur following daily administration of vehicle or the extract for 28 days in control or extract treated group, respectively. however, there were significant dose - dependent decreases in animals ' body weight gain as well as food and water consumptions. these reductions were most pronounced (p<0.05) in the animals that were administered the extract at the highest dose (200 mg / kg bw). moreover, the macroscopic observation of livers of animals revealed the presence of white vesicles on the surface of this organ at the dose of 200 mg / kg bw (figure 4). also, significant decreases (p<0.05) were recorded in the relative liver, heart, lung and kidney weights at the same dose irrespective of the sex (figure 5). none of the screened organ showed significant (p0.05) variation in the parameters evaluated above at doses 100 mg / kg bw (figure 5). livers from rats treated with the ch2cl2/meoh (1:1) extract of coula edulis stem bark (a) or vehicle (dimethylsulfoxide, dmso) (b). they can be differentiated by the presence of white vesicles on liver from rats receiving the extract. relative organ weights (as a percent of body weight) of rats after sub - acute treatment (28 days) with different doses of coula edulis ch2cl2/meoh (1:1) stem bark extract. indicate significant (p < 0.05) difference from the control group for the each organ and gender. hematological and biochemical observations there was no gender - dependent differences in rbc and wbc, but a significant decrease in hematocrit (p<0.05) was observed in males at the dose of 200 mg/ kg bw as compared to that of the control (table 3). this dose also induced a significant (p<0.05) increase in serum creatinine in both sexes. also, a significant (p<0.05) decrease in serum total cholesterol levels, and a significant (p<0.05) increase in serum and liver levels of proteins as well as serum levels of alt and ast were observed in both male and female rats compared to the control group (tables 4 - 5). antidermatophytic activity the antidermatophytic activities of the ch2cl2-meoh (1:1 v / v) extract from stem bark of c. edulis may be attributed to the presence of various classes of compounds of biological interest, namely alkaloids, terpenoids, flavonoids, tannins and anthraquinones as shown by tamokou and co - workers. differences observed in the antidermatophytic activities of crude extract and its fractions can be linked to the differences in chemical composition of these test samples. fraction f3 was more active than the crude extract, indicating that fractionation increased its antidermatophytic activity. this could be due to the exclusion, by fractionation, of some constituents of the extract, which may tend to dilute the active principle and reduce its activity. on the other hand, fractionation may have increased the concentrations and the activities of antidermatophytic principles in this fraction. a keen look of the mfc results, indicated that none of the noticeable values obtained with many samples were more than 4 fold their corresponding mic, postulating a fungicidal effect of the studied samples. compounds 1 and 2 displayed antidermatophytic activities. these results reveal the potential of c. edulis as a source of antidermatophyte drugs and support its use in folk medicine for the treatment of fungal skin infections. peripheral blood changes observed in rats after 82 days treatment with different doses of c. edulis ch2cl2/meoh (1:1) stem bark extract. doses are expressed in mg / kg body weight (bw), wbc : white blood cells ; rbc : red blood cells. for the same sex and in the same column, values bearing different superscript letters are significantly (p < 0.05) different from each other. serum levels of different parameters in rats treated for 28 days with different doses of c. edulis ch2cl2/meoh (1:1) stem bark extract. for the same sex and in the same column, values bearing different superscript letters are significantly (p < 0.05) different from each other. the concentrations of different parameters in the liver of the rats treated for 28 days with different doses of stem bark crude extract of c. edulis. for the same sex and in the same column, values bearing different superscript letters are significantly (p < 0.05) different from each other. in developing countries, phytotherapy often represents the main, if not the lone, therapeutic approach to which a majority of the people are referred to for their primary health care. the increase in the number of users medicinal plants in the face of the scarcity of scientific evidences on their safety have raised concerns regarding the toxicity and detrimental effects of these remedies, and the same applies for c. edulis. this plant, like most others, contains several bioactive principles which are able to induce beneficial and/or detrimental effects. to optimize its safety use as a plant - based medicine, one should, beside the historical documentation on c. edulis, have a toxicity assessment of this medicinal plant. thus, the evaluation of the acute and sub - acute toxicities of c. edulis in the present study appears to be biologically essential. with the ld50 of 16.8 and kg in male and female mice respectively, the crude extract of c. edulis may be considered fairly toxic. these result indicate that female mice are more tolerant to the c. edulis extract than males after oral administration. this is in contrary to the observation of drici and clement, and liechti and co - workers, who showed that the adverse effects of drugs and toxic substances were more pronounced in women than in men. a reduced reaction to noise was observed suggesting that the extract may have a depressant or sedative effect on the central nervous system. this decreased sensitivity may be due to the action of the extract on the nociceptors or to the inhibition of the production of algogenic substances (e.g. prostaglandins or histamines), or to the inhibition of the painful message transmission at the central level. changes in body weight are used as an indicator of adverse effects of drugs and chemicals. in the sub - acute toxicity study, significant decreases in total weight gain were observed in the rats, which received the extract at the dose of 200 mg / kg bw as compared to the control. the reduction in total weight gain may be due to less food and water intake, after the administration of c. edulis extract. this growth retardation may also be due to the antilipidaemic effect of c. edulis extract as shown by the decrease of serum total cholesterol. the hematopoietic system is one of the most sensitive targets for toxic compounds, and is an important index of physiological and pathological status in man and animal, in this study, a significant decrease in hematocrit values was also observed in male from the dose of 200 mg / kg bw as compared to that of the control group, suggesting that the extract at high doses may have some effect on the red blood cells. this was confirmed by the decrease, though not significant, observed in red blood cells count of rats treated with the same doses. however, the normal values for hematocrit range from 34% to 48% in wistar albino rats. in the present study, hematocrit value (45.01.2) of the male rats receiving the extract at the dose of 200 mg / kg bw was within the normal range. the biochemical parameters (i.e. serum levels of alt, ast and creatinine) also showed significant increases in the group receiving the highest dose as compared to that of the control group. indeed, the transaminases (ast and alt) are well - known enzymes used as good indicators of liver function, and as biomarkers predicting possible toxicity. generally, any damage to the parenchymal liver cells results in the elevations of both transaminases in the blood. in addition, ast, found in the serum, is of both mitochondrial and cytoplasmic origins and any rise can be taken as a first sign of cell damage that leads to the outflow of the enzyme into the serum. thus, the significant increases observed in alt and ast activities strongly suggest that the sub - acute oral administration of c. edulis extract did affect the hepatocytes, and consequently the metabolism of the rats. equally, there was also a significant rise in creatinine in group receiving the highest dose when compared to that of the control group. any rise in creatinine level is only observed, if there is a marked damage at the nephrons. therefore, the results recorded in this study similarly suggest that c. edulis extract might have altered the renal function. clearly, this only serves as a preliminary test, and for a better estimation of renal function a creatinine clearance test is required. at last, significant decreases were recorded in the relative liver, heart, lung and kidney weights at the dose of 200 mg / kg bw indicating that the sub - acute oral administration of c. edulis extract had a detrimental effect on the normal growth of these organs. this corroborates with the white vesicles observed on the liver surface indicating damages at the level of this organ. endogenous proteins ensure not only the transportation of xenobiotics in blood toward target organs, but also their biotransformation in the liver in order to activate, excrete or detoxify them. the increased protein levels in the serum and liver could be due to the response of hepatic cells to the toxic substances. this study is the first to show that c. edulis, which is claimed to be a cure for stomach ache and infectious diseases, is a medicinal plant with detrimental biological properties. if an extrapolation of the above results is to be made to humans, it might be possible to suggest that precautions during its use is necessary, especially when used at high doses (200 mg / kg bw) or over a long period of time this study provides valuable data on the antidermatophytic activity as well as acute and sub - acute oral toxicity profiles of c. edulis extract that might be very useful for any future in vivo and clinical studies of this medicinal plant. fraction f3 is the most active fraction, and microsporum audouinii and epidermophyton floccoseum are the most sensitive microorganisms to the plant fractions. the c. edulis ch2cl2-meoh (1:1) extract at high doses (200 mg / kg bw) had significant hepatotoxic and nephrotoxic activities. further studies to determine the effects of this plant on animal fetuses, and pregnant animals and their reproductive capacity are necessary to complete the safety profile of this plant	background : coula edulis bail (olacaceae), is an evergreen tree growing to a height of 25. this study aimed at evaluating the antidermatophytic and toxicological properties of the stem bark of c. edulis extract as well as fractions and compounds isolated from it. methods : the plant extract was prepared by maceration in ch2cl2-meoh (1:1 v / v). the fractionation of this extract was done by silica gel column chromatography. antidermatophytic activities were assayed using agar dilution method. the acute and sub - acute toxicities of oral administrations of the extract were studied in rodents. results : the crude extract of c. edulis displayed antidermatophytic activity against the tested microorganisms with highest activity against microsporum audouinii and trichophyton mentagrophytes. the fractionation enhanced the antidermatophytic activity in fraction f3 (mic=0.62 - 1.25 mg / ml) compared to the crude extract (mic=1.25 - 5 mg / ml). further fractionation and purification of the fractions f2 and f3 gave respectively 3-o--d - glucopyranoside of sitosterol (mic=0.20 - 0.40 mg / ml) and a mixture of -sitosterol, stigmasterol and n - hexadecanoid acid (mic=0.80 mg / ml). the median lethal doses (ld50) of the crude extract were 16.8 and 19.6 g / kg body weight (bw) in male and female mice, respectively. at 200 mg / kg bw, there was a decrease in body weight gain, food and water consumptions. gross anatomical analysis revealed white vesicles on the liver of the rats treated with the extract at 200 mg / kg bw. this dose also induced significant (p<0.05) changes on hematological and biochemical parameters in rats after 28 days of treatment. conclusion : these data suggest that the ch2cl2-meoh (1:1 v / v) extract of c. edulis stem bark possesses antidermatophytic properties. they also show that at high doses (200 mg / kg bw), the extract has significant hepatotoxic and nephrotoxic activities.
swabs were taken from the anterior nares of dogs, horses, and staff ; nasal surface of cats ; perineum of dogs, cats, and horses ; and the neck skin surface of horses. swab specimens were directly inoculated onto mannitol salt agar (labm, bury, uk) with aztreonam (2 mg / l) and oxacillin resistance screening agar (oxoid, basingstoke, uk) and incubated at 37c for < 48 h. staphylococci were identified by colony shape, gram stain, staphylase test (oxoid), and api staph kit (mr - cns only) (biomrieux, basingstoke, uk). the disk - diffusion method (mast, liverpool, uk) was used to determine the susceptibility of all isolates to oxacillin, methicillin, gentamicin, vancomycin, rifampicin, ciprofloxacin, co - trimoxazole, fusidic acid, and tetracycline, according to the british society for antimicrobial chemotherapy guidelines, by using s. aureus atcc 26923, emrsa-15, and emrsa-16 as controls (9). cell lysates of all methicillin - resistant staphylococci were prepared as described previously (10). cell lysates were also prepared from 3 control strains, emrsa-15, emrsa-16, and the canadian epidemic strain, cmrsa-5, previously found in horses and humans (8). the presence of the meca gene was determined with polymerase chain reaction (pcr) by using a modified method adapted from vanuffel. (11), with a conventional thermocycler. pcr to detect the s. aureus fema gene was used to confirm isolates as mrsa (12). for all mrsa and equine mr - cns isolates, the sccmec cassette and the agr operon all mrsa isolates were screened for the gene encoding panton - valentine leukocidin by using the method of lina. (14) ; a positive control for this reaction was provided by the scottish mrsa reference laboratory. macrorestriction of the genome and pfge were conducted on all mrsa isolates according to the protocol described by murchan. swabs taken from cats (n = 50) and dogs (n = 55) treated at the sah and cats within the community (february march 2004) were negative for mrsa. one cat was positive for methicillin - resistant staphylococci, and 4 dogs were positive for mr - cns, all of which were confirmed by pcr to be carrying the meca gene. however, 3 dogs with clinical infections (a joint infection in january 2004, pleuropneumonia in march 2004, and a wound infection in june 2004) were positive for mrsa at the site of infection. the dog with the joint infection was also positive for nasal and fecal carriage of mrsa ; a student who treated the dog had an mrsa - positive nasal swab in april 2004. eleven staff provided nasal swabs, of which 2 were positive for mrsa in january 2004 (table). all mrsa isolates were resistant to ciprofloxacin but sensitive to all other antimicrobial drugs tested. all mrsa isolates were positive for the meca and fema genes, carried the sccmec type iv cassette, and were agr operon group 1 strains but were negative for pvl genes. pfge showed that the human and dog clinical mrsa isolates were identical to the human epidemic strain, emrsa-15 (figure). sah, small animal hospital ; pleh, philip leverhulme equine hospital ; nt, not tested ; mr - cns, methicillin - resistant, coagulase - negative staphylococci. dendrogram showing the pulsed - field gel electrophoresis patterns after macrorestriction of genomic dna with smai of methicillin - resistant staphylococcus aureus (mrsa) isolates from the small animal hospital (sah) and the equine hospital. the dog and human isolates (sah staff) were identical to the uk major epidemic strain emrsa-15, and the equine mrsa isolates (5 distinct profiles) were unrelated to emrsa-15, emrsa-16, or cmrsa-5. profiles were analyzed with molecular analyst software (applied maths, inc., sint - martens - latem, belgium) by unweighted pair grouping by mathematical averaging clustering method with a 2% tolerance window and using the dice coefficient. of the 105 horses sampled, of the 67 horses sampled at pleh, 11 were positive (16%) for carriage and 3 had mrsa - associated clinical infections (pleuropneumonia, chronic septic arthritis, and chronic dermatitis). none of the isolates submitted from 12 staff members at the equine hospital were positive for mrsa. the horse mrsa isolates were resistant to gentamicin (100%), rifampicin (80%), ciprofloxacin (78%), fusidic acid (69%), co - trimoxazole (50%), and tetracycline (50%) but not to vancomycin. all mrsa isolates were positive for the meca and fema genes and were agr group 1, except 2 that were agr group 2, but all were negative for the pvl genes. like the human and dog isolates, all horse mrsa isolates except 3 (1 isolate had a variant of type ii or iii, and 2 isolates repeatedly failed to give pcr products for sccmec cassettes), carried the sccmec cassette type iv. mr - cns was isolated from 19% of horses at the pleh and 30% of horses in the community. all horse mr - cns isolates (including those from pleh) had different sccmec cassettes than the mrsa isolates, and their banding patterns did not fully correspond to any of the known cassette types, giving a 209-bp band (types ii and iii) and a further band of 495 bp (type i). twelve mrsa isolates from 7 horses were selected for pfge based on differences in antibiogram and genes detected by pcr. the same strain found in nasal samples, 1 skin sample from 3 horses, and 1 mrsa strain from a clinical case - patient were closely related to a nasal isolate from a different horse. none of the horse mrsa strains were related to emrsa-15, emrsa-16, or cmrsa-5 as demonstrated in the figure. this study documents mrsa transmission between humans and dogs ; the same strain was found in 3 staff members and 3 dogs, all identical to the predominant human epidemic strain emrsa-15. two staff members and a student who treated 1 dog were positive for the same mrsa strain. furthermore, mrsa was associated with clinical disease in 2 other dogs some months later ; this finding could suggest a cycle of transmission between staff and animals. however, the origin of mrsa in the first dog is unknown and could have originated in either staff or the dog in question, with dog - to - human transmission or vice versa. this study suggests that dogs can act as reservoirs of mrsa, which can pose a public health risk to owners and veterinary staff, as well as limit the options for antimicrobial drug treatment of mrsa infections. staff in veterinary hospitals could have an increased risk of carrying mrsa because of contact with infected animals and antimicrobial drugs in their work environment. contrary to sah results of this study and previous work in canada, no evidence was seen of mrsa transmission between staff and horses at pleh, nor were any isolates related to the predominant uk human epidemic strains or cmrsa-5. the fact that different sccmec cassettes were found in horse mr - cns isolates than in mrsa isolates does not suggest that methicillin resistance had transferred from mr - cns to mrsa. furthermore, the prevalence of mr - cns in horses in the community is almost double that which was found in horses at pleh. this could suggest that mr - cns may compete well with methicillin - sensitive cns in an environment where antimicrobial drugs are not present. these results imply that mrsa is present in the general horse population and may represent a reservoir of new or rare mrsa strains that could be transmitted to humans.	we determined the molecular characteristics of methicillin - resistant staphylococci from animals and staff at a small animal and equine hospital. methicillin - resistant staphylococcus aureus (mrsa) identical to human emrsa-15 was found in dogs and hospital staff. in contrast, 5 distinct mrsa strains were isolated from horses but not from hospital staff.
the concept of stability in vitiligo is multifaceted, and no consensus has yet been reached on defining the criteria for this so far. it includes not only clinical aspects of stability but also many recently identified biochemical and ultrastructural correlates of the same. the exact definition of stability in vitiligo is still elusive, and a number of difficulties arise when examining individual patients to decide on the stability of this disease. this concept gains utmost importance when selecting appropriate patients of refractory vitiligo for surgical interventions. apart from clinical features that help in deciding stability of the disease, a number of studies have focussed on evaluating ultrastructural, serological and biochemical parameters to distinguish between stable and active disease. most of these parameters have evolved as a result of understanding the pathogenesis of the disease and the various hypotheses for the same : autoimmune hypothesis (serum levels of autoantibodies, t cell subset dysregulation and histological changes), neural hypothesis (serum catecholamines and their metabolites and neuropeptide y), oxidative stress (oxidant - antioxidant levels) and melanocytorrhagy (ultrastructural studies). although no universal consensus exists on the optimum duration of non - progression for the disease to be labelled as stable clinically, recently, the indian association of dermatologists and venereologists (iadvl) taskforce for standard guidelines of care for dermatosurgical procedures in their consensus recommendations defined stability as a patient reporting no new lesions, no progression of existing lesions, and absence of koebner phenomenon during the past 1 year. the stark difference in the minimum required period of stability in different studies is depicted in table 1. however, in a recent study comparing the results of suction blister grafting in patients with varying periods of stability, successful repigmentation (> 75%) was seen in 0% of patients with period of stability ranging from 3 months to 1 year, 37.5% in 12 year group and 77.8% when period of stability was > 2 years (p = 0.005). this new study may lend greater credence to supporters of a 2 year minimum stability period. minimum recommended period of stability required for recruitment for surgery in various studies in many cases, a clinician s expertise and certain characteristics of the disease may help in deciding the likely course of the vitiligo. a study on 400 patients found that significantly greater progression of disease was seen in patients with a longer disease duration, positive family history, nonsegmental clinical type, koebners phenomenon and mucous membrane involvement. it is important to not completely rely on the patient s reporting of disease activity as this may be erroneous and the clinician must rely on his own documentation or photographic records in doubtful cases. the most commonly described clinical criteria include the following : history of progression : absence of new lesionsextension of old lesions : no extension of pre - existing lesionskoebner phenomenon : it is defined as the development of vitiligo at sites of aspecifically traumatized skin. it has frequently been proposed to indicate active disease. recently, it has been further classified into koebner phenomenon by history (kp - h) and experimentally induced koebner phenomenon (kp - e) by njoo., who studied the correlation between kp - h and kp - e and the responsiveness to ultraviolet light therapy (uva plus fluticasone propionate or nbuvb) in 61 patients of vitiligo vulgaris off any topical or systemic therapies for at least 6 months. kp - e was assessed by inducing an epidermodermal injury by extracting a 2-mm punch biopsy specimen from clinically uninvolved skin. the outcome was evaluated 3 months later to look for depigmentation in the scar or surrounding it (kp - e positive). they found a significant difference between kp - h and kp - e and reported the positive and negative predictive value, respectively, of kp - h when taking kp - e as gold standard to be 89% and 52%, respectively. surprisingly, the responsiveness to uv - b (311 nm) therapy among kp - e - positive or kp - e - negative patients was not significantly different (p = 0.66). however, in the fluticasone propionate plus uv - a group, kp - e - positive patients showed a better response than did kp - e - negative patients (p = 0.01). boersma., found a correlation between kp - h and minipunch test grafting ; in all patients with positive kp - h, depigmentation of the punch grafts was observed.vida score (vitiligo disease activity score) was described by njoo., to grade the level of activity of disease in individual vitiligo patients off any therapies for atleast 6 months. they scored the activity of disease from + 4 to 1, indicating gradually decreasing levels of activity. patients with score of 0 were those with disease stable for 1 year and those with score 1 had, in addition, spontaneous repigmentation. in a study to correlate the vida score with kp - e, it was observed that patients with vida scores of + 1 and + 2 did not necessarily show a positive kp - e. however, all the patients with vida scores of + 3 and + 4 showed a positive kp-e.minigrafting or test grafting history of progression : absence of new lesions extension of old lesions : no extension of pre - existing lesions koebner phenomenon : it is defined as the development of vitiligo at sites of aspecifically traumatized skin. it has frequently been proposed to indicate active disease. recently, it has been further classified into koebner phenomenon by history (kp - h) and experimentally induced koebner phenomenon (kp - e) by njoo., who studied the correlation between kp - h and kp - e and the responsiveness to ultraviolet light therapy (uva plus fluticasone propionate or nbuvb) in 61 patients of vitiligo vulgaris off any topical or systemic therapies for at least 6 months. kp - e was assessed by inducing an epidermodermal injury by extracting a 2-mm punch biopsy specimen from clinically uninvolved skin. the outcome was evaluated 3 months later to look for depigmentation in the scar or surrounding it (kp - e positive). they found a significant difference between kp - h and kp - e and reported the positive and negative predictive value, respectively, of kp - h when taking kp - e as gold standard to be 89% and 52%, respectively. surprisingly, the responsiveness to uv - b (311 nm) therapy among kp - e - positive or kp - e - negative patients was not significantly different (p = 0.66). however, in the fluticasone propionate plus uv - a group, kp - e - positive patients showed a better response than did kp - e - negative patients (p = 0.01). boersma., found a correlation between kp - h and minipunch test grafting ; in all patients with positive kp - h, depigmentation of the punch grafts was observed., to grade the level of activity of disease in individual vitiligo patients off any therapies for atleast 6 months. they scored the activity of disease from + 4 to 1, indicating gradually decreasing levels of activity. patients with score of 0 were those with disease stable for 1 year and those with score 1 had, in addition, spontaneous repigmentation. in a study to correlate the vida score with kp - e, it was observed that patients with vida scores of + 1 and + 2 did not necessarily show a positive kp - e. however, all the patients with vida scores of + 3 and + 4 showed a positive kp - e. minigrafting or test grafting this test was described by falabella., to aid in selecting appropriate patients for surgical intervention in vitiligo. they performed the test grafting on 57 patients of vitiligo, which was stable for atleast 2 years. the test consists of placing a few grafts (1.01.2 mm) in the centre of the depigmented lesion to be scrutinized followed by dressing with micropore adhesive tape, which is kept for a couple of weeks. this is followed by sun exposure for 15 min daily for a period of 3 months, following which, the test sites are visualized under wood s light. the test is considered positive if unequivocal repigmentation takes place beyond 1 mm from the border of the implanted grafts. there is some evidence to suggest that stability may be site - dependent. in the same patient, some lesions may show evidence of progression, while other lesions may repigment well with surgical therapy. in addition, there have been instances of simultaneous donor site depigmentation and recipient site repigmentation and also vice - versa reported following surgery for vitiligo. even test grafting has not been found to be fool proof in detecting ideal cases for surgical intervention. there have been instances of failed surgical attempts in patients with positive test grafting and also reports of successful repigmentation in patients with negative test grafting.[1517 ] in fact, falabella himself observed that test grafting is not an absolute indication for successful surgical repigmentation. hence, it has been suggested that each patient must be treated on an individualized basis rather than based on the above criteria. recently, an attempt has been made to study the lesional, perilesional and repigmented skin of vitiligo patients by in vivo reflectance confocal microscopy. depigmented skin showed disappearance of the bright rings normally seen at the dermo - epidermal junction, while even the non - lesional skin of vitiligo patients showed unexpected changes as the presence of half - rings or scalloped border - like features of the bright papillary rings. these data are preliminary, but may prove useful in the future to predict the possible course of disease for individual patients. apart from clinical criteria of stability, various studies have shown several biochemical, histopathological and ultrastructural features, which differ in active versus stable vitiligo. at present, however, they are not sufficiently well characterized so as to definitively differentiate active from stable vitiligo. to completely understand the concept of stability, it is essential to have an in - depth knowledge of the pathomechanisms of the disease. the most commonly described clinical criteria include the following : history of progression : absence of new lesionsextension of old lesions : no extension of pre - existing lesionskoebner phenomenon : it is defined as the development of vitiligo at sites of aspecifically traumatized skin. it has frequently been proposed to indicate active disease. recently, it has been further classified into koebner phenomenon by history (kp - h) and experimentally induced koebner phenomenon (kp - e) by njoo., who studied the correlation between kp - h and kp - e and the responsiveness to ultraviolet light therapy (uva plus fluticasone propionate or nbuvb) in 61 patients of vitiligo vulgaris off any topical or systemic therapies for at least 6 months. kp - e was assessed by inducing an epidermodermal injury by extracting a 2-mm punch biopsy specimen from clinically uninvolved skin. the outcome was evaluated 3 months later to look for depigmentation in the scar or surrounding it (kp - e positive). they found a significant difference between kp - h and kp - e and reported the positive and negative predictive value, respectively, of kp - h when taking kp - e as gold standard to be 89% and 52%, respectively. surprisingly, the responsiveness to uv - b (311 nm) therapy among kp - e - positive or kp - e - negative patients was not significantly different (p = 0.66). however, in the fluticasone propionate plus uv - a group, kp - e - positive patients showed a better response than did kp - e - negative patients (p = 0.01)., found a correlation between kp - h and minipunch test grafting ; in all patients with positive kp - h, depigmentation of the punch grafts was observed.vida score (vitiligo disease activity score) was described by njoo., to grade the level of activity of disease in individual vitiligo patients off any therapies for atleast 6 months. they scored the activity of disease from + 4 to 1, indicating gradually decreasing levels of activity. patients with score of 0 were those with disease stable for 1 year and those with score 1 had, in addition, spontaneous repigmentation. in a study to correlate the vida score with kp - e, it was observed that patients with vida scores of + 1 and + 2 did not necessarily show a positive kp - e. however, all the patients with vida scores of + 3 and + 4 showed a positive kp-e.minigrafting or test grafting history of progression : absence of new lesions extension of old lesions : no extension of pre - existing lesions koebner phenomenon : it is defined as the development of vitiligo at sites of aspecifically traumatized skin. it has frequently been proposed to indicate active disease. recently, it has been further classified into koebner phenomenon by history (kp - h) and experimentally induced koebner phenomenon (kp - e) by njoo., who studied the correlation between kp - h and kp - e and the responsiveness to ultraviolet light therapy (uva plus fluticasone propionate or nbuvb) in 61 patients of vitiligo vulgaris off any topical or systemic therapies for at least 6 months. kp - e was assessed by inducing an epidermodermal injury by extracting a 2-mm punch biopsy specimen from clinically uninvolved skin. the outcome was evaluated 3 months later to look for depigmentation in the scar or surrounding it (kp - e positive). they found a significant difference between kp - h and kp - e and reported the positive and negative predictive value, respectively, of kp - h when taking kp - e as gold standard to be 89% and 52%, respectively. surprisingly, the responsiveness to uv - b (311 nm) therapy among kp - e - positive or kp - e - negative patients was not significantly different (p = 0.66). however, in the fluticasone propionate plus uv - a group, kp - e - positive patients showed a better response than did kp - e - negative patients (p = 0.01). boersma., found a correlation between kp - h and minipunch test grafting ; in all patients with positive kp - h, depigmentation of the punch grafts was observed., to grade the level of activity of disease in individual vitiligo patients off any therapies for atleast 6 months. they scored the activity of disease from + 4 to 1, indicating gradually decreasing levels of activity. patients with score of 0 were those with disease stable for 1 year and those with score 1 had, in addition, spontaneous repigmentation. in a study to correlate the vida score with kp - e, it was observed that patients with vida scores of + 1 and + 2 did not necessarily show a positive kp - e. however, all the patients with vida scores of + 3 and + 4 showed a positive kp - e. minigrafting or test grafting this test was described by falabella., to aid in selecting appropriate patients for surgical intervention in vitiligo. they performed the test grafting on 57 patients of vitiligo, which was stable for atleast 2 years. the test consists of placing a few grafts (1.01.2 mm) in the centre of the depigmented lesion to be scrutinized followed by dressing with micropore adhesive tape, which is kept for a couple of weeks. this is followed by sun exposure for 15 min daily for a period of 3 months, following which, the test sites are visualized under wood s light. the test is considered positive if unequivocal repigmentation takes place beyond 1 mm from the border of the implanted grafts. there is some evidence to suggest that stability may be site - dependent. in the same patient, some lesions may show evidence of progression, while other lesions may repigment well with surgical therapy. in addition, there have been instances of simultaneous donor site depigmentation and recipient site repigmentation and also vice - versa reported following surgery for vitiligo. even test grafting has not been found to be fool proof in detecting ideal cases for surgical intervention. there have been instances of failed surgical attempts in patients with positive test grafting and also reports of successful repigmentation in patients with negative test grafting.[1517 ] in fact, falabella himself observed that test grafting is not an absolute indication for successful surgical repigmentation. hence, it has been suggested that each patient must be treated on an individualized basis rather than based on the above criteria. recently, an attempt has been made to study the lesional, perilesional and repigmented skin of vitiligo patients by in vivo reflectance confocal microscopy. depigmented skin showed disappearance of the bright rings normally seen at the dermo - epidermal junction, while even the non - lesional skin of vitiligo patients showed unexpected changes as the presence of half - rings or scalloped border - like features of the bright papillary rings. these data are preliminary, but may prove useful in the future to predict the possible course of disease for individual patients. apart from clinical criteria of stability, various studies have shown several biochemical, histopathological and ultrastructural features, which differ in active versus stable vitiligo. at present, however, they are not sufficiently well characterized so as to definitively differentiate active from stable vitiligo. to completely understand the concept of stability, it is essential to have an in - depth knowledge of the pathomechanisms of the disease. morrone,., were among the first to report significant increases in the urinary concentrations of the catecholamine metabolites homovanillic acid (hva) and vanillylmandelic acid (vma) in active vitiligo patients. their study has been followed by other similar studies reporting increase in plasma as well as urine concentrations of catecholamines and their metabolites in vitiligo patients having active disease. it has been proposed that the synthesis as well as metabolism of catecholamines is increased in vitiligo patients. lepoole., demonstrated higher levels of catechol - o - methyl transferase (comt) activity in epidermal homogenates from vitiligo patients as compared to healthy controls. such differences were, however, not found at the systemic level. in accordance with these findings, cucchi., found that, as compared to patients with stable nonsegmental vitiligo, the patients with active disease (in last 3 months) showed significantly increased plasma levels of norepinephrine (ne), normetanephrine (nmn), 3-methoxy-4-hydroxyphenylglycol (mhpg) and hva, all of which are comt products of catecholamines. in addition, they also observed that, among patients with active disease, statistically significant differences were found in values of ne, epinephrine (e) and metanephrine (mn) depending on the disease duration, with levels being much higher in patients with recent onset disease. the same group of authors later demonstrated that 24-h urinary ne levels were significantly higher in patients with active vitiligo as compared to stable disease and controls. epinephrine (e), da (dopamine), nmn, mn (metanephrine), vma, 5-hiaa (5-hydroxy indole acetic acid) and hva levels were significantly higher in patients in an active phase than in controls. they propose that urinary metabolite levels give more mediated information, referring to 24-h period of activity as compared to the plasma levels, which reflect the actual real - time activity, and thus are more likely to be affected by momentary emotional events and even the drawing of blood. hence, urinary levels of these metabolites may be more accurately used in the assessment of stability of disease. serum analysis of oxidant - antioxidant status in vitiligo patients may also give a clue to the status of stability of disease. the oxidative stress hypothesis of vitiligo proposes that certain intermediates in the process of melanin biosynthesis, such as 3, 4-dihydroxyphenylalanine (dopa), dopachrome and 5, 6-dihydroxyindole, are toxic to melanocytes through the increased production of free radicals. ines,., compared serum and red blood cell (rbc) oxidant - antioxidant status in patients of active and stable vitiligo with that in controls and found higher serum levels of malondialdehyde (an end product of lipid peroxidation) and selenium and higher rbc levels of superoxide dismutase (sod) in patients of active vitiligo as compared to that in controls. these levels were also higher than those in patients with stable disease ; however, no comment was made whether these results reached statistical significance. they also observed rbc glutathione peroxidase levels to be lower in active vitiligo patients as compared to controls and stable vitiligo patients. the higher sod level in active vitiligo patients has been proposed to occur as an adaptation to the increased oxidative stress evident in these individuals. in few small studies, the role of elevated serum homocysteine levels has been proposed in the pathogenesis of vitiligo. singh., studied homocysteine (hcy) levels in serum of active and stable vitiligo patients and controls. they found that there was a significant relationship between hcy level and activity of vitiligo. the mean hcy level in patient with active vitiligo was significantly higher than in stable vitiligo cases. it has been proposed that patients in the active stages of vitiligo are deficient in vitamin b12 and folate, which are cofactors for the enzyme hcy methyl transferase, which is important for the regeneration of methionine from hcy. this leads to increased serum levels of hcy, which is responsible for the production of reactive oxygen species and also the inhibition of the enzyme tyrosinase by binding with the copper at its active site. tu., in their study on plasma levels of neuropeptide y (npy) found the levels to be significantly higher in patients with vitiligo (of the generalized, local and segmental types) as compared to normal controls. in addition, in both local and segmental type, but not in the generalized type, the levels in progressive stage were significantly higher than in those in the stable stage. they also documented that the levels of npy in the tissue fluids from skin lesions were significantly higher than in those from uninvolved skin in both the local type and segmental type (p 0.05) between the npy level in the tissue fluid from skin lesion and that from uninvolved skin. nerve endings lie close in contact with melanocytes and the release of mediators such as neuropeptide y has been proposed to cause melanocyte loss in vitiligo by both immunological and non - immunological means. the above data points to the greater role of neurological mediators in segmental as compared to non segmental vitiligo and may allow for an assessment of stability of segmental vitiligo, about which not much data exists so far. in another study, it was found that the serum levels of granulocyte macrophage colony stimulating factor (gm - csf) in both focal and generalized type and the il-6 level in the generalized type were significantly higher in those with progressive disease (in last 1 month) than in those with stable disease. however, such differences depending on activity of disease did not exist either for il - l, il-8 and tnf- or for any cytokine in segmental vitiligo. however, these findings are contradictory to the results of the study of yu., who showed a decrease in the production of gm - csf and proposed gm - csf to be an intrinsic factor for melanocyte growth. apart from these biochemical markers, peripheral t cell subset imbalance has also been found in patients of vitiligo as compared to controls. however, the only study that compared t cell subsets between active and stable vitiligo patients failed to find a significant difference. one of the most popular theories regarding the pathogenesis of vitiligo is the autoimmune theory. according to this theory, antibodies against melanocyte antigens as well as enzymes involved in melanogenesis have been found in vitiligo patients, but not in controls. however, it is not entirely clear whether the presence of these autoantibodies is a pathomechanism of vitiligo or just an epiphenomenon related to melanocyte loss and the exposure of cryptic autoantigens. whether vitiligo autoantibodies are the cause or the result of the disease, they do have the capacity to injure pigment cells. different techniques have been used to detect these antibodies including immunoprecipitation, indirect immunofluorescence, immunoblotting, and conventional elisa, and their functions have been further investigated with complement - dependent cytotoxicity and antibody - dependent cellular cytotoxicity assays or passive transfer experiments., who documented that complement - mediated cytolysis of melanocytes by patient sera was found to be much more common in patients with active disease than in those with inactive disease. in a previous study, using modified live - cell elisa, the same authors had reported that igg pigment cell antibodies were present in 80% (8 of 10) of patients with active vitiligo, but in none of those with inactive disease or in normal individuals. however, the presence of these antibodies was found to be also related to the extent of disease being detected in 50% of patients with minimal vitiligo (6 months), while 64 had active disease. th antibodies were evaluated in a radioimmunoassay (ria) using [35s]-labelled th and titres were determined by testing serum dilutions of 1:100, 1:200, 1:500, 1:1000 and 1:2000. in addition, for each sample, a th antibody (th ab) index was calculated as counts per minute (cpm) immunoprecipitated by tested serummean cpm immunoprecipitated by healthy control sera. the upper limit of normal for the ria was estimated as a th ab index of 1.09. any serum sample with a th ab index above the upper limit of normal was designated as positive for th antibody reactivity. the authors observed that 18 of 79 (23%) sera from patients with non - segmental vitiligo had a th ab index above 1.09 and were considered positive, while none of the sera of patients with segmental vitiligo or controls were th antibody positive (p = 0.003). eighteen of the 67 (27%) patients with active vitiligo demonstrated th antibodies in the serum, while none of the 20 (0%) patients with stable disease demonstrated the same (p = 0.009). this study may have a high clinical relevance, since the presence of th antibodies had a 100% positive predictive value and specificity for recognition of active disease. however, 77% of patients with active disease did not show the antibodies and hence the sensitivity in diagnosing active disease is low. however, in another study, xie., using immunoblotting found no significant difference in the prevalence of antibodies to an antigen that comigrated with tyrosinase between patients with active vitiligo (50%), stable vitiligo (64.3%) and controls (55.8%). in addition, by immunoprecipitation dopa stain and sandwich elisa, none of the vitiligo or control individuals had antibodies to tyrosinase. one of its kind study by hann., measured the percent cytotoxicity of melanocyte mediated by autoantibody and complement in normal controls (n = 31) and in the patients with active vitiligo (n = 37) and followed up with repeat measurements after a course of systemic steroids. they found a significant reduction in percent cytotoxicity between pre- and post - treatment groups (p = 0.0243). these findings lend favour to the hypothesis that a decrease in the antibody - mediated cytotoxicity against melanocytes may play a role in the improvement of vitiliginous lesions after systemic steroid treatment. the end result of all the pathogenetic factors in vitiligo is to create a local environment that is unfavourable to the survival of melanocytes, which are believed to be more sensitive than other cells to these deleterious stimuli because of a defective membrane structure and functionality. it has long been debated whether the ultimate loss of melanocytes in vitiligo occurs via necrosis, apoptosis or melanocytorrhagy, with the evidence in favour of melanocytorrhagy fast gaining momentum. a number of ultrastructural studies have been done on the skin of vitiligo patients (lesional, perilesional and normal) in order to gain an insight into the pathogenesis of the disease. in the process, a number of findings have come forth that may allow differentiation of active from stable disease. light and electron microscopy studies were performed on the vitiliginous and adjacent normal skin from 97 patients with actively spreading vitiligo and 19 patients with stable vitiligo. epidermis of vitiliginous skin revealed complete loss of pigment and melanocytes, while perilesional skin showed vacuolar changes of basal cells and epidermal and dermal infiltration of lymphocytes and melanophages in the upper dermis. all these changes were more prominent in the skin of actively spreading vitiligo than in stable vitiligo. in another study, apart from the above changes, focal spongiosis was found to be present in 48% of vitiliginous lesions and this was largely limited to the marginal areas of the lesions. in another case series of trichrome vitiligo, the number of langerhans cells was found to be increased in the epidermis of light brown skin and perilesional normal skin as compared with vitiliginous and normal skin. these may be responsible for the immune dysregulation implicated in the spread of trichrome vitiligo. abnormal expression of mhc class ii and a six - fold increased expression of icam-1 has also been demonstrated in perilesional melanocytes of vitiligo patients. these data emphasize on the role of antigen presentation in the damage to melanocytes in active vitiligo. kumar., studied 14 patients of vitiligo (7 each with stable and active disease) and 5 controls. stable vitiligo was defined as having no new lesions and no progression of existing lesions for at least 2 years, while unstable vitiligo was defined as new lesions or progression of existing lesions over the past 6 weeks. perilesional skin melanocytes from these patients were cultured and studied for morphological changes, markers of adhesion and apoptosis. it was documented that melanocytes from patients with active disease were morphologically different from those with stable disease and normal controls in demonstrating a larger perinuclear zone and small dendrites with clubbed ends (retracted dendrites). significantly low adhesion to collagen type iv was also observed in melanocytes from unstable vitiligo patients as compared to control and stable vitiligo patients. in addition, caspase 3 and annexin v (both markers of apoptosis) staining was significantly greater in unstable vitiligo cultured melanocytes treated with okadaic acid (an inducer of apoptosis) as compared with the melanocytes from controls. all these findings lend credence to the hypothesis of defective melanocyte attachment and melanocytorrhagy as pathogenetic in progressive vitiligo and also imply that unstable vitiligo melanocytes are more prone to apoptosis as compared to controls. similar to the above data on serum oxidant - antioxidant levels in vitiligo described above, ines., followed up their study with assessment of antioxidant enzymes and lipid peroxidation status at the tissue level in stable and active vitiligo cases. they observed that levels of superoxide dismutase, glutathione peroxidase and malondialdehyde in tissues were increased significantly, while catalase levels were decreased significantly in patients with active vitiligo as compared to stable vitiligo patients and controls. they concluded that, although oxidative stress is involved in the pathophysiology of both active and stable vitiligo, an increased imbalance of antioxidants is observed in the tissues of patients with active vitiligo. hann., conducted light and electron microscopy studies on the vitiligo and adjacent, normal appearing skin from 97 patients with actively spreading vitiligo and 19 patients with stable vitiligo. epidermal and dermal changes in perilesional skin were found to be more prominent in the skin of actively spreading vitiligo than in stable vitiligo. these changes included vacuolar changes of basal cells, degenerative changes in melanocytes, epidermal and dermal infiltration of lymphocytes, and melanophages in the upper dermis. these findings suggest that the biopsy from adjacent, normal appearing skin of vitiligo may give a clue to the status of stability of disease in an individual patient. further supporting the role of inflammation in the spread of vitiligo lesions, ahn., in an immunohistochemical study from the marginal skin of vitiligo lesions found enhanced expression of epidermal icam-1 and cd4 lymphocytes in samples from active vitiligo as compared to stable disease. in another study, highly significant increases in cd3 +, cd4 + and cd8 + t cells were found in margin of vitiligo lesions and these cells were mostly activated cd45ro+ cells of the memory subset. in addition, deficient expression of ccl22, a skin homing chemokine for treg (regulatory t cells) has been found in vitiligo skin on immunohistochemistry. this was hypothesized to explain the failure of circulating, functional treg to home to the skin in vitiligo that was proposed to be responsible for perpetual anti - melanocyte reactivity in progressive disease. benzekri., biopsied 50 patients of vitiligo classified them clinically into hypomelanotic with poorly defined borders (hpdb, 29 cases) or amelanotic with sharply demarcated borders (asdb, 21 cases) and followed them for a period of 1 year. one year after the biopsy, of the 48 patients still in the study, 20 had lesions that were considered to be stable and 28 had active lesions. the hpdb and asdb lesions were correlated respectively with active and stable status (p < 0001) and correlations were also obtained between clinical aspects, histological findings and vitiligo activity. most of the other studies on ultrastructural changes in vitiligo do not provide a head - to - head comparison of findings in active as compared to stable vitiligo. extensive research is still needed to identify definitive ultrastructural and molecular features, which may allow reliable differentiation of vitiligo that is expected to progress from vitiligo that has reached stability. one of the only studies of its kind by rao., studied the correlation of results of repigmentation following suction blister grafting in vitiligo with serum catalase levels and lesional immunohistochemistry for cd4, cd8, cd45ro, cd45ra and foxp3. there was no correlation of serum catalase levels with either the period of stability or the results of surgical repigmentation. similarly, cd45ra, cd4 and fox p3 were also not found to correlate with response to surgical treatment. however, cd8 t cell counts were found to be lower in responders [median 1% (range 04%) ] as compared to the non - responders [median 3% (range 17%) ] (p = 0.04). cd45ro cells were seen exclusively in some non - responders, while the responders showed complete absence of these cells. most studies on the biochemical / serological aspects of stability in vitiligo are cross - sectional and hence do not shed light on the correlation of these parameters with the course and prognosis of the disease. more studies need to be conducted to follow the course of disease and to correlate it with the levels of humoural factors. another aspect on which further research is needed is the correlation of these tests with the outcome of medically and/or surgically induced repigmentation. second, most studies have so far not been able to establish cut - off values that may be helpful to classify disease as active or stable in an individual patient. it may also be useful to correlate the change in level of serum autoantibodies with the introduction of immunosuppressive therapy or phototherapy. a landmark study in this regard was the study by hann., who found that response of vitiligo lesions to systemic steroid therapy correlates with the finding of a significant reduction in percent cytotoxicity of melanocyte mediated by autoantibody and complement. lesional stability as a concept needs to be investigated in greater detail, since, in the same patient, at the same time, different lesions may show stability, regression or progression. ultrastructural changes evaluated at the site of induced koebner phenomenon may lead to further breakthroughs in understanding both the pathogenesis of disease and the concept of stability. in addition, there is a need to set uniform clinical criteria for defining stability before embarking on biochemical and other investigative findings so as to be able to compare results between studies and draw definitive conclusions. also, so far these tests are only research tools available in very few centres and extensive work needs to be done to make these tests sufficiently reliable, cheap and widely available, so as to enable decision making in individual patients. extensive research on the concept of stability is essential in order to prognosticate individual patients affected by this socially devastating disease that would help us in counselling them as to the expected course of their disease. more emphasis also needs to be laid on the detection of genetic defects that may correlate with the severity of disease and enable genetic counselling.	stability is a hard - to - define concept in the setting of vitiligo, but is nonetheless extremely crucial to the planning of treatment regimens and also in prognosticating for the patient. there are several ways to judge stability in vitiligo, which include clinical features and, recently, many biochemical, cytological and ultrastructural correlates of the same. these recent advances help in not only in prognosticating individual patients but also in elucidating some of the mechanisms for the pathogenesis of vitiligo, including melanocytorrhagy and oxidative damage to melanocytes.
dpp - iii (ec 3.4.14.4) of the goat brain is a dipeptidylaminopeptidase which removes n - terminal dipeptide from arg - arg-4mna at ph 8.5. the enzyme was recently purified and characterized and found to be affected by thiol compounds and metal ions. it hydrolysed leu - enkephalin and other bioactive peptides and displayed micromolar affinity for enkephalins thereby suggesting its involvement in regulating enkephalin disposition [2, 4 ]. all the studied analgesic and antihypertensive drugs inhibited the enzyme. in the present study, it has been demonstrated that the enzyme activity is retained in davis gel electrophoresis at ph 8.3. understanding of catalytic mechanisms, structural features of protease, and their inhibitors are very important to explore their applications in medicinal field. ethylene diamine tetraacetic acid (edta), tris - hcl, dialysis bags, polyacrylamide, n, n-methylene bisacrylamide, ammonium persulphate, and temed were procured from himedia. louis, mo, usa. the routine pipetting was done with micropipettes from tarson and very small volumes were pipetted out using hamilton syringes. the digital spectrophotometer from systronics was used to record the absorbance at 520 nm. dpp was purified and assayed with arg - arg-4mna as substrate at ph 8.5 (tris - hcl, 50 mm, containing 100 mm nacl and 1 mm -mercaptoethanol (-me). one unit of enzyme activity was defined as the amount of enzyme that liberated 1 nanomole of 4 mna from the substrate per minute under assay conditions. the enzyme was incubated with tris - hcl buffer (50 mm, ph 8.5 containing 1 mm -me) with different concentrations of nacl (0 to 1000 mm) at 37c for 10 min., the 10% davis gel was prepared. before loading the protein samples, the polymerized gel was pre - electrophoresed for 2 h at a current of 4 ma by using resolving gel buffer. purified protein (25 g) was loaded on gel and run at a constant current of 4 ma at 4c. one half was stained with coomassie brilliant dye and other half was stained for enzyme activity by thoroughly washing the gel with assay buffer and incubating the gel with substrate at 37c and then putting the gel in fast garnet gbc (1 mg / ml) for 15 min for colour development. purified dpp - iii was treated with 2.5 mm edta for 10 min and then extensively dialysed against 50 mm tris - hcl buffer, ph 7.0. the edta pretreated enzyme was preincubated with appropriate salts in assay buffer at 37c for 10 min. the reaction was started by adding 150 m of substrate and activity is expressed as percentage of control. likewise effect of dtnb was studied on edta pretreated enzyme in presence of zncl2 and cocl2. the purified enzyme retained its activity during electrophoresis at ph 8.3, in davis gel as shown in figure 1. the activity band obtained with arg - arg-4mna as specific substrate corresponded well with the protein band stained with coomassie brilliant blue. the enzyme was activated by cl ions and maximum activation was achieved at 100 mm final concentration, which accounted for more than 1.5-fold increase in enzyme activity (figure 2). this property is similar to that of dpp - iii enzyme of anterior pituitary. beyond 100 mm, enzyme activity decreased with increase in nacl concentration. incubation of pure dpp - iii with 2.5 mm edta resulted in 60% inhibition of enzyme activity. the suppressed activity could be partially restored by adding metal ions like zncl2, cocl2, nicl2, feso4, and mgcl2 but none of the metal ions could completely restore the enzyme activity. zn at 50 m almost completely restored enzyme activity (~97%) (figure 3). these results support our earlier studies with o - phenanthroline thereby confirming this enzyme to be a metalloprotease having zn at the active site. our results are in agreement with human placental dpp - iii, whereas co was most effective in restoring the activity of edta pretreated dpp - iii from human rbcs. ca and co were most effective in restoring the activity of edta pretreated guinea pig brain dpp - iii. on the other hand, untreated dpp - iii was activated by co and inhibited by zn, ni, and cu. relationship between binding of metal ions and cysteine residues on dpp - iii was investigated by inactivation of edta - treated enzyme with dtnb in the presence and absence of co and zn. however zn was more protective than co. it appears that binding of metal ions influence reactivity and accessibility of thiol group(s) essential for enzyme activity. therefore it can be concluded that enzyme is a metalloprotease with the involvement of cysteine residues either located on the catalytic site or involved in regulation. several other metalloenzymes having sh group at the active site have also been reported earlier [12, 13 ].	dipeptidylpeptidase - iii (dpp - iii) from goat brain was purified and characterized using arginyl - arginyl-4-methoxy--naphthylamide (arg - arg-4mna) substrate. this enzyme retained its activity in native 10% polyacrylamide gel when stained using arg - arg-4mna. the activity was significantly increased by 100 mm chloride. studies for its inhibition with some peptides and chemical inhibitors revealed that leu - trp - met - arg - phe - ala was most potent inhibitor followed by arg - phe - ala and gly - phe - leu. all the studied chemical inhibitors caused 4050% inhibition at 1 mm. metal ions helped to regain activity of edta pretreated enzyme. zncl2 at 50 m almost completely restored the enzyme activity. further zncl2 and cocl2 exerted protective effects on edta pretreated enzyme for its susceptibility to dtnb inhibition. therefore, dpp - iii is a metalloprotease with the involvement of cysteine residues either located at the catalytic site or involved in regulation.
one of the major questions in the nkt cell field is the identity of the glycolipid ligands responsible for the positive selection of nkt cells. cd1d molecules most likely bind their ligands as they recirculate through the endosomal / lysosomal pathway of the dp cells before returning to the cell membrane to present the ligands to developing nkt cells (68). the prototypic nkt cell antigen is -galacytosylceramide (-galcer) (9, 10), which is recognized by most, if not all, nkt cells in mice and humans. -galcer, a glycosphingolipid derived from marine sponges, is a potent agonist ligand that can initiate nkt cell dependent immune responses, leading to enhanced immunity to tumors and infectious organisms and suppression of certain autoimmune diseases (3). several other nonmammalian agonist glycolipid ligands for nkt cells have recently been identified (9, 11). although these ligands provide important insight into targets for nkt cell dependent immune responses, they can not serve as endogenous ligands for nkt cell selection. a word about -hexosaminidase nomenclature.lysosomal -hexosaminidase enzymes are dimers. -hexosaminidase a is a heterodimer consisting of and subunits, -hexosaminidase b is a subunit homodimer, and -hexosaminidase s is an subunit homodimer. thus, a mutation in the subunit (hexa ; tay - sachs disease) affects -hexosaminidase a and s but not -hexosaminidase b, whereas a mutation in the subunit (hexb ; sandhoff disease) affects both -hexosaminidase a and b enzymes. both -hexosaminidase a and b enzymes degrade igb4 to igb3 in lysosomes, meaning that this particular pathway is disrupted in sandhoff disease but not in tay - sachs disease (18). a word about -hexosaminidase nomenclature. -hexosaminidase a is a heterodimer consisting of and subunits, -hexosaminidase b is a subunit homodimer, and -hexosaminidase s is an subunit homodimer. thus, a mutation in the subunit (hexa ; tay - sachs disease) affects -hexosaminidase a and s but not -hexosaminidase b, whereas a mutation in the subunit (hexb ; sandhoff disease) affects both -hexosaminidase a and b enzymes. both -hexosaminidase a and b enzymes degrade igb4 to igb3 in lysosomes, meaning that this particular pathway is disrupted in sandhoff disease but not in tay - sachs disease (18). (5) provided a breakthrough in the field, offering strong evidence that igb3, a mammalian glycosphingolipid, is a cd1d - dependent agonist for nkt cells from mice and humans. this report also demonstrated that hexb mutant mice, a model for human sandhoff disease, had markedly impaired nkt cell development (5). the hexb gene product is a key subunit of the enzymes (-hexosaminidase a and b ; see text box) necessary for the lysosomal degradation of igb4 to igb3 (5), as well as for the production of other glycolipid products. among these products assuming nkt cells are selected by self - agonists, this result implicated igb3 as the prime candidate nkt cell selecting ligand (fig. cd1d is initially expressed on the cell surface loaded with phospholipids but then traffics to lysosomes where phospholipids are exchanged with glycolipids. (a) in normal cells, lysosomal glycolipid degradation, which is controlled by various hydrolytic enzymes and lipid transfer proteins, results in a series of glycolipids, such as ig3b, becoming available for cd1d loading (red arrows). the current model holds that degradation of igb4 by the enzymes -hexosaminidase a and b generates igb3 in the lysosome ; igb3 is thought to be the main glycolipid involved in nkt cell selection. (b) a mutated hexb gene (sandhoff disease) causes a deficiency in the -hexosaminidase a and b enzymes (see text box), thus removing igb3 from the pool of lysosomal glycolipids available for cd1d loading. proposes that any disruption of lysosomal processing (including but not limited to sandhoff disease) nonspecifically alters the repertoire of glycolipids available for cd1d loading to the point that nkt cell development is inhibited (reference 4). the case for igb3 as a mammalian nkt cell agonist ligand is strong and has been verified by several other studies (1316), including a report that demonstrated a role for this ligand in the activation of nkt cells in the periphery (15). however, whether this ligand is unique in its ability to mediate intrathymic nkt cell selection has yet to be definitively demonstrated. it is also unclear whether these results can be translated to humans, as the synthesis of igb3 in humans has not been formally demonstrated. a recent paper stated (as unpublished data) that igb3 synthase mrna was not detectable in a range of human tissues, including thymus (17). (5) demonstrated, using an inhibitory lectin, that nkt cells respond to human dendritic cells via an nkt cell antigen comprising a gal1 - 3gal linkage. given that the only two enzymes that can produce this linkage are -galactosyltransferase and igb3 synthase and that humans lack the former (17), this result strongly suggested the presence of igb3 in human cells. gadola. provide intriguing new results that suggest an alternative explanation for the nkt cell deficiency observed in hexb mutant sandhoff mice (4). sandhoff disease is one of several diseases of lysosomal glycolipid processing, broadly classed as lsds, in which impaired trafficking or degradation results in an accumulation of lysosomal glycolipids and impaired cellular function (18). in their study, (4) gadola. examined several mouse models of lsd, each carrying a mutation that affects a different aspect of lysosomal glycolipid processing. these included mice with deficiencies in the lysosomal enzymes -hexaminidase a and b (hexb, a model of sandhoff disease), -hexaminidase a and s (hexa, a model of tay - sachs disease and late - onset tay - sachs disease), -galactosidase (a model of gm1 gangliosidosis), and -galactosidase (a model of fabry disease). the group also studied a mouse model of niemann - pick disease type c1 in which the mutation causes impaired cholesterol and glycolipid trafficking from the late endosome, a very different cause of lsd. whereas the hexb mutants (sandhoff) have impaired hydrolysis of igb4 to igb3, this step should be intact in mice lacking functional hexa (tay - sachs), -galactosidase (gm1 gangliosidosis), or -galactosidase (fabry). indeed, -galactosidase mutant cells accumulate globotriaosyl ceramides, such as igb3, as the breakdown of these glycolipids to lactosylceramide is inhibited (18). despite the diversity of these mutations, the pathways affected, and the glycolipids that are stored, nkt cell development was impaired in each model, albeit to varying extents. in addition, antigen - presenting cells from hexb (sandhoff), -galactosidase deficient (gm1 gangliosidosis), and niemann - pick disease type c1 mice had impaired ability to process and present an exogenous disaccharide analogue of -galcer, gal1 - 2galcer galactosylceramide (which can be processed and presented as an nkt cell antigen by normal cells), even though this processing event is independent of hexb and -galactosidase. collectively, these observations prompted the authors to challenge the notion that the failure to degrade igb4 to igb3 in hexb mice is specifically responsible for impaired nkt cell development. they instead suggest that any disruption of lysosomal glycolipid processing that results in lsd will potentially affect cd1d loading and, consequently, impair nkt cell development (fig. first, glycolipids (and some proteins) in the limiting membrane (the outer lysosomal membrane) of the lysosome are packaged into intraluminal vesicles that bud into the luminal space of the lysosome. second, these intraluminal vesicles are degraded by the sequential action of glycosidases and lipases, often in concert with saposin proteins that help to solubilize membrane - embedded apolar glycolipid species (18). it is conceivable that cd1d proteins located in the limiting membrane of the lysosome could sample glycolipids from both the limiting membrane and/or from the intraluminal vesicles (fig. 1). defects in glycolipid degradation could thus lead to global defects in both the generation and composition of the intraluminal vesicles, as well as in their breakdown. the perturbation of these processes might affect the production and/or presentation of specific glycolipid species (such as igb3) and, therefore, the reduced loading of cd1d with ligands needed for nkt cell selection. alternatively, the increase in glycolipids in the lumen of the lysosome may simply dilute out ligands such as igb3, decreasing the probability that cd1d will be loaded with nkt cell selecting ligands. the gadola study highlights the potential importance of proper lysosome function and glycolipid processing for appropriate cd1d loading. although it does not eliminate igb3 as a candidate selecting ligand, it appears to weaken the evidence that igb3 is the exclusive selecting ligand, a hypothesis originally based on the use of hexb mutant mice (5). it must be pointed out that some results in the study by gadola. in particular, the original paper describing igb3 as an nkt cell ligand (5) included experiments to test whether the development of lsd in hexb mutants nonspecifically disrupted glycolipid processing. in contrast to the findings reported in the gadola study (4), zhou. (5) showed that hexb antigen - presenting cells processed and presented disaccharide gal1 - 2galcer galactosylceramide normally, providing convincing evidence that this lsd did not cause a general disruption of glycolipid processing. furthermore, whereas gadola. showed that -galactosidase (fabry) mutant mice had impaired nkt cell development (consistent with an earlier report that claimed reduced nkt cell numbers in the spleen), no such defect was observed in a 2004 paper from zhou. reasons for these discrepancies are unclear but may relate to different disease states caused by mouse age, sex, or other variables. the fabry disease mice are particularly interesting in the context of igb3, because this disease should lead to an accumulation of this ligand in the lysosome. if igb3 is a major selecting ligand for nkt cells, it might be predicted that nkt cell development would be enhanced in these mice. however, it is also possible that an excess of agonist ligand could cause negative selection of nkt cells (20), which would represent a distinct cause of impaired nkt cell development. lastly, the hexa (tay - sachs) mice only showed impaired nkt cell numbers in the liver, which appeared to correlate with a more mild lsd that affected the liver but spared the thymus and spleen. although this seems reasonable, it is inconsistent with reports that peripheral homeostasis of nkt cells is largely independent of peripheral cd1d - mediated signals (21, 22). clearly, there is considerable controversy surrounding the use of these lsd mouse models, and it will be important to independently assess these variables, as they have a major bearing on the interpretation of studies of nkt cell development and function using such models. igb3 is currently the only mammalian glycolipid with clear agonist activity for a majority of nkt cells and remains the strongest candidate ligand for nkt cell selection. it is important to add that even if lsd by itself impairs nkt cell development, this does not automatically exclude igb3 as the candidate ligand (fig. 1). however, more definitive studies are clearly necessary to test the hypothesis that igb3 is required for normal nkt cell development in mice and humans. the production of igb3 synthase deficient mice is the most obvious approach, as this defect would affect igb3 biosynthesis in the early secretory pathway rather than its degradation in the lysosome, and the mice would thus be unlikely to develop lsd. regardless of whether igb3 is the key selecting ligand in mice, it remains unclear whether humans express a functional igb3 synthase gene and, more specifically, whether igb3 is produced in human thymus. given that human nkt cells are highly variable in frequency but are typically 10100 times less frequent than mouse nkt cells (23), the identification and measurement of the human nkt cell selecting ligands are challenging but important objectives. an analysis of the nkt cell compartment of humans with various lsds will also be very valuable. the prediction from the gadola study would be that these individuals would have lower nkt cell numbers compared with healthy individuals. a recent report demonstrated that patients with gaucher disease (an lsd caused by glucocerebrosidase deficiency) undergoing enzyme replacement therapy had a modest increase in the percentage of v24 cells within the cd4 t cell pool compared with healthy controls (24), which appears to support this hypothesis. however, some caveats to this study are that gaucher disease itself was not associated with reduced v24 cells compared with healthy controls and, furthermore, that v24 alone is a not a reliable marker of nkt cells finally, it will now be interesting to study nkt cell development and glycolipid presentation by cd1d in mice or cell lines that have other defects in lysosomal function to further test the extent to which lsds generally disrupt nkt cell development. for example, analysis of mice with defects in the formation of the intraluminal vesicles (25) will provide a distinct model of lsd, and it may also provide some insights as to whether glycolipids are loaded onto cd1 proteins from the limiting membrane of the lysosome or from the intraluminal vesicles.	natural killer t cells (nkt cells) are selected in the thymus by self - glycolipid antigens presented by cd1d molecules. it is currently thought that one specific component of the lysosomal processing pathway, which leads to the production of isoglobotrihexosylceramide (igb3), is essential for normal nkt cell development. new evidence now shows that nkt cell development can be disrupted by a diverse range of mutations that interfere with different elements of the lysosomal processing and degradation of glycolipids. this suggests that lysosomal storage diseases (lsds) in general, rather than one specific defect, can disrupt cd1d antigen presentation, leading to impaired development of nkt cells.
hcv infection is among life threatening public health problems worldwide, with over 170200 million infected people including about 17 million from pakistan. it has been estimated to cause approximately 27% of cirrhosis and 25% of hepatocellular carcinoma cases worldwide. hcv is a small enveloped, positive sense single stranded rna virus and has been classified as a separate genus hepacivirus in the flaviviridae family. the hcv genome is approximately 9.6 kb, encoding a polyprotein of about 3010 amino acids and is flanked by short untranslated regions (utrs) regions at the 5 and 3 terminus. this polyprotein is posttranslationally processed by viral and cellular proteins to generate the structural proteins (c, e1, e2, and p7) and nonstructural proteins (ns2, ns3, ns4a, ns4b, ns5a, and ns5b),. hcv shows high degree of genetic heterogeneity ; consequently six major genotypes and multiple subtypes of hcv have been identified so far in world. the common subtypes found in north and south america, europe, russia, china, japan, australia, and new zealand are 1a, 1b, 2a, 2c, and 3a. genotype 4 is predominant in egypt, north africa, central africa, and middle east. genotype 5 in south africa and genotype 6 in southeast asia have been identified. genotype 3 is the most prevalent genotype in india, bangladesh, pakistan, and nepal [1215 ]. subtypes of genotypes 1, 2, 3, and 6 have been found prevalent in thailand, vietnam, indonesia, and burma respectively. genotype 1b is the most prevalent genotype in china ; however genotype 2 has also been reported from some regions of china. in pakistan, the prevalence of hcv infection has been estimated to be 8% and is increasing gradually due to deficiency in basic health care recourses and lack of the general public awareness about safety measures. some studies have been conducted on prevalence of hcv genotypes in khyber pukhtunkhwa region of pakistan [1720 ]. however, little has been reported on prevalence of hcv genotypes in district bannu in khyber pukhtunkhwa region of pakistan. therefore, this study was conducted to find out baseline information on the prevalence of hcv genotypes in district bannu. accurate hcv genotyping can be used in better understanding of hcv infection, for creating awareness in the general public and subsequently for implementation of preventive and therapeutic strategies. all the procedures used in this study were approved by the ethics committees of department of microbiology, kohat university of science and technology. an inclusion criterion for patients was to be seropositive for anti - hcv by third generation enzyme linked immunosorbent assay (elisa). the information regarding age, gender, and possible routes of transmission was obtained from each participating patient. total 117 blood samples were collected from patients attending district hospital bannu and khalifa hospital bannu. serum was separated from each blood sample at 3000 g for 5 min and then labeled and stored deep - frozen at 20c. for this 10 l of hcv extracted rna was incubated at 37c for 50 min along with primer specific for core region and 200 u of moloney murine leukemia virus reverse transcriptase (m - mlv rtase) (fermentas usa), 5x first strand buffer (mmulv buffer) dntps and ddh2o. in the first round of nested pcr the pcr program was as follows : initial denaturation was at 94c for 5 min, followed by 45 cycles, each of 45 sec denaturation at 92c, 45 sec annealing at 55c, and 1 min extension at 72c, with final extension at 72c for 10 min. in second round of nested pcr, genotype - specific pcr was performed by using allele specific primers for core region reported by ohno. at same pcr program that was adopted for first round nested pcr. the final pcr products obtained after each round of nested pcr were subjected to electrophoresis and separated on 2% agarose gel. after staining with ethidium bromide, out of 117 anti - hcv positive sera by elisa, 110 samples were found positive by pcr analysis, with greater representation of males 81 (73.6%) as compared to females 29 (26.4%) as shown in table 1. genotyping of 110 hcv - pcr positive samples determined four different genotypes including 1a, 2a, 3a, and 3b (figure 1). however, hcv genotypes 1b, 2b, 4, 5, and 6 were not detected among patients studied. genotype 3a was the most prevalent one detected in 42 (38%) patients, followed by genotype 3b in 23 (21%) patients and then genotype 2a in 13 (12%) patients. genotype 1a was the least prevalent and was detected in only in 1 (1%) patient while in 8 (7%) patients mixed genotypes of hcv were detected. moreover, 23 (21%) hcv - pcr positive samples could not be genotyped by using the method as described previously. the studied patients were categorized in three different age groups and then prevalence of age associated hcv genotypes was determined (table 1). genotype 3a was most prevalent genotype in all age groups patients and its prevalence was found high among patients with increasing age (> 34 years). similarly, high prevalence of genotype 2a was also observed in age group 5574 years. moreover, genotype 1a was found in only one patient, who had age of 23 years and subsequently belonged to age group 1534 years. in our study, those patients who had history of visit to barber shop, intravenous drug addiction, and dental procedures were recorded major risk factors responsible for hcv transmission in district bannu as shown in table 2. patients with history of visit to barber shop and receiving multiple therapeutic injections accounted for 40 (36.4%) and 39 (35.4%), respectively, followed by patients with history of dental procedures 22 (20%). history of blood transfusion and tattooing was recorded in 7 (6.4%) and 2 (1.8%) patients, respectively. genotype 3a and genotype 3b were found to be the most prevalent genotypes in patients with history of shaving by barbers, receiving multiple injections, and dental procedures. however, genotype 2a and genotype 1a were more commonly found in patients with history of dental procedures (table 2). the molecular epidemiological studies have reported that significant regional differences appear to be present in the frequency distribution of hcv genotypes. moreover, it has been reported that there are variations in disease outcome and response to antiviral therapy of hcv genotypes. however, in pakistan treatment of hcv infected patients is based on qualitative or quantitative viral detection and genotypes are not determined prior to treatment. therefore variable response rates of hcv infected patients to antiviral therapy can not be detected. the present study was conducted to determine baseline data on the prevalence of hcv genotypes in a district in khyber pakhtunkhwa region of pakistan. the baseline information will help in better understanding of hcv infection, awareness in the general public and subsequent control strategies. the genotype 3a was found to be the most prevalent genotype followed by 3b and 2a and genotype 1a was found to be less prevalent (figure 1). results of the present study are in conformity with results of previous studies reported from different regions of the khyber pakhtunkhwa in pakistan [2025 ]. previous studies conducted in india, bangladesh, and nepal also reported that the genotype 3 is the most prevalent genotype [1214 ]. in this study the assay used could not determine hcv genotypes among a considerable number of hcv patients (23%). however, there is a need to use more reliable and sensitive assay for genotyping of hcv in untypeable samples. the distribution of hcv genotypes may be variable among the patients of different age groups. studies have reported that genotypes 1b and 2 were more prevalent in older patients, whereas genotype 1a was observed more frequently in the younger population [26, 27 ]. another study reported that in france genotype 5 was frequently detected in patients aged more than 50 years. in iran genotype 3a was the most frequently detected in patients less than 40 years. in this study, we observed the distribution of hcv genotypes among different age groups. the prevalence of genotypes 2a and 3a was found increasing with increasing age of patients. genotype 3b was found more prevalent in age groups more than 35 years. moreover, genotype 1a was least prevalent genotype detected in a patient of a younger age group less than 34 years. analysis of possible routes in transmission of hcv genotypes in district bannu is shown in table 2. the hcv genotypes reported in present study were isolated from participating patients with known route of transmission. in our study genotypes 3a and 3b were more frequently observed in patients with previous history of shaving by barbers followed by multiple injections received and dental procedures. whereas genotypes 1a and 2a were more commonly observed in patients who had history of dental procedures. hcv genotype 2a was also common in patients with previous history of visit to barbers and receiving multiple injections. the possible routes of transmission of hcv genotypes have also been reported in other studies. the high prevalence of hcv genotype 3 is attributed to intravenous drug addicts in the united states and europe. moreover present study and other studies from pakistan have also reported increased prevalence of genotype 3 in those patients who had received multiple therapeutic unsafe and unnecessary injections by untrained health practitioners particularly in rural areas. these untrained health practitioners usually use nondisposable syringe or used syringe and needles for more than one patient at the public health - care centers [2432 ]. however, high prevalence of genotypes 3a, 3b, and 2a among patients of district bannu with history of shaving by barbers and dental procedures has not been reported in the united states and europe. in present study we observed in district bannu that uneducated barbers common practice is to reuse of unsterilized razors and scissors for multiple customers. similarly untrained health practitioners at dental clinics are usually in practice of using used and unsterilized dental equipment for multiple individuals. consequently, these barbers and health practitioners are promoting the risk of transmission of hcv infection from one person to another in this district. in a patient with genotype 1a this is consistent with result of a previous study from pakistan where most of patients with genotype 1a had a history of dental procedures. our study provides baseline information on the prevalence of hcv genotypes in district bannu in khyber pukhtunkhwa region of pakistan. the most prevalent hcv genotype was 3a isolated from patients in district bannu, followed by genotypes 3b and 2a. the frequency distribution of these genotypes was found variable according to the age groups of the patients studied. the possible routes of transmission for these genotypes observed were shaving by barbers, receiving multiple injections, and dental procedures. further studies are needed to investigate hcv genotypes in district bannu by using more sensitive assays and considering large population size.	determination of an individual 's hepatitis c virus (hcv) genotypes prior to antiviral therapy has become increasingly important for the clinical management and prognosis of hcv infection. therefore, this study was conducted to investigate the prevalence of hcv genotypes in hcv infected patients of district bannu in khyber pakhtunkhwa region of pakistan. serum samples of 117 seropositive patients were screened for hcv - rna by using reverse transcriptase - nested polymerase chain reaction (rt - nested pcr) and then pcr positive samples were subjected to hcv genotyping. out of 117 seropositive samples, 110 samples were found positive by pcr analysis. genotype 3a was the most prevalent one detected in 38% of patients, followed by genotype 3b in 21% of patients, and then genotype 2a in 12% of patients. however 21% of hcv - pcr positive samples could not be genotyped by method used in this study. genotype 3a was the most prevalent genotype in patients of all age groups and its prevalence was found high among patients with increasing age (> 34 years). moreover, genotypes 3a and 3b were found to be the most prevalent genotypes in patients with history of shaving by barbers, receiving multiple injections, and dental procedures. in conclusion there is need of further investigation of genotypes of hcv by using more sensitive assays and considering large sample size in district bannu.
smoking tobacco not only predisposes to the development of disease, it increases disease severity and treatment failure rates. for these reasons, smoking cessation particularly benefits those patients who have smoking - related cancers such as head and neck or lung cancer and those who are diagnosed with curable disease. cigarette smoking and alcohol consumption are well - established risk factors for developing squamous cell carcinoma of the head and neck. furthermore, a number of studies have revealed an association between tobacco carcinogens and the molecular progression of squamous cell carcinoma of the head and neck. in countries with a high prevalence of smoking, furthermore, the increased incidence of lung cancer from smoking is proportional to the length and intensity of smoking history. smoking cessation before diagnosis reduces the risk of developing a primary tumour of all major histological types of lung carcinoma. prolonged tobacco smoking in cancer patients has many adverse effects during the oncology treatment plan as well. studies with head and neck and lung cancer patients demonstrate that tobacco smoking reduces survival time and increases the risk of a recurrence or a second primary tumor [4, 5 ]. smoking also reduces the efficacy of radiotherapy in head and neck cancer patients, as smokers have a lower rate of complete response and poorer 2-year survival rate than nonsmokers and those who quit prior to treatment. tobacco smoking also exacerbates and prolongs radiotherapy induced complications such as mucositis, dry mouth, loss of taste, voice, impaired pulmonary function, wound healing, as well as tissue and bone necrosis [4, 7 ]. despite these adverse health effects, 23% to 35% of head and neck cancer patients [5, 810 ] and 13% to 20% of lung cancer patients who smoked prior to diagnosis continue to do so after diagnosis. comorbid conditions such as depression, disease - related anxiety, and alcohol abuse often make cessation challenging. the diagnosis of cancer allows an opportunity for patients to review and change their lifestyle habits [11, 12 ]. the earliest descriptions of smoking cessation interventions in the health care setting are described in a summary report by schwartz. interventions may be hospital - based, community - based, or based on individual counseling. current smoking cessation interventions can be either pharmacological, nonpharmacological or a combination of both. examples of effective approaches include identifying tobacco use in patients, motivating them to quit and supporting them to quit through brochures and pamphlets, counseling, pharmacotherapy as well as regular followup. despite the substantial benefits of tobacco cessation in cancer patients, there is still a relative paucity of data on how to best achieve cessation in this population. the aim of our study was to systematically review the literature to summarize tobacco cessation interventions for cancer patients and the associated smoking cessation rates as a consequence of these interventions. this systematic review was performed in accordance with a predetermined protocol consisting of eligibility criteria, a search strategy, outcomes, and statistical analysis. our primary aim was to perform a pooled analysis of smoking cessation rates if appropriate. the literature was searched using ovid medline (1950 through november 2010), embase (1980 to november 2010), and the cochrane library (cochrane database of systematic reviews (2010 issue 12). relevant articles and abstracts were selected and reviewed, and the reference lists from these sources and recent review articles or meta - analyses were searched for additional publications. the literature search of the electronic databases combined disease specific keywords (cancer, neoplasm, and malignancy) with outcome specific keywords (tobacco cessation, smoking cessation, nicotine cessation, quit rates, patient education, and patient intervention) for the following study designs and publication types : retrospective studies, prospective cohort studies, randomized controlled trials (rcts), systematic reviews, and meta - analyses. the literature search was not limited for study design or publication date to ensure all relevant published articles were captured. articles were included in the systematic review of the evidence if they were fully published reports or abstracts of randomized controlled trials (rcts) evaluating a tobacco smoking cessation intervention versus standard usual care in the adult smoking cancer population (> 18 years of age). to be included, articles were excluded if they were published in a language other than english, did not discuss a tobacco cessation intervention, discussed nontobacco products without separation of data, or were in the pediatric population. relevant data was extracted from fully published reports by two independent review authors using prescribed tables. primary authors of included studies were contacted if further elaboration on data was needed [1, 13 ]. where studies were duplicated, the larger data set was used for the analysis [13, 18 ]. statistical calculations were performed using the statsdirect software (chesire, uk). given that we analyzed prospectively gathered data from randomized trials, we calculated a pooled relative risk. the relative risk was a ratio of the risk of tobacco cessation in the intervention group versus the risk of tobacco cessation in the control group. the relative risks were calculated where data was available by intention - to - treat analysis. pooled relative risks were calculated using the rothman - boice type of mantel - haenszel method assuming fixed effects. the random - effects model of pooled relative risks was calculated using the dersimonian - laird method. the decision to use either a random effects model or a fixed effects model was based on calculation of heterogeneity of the data using an i calculation. where heterogeneity of the data was large, a random effects model was used. confidence intervals of the pooled relative risk were calculated using the greenland - robin variance formula. eight studies [1, 4, 11, 13, 17, 2022 ] were narrowed down through the search (figure 1). all the studies identified were rcts in the adult smoking population which described a tobacco smoking cessation intervention and smoking cessation rates. all published studies (table 1) were rcts, which were either single center [11, 13, 17, 21, 22 ] or multicenter [1, 4, 20 ]. the included studies did not show significant differences in baseline characteristics of mean age and gender distribution except in studies that included only head and neck patients [11, 13 ] (table 1). interventions were nonpharmacological (cognitive behavioral therapy, self - help material, education modules, motivational interviewing), or pharmacological (nicotine replacement therapy or bupropion) (table 2). all studies evaluated tobacco smoking. all the studies used self - reported rates of tobacco cessation. in addition, some studies used biochemical verification as well for smoking cessation. two of the studies used breath testing of carbon monoxide (co) [11, 21 ], two studies used urine cotinine levels [1, 11 ] and two studies used saliva cotinine levels [13, 17 ] where possible to confirm self - reported rates (table 2). cessation rates depending on randomization varied for each study at different followup times (table 3). the studies were evaluated in two groups, one group with a shorter followup time, mean of 5 weeks [13, 17, 22 ] and the other group had a longer followup time of at least 6 months [1, 4, 11, 20 ]. in the second group, pooled rates were calculated from the 6 month abstinence rates in all studies except in one study which did not report a 6 month rate but only a 12 month rate. schnoll '.s study was excluded from the longer followup group and analysis due to a purely pharmacological intervention compared to the other studies in the other group which were combination interventions. for the purpose of pooling data, when we examined the shorter followup group, the pooled relative risk was calculated to be 1.16 (95% ci = 0.80 to 1.76) in the short followup group (figure 2). the longer followup group had a pooled relative risk of 1.19 (95% ci = 0.78 to 1.78) (figure 3). the pooled relative risk of the three most recent studies shows a result that is much more positive, with the relative risk achieving statistical significance. this pooled rate was calculated to be 1.42 (95% ci, 1.05 to 1.94). when necessary, authors were contacted to provide additional data to ensure an accurate data set. the identified papers were methodologically sound with prospectively gathered data, randomized study populations, and suitable control groups. only one study looked at a purely pharmacological approach to tobacco cessation while three studies had only a nonpharmacological approach [1, 13, 17 ]. four studies [4, 11, 20, 22 ] had a combination approach of nicotine replacement therapy, counseling and/or cognitive behavioral study. duffy. looked at the combination of cognitive behavioral therapy in addition to bupropion and nicotine replacement therapy. comparison of the confidence intervals of the calculated relative risks of the studies does not demonstrate a significant difference in tobacco smoking cessation rates between any of the different types of intervention. similar to other systematic reviews, our analysis comprised of a relatively high heterogeneity of treatments and patient groups. the studies were divided into two groups short followup time (mean 5 weeks) and longer followup time (6 months). while comparing the pooled relative risks of the two groups, it does not demonstrate a significant difference in the cessation rates despite the fact that a longer followup time would tend to represent better cessation rates. however, considering the shorter followup times, it is difficult to state whether at 6 months, this group would continue to have the same cessation rates. when we examined the longer followup group, four studies were included [1, 4, 11, 20 ]. this study examined a group of 186 head and neck cancer patients and utilized a nonpharmacological counseling - based approach. if this original study is excluded from the analysis, this long - term followup group does appear to yield a statistically significant effect due to a multi - modal cessation intervention. notably, these other three studies [4, 11, 20 ] were performed in the most recent decade and examined 705 patients with diverse oncologic diagnoses. furthermore, these three studies all included a pharmacological approach in addition to nonpharmacological intervention. these differences may account for the reason that the pooling most recent studies reaches a statistically significant effect for smoking cessation intervention. in addition, the setting in which the cessation methods were offered are also different. some studies counseled patients on smoking cessation during a postoperative hospital admission, while other interventions were provided in the clinics. comparing the cessation rates of the individual studies does not demonstrate a significant difference in the cessation patterns based on setting. it is unlikely the self - reported rates would bias our review towards a negative result. when all studies are analyzed in the short and long - term, there was no statistical to a tobacco smoking cessation intervention in addition to usual care. however, when examining the effect of a multifaceted approach (pharmacological and nonpharmacological) to smoking cessation, the analysis suggested a more positive result. our review does not demonstrate a significant difference in tobacco smoking cessation rates through these interventions. the data does, however, suggest that the combination of both pharmacological and nonpharmacological approaches may be more successful at achieving tobacco cessation. collaboration within the health - care team is paramount in implementing a smoking cessation intervention. the significant benefits of tobacco cessation demand the oncology team continue to explore and investigate novel and known methods to help patients become tobacco - free.	background. tobacco smoking cessation interventions in the oncology population are an important part of comprehensive treatment plan. objectives. to evaluate through a systematic review smoking cessation interventions and cessation rates in cancer patients. search strategy. the literature was searched using medline, embase, and the cochrane library (inception to november 2010) by three independent review authors. selection criteria. studies were included if tobacco smoking cessation interventions were evaluated and patients were randomized to usual care or an intervention. the primary outcome measure was cessation rates. data collection and analysis. two authors extracted data independently for each paper, with disagreements resolved by consensus. main results. the systematic review found eight rcts investigating smoking cessation interventions in the oncology patient population. pooled relative risks were calculated from two groups of rcts of smoking cessation interventions based on followup duration. in both groups, the pooled relative risk did not suggest a statistically significant improvement in tobacco cessation compared to usual care. conclusions. our review demonstrates that recent interventions in the last decade which are a combination of non - pharmacological and pharmacological approaches yield a statistically significant improvement in smoking cessation rates compared to usual care.
most scientists view estradiol as women 's sole bone - active gonadal steroid. in reality estrogen plays positive roles in bone biology and osteoporosis prevention and treatment primarily through decreasing bone resorption [35 ]. there is also compelling evidence that powerful bone - destructive cytokines such as il-1, il-6, and tnf are released and increase rapidly with dropping estradiol levels, as occurs with surgical menopause. estradiol achieves its positive bone effects largely through two key actions : facilitation of vitamin d - related intestinal calcium absorption [4, 7 ] and suppression of bone resorption through the osteoprotegerin / rank / rankl system. it is also clinically obvious that premenopausal women with amenorrhea have lower estradiol levels and lower bone mineral density (bmd) and/or lose bone rapidly. not until recently did randomized, placebo - controlled trial data from the whi studies show that treatment with conjugated equine estrogen (cee) plus medroxyprogesterone (mpa) or with cee alone (in women with hysterectomy) prevented osteoporotic fractures in asymptomatic postmenopausal women ages 5079 [5, 9 ]. however, progesterone is usually a present, but an unrecognized partner in bone. with amenorrhea and surgical or natural menopause, not only are estradiol levels low or dropping, progesterone levels are also low. while, in these conditions, estrogen and progesterone deficiency are nearly indistinguishable, progesterone deficiency precedes low estradiol levels in perimenopause, for example, and with ovulatory disturbances, occurs silently in regular cycles with normal estrogen levels. the purpose of this paper and meta - analyses is to study recent clinical evidence that endogenous progesterone plays a role in bone health. so far, three in vitro publications document progesterone 's ability to increase osteoblast numbers [1214 ] as well as its effects to promote osteoblast maturation and differentiation. progesterone appears to play a differing but also physiological role in partnership with estrogen in achieving optimal peak bone mass. medroxyprogesterone increases premenopausal spine bmd as physiological - dose cyclic therapy in a randomized controlled trial (rct) for healthy women experiencing hypothalamic amenorrhea, oligomenorrhea, anovulation, or short luteal phase cycles. progesterone may also have a therapeutic role in postmenopausal osteoporosis if paired with an antiresorptive therapy. thus this paper highlights the accumulating human evidence for a role of progesterone for increasing bone formation in estrogen - replete women with regular menstrual cycles. from a teleological point of view, a higher trabecular bone mass in women is needed in preparation for building of the fetal skeleton during pregnancy. interestingly, the third trimester of pregnancy, during which 80% of the fetal skeleton is mineralized, coincides with the maximum rate of progesterone production in human physiology. under normal circumstances, enough trabecular bone has been accumulated and maintained in women 's skeletons to serve as a reservoir for the calcium needs of both mother and fetus during the months of pregnancy, and for the infant during potential months of breast - feeding. the fact that bone morphogenic proteins play a crucial role in both ovulation and bone metabolism points towards a functional link between bone and reproductive systems aimed at preparing for the increased demands of pregnancy. knowledge of progesterone 's actions in the context of the latest genetic, receptor, and bone ligand systems is in its infancy relationships may well exist between progesterone and the immune system through osteoblast and hematopoietic stem cell interactions in bone marrow, through progesterone 's known brain anti - inflammatory and antiapoptotic actions, and through potential relationships with emerging bone - related molecules such as sclerostin, vascular endothelial growth factor (vegf), and basic fibroblast growth factor (bfgf), to name a few. these molecular biology issues, however, are beyond the scope of this primarily clinical and therapeutic review. over the last 20 years, a number of controlled trials and prospective studies suggest that progesterone may have a role in treatment of pre- or perimenopausal women with regular, estrogen - sufficient menstrual cycles who, however, are also experiencing ovulatory disturbances (anovulation, or short luteal phase length cycles). the most prevalent of abnormal cycles are subclinical ovulatory disturbances (sod) that are unremarkable because they occur within regular, asymptomatic menstrual cycles [11, 18 ]. they have an increased incidence in normal weight women with subclinical cognitive dietary restraint, women working shifts and in stressful environments. however, currently there are no published data about effects of progesterone on human bone architecture and bone quantitative histomorphometry in either the cortical or cancellous bone compartments, or about the potential of molecularly identical progesterone to decrease fracture risk. studies on endogenous and/or physiologic progesterone concentrations and bone are very scarce : a pubmed search carried out in january, 2010 using the mesh terms endogenous progesterone and bone yielded 51 results since 1975. similarly, 83 papers since 1968 were found using the terms physiological progesterone and bone. we excluded all citations concerning animals and/or nonhuman cell lines (most of which have been previously reviewed), those relating to preterm infants, and publications on synthetic androgenic or estrogenic progestins, depot - mpa or other injectable progestins, or those in supraphysiological doses. this paper will focus on the physiological and pharmaceutical actions of progesterone and/or physiological dose medroxyprogesterone acetate (mpa) as the progesterone - derived therapy most commonly prescribed in the usa and canada. progesterone, we are always discussing the native human steroid. if reference to the actions of a progestin or progestogen is required, this paper will specifically state the compound involved. neta and other progestins that primarily are metabolized to estrogen or that act through androgen osteoblast receptors is not covered because our focus is on physiological bone actions of the human steroid, progesterone. given our broad purpose, we are evaluating data from diverse sources ; we are also, of necessity, comparing studies with differing methodologies and designs. therefore, although numerical summaries are created where possible, we have not subjected these combined data to statistical analysis. most studies of the action of progesterone on human osteoblasts in vitro have assessed effects over a maximum of only 72 hours ' duration [1214 ]. one recent study from munich, however, used long - term cultures of human osteoblasts (hobs) to characterize the influence of progesterone and estradiol on bone proliferation (using a hexosaminidase assay) and differentiation (using alkaline phosphatase [alp ] staining). this study quantified alp production photometrically with extinction at 405 nm following incubation with p - nitrophenyl - phosphate (pnpp) and buffer (figure 1). these primary osteoblast cultures, derived from nonosteoporotic perimenopausal women undergoing hip replacement surgery, were exposed to 7 or 21 days of progesterone with and without estradiol pre- and cotreatment. the effect of progesterone in vitro on differentiation of osteoblasts was dose - dependent for progesterone, independent of estradiol, and reached its maximal stimulation at concentrations of 10 m progesterone (figure 1). seven days of exposure to physiologic levels of progesterone (6.4 1010 m) led to increased alp concentrations of 70% (p =.004.019), while a supraphysiological progesterone concentration (6.4 10 m) caused a significant 50% reduction in alp (p =.028). after 21 days of physiological progesterone exposure, the alp production increased 2.7-fold (p =.000 to.004). at supraphysiological progesterone concentrations alp staining thus there was a physiological osteoblast differentiation dose - response curve optimal at luteal phase levels with suppression at high progesterone doses. in contrast to expectation and the observations of others, this effect was independent of pre- or cotreatment with estradiol. proliferation, however, was not significantly affected by progesterone in the absence of estradiol. these results suggest an osteoanabolic function of progesterone, while showing for the first time that supraphysiological progesterone concentrations suppressed osteoblast differentiation. these data are the longest of any in vitro data on human osteoblasts and progesterone. they clearly show a progesterone osteoblast differentiation dose response and independence from estradiol. during the bone remodeling cycle within a single bone multicellular unit (bmu), activation is followed by increased resorption, which in turn is followed by osteoid formation and osteoid mineralization. within a single bmu, formation takes approximately two to three weeks while formation and initial (incomplete) mineralization requires at least three months. perhaps in compensation, osteoblasts appear to be more abundant and also more plastic than osteoclasts and evolve to become both lining cells and osteocytes. although a number of studies have been performed of bone turnover markers across the menstrual cycle, most of them used less precise or specific markers and methods, inadequately differentiated ovulatory from anovulatory cycles (by hormonal measures), or recorded too few cycles to be helpful. some studies with careful cycle bone marker documentation are now available [23, 24 ] and tend to show increased follicular phase urinary markers of bone resorption in addition to increased luteal phase markers of bone formation. chiu. found the bone resorption marker deoxypyridinoline (d - pyr) to be higher during the follicular phase than in the luteal phase and to correlate negatively both with e2 values measured 6 and 8 days earlier and with progesterone levels measured 26 days earlier. unfortunately, the authors did not differentiate between ovulatory and anovulatory cycles, which judging from the wide span of progesterone values must have been mixed in their study. they concluded that normal women experience monthly episodes of increased bone resorption from menarche to menopause. in another study, 10 japanese women with normal ovulatory function showed significant decreases in ctx, free d - pyr, and serum intact carboxyterminal telopeptide (ictp) during the luteal phase and significantly higher serum pth levels during the follicular than the luteal phase, perhaps because of coupling of resorption and formation. very recently proposed a potential role of endogenous progesterone in modulation of gh - secretion (along with prolactin and trh) during the normal menstrual cycle. in their study of 10 young belgian women, 24-hour growth hormone secretion was associated with higher progesterone levels, and daytime gh secretion was increased in the luteal phase compared with the follicular phase. another european group had already found that pth concentrations were highest on day three of the menstrual cycle, but had not monitored ovulation and found no relation to progesterone levels. earlier, a danish serial serum hormone study in eight healthy women aged 2047 found osteoblastic activity to be higher during the well - documented luteal phase by measurements of osteocalcin (oc) and bone - specific alkaline phosphatase (bap). in addition, this study also observed the highest level of igf-1 (then called somatomedin c) during the luteal phase of the menstrual cycle, with which the recent growth hormone data agree. thus several studies confirm higher follicular phase bone resorption rates and higher luteal phase rates of bone formation. young women gain body size (bmi), bone size, and bmd rapidly around the time of peak height velocity and menarche [29, 30 ]. although not well characterized, it is known that levels of estradiol, testosterone, and growth hormone are increased during this period of bone growth and reproductive maturation. however, ovulatory cycles are rare at menarche and become more prevalent only with increasing time since the first period [31, 32 ]. there are sparse data about relationships between bone change and ovulation, documented either by tanner breast stages (in which tanner stages 4 and 5 indicate the presence of progesterone) and/or by hormonal measures. a recent population - based study of estradiol receptor polymorphisms and bmc data (corrected for bone area but not bmi or body size) compared bmc with breast tanner stage in a cross - sectional study of girls who averaged aged 11.8. these data showed that bone size - adjusted bmc is greater in tanner stage 5 than in stage 1 (figure 2). such cross - sectional population - based data fit with prospective observations in the teen bone study, a prospective, observational study in a convenience cohort of 38 girls aged 911 (mean initial age 10.6 [sd ] 0.6 years) that documented total body and spine bmd and bmc at baseline and yearly. in addition six monthly measurements were made of weight, height, seated height, wrist width, bmi, and questionnaires about calcium intakes and exercise. the onset of menstruation, menstrual cycle calendar data, and weekly salivary progesterone levels were used to assess the prevalence of ovulation based on a threshold value of higher than 40 based on 93 menstrual cycles from 13 young women that averaged 36 days long (range 20119) and their weekly salivary progesterone data (n = 163 samples), 27 (29%) cycles were ovulatory while 66 (71%) were anovulatory. figure 3 shows that total body bmd increased significantly by the number of days since menarche (day 0 in figure 3) ; in particular bmd increased more following the onset of ovulation. gains in bone density were greater 10 5 months after menarche following which time ovulation first developed (shown with the dotted vertical line) than before (r = 0.40, p 10 years since menarche and are mainly in their 30s (mean age 31.4) except for the younger women (mean age 22.1) in the bedford study. in these five studies assessing prospective bone change by the incidence of ovulatory disturbances, the total number of cycles with documentation of ovulation (table 1) varied from a median of 10/year in the prior 1990 study to 5/year in the waugh investigation, to 6.8/year in the bedford study, to 2.7/year in the waller, and 1.5/year in the prior 1996 data. in this latter four - year follow - up study, women collected menstrual cycle and qbt data for 36 months at the end of the fourth year and before repeat bmd measurement at the five - year anniversary of their initial qct. here, the median number of cycles of data collected by the 27 reported women was 6 (range 346) with a minimum of 3 cycles. in those three studies that had documentation of ovulation in at least five cycles / year, which reached a total of almost 400 women, those with more prevalent normally ovulatory cycles had a + 1.23% gain versus the 1.00% loss / year in those with ovulatory disturbances (table 1) [11, 46, 48 ]. by contrast, studies with fewer cycles between bone density measurements or few measurements not within the bone change window were not able to show any such ovulation - bone change relationship [45, 47 ]. however, the luteal index (mean luteal phase length divided by mean cycle length) from year one of the prior study continued to relate positively (r = 0.339. also in the total body bone density reported by waller, normally cycling women experienced a + 0.02% change while those with ovulatory disturbances experienced a 1.7% loss (p =.08). furthermore, the bedford study showed that total hip bmd change, in addition to spinal bmd, was significantly related to ovulatory disturbances (0.6% versus + 0.9%, p =.001). in summary, it appears that five or more cycles of ovulation - documented data per year are needed to see any bone change related to progesterone production within regular menstrual cycles. the most influential of these has a nested case - control design within a population - based sample (the michigan bone health study). a randomly sampled cohort of premenopausal women ages 2545 (n = 582) all had bmd measured by dxa. those in the lowest 10th percentile of bone density (cases) and those in the 50th to 75th percentile of bmd (controls), who had regular cycles, were on no hormones (n = 31 cases and 34 controls) collected daily first morning urines for lh, fsh, and excretory products of estrogen (e1c) and progesterone (pdg) over two cycles or 84 days. cases (women with low bmd) were smaller and leaner than controls (bmi 23.6 versus 26.1), probably of lower socioeconomic status (based on significantly fewer years of education) and were less likely to use alcohol or to have taken oral contraceptives. results of this cross - sectional study showed lower pdg and e1c excretions across cycles in cases compared with controls. all three summary measures of pdg were lower in cases (peak, mean, and area under the curve with p =.002.006). e1c was also lower (with p =.01 to.008). although not statistically significant, anovulation rates were higher in cases (14.8%) than in controls (8.8%). the data suggest that lower bmd values are related to subtle disturbances in ovulation and perhaps estradiol levels within regular cycles. the final two cross - sectional studies failed to confirm a relationship between ovulatory disturbances and bone change in premenopausal women [51, 53 ]. these studies typically have measured ovulatory function in only one cycle and/or did not document short luteal phase lengths that are the most prevalent subclinical disturbances of ovulation [51, 53 ]. it is likely that a cross - sectional study does not have the power to show a bone - ovulation relationship because of the great within - woman variability of subclinical ovulatory disturbances. if the above associations of ovulatory disturbances with less positive changes in bone hold true, women with subclinical ovulatory disturbances who are currently undiagnosed and overlooked as having bone risks might be experiencing bone loss over many asymptomatic premenopausal years. so far, no progesterone trial with bone endpoints has been undertaken, but there are two published trials of physiologic dose (not depot) cyclic medroxyprogesterone (mpa) of which we are aware, one a randomized controlled trial in healthy, normal weight, physically active women in their early 30 s and one an open although apparently randomized trial in underweight teenagers with amenorrhea or oligomenorrhea. the prospective trial of cyclic medroxyprogesterone acetate (mpa, 10 mg / day for 12 days a month) for underweight teenagers is compared with the randomized, double - blind placebo - controlled two by two factorial design trial of cyclic mpa (10 mg / day for 10 days a month) and/or calcium supplementation (1000 mg / d). women participating in this latter one - year trial differed from those in the teen study in being healthy, of normal weight, and physically active. in addition, they had a range of menstrual cycle and ovulatory disturbances including hypothalamic amenorrhea, oligomenorrhea, or ovulatory disturbances within regular cycles. bone change across one year was compared by randomization to cyclic mpa or to placebo. women with regular cycles were required to have two consecutive cycles with proof of ovulatory disturbances by qbt before enrolment. participants were stratified by amenorrhea, oligomenorrhea, anovulation, and short luteal phase cycles into one of four groups(1) cyclic mpa (10 mg for 10 days a month or cycle days 1625) with active calcium (an additional 1000 mg / d) ; (2) cyclic mpa with placebo calcium ; (3) placebo cyclic mpa with active calcium or (4) both mpa and calcium placebos. the primary outcome, bmd of l1 - 4 in the spine, was measured at the beginning and the end of the year, as were body weight, height, and skin folds. women also recorded 3-day diet diaries every three months and daily completed a menstrual cycle diary record daily, as well as recording their basal temperatures and exercise duration, type and mean exercise heart rates. results in the 61 women completing this cyclic mpa trial showed that bone change over one year was positive in those assigned to cyclic mpa with or without calcium supplementation and averaged + 1.7 0.5 (sem) percent (2 2 anova f = 19.43, p =.0001). the effect of calcium supplementation was not quite significant (f = 3.34, p =.073) ; however it prevented some bone loss (mean change = 0.7%, p =.28). women assigned to both placebos lost bone at a significant rate (2.0%, p =.005) despite being of normal weight, having regular exercise and adequate calcium intakes. in a small open, apparently randomized (no clear rct methodology provided) trial of underweight or anorexic teenagers with amenorrhea, who had inadequate calcium intakes (less than 1300 mg / d), the girls were assigned to cyclic mpa (10 mg for 12 days / month, n = 5), oral contraceptives (35 g ethinyl estradiol, n = 5), or placebo (n = 5). young women in the same study who had oligomenorrhea were assigned to cyclic mpa (n = 5) or placebo (n = 4). amenorrheic women on oral contraceptives appeared to gain spine bmd while those on cyclic mpa and placebo lost bmd. however, these results are flawed by the differences of endogenous estradiol between oligomenorrhea and amenorrhoea as well as by the undernutrition of enrolled young women, and the few participants. although perimenopause is understood to be a time of dropping estrogen levels, its hormonal changes are much more complex than estrogen deficiency. hormonal perimenopausal changes involve altered control of gonadotrophins, disturbances of feedback of ovarian hormones at the pituitary and hypothalamic levels, at least partly through the inhibins, and erratic ovarian follicular growth despite decreasing numbers of follicles. ovulation disturbance is one of the consequences of these perimenopausal hormonal changes, which, in turn, may accentuate the changes. in the normal menstrual cycle, progesterone exerts feedback on the hypothalamic gnrh pulse generator and slows the frequency of gnrh pulses [60, 61 ]. however the amplitude of the pulses is higher during the luteal phase compared with the follicular phase. towards the end of the luteal phase, the decreasing progesterone concentrations cause the gnrh - pulse generator to accelerate again. during these few days of acceleration, gnrh - receptors in fsh - producing cells are particularly sensitised, so that, for a few days before, during and after flow, fsh - levels rise. this mechanism is pronounced during perimenopause, when increasing numbers of anovulatory cycles go hand in hand with rising early follicular phase fsh levels. this next section will first review several studies of cross - sectional bmd values and bone resorption markers related to pre-, peri-, and postmenopausal status (table 2). results of prospective changes in bone turnover markers in women who differed in reproductive status but were all over age 40 and changes in spinal bmd by qct in untreated pre-, peri-, and early postmenopausal women at baseline, two, and six years will be studied. the majority of studies on perimenopausal bone change have been conducted using dual (energy) x - ray absorptiometry (dxa) of the hip and/or spine. dxa provides an areal, rather than true volumetric summary measurement of mineral content including both cortical and trabecular bone. cancellous or trabecular bone, which is more responsive to hormonal changes, and measured volumetrically by qct, provides a more sensitive assessment of change in bmd within the more metabolically active cancellous compartment and may result in earlier detection of bone loss. since perimenopause is characterized by unpredictable and unstable endocrinological changes, systematic comparison and classification are difficult. efforts to establish standards for scientific comparisons and for clinical use have led to five phases of reproductive transition, based on endocrinological and clinical criteria defined in international boards such as the who scientific group and workshops (e.g., staging of reproductive aging workshop (straw)), with the aim of achieving comparability of scientific results on perimenopause. to date international standardisation has not been achieved, and the newly defined criteria are still not used consistently. therefore publications reporting that they studied perimenopausal women may include them either with premenopausal or postmenopausal groups, as by kushida. or melton. in table 2 [66, 68 ], or mix them with others to form a group of middle - aged women such as ages 4059 years without applying any distinct hormonal or menstrual cycle criteria. another way of dealing with the problem of definition has been to take change from premenopause to postmenopause over a time course of many years, which is only possible in studies such as those published by lfman or ravn [67, 69 ] (5-year follow - up, see table 2). these studies, however, carry the risk of not capturing perimenopause itself over such long intervals. amongst the published cross - sectional data, only ebeling. and sowers, in the baseline data of the multiethnic participants (n = 2336 women aged 4252) from swan, the study of women across the nation, also showed that increased bone turnover begins years before menopause. a meta - analysis of within - centre studies documenting both perimenopausal and postmenopausal rates of spinal bone loss earlier showed significantly greater rates of loss in perimenopause (1.8 versus 1.2%/year). that analysis reported preliminary melbourne midlife women 's health study results prior to their publication. however, in 224 untreated pre-, peri, and postmenopausal participants (n = 78 early perimenopausal, n = 12 late perimenopausal), the greatest amount of loss occurred in the first three years following the final menstrual flow. this may have been because of inclusion of the first year after the final menstrual flow in postmenopause rather than perimenopause, or because of the relative time lag of dxa for bone changes affecting mainly or exclusively the trabecular compartment. accordingly, early cycle elevated fsh and low estradiol values, as are commonly found in postmenopause, correlated with this increased loss. another study by slemenda. showed increased bone loss in 62 perimenopausal women from a total of 231 untreated women. apart from low estrogen, bone loss in this study was also associated with lowered serum androgen levels. the michigan bone health study cohort (513 women, aged 2545 randomly sampled from the population) documented that dxa of the spine was three percent lower in perimenopausal than in premenopausal women and that annual bone loss was significantly elevated in perimenopausal women, when compared with premenopausal participants. these observations were confirmed by the even larger swan study (n = 2311). in the first 4 years of this study with annual bone density measurements and early follicular phase serum hormone values, this study showed that in both baseline and follow - up, elevated fsh levels were associated with decreased bone density, while estradiol was not. in both the australian and usa large studies, however, hormone values were only taken during the early follicular phase, a time when fsh is often elevated in perimenopausal women, estrogen is normally low, and progesterone can not be evaluated. so, despite the large size and the power of these studies, they could only assess hormonal effects of the first week of women 's menstrual cycles, excluding the remaining 75% of potentially available information. two prospective observational german studies attempted to systematically characterize the changes in bone metabolism associated with perimenopause. in the first study, serial bone turnover marker measurements were made on 64 healthy women over age 40, who had taken no exogenous hormones and were within three reproductive life phases : premenopause (mean age 43.7 years, n = 20), perimenopause (mean age 50.3 years, n = 24), and postmenopause (mean age 52.2 years, n = 20). these prospective, serial bone marker measurements were first made on four visits across one year (0, 3, 6, and 12 months). parameters relating to bone resorption were the urinary excretion of pyridinoline (pyd), deoxypyridinoline (dpd), and n - terminal telopeptide (ntx), all corrected for creatinine. as well, serum bone formation markers were measured including osteocalcin (oc) and bone - specific alkaline phosphatase (bap). in these midlife women with regular cycles, this study found a significant decrease over time for the bone formation marker bap, leading to the conclusion that the metabolic changes in bone remodeling commonly associated with perimenopause (like the higher estradiol levels and disturbed ovulation) had already begun in the late reproductive phase. these participants were followed for a second year, as well as eventually over six and nine years. the six - year follow - up allowed for a longitudinal comparison of bone changes in pre- as opposed to perimenopausal and early postmenopausal women. analysis of qct changes over time required classification of women 's reproductive status and its changes over time. invariably for all analyses, the perimenopausal period during which estrogen levels were still adequate was associated with the greatest reduction of qct, with loss rates reaching 6.3%/year. total bone loss differed by pattern of individual women 's experiences of the transition from pre- to postmenopause (one - way anova p 45 years, cycle lengths no greater than 42 days, no use of exogenous hormones during the 6 months prior to study onset, and no medical reasons for low bone mass. lumbar spine trabecular bmd measurements are performed using qct at baseline and after two years. participants note the beginning and end of each cycle and used a cycle monitor to detect the day on which there was a high probability of ovulation. results are available so far for 54 women (mean age 48.3 2.3 sd years) who have recorded 673 evaluable cycles and had 132 luteal phase blood tests suitable for analysis. qct measurements at baseline show that 45 women had normal bone density (mean 148.2 19.3 mg calcium - hydroxyapatite (ca - ha)/ml), while nine had osteopenia (mean 103.7 7.3 mg ca - ha)/ml. women with normal bmd at the beginning of the study, and those who maintained bmd levels within the normal range over two years, were more likely to experience normal ovulatory cycles with fewer ovulatory disturbances than those women whose initial or two - year qct values showed osteopenia. during the course of this two - year study, the proportion of ovulatory cycles related to qct bone change (r = 0.7, p <.05) (figure 5). also, as has previously been shown [59, 82 ], progesterone levels decreased before cycles without ovulation became common. although women are known to lose bone rapidly before as well as after they become postmenopausal [10, 83 ], this study adds to existing data by showing that this bone loss is not simply due to the increased bone resorption caused by the perimenopausal swings in estrogen levels but is also related to progesterone levels and ovulatory characteristics. postmenopausal women are more likely to experience fragility fractures than are pre- or perimenopausal women. this increased fracture risk is usually ascribed to estrogen deficiency but this state also includes progesterone deficiency. a number of published investigations have asked two questions about the relationship of progesterone to bone change in postmenopausal women. (1) does progesterone therapy prevent or treat osteoporosis in postmenopausal women ? and, (2) does progesterone therapy add to the bone - positive effects of anti - resorptive therapies (such as estrogens, calcitonin, or bisphosphonates) ? this section and the next will review the available human data to answer these two questions. to determine whether progesterone is effective treatment for osteoporosis in postmenopausal women, changes in bmd by dxa and/or qct in four rcts compared treatment with progesterone or mpa with placebo. gallagher, in the earliest study, asked whether a high dose of the non - androgenic progestin, medroxyprogesterone [mpa ] effectively treated postmenopausal osteoporosis. the 20 mg dose of mpa for 23 of 28 days did not prevent bone loss by spine dual photon absorptiometry (dpa). likewise, table 3 shows bone change in two further rcts of more standard mpa doses of 10 mg / d, 300 mg / d of oral micronized progesterone (omp), or 20 mg / d of progesterone cream. the net result of the placebo - controlled trials with mpa was bone loss (2.2% per year) despite these mpa or progesterone therapies and with no apparent difference from the bone change on placebo (2.4%/year). one of the rcts of mpa alone and bone change was a unique one - year randomized blinded comparative study versus conjugated equine estrogen (cee) in 41 premenopausal women who had just undergone premenopausal abdo - minal hysterectomy with bilateral ovariectomy for benign problems. cee (0.6 mg / day) was compared with mpa (10 mg / day) over one year. all 41 women began study participation after fasting blood and urine samples were obtained on the morning they were discharged following their surgery. results showed highly significant rates of spinal cancellous qct bone loss in women on both therapies (15% mpa, 8.3% cee, p =.04). mpa also did not prevent significant bone loss in the whole body (2.8%) and femoral neck (5.2%). the results of this mpa versus cee randomized comparative trial may provide clues to causes for major bone loss despite progesterone / mpa therapy with their osteoblast differentiating and bone formation effects. on average at seven days following surgery, bone resorption markers were three to five standard deviations higher than premenopausal levels. these bone resorption markers did not decrease across a year of mpa therapy despite the fact that all women were supplemented with 600 mg of additional calcium / day and gained approximately 2.5 kg in weight. one further randomized 2-year placebo - controlled trial of a progestin and bone change is available. this study treated early postmenopausal women with promegestone, a 19 nor - progestin, or placebo and showed some prevention of bone loss (1.3% versus 4.5% on placebo, p =.05). urinary calcium excretion was significantly decreased in the promegestone group, however, suggesting it may decrease resorption rather than acting through the progesterone receptor. taken together from this meta - analysis, the answer to the first question is as follows mpa / progesterone alone is not effective therapy for postmenopausal osteoporosis because it has no or little effect to control bone resorption, the driving force in human bone loss and osteoporosis. yearly percent bone change on co - therapy with an antiresorptive and progesterone or mpa compared with the antiresorptive agent alone has been studied in five randomized, double, blind controlled trials to answer the second research question named above (table 4). two of these were major studies in the bone field (postmenopausal estrogen progestin investigation [pepi ] and the women 's hope trial). a more recent study combined mpa 10 mg / d with oral micronized estradiol in a dose of 1 mg / d, versus the estradiol alone. the results of these rcts show the mean change in spinal bmd on co - therapy with daily low - dose mpa, and an antiresorptive was slightly more positive (+ 1.7%/year) than with the antiresorptive alone (+ 1.3%/year), a difference of about 24%. in both of the largest studies [89, 90 ], estrogen - progestin spine results were noted to be significantly more positive than those related to the antiresorptive alone [89, 90 ]. this, however, did not appear to occur when the progestin was given cyclically, suggesting that daily progesterone is needed to increase bmd in menopausal women. progesterone daily co - therapy with estrogen is more effective than estrogen alone for postmenopausal osteoporosis. the non - randomized clinical studies combining mpa with an antiresorptive therapy show similar but even greater increases in bmd on mpa and antiresorptive co - therapy compared with the antiresorptive alone [9294 ]. it is very difficult to compare studies in women who have had hysterectomy with / without ovariectomy because women with hysterectomy, and certainly following ovariectomy, are much more likely to be treated with estrogen than are women with natural menopause ; this represents confounding by indication. the new zealand studies examined older postmenopausal women with high rates of bone loss who were treated with cee plus 5 mg / d of mpa or with cee alone this one - year study saw a 65% greater spine bmd increase on combined therapy (6.6%) compared with cee alone (4.0%). a prospective study also from new zealand and in a similar population looked at the rates of bone change in the hip and spine when either cee or transdermal estradiol was paired with mpa and compared with placebo. one - year results were quite positive in the spine (+ 7.1%) and in the femoral neck (2.9%) but there was no anti - resorptive alone comparison in this descriptive study. finally, a small pilot study on a random sample of (n = 20) clinical patients treated with mpa combined with an early bisphosphonate (intermittent cyclic etidronate, didrocal) compared their bone change data with that from a meta - analysis of rcts of etidronate alone. in this comparison, spine increases were greater on mpa - antiresorptive co - therapy (+ 2.6%) than on antiresorptive therapy alone (+ 1.8%) ; femoral neck bmd increases on mpa co - therapy were also more positive (+ 1.5% versus + 0.5%). so far in this paper, the fracture prevention shown in the cee - mpa and the cee only arms of the women 's health initiative (whi) trials has not been discussed [5, 96 ]. these are not only the largest studies of bone in women randomized to postmenopausal hormone therapy or placebo (n = 27,000 in both studies together), they are also the only randomized, placebo - controlled studies to show fracture prevention with ovarian hormone therapy. these data are especially important since the study population was not selected for low bone mass or osteoporosis risk factors. ideally we could compare the rates of fracture in the co - therapy with the cee - only arms but this is not possible because each was in a different randomization scheme and had its own placebo group. data so far suggest that progesterone or mpa co - therapy with estrogen is more effective for osteoporosis ; however breast cancer is an important clinical concern. combined hormone therapy containing mpa has been repeatedly associated with increased breast cancer risk [9799 ]. the prospective e3n observational study, following 80,000 french women over eight years however, saw an increase in breast cancer risk only with estrogen alone or with synthetic progestins, but not with oral micronized progesterone combined with estrogen [99, 100 ]. likewise, effects of progesterone and various progestins on intramammary estradiol metabolism are needed before combined estradiol and progestin would be considered safe or acceptable. other important non - bone issues in women with postmenopausal osteoporosis are sleep disturbances and hot flushes and night sweats (vasomotor symptoms, vms) that have been linked to increased bone loss [101103 ]. oral micronized progesterone is clinically useful for insomnia and in a dose of 300 mg at bedtime significantly increased total sleep time, decreased time required to fall asleep, and increased early night rem sleep in a cross - over rct. that trial also showed that, after 21 days of treatment, progesterone caused no lack of alertness or any cognitive impairment in the morning. vasomotor symptoms, that occur in about 70% of postmenopausal women and are severe in almost 10 percent, are effectively treated by mpa [105, 106 ] and also by oral micronized progesterone treatment. although the dominant osteoporosis paradigm for women is, and should remain, centred on estrogen, progesterone is emerging as an important partner hormone that collaborates with estrogen. in vitro studies of human osteoblasts in culture, prospective studies in adolescent, premenopausal, perimenopausal, and postmenopausal women all indicate that progesterone likely working through bone formation pathways plays an active role in maintaining women 's bone and in osteoporosis prevention. finally, although progesterone or mpa therapy does not prevent bone loss when bone turnover is high, evidence from a number of randomized controlled trials suggests that progesterone as co - therapy with an antiresorptive agent may have promise. data on progesterone co - treatment and fracture prevention are urgently needed, as is more information about the microarchitectural and histomorphometric changes during progesterone therapy. progesterone, a physiological ovarian steroid that is normally secreted in high levels for two weeks per menstrual cycle in ovulatory menstruating women, appears to have complementary bone actions with estrogen and antiresorptive therapies. progesterone deserves to be studied more as a new and emerging agent for achieving and preserving peak bone mass, for prevention of pre- and perimenopausal bone loss, and, with an antiresorptive therapy, in increasing bmd and potentially decreasing fractures in postmenopausal women.	estradiol (e2) and progesterone (p4) collaborate within bone remodelling on resorption (e2) and formation (p4). we integrate evidence that p4 may prevent and, with antiresorptives, treat women 's osteoporosis. p4 stimulates osteoblast differentiation in vitro. menarche (e2) and onset of ovulation (p4) both contribute to peak bmd. meta - analysis of 5 studies confirms that regularly cycling premenopausal women lose bone mineral density (bmd) related to subclinical ovulatory disturbances (sods). cyclic progestin prevents bone loss in healthy premenopausal women with amenorrhea or sod. bmd loss is more rapid in perimenopause than postmenopause decreased bone formation due to p4 deficiency contributes. in 4 placebo - controlled rcts, bmd loss is not prevented by p4 in postmenopausal women with increased bone turnover. however, 5 studies of e2-mpa co - therapy show greater bmd increases versus e2 alone. p4 fracture data are lacking. p4 prevents bone loss in pre- and possibly perimenopausal women ; progesterone co - therapy with antiresorptives may increase bone formation and bmd.
over last three decades, the role of hematopoietic stem cell transplant (hsct) in chronic myeloid leukemia (cml) has seen several phases and continues to be defined. in 1980 's, hsct came as a revolutionary concept that offered cure from cml. in 1990 's, transplant methodologies were refined, which resulted in increased cure rates and decreased transplant - related mortality. survival outcomes improved significantly in chronic phase patients with 3 years survival rate of more than 80%. thirty years later, it is still the only treatment that offers cure in cml. the ability of allogeneic hsct to cure cml is related to the antileukemic effects of both the conditioning regimen and the graft versus leukemia (gvl) effect of the donor lymphocytes. however, with the advent of imatinib in early 2000 's the natural history of cml was changed and so did the way we treated cml. with the excellent response rates and minimal toxicity imatinib soon became the treatment of choice for chronic phase cml, and it was thought that hsct was no longer needed at least in chronic phase. however, as our experience with imatinib increased, issues of resistance / intolerance in chronic phase emerged. at 18 months of treatment, imatinib resistance also, the treatment of advanced phase disease (accelerated and blast phases) with imatinib proved to be inadequate. second - generation tyrosine kinase inhibitors (tkis) including dasatinib and nilotinib were able to achieve < 50% complete cytogenetic response (ccyr) in imatinib resistant / intolerant cases. thus, transplantation still has a definite, though more limited, role in the treatment of cml. in advanced phase disease, treatment with tkis can achieve initial good response (second chronic phase). however, such responses are usually short lived and do not appear to be associated with long - term survival. in one study, the rate of major cyr and ccyr in accelerated phase patients treated with imatinib at 600 mg / day was only 24% and 17%, respectively. in another analysis of three phase ii studies of cml patients in blast crisis treated with 600 mg / day imatinib, at 36 months only 7% were disease free and only 14% were alive. however, it would be prudent to start the patient on a tki for two reasons. first, it tides over the time period required to find human leukocyte antigen (hla) matched unrelated donor if hla - matched sibling is not available. second, cure rates in advanced phase disease are better if transplanted in second chronic phase. among patients in chronic phase treated with imatinib as first line tki therapy, approximately 20% will fail primary therapy, either from intolerance, relapse or progression to advanced phase disease. it is reasonable to consider hsct at the time of first - line failure. however, secondary tki therapy should be started at the time of resistance for two reasons - first, a ccyr on secondary therapy is achieved in approximately 50% patients second, a donor search may take months. patients who relapse with a t315i mutation should proceed to transplant at the earliest, given the low - response rate to secondary therapy. similarly, those who have a mutation within the p loop region, which is known to be associated with an increased risk of progression to advance phase disease, transplant is a reasonable option. thus, current indications for transplant in cml include [figure 1 ] : advanced phase disease (accelerated phase and blast crisis)resistance / intolerance to tkisrelapse on tkis. advanced phase disease (accelerated phase and blast crisis) resistance / intolerance to tkis algorithm for consideration of hematopoietic stem cell transplant in chronic myeloid leukemia several factors influence the outcome of allogeneic hsct in cml, most importantly the phase of the disease, but also, the type of donor used, the nature of the stem cell product, and the age of the patient. the european group for blood and marrow transplantation (ebmt) devised a risk score based on five separate characteristics, which predicted treatment - related mortality and 5 years overall survival following allogeneic hematopoietic cell transplantation. this system uses hla matching, stage, age, sex of donor / recipient and time from diagnosis to transplant as risk factors. survival at 5 years varied from 72% for the best score to 22% for the worst score. the ebmt risk score was later validated using separate data from the international bone marrow transplant registry. however, the value of this prognostic scoring system is largely for prognostication rather than decision - making. five years disease - free survival varies from 90% in chronic phase to 40 - 50% in accelerated phase to 10 - 20% in blast crisis. outcome of patients in blast crisis who achieve a second chronic phase with tki therapy is similar to that of patients in accelerated phase. advances in hla typing and graft versus host disease (gvhd) therapy has improved transplant outcomes in cml. results with a fully matched unrelated donor are quite similar to that achieved with a matched - related donor. bone marrow harvest has been replaced by peripheral blood mobilization for stem cell collection making the procedure more donor compliant. two randomized trials involving patients with various hematologic malignancies, including cml, concluded that use of granulocyte colony - stimulating factor mobilized peripheral blood stem cells lead to faster myeloid and platelet recovery, no significant difference in acute or chronic gvhd and an overall survival advantage compared with bone marrow. however, another study in chronic phase cml showed no significant difference in the outcome between the bone marrow and peripheral blood groups. in earlier studies, younger age has been shown to improve survival after hsct in cml, however, better supportive care, better donor selection and use of reduced intensity conditioning regimens have dampened the effect of age on survival outcome. some studies had suggested that increased interval from diagnosis to transplant was associated with a worse transplant outcome, higher relapse rate and an increase in nonrelapse mortality. this was attributed to the development of resistant clones associated with a longer delay to transplantation. another factor implicated in affecting outcome in earlier studies was the use of prior imatinib, which was shown to be associated with an increase in regimen - related toxicity and mortality, especially from hepatic causes. however, larger studies have shown that there is no deleterious effect of the pretransplant imatinib on outcome. furthermore, patients with abl mutations have similar outcomes compared with those with no mutations following transplantation. on average 5 - 20% of the chronic phase patients and 30 - 60% of advanced phase patients relapse following allo - hsct. increased incidence of relapse is seen with hsct strategies involving t - cell depletion and use of reduced intensity conditioning regimens. an increasing level of bcr - abl transcript measured by quantitative polymerase chain reaction is predictive of impending disease relapse and needs intervention. modalities available to prevent and/or treat posttransplant relapse include donor lymphocyte infusion (dli) therapy, tki therapy, interferon therapy and infusion of in vitro stimulated cd8 t cells. dli have been very effective (70 - 90% complete remission rate) for patients who relapse with chronic phase. the efficacy of dli is the result of gvl effect which is highly pronounced in cml. however, the drawbacks of dli are (1) advanced phases of the disease are least responsive to dlis, (2) effect of dli may last for few months and repeat dli may be required and (3) it may be complicated by life - threatening gvhd. tki therapy with imatinib is highly effective in treatment of posttransplant relapse. in a study of 28 cml patients who were treated with imatinib for posttransplant relapse, longer follow - up of similar patients had shown that these responses are quite durable. response rates are higher in patients who relapse in chronic phase compared to those who relapse in advanced phase disease. furthermore, there is some evidence that imatinb maintenance therapy posttransplant is effective in preventing relapse in high - risk cases. however, considering the morbidity and mortality associated with hsct and efficacy and favorable toxicity profile of tkis, cml chronic phase patients should be initially treated with tki. for patients with advanced phase disease and those with chronic phase disease who are resistant or intolerant to tki or relapse on tki,	indications for hematopoietic stem cell transplant (hsct) in chronic myeloid leukemia (cml) have changed over time. this change has largely been influenced by the advent of tyrosine kinase inhibitors, increased understanding of the mechanisms underlying disease phase progression as well as drug resistance, refinement of transplant techniques and exploitation of graft versus leukemia effect in this disease. here, we have discussed the status of hsct in cml in the present era with regards to the current indications, factors determining outcome and management strategies for posttransplant relapse.
chorioangiomas are the most common benign tumors of the placenta originating from primitive angioblastic tissues. the newborn are rare and usually associated with tumors greater than 5 cm in diameter and consist of polyhydramnios, fetal anemia, massive edema with pleural effusion, ascites and intrauterine growth retardation. we present a case with large chorioangioma as the cause of non - immunologic hydrops fetalis with a successful outcome. the patient was a female newborn with history of polyhydramnios, symptoms of congestive heart failure and associated anemia, thrombocytopenia and coagulopathy. chorioangioma of the placenta has potentially serious perinatal risks and so the pregnancy needs to have regular surveillance. the term non - immunologic hydrops fetalis (nihf) defins an edematous fetus with fluid collections in some or all serous cavities that does not have erythroblastosis fetalis from isoimmunization. in 1943 dr edith potter published the first description of nihf ; now over 80 conditions are known to be associated with hydrops with very high perinatal mortality ranging from structural heart disease, fetal arrhythmias, chromosomal anomalies, intrauterine infections and larger chorioangiomas of the placenta[25 ]. in most countries with low rhesus - negative rates in the population, nonimmune causes are more prevalent ; the incidence depends on the region and also varies seasonally in relation to parvovirus b19 epidemics. we describe a newborn in whom cardiac enlargement and congestive heart failure were caused by a vascular shunt through a large placental chorioangioma, emphasizing the importance of the anatomical study of the placenta for the correct diagnosis, managing the neonatal care and evolution of the newborn. a 2.120 g preterm female newborn, product of a non consanguineous marriage was born from a primigravida by emergency cesarean section at 32 weeks of gestation because ultrasound examination revealed cardiomegaly with abnormal umbilical flow and signs of vascular fetal insufficiency. physical examination at birth revealed 1 minute apgar score 8, anasarca, poor respiratory effort with bilateral wet rales, hepatosplenomegaly with ascites and no reflexes. the initial chest radiograph obtained 2 hours after birth showed soft tissue edema, cardiomegaly and pleural effusion compatible with congestive heart failure. laboratory data included hypoproteinemia and hypoalbuminemia, anemia (hematocrit 31% ; hemoglobin 10.3mg / dl) and hyponatremia (na 125 meq / l), thrombocytopenia (platelets 4110/l) and deranged coagulation profile (prothrombin time 19 seconds, activated partial thromboplastin time 120 seconds). the infant 's cardiorespiratory status gradually improved with water restriction, conventional respiratory assistance and inotropic drugs which resulted in 29 percent decrease in weight compared to her birth weight. pathology of the placenta showed edema without signs of placental infarction and a big tumoral mass measuring 1043 cm (fig. microscopic examination revealed large fusiform vessels in a fibrotic stroma with focal edema and clusters of myxoid cells (fig. 2 and 3). placental chorioangioma : tumoral mass measuring 1043 cm placental chorioangioma : large fusiform vessels in a fibrotic stroma with focal edema and clusters of myxoid cells placental chorioangioma is a benign vascular tumor detected in 1 percent of placentas after systematic examination. most of these tumors are small and discovered only by microscopic examination and have no adverse impact on the fetus. larger tumors are rare and when above 5 cm in diameter, they are associated with serious complications. these tumors are found accidentally by ultrasound examination. in our case, the placental tumor measured more than 10 cm and led to cardiomegaly with abnormalities in the umbilical flow and signs of vascular fetal insufficiency. where the tumor is avascular, no specific complications should be expected. when the tumor is vascularized, and in particular if it contains numerous large vessels, serial ultrasound and doppler examinations are warranted to detect early features of fetal congestive heart failure. two hypotheses are proposed for formation of congestive heart failure in this condition : the left to right shunt as a result of intra tumoral arteriovenous shunting and chronic fetal hypoxia secondary to insufficient placental function or anemia and thrombocytopenia[8, 9 ]. the detection of ultrasound findings of heart failure or suggestive signs of anemia as cardiomegaly, enlargement of the liver and abnormal umbilical vein. large placental chorioangiomas are rare and the prognosis is bad when a big tumor causes fetal hemodynamic changes with nihf, but treatment of heart failure may be promising in these newborns and complete recovery is achieved in some cases. chorioangioma of the placenta has potentially serious perinatal risks and so the pregnancy needs to have regular surveillance.	backgroundchorioangiomas are the most common benign tumors of the placenta originating from primitive angioblastic tissues. it comprises near 1 percent of placental tumors. clinical manifestations in the newborn are rare and usually associated with tumors greater than 5 cm in diameter and consist of polyhydramnios, fetal anemia, massive edema with pleural effusion, ascites and intrauterine growth retardation. we present a case with large chorioangioma as the cause of non - immunologic hydrops fetalis with a successful outcome.case presentationthe patient was a female newborn with history of polyhydramnios, symptoms of congestive heart failure and associated anemia, thrombocytopenia and coagulopathy. the pathophysiology and management of the complications of hydrops fetalis with chorioangioma are discussedconclusionchorioangioma of the placenta has potentially serious perinatal risks and so the pregnancy needs to have regular surveillance. the chance of developing complications is directly related with the tumor size.
a 46-year - old female presented with vague gastrointestinal symptoms, chronic right upper quadrant abdominal pain and intolerance to fatty food and diarrhea for the last two years. she was given the diagnosis of irritable bowel syndrome and had been followed by her internist. she had undergone an abdominal hysterectomy with bilateral salpingo - oophorectomy for menometrorrhagia and fibroids 15 years ago but was otherwise healthy. during the work - up, an ultrasound (u / s) of the abdomen revealed several small stones in the fundus of the gallbladder and a common bile duct of normal diameter. laparoscopic visualization of the abdominal cavity revealed a small brownish mass at the tip of the appendix resembling a lymph node. the camera was then moved from the supraumbilical port to the subxyphoid one. using the same instruments, ie, two endo grasps plus a multifire endo gia 30 stapler, the appendix pathologic examination demonstrated a carcinoid tumor in the tip of the appendix, which measured 0.3 0.2 cm (figure 1, 2). the margins of the specimen were clear, no lymph nodes were seen, and there was no mesoappendix invasion.. longitudinal section of the appendix tip demonstrating nests of uniform, polygonal cells with round, centrally placed nuclei, characteristic of carcinoid tumors, 200x. merling, in 1838, described the gross pathology of carcinoid tumor of the appendix, and in 1907 oberndorfer coined the term karzinoide. carcinoid tumors of the midgut arise from the distal duodenum, jejunum, ileum, appendix, and ascending and right transverse colon, with the appendix and terminal ileum being the most common locations. carcinoids share common histochemical characteristics with other gut cells ; they originate as solid nests of small monotonous neuroendocrine cells with high rare mitoses and occasional acinar or rosette formation. they have a high amine content in the cytoplasm, are capable of amine precursor uptake, and are able to decarboxylase these products to synthesize amines and/or peptides, such as tachykinins (substance p, neurokinin a, neuropeptide k) and others. godwin reviewed 2,837 cases of carcinoid tumor and found that the majority originate from the gastrointestinal tract (85%), but they were also found in the lung, ovary, and biliary tracts. carcinoid tumors showed several differences from other kinds of tumor, including a low age for appendiceal and lung cases and low male / female and black / white ratios in the lung. godwin 's percentages of concurrent neoplasm and multiple carcinoids were low compared to other series. five - year relative survival rates ranged from 99% (appendix) to 33% (sigmoid colon). however, survival for colon cases was not as low as expected on the basis of the high rate of metastases. histologically, there are five generally accepted carcinoid growth patterns, ie, insular (type a), trabecular (type b), glandular (type c), undifferentiated (type d), and mixed type. the mixed tumors with acinar and glandular pattern have the best median survival time (4.4 years), whereas the undifferentiated has the poorest median survival (0.5 year). in decreasing order of median survival time in years, the growth patterns ranked as follows : mixed insular plus glandular, 4.4 ; insular, 2.9 ; trabecular, 2.5 ; mixed insular plus trabecular, 2.3 ; three pooled low incidence rate mixed growth patterns, 1.4 ; glandular, 0.9 ; and undifferentiated, 0.5. the site of origin and rate of metastases varies, with appendix being the most common site of carcinoid. carcinoids of the appendix and rectum smaller than 2 cm have a 5-year survival rate of approximately 100%, declining to 40% when the tumor diameter is larger than 2 cm. however, metastases have been reported from carcinoid of the appendix less than 2 cm in size. while the risk of metastasis of these tumors has been correlated with their size, invasion of the mesoappendix is predictive of an increased risk of metastasis for carcinoid tumors of the appendix less than 2 cm in size. the clinical presentation of carcinoid tumors depends on their location with a wide clinical spectrum varying from asymptomatic to the malignant carcinoid syndrome. they are, in most instances, found incidentally at operation, as in our case. a third of patients with carcinoid present with years of intermittent abdominal pain often ascribed to other gastrointestinal or biliary disease, or to the irritable bowel syndrome. malignant carcinoid tumors may present with symptoms of mechanical bowel obstruction due to fibrosis, adhesions and kinking of the intestine. other constitutional symptoms include weight loss, diarrhea, upper gastrointestinal bleeding, intussusception, and abdominal mass. in patients with carcinoid of the foregut (atypical carcinoid), the urine contains only slightly elevated levels of 5-hydroxyindoleacetic acid (5-hiaa), but large quantities of 5-hydroxytryptophan (5-htp) and 5-hydroxytrypta - mine (5-ht), because these tumors are deficient in dopadecarboxylase, which is responsible for the conversion of 5-htp to 5-ht. in carcinoid of the midgut (typical carcinoid) most of the 5-htp is rapidly converted to 5-ht, which is taken up by platelets. the excess of 5-ht is converted by monoamino oxidase (mao) and aldehyde dehydrogenase (da) to 5-hiaa, which then is excreted in high concentrations in the urine. it is interesting to note that serotonin - rich foods, such as bananas, plantains, pineapples, kiwi fruits, wal - nuts, hickory nuts, pecans, avocados, and acetaminophen may artificially elevate 5-hiaa. numerous techniques can identify the primary site of the tumor. a chest radiograph or computed tomography (ct) may show a bronchial or mediastinal tumor double - contrast gastrointestinal studies still best define the primary neoplasm. appendiceal tumors frequently escape radiological detection until large enough to be discovered by computed tomography (ct). the hypervascular nature of carcinoid tumors and their metastases allows superior mesenteric arteriography of the small bowel and cecum to be used when the scanning procedures are not revealing. configuration of the desmoplastic mesenteric masses and lymph node metastases are best seen by ct, whereas hepatic metastases can be demonstrated by ct, ct - angioportography (ctap), ultrasonography (us), magnetic resonance imaging (mri), and octreotide scintigraphy. percutaneous needle biopsy with radiological guidance may confirm the diagnosis of carcinoid tumors and their metastases. appendiceal carcinoid tumors are rarely malignant, and lesions smaller than 1.5 cm can be safely resected by appendectomy only. if the tumor is at the base of the appendix, a cecectomy may prove necessary. laparoscopic resection of carcinoid tumors from the stomach, gallbladder, proximal and distal rectum have been described. laparoscopic appendectomy has been compared to open procedures, and the results showed open procedures taking less time, but there were more wound infections than in the laparoscopic procedure. patients with acute appendicitis recuperated more quickly from the laparoscopic procedure, as evidenced by the time until eating regular diet, period of hospitalization, incidence of nausea and pain medications on postoperative day one. we report a case of incidental laparoscopic resection of a carcinoid tumor at the tip of the appendix during an elective laparoscopic cholecystectomy. even though the risk of metastasis from carcinoid correlates with the size, ie, greater than 2 cm, there are several cases of metastatic disease from carcinoid tumors smaller than 1 cm in diameter. based on review of the literature, we suggest that any suspicious lesion of the appendix found during laparoscopic exploration of the abdominal cavity should be removed. we believe that the magnification provided by the laparoscope, ie, up to 18 times, and the ability to inspect the abdominal cavity allowed us to identify the lesion and to perform laparoscopic appendectomy while adding minimal morbidity to the procedure.	carcinoid tumors of the midgut arise from the distal duodenum, jejunum, ileum, appendix, ascending and right transverse colon. the appendix and terminal ileum are the most common location. the majority of carcinoid tumors originate from neuroendocrine cells along the gastrointestinal tract, but they are also found in the lung, ovary, and biliary tracts. we report the first case of elective laparoscopic cholecystectomy in which we found a suspicious lesion at the tip of the appendix and proceeded to perform a laparoscopic appendectomy. the lesion revealed a carcinoid tumor of the appendix.
in this article, we take a historical perspective to describe how individual diseases caused by cmv were first recognised. we focus on congenital cmv, infections in solid organ transplants, bone marrow transplants and advanced hiv using data from developed countries, because other articles in this issue will consider africa, hiv - infected or exposed neonates with cmv and the prospects for developing cmv vaccines. this was first recognised about 100 years ago when intranuclear inclusion bodies were seen in histopathological sections from cases of stillbirth. the availability of cell culture diagnosed infection in cases who survived intrauterine infection to be born with features of cytomegalic inclusion disease (table 1). prospective natural history studies also showed that apparently normal neonates could have congenital cmv infection. importantly, those with symptoms at birth had higher levels of cmv in the urine than those without symptoms (figure 1) in what was the first demonstration in humans of the phenomenon now termed viral load. the implications of this observation from 1975 were profound (table 2) and have all turned out to be correct. this includes the threshold concept, that disease occurs once viral load exceeds a critical value, so that benefit against disease may be greater than predicted from the activity of a drug against infection. cytomegalic inclusion disease blueberry muffin rash intrauterine growth retardation sensorineural hearing loss conjugated hyperbilirubinaemia raised liver transaminases periventricular calcifications association between quantity of cmv found in the urine and the severity of disease in neonates. j infect dis 1975 ; 132 : 568577 implications of results shown in figure 2 cmv is a systemic infection sampling urine provides information about clinically inaccessible sites e.g. inner ear cmv is a chronic infection in neonates so there may be a cmv - specific immune defect cmv may cause disease once a threshold value of viral load is exceeded treatment may be beneficial if viral load is kept below this threshold value postnatal treatment may be beneficial even if short - term prospective studies also showed that those born without symptoms were at risk of developing disease later in childhood, with sensorineural hearing loss and damage to intellectual function predominant. this association of progressive disease in the presence of ongoing virus replication suggested that the former might be limited if the latter could be controlled. two randomised controlled trials, both conducted by the collaborative antiviral study group, have addressed this issue. in the first, neonates born with cns symptoms were randomised to receive ganciclovir intravenously for 6 weeks at a dose of 6 mg / kg twice a day. this dose was chosen because of an earlier comparison of two doses of ganciclovir in sequential cohorts. the results of the randomised controlled trial showed that a lower proportion of ganciclovir recipients developed sensorineural hearing loss and a follow - up report extended this observation to show benefits for intellectual function. these results were so important clinically that they were accepted as the standard of care. the second randomised controlled trial gave all neonates born with symptoms of congenital cmv infection (not just cns symptoms) 6 weeks of valganciclovir at 16 mg / kg twice daily having shown in a previous study that this dose produced equivalent levels of ganciclovir to that found when ganciclovir was given intravenously at 6 mg / kg. after 6 weeks of valganciclovir, the randomised controlled trial continued this drug to complete 6 months of therapy or administered a matching placebo. the results showed that 6 months of treatment was superior to 6 weeks and so became the new standard of care. as predicted by the threshold concept, the four - times longer duration of treatment did not produce four times the clinical benefits ; in other words, the initial treatment for 6 weeks had a major effect. in the early days of experimental solid organ transplantation, an autopsy series published in the new england journal of medicine provides sobering reading, because a major limitation was the occurrence of cmv eod, particularly pneumonitis. with the recognition of this complication of excessive immunosuppression and the availability of safer immunosuppressive drugs, the subject moved forward into the life - saving routine part of medical care that we see today. in contemporary solid organ transplantation, cmv eod is controlled through the use of valganciclovir either given prophylactically or as part of pre - emptive therapy. in the former, drug is given for a fixed period of time (clinical trials support 100 days or 200 days) from the time of transplant. the drug effectively suppresses cmv eod during this time, but cases occur when the drug is stopped, some of them with strains of cmv resistant to ganciclovir, which then have to be treated with the off - label use of foscarnet. in pre - emptive therapy, patients are monitored regularly for cmv dna in the blood by real - time pcr and given ganciclovir intravenously or valganciclovir orally if a particular viral load level is detected. in our laboratory, this level is 3000 genomes / ml whole blood (2520 iu / ml) and treatment is continued until that patient has two consecutive samples where cmv dna is undetectable. similar protocols with slightly different sampling times and cut - off levels are used in the developed world. this cut - off level was derived from prospective natural history studies aiming to see if the viral load associations seen in neonates (figure 1) were also found after solid organ transplantation. in summary, all of the principles gleaned from that 1975 paper (table 2) apply to this distinct patient population as well. specifically, patients can be triaged into four groups depending on the presence of cmv igg antibodies pre - transplant in donor and recipient (figure 2). the highest incidence of cmv infection, highest peak viral load and longest duration of viraemia are seen in the d+r- subgroup (where cmv is transmitted from donor to immunologically naive recipient), d+r+ (patients with natural immunity who are at risk of reactivation of latent virus or reinfection from the donor) ; d - r+ (patients at risk of reactivation of latent virus). the last group (d - r-) have a zero risk of cmv infection except in rare cases where a donor acquires primary infection just before donating an organ. detection of cmv dna by real time pcr post - transplant is distinct among four subgroups of patients defined by their donor and recipient serostatus pre - transplant. the term indirect effects of cmv was coined by dr bob rubin in an editorial accompanying a case series of heart transplant patients. those with cmv eod had an excess of graft rejection, fungal infections and allograft atherosclerosis as a group, although there were no clinical features to identify which patients had this disease enhanced by cmv. a randomised controlled trial in renal transplant patients showed that prophylaxis with high - dose valaciclovir significantly reduced biopsy proven acute graft rejection in d+r- patients experiencing primary cmv infection, but not in those who were seropositive prior to transplant. the same principles of a high viral load being a prerequisite for eod apply here, but with two differences from solid organ transplant patients. most strains of cmv detected after bone marrow transplant come from reactivation of latent virus in the recipient, with a low risk of transferring cmv from the donor. second, bone marrow transplant patients get eod at a lower peak viral load than do solid organ transplant patients. disease is controlled by pre - emptive therapy as described above. the same viral load cut - offs can be used to decide when therapy should be started. this situation might change in the future because three new antiviral compounds (maribavir, brincidofovir, letermovir) without bone marrow toxicity are in clinical trial. all three produced encouraging results in phase ii studies in bone marrow transplant patients [2426 ]. two have so far completed phase iii studies, which included a washout period after drug administration, and both failed to reach their primary endpoints. all three drugs can suppress cmv infection, but carefully designed clinical trials will be required to show how they can produce benefits for bone marrow transplant patients. the indirect effects of cmv in this patient population are bacterial or fungal superinfection and death, each of which has been significantly reduced in randomised controlled trials of antiviral drugs. graft versus host disease has been proposed as an indirect effect, but lacks proof so far. the effect on mortality the first cases described in 1981 had cmv retinitis, which would now be termed as an aids - defining condition. active replication with cmv is uncommon until the cd4 cells count has declined below 100 cells / mm. cmv replication then becomes common and causes eod once the viral load reaches a similar value to that seen in solid organ transplant patients. in aids patients, most eod (85%) is retinitis compared to 1% after solid organ transplant ; a marked difference in natural history that remains unexplained. the best prevention of cmv eod involves maintaining the cd4 cell count above 100 cells / mm. if this is not possible, prophylaxis with oral ganciclovir (a drug no longer available) has been shown to prevent cmv retinitis, but at high cost and at the risk of developing resistance. treatment of established cmv retinitis is with intravenous ganciclovir followed by valganciclovir long - term. because levels of intraocular ganciclovir are low, an implant is available that releases the drug slowly over a period of months. this was useful in the early days of aids, but now that haart is available, cmv eod is now rare. the indirect effects of cmv in this patient population are an excess of aids - defining conditions and an excess mortality. the indirect effects were originally called cofactor effects and were controversial, perhaps because they were first described around the time that some prominent people disputed the fact that hiv causes aids. for whatever reason, the possibility of indirect effects has been ignored in advanced hiv infection relative to the other patient groups discussed here. initially, it was difficult to study cohort effects of cmv, because most hiv - positive men who have sex with men were co - infected with cmv. this problem was overcome by investigating haemophiliacs, who have a seroprevalence of about 60%, but only igg serology was available. when pcr was deployed, the association of cmv with mortality in the pre - haart era was greater than that of hiv itself. when haart was introduced, cmv and the cd4 cell count were identified as major associations with mortality, leading hiv to make a non - significant contribution once these two factors had been accounted for. clearly, hiv provides the context for increased mortality in aids patients, but cmv, in the presence of a low cd4 cell count, provides the coup de grace. the importance of cmv as a cofactor in hiv - positive individuals has recently been revisited in a large italian cohort study. results from this analysis demonstrated that patients who were cmv igg positive at baseline were significantly more likely to develop severe non - aids - defining events. in addition, cmv seropositivity was identified as an independent risk factor for both cardiovascular and cerebrovascular disease. as regards the mechanisms for this putative cofactor effect, it was speculated that cmv had an immunosuppressive effect that enhanced the pathogenicity of hiv or that one or more of six specific cellular or molecular interactions between cmv and hiv might be at play. most of these six mechanisms would be expected to increase the hiv viral load and, in summary, no evidence of this was subsequently found. meanwhile, the vague description of cmv having an immunosuppressive effect has matured into the concept of cmv - induced immunosenescence (see below) characterised by an excess of cd8 t lymphocytes searching for hidden sites of cmv replication. the abundance of these cells in hiv - positive patients has been reduced by valganciclovir in a placebo - controlled randomised trial. there is no evidence for cmv eod among the elderly, although the autopsy rate is low. several prospective studies of free - living elderly, (i.e. those not receiving institutional care), report that mortality is associated not just with the number of diseases patients have accumulated during life, but with the presence of an immune risk phenotype. originally defined as an inverted cd4/cd8 ratio, this phenotype has expanded to include detection of excessive levels of cytokines. in 1999, the excess of cd8 lymphocytes, which is key to the immune risk phenotype, was reported to be found predominately in those elderly who were cmv seropositive. in brief, it is speculated that the cd8 cells are themselves aggressively inflammatory, increasing the progression of diseases like atherosclerosis, or that the excess of cd8 cells is a marker for a shortage of cd4 cells required for mounting immune responses to new antigens. thus, elderly, frail individuals with the immune risk phenotype may have an excess mortality because they have impaired protection against influenza or pneumococcal disease despite being given the appropriate vaccines. no randomised controlled trial of drugs active against cmv has been reported in this population, but in our opinion, one should be conducted to determine if survival, independent life and quality - of - life in the elderly can be enhanced. a large population - based sample (the national health and nutrition examination survey) representative of the us population was tested for cmv igg antibodies. subjects were over 25 years of age and were followed for a mean of 14 years. the magnitude of this effect was similar to that of having a raised c - reactive protein and was independent of it. the observed difference due to cmv was attenuated by controlling for age, gender, smoking, diabetes and obesity and yet remained significant. the median reduction in life expectancy compared to a seronegative individual was about 12 months. a similar investigation was performed in a different population in the uk with confirmatory results. cytomegalovirus was originally perceived as a mild, slowly growing virus that could only cause disease in patients with immature or suppressed immune responses. when direct measures of the dynamics of primary cmv replication in blood showed these to be similar to those of primary hiv infection, this view had to be changed ; cmv was then seen as an aggressive virus that required extensive commitments from the immune system to stop it causing overt disease. the results summarised here show that the view of cmv needs to change again ; it alters the size and shape of the immune system long - term. the ability of cmv to downregulate class i hla display and interfere with recognition of infected cells by t lymphocytes and nk cells (figure 3) allows cmv to persist in sanctuary sites and yet changes the proportion of these important immune effectors. over years, these changes may contribute to inflammatory diseases, decreased immune responses to vaccination and decreased immune surveillance against nascent tumours. in this way, a common, and apparently innocuous virus may be having profound effects on the longevity of our species. cytomegalovirus deserves to be eliminated from developed countries as a prelude to tackling eradication around the globe, which is more difficult to contemplate because of the early age of acquisition of cmv in developing countries. pathway of biogenesis of class i hla molecules showing sites where cmv can interfere with their function of immune presentation of virus - encoded peptides. reprinted with kind permission from : griffiths. cytomegalovirus. in : principles and practice of clinical virology (aj zuckerman, je banatvala, bd schoub, eds). 2009 ; pp 161197 one has to consider how this phenomenon can have been missed for so long. it may be that, as in the indian proverb of blind men encountering different parts of an elephant, specialised physicians have seen only one aspect of cmv and classified it accordingly (figure 4). with this broader vision, the case is now clear for controlling cmv at the population level by universal immunisation. at present, the costs of vaccine development and evaluation are being justified financially by prevention of eod in congenital infection and in transplant recipients. based on the evidence presented here, we suggest that the gains achieved in terms of prevention of the indirect effects of cmv will greatly enhance the cost effectiveness of cmv vaccines. schematic representation of specialist physicians who are blind to holistic medicine describing the indirect effects of cmv that present in their patients.	abstractcytomegalovirus (cmv) is well - known for the end organ diseases (eods) it causes following viraemic dissemination in immunocompromised hosts. these are termed the direct effects of cmv, where a diagnosis can be made in an individual patient. in addition, cmv is associated with indirect effects where populations can be seen to be disadvantaged compared to those without cmv. these indirect effects have been described in solid organ transplants, bone marrow transplants, advanced hiv, people admitted to intensive care units, the elderly and the general population.we summarise the evidence that associates cmv with its direct effects following congenital infection, solid organ transplantation, bone marrow transplantation and advanced hiv as well as its indirect effects in all patient populations. we propose that the greatest worldwide burden of cmv comes from its indirect effects. control of this infection at the population level is being sought through the development of vaccines to control eods where cost effectiveness is expected. we propose that the financial case for universal immunisation will be enhanced even further by the potential benefits vaccines may produce against the indirect effects of cmv.
interest in the redox properties of natural products has stimulated many studies focusing on natural products that prevent the destructive effects caused by reactive oxygen species (ros) on many biomolecules (1). ros are also involved in controlling the pathogenesis of many degenerative diseases (2,3) and may activate redox sensitive transcription factors (4). as a result, the maintenance of redox homeostasis is a crucial asset for survival of stress scenarios, in the tissues of both plants (5) and animals (2).the maintenance of physiological redox homeostasis is as essential for a cell as that of osmosis or ph. during evolution, cells have developed complex interacting regulatory mechanisms that include enzymes and reducing metabolites that help to maintain the redox homeostasis (6). consequently, natural products have been and are screened for their antioxidant activity and, in this context, especially for their ros - scavenging properties. this broad interest has led to the development of various assays to determine antioxidant activity (710). the hydroxyl radical (oh) occupies an exceptional position among ros because of its extreme reactivity and oxidative potential ; it attacks even inert compound such as alkanes (11) which are normally considered to be stable under physiological conditions. one route to hydroxyl radicals is outlined by the fenton reaction (reaction 1) which is catalyzed by transition metals (e.g., fe, cr, cu, or mn). gutteridge and co - workers introduced an assay that allowed the detection of interactions of the test compounds with the formation of hydroxyl radicals by the fenton reaction (1214). this assay uses 2-deoxy - d - ribose as detection molecule, and it is utilized in phytochemistry and food chemistry to assess antioxidant properties of various compounds or extracts (10,1517). 2-deoxy - d - ribose is degraded by hydroxyl radicals that are generated in the reaction mixture by the fenton reaction. the amount of the degradation product, malonyldialdehyde (mda), can be determined photometrically after a reaction with 2-thiobarbituric acid yielding a pink pigment. benzoic or formic acids, rhodamine b and other substances were used as substrates to detect hydroxyl radical attack (18,19) ; they show, however, no special advantage compared to 2-deoxy - d - ribose. the originally described reaction mixture contains hydrogen peroxide, iron(iii) ions, ascorbic acid and 2-deoxy - d - ribose. iron is added in two forms into the reaction mixture, either as fecl3 that can be chelated by tested substances or in the form of a fe(iii)edta complex. the complex of iron with edta avoids complex formation with the tested substances, 2-deoxy - d - ribose (13) or ascorbic acid (20), but does not prevent the participation of the iron in the fenton reaction. according to gutteridge (12,13), redox active scavengers inhibit efficiently 2-deoxy - d - ribose degradation by hydroxyl radicals that were formed in the solution : the iron ions were complexed by edta. in the absence of edta, a portion of the iron ions is complexed by 2-deoxy - d - ribose. accordingly, compounds with ligand properties compete for iron ions with the 2-deoxy - d - ribose molecules and thus decrease 2-deoxy - d - ribose degradation that is caused by iron - catalyzed hydroxyl radical attack. the reactants can be dissolved only in water or inorganic buffers, because the hydroxyl radical reacts with most of the organic solvents and substances employed for buffer preparations (21). the kinetics of this iron(iii) reduction may be the decisive factor (22,23). thus, if ascorbic acid is omitted in the reaction mixture, the capability of the test compound itself to reduce iron(iii) and start the fenton reaction can be also assessed (10). the aim of this paper is to introduce additional modifications of the 2-deoxy - d - ribose degradation assay that facilitate even more detailed insights into the possible reactions of the test compound than those that are already described in the literature. the main innovations that these modifications offer are that (i) the omission of hydrogen peroxide allows determination of interactions with the autoxidation of ascorbic acid, and (ii) if ascorbic acid is also left out, the possible autoxidation of the tested substance itself may become evident. the quality of the information that may be obtained by the newly introduced modifications of the 2-deoxy - d - ribose degradation assay are exemplified by juglone and quercetin (figure 1). for comparative reasons, the chosen ph is exactly the same as of the cytoplasm (ph = 7.4). juglone (5-hydoxy-1,4-naphthoquinone) is known as a phytotoxin and redox cycler (17,24), and quercetin is a flavonoid aglycon widespread within the plant kingdom and well - known for its antioxidative and iron chelating properties (25,26). reputedly, quinones are good acceptors of electrons (27) whereas phenols are donors of electrons (28). the o - hydroxyl groups of ring b are usually the initial target of oxidants. structural features that are required for complex stability with transition metals include the 3-hydroxy-4-keto grouping in ring c, the 5-hydroxy-4-keto arrangement of rings a and c, and the o - hydroxyl groups of ring b (figure 2) (26,29). consequently, the antioxidant activities of flavonoids depend on their redox properties and chelation of transition metals juglone, hydrogen peroxide, and 2-deoxy - d - ribose (deoxyribose) were obtained from fluka (buchs, switzerland). all other chemicals and organic solvents used were of analytical grade and purchased from sigma - aldrich inc. juglone or quercetin was dissolved in an aqueous kh2po4/koh buffer solution (50 mm, ph 7.4) to yield final concentrations from 2 to 500 m ; to 125 l of this solution, 25 l of a 10.4 mm 2-deoxy - d - ribose solution in the same buffer system and 50 l of an aqueous solution of fecl3 (50 m) were added. in one series, those 50 l contained 52 m edta dissolved in buffer, which was premixed with the aqueous fecl3 solution (1:1 v / v). in the other series, the edta solution was replaced by the same volume of the buffer. in the first series, edta complexed the iron ions, preventing them from being chelated by the test compound ; in the second series, the iron ions were complexed by the test compound. to start the fenton reaction, various reactants dissolved in the above - mentioned buffer systems or in water were added : 25 l of 10.0 mm aqueous solution of h2o2 and 25 l of 1.0 mm ascorbic acid in buffer. standard 1.5 ml sample vials (la - pha - pack, werner reifferscheidt gmbh, langerwehe, germany) were used as reaction vials. thereafter, 10 l of 2.5% ethanolic butylated hydroxytoluene solution (w / v) followed by 250 l of 1.0% 2-thiobarbituric acid dissolved in 3% trichloroacetic acid (w / v) was added to each vial to detect malonyldialdehyde, the decomposition product of 2-deoxy - d - ribose caused by the attack of hydroxyl radicals. the vials were vortexed and heated in a water bath at 85 c for 30 min. the reaction was stopped by transferring the vials into an ice water bath for 3 min. to extract the reaction product of mda and thiobarbituric acid, 600 l of n - butanol was added, and the mixture was rigorously vortexed. the butanol layers of the vials, each 350 l, were pipetted into flat bottomed 96 well plates (greiner, kremsmnster, austria) and the absorbance was determined with a microplate reader (tecan infinite m200, mnnedorf, switzerland) at 532 nm. the blank contained the full reaction mixture except 2-deoxy - d - ribose (negative control). this modification was carried out without the addition of ascorbic acid, which was replaced by the same volume of the buffer. scoring was performed after 1 h. the blank contained the full reaction mixture except 2-deoxy - d - ribose (negative control). the positive control was the h2o2/fe / ascorbic acid system mixture lacking the test compound (100% mda). consequently, scoring was performed only after 16 h. the blank (negative control) contained the full reaction mixture without 2-deoxy - d - ribose (0% mda). the positive control was the h2o2/fe / ascorbic acid system mixture lacking the test compound (100% mda). this modification of the deoxyribose assay was carried out without the addition of h2o2 and ascorbic acid, which were replaced by the same volume of the buffer or water. the blank contained the full reaction mixture except 2-deoxy - d - ribose (negative control). the positive control was the h2o2/fe / ascorbic acid system mixture lacking the test compound (100% mda). for all systems, possible interferences of tested compounds with the mda detection procedure in the assay systems were checked before the experiments (8). rockville, md) was used to perform analyses of variance (anova) with duncan s multiple range tests at a confidence level of 95%. all reactions that are presented in the ongoing text are hypotheses that aim to explain the results which were obtained from the deoxyribose degradation assay. these reactions the fenton reaction generates hydroxyl radicals after reduction of iron(iii) by ascorbic acid (21). juglone and quercetin proved to be strong inhibitors of 2-deoxy - d - ribose degradation in both variants of this experiment, with and without addition of edta (figure 3a, b). additionally, juglone showed a very weak pro - oxidative effect in the concentration 500 m in the variant without edta (figure 3a). several interactions are possible : (i) the hydroxyl group can reduce hydroxyl radical to water by an one electron transfer (figure 4) ; (ii) the quinone part can oxidize hydrogen peroxide to molecular oxygen and/or ascorbic acid to dehydroascorbic acid by two electron transfers (figure 4) ; (iii) juglone may be reduced to trihydroxynaphthalene by two electron transfers, a further reducing agent that scavenges any ros by either one or two electron transfers (figures 4 and 5). the absence of hydrogen peroxide and ascorbic acid prevented the initialization of fenton reaction in both variants (with and without edta) when the scoring was performed within one hour. juglone showed pronounced antioxidative effects by decreasing the deoxyribose degradation in both systems, either with or without addition of edta. in the latter system, however, in 500 m, juglone again increased the concentration of mda compared to the concentration of 250 m. the following chemistry is possible : in the concentrations 2250 m juglone removes the iron ions from the competive ligand 2-d - deoxyribose and concomitantly scavenges arising ros. juglone is a 5-hydroxy-1,4-naphthoquinone, and the 5-hydroxy-4-carbonyl moiety of the juglone molecule complexes iron ions (figure 2) (29). most flavonoids show the same combination of functional groups that are well - known for chelation of transition metals (30). activities of juglone and quercetin in various systems of the deoxyribose degradation assay, quantified in % malonyldialdehyde, an oxidative decomposition product of 2-deoxy - d - ribose ; bars are means ; error bars, standard deviation ; n = 3, letters indicate different levels of significance (95% probability, duncan s multiple range test). selected possible one electron and two electron redox reactions of phenolic and quinone groups of juglone. aa, ascorbic acid ; daa, dehydroascorbic acid. selected possible one electron redox reactions of quinone and semiquinone groups of juglone. the weak pro - oxidative effect observed (figure 3a) in the concentration 500 m in the variant without addition of edta most probably is caused by the different redox properties of ironjuglone complex. the reduction of iron(iii) in the ironjuglone complex might proceed more easily compared to the complex of fe(iii)edta if trihydroxynaphthalene or higher concentrations of juglone are present (figure 6). this interpretation offers a possible explanation for the different behavior of juglone in the two variants of the assay at the highest concentration tested, 500 m. low solubility of higher concentrations than that precluded the testing of higher dosages of juglone. possible one electron and two electrons reactions of juglone are shown in figures 4 and 5. reduction of the iron(iii)juglone complex by trihydroxynaphthalene or juglone. quercetin is well - known as an efficient reducing agent and chelator of transition metals (31). both characteristics are visible in the results of the assay : the decrease of the relative mda concentrations depends on the quercetin concentrations in both variants of the assay (figure 3b) (12,13). quercetin can reduce not only the highly reactive hydroxyl radical but also the more stable hydrogen peroxide to water (figures 7 and 8). scavenging of free radicals and chelation of iron both contribute to the antioxidant activity of flavonoids. this assay suggests that the redox properties of quercetin are more responsible for the observed antioxidative effect than the chelation of iron. the protection of deoxyribose against attack by hydroxyl radicals was more efficient in the variant with edta added (figure 3b). oxidation products of quercetin, such as phenolic acids, their esters and other derivatives (32) with similar antioxidant and/or chelation properties, however, could also participate in the previously outlined reactions. this assay system explores if the tested compound can substitute for the function of ascorbic acid and start the fenton reaction by reduction of iron(iii) (10). hydrogen peroxide may also reduce iron(iii) ions (reaction 3) and initiate the fenton reaction superoxide anion radicals (o2) undergo spontaneous dismutation to hydrogen peroxide (reaction 4). the speed of this reaction may be increased by phenolic complexes of the metals that function as catalysts (33). juglone demonstrated negligible antioxidant activity in the variant of the assay without addition of edta, especially in the concentrations 500 and 250 m (figure 3c). in the variant with addition of edta, the concentration of 250 m indicates the emergence of a weak pro - oxidative effect. quercetin definitely had no effects in either variant of this assay (figure 3d). in summary, the obtained results suggest that neither juglone nor quercetin can promote the 2-deoxy - d - ribose degradation in the presence of hydrogen peroxide. here, ascorbic acid undergoes autoxidation in the presence of transition metals and, as a result, produces ros (reactions 7 and 8) (20,34), but compared to the previously described systems the speed of the whole process is slower because it depends on the diffusion rate of atmospheric oxygen into the reaction liquid. the time point for scoring thus was extended to 16 h. if the iron ions form a complex with ascorbic acid this is the case if no edta is added the reduction of iron ions and molecular oxygen increases (0 concentrations in figure 3e, f), and, thus, more ros are formed that may enter the haberweiss and fenton reactions. by contrast, buettner reported the opposite phenomenon (20) : the iron(iii)edta complex increased the speed of the ascorbic acid autoxidation reaction. it is important to pay attention to the fact that buettner studied the decrease of ascorbic acid, not that of 2-deoxy - d - ribose. 2-deoxy - d - ribose most probably competes with ascorbic acid as ligand for iron. this affects the portion of the iron ions that are complexed by the 2-deoxy - d - ribose molecules (12). if this is the case, then the possibility that formed hydroxyl radicals directly attack 2-deoxy - d - ribose increases (13). juglone boosted the pro - oxidative effect of ascorbic acid in both variants of the assay. the amplification of the activity was stronger in the variant without addition of edta (figure 3e). the effect increased in concentrations 63125 m and slightly decreased in concentrations from 250 to 500 m. the redox properties of the ironjuglone complex and the reduction activity of the hydroxyl group of juglone and the potentially formed trihydroxynaphthalene contribute most probably to the pro - oxidative effect that is evident in this system of the assay. trihydroxynaphthalene may arise following reduction by ascorbic acid, superoxide anion radical or hydrogen peroxide. juglone and its reduced derivative, trihydroxynaphthalene, participate in the redox cycling of iron(iii)/iron(ii) besides of ascorbic acid (figures 4 and 5). this effect was visible in both of the variants with and without addition of edta. these results suggest that the most important contribution was the more easy reduction of the ironjuglone complex compared to that of the feedta complex. this effect, however, is not fully visible in the above - mentioned systems because of the presence of hydrogen peroxide that may undergo similar reactions from the start of the assay. in this system, hydrogen peroxide is generated by concomitant activities of juglone, ascorbic acid and iron ions. by contrast, this is not the case in the classic system of the 2-deoxy - d - ribose degradation assay. there exists, however, an assay system that uses phospholipid liposomes for detection of hydroxyl radicals (34,35) ; it uses a similar setup as in this modified system of the 2-deoxy - d - ribose degradation assay. in the variant without addition of edta, the potential shift in the redox properties may cause the strong pro - oxidative effects observed in the 63 and 125 m concentrations where iron might be better available for fenton reaction. the decrease of the pro - oxidative effect in the higher concentrations may be caused by changing concentrations of reactants and reaction products. quercetin inhibited the pro - oxidative activity of ascorbic acid more or less acting as an antioxidant. in contrast to juglone, this effect was more apparent in the variant without addition of edta (figure 3f). it is possible that both mechanisms, scavenging of ros and chelation of iron ions, contributed to the observed effect. the results from the variant without addition of edta indicate that the contribution of complexation of iron ions may be higher ; ironquercetin complexes decrease the activity of iron ions in the fenton reaction as their reduction seems to be more difficult (36). further studies are required to explore if quercetin protects the iron ions against reduction by ascorbic acid by acting as more efficient competitor in their chelation. the coupling reactions between semiquinones and monodehydroascorbic acid also may influence the activities of both juglone and quercetin (37). the principle is similar to the system where ascorbic acid generates ros, but here the test compound replaces ascorbic acid (reactions 911).alternatively, the following reaction is also possible : iron(ii) ions can reduce molecular oxygen into superoxide anion radicals (reaction 8). complex formation between the tested substance and iron ions plays a key role ; in the various complexes, iron ions possess variable redox properties that affect their participation in oxidation or reduction reactions (reactions 12 and 13). similar to the last system described, scoring was performed after 16 h because the system also depends on the diffusion of molecular oxygen from the air into the reaction mixture. juglone showed notable pro - oxidant activity that was more pronounced in the variant without edta addition. the efficient concentrations were 63500 m for the variant without edta addition and 125500 m for variant with edta addition. the results suggest that juglone reduced iron(iii) to iron(ii) ions, either directly by its hydroxyl group or indirectly by superoxide anion radicals that were formed by reduction of molecular oxygen (figures 4 and 5). the reduction of molecular oxygen to the superoxide anion radical and its subsequent dismutation generates hydrogen peroxide which initiates the fenton reaction (figure 4). the reduction activity of juglone explains the pro - oxidative effect in both variants of this assay system. the higher pro - oxidative effect in the variant without addition of edta suggests that iron ions are more easily reduced in the complex with juglone than in the complex with edta. the pro - oxidative effect of quercetin was more evident in the variant with addition of edta than in the variant without addition of edta (figure 3h). in the variant without addition of edta, the pro - oxidative effect was only apparent in the lower concentrations (463 m). the results suggest that quercetin affects the degradation of 2-deoxy - d - ribose in this system assay by chelation of iron ions and strong redox properties. in the variant without the addition of edta, iron was chelated by quercetin and this prevented the reduction of iron(iii) to iron(ii). in the variant with addition of edta quercetin may also interact with molecular oxygen by transfer of either one or two electrons (figures 7 and 8) ; this generates hydrogen peroxide. it is suggested that hydrogen peroxide may arise mainly through the superoxide anion radical intermediate (28,38). reduction of molecular oxygen and iron(iii) started the fenton reaction in the variant without the addition of edta. all modified systems of the 2-deoxy - d - ribose degradation assay demonstrated that the chosen test compounds, juglone and quercetin, enter complex redox reactions depending on the presence and absence of other components in the assay system. in the author s view, this set of assays provides easy and cost - effective characterization of the potential pro- and antioxidative effects of the test compound in changing milieus, a highly critical issue in the characterization of the redox chemistry of a test compound. electron transfer reactions determined by fenton chemistry are highly milieu - dependent and this especially merits attention in the classification of antioxidative properties of tested compounds or compound mixtures. edta, ethylenediaminetetraacetic acid ; feedta, chelate of edta with iron ions ; mda, malonyldialdehyde ; ros, reactive oxygen species.	interest in the redox properties of natural products has led to the development of various assays for the detection of antioxidant activities and ros - scavenging properties. here, additional modifications of the 2-deoxy - d - ribose degradation assay are introduced that specifically allow the determination of interactions of the test compound with the autoxidation of ascorbic acid and the autoxidation of the test compound itself. to illustrate this, juglone and quercetin were used as examples. the modified assay systems provide insights into their specific antioxidative and pro - oxidative properties. in additional, an extensive characterization of the redox properties of their complex with iron is possible, if iron ions are added in the free form or complexed with edta. the jugloneiron complex proved to be pro - oxidative in a wider range of milieus than the quercetiniron complex.
arrhythmogenic right ventricular cardiomyopathy/ dysplasia (arvc / d) is a myocardial disease in which myocardium of the right ventricular free wall is partially or almost entirely replaced by fatty or fibro - fatty tissue (13). the anterior right ventricular outflow tract, the apex, and the inferior - posterior wall the so - called triangle of dysplasia are primarily involved (4). the degenerative process may be segmental or diffuse ; on post mortem examination degeneration results to affect the left ventricle in about 50% of cases and to involve the septum only in 20% (3). clinical manifestations of the disease mostly occur between the second and fourth decade of life ; they include structural and functional abnormalities of the right ventricle, electrocardiographic depolarization / repolarization changes and arrhythmias of right ventricular origin (5). ventricular tachycardias are thought to be due to re - entry between the abnormal and normal areas of the right ventricular myocardium. arvc is a progressive heart muscle disease with different clinico - pathological patterns : a) silent cardiomyopathic abnormalities localized to the right ventricle in asymptomatic victims of sudden death ; b) overt disease characterized by segmental or global right ventricular structural changes, often associated with histological evidence of left ventricular involvement and underlying symptomatic ventricular arrhythmias ; c) end - stage biventricular cardiomyopathy mimicking dilated cardiomyopathy, which leads to progressive heart failure and may require heart transplantation (6). a scoring system to establish diagnosis of arvc has been developed on the basis of the presence of major and minor criteria encompassing structural, histological, electrocardiographic, arrhythmic and genetic features of the disease (7). drug treatment is warranted in patients with palpitations, syncope or documented sustained ventricular arrhythmias. clinical investigation aims at identifying subjects at risk of complications in order to provide them proper treatment. ten years ago, we estimated that prevalence rate of arvc in the veneto region of italy might be about 1:1500 (8) ; however prevalence could be higher, because of many non - diagnosed or misdiagnosed cases. it was reported that in italy, between 12.5 and 25% of sudden death events in young non - athletes and young athletes under the age of 35 years were caused by undiagnosed arvc (9). two international registries, in europe and usa, are presently on the way, aiming at determining clinical, pathological and genetic features of arvc, at validating diagnostic criteria and at defining strategies for disease management and sudden death prevention (1012). familial occurrence is common, and in 50% of cases evidence has been found for autosomal dominant inheritance with variable penetrance (13). recessive forms are also described, although in association with cutaneous disorders (14). since the identification of the first arvc locus in 1994 (8), ten loci were detected, but only five disease genes have been identified so far (1519). the first arvc gene was identified in a rare syndrome, characterized by arrhythmogenic right ventricular cardiomyopathy associated with palmoplantar keratoderma and peculiar woolly hairs, inherited as autosomal recessive trait. naxos syndrome, because of a peculiar concentration of cases in the greek island of naxos. clinical features of the disease were first described by protonotarios in 1986 (14) ; ten years later, the syndrome was recognized as a distinct human disease and as a variant of arvd (omim 601214). the pattern of disease stereotyped in all cases. at birth woolly hair is present. at that time or shortly after, palmar erythema occurs, and when the infants start to use their hands keratoderma develops. later, when they start to ambulate, plantar erythema occurs, followed by keratoderma and producing the typical pattern. the symptomatic presentation is usually with syncope and/or sustained ventricular tachycardia during adolescence with a peak in young adulthood (20). the presence of a visible defect in epidermal cells suggested that cardiac defect could be closely linked to a locus to which keratin genes were mapped. indeed, dna markers of the chromosomal region 17 did show positive linkage with the disease (21). shortly later, mutation screening of plakoglobin gene, closely linked to keratin genes, succeeded in detecting in naxos patients a two - nucleotide deletion (pk2157del2tg) producing a frameshift which alters five amino acids and produces a stop codon (15). a genotype - phenotype correlation study, performed on 26 subjects, showed that the recessive trait is fully penetrant by adolescence (20). a minority of heterozygous carriers presented few phenotypic features consisting of woolly hair and minor electrocardiographic / echocardiographic changes, not fulfilling the criteria for arvd. it is involved in tight adhesions of many cell types, cardiomyocytes included and is thought to serve as a linker molecule between the inner and outer portions of the desmosomal plaque by binding tightly to the cytoplasmatic domain of cadherins. the adhesive function of plakoglobin is mediated through its interaction with other desmosomal and cytosolic proteins ; highly conserved armadillo repeats, which form the central domain of plakoglobin, facilitate the association between plakoglobin and these molecules (22, 23). plakoglobin has also been shown to directly signal structural changes in adherens junctions to the nucleus (24, 25). normal functioning of cell - cell junctions is of utmost importance in myocardium and skin particularly of palms and soles, tissues that experience constant mechanical stress. defects in linking sites of plakoglobin might disturb the contiguous cell - cell adhesion and tissue integrity in skin and heart particularly when increased mechanical stress is applied on the tissue. this mechanism has been fostered in plakoglobin - null mice myocardium presenting decreased compliance and ventricular rupture under increased mechanical stress (26). alcalai identified a missense mutation in the c - terminal of desmoplakin in one arabic family with recessive arvc, woolly hair and a pemphigous - like skin disorders (27). desmoplakin, together with plakoglobin, is a constituent of the desmosomal plaque, anchoring intermediate filaments to the plasma membrane and forming a scaffold that is essential for maintaining tissue integrity. interestingly, in two additional arabic families, clinically affected with naxos disease, mutations in genes encoding plakoglobin, desmoplakin, plakophilin 1, 2, and 4, types i and ii keratin, desmoyokin and desmocollins / desmogleins have been excluded, thus suggesting additional genetic heterogeneity in this cardiocutaneous syndrome (28). the first arvc gene identified in a dominant form was cardiac ryanodine receptor involved in arvd2 (16). arvd2 shows fibro - fatty substitution of the myocardial tissue, though much less pronounced than in the typical arvcs. however, the distinctive feature of this form is the presence of polymorphic, effort - induced arrhythmias. after restriction of the critical region on chromosome 1q42-q43 and the unsuccessful mutation screening of different genes mapped to the critical interval, causative mutations were finally detected in the gene encoding the monomer of the cardiac ryanodine receptor (ryr2) (16). hryr2 is one of the largest human genes (105 exons) ; it encodes a 565kda protein. the homo - tetrameric structure known as cardiac ryanodine receptor plays a pivotal role in intracellular calcium homeostasis and excitation - contraction coupling in cardiomyocytes. stimulation of voltage - sensitive l - type calcium channels (dihydropyridine receptors) on the outer myocardial cell membrane allows the entry of small amounts of calcium ions, which in turn activate release of larger amounts of calcium from the sarcoplasmic reticulum lumen into the cytoplasm via ryr2. thus, ryr2 channels serve to couple the excitation of myocardial cells to their actin / myosin contractile apparatus by a mechanism involving a calcium - induced calcium release (29, 30). all ryr2 missense mutations detected in arvd2 patients resulted in substitution involving amino acids highly conserved through evolution in domains of the protein which are critical for the regulation of the calcium channel (31). up to present, mutations in the human ryr2 gene have been associated with three inherited cardiac diseases : arrhythmogenic right ventricular cardiomyopathy type 2 (arvd2 ; omim 600996) (16, 32), catecholaminergic polymorphic ventricular tachycardia (cpvt ; omim 604772) (33, 34) and familial polymorphic ventricular tachycardia (fpvt) ; omim 604772) (35, 36). all these diseases are characterized by effort - induced polymorphic ventricular arrhythmias and a risk of sudden death. moreover, putative pathogenic mutations in ryr2 have been reported in 20 of 240 patients with long - qt syndrome (37). all ryr2 mutations described to date show clustering in three specific domains : the n - terminal amino - acid residues 176433, the centrally located residues 22462504, and the c - terminal residues 37784959. the finding of ryr2 mutations in both arvd2 and cpvt patients raised the question of the possible existence of a single genetic defect whose different phenotypes might be simply due to variable expression and incomplete penetrance. interestingly, a 17 year - old boy, who died suddenly and at postmortem showed fibrofatty replacement in the right ventricular free wall consistent with arvc, resulted as carrying a missense ryr2 mutation (a77v) (38). his mother and sister, carrying the same ryr2 mutation, showed effort - induced polymorphic ventricular tachycardia in the setting of normal echocardiogram consistent with cpvt. the observation of both arvd2 and cpvt in the same family suggests that the two entities might correspond to different degrees of phenotypic expression of the same disease. both the arvd2- and cpvt - ryr2 missense mutations (16, 33) would alter the ability of the calcium channel to remain closed and thus, intense adrenergic stimulation due to emotional or physical stress would lead to calcium overload, thus triggering severe arrhythmias. leaky ryr channels might release sr ca during the resting phase of the cardiac cycle (diastole), resulting in membrane depolarizations that occur after repolarization of the previous action potential (delayed after - depolarizations, dads) (39). in support of this hypothesis it has recently been reported that dads are known to trigger premature ventricular contractions which can initiate fatal cardiac arrhythmias (40). beta - blockers therapy proved to be effective in preventing fatal arrhythmias in several arvd2 and cpvt patients (16,33). this may be explained by the fact that the rapid enhancement of cardiac output during exercise or sudden stress is based on the -ar cascade (41). therefore, blockage of -ar signaling would result in improved cardiac contractility, as shown in human heart failure (42). the common finding, both in cpvt- and arvd2-associated mutations (43 46) is an increased ca release after stimulation. functional role of mutations r176q, l433p, n2386i and t2504 m, previously detected in arvd2 patients and reported by tiso 2001, was recently investigated (46). ryr2 mutants n2386i and r176q / t2504 m exhibited enhanced sensitivity to caffeine activation and increased ca release, in agreement with the current hypothesis that defective ryr2 cause ca leak. on the contrary, the first disease gene linked to autosomal dominant arvc showing the typical right ventricular phenotype was desmoplakin (17). dna sequencing of all dsp exons in the index case of the investigated family revealed a missense mutation in exon 7 (c1176 g ; agcagg). the residue ser299arg mutated in patients is at the center of a coiled, charged region, separating the two short helices of dsp sub - domain z. it suppresses a putative phosphorylation site which is fully conserved in related proteins belonging to the same family, thus supporting the hypothesis that the amino acid change might cause a functional alteration. this mutation is thought to disrupt a protein kinase c (pkc) phosphorylation site which is involved in plakoglobin binding and in clustering of desmosomal cadherin - plakoglobin complexes. desmoplakin, together with plakoglobin, anchors to desmosomal cadherins, forming an ordered array of non - transmembrane proteins, which then bind to keratin intermediate filaments (if) (47). the primary structure of desmoplakin contains three functional domains : the n - terminal, which binds to the desmosome via connection with plakoglobin and plakophilin ; the rod segment, which is predicted to form a dimeric coil ; and the c - terminal domain, which binds if s (48). the cdnas encoding these two highly related proteins differ in a 1.8 kbase sequence that is missing in dspii, most likely due to differential splicing of a longer transcript (49). actually, mutations in desmoplakin gene have been shown to underlie some cases of an autosomal dominant skin disorder (striate palmoplantar keratoderma) without cardiac involvement (5052), a dominant form of arvc without skin disease, an autosomal recessive condition characterized by dilated cardiomyopathy, woolly hair and keratoderma, named carvajal syndrome (53), an autosomal recessive condition characterized by arvc, woolly hair and keratoderma (27) and a left - sided arvc named arrhythmogenic left ventricular cardiomyopathy (alvc) (54) (tab. table i- known desmoplakin mutations and associated diseasediseaseinheritancenucleotide change(s)amino acid change(s)referencesstriate subtype of palmoplantar keratodermadominatc1323tq331xamstrong, 1999striate palmoplantar keratodermadominant939 + 1g > amutant splice productwhittock, 1999dilated cardiomyopathy, woolly hair and keratodermarecessive7901delgframeshift leading to a premature stop codon and truncated proteinnorgett, 2000skin fragility and woolly hair syndromecompound heterozygosity861t > g and 2427 t > an287k and c809xwhittock, 2002skin fragility and woolly hair syndromecompound heterozygosity1990c > t and 7096c > tq664x and r2366gwhittock, 2002arvcdominantc1176gs299rrampazzo, 2002arvc, skin disorder and woolly hairrecessiveg7402cg2375ralcalai, 2003arrhythmogenic left ventricular cardiomyopathy (alvc)dominant2034insaframeshift leading to a premature stop codon and truncated proteinnormann, 2005 in 2004, gerull directly sequenced all 14 exons of the pkp2 gene, including flanking intronic splice sequences. these authors identified 25 different heterozygous mutations (12 insertion - deletion, 6 nonsense, 4 missense and 3 splice site mutations) in 32 over 120 unrelated arvc probands (18). plakophilin-2 gene was selected as candidate gene on the basis of the finding of a lethal defect in cardiac morphogenesis at embryonic day 10.75 in mice homozygous with respect to a deletion mutation of pkp2. the resulting mutant mice exhibit lethal alterations in heart morphogenesis characterized by reduced trabeculation, disarrayed cytoskeleton, ruptures of cardiac walls, and blood leakage into the pericardiac cavity. in the absence of plakophilin-2, the cytoskeletal linker protein desmoplakin dissociates from the plaques of the adhering junctions that connect the cardiomyocytes and forms granular aggregates in the cytoplasm (55). plakophilin-2 is an armadillo - related protein, located in the outer dense plaque of desmosomes. plakophilins are also present in the nucleus, where they may play a role in transcriptional regulation (56). gerull speculated that lack of plakophilin-2 or incorporation of mutant plakophilin-2 in the cardiac desmosomes might impair cell - cell contacts and, as a consequence, might disrupt association between adjacent cardiomyocytes, particularly in response to mechanical stress or stretch (thus providing a potential explanation for the high prevalence of the disorder in athletes, the frequent occurrence of ventricular tachyarrhythmias and sudden death during exercise, and the predominant affection of the right ventricle). the potential cellular mechanism for the initiation of ventricular tachyarrhythmias in arvc could be the intrinsic variation in conduction properties as a result of the patchy areas of fibro - fatty cardiomyocyte degeneration. desmosomes are important cell - cell adhesion junctions which are predominantly found in the epidermis and heart and which couple cytoskeletal elements to the plasma membrane at cell - cell or cell - substrate adhesions. whereas adherens junctions associate with microfilaments at cell - cell interfaces, desmosomes are tailored to anchor stress - bearing intermediate filaments at sites of strong intercellular adhesion. the resulting scaffold plays a key role in providing mechanical integrity to tissues such as epidermis and heart which experience mechanical stress. desmosomes include proteins from at least three distinct gene families : cadherins, armadillo proteins and plakins. desmosomal cadherins include desmogleins and desmocollins ; members of both subfamilies are single - pass transmembrane glycoproteins, mediating ca - dependent cell - cell adhesion. the plakin family proteins include desmoplakin, plectin and the cell envelope proteins envoplakin and periplakin. since the desmoplakin involved in arvd8, plakophilin involved in arvd9 and plakoglobin involved in naxos syndrome encodes desmosomal proteins, different defects in proteins of desmosomal complex lead to arvc. more recently, our group succeeded in identifying the gene involved in arvd1. in one family fulfilling diagnostic criteria for arvc, significant linkage to arvd1 the critical interval for arvd1, still very large, contains 40 known genes ; five of them (pomt2, kiaa0759, kiaa1036, c14orf4 and tail1) were unsuccessfully screened for pathogenic arvc mutations (57, 58). among genes mapped to arvd1 critical region and expressed in myocardium, transforming growth factor - beta3 (tgf3) appeared a very good candidate, as it encodes a cytokine stimulating fibrosis and modulating cell adhesion (59). after previous analyses failed to detect any mutation in the coding region of this gene, mutation screening was extended to the promoter and untranslated regions (utrs). a nucleotide substitution (c.-36g > a) in 5utr of tgf3 gene was detected in all affected subjects belonging to a large arvd1 family. after the investigation was extended to 30 unrelated arvc index patients, an additional mutation (c.1723c > t) was identified in the 3 utr of one proband. in vitro expression assays of constructs containing the mutations showed that mutated utrs were twofold more active than wild - types (19). the tgf- superfamily consist of a diverse range of proteins that regulate many different physiological processes, including embryonic development, homeostasis, wound healing, chemotaxis, and cell cycle control. cytokines of the tgf- superfamily are dimeric proteins with conserved structures and have pleiotropic functions in vitro and in vivo (60). tgf-1, -2, -3 are the prototypes of the tgf- superfamily ; they inhibit proliferation in most types of cells and induce the apoptosis of ephitelial cells. conversely, tgf-1, -2, -3 stimulate mesenchymal cells to proliferate and produce extracellular matrix and induce a fibrotic response in various tissue in vivo. thus, the tgf- superfamily regulates wide - ranging and diverse roles in development, differentiation, and homeostasis (60). finding tgf3 mutations associated with arvc is very interesting, as it is well established that tgfs stimulate mesenchymal cells to proliferate and to produce extracellular matrix components. it may be hypothesized that the reported mutations in utrs of tgf3 gene, which in vitro enhance expression, could promote myocardial fibrosis. extensive myocardial fibrosis may disrupt electrical and mechanical behavior of the myocardium and extracellular matrix abnormalities may predispose to re - entrant ventricular arrhythmias (61). in fact, endomyocardial biopsy in the two probands shows extensive replacement - type fibrosis, in agreement with this hypothesis. it has been shown that tgfs modulate expression of genes encoding desmosomal proteins in different cell types. cdna microarray analysis performed on rna from cardiac fibroblasts incubated in the presence or in the absence of exogenous tgfs revealed increased expression of different genes, including plakoglobin (62). yoshida reported that tgf1 exposure of cultured airway epithelial cells increases the content of desmoplakins i and ii ; this suggests that regulation of cell - cell junctional complexes may be an important effect due to tgfs (63). therefore, overexpression of tgf3, caused by utrs mutations, might affect as well cell - to - cell junction stability, thus leading to a final outcome similar to that observed in arvd8 (17) and in the arvc - related naxos syndrome (15). known arvd genes and causative mutations identified so far are reported in table ii. table ii - known arvd genes and causative mutations identified so fararvdgenemutationsreferencesarvd1tgf32 regulatory mutations (in 5 e 3 utrs) among 33 probandsbeffagna, 2005arvd2ryr26 mutations (missense) in affectedsubjects belonging to 6 familiestiso, 2001 ; bauce, 2002 ; damati, 2005arvd8dsp4 mutations (3 missense and 1 splice site) in affected subjects belonging to 4 large familiesrampazzo, 2002 ; bauce, 2005arvd9pkp225 mutations (missense, nonsense, insertion / deletion and splicing site) in 32 unrelated patients among 120 probandsgerull, 2004naxosjup1 mutation (2bp - deletion) in affected patients belonging to a large familymckoy, 2000 the first arvc gene was identified in a rare syndrome, characterized by arrhythmogenic right ventricular cardiomyopathy associated with palmoplantar keratoderma and peculiar woolly hairs, inherited as autosomal recessive trait. naxos syndrome, because of a peculiar concentration of cases in the greek island of naxos. clinical features of the disease were first described by protonotarios in 1986 (14) ; ten years later, the syndrome was recognized as a distinct human disease and as a variant of arvd (omim 601214). the pattern of disease stereotyped in all cases. at birth woolly hair is present. at that time or shortly after, palmar erythema occurs, and when the infants start to use their hands keratoderma develops. later, when they start to ambulate, plantar erythema occurs, followed by keratoderma and producing the typical pattern. cardiac abnormality presents later. all patients present electrocardiographic and/ or echocardiographic abnormalities fulfilling criteria of arvc. the symptomatic presentation is usually with syncope and/or sustained ventricular tachycardia during adolescence with a peak in young adulthood (20). the presence of a visible defect in epidermal cells suggested that cardiac defect could be closely linked to a locus to which keratin genes were mapped. indeed, dna markers of the chromosomal region 17 did show positive linkage with the disease (21). shortly later, mutation screening of plakoglobin gene, closely linked to keratin genes, succeeded in detecting in naxos patients a two - nucleotide deletion (pk2157del2tg) producing a frameshift which alters five amino acids and produces a stop codon (15). a genotype - phenotype correlation study, performed on 26 subjects, showed that the recessive trait is fully penetrant by adolescence (20). a minority of heterozygous carriers presented few phenotypic features consisting of woolly hair and minor electrocardiographic / echocardiographic changes, not fulfilling the criteria for arvd. it is involved in tight adhesions of many cell types, cardiomyocytes included and is thought to serve as a linker molecule between the inner and outer portions of the desmosomal plaque by binding tightly to the cytoplasmatic domain of cadherins. the adhesive function of plakoglobin is mediated through its interaction with other desmosomal and cytosolic proteins ; highly conserved armadillo repeats, which form the central domain of plakoglobin, facilitate the association between plakoglobin and these molecules (22, 23). plakoglobin has also been shown to directly signal structural changes in adherens junctions to the nucleus (24, 25). normal functioning of cell - cell junctions is of utmost importance in myocardium and skin particularly of palms and soles, tissues that experience constant mechanical stress. defects in linking sites of plakoglobin might disturb the contiguous cell - cell adhesion and tissue integrity in skin and heart particularly when increased mechanical stress is applied on the tissue. this mechanism has been fostered in plakoglobin - null mice myocardium presenting decreased compliance and ventricular rupture under increased mechanical stress (26). more recently, alcalai identified a missense mutation in the c - terminal of desmoplakin in one arabic family with recessive arvc, woolly hair and a pemphigous - like skin disorders (27). desmoplakin, together with plakoglobin, is a constituent of the desmosomal plaque, anchoring intermediate filaments to the plasma membrane and forming a scaffold that is essential for maintaining tissue integrity. interestingly, in two additional arabic families, clinically affected with naxos disease, mutations in genes encoding plakoglobin, desmoplakin, plakophilin 1, 2, and 4, types i and ii keratin, desmoyokin and desmocollins / desmogleins have been excluded, thus suggesting additional genetic heterogeneity in this cardiocutaneous syndrome (28). the first arvc gene identified in a dominant form was cardiac ryanodine receptor involved in arvd2 (16). arvd2 shows fibro - fatty substitution of the myocardial tissue, though much less pronounced than in the typical arvcs. however, the distinctive feature of this form is the presence of polymorphic, effort - induced arrhythmias. after restriction of the critical region on chromosome 1q42-q43 and the unsuccessful mutation screening of different genes mapped to the critical interval, causative mutations were finally detected in the gene encoding the monomer of the cardiac ryanodine receptor (ryr2) (16). hryr2 is one of the largest human genes (105 exons) ; it encodes a 565kda protein. the homo - tetrameric structure known as cardiac ryanodine receptor plays a pivotal role in intracellular calcium homeostasis and excitation - contraction coupling in cardiomyocytes. stimulation of voltage - sensitive l - type calcium channels (dihydropyridine receptors) on the outer myocardial cell membrane allows the entry of small amounts of calcium ions, which in turn activate release of larger amounts of calcium from the sarcoplasmic reticulum lumen into the cytoplasm via ryr2. thus, ryr2 channels serve to couple the excitation of myocardial cells to their actin / myosin contractile apparatus by a mechanism involving a calcium - induced calcium release (29, 30). all ryr2 missense mutations detected in arvd2 patients resulted in substitution involving amino acids highly conserved through evolution in domains of the protein which are critical for the regulation of the calcium channel (31). up to present, mutations in the human ryr2 gene have been associated with three inherited cardiac diseases : arrhythmogenic right ventricular cardiomyopathy type 2 (arvd2 ; omim 600996) (16, 32), catecholaminergic polymorphic ventricular tachycardia (cpvt ; omim 604772) (33, 34) and familial polymorphic ventricular tachycardia (fpvt) ; omim 604772) (35, 36). all these diseases are characterized by effort - induced polymorphic ventricular arrhythmias and a risk of sudden death. moreover, putative pathogenic mutations in ryr2 have been reported in 20 of 240 patients with long - qt syndrome (37). all ryr2 mutations described to date show clustering in three specific domains : the n - terminal amino - acid residues 176433, the centrally located residues 22462504, and the c - terminal residues 37784959. the finding of ryr2 mutations in both arvd2 and cpvt patients raised the question of the possible existence of a single genetic defect whose different phenotypes might be simply due to variable expression and incomplete penetrance. interestingly, a 17 year - old boy, who died suddenly and at postmortem showed fibrofatty replacement in the right ventricular free wall consistent with arvc, resulted as carrying a missense ryr2 mutation (a77v) (38). his mother and sister, carrying the same ryr2 mutation, showed effort - induced polymorphic ventricular tachycardia in the setting of normal echocardiogram consistent with cpvt. the observation of both arvd2 and cpvt in the same family suggests that the two entities might correspond to different degrees of phenotypic expression of the same disease. both the arvd2- and cpvt - ryr2 missense mutations (16, 33) would alter the ability of the calcium channel to remain closed and thus, intense adrenergic stimulation due to emotional or physical stress would lead to calcium overload, thus triggering severe arrhythmias. leaky ryr channels might release sr ca during the resting phase of the cardiac cycle (diastole), resulting in membrane depolarizations that occur after repolarization of the previous action potential (delayed after - depolarizations, dads) (39). in support of this hypothesis it has recently been reported that dads are known to trigger premature ventricular contractions which can initiate fatal cardiac arrhythmias (40). beta - blockers therapy proved to be effective in preventing fatal arrhythmias in several arvd2 and cpvt patients (16,33). this may be explained by the fact that the rapid enhancement of cardiac output during exercise or sudden stress is based on the -ar cascade (41). therefore, blockage of -ar signaling would result in improved cardiac contractility, as shown in human heart failure (42). finding, both in cpvt- and arvd2-associated mutations (43 46) is an increased ca release after stimulation. t2504 m, previously detected in arvd2 patients and reported by tiso 2001, was recently investigated (46). / t2504 m exhibited enhanced sensitivity to caffeine activation and increased ca release, in agreement with the current hypothesis that defective ryr2 cause ca leak. the first disease gene linked to autosomal dominant arvc showing the typical right ventricular phenotype was desmoplakin (17). dna sequencing of all dsp exons in the index case of the investigated family revealed a missense mutation in exon 7 (c1176 g ; agcagg). the residue ser299arg mutated in patients is at the center of a coiled, charged region, separating the two short helices of dsp sub - domain z. it suppresses a putative phosphorylation site which is fully conserved in related proteins belonging to the same family, thus supporting the hypothesis that the amino acid change might cause a functional alteration. this mutation is thought to disrupt a protein kinase c (pkc) phosphorylation site which is involved in plakoglobin binding and in clustering of desmosomal cadherin - plakoglobin complexes. desmoplakin, together with plakoglobin, anchors to desmosomal cadherins, forming an ordered array of non - transmembrane proteins, which then bind to keratin intermediate filaments (if) (47). the primary structure of desmoplakin contains three functional domains : the n - terminal, which binds to the desmosome via connection with plakoglobin and plakophilin ; the rod segment, which is predicted to form a dimeric coil ; and the c - terminal domain, which binds if s (48). the cdnas encoding these two highly related proteins differ in a 1.8 kbase sequence that is missing in dspii, most likely due to differential splicing of a longer transcript (49). actually, mutations in desmoplakin gene have been shown to underlie some cases of an autosomal dominant skin disorder (striate palmoplantar keratoderma) without cardiac involvement (5052), a dominant form of arvc without skin disease, an autosomal recessive condition characterized by dilated cardiomyopathy, woolly hair and keratoderma, named carvajal syndrome (53), an autosomal recessive condition characterized by arvc, woolly hair and keratoderma (27) and a left - sided arvc named arrhythmogenic left ventricular cardiomyopathy (alvc) (54) (tab. table i- known desmoplakin mutations and associated diseasediseaseinheritancenucleotide change(s)amino acid change(s)referencesstriate subtype of palmoplantar keratodermadominatc1323tq331xamstrong, 1999striate palmoplantar keratodermadominant939 + 1g > amutant splice productwhittock, 1999dilated cardiomyopathy, woolly hair and keratodermarecessive7901delgframeshift leading to a premature stop codon and truncated proteinnorgett, 2000skin fragility and woolly hair syndromecompound heterozygosity861t > g and 2427 t > an287k and c809xwhittock, 2002skin fragility and woolly hair syndromecompound heterozygosity1990c > t and 7096c > tq664x and r2366gwhittock, 2002arvcdominantc1176gs299rrampazzo, 2002arvc, skin disorder and woolly hairrecessiveg7402cg2375ralcalai, 2003arrhythmogenic left ventricular cardiomyopathy (alvc)dominant2034insaframeshift leading to a premature stop codon and truncated proteinnormann, 2005 in 2004, gerull directly sequenced all 14 exons of the pkp2 gene, including flanking intronic splice sequences. these authors identified 25 different heterozygous mutations (12 insertion - deletion, 6 nonsense, 4 missense and 3 splice site mutations) in 32 over 120 unrelated arvc probands (18). plakophilin-2 gene was selected as candidate gene on the basis of the finding of a lethal defect in cardiac morphogenesis at embryonic day 10.75 in mice homozygous with respect to a deletion mutation of pkp2. the resulting mutant mice exhibit lethal alterations in heart morphogenesis characterized by reduced trabeculation, disarrayed cytoskeleton, ruptures of cardiac walls, and blood leakage into the pericardiac cavity. in the absence of plakophilin-2, the cytoskeletal linker protein desmoplakin dissociates from the plaques of the adhering junctions that connect the cardiomyocytes and forms granular aggregates in the cytoplasm (55). plakophilin-2 is an armadillo - related protein, located in the outer dense plaque of desmosomes. plakophilins are also present in the nucleus, where they may play a role in transcriptional regulation (56). gerull speculated that lack of plakophilin-2 or incorporation of mutant plakophilin-2 in the cardiac desmosomes might impair cell - cell contacts and, as a consequence, might disrupt association between adjacent cardiomyocytes, particularly in response to mechanical stress or stretch (thus providing a potential explanation for the high prevalence of the disorder in athletes, the frequent occurrence of ventricular tachyarrhythmias and sudden death during exercise, and the predominant affection of the right ventricle). the potential cellular mechanism for the initiation of ventricular tachyarrhythmias in arvc could be the intrinsic variation in conduction properties as a result of the patchy areas of fibro - fatty cardiomyocyte degeneration. desmosomes are important cell - cell adhesion junctions which are predominantly found in the epidermis and heart and which couple cytoskeletal elements to the plasma membrane at cell - cell or cell - substrate adhesions. whereas adherens junctions associate with microfilaments at cell - cell interfaces, desmosomes are tailored to anchor stress - bearing intermediate filaments at sites of strong intercellular adhesion. the resulting scaffold plays a key role in providing mechanical integrity to tissues such as epidermis and heart which experience mechanical stress. desmosomes include proteins from at least three distinct gene families : cadherins, armadillo proteins and plakins. desmosomal cadherins include desmogleins and desmocollins ; members of both subfamilies are single - pass transmembrane glycoproteins, mediating ca - dependent cell - cell adhesion. the plakin family proteins include desmoplakin, plectin and the cell envelope proteins envoplakin and periplakin. since the desmoplakin involved in arvd8, plakophilin involved in arvd9 and plakoglobin involved in naxos syndrome encodes desmosomal proteins, different defects in proteins of desmosomal complex lead to arvc. more recently, our group succeeded in identifying the gene involved in arvd1. in one family fulfilling diagnostic criteria for arvc, significant linkage to arvd1 was detected, thus confirming the early locus assignment (57). the critical interval for arvd1, still very large, contains 40 known genes ; five of them (pomt2, kiaa0759, kiaa1036, c14orf4 and tail1) were unsuccessfully screened for pathogenic arvc mutations (57, 58). among genes mapped to arvd1 critical region and expressed in myocardium, transforming growth factor - beta3 (tgf3) appeared a very good candidate, as it encodes a cytokine stimulating fibrosis and modulating cell adhesion (59). after previous analyses failed to detect any mutation in the coding region of this gene, mutation screening was extended to the promoter and untranslated regions (utrs). a nucleotide substitution (c.-36g > a) in 5utr of tgf3 gene was detected in all affected subjects belonging to a large arvd1 family. after the investigation was extended to 30 unrelated arvc index patients, an additional mutation (c.1723c > t) was identified in the 3 utr of one proband. in vitro expression assays of constructs containing the mutations showed that mutated utrs were twofold more active than wild - types (19). the tgf- superfamily consist of a diverse range of proteins that regulate many different physiological processes, including embryonic development, homeostasis, wound healing, chemotaxis, and cell cycle control. cytokines of the tgf- superfamily are dimeric proteins with conserved structures and have pleiotropic functions in vitro and in vivo (60). tgf-1, -2, -3 are the prototypes of the tgf- superfamily ; they inhibit proliferation in most types of cells and induce the apoptosis of ephitelial cells. conversely, tgf-1, -2, -3 stimulate mesenchymal cells to proliferate and produce extracellular matrix and induce a fibrotic response in various tissue in vivo. thus, the tgf- superfamily regulates wide - ranging and diverse roles in development, differentiation, and homeostasis (60). finding tgf3 mutations associated with arvc is very interesting, as it is well established that tgfs stimulate mesenchymal cells to proliferate and to produce extracellular matrix components. it may be hypothesized that the reported mutations in utrs of tgf3 gene, which in vitro enhance expression, could promote myocardial fibrosis. extensive myocardial fibrosis may disrupt electrical and mechanical behavior of the myocardium and extracellular matrix abnormalities may predispose to re - entrant ventricular arrhythmias (61). in fact, endomyocardial biopsy in the two probands shows extensive replacement - type fibrosis, in agreement with this hypothesis. it has been shown that tgfs modulate expression of genes encoding desmosomal proteins in different cell types. cdna microarray analysis performed on rna from cardiac fibroblasts incubated in the presence or in the absence of exogenous tgfs revealed increased expression of different genes, including plakoglobin (62). yoshida reported that tgf1 exposure of cultured airway epithelial cells increases the content of desmoplakins i and ii ; this suggests that regulation of cell - cell junctional complexes may be an important effect due to tgfs (63). therefore, overexpression of tgf3, caused by utrs mutations, might affect as well cell - to - cell junction stability, thus leading to a final outcome similar to that observed in arvd8 (17) and in the arvc - related naxos syndrome (15).. table ii - known arvd genes and causative mutations identified so fararvdgenemutationsreferencesarvd1tgf32 regulatory mutations (in 5 e 3 utrs) among 33 probandsbeffagna, 2005arvd2ryr26 mutations (missense) in affectedsubjects belonging to 6 familiestiso, 2001 ; bauce, 2002 ; damati, 2005arvd8dsp4 mutations (3 missense and 1 splice site) in affected subjects belonging to 4 large familiesrampazzo, 2002 ; bauce, 2005arvd9pkp225 mutations (missense, nonsense, insertion / deletion and splicing site) in 32 unrelated patients among 120 probandsgerull, 2004naxosjup1 mutation (2bp - deletion) in affected patients belonging to a large familymckoy, 2000 the reported involvement of different desmosomal proteins in arvcs and the discovery that some ryr2 mutations may produce arvd2, lead us to put forward a novel hypothesis on molecular pathogenesis of arvcs (17). according to such hypothesis, the almost selective affection of the right ventricle in arvcs might be in relation to higher extensibility of its wall, in comparison with the free wall of left ventricle. possibly, defective proteins in cardiac desmosomes might impair cell - to - cell contacts and, hence, might affect the response of ventricular myocardium to mechanical stretch. these localizations, including the right ventricular outflow tract, the apex and sub - tricuspid areas, are known as the triangle of dysplasia. according to present knowledge, mechanical forces applied to adherens junctions activate stretch - sensitive calcium channels via cadherins mechanical intracellular signaling (64). data on stretch - activated channels in ventricular cardiomyocytes (6567) point to the relevance of such channels in transduction of mechanical forces into a cellular electrochemical signal via increase in intracellular calcium concentration. volume overload in the right ventricle of a person carrying genetically defective intercellular junctions (as in case of mutant plakoglobin, desmoplakin or plakophilin) would produce over - stretch and, hence, excessive calcium load. stretching of cardiomyocytes is known to modulate the elementary calcium release process from ryanodine receptor release channels (68) ; therefore, a genetically impaired response to mechanical stress might adversely affect intracellular calcium concentration and the excitation - contraction coupling, producing arrhythmias. on the other hand, volume overload of the right ventricle in carriers of mutations in ryr2 (cardiac ryanodine receptor) would cause calcium overload, because of the defective ca++ homeostasis. the existence of a dominant form of arvc (arvd2) due to ryr2 mutations supports the hypothesis of a key pathogenic role of intracellular calcium overload in molecular pathogenesis of arvds. the ongoing progresses of molecular genetics are leading to new concepts about the pathogenesis and diagnosis of arrhythmic heart diseases. at the same time, genetic studies on patients with inherited diseases are accompanied by the onset of several medical and ethical problems. an immediate clinical benefit from the discovery of human gene mutations in affected subjects is early and accurate diagnosis. however, in some cases, a pathological mutation can exist in the setting of healthy or borderline phenotype. the detection in apparently healthy subjects of a human gene mutation raises complex clinical management issues.	arrhythmogenic right ventricular cardiomyopathy (arvc) is a heart muscle disease in which the pathological substrate is a fibro - fatty replacement of the right ventricular myocardium. the major clinical features are different types of arrhythmias with a left branch block pattern. arvc shows autosomal dominant inheritance with incomplete penetrance. recessive forms were also described, although in association with skin disorders.ten genetic loci have been discovered so far and mutations were reported in five different genes. arvd1 was associated with regulatory mutations of transforming growth factor beta-3 (tgf3), whereas arvd2, characterized by effort - induced polymorphic arrhythmias, was associated with mutations in cardiac ryanodine receptor-2 (ryr2). all other mutations identified to date have been detected in genes encoding desmosomal proteins : plakoglobin (jup) which causes naxos disease (a recessive form of arvc associated with palmoplantar keratosis and woolly hair) ; desmoplakin (dsp) which causes the autosomal dominant arvd8 and plakophilin-2 (pkp2) involved in arvd9. desmosomes are important cell - to - cell adhesion junctions predominantly found in epidermis and heart ; they are believed to couple cytoskeletal elements to plasma membrane in cell - to - cell or cell - to - substrate adhesions.
double free - flaps are technically challenging due to the complex nature of the defect, harvest of two flaps and use of two pairs of recipient 's vessels. in such limb defects more further the risk of distal limb ischaemia is imminent when collateral circulation is not adequate. double fasciocutanous flaps either perfused independently or as chimeric flaps fulfil the requirements provided suitable recipient vessels are available. the risk of distal limb ischaemia is minimal when a single vascular axial limb vessel is used as the recipient. harvest of such flaps from a common donor site avoids the morbidity of distant second donor site. we report successful resurfacing of large bimalleolar defects in a 14-year - old boy using the anterolateral and anteromedial fasciocutanous perforator flaps harvested independently and anastomosed to the proximal and distal cut ends of the anterior tibial vessels. a 14-year - old boy presented to us with a 2 weeks old infected bimalleolar defect with dimensions of 12 cm 7 cm medially and 8 cm 4 cm laterally [figure 1 ] at the ankle. the patient was treated with cast application elsewhere for swelling of the ankle following a fall and had no bony injury. he developed severe pain in the ankle soon after and fever a week later,. on removal of the cast, necrosis of the skin was noted over the both malleoli which was debrided at the referral hospital and then he was referred to our institute for further management. malleoli and the adjacent lower ends of tibia and fibula were exposed with open ankle joint - draining frank pus. the foot was sensate and well vascularised with good dorsalis pedis and posterior tibial pulsations. considering the dimensions and proximity of the two defects, a chimeric fasciocutanous anteromedial thigh (amt) and anterolateral thigh (alt) flap [figure 2 ] based on the lateral circumflex, femoral vessels was planned and their perforators marked with hand held doppler. the flaps were raised based on these perforators and the pedicles traced proximally for their confluence. it was found to be very close to the origin of the lateral circumflex femoral artery precluding chimeric flap design and due to gross vessel size mismatch and excess pedicle length. the vessels were healthy and amenable for the use with good pulsatile flow from both the proximal and distal cut ends of the recipient artery. both flap vessels were anstomosed to the proximal and distal cut ends of the anterior tibial artery, in an end to end fashion. the corresponding flap veins were anastomosed to the available two vena comitans of the anterior tibial artery in an antegrade direction. at 11 months follow - up, the patient is ambulatory with a stiff ankle in slight varus position with x - ray showing extensive post - septic arthritic sequale of the ankle joint [figure 4 ]. medial and lateral malleolar defect chimeric anterolateral thigh and anteromedial thigh flaps settled anterolateral thigh and anteromedial thigh flaps x - ray showing post arthritic sequele distal lower limb defects requiring double flaps can be resurfaced by a combination of two separate distally based flaps laterally and medially, a single pedicled flap with de - epithelisation of intervening skin bridge and use of chimeric free flaps. chimeric free flaps resurface more than one defect based on single pedicle by innovation in the flap design. lin. have demonstrated the feasibility of harvesting more than one skin and muscle components on the lateral circumflex femoral system. two separate skin paddles based on the anterolateral and anteromedial perforators of the descending branch of the lateral circumflex femoral artery can be harvested as a chimeric flap. however, the pedicle of the amt flap can arise from the lateral circumflex femoral artery or the femoral artery. when the chimeric anterolateral and anteromedial flap is harvested in such circumstances, the confluence would be in a much more proximal position which was the case in our patient. routine imaging has not been advocated for the harvest of these flaps by however, when chimeric flap harvest is planned, imaging can be helpful in assessing the location of the confluence. the harvest of both the flaps did not incur additional morbidity in our case though the potential exists. lin. in their preference for choosing chimeric flaps over double free - flaps have observed the following difficulties in advocating double free - flaps for limb defects namely, (1) the need for more than one pair of recipient vessels or a flow - through flap (2) morbidity of the second flap harvest and (3) the additional time for second anastomosis. the choice of the recipient vessel for a free flap in the limb will depend on the location and the vascular status of the limb. collateral circulation maintains distal limb perfusion and hence its intactness and adequacy are vital when one of the major limb axial vessels is utilised. this is possible because of presence of collaterals at multiple levels between the anterior tibial, posterior tibial and peroneal vessels. in 3 of the 50 cases of park. reverse flow from anterior tibial was used as the recipient vessel, and they suggested angiography and pulsatile flow intra - op to be usable criteria for the vessel. thus, if both the proximal and distal cut ends have good flow, they can be utilised for perfusion of two flaps assuming that collateral circulation is adequate. both superficial and deep park. have found the vena comitans to be better suited than superficial veins as they are less vulnerable to injury and located in the same operative field. even though patency rates are similar to that of an end to end anastomosis, it has technical difficulties (angle of vessel take off, arteriotomy, difficulty in diseased vessels) and flow problems (turbulence, insufficient flow, thrombosis). although it gives a safer and more satisfactory outcome in size discrepancy, it is not feasible when flap vessel is larger than the recipient vessel which was the situation in our case. thus, in a properly selected patient double free - flaps can be done safely with minimal additional morbidity as demonstrated in this case.	double free - flaps are necessary when tissue cover can not be sufficed with a single flap. the other factors to be considered when using two free flaps for resurfacing of distal limb defects are the availability of more than one recipient vessel, the risk of distal limb ischaemia and the donor site morbidity of double flap harvest. if these factors are adequately addressed, double free - flaps can be safely executed for resurfacing distal limb defects with minimal morbidity. we report the simultaneous harvest and transfer of the anterolateral and anteromedial thigh flaps inset and vascularised as double free - flaps to resurface a large bimalleolar defect in a 14-year - old boy with no additional morbidity as compared to that of a single free tissue transfer.
chronic obstructive pulmonary disease (copd) is characterized by persistent and progressive airflow limitation resulting from abnormal inflammatory response of the airways and lungs to noxious particles inhalation.1 apart from inducing lung damage, copd is recognized as a multisystemic inflammatory disease associated with extrapulmonary comorbidities that can substantially affect the disease prognosis.1,2 the prevalence of comorbidities in copd patients ranges between 65% and 81%,2 and they represent the primary causes of death in more than 60% of copd patients.3 specifically, the prevalence of cardiovascular disorders in copd patients is ~40%;2 such disorders are directly associated with cardiac autonomic regulation.4,5 the integration of the cardiovascular, respiratory, and muscular systems constitutes a complex and sophisticated mechanism of energy generation6 in which the cardiovascular system activity, aiming at organic homeostasis preservation, is controlled by the autonomous nervous system (ans).7 however, cardiorespiratory disorders, such as copd, can induce changes in the sympathovagal balance, which can result in detrimental alterations in the ans functioning of these patients.5 the heart rate variability (hrv) analysis is an important tool for the assessment of the ans behavior,8 used to determine pathological conditions and investigate physiological modifications, which can be associated with physical exercise performance.6,8 reduced hrv is associated with increased morbidity and mortality in copd patients,4,5 and this has led various researchers to investigate the ans behavior during respiratory maneuvers, position changes, and pharmacological blockade.9 it is widely known that in copd patients the hrv is reduced, and postural adjustments, which induce a predominantly sympathetic stimulation, are also impaired. however, the number of studies that evaluated the parasympathetic component is scarce.10 the heart rate (hr) follows an oscillatory pattern synchronized with the respiratory cycle ; this phenomenon is known as respiratory sinus arrhythmia (rsa). during inspiration, hr increases mainly due to the vagal withdrawal effect on the sinus node, while, during expiration, parasympathetic activity is regulated and hr decreases. rsa significantly decreases the sympathovagal balance, markedly increasing vagal modulation on the sinus node.11 recent studies investigated the relationship between respiratory muscle strength (rms) and hrv in copd patients and showed that respiratory muscle weakness can modify the hrv. however, this alteration still needs to be quantified ; this could lead to an improvement of therapeutic treatment in pulmonary rehabilitation programs.12,13 starting from this evidence, we investigated if alterations in rms may affect cardiac autonomic modulation in copd patients. we hypothesized that respiratory muscle weakness negatively affects hrv at rest and during an rsa maneuver (rsa - m) in copd patients. we performed a cross - sectional case study on a convenience nonprobability sample ; the study was conducted within santa cruz hospital s pulmonary rehabilitation program (santa cruz do sul, rs, brazil). the study was approved by the research ethics committee of the university of santa cruz do sul, protocol number 1.100.926, and all volunteers signed an informed consent statement prior to participation. ten patients with a clinical diagnosis of copd, confirmed by pulmonary function test, participating in a pulmonary rehabilitation program and without disease exacerbation for at least 30 days were included in the study. patients with complex cardiac arrhythmias, unstable angina, uncontrolled systemic arterial hypertension, or myocardial ischemia were excluded from the study. patients were evaluated in a laboratory at a temperature of 22c and relative humidity between 50% and 60%. they were instructed to avoid stimulants and alcoholic drinks and not to perform exhausting physical exercise the day before the test ; they were also instructed not to smoke or use bronchodilators for 6 hours before the test. baseline variables, including systolic arterial pressure, diastolic arterial pressure, hr, respiratory frequency, and peripheral oxygen saturation, were measured. clinical data including sex, age, body mass index, ethnicity, copd stage,3 and smoking status were also collected. pulmonary function was assessed using a digital spirometer (microloop, mk8, care fusion, hoechberg, germany), which provided measures of the slow vital capacity, the forced vital capacity (fvc), the forced expiratory volume in 1 second (fev1), and the fev1/fvc ratio. spirometry was performed according to the recommendations of the american thoracic society,14 and the results were analyzed according to the values predicted by pereira.15 the classification of severity of airflow limitation in copd was performed according to the global initiative for chronic obstructive lung disease (gold) recommendations1 and patients were classified as moderate (gold ii), severe (gold iii), or very severe (gold iv). rms was assessed using a digital manometer (mdi, mvd300, porto alegre, brazil), which provided measures of the maximum inspiratory pressure (pimax) and the maximum expiratory pressure (pemax). the pimax followed by pemax was obtained from residual volume and total lung capacity ; during the maneuver, the subjects remained seated, wearing nose clips and with a rigid, plastic flanged mouthpiece in place.16 the values were then compared with those described in literature and expressed as percentage of predicted values.16 hr and rr intervals were recorded using a telemetric cardiac monitor (polar s810i, kempele, finland) at rest (10 minutes) and during an rsa - m (4 minutes). recorded signals contained at least 256 points.17 an elastic band (polar t31 transmissor) was placed around the patient s thorax at the level of the lower third of the sternum while the patient was in sitting position, and signals were continuously transmitted to the receiving unit by an electromagnetic field. recorded data were then transferred to the kubios hrv analysis software (version 2.2, matlab kuopio, finland) for subsequent analysis. for hrv recording during the rsa - m, subjects were instructed to perform a series of deep and slow inspirations and expirations, with a pulmonary volume that varied from the total lung capacity (maximal inspiration) to the residual volume (maximal expiration) ; each respiratory cycle was performed in 10 seconds, with a 5-second inspiration and a 5-second expiration, resulting in five to six respiratory cycles per minute.18 frequency domain, time domain, and nonlinear analysis were performed on signals recorded at rest and during the rsa - m. time domain analysis provided mean rr, standard deviation (sd) rr, mean hr, sd hr, the square root of the mean - squared differences of successive hr and rr intervals, and the rr tri - index. spectral analysis provided the hrv signal power in the low - frequency (lf) and in the high - frequency (hf) bands, expressed in normalized units (nu), and the lf / hf ratio. nonlinear analysis provided the approximate entropy (apen) and the sample entropy (sampen) indices. data were analyzed using the sigmaplot statistical package (version 11.0, systat software inc. wilk test and presented descriptively as mean and standard deviation (parametric) or as median and minimum and maximum interval (nonparametric). to reject the null hypothesis, we performed a cross - sectional case study on a convenience nonprobability sample ; the study was conducted within santa cruz hospital s pulmonary rehabilitation program (santa cruz do sul, rs, brazil). the study was approved by the research ethics committee of the university of santa cruz do sul, protocol number 1.100.926, and all volunteers signed an informed consent statement prior to participation. ten patients with a clinical diagnosis of copd, confirmed by pulmonary function test, participating in a pulmonary rehabilitation program and without disease exacerbation for at least 30 days were included in the study. patients with complex cardiac arrhythmias, unstable angina, uncontrolled systemic arterial hypertension, or myocardial ischemia were excluded from the study. patients were evaluated in a laboratory at a temperature of 22c and relative humidity between 50% and 60%. they were instructed to avoid stimulants and alcoholic drinks and not to perform exhausting physical exercise the day before the test ; they were also instructed not to smoke or use bronchodilators for 6 hours before the test. baseline variables, including systolic arterial pressure, diastolic arterial pressure, hr, respiratory frequency, and peripheral oxygen saturation, were measured. clinical data including sex, age, body mass index, ethnicity, copd stage,3 and smoking status were also collected. pulmonary function was assessed using a digital spirometer (microloop, mk8, care fusion, hoechberg, germany), which provided measures of the slow vital capacity, the forced vital capacity (fvc), the forced expiratory volume in 1 second (fev1), and the fev1/fvc ratio. spirometry was performed according to the recommendations of the american thoracic society,14 and the results were analyzed according to the values predicted by pereira.15 the classification of severity of airflow limitation in copd was performed according to the global initiative for chronic obstructive lung disease (gold) recommendations1 and patients were classified as moderate (gold ii), severe (gold iii), or very severe (gold iv). rms was assessed using a digital manometer (mdi, mvd300, porto alegre, brazil), which provided measures of the maximum inspiratory pressure (pimax) and the maximum expiratory pressure (pemax). the pimax followed by pemax was obtained from residual volume and total lung capacity ; during the maneuver, the subjects remained seated, wearing nose clips and with a rigid, plastic flanged mouthpiece in place.16 the values were then compared with those described in literature and expressed as percentage of predicted values.16 pulmonary function was assessed using a digital spirometer (microloop, mk8, care fusion, hoechberg, germany), which provided measures of the slow vital capacity, the forced vital capacity (fvc), the forced expiratory volume in 1 second (fev1), and the fev1/fvc ratio. spirometry was performed according to the recommendations of the american thoracic society,14 and the results were analyzed according to the values predicted by pereira.15 the classification of severity of airflow limitation in copd was performed according to the global initiative for chronic obstructive lung disease (gold) recommendations1 and patients were classified as moderate (gold ii), severe (gold iii), or very severe (gold iv). rms was assessed using a digital manometer (mdi, mvd300, porto alegre, brazil), which provided measures of the maximum inspiratory pressure (pimax) and the maximum expiratory pressure (pemax). the pimax followed by pemax was obtained from residual volume and total lung capacity ; during the maneuver, the subjects remained seated, wearing nose clips and with a rigid, plastic flanged mouthpiece in place.16 the values were then compared with those described in literature and expressed as percentage of predicted values.16 hr and rr intervals were recorded using a telemetric cardiac monitor (polar s810i, kempele, finland) at rest (10 minutes) and during an rsa - m (4 minutes). recorded signals contained at least 256 points.17 an elastic band (polar t31 transmissor) was placed around the patient s thorax at the level of the lower third of the sternum while the patient was in sitting position, and signals were continuously transmitted to the receiving unit by an electromagnetic field. recorded data were then transferred to the kubios hrv analysis software (version 2.2, matlab kuopio, finland) for subsequent analysis. for hrv recording during the rsa - m, subjects were instructed to perform a series of deep and slow inspirations and expirations, with a pulmonary volume that varied from the total lung capacity (maximal inspiration) to the residual volume (maximal expiration) ; each respiratory cycle was performed in 10 seconds, with a 5-second inspiration and a 5-second expiration, resulting in five to six respiratory cycles per minute.18 frequency domain, time domain, and nonlinear analysis were performed on signals recorded at rest and during the rsa - m. time domain analysis provided mean rr, standard deviation (sd) rr, mean hr, sd hr, the square root of the mean - squared differences of successive hr and rr intervals, and the rr tri - index. spectral analysis provided the hrv signal power in the low - frequency (lf) and in the high - frequency (hf) bands, expressed in normalized units (nu), and the lf / hf ratio. nonlinear analysis provided the approximate entropy (apen) and the sample entropy (sampen) indices. data were analyzed using the sigmaplot statistical package (version 11.0, systat software inc. wilk test and presented descriptively as mean and standard deviation (parametric) or as median and minimum and maximum interval (nonparametric). to reject the null hypothesis, a total of 12 copd patients were recruited ; two patients who presented arrhythmias were excluded during the screening phase. data are in line with others found in literature, with the exception of the number of copd patients with obesity. spectral and complexity hrv indices were significantly different between the resting condition and the rsa - m (table 2). our results showed that the rsa - m did not modify the time domain of hrv parameters (p>0.05). however, in the frequency domain, interestingly, the lf power and the lf / hf ratio increased (p=0.01), while the hf power decreased (p=0.01). this behavior suggests a sympathovagal modulation contrary to what is expected during the rsa - m. moreover, apen and sampen significantly decreased, indicating an hrv complexity decrease during the rsa - m. moderate - to - strong correlations were found between pimax and spectral hrv index and between pemax and spectral hrv index during the rsa - m (p<0.05). strong correlations were also observed between hrv complexity indices (apen and sampen) and pemax during the rsa - m, as shown in figure 2. a simple linear regression model was applied and the results are listed in table 3. we found that, during the rsa - m, isolated pimax explained 44% of lfnu behavior. the primary finding of this study was that patients affected with copd presented increased parasympathetic activity at rest in the sitting position when compared to the rsa - m. however, during the rsa - m, copd patients presented enhanced sympathetic response and reduced parasympathetic tone, with an hrv complexity reduction. finally, moderate - to - strong correlations were observed between rms and spectral hrv index and between rms and nonlinear hrv index. our findings are relevant to understand copd effects on hr autonomic modulation and their relationship with impaired rms. in this study, we observed marked parasympathetic modulation in copd patients at rest. this is in line with literature findings and has been previously explained by the fev1 reduction and the bronchoconstriction increase, which are characteristic in these patients.19 however, the rsa - m induces a stimulation of the ans,15 as it is a maneuver able to elicit a parasympathetic response. we observed that patients presented a response contrary to what was expected during the parasympathetic accentuation maneuver. our results are in line with those by reis,18 who observed increased sympathetic activation and reduced parasympathetic response. controlled breathing could possibly accentuate pulmonary hyperinflation, which is already present in these patients as a result of chronic airways obstruction.10,18 novel results were obtained in this study regarding the ans complexity, assessed through hrv nonlinear indices sampen and apen ; complexity was found to be reduced during the rsa - m when compared to resting conditions. literature results show that copd patients present reduced ans complexity when compared with healthy subjects.20 in this line of evidence, mazzuco observed that the rsa - m, when compared with other autonomic tests that predominantly stimulate the sympathetic drive, was able to better evidence the impairments caused by the disease. this can be explained by the fact that parasympathetic modulation is more impaired in these patients due to air trapping and gas - exchange disturbances.9 moderate - to - strong correlations were observed in this study between rms (pimax and pemax) and spectral and nonlinear hrv indices ; moreover, isolated pimax was found to be able to explain 44% of lf power behavior. respiratory muscle weakness influences the phrenic dynamics and the expired air volume, with a functional residual capacity increase. thus, it could be responsible for the alteration of the cardiac autonomic control response.12 therefore, we can assume that impaired rms can substantially influence the rsa - m effect and the hrv behavior and that inspiratory muscle weakness can determine greater vagal attenuation in copd patients. it is known that respiratory muscle weakness leads to fast and shallow breathing and that diaphragmatic incursion is limited by pulmonary hyperinflation. thus, the ergoreceptor may be activated early and may be responsible for the fast central response in cardiac autonomic control.12 a similar result was obtained between respiratory muscle weakness and reduced hrv in chronic heart failure patients.11 based on the result of this study, we propose an equation for lf prediction during the rsa - m : lf during the rsa - m = 120.71(0.623 pimax). this study does possess limitations that deserve to be mentioned. because of rigid exclusion criteria and the selection of patients with more than 95% of sinus beats, our sample is not fully representative of the entire copd population, which is known to include patients with arrhythmias that compromise data recording and analysis. moreover, only patients with gold stage ii or higher copd stage were included in the study ; however, patients in the early stages of the disease could have a lower impact of the disease on cardiac autonomic control. in this study, we evaluated a relatively small cohort of copd patients. interestingly, most of the previous studies enrolled similar numbers of patients,5,912 whereas few studies analyzed larger cohorts of patients.1820 another limitation of this work consists of the fact that underlying inflammation was not evaluated and that sarcopenia was not quantified. such analyses could contribute to a better understanding of the mechanisms involved in mechanoneurological control, such as flow and blood oxygenation reduction, both in the brain and in the peripheral muscles.21 therefore, studies with greater, heterogeneous samples, including more comprehensive investigations, are needed. the novel results hereby presented about rms in copd patients might lead to an effective improvement in pulmonary rehabilitation in a clinical setting. respiratory muscle training, potential clinical routine use of controlled breathing pattern in copd patients during pulmonary rehabilitation, and any adverse effects on cardiopulmonary dynamics need further investigation in future studies. in conclusion, patients affected by copd presented in creased parasympathetic activity and ans complexity at rest in the sitting position when compared to the rsa - m. this suggests an autonomic modulation alteration in basal conditions. during the rsa - m, a marked sympathetic modulation and a reduced parasympathetic response, with an hrv complexity reduction, were induced. finally, rms was found to be strongly associated with the sympathovagal response in copd patients. these findings are relevant to understanding of copd effects on hr autonomic modulation, and this is important to elucidate pathobiological mechanisms linking copd to its comorbidities.	introductionchronic obstructive pulmonary disease (copd) is recognized as a multisystemic inflammatory disease associated with extrapulmonary comorbidities, including respiratory muscle weakness and cardiovascular and cardiac autonomic regulation disorders. we investigated whether alterations in respiratory muscle strength (rms) would affect cardiac autonomic modulation in copd patients.methodsthis study was a cross - sectional study done in ten copd patients affected by moderate to very severe disease. the heart rate variability (hrv) signal was recorded using a polar cardiofrequencimeter at rest in the sitting position (10 minutes) and during a respiratory sinus arrhythmia maneuver (rsa - m ; 4 minutes). linear analysis in the time and frequency domains and nonlinear analysis were performed on the recorded signals. rms was assessed using a digital manometer, which provided the maximum inspiratory pressure (pimax) and the maximum expiratory pressure (pemax).resultsduring the rsa - m, patients presented an hrv power increase in the low - frequency band (lfnu) (46.923.7 vs 75.827.2 ; p=0.01) and a decrease in the high - frequency band (hfnu) (52.823.5 vs 24.027.0 ; p=0.01) when compared to the resting condition. significant associations were found between rms and hrv spectral indices : pimax and lfnu (r=0.74 ; p=0.01) ; pimax and hfnu (r=0.74 ; p=0.01) ; pemax and lfnu (r=0.66 ; p=0.01) ; pemax and hfnu (r=0.66 ; p=0.03) ; between pemax and sample entropy (r=0.83 ; p<0.01) and between pemax and approximate entropy (r=0.74 ; p=0.01). using a linear regression model, we found that pimax explained 44% of lfnu behavior during the rsa-m.conclusioncopd patients with impaired rms presented altered cardiac autonomic control, characterized by marked sympathetic modulation and a reduced parasympathetic response ; reduced hrv complexity was observed during the rsa - m.
a retrospective case review was performed to identify patients who developed tao in temporal association with periocular surgery. patients were examined for proptosis, lid retraction and lid lag, extraocular motility abnormalities, and periocular swelling. radiological investigations (mri or ct) were used to confirm clinical impressions and define extraocular muscle and orbital fat involvement. university institutional review board (irb) / ethics committee approval was obtained by authors. nine patients were identified, all of which female, ranging in age from 45 - 75 years (average : 59.3 years). group 1 was comprised of four patients who had previously been diagnosed with graves ' hyperthyroidism. they ranged in age from 48 - 75 years (average : 58.8 yrs). the diagnosis of graves ' hyperthyroidism had been made 12 to 96 months (average : 50.5 months) prior to presenting with orbitopathy. group 2 was comprised of five patients who were not documented to have had any previous or concurrent thyroid abnormality. they ranged in age from 45 - 74 years (average : 60.2 years). none of the patients had previously been diagnosed with tao in relation to their graves ' disease the periocular procedures performed are summarized in table 1. all of these patients had been stable with no signs of tao for an average of over four years before periocular surgery. this 48-year - old patient developed graves ' disease in june of 1994 at age 38. she was treated with iodine 131 and rendered euthyroid upon replacement thyroxine treatment. in november 1999 she underwent bilateral lasik surgery to correct her myopia. immediately after surgery she noted swelling in the left eye. in december 1999 it was noted that she had proptosis in both eyes and left upper lid retraction. she was observed until she was stable and, in june of 2003, underwent a bilateral fat decompression for cosmesis, followed by left upper lid retraction repair. this 59-year - old patient was diagnosed with grave 's hyperthyroidism at 24 years of age and was treated for 12 months with methimazole, by which time her thyroid levels had normalized. she required no further treatment until september 2001 when, at the age of 56, she again developed graves hyperthyroidism. after an initial six - months treatment period with methimazole, she was treated with iodine 131 in april of 2002. iodine 131 was subsequently replaced with thyroxine and the patient was considered euthyroid. in september of 2002 she underwent botox injections to her eyelids and brow. it was noted that she had marked swelling after the injections and, in the next one to two months, developed bilateral lid retraction. there was no sign of proptosis or diplopia. at the time of presentation, the tsh level was normal, t4 was slightly elevated, and anti - thyroid peroxidase antibody was positive. she did not develop any further signs of tao and in february of 2004 underwent bilateral lid retraction repair with good postoperative results. five patients did not have any history of dysthyroid state or tao before their periocular surgery. this 74-year - old patient underwent left cataract extraction with retrobulbar injection in october of 1999. thyroid function tests showed normal t4 and t3 levels and a mild suppression of tsh with positive tsh receptor antibodies. in april of 2000 she was noted to have mild bilateral proptosis that was more severe in the left eye, and left upper lid retraction. an mri showed an enlarged left superior rectus muscle. because of the atypical presentation she underwent biopsy of the enlarged muscle in october 2000, which showed inflammatory changes consistent with graves ' hyperthyroidism. the diplopia slowly worsened and in june 2001 a ct scan showed bilateral enlargement of all extraocular muscles, which was greater in the left eye. after spontaneous stabilization of the orbitopathy she underwent bilateral strabismus surgery in july 2001 and again in july 2002 to treat her diplopia. she remained euthyroid until october 2003 when she developed clinical hyperthyroidism with grossly elevated t4 and suppressed tsh. this 71-year - old patient underwent cosmetic surgery consisting of facelift, bilateral upper lid blepharoplasty, and lower lid laser resurfacing in december 2002. she noted significant postoperative edema that was worse on the left side, and in january 2003 prominence of her left eye. upon examination she was noted to have left eye proptosis, brow swelling, and limited elevation of the left globe. an mri showed enlargement of the left inferior rectus, as well as mild enlargement of the left superior and lateral rectus. in march 2003 she developed hyperthyroidism with elevated t4 and suppressed tsh, and began ptu therapy. in may 2003 she developed the prednisone treatment was tapered to zero and by december 2003 her vision had stabilized. we present a series of four patients among nine who developed tao in temporal relationship to periocular surgery. there were five patients (group 2) without a history of thyroid dysfunction prior to surgery. four of these patients subsequently developed graves ' hyperthyroidism (this occurred 2, 3, 11, and 48 months after tao diagnosis) and the fifth tested positive for auto - antibodies. in each of these patients there was a temporal relationship between their surgery and the development of tao. in all patients tao developed within six weeks of the periocular surgery. all patients developed proptosis and upper lid retraction and four of the five had diplopia due to extraocular muscle enlargement. four of the five patients required lid surgery, and three of five required extraocular muscle surgery. four patients had previous history of thyroid abnormality (group 1). in all patients there was significant lid retraction, three of four developed diplopia, and one patient developed compressive optic neuropathy. a summary of the cases is presented in table 2. all of these patients had been stable with no signs of tao for an average of over four years before periocular surgery. this 48-year - old patient developed graves ' disease in june of 1994 at age 38. she was treated with iodine 131 and rendered euthyroid upon replacement thyroxine treatment. in november 1999 she underwent bilateral lasik surgery to correct her myopia. immediately after surgery she noted swelling in the left eye. in december 1999 it was noted that she had proptosis in both eyes and left upper lid retraction. she was observed until she was stable and, in june of 2003, underwent a bilateral fat decompression for cosmesis, followed by left upper lid retraction repair. this 59-year - old patient was diagnosed with grave 's hyperthyroidism at 24 years of age and was treated for 12 months with methimazole, by which time her thyroid levels had normalized. she required no further treatment until september 2001 when, at the age of 56, she again developed graves hyperthyroidism. after an initial six - months treatment period with methimazole, she was treated with iodine 131 in april of 2002. iodine 131 was subsequently replaced with thyroxine and the patient was considered euthyroid. in september of 2002 she underwent botox injections to her eyelids and brow. it was noted that she had marked swelling after the injections and, in the next one to two months, developed bilateral lid retraction. there was no sign of proptosis or diplopia. at the time of presentation, the tsh level was normal, t4 was slightly elevated, and anti - thyroid peroxidase antibody was positive. she did not develop any further signs of tao and in february of 2004 underwent bilateral lid retraction repair with good postoperative results. this 48-year - old patient developed graves ' disease in june of 1994 at age 38. she was treated with iodine 131 and rendered euthyroid upon replacement thyroxine treatment. in november 1999 she underwent bilateral lasik surgery to correct her myopia. immediately after surgery she noted swelling in the left eye. in december 1999 it was noted that she had proptosis in both eyes and left upper lid retraction. she was observed until she was stable and, in june of 2003, underwent a bilateral fat decompression for cosmesis, followed by left upper lid retraction repair. this 59-year - old patient was diagnosed with grave 's hyperthyroidism at 24 years of age and was treated for 12 months with methimazole, by which time her thyroid levels had normalized. she required no further treatment until september 2001 when, at the age of 56, she again developed graves hyperthyroidism. after an initial six - months treatment period with methimazole, she was treated with iodine 131 in april of 2002. iodine 131 was subsequently replaced with thyroxine and the patient was considered euthyroid. in september of 2002 she underwent botox injections to her eyelids and brow. it was noted that she had marked swelling after the injections and, in the next one to two months, developed bilateral lid retraction. there was no sign of proptosis or diplopia. at the time of presentation, the tsh level was normal, t4 was slightly elevated, and anti - thyroid peroxidase antibody was positive. she did not develop any further signs of tao and in february of 2004 underwent bilateral lid retraction repair with good postoperative results. five patients did not have any history of dysthyroid state or tao before their periocular surgery. this 74-year - old patient underwent left cataract extraction with retrobulbar injection in october of 1999. thyroid function tests showed normal t4 and t3 levels and a mild suppression of tsh with positive tsh receptor antibodies. in april of 2000 she was noted to have mild bilateral proptosis that was more severe in the left eye, and left upper lid retraction. an mri showed an enlarged left superior rectus muscle. because of the atypical presentation she underwent biopsy of the enlarged muscle in october 2000, which showed inflammatory changes consistent with graves ' hyperthyroidism. the diplopia slowly worsened and in june 2001 a ct scan showed bilateral enlargement of all extraocular muscles, which was greater in the left eye. after spontaneous stabilization of the orbitopathy she underwent bilateral strabismus surgery in july 2001 and again in july 2002 to treat her diplopia. she remained euthyroid until october 2003 when she developed clinical hyperthyroidism with grossly elevated t4 and suppressed tsh. this 71-year - old patient underwent cosmetic surgery consisting of facelift, bilateral upper lid blepharoplasty, and lower lid laser resurfacing in december 2002. she noted significant postoperative edema that was worse on the left side, and in january 2003 prominence of her left eye. upon examination she was noted to have left eye proptosis, brow swelling, and limited elevation of the left globe. an mri showed enlargement of the left inferior rectus, as well as mild enlargement of the left superior and lateral rectus. in march 2003 she developed hyperthyroidism with elevated t4 and suppressed tsh, and began ptu therapy. in may 2003 she developed the prednisone treatment was tapered to zero and by december 2003 her vision had stabilized. we present a series of four patients among nine who developed tao in temporal relationship to periocular surgery. there were five patients (group 2) without a history of thyroid dysfunction prior to surgery. four of these patients subsequently developed graves ' hyperthyroidism (this occurred 2, 3, 11, and 48 months after tao diagnosis) and the fifth tested positive for auto - antibodies. in each of these patients there was a temporal relationship between their surgery and the development of tao. in all patients tao developed within six weeks of the periocular surgery. all patients developed proptosis and upper lid retraction and four of the five had diplopia due to extraocular muscle enlargement. four of the five patients required lid surgery, and three of five required extraocular muscle surgery. four patients had previous history of thyroid abnormality (group 1). in all patients there was significant lid retraction, three of four developed diplopia, and one patient developed compressive optic neuropathy. this 74-year - old patient underwent left cataract extraction with retrobulbar injection in october of 1999. thyroid function tests showed normal t4 and t3 levels and a mild suppression of tsh with positive tsh receptor antibodies. in april of 2000 she was noted to have mild bilateral proptosis that was more severe in the left eye, and left upper lid retraction. an mri showed an enlarged left superior rectus muscle. because of the atypical presentation she underwent biopsy of the enlarged muscle in october 2000, which showed inflammatory changes consistent with graves ' hyperthyroidism. the diplopia slowly worsened and in june 2001 a ct scan showed bilateral enlargement of all extraocular muscles, which was greater in the left eye. after spontaneous stabilization of the orbitopathy she underwent bilateral strabismus surgery in july 2001 and again in july 2002 to treat her diplopia. she remained euthyroid until october 2003 when she developed clinical hyperthyroidism with grossly elevated t4 and suppressed tsh. this 71-year - old patient underwent cosmetic surgery consisting of facelift, bilateral upper lid blepharoplasty, and lower lid laser resurfacing in december 2002. she noted significant postoperative edema that was worse on the left side, and in january 2003 prominence of her left eye. upon examination she was noted to have left eye proptosis, brow swelling, and limited elevation of the left globe. an mri showed enlargement of the left inferior rectus, as well as mild enlargement of the left superior and lateral rectus. in march 2003 she developed hyperthyroidism with elevated t4 and suppressed tsh, and began ptu therapy. in may 2003 she developed the prednisone treatment was tapered to zero and by december 2003 her vision had stabilized. we present a series of four patients among nine who developed tao in temporal relationship to periocular surgery. there were five patients (group 2) without a history of thyroid dysfunction prior to surgery. four of these patients subsequently developed graves ' hyperthyroidism (this occurred 2, 3, 11, and 48 months after tao diagnosis) and the fifth tested positive for auto - antibodies. in each of these patients there was a temporal relationship between their surgery and the development of tao. in all patients tao developed within six weeks of the periocular surgery. all patients developed proptosis and upper lid retraction and four of the five had diplopia due to extraocular muscle enlargement. four of the five patients required lid surgery, and three of five required extraocular muscle surgery. four patients had previous history of thyroid abnormality (group 1). in all patients there was significant lid retraction, three of four developed diplopia, and one patient developed compressive optic neuropathy. a summary of the cases is presented in table 2. we studied nine patients in whom surgery on or around the eye was temporally associated with the development of tao, both in patients with previously stable graves ' hyperthyroidism and in patients with no previous thyroid disease history. before discussing this group of patients further all patients were euthyroid at the time of tao, which is uncommon with most patients developing tao in the setting of systemic hyperthyroidism or more uncommonly, hypothyroidism.3,9,10 five patients (group 2) had no previous thyroid abnormality. four patients (group 1) had been treated for graves ' hyperthyroidism. while it may be argued that the development of tao was part of the natural history of the disease, three of the four patients had stable graves disease for at least 29 months before the surgical event. bartley reported that the usual temporal relationship of hyperthyroidism and the development of tao is 18 months in 85% of patients.3,9,10 our observed time interval falls outside that expected between thyroid dysfunction and the development of orbitopathy. in only 15% of cases one of the four patients had botox injections 12 months after the diagnosis of graves ' disease, and it could be argued that the development of tao was merely coincidental to the treatment. two patients with previous graves ' hyperthyroidism developed tao at least five years after their original diagnosis. the usual ratio of women to men when one considers tao is around six to one.9 the average age of the patients in this study was 59.3 years, which corresponds to the second peak in the bimodal distribution of tao seen in women.9,11 the pathogenesis of tao has been a topic of controversy for many years. the instigation of the extrathyroidal manifestations of graves ' disease and other dysthyroid states has yet to be explained. the original description by graves and von basedow in the 1830s1,2 included pretibial myxedema, hyperthyroidism, and orbitopathy, and for years a common auto - antigen has been sought.12 initially extraocular muscle antigens 13 and the tsh receptor were considered likely auto - antigens.14 these antigens are however not limited to the sites that manifest changes in graves disease.15 more recently the central role of the unique orbital fibroblast has been implicated in tao.16,17 studies have identified the role of the orbital fibroblast as a target of the t - cell mediated infiltration of the orbital connective tissues. orbital fibroblasts in particular are neural crest derived17 and express cd40 (a typical b - cell cell surface receptor) that can be activated by t - cell receptor (cd154) linkage to elicit inflammatory cytokines and bone marrow derived cell migration factors.18,19 moreover, a subpopulation of orbital fibroblasts can undergo adipocyte differentiation in vitro when placed in appropriate culture media, and can be induced by 20 inflammatory cytokines to produce up to a 100-fold greater amount of glycosaminoglycan than normal fibroblasts.21,22 these latter two properties explain the exaggerated, glycosaminoglycan deposition and fat proliferation obseved in tao patients.23 the effect on the orbits can be unilateral in as many as 10% of cases. it is difficult to find any previous analysis of the type of patients examined in this study. some authors have suggested that trauma and pressure may play a central role in the sites of extrathyroidal manifestations of tao.24,25 previous authors have described tao as a cause of diplopia after cataract surgery.26 these authors described 58 patients who developed unexpected diplopia after cataract surgery. three patients had been previously diagnosed with stable graves ' hyperthyroidism, two subsequently developed dysthyroid changes, and three patients were euthyroid. in seven patients, retrobulbar anesthetic injection was used for the cataract surgery. previously, authors have postulated traumatic aggravation of subclinical tao as the explanation for the symptoms. a single case report of tao in a previously stable graves ' hyperthyroidism patient27 postulates a local pressure mechanism for the induction of tao, and extrapolates this to suggest that local factors are the main determinant of the extrathyroidal manifestations of dysthyroid states. in this particular case, the patient had previously stable hyperthyroidism and developed tao after cataract extraction with retrobulbar anesthesia. it has also been suggested that iodine 131 treatment can exacerbate or incite tao in the acute phase of graves ' hyperthyroidism.28 the role of localized trauma from periocular surgery may be central to tao develpoment in the nine patients identified in this study. it may be that, in the patients with a pre - existing dysthyroid state, the local trauma of the surgery led to inflammation in a pre - sensitized host that stimulated the development of tao. in the subset of patients with no previous dysthyroid state (group 2), other factors may also be involved. surgery may lead to the development of tao and graves ' hyperthyroidism in predisposed patients. these immunologically susceptible people may be impacted by local mechanisms that prime site - specific responses. it is of note that smoking imposes a seven - fold increased risk for the development of tao in people who develop thyroid dysfunction. the mechanism for this is unknown, but it may be related to microvascular ischemia that causes anoxic responses in all tissues, but the site specificity is granted via particular cell types in the orbit. local trauma may lead to local inflammatory pathways sensitizing orbit - specific cells and priming the immune system to various site - specific antigens including the orbit and thyroid gland. it is possible that the five patients (group 2) who had no history of dysthyroid state may have had subclinical graves ' hyperthyroidism in which the progression to tao was simply coincidental with the surgery they underwent. however, no constant symptom during the detailed history review was found to suggest this. it is important to quickly identify this subgroup of patients as the manifestations of tao are more severe in middle aged or older patients,3 and certainly three patients in this study required systemic treatment, radiotherapy, and eventual surgery to alleviate compressive neuropathy due to their tao. although it is difficult to generalize a condition with such protean manifestations, it may be reasonable to screen patients on a history basis for any immunological mediated thyroid disease. we do not necessarily advocate thyroid function tests for all preoperative patients, but in many centers they are routinely done as part of the preoperative workup. there may be a role for preoperative baseline blood work to detect the use of systemic steroids before periocular surgery in a patient that gives a history of a previous immunological mediated dysthyroid state. shortcomings of this study are the lack of a control group and the small number of participants. additional case - control studies will be needed to identify the cause - and - effect relationship between tao and periocular surgery. in this paper we present nine patients who developed tao of varying severity after cataract surgery or cosmetic surgery around the orbit. this may be related to the local inflammatory process stimulating exaggerated autoimmune responses in predisposed individuals. furthermore, it may be important to counsel patients with pre - existing dysthyroid states undergoing surgery about the possibility of exacerbating their condition. lastly, in cosmetic surgery patients, any prolonged recovery or development of diplopia or lid retraction may prompt an investigation for tao.	purposeto descirbe a series of patients in which thyroid associated orbitopathy (tao) occurred after periocular surgery.methodsa retrospective case review of patients who developed tao in close temporal association with periocular surgical interventions and presented at the orbital clinic from 1997 to 2004. history of previous thyroid abnormality and the lack of tao signs and symptoms before surgery were reviewed and analyzed.resultsnine patients that developed tao in association with periocular surgery were identified. all were women with an average age of 59.3years. (range : 45 - 75 years). the patients divided into two groups. group 1 consisted of four patients who had previously been diagnosed with graves ' hyperthyroidism (gh). they ranged in age from 48 to 75 years (average : 58.8 years). the diagnosis of gh had been made an average of 50.5 months (range : 12 - 96 months) before presentation with tao. group 2 consisted of five patients who had no previous history of thyroid abnormality. they ranged in age from 45 to 74 years (average : 60.2 years). no patients had any signs or symptoms of tao before their recent presentation.conclusionsperiocular surgery may lead to local inflammatory events that may contribute to the instigation of tao in predisposed individuals.
blood samples and tumour tissues were obtained from 117 operated lung cancer patients admitted to oslo university hospitalrikshospitalet in the period 20062011. the collected tumor samples consisted of 93 adenocarcinomas, 2 large cell carcinomas and 22 squamous cell carcinomas. one patient was diagnosed with metastases based on pathology report, and was omitted from survival analyses. tumour tissue was snap frozen in liquid nitrogen and stored at 80c until dna isolation. dna was extracted using maxwell16 dna purification kits and a maxwell16 instrument according to technical manual (literature # tm284)(http://www.promega.com). dna from blood was isolated using the master pure dna purification kit for blood according to the dna purification protocol (http://www.epicentre.com). targeted resequencing was performed using the sureselect human kinome kit (agilent technologies), with capture probes targeting 3.2 mb of the human genome, including exons and untranslated regions (utrs) of all known kinases and selected cancerrelated genes (612). library construction and in solution capturing was performed following agilent 's sureselectxt library construction kit and sureselect target enrichment protocol, respectively. sequencing was performed on an illumina genome analyzer using truseq sbs kit v5 generating pairedend reads of 75 bp in length. base calling, demultiplexing and quality filtering was performed using illumina 's software packages scs2.8/rta1.8 and offline basecallerv1.8. the raw sequencing reads derived from tumour and control samples were subsequently processed in a computational pipeline to identify and functionally annotate somatic dna changes. a variant calling pipeline was established to identify somatic mutations in each tumour / control sample pair. this included several steps : (i) alignment of sequence reads toward the reference genome (grch37 including unlocalised / unplaced contigs and decoy sequences) using bwamem,9 (ii) marking of potential pcrderived duplicate reads using picard (http://broadinstitute.github.io/picard/), (iii) local realignment around indel sites using gatk realignertargetcreator and indelrealigner,10 (iv) base quality recalibration using gatk baserecalibrator, and (v) somatic single nucleotide variant (snv) and short insertion / deletion (indel) calling using strelka and mutect algorithms.11, 12 for snvs, we only considered calls designated as somatic by both mutect and strelka (indels were called by strelka only). our pipeline was recently part of a wholegenome benchmarking exercise organized through icgc, in which our performance was assessed for snv (precision = 0.90, recall = 0.73) and indel calling (precision = 0.71, recall = 0.70).13 to understand the functional role of identified variants, all variants were subject to a computational annotation workflow including a modified version of annovar (release 2015dec14, using ensembl as the gene model), cosmic (known somatic cancer variants and cancer gene census, v76 february 2016), pfam (protein domain information, v27.0), uniprot kb (functional protein properties, release 2016_02), the drug gene interaction database (druggable targets, version 2.0), database of curated mutations (release january 2016), and database of computational predictions of effects of nonsynonymous variants, v2.1.13, 14, 15, 16, 17, 18 we used intogen (integrative onco genomics) to identify cancer driver genes in our sample cohort. considering that a frequencybased approach to discover significantly mutated genes is suboptimal in samples with low mutation counts, intogen uses an approach by which a clustering and functional bias among gene mutations (across the sample cohort) indicates driver candidates.19 we have previously reported on the survival impact of stromal cd8 expression (cytotoxic tcells) including most of the patients in this study (n = 107).7 in short, tissue microarrays were used for determination of an immunoscore by immunohistochemistry cd8 staining by ventana benchmark, xt automated slide stainer (ventana medical system). by light microscopy, the tissue cores were scored for the degree of infiltration of cd8 + lymphocytes. the percentages of cd8 + lymphocytes among all nucleated cells in the stromal compartments were assessed. scoring cutoff points at 5%, 25%, or 50% were used for each core. all samples were anonymized and independently scored by two pathologists. the mean score for duplicate cores from each individual was calculated and the median stromal cd8 score was used as cutoff. time to relapse was calculated from the date of diagnosis to the date of diagnosed local relapse, distant metastasis, or lung cancer death with a maximum followup time of 80 months after surgery. the survival analyses were performed using spss (pasw statistics for windows, version 18.0, chicago : spss). survival curves and estimation of statistical significance between the survival curves utilized the kaplanmeier method and log rank test, respectively. a cox regression model was applied for the multivariate survival analysis using spss (v. 18). probes that targeted the human kinome were captured and sequenced at 5060 coverage in 117 tumourcontrol sample pairs. the medians for allelic fraction and read depth at confident variant sites were 0.2 and 84, respectively. the best covered variant sites (read depth of 150) enabled detection of variants with allelic fraction as low as 34%. in addition to coding exonic sequences, the targeted regions included canonical splice sites in introns, as well as utrs. each tumour sample had an accompanying control sample (blood), which allowed the detection of point mutations and insertions / deletions of somatic origin. our pipeline for somatic mutation detection relied on a consensus between two different algorithms (mutect and strelka), a strategy that performed well in a previous benchmarking exercise.20 only mutations called by both the algorithms were thus included in the further analysis. the number of coding mutations varied extensively between tumours, ranging from 0 to 50 (mean = 11, median = 9). calculation of coding mutations in the same genes (i.e., kinome) of tcga lung adenocarcinoma samples revealed similar numbers (mean 13.2, median 9).21 there was no significant difference in number of mutations between men and women or between tumours with different histological subtypes. number of mutations was significantly associated with packyears of tobacco smoking (p = 0.009). the tp53 gene and the ttn gene were the most frequently mutated genes, the latter being a known artefact due to its large size (fig. 1 a). the tp53 mutations were all validated by sanger sequencing where the sequences were aligned and analysed using seqscape v.2.5 according to the project template [tp53 accession nr. (a) recurrence of somatically mutated genes. shown are all mutated genes with a recurrence frequency > = 4% among all 117 samples. ad = adenocarcinoma, scc = squamous cell carcinoma, lcc = large cell carcinoma. genes defined by intogen as significant cancer drivers are indicated in red. through use of intogen, kras, egfr, tp53 and kras was mutated in 28 samples (27 adenocarcinomas, one large cell carcinoma). eight samples (seven adenocarcinomas) were mutated in the stk11 gene. only adenocarcinomas were egfrmutated, with mainly l858r mutations and exon 19 deletions. twentyseven samples had mutations in known dna repair genes,1 including palb2, atm, atr, brca1, brca2, fancl, chek1, chek2 and clk2. there was a significant correlation between mutations in one of these genes and the total number of mutations (p < 0.001). tumours with a mutation in tp53, atm or atr had an increased number of mutations when analysed separately (fig. 2), whereas tumours with mutations in the other repair genes did not show a significant increase by themselves ; however, the number of samples in these groups were small. mutations in one of the dna repair genes were significantly associated with a higher number of mutations. mutations in tp53, atr and atm alone were associated with a higher number of mutations. the tumours were divided in three separate groups based on an immunoscore reflecting the number of infiltrating cd8 + tlymphocytes, as defined by donnem.7 there was no significant association between immunoscore and the number of point mutations. however, when using the median stromal cd8score as cutoff (high score n = 58, low score n = 49), there was a significant inverse correlation between the number of infiltrating stromal cd8 + lymphocytes and presence of egfr mutations (r = 0.21, p = 0.029) (pearson). patients with more than the median number of mutations in their tumours had shorter relapsefree survival than patients with submedian mutation counts (fig. multivariate analysis of relapsefree survival was performed using cox regression to study the influence of known prognostic factors (histology, stage, sex). the number of mutations was not significantly associated with survival in a coxanalysis with number of mutations as a continuous variable (p = 0.60). however, the number of mutations (over median) was found to be significantly associated with time to progression after adjusting for clinical variables (p = 0.021). there was a tendency toward increased relapsefree survival for patients with high cd8score (p = 0.10). twentyseven samples had mutations in known dna repair genes,1 including palb2, atm, atr, brca1, brca2, fancl, chek1, chek2 and clk2. there was a significant correlation between mutations in one of these genes and the total number of mutations (p < 0.001). tumours with a mutation in tp53, atm or atr had an increased number of mutations when analysed separately (fig. 2), whereas tumours with mutations in the other repair genes did not show a significant increase by themselves ; however, the number of samples in these groups were small. mutations in one of the dna repair genes were significantly associated with a higher number of mutations. mutations in tp53, atr and atm alone were associated with a higher number of mutations. the tumours were divided in three separate groups based on an immunoscore reflecting the number of infiltrating cd8 + tlymphocytes, as defined by donnem.7 there was no significant association between immunoscore and the number of point mutations. however, when using the median stromal cd8score as cutoff (high score n = 58, low score n = 49), there was a significant inverse correlation between the number of infiltrating stromal cd8 + lymphocytes and presence of egfr mutations (r = 0.21, p = 0.029) (pearson). patients with more than the median number of mutations in their tumours had shorter relapsefree survival than patients with submedian mutation counts (fig. multivariate analysis of relapsefree survival was performed using cox regression to study the influence of known prognostic factors (histology, stage, sex). the number of mutations was not significantly associated with survival in a coxanalysis with number of mutations as a continuous variable (p = 0.60). however, the number of mutations (over median) was found to be significantly associated with time to progression after adjusting for clinical variables (p = 0.021). there was a tendency toward increased relapsefree survival for patients with high cd8score (p = 0.10). by secondgeneration sequencing, we have confirmed that lung cancers are highly heterogeneous in terms of somatic mutation profiles, and that the number of mutations is associated with patient survival. an improved understanding of tumour emergence relies on the identification of genes that drive carcinogenesis. several bioinformatics approaches have been proposed to identify driver genes, all with shortcomings and particular biases.19 given the limited number of mutations per tumour kinome, we chose an approach (intogen) that emphasizes enrichment of clustered and functionally biased mutations. this algorithm has previously demonstrated its capability of detecting cancer drivers.19 when applying the intogen algorithm on our dataset, tp53, egfr, kras, and stk11 were identified as significant driver genes, as previously described.21 despite extensive efforts, no effective treatments targeting tp53 and kras have been presented up to now. conversely, targeted treatment of mutated egfr has changed the prospects for the subset of patients with lung egfrmutationpositive lung cancers. stk11 is a serine / threonine kinase and a tumour suppressor and has been ranked as the third most frequently mutated gene in lung cancers.22 it is implicated in cell polarity, energy metabolism, apoptosis, cell cycle arrest and proliferation. the mutations observed were in the protein kinase domain, but are probably inactivating as stk11 is a tumour suppressor. other known genes involved in lung carcinogenesis, like alk and ros1, were also mutated in a small subset of the tumours. however, these genes are usually changed by inversions and translocations, not detected by our sequencing analysis. they hamper tumour development, but unfortunately tumours can prevent sustained tcell responses via immune checkpoints. unfortunately, good predictive biomarkers for response to checkpoint inhibitors are hitherto lacking.23 there have been several reports indicating that the effect of induced immuneresponse correlates with the number of mutations, with the novel immunotherapeutic checkpoint inhibitors having better efficacy on tumours with a high number of mutations.8 egfrmutated tumours generally have lower number of mutations.24 in our study, we found significantly more infiltrating stromal cd8 + tcells in tumours without egfr mutations. this would be in accordance with a higher number of immunogenic antigens in tumours with a high number of mutations. in addition, this is in accordance with the lack of cd8 + lymphocyte response in egfrmutant mice models and human tumours.25 mutations in dna repair genes would most often lead to repair defects, which would in turn allow certain types of mutations to accumulate. in our material, we find a significant association between number of mutations and mutated dna repair genes. whether the significantly higher number of mutations is a consequence of dysfunctional dna repair genes in these cases has not been determined. clearly, our study is limited in size, so ruling out which genes in the dnarepair pathway are the most important should be studied more extensively, perhaps revealing a correlation of mutation signature to specific defects. a total of only 28 samples were mutated in the dna repair genes. despite the modest number of samples in our cohort, we report a correlation between number of mutations and course of disease. in the present era of evolving immune therapies, we believe this to be an important insight, which needs more attention in larger cohorts, and possibly with a further potential in the clinical setting.	lung cancer is the leading cause of cancer related death, and the past years improved insight into underlying molecular events has significantly improved outcome for specific subsets of patients. in particular, several new therapies that target protein kinases have been implemented, and many more are becoming available. we have investigated lung cancer specimens for somatic mutations in a targeted panel of 612 human genes, the majority being protein kinases. the somatic mutation profiles were correlated to profiles of immune cell infiltration as well as relapsefree survival. targeted deep sequencing was performed on 117 tumour / normal pairs using the sureselect human kinome kit (agilent technologies), with capture probes targeting 3.2 mb of the human genome, including exons and untranslated regions of all known kinases, kinase receptors and selected cancerrelated genes (612 genes in total). cd8 staining was determined using ventana benchmark. survival analyses were performed using spss. the number of mutations per sample ranged from 0 to 50 (within the 612 genes tested), with a median of nine. the prognosis was worse for patients with more than the median number of mutations. a significant correlation was found between mutations in one of selected dnarepair genes and the total number of mutations in that tumour (p < 0.001). there was a significant inverse correlation between the number of infiltrating stromal cd8 + lymphocytes and the presence of egfr mutations.
natural variability in climate is a function of : (i) the relative position of the sun (and its activity such as sunspots, radiation, magnetism, eruption) and the earth ; (ii) the milankovitch cycles (1) ; and (iii) the interactions between the components of the climate system, i.e. the atmosphere, the hydrosphere, the cryosphere, the biosphere and the lithosphere. for centuries a panoply of climate signals have been noted, ranging from the diurnal, to multi - decadal effects including seasonal, quasi - biennial (qb), el - nio / southern oscillation (enso), quasi - decadal (qd) and inter - decadal (i d) oscillations (2). adding to these natural cycles and oscillations is the anthropogenic component from population increase, energy needs and associated pollution. natural climate oscillations interact with the anthropogenic climate change component, and directly impact ecosystems, public health and socio - economic conditions. the natural variability of the global climate during the 20th century is reproduced in fig. 1 [see also (3) ]. during the 20th century a global statistical analysis in the frequency - domain of both sea - surface temperature and sea - level pressure, allows identification of natural climate signals. coloured bands highlight those signals with their percentage of variance displayed on the ordinates, i.e. secular signal or penta - decadal (blue band, signal # 1), el - nio / southern oscillation or enso (orange bands, signals # 4, 5 and 6), the quasi - biennial signal (green bands, signals # 7 and 8). signal # 2 i d or inter - decadal, and signal # 3 qd or quasi - decadal, are more locals and found over the pacific and atlantic oceans, respectively (2). the anthropogenic climate change is interacting and modulates the above climate signals. climate change alters regional and local social and economic dynamics with the potential of bringing additional inequalities all around the world (4). climate change had impacts in historical times with respect to the development of many cultures. changes have been observed in nutrient budgets and nutrient cycles, with enhanced human pressure through population increase and public health impacts. the total primary energy demand is expected to increase by ~60% during the first quarter of the 21st century. most of this energy will come from fossil sources, and unfortunately only 12% is expected from renewable sources. such disequilibrium is likely to create socio - economic chaos, regional and local vulnerability in terms of prices and supply, and have considerable impacts on the environment and public health, for example, on infectious diseases, respiratory and circulatory problems, pollution, allergen - related diseases and impaired immune systems. public health issues will also be exacerbated by poor water quality and malnutrition, leading to huge costs and increasing poverty. climate change perturbs important physical and biological systems to which human populations are generally biologically and culturally adjusted. the various environmental changes linked to natural and anthropogenic variability and changes in climate, and loss of biodiversity though land - use changes, will all have their own impacts on public health. it is recognised that beneficial impacts such as decreases in cold - related deaths are also anticipated. direct influence from demographic factors may increase risks of infectious diseases being transmitted from person - to - person. thus, socio - economic impacts on infectious diseases and public health, arising from climate and environmental changes, require attention. most emerging (or re - emerging) infectious diseases (including vector - borne diseases) are due partly to changes in microbial traffic, for example, the introduction of pathogens from wildlife into human populations already at risk. changes in transmission of diseases by vectors (such as mosquitoes) may arise from new vector reservoirs in different habitats, the changing climate and environmental determinants of which deserve further investigation. these processes may depend upon ecological and environmental factors, but the spread of diseases is also facilitated by climate variability / change, population migration, demographic crowding effects, sanitation levels and/or breakdowns in public health systems. as of today, the increase in occurrence of many infectious diseases reflects the compounded effects of climatic and environmental changes, population increases, economic, social and technological changes. the challenge for assessing socio - economic impact of infectious diseases (~75% of actual infectious diseases in humans are zoonoses) can not be addressed without considering both abiotic and biotic environmental factors that affect the maintenance and transmission of the diseases. the last 25 years have witnessed an explosion of environmentally related diseases and disorders, with strong environmental forcing and adaptation or lack thereof. for infectious diseases, this includes increases in prevalence, incidence and geographical distribution across wide taxonomic ranges, related to climatic and environmental changes and practical changes in land - use. the understanding of these associated changes represents an important step for moving away from the more traditional individual - centred view of microbiology and medical epidemiology. direct health effects of climate variability and change include : (i) changes in mortality and morbidity arising from heat - waves and thermal stress (such as in 2003 over southwest europe ; and to a lesser degree in 2007 over italy and greece) ; (ii) respiratory ailments associated with modified concentrations of particulate matter and aero - allergens (e.g. spores, moulds) and/or air pollutants ; and (iii) health consequences from extreme weather events, including storms, floods and gales. indirect health effects arise from perturbation of more complex ecological systems, and include changes in the ecology, range and activity of vectors and associated diseases (i.e. malaria, west nile virus, rift valley fever (rvf), avian flu, chickungunya, dengue fever and others) (5) ; changes in the environment for water - borne diseases and pathogens (i.e. gastro - intestinal infections, vibrio diseases including cholera, diseases from polluted water and others) ; changes in the atmospheric boundary layer, and transmission of air - borne diseases (i.e. meningitis, respiratory ailments and others) ; changes in regional and local agricultural practices and food availability which can lead to malnutrition and lack of fresh water. public health can also be affected by massive population movements along narrow coastal regions, and by regional conflicts arising from declining agricultural and water resources. some diseases have already extended their endemic range, such as leishmaniasis in southern europe and the maghreb. climate change may facilitate habitat extension for sandfly and other phlebotome vectors northwards, whilst the ecology and geography of the tick species responsible for transmitting lyme disease may profoundly change. climate change affects regional socio - economic costs and losses, through changes in temperature and soil moisture, inherent use of fertilisers and pest and pathogen activity. decision - making models to be used must include : identification of normal impacts of disease (in lives and economic terms).definition of climate events linked to health events (epidemics, endemics, pandemics).definition of increased impacts and socio - economic losses.identification of methods for loss mitigation.definition of real costs for effective implementation of services such as health information systems (his).quantification of real savings (including lives) if a well - identified health event does not occur. definition of climate events linked to health events (epidemics, endemics, pandemics). definition of real costs for effective implementation of services such as health information systems (his). even if regional modelling studies consistently indicate that tropical and sub - tropical countries would be most affected, changing climate and environment at higher latitudes must also be considered. forecasting climate change impacts on public health requires the development of scenario - based risk assessments which must include generalised assessment of the consequences from complex demographic, social and economical disruptions. integrated mathematical modelling must be used if one wants to estimate the future impacts of climate change on health (6). such new modelling requires that each component of the chain of causation : climate, environmental and social change is fully represented. uncertainties do remain and are due to future industrial and economic activities, interactions between and within natural systems, and differences in sensitivity of disease systems and vulnerability of populations. differences in population vulnerability could arise from heterogeneity of human culture, social relations and behaviour. non - linear uncertainties arise from the stochastic nature of the biophysical systems being modelled. local anthropogenic deforestation may directly alter the distribution of vector - borne diseases while also cause a local increase in temperature (positive feedback). public health indicators and disease surveillance activities should be integrated with other in - situ monitoring systems developed by the united nations, such as global climate observing system (gcos), global ocean observing system (goos), global terrestrial observing system (gtos) and the integrated global earth observation system of systems (geoss). today, the use of satellites allows monitoring in high resolution of changes in environmental and climatic parameters. this provides an important continuum of observational spatio - temporal scales on both oceanic and terrestrial environmental structures, which should never be interrupted. natural variability in climate is a function of : (i) the relative position of the sun (and its activity such as sunspots, radiation, magnetism, eruption) and the earth ; (ii) the milankovitch cycles (1) ; and (iii) the interactions between the components of the climate system, i.e. the atmosphere, the hydrosphere, the cryosphere, the biosphere and the lithosphere. for centuries a panoply of climate signals have been noted, ranging from the diurnal, to multi - decadal effects including seasonal, quasi - biennial (qb), el - nio / southern oscillation (enso), quasi - decadal (qd) and inter - decadal (i d) oscillations (2). adding to these natural cycles and oscillations is the anthropogenic component from population increase, energy needs and associated pollution. natural climate oscillations interact with the anthropogenic climate change component, and directly impact ecosystems, public health and socio - economic conditions. the natural variability of the global climate during the 20th century is reproduced in fig. 1 [see also (3) ]. during the 20th century a global statistical analysis in the frequency - domain of both sea - surface temperature and sea - level pressure, allows identification of natural climate signals. coloured bands highlight those signals with their percentage of variance displayed on the ordinates, i.e. secular signal or penta - decadal (blue band, signal # 1), el - nio / southern oscillation or enso (orange bands, signals # 4, 5 and 6), the quasi - biennial signal (green bands, signals # 7 and 8). signal # 2 i d or inter - decadal, and signal # 3 qd or quasi - decadal, are more locals and found over the pacific and atlantic oceans, respectively (2). the anthropogenic climate change is interacting and modulates the above climate signals. climate change alters regional and local social and economic dynamics with the potential of bringing additional inequalities all around the world (4). climate change had impacts in historical times with respect to the development of many cultures. changes have been observed in nutrient budgets and nutrient cycles, with enhanced human pressure through population increase and public health impacts. the total primary energy demand is expected to increase by ~60% during the first quarter of the 21st century. most of this energy will come from fossil sources, and unfortunately only 12% is expected from renewable sources. such disequilibrium is likely to create socio - economic chaos, regional and local vulnerability in terms of prices and supply, and have considerable impacts on the environment and public health, for example, on infectious diseases, respiratory and circulatory problems, pollution, allergen - related diseases and impaired immune systems. public health issues will also be exacerbated by poor water quality and malnutrition, leading to huge costs and increasing poverty. climate change perturbs important physical and biological systems to which human populations are generally biologically and culturally adjusted. the various environmental changes linked to natural and anthropogenic variability and changes in climate, and loss of biodiversity though land - use changes, will all have their own impacts on public health. it is recognised that beneficial impacts such as decreases in cold - related deaths are also anticipated. direct influence from demographic factors may increase risks of infectious diseases being transmitted from person - to - person. thus, socio - economic impacts on infectious diseases and public health, arising from climate and environmental changes, require attention. most emerging (or re - emerging) infectious diseases (including vector - borne diseases) are due partly to changes in microbial traffic, for example, the introduction of pathogens from wildlife into human populations already at risk. changes in transmission of diseases by vectors (such as mosquitoes) may arise from new vector reservoirs in different habitats, the changing climate and environmental determinants of which deserve further investigation. these processes may depend upon ecological and environmental factors, but the spread of diseases is also facilitated by climate variability / change, population migration, demographic crowding effects, sanitation levels and/or breakdowns in public health systems. as of today, the increase in occurrence of many infectious diseases reflects the compounded effects of climatic and environmental changes, population increases, economic, social and technological changes. the challenge for assessing socio - economic impact of infectious diseases (~75% of actual infectious diseases in humans are zoonoses) can not be addressed without considering both abiotic and biotic environmental factors that affect the maintenance and transmission of the diseases. the last 25 years have witnessed an explosion of environmentally related diseases and disorders, with strong environmental forcing and adaptation or lack thereof. for infectious diseases, this includes increases in prevalence, incidence and geographical distribution across wide taxonomic ranges, related to climatic and environmental changes and practical changes in land - use. the understanding of these associated changes represents an important step for moving away from the more traditional individual - centred view of microbiology and medical epidemiology. direct health effects of climate variability and change include : (i) changes in mortality and morbidity arising from heat - waves and thermal stress (such as in 2003 over southwest europe ; and to a lesser degree in 2007 over italy and greece) ; (ii) respiratory ailments associated with modified concentrations of particulate matter and aero - allergens (e.g. spores, moulds) and/or air pollutants ; and (iii) health consequences from extreme weather events, including storms, floods and gales. indirect health effects arise from perturbation of more complex ecological systems, and include changes in the ecology, range and activity of vectors and associated diseases (i.e. malaria, west nile virus, rift valley fever (rvf), avian flu, chickungunya, dengue fever and others) (5) ; changes in the environment for water - borne diseases and pathogens (i.e. gastro - intestinal infections, vibrio diseases including cholera, diseases from polluted water and others) ; changes in the atmospheric boundary layer, and transmission of air - borne diseases (i.e. meningitis, respiratory ailments and others) ; changes in regional and local agricultural practices and food availability which can lead to malnutrition and lack of fresh water. public health can also be affected by massive population movements along narrow coastal regions, and by regional conflicts arising from declining agricultural and water resources. some diseases have already extended their endemic range, such as leishmaniasis in southern europe and the maghreb. climate change may facilitate habitat extension for sandfly and other phlebotome vectors northwards, whilst the ecology and geography of the tick species responsible for transmitting lyme disease may profoundly change. climate change affects regional socio - economic costs and losses, through changes in temperature and soil moisture, inherent use of fertilisers and pest and pathogen activity. decision - making models to be used must include : identification of normal impacts of disease (in lives and economic terms).definition of climate events linked to health events (epidemics, endemics, pandemics).definition of increased impacts and socio - economic losses.identification of methods for loss mitigation.definition of real costs for effective implementation of services such as health information systems (his).quantification of real savings (including lives) if a well - identified health event does not occur. definition of real costs for effective implementation of services such as health information systems (his). even if regional modelling studies consistently indicate that tropical and sub - tropical countries would be most affected, changing climate and environment at higher latitudes must also be considered. forecasting climate change impacts on public health requires the development of scenario - based risk assessments which must include generalised assessment of the consequences from complex demographic, social and economical disruptions. integrated mathematical modelling must be used if one wants to estimate the future impacts of climate change on health (6). such new modelling requires that each component of the chain of causation : climate, environmental and social change is fully represented. uncertainties do remain and are due to future industrial and economic activities, interactions between and within natural systems, and differences in sensitivity of disease systems and vulnerability of populations. differences in population vulnerability could arise from heterogeneity of human culture, social relations and behaviour. non - linear uncertainties arise from the stochastic nature of the biophysical systems being modelled. local anthropogenic deforestation may directly alter the distribution of vector - borne diseases while also cause a local increase in temperature (positive feedback). public health indicators and disease surveillance activities should be integrated with other in - situ monitoring systems developed by the united nations, such as global climate observing system (gcos), global ocean observing system (goos), global terrestrial observing system (gtos) and the integrated global earth observation system of systems (geoss). today, the use of satellites allows monitoring in high resolution of changes in environmental and climatic parameters. this provides an important continuum of observational spatio - temporal scales on both oceanic and terrestrial environmental structures, which should never be interrupted. infectious diseases remain a considerable challenge to public health. in the context of climate change and the rapidly increasing population as mentioned above, some epidemics are emerging or re - emerging such as the rvf over west africa, dengue fever over northern argentina and chikungunya in the indian ocean and northern italy, among others. following the french contribution and presentation during the johannesburg summit 2002, a new conceptual approach has been developed : so - called tele - epidemiology (7). it aims to monitor and study the spread of human and animal infectious diseases which are closely tied to climate and environmental changes. by combining satellite - originated data on vegetation (spot), meteorology (meteosat, trmm), oceanography (topex / poseidon ; envisat, jason) with hydrology data (distribution of lakes, water levels in rivers, ponds and reservoirs), with clinical data from humans and animals (clinical cases and serum use), lately as a part of the french ministry of research 's earth space network, a pilot sentinel network has been deployed in niger and burkina faso for monitoring infectious diseases such as malaria, which is also tied to changing environmental factors. this integrated and multidisciplinary approach of tele - epidemiology includes : monitoring and assembling multidisciplinary in - situ datasets to extract and identify physical and biological mechanisms at stake;remote - sensing monitoring of climate and environment, linking epidemics with confounding factors such as rainfall, vegetation, hydrology and population dynamics ; anduse of bio - mathematical models for epidemic dynamics, vector aggressiveness and associated risks.as such an interactive tool contributing to his on re - emergent and new infectious diseases (redgems) was born (8). it constitutes the main pillar of tele - epidemiology by facilitating real - time monitoring of human and animal health and the exchanges of epidemiological, clinical and entomological data. the primary mission of redgems (www.redgems.org) is to contribute towards the development of early warning systems (ews) for infectious diseases and contribute to the main three actions of tele - epidemiology presented above. the overall objective is to attempt predicting and mitigating public health impacts from epidemics, endemics and pandemics. monitoring and assembling multidisciplinary in - situ datasets to extract and identify physical and biological mechanisms at stake ; remote - sensing monitoring of climate and environment, linking epidemics with confounding factors such as rainfall, vegetation, hydrology and population dynamics ; and use of bio - mathematical models for epidemic dynamics, vector aggressiveness and associated risks. the various components of the new conceptual approach described above have been thoroughly tested with regard to the emerging rvf in the ferlo (senegal). this successful approach has led the senegalese government to provide funding, and extend the approach to all risk zones (i.e. hazards + vulnerability) where populations and cattle are exposed (9). the ferlo region in senegal, became prone to rvf in the late 1980s with the appearance of infected vector mosquitoes of the aedes vexans and culex poicilipes species (10, 11). so far, human - related disease symptoms are often limited to flu - like syndromes but can include more severe forms of encephalitis and haemorrhagic fevers. as a result, local socio the ultimate goal was to use specific geographical information system (gis) tools (12) and remote - sensing (rs) images and data to detect potential breeding ponds and evaluate rvf transmission and areas potentially at risk, characterised as zones potentially occupied by mosquitoes (zpoms). a schematic design of the integrated conceptual approach to determine the environmental risk levels of rvf is presented in fig. 2. the upper left box in the figure identifies key entomological factors for a. vexans (flying - range, aggressiveness and embryogenesis), environmental factors (rainfall distribution, limnimetry and pond dynamics) as well as pastoral data such as the zones where animals are penned at night. from the upper right box, the detection of lead environmental and climatic factors (mainly rainfall) favouring the mechanisms presented are highlighted. for example, localities and optimal pond conditions for the breeding and hatching of a. vexans can be modelled (13). the integration of all the above components leads to the notion of risks : hazards and exposure vulnerability of hosts. this original approach (14) bridges the physical and biological mechanisms, linking environmental conditions to the production of rvf vectors and accompanying potential risks. the basic components for the concept are presented in the top three boxes : in - situ data (upper left), remotely sensed data (upper right) and zone potentially occupied by mosquitoes or zpoms and productive rainfall in terms of production of mosquitoes / vectors (centre). the bottom three boxes distinguish between hazards (bottom left), vulnerability (bottom right), both leading to the environmental risks (very bottom). out of 18 rainfall events obtained from trmm for the 2003 rainy season, seven were considered as zone potentially occupied by mosquitoes, or zpoms with ranked hazards from yellow (low hazards) to red (high hazards). zpoms in the barkedji area constructed from the pond distribution after a single rainfall event (top left). localisation of the barkedji village and ruminants fenced - in areas (vulnerability, from quickbird) in black for the same area and period (top right). potential risks i.e. hazards + vulnerability are shown by super - imposing the two pictures (bottom). following the french contribution and presentation during the johannesburg summit 2002, a new conceptual approach has been developed : so - called tele - epidemiology (7). it aims to monitor and study the spread of human and animal infectious diseases which are closely tied to climate and environmental changes. by combining satellite - originated data on vegetation (spot), meteorology (meteosat, trmm), oceanography (topex / poseidon ; envisat, jason) with hydrology data (distribution of lakes, water levels in rivers, ponds and reservoirs), with clinical data from humans and animals (clinical cases and serum use), predictive mathematical models can be constructed. lately as a part of the french ministry of research 's earth space network, a pilot sentinel network has been deployed in niger and burkina faso for monitoring infectious diseases such as malaria, which is also tied to changing environmental factors. this integrated and multidisciplinary approach of tele - epidemiology includes : monitoring and assembling multidisciplinary in - situ datasets to extract and identify physical and biological mechanisms at stake;remote - sensing monitoring of climate and environment, linking epidemics with confounding factors such as rainfall, vegetation, hydrology and population dynamics ; anduse of bio - mathematical models for epidemic dynamics, vector aggressiveness and associated risks.as such an interactive tool contributing to his on re - emergent and new infectious diseases (redgems) was born (8). it constitutes the main pillar of tele - epidemiology by facilitating real - time monitoring of human and animal health and the exchanges of epidemiological, clinical and entomological data. the primary mission of redgems (www.redgems.org) is to contribute towards the development of early warning systems (ews) for infectious diseases and contribute to the main three actions of tele - epidemiology presented above. the overall objective is to attempt predicting and mitigating public health impacts from epidemics, endemics and pandemics. monitoring and assembling multidisciplinary in - situ datasets to extract and identify physical and biological mechanisms at stake ; remote - sensing monitoring of climate and environment, linking epidemics with confounding factors such as rainfall, vegetation, hydrology and population dynamics ; and use of bio - mathematical models for epidemic dynamics, vector aggressiveness and associated risks. the various components of the new conceptual approach described above have been thoroughly tested with regard to the emerging rvf in the ferlo (senegal). this successful approach has led the senegalese government to provide funding, and extend the approach to all risk zones (i.e. hazards + vulnerability) where populations and cattle are exposed (9). the ferlo region in senegal, became prone to rvf in the late 1980s with the appearance of infected vector mosquitoes of the aedes vexans and culex poicilipes species (10, 11). so far, human - related disease symptoms are often limited to flu - like syndromes but can include more severe forms of encephalitis and haemorrhagic fevers. as a result, local socio the ultimate goal was to use specific geographical information system (gis) tools (12) and remote - sensing (rs) images and data to detect potential breeding ponds and evaluate rvf transmission and areas potentially at risk, characterised as zones potentially occupied by mosquitoes (zpoms). a schematic design of the integrated conceptual approach to determine the environmental risk levels of rvf is presented in fig. the upper left box in the figure identifies key entomological factors for a. vexans (flying - range, aggressiveness and embryogenesis), environmental factors (rainfall distribution, limnimetry and pond dynamics) as well as pastoral data such as the zones where animals are penned at night. from the upper right box, the detection of lead environmental and climatic factors (mainly rainfall) favouring the mechanisms presented are highlighted. for example, localities and optimal pond conditions for the breeding and hatching of a. vexans can be modelled (13). the integration of all the above components leads to the notion of risks : hazards and exposure vulnerability of hosts. this original approach (14) bridges the physical and biological mechanisms, linking environmental conditions to the production of rvf vectors and accompanying potential risks. the basic components for the concept are presented in the top three boxes : in - situ data (upper left), remotely sensed data (upper right) and zone potentially occupied by mosquitoes or zpoms and productive rainfall in terms of production of mosquitoes / vectors (centre). the bottom three boxes distinguish between hazards (bottom left), vulnerability (bottom right), both leading to the environmental risks (very bottom). thus, parks and villages can easily be identified. out of 18 rainfall events obtained from trmm for the 2003 rainy season, zone potentially occupied by mosquitoes, or zpoms with ranked hazards from yellow (low hazards) to red (high hazards). zpoms in the barkedji area constructed from the pond distribution after a single rainfall event (top left). localisation of the barkedji village and ruminants fenced - in areas (vulnerability, from quickbird) in black for the same area and period (top right). potential risks i.e. hazards + vulnerability are shown by super - imposing the two pictures (bottom). climate variability and change, environmental risks and public health are all associated. in the case of potential rvf epidemics, mechanisms linking rainfall variability (and trends), density and aggressiveness of vectors and vulnerability of hosts are presented. using observations in space, we constructed the dynamic evolution of zpoms [fig. 4 ; see also animated on - line version in (9) available at www.geospatialhealth.unina.it ] from the distribution and development of ponds was crucial. it allowed direct identification of rvf risks from discrete and productive rainfall events such as local deep atmospheric convections and propagating squall - lines. this remote - sensing approach and the new integrated concept belongs to the so - called tele - epidemiology developed at cnes (14). dynamic zpoms with ranked hazards (from very unlikely and very low in yellow, to very high in red, bottom scale) and ponds distribution (in blue) during the 2003 rainy season. from the hyperlinked figure available on - line paper, by clicking on the two fat black arrows, animated zpoms from productive rainfall (highlighted in blue, at the bottom right) are displayed (upper arrow for forward motion, lower arrow for backward motion) along with the relative parks locations (vulnerability). climatic and environmental variability and changes identified from space provide the elements for the mapping of risk zones in which necessary conditions for the rvf virus to circulate and be transmitted exist. the evolution of the zpoms during the rainy season reveals areas in which populations and cattle of the ferlo region in senegal are exposed. it can be used in quasi real - time, and results can be linked with biological modelling for virus transmission and circulation and more classical epidemiological models. socio - economic risks may be reduced and mitigated, based upon statistical evaluation of the seasonal rainfall forecasts which can be assessed a few months prior to the rainy season and subsequently updated. for example, results can be immediately applied upstream by the senegalese direction de l'elevage (direl) though strategic displacement of fenced - in areas for cattle penned at night, during the course of the rainy season. nonetheless, socio - economic problems may still arise if the relevant information has not been distributed operationally to all parties involved, through regional his. ultimately, the fully integrated approach should help in understanding the mechanisms leading to potential rvf epidemics and improve the rvf ews. the conceptual approach presented might not apply directly for other vector - borne diseases, whose vectors have different behaviours. thus, physical and biological mechanisms for other infectious diseases and places (including higher latitude regions) need to be studied individually. a similar methodology using space observations may be used, particularly in places where climate and environment are foreseen to change rapidly, as for example currently being implemented for malaria in burkina faso. the authors have not received any funding or benefits from industry to conduct this study.	backgroundclimate and environment vary across many spatio - temporal scales, including the concept of climate change, which impact on ecosystems, vector - borne diseases and public health worldwide.objectivesto develop a conceptual approach by mapping climatic and environmental conditions from space and studying their linkages with rift valley fever (rvf) epidemics in senegal.designponds in which mosquitoes could thrive were identified from remote sensing using high - resolution spot-5 satellite images. additional data on pond dynamics and rainfall events (obtained from the tropical rainfall measuring mission) were combined with hydrological in - situ data. localisation of vulnerable hosts such as penned cattle (from quickbird satellite) were also used.resultsdynamic spatio - temporal distribution of aedes vexans density (one of the main rvf vectors) is based on the total rainfall amount and ponds dynamics. while zones potentially occupied by mosquitoes are mapped, detailed risk areas, i.e. zones where hazards and vulnerability occur, are expressed in percentages of areas where cattle are potentially exposed to mosquitoes bites.conclusionsthis new conceptual approach, using precise remote - sensing techniques, simply relies upon rainfall distribution also evaluated from space. it is meant to contribute to the implementation of operational early warning systems for rvf based on both natural and anthropogenic climatic and environmental changes. in a climate change context, this approach could also be applied to other vector - borne diseases and places worldwide.
patellar dislocation and patellofemoral instability may occur in a young population with varying activity levels. the overall recurrence rate of patellar dislocation after an initial event is close to 40 %. in fact, patients who have a primary patellar dislocation have a 17 % recurrence rate, and patients who sustain repeat patellofemoral joint dislocation have a 49 % recurrence rate. it is obvious that athletic patients have as a goal resumption of their sports activities at the same high level as prior to the episode of dislocation. for less active patients, an increase in their level of activity could be an attractive goal, as strength and stability of the lower limb can prevent re - injury. information about the functional capacity that allows for a safe return to sports after either primary dislocation or surgical stabilization is sparse. it is known that medial patellofemoral ligament (mpfl) reconstruction and rehabilitation improves the ability to perform routine activities of daily living [8, 13 ], but it is less evident as regards the ability to resume sports participation safely. testing protocols are requested after patellar dislocation to assure a safe return to sport (rts), but information on this issue is currently limited in the literature. thus far, quantitative assessment was recommended, but as it will be shown in this article, qualitative measurement with a systematic video analysis has to be considered to better evaluate the dynamic stability of the knee. this article focuses on objective patellofemoral instability and return to sport, addressing only those situations where one or more episodes of dislocation have occurred or in cases where surgery for instability has been performed. it was attempted to answer the following two questions : (1) how and when can patients safely return to sport after primary or recurrent patellar dislocation, or after patellofemoral stabilization ? (2) what validated evaluations can be utilized to determine readiness to return to sport ? in our experience, return to sport can be compromised by pain, instability, weakness, and poor motor control. a safe return to sport implies that lesions of the knee have healed and the injured lower limb has adequately recovered to face the demands of sporting activities. successful return to sport implies : (1) no early re - injury ; (2) no further damage to the knee ; (3) return to the preinjury or higher level ; (4) no limiting pain ; (5) still playing after 5 years ; and (6) no early osteoarthrosis. a comprehensive return to sport decision - making process should be based upon : (1) clinical examination ; (2) evaluation of laxity ; (3) strength measurement ; (4) neuromuscular evaluation ; and (5) counselling with the physical conditioner and coach for professional athletes. as regards the patellofemoral joint, the challenge is that the patella is a sesamoid bone enclosed within the extensor mechanism of the lower limb. its function is closely associated with dynamic muscle activity while retaining its osseous and soft tissue static elements.. followed 74 patients (37 men, 37 women) after a first dislocation that was treated conservatively. preinjury sports activity was similar to that of patients with primary anterior cruciate ligament (acl) injury. patients were authorized to return to sports after they regained full passive range of motion, had no effusion, and when quadriceps muscle strength was at least 80 % of the noninjured limb. sports participation was limited during the first 6 months after injury, with difficulties in squatting and kneeling. at 6 months, 58 % of patients noted limitations in strenuous activity, but no recurrence was recorded. reported that the return to preinjury activity level varied between 44 % and 60 % regardless of the modality of treatment after the first dislocation. there are few high - quality studies concerning rehabilitation after patellar dislocation, especially as regards the last phase of treatment before return to sport. there are no published randomized clinical trials, but only thoughts and recommendations as summarized in the review by fisher.. however, since the objectives are similar, a parallel situation exists with the information available in the literature concerning return to sport after acl reconstruction. in order to achieve a proper and safe resumption of sports activities the strength of the lower limb muscles, especially the quadriceps [6, 36 ], and the gluteus medius is one key point. core strength is also crucial as it plays an important role in the stability of the lower limb. indeed, if the trunk is not stable during cutting manoeuvres, the loads applied to the knee are in valgus, thus generating a situation where the patellofemoral joint is at risk of dislocation [13, 18 ]. to avoid re - injury, the stability of the lower limb must be mastered at the end of the rehabilitation programme. cutting manoeuvres, change of direction, and running on uneven ground are the three activities perceived to be the greatest risk factors for patellar dislocation. therefore, the final goal of the rehabilitation programme should be to focus on the stability of the lower limb by the use of specific exercises on different surfaces, including cutting manoeuvres, side hops, and sudden change of direction. during the final phase of the rehabilitation programme, another important factor to consider for a proper return to sport concerns sport - specific activities. the athlete should be prepared for the specific loads and demands to be experienced in their specific sport, including : (1) cutting manoeuvres and pivoting exercises, performed for most of the team sports ; (2) plyometric and landing strategies, emphasized in any sports with jumps ; (3) one - leg stability, particularly exercised for martial arts ; and (4) proprioception, side stability, and landing capacities, which are stressed with skiers. as previously mentioned, a parallel can be made with return to sport after acl reconstruction. specific exercises to be implemented for patients involved in soccer, basketball, alpine skiing, and american football have been described [7, 20, 37, 38 ]. there are few high - quality studies concerning rehabilitation after patellar dislocation, especially as regards the last phase of treatment before return to sport. there are no published randomized clinical trials, but only thoughts and recommendations as summarized in the review by fisher.. however, since the objectives are similar, a parallel situation exists with the information available in the literature concerning return to sport after acl reconstruction. in order to achieve a proper and safe resumption of sports activities the strength of the lower limb muscles, especially the quadriceps [6, 36 ], and the gluteus medius is one key point. core strength is also crucial as it plays an important role in the stability of the lower limb. indeed, if the trunk is not stable during cutting manoeuvres, the loads applied to the knee are in valgus, thus generating a situation where the patellofemoral joint is at risk of dislocation [13, 18 ]. to avoid re - injury, the stability of the lower limb must be mastered at the end of the rehabilitation programme. cutting manoeuvres, change of direction, and running on uneven ground are the three activities perceived to be the greatest risk factors for patellar dislocation. therefore, the final goal of the rehabilitation programme should be to focus on the stability of the lower limb by the use of specific exercises on different surfaces, including cutting manoeuvres, side hops, and sudden change of direction. during the final phase of the rehabilitation programme, another important factor to consider for a proper return to sport concerns sport - specific activities. the athlete should be prepared for the specific loads and demands to be experienced in their specific sport, including : (1) cutting manoeuvres and pivoting exercises, performed for most of the team sports ; (2) plyometric and landing strategies, emphasized in any sports with jumps ; (3) one - leg stability, particularly exercised for martial arts ; and (4) proprioception, side stability, and landing capacities, which are stressed with skiers. as previously mentioned, a parallel can be made with return to sport after acl reconstruction. specific exercises to be implemented for patients involved in soccer, basketball, alpine skiing, and american football have been described [7, 20, 37, 38 ]. the same principles as mentioned above can be applied to patients after surgery for instability, regardless of the procedure performed. with respect to return to sport after medial patellofemoral ligament (mpfl) reconstruction, fisher. they reported on only two studies [11, 25 ] concerning the rate of return to a specific level of sports and found that 77 % of patients were able to resume sports at their preinjury level of performance. in a study by ntagiopoulos., 87 % of patients returned to their previous activities after isolated trochleoplasty, but the level of activity was not specified. studied the outcome after combined trochleoplasty and mpfl reconstruction for recurrent dislocation in patients with severe trochlear dysplasia. twenty - eight patients at a minimum follow - up of 2-years were included in the study. one patient returned to sport at a higher level than preoperatively, sixteen returned at the same preoperative level, and only six patients reported a return to a lower level of activity than before surgery. unfortunately, there is no information in the literature about validated timelines for a safe return to sport after patellofemoral surgery, especially after tibial tubercle osteotomy. however, common sense recommends to wait until the osteotomy is healed, and to delay the return until maximum recovery of muscle strength and dynamic stability. treatment can vary according to the size of the lesion and the intrinsic stability of the patellofemoral joint. factors to consider include size of the lesion, intrinsic healing capacity of the cartilage, and residual pain. cartilage lesions are certainly not a favourable factor for a safe return to high - impact and high - demanding sports activities. clearly, a large cartilage lesion (> 2 cm) influences the prognosis for return to sport. however, there is no specific data in the literature that allows for solid recommendations. based on the current literature, the return to previous level of sports activities after an objective episode of instability is limited to two - thirds of patients with or without surgery. there is little in the current literature about return to sport after objective patellar instability, and thus, no clear criteria can be as yet endorsed. however, as already mentioned, one can draw a parallel with the literature dedicated to return to sport post - acl reconstruction [7, 20, 37, 38 ]. based upon this literature and our experience, we propose six clinical criteria to support our return to sport decision - making process. as regards timing, it is no longer a matter of weeks or months, but rather a matter of clinical and testing requirements that the patient should fulfil. these criteria are as follows : (1) no pain ; (2) no effusion ; (3) no patellofemoral instability ; (4) a full range of motion ; (5) nearly symmetrical strength (8590 %) ; and (6) excellent dynamic stability. ideally, patients should satisfy these criteria at 6 weeks after a dislocation, and 3 months after surgery. our protocol and criteria for return to sport are currently under evaluation. in 2013, the isakos sports medicine committee also defined criteria for return to sport after surgery, and their criteria are very similar to ours (table 1). initially, the first 4 criteria listed above are assessed by the surgeon, followed by measurement of quadriceps and hamstring muscle strength in both legs with an isokinetic dynamometer. at this point, normal, and a limb symmetry index (lsi) is thus calculated by computing side - to - side differences in the results. and finally, in light of the results, the surgeon and patient can make a well - documented decision with regards to return to sport. for strength evaluation, especially in high - demanding sports (e.g., alpine skiing, football, basketball, and handball), the patient should reach a lsi of at least 90 % in order to be cleared for return to sports [7, 20, 37, 38].table 1from the isakos sports medicine committee, isakos consensus meeting on return - to - play, london 2013. with the permission of elisabeth arendt, md and franois kelberine, mdcriteria for a safe rts after patellofemoral instability isakosif bony surgery is involved, complete radiographic healing of boneno complaints of knee pain or knee instabilityfull or near full range of motionno knee effusioncompleted neuromuscular training / proprioceptionsatisfactory core strength and enduranceacceptable control with dynamic activities (e.g., star excursion balance test)limb symmetry index > 85 % on hop tests, especially if resuming pivoting sportsadequate performance with physiotherapist during sport - specific drills simulating the intensity and movement patterns of the athlete s given sportathlete demonstrates a psychological readiness to return to sport (e.g., sane score > 80/100) from the isakos sports medicine committee, isakos consensus meeting on return - to - play, london 2013. with the permission of elisabeth arendt, md and franois kelberine, md testing exercises are mandatory to evaluate recovery and the competence of the injured or operated limb. there are many functional tests for the knee that have been used [17, 22, 31, 39 ] and appear to be reliable and valuable tools. after a thorough evaluation of the different tests that have been validated in the literature, we have selected the single - leg squat, the star excursion balance test (sebt), the drop jump test, and the side - hop test. the knee must stay above the foot without going into a valgus movement, and the pelvis has to remain stable without dropping or turning. this exercise is part of the rehabilitation programme and should be perfectly mastered. in the sebt, the knee has to stay aligned as the pelvis is moving. the patient stands on one foot and reaches points around him like a clock quadrant [18, 28 ]. the results obtained are qualitative on the video analysis and also quantitative since distances reached during the sebt can be noted and reported. this test is very useful for the evaluation of lower limb stability [9, 16, 21].fig. 1 a single - leg squat to evaluate the dynamic stability of the lower limb, b star excursion balance test(sebt) to evaluate the limb stability while reaching the maximum distance around with the other leg a single - leg squat to evaluate the dynamic stability of the lower limb, b star excursion balance test(sebt) to evaluate the limb stability while reaching the maximum distance around with the other leg many sports demand change in direction and landing from jumps. if the limb can not be maintained in good alignment and as well properly decelerate, this may result in pain and risk re - injury. it is therefore important to assess these parameters during the phase of return to sport. drop and jump is a simple test that provides valuable information about control of landing. the patient drops from a box 35 cm high, lands on both feet, and immediately jumps as high as possible before landing a second time. the symmetry of the reception, the alignment of both knees, deceleration, and the capacity for absorbing the shock are evaluated using video recording [4, 15, 19, 30 ]. in this case, the results are qualitative, but highly valuable. the side - hop test consists in jumping on one leg between two lines at a distance of 40 cm as often as possible in 30 s (fig. 2). during this test, many aspects of physical conditioning can be observed, including speed, agility, muscle coordination, limb alignment, trunk stability, and control in change of direction. here, the results are qualitative (video analysis) as well as quantitative (number of jumps). they are then shown to the patient, and the results discussed in order to outline a new set of exercises aimed at correction of any deficits noted. in this way, the training may evolve over time towards more sport - specific exercises with the aim to prepare the patient for return to sport. have also described a series of tests that can be used to evaluate patients with patellofemoral problems or following corrective patellofemoral surgery [1, 2, 26 ]. they assessed core and trunk stability using prone plank, side plank, and single - limb exercises. for patients with patellofemoral problems, lower limb physical performance was evaluated with the stand and reach balance test, sebt, single - limb squat test, and retro step - up / down test.fig. 2side hop - test on lines 40 cm away during 30 seconds. the trunk and limb alignement is observed side hop - test on lines 40 cm away during 30 seconds. the trunk and limb alignement is observed from our point of view, patient education is a key point. very often, the patient has no idea about the importance of whole limb stability and is overly focused on the patellar problem. experience has shown that these self - administered exercises have been very useful to return the patient to sports.fig. 3home exercise programme : a gluteus and hamstrings strengthening, b myofascial release of itb, c rotational core stability, d lunges with trunk rotation, e single - leg squat home exercise programme : a gluteus and hamstrings strengthening, b myofascial release of itb, c rotational core stability, d lunges with trunk rotation, e single - leg squat with all, we have presented there still remains a lack of solid evidence about the criteria to determine a safe return to sports after patellofemoral dislocation or surgery. further work needs to be conducted in this field to better understand the true capability of our functional testing, rehabilitation programme, and surgical procedures, to safely and durably bring our patient back to sports. there is little in the current literature about return to sport after objective patellar instability, and thus, no clear criteria can be as yet endorsed. however, as already mentioned, one can draw a parallel with the literature dedicated to return to sport post - acl reconstruction [7, 20, 37, 38 ]. based upon this literature and our experience, we propose six clinical criteria to support our return to sport decision - making process. as regards timing, it is no longer a matter of weeks or months, but rather a matter of clinical and testing requirements that the patient should fulfil. these criteria are as follows : (1) no pain ; (2) no effusion ; (3) no patellofemoral instability ; (4) a full range of motion ; (5) nearly symmetrical strength (8590 %) ; and (6) excellent dynamic stability. ideally, patients should satisfy these criteria at 6 weeks after a dislocation, and 3 months after surgery. our protocol and criteria for return to sport are currently under evaluation. in 2013, the isakos sports medicine committee also defined criteria for return to sport after surgery, and their criteria are very similar to ours (table 1). initially, the first 4 criteria listed above are assessed by the surgeon, followed by measurement of quadriceps and hamstring muscle strength in both legs with an isokinetic dynamometer. at this point, normal, and a limb symmetry index (lsi) is thus calculated by computing side - to - side differences in the results. and finally, in light of the results, the surgeon and patient can make a well - documented decision with regards to return to sport. for strength evaluation, especially in high - demanding sports (e.g., alpine skiing, football, basketball, and handball), the patient should reach a lsi of at least 90 % in order to be cleared for return to sports [7, 20, 37, 38].table 1from the isakos sports medicine committee, isakos consensus meeting on return - to - play, london 2013. with the permission of elisabeth arendt, md and franois kelberine, mdcriteria for a safe rts after patellofemoral instability isakosif bony surgery is involved, complete radiographic healing of boneno complaints of knee pain or knee instabilityfull or near full range of motionno knee effusioncompleted neuromuscular training / proprioceptionsatisfactory core strength and enduranceacceptable control with dynamic activities (e.g., star excursion balance test)limb symmetry index > 85 % on hop tests, especially if resuming pivoting sportsadequate performance with physiotherapist during sport - specific drills simulating the intensity and movement patterns of the athlete s given sportathlete demonstrates a psychological readiness to return to sport (e.g., sane score > 80/100) from the isakos sports medicine committee, isakos consensus meeting on return - to - play, london 2013. with the permission of elisabeth arendt, md and franois kelberine, md testing exercises are mandatory to evaluate recovery and the competence of the injured or operated limb. there are many functional tests for the knee that have been used [17, 22, 31, 39 ] and appear to be reliable and valuable tools. after a thorough evaluation of the different tests that have been validated in the literature, we have selected the single - leg squat, the star excursion balance test (sebt), the drop jump test, and the side - hop test. the knee must stay above the foot without going into a valgus movement, and the pelvis has to remain stable without dropping or turning. this exercise is part of the rehabilitation programme and should be perfectly mastered. in the sebt, the knee has to stay aligned as the pelvis is moving. the patient stands on one foot and reaches points around him like a clock quadrant [18, 28 ]. the results obtained are qualitative on the video analysis and also quantitative since distances reached during the sebt can be noted and reported. this test is very useful for the evaluation of lower limb stability [9, 16, 21].fig. 1 a single - leg squat to evaluate the dynamic stability of the lower limb, b star excursion balance test(sebt) to evaluate the limb stability while reaching the maximum distance around with the other leg a single - leg squat to evaluate the dynamic stability of the lower limb, b star excursion balance test(sebt) to evaluate the limb stability while reaching the maximum distance around with the other leg many sports demand change in direction and landing from jumps. if the limb can not be maintained in good alignment and as well properly decelerate, this may result in pain and risk re - injury. it is therefore important to assess these parameters during the phase of return to sport. drop and jump is a simple test that provides valuable information about control of landing. the patient drops from a box 35 cm high, lands on both feet, and immediately jumps as high as possible before landing a second time. the symmetry of the reception, the alignment of both knees, deceleration, and the capacity for absorbing the shock are evaluated using video recording [4, 15, 19, 30 ]. in this case, the results are qualitative, but highly valuable. the side - hop test consists in jumping on one leg between two lines at a distance of 40 cm as often as possible in 30 s (fig. 2). during this test, many aspects of physical conditioning can be observed, including speed, agility, muscle coordination, limb alignment, trunk stability, and control in change of direction. here, the results are qualitative (video analysis) as well as quantitative (number of jumps). they are then shown to the patient, and the results discussed in order to outline a new set of exercises aimed at correction of any deficits noted. in this way, the training may evolve over time towards more sport - specific exercises with the aim to prepare the patient for return to sport. have also described a series of tests that can be used to evaluate patients with patellofemoral problems or following corrective patellofemoral surgery [1, 2, 26 ]. they assessed core and trunk stability using prone plank, side plank, and single - limb exercises. for patients with patellofemoral problems, lower limb physical performance was evaluated with the stand and reach balance test, sebt, single - limb squat test, and retro step - up / down test.fig. 2side hop - test on lines 40 cm away during 30 seconds. the trunk and limb alignement is observed side hop - test on lines 40 cm away during 30 seconds. the trunk and limb alignement is observed from our point of view, patient education is a key point. very often, the patient has no idea about the importance of whole limb stability and is overly focused on the patellar problem. experience has shown that these self - administered exercises have been very useful to return the patient to sports.fig. 3home exercise programme : a gluteus and hamstrings strengthening, b myofascial release of itb, c rotational core stability, d lunges with trunk rotation, e single - leg squat home exercise programme : a gluteus and hamstrings strengthening, b myofascial release of itb, c rotational core stability, d lunges with trunk rotation, e single - leg squat with all, we have presented there still remains a lack of solid evidence about the criteria to determine a safe return to sports after patellofemoral dislocation or surgery. further work needs to be conducted in this field to better understand the true capability of our functional testing, rehabilitation programme, and surgical procedures, to safely and durably bring our patient back to sports. patellar instability is a pathology that concerns a young active population. even after a single dislocation, return to sports at the same level of performance as before injury appears to be compromised. analysis of the literature reveals that only two - thirds of patients return to sports at the same level. this can be considered a poor result with respect to the young age of the affected population. return to sport may be encouraged and promoted using home self - administered exercises and by educating the patient about the importance of regaining muscle strength and dynamic stability. finally, testing protocols for the rts should include quantitative and qualitative criteria.	patellofemoral instability may occur in a young population as a result of injury during sporting activities. this review focuses on return to sport after one episode of dislocation treated no operatively and as well after surgery for chronic patellofemoral instability. with or without surgery, only two - thirds of patients return to sports at the same level as prior to injury. a high - quality rehabilitation programme using specific exercises is the key for a safe return to sporting activities. to achieve this goal, recovery of muscle strength and dynamic stability of the lower limbs is crucial. the focus should be directed to strengthen the quadriceps muscle and pelvic stabilizers, as well as lateral trunk muscle training. patient education and regularly performed home exercises are other key factors that can lead to a successful return to sports. the criteria for a safe return to sports include the absence of pain, no effusion, a complete range of motion, almost symmetrical strength, and excellent dynamic stability.level of evidence iv.
the prospective, parallel - design, randomized cluster trial was conducted in three highly populated office buildings for employees in a midwestern mutual health insurance company (medical mutual of ohio, cleveland) over a more than 13-month period from february 2014 through march 2015. the chesapeake research review institutional review board (irb) assessed the study protocol and documentation, approved the study, and provided appropriate oversight throughout the process. in an effort to start the study during typical cold and flu season, baseline surveys were administered in january 2014. the building with the most (782) employees was randomly assigned (as a cluster) to the control group. the 604 employees in the other two buildings (the second cluster) were consequently assigned to the intervention group. because the study was low risk in nature, no consent forms were required. all employees at the three facilities who were 18 years of age or older, were enrolled in the company health insurance coverage, did not transfer between sites and worked onsite full time (32 hours) were eligible for the study. the three buildings used in the trial had a similar open floor plan with the majority of employees sitting in cubicles. a small percentage (< 15%) of traditional - style offices with doors lined the outer perimeter of each floor. the average amount of work space per worker in the intervention site was 309 square feet, similar to the control site at 323 square feet per worker. the intervention sites had a total space of 276,000 square feet, and the control site had a total space of 381,000 square feet. the primary endpoints were (1) the number of health care insurance claims, for a defined set of preventable illnesses, per subject per year, and (2) absenteeism, defined as the number of sick episodes per subject per year. sick episodes were calculated for each employee based on unscheduled paid time off (pto) events lasting at least 4 hours. an unscheduled pto event was defined as lasting at least 4 hours, where an event was counted as a single occurrence, whether the duration was 1 day or a series of consecutive unscheduled pto days. this approach was chosen as the most accurate measure to evaluate the trial 's hypothesis that alcohol - based hand sanitizer usage prevented communicable illness, as opposed to reducing severity of the illness, which is a different study question and would best be evaluated by length of pto. secondary outcomes focused on employee knowledge of appropriate hand hygiene practice and satisfaction at the workplace, as assessed by a thorough knowledge, attitudes, and practices (kaps) survey. another secondary outcome was estimation of hand hygiene frequency by employees in the intervention group. historic data for health care claims and absenteeism were compiled for each subject for the 4 years before the study (2010 to 2014), which allowed more robust statistical analysis and higher confidence in conclusions. the kaps survey was administered to all participants before the start of the trial (baseline) and 4 months into the trial (post study). the postsurvey was conducted at four months rather than later, for example, at the study 's conclusion, to allow sufficient time for employees to familiarize themselves with the hand hygiene program, but not to allow so much time that their initial reactions to the program would be lost. the kaps survey was a focused evaluation yielding quantifiable data that measures change in kaps in response to a specific intervention. questions included demographics, knowledge of, and compliance with appropriate hand hygiene practice, perceptions and usage of the alcohol - based hand sanitizer, concerns regarding illness and cleanliness in the office, and impressions of the workplace environment and its amenities. an e - mail was sent to all employees in january, 2014, stating that a hand hygiene research study was being conducted at the office and participation was voluntary. an incentive of 25 wellness points was offered to each employee who completed both the baseline and poststudy kaps survey. employees at medical mutual of ohio earn wellness points for various health - related activities over the course of the year. when a certain point threshold is reached, monetary compensation toward health care premiums for the next year is granted. the 25 additional wellness points for completing a hand hygiene survey contributed to as much as 7% toward participating employees attaining monetary compensation in the medical mutual of ohio 2014 wellness incentive. entry into a raffle for 1 of 100 $ 25 gift cards was offered as an added incentive for completing both surveys. the baseline survey also included demographic information and important covariates including age, gender, number of people in household, number of children less than 17 years of age in household, number of children in daycare, type of transportation to work (car, car pool, public transportation, bike, walk or other), and if employee received a flu vaccination in the fall of 2013. on february 6, 2014, 11 days before the commencement of data collection, alcohol - based hand sanitizer (purell advanced, gojo industries inc, akron, ohio) was installed in high traffic common areas (eg, near elevators, at entrances) and other appropriate public spaces, including the coffee area, break rooms, conference rooms, training rooms, lobbies, and reception areas, as wall - mounted dispensers, stands, or free - standing bottles (depending on the environment and space available). an 8-ounce bottle of hand sanitizer (purell advanced) and a 100-count canister of hand wipes (purell wipes) were delivered to each cubicle. every employee in the intervention group was also given a 1-ounce bottle of hand sanitizer (purell advanced) for personal use. replenishment product was stored in the supply room and made easily available to individual employees upon request (a simple process in case they ran out). the restrooms in both the control and intervention sites provided foam handwash (gojo green certified foam handwash) as well as an alcohol - based hand sanitizer foam wall - mounted dispenser (purell, gojo industries) near the restroom exit, which had been in place at all sites for months before the study. we also ensured that the soap in all restrooms was identical, so the quality or personal preference of soap (which could impact usage behaviors) and hand hygiene options at the restroom was not a variable within the study. the intervention and control groups received identical education on hand hygiene and illness prevention. a brief (less than one - minute) educational video about proper hand hygiene technique, for both washing and sanitizing hands, was embedded at the end of the baseline online kaps survey. the same signage to wash your hands, promoting hand hygiene compliance, was posted next to restroom exits at both the control and intervention sites, and they were in place in advance of the study, not because of the study. no additional such signage was placed at the intervention sites. to evaluate health care claims, the international classification of diseases, 9th revision, clinical modification (icd-9) codes for illnesses with a hand - to - mouth mode of transmission (eg, cold and influenza, adenovirus, etc.) the study assessed 24 of the most common and appropriate diagnosis codes for these communicable, hand - to - mouth transmitted diseases considered to be preventable through effective hand hygiene (see table 1). the study included only paid facility (inpatient and outpatient) and professional medical claims for dates of service from february 17, 2014, to march 28, 2015, allowing for a three - month claims run - out time period to increase accuracy and eliminate invalid claims. additional historical facility and professional claims were also evaluated for trending, including claims from february 18, 2010, to february 16, 2014. cold and influenza claims were identified using the primary diagnosis associated with each claim and evaluated by claim volume and cost. the number of employees to be included in this study was calculated to detect a 20% reduction in the number of unscheduled pto events between the intervention and the control groups, assuming a 0.05 p value and 80% power. assuming an episode sick rate of 0.7 for 6 months and taking into consideration intracluster correction between the two groups and a potential nonresponse rate of 10%, the sample size was estimated at 495 individuals for each group. to compare the incidence of claims and absenteeism between the two groups over time, the fixed effects in the model were group (control or intervention), intervention period (pre- and post-), and the two - way interaction. to account for repeated measures from each subject, office building, and time period (1 to 6 : five 12-month periods over the 4-year retrospective period and the first year of the intervention, and an additional 1.5-month period at the end of the study), random effects the model accounted for the total number of months worked by the employees in each group. because the data were zero - inflated and no significant correlation was found among subjects in the same building, the data were aggregated by group and the random effect due to office building, was dropped for the final statistical analysis. statistical analysis of the subjective survey data (kaps) was done by chi - square, with p values less than 0.05 considered statistically significant. demographic variables were compared using chi - square for categorical variables and the student t test for continuous variables. the prospective, parallel - design, randomized cluster trial was conducted in three highly populated office buildings for employees in a midwestern mutual health insurance company (medical mutual of ohio, cleveland) over a more than 13-month period from february 2014 through march 2015. the chesapeake research review institutional review board (irb) assessed the study protocol and documentation, approved the study, and provided appropriate oversight throughout the process. in an effort to start the study during typical cold and flu season, baseline surveys were administered in january 2014. the building with the most (782) employees was randomly assigned (as a cluster) to the control group. the 604 employees in the other two buildings (the second cluster) were consequently assigned to the intervention group. because the study was low risk in nature, no consent forms were required. all employees at the three facilities who were 18 years of age or older, were enrolled in the company health insurance coverage, did not transfer between sites and worked onsite full time (32 hours) were eligible for the study. the three buildings used in the trial had a similar open floor plan with the majority of employees sitting in cubicles. a small percentage (< 15%) of traditional - style offices with doors lined the outer perimeter of each floor. the average amount of work space per worker in the intervention site was 309 square feet, similar to the control site at 323 square feet per worker. the intervention sites had a total space of 276,000 square feet, and the control site had a total space of 381,000 square feet. the primary endpoints were (1) the number of health care insurance claims, for a defined set of preventable illnesses, per subject per year, and (2) absenteeism, defined as the number of sick episodes per subject per year. sick episodes were calculated for each employee based on unscheduled paid time off (pto) events lasting at least 4 hours. an unscheduled pto event was defined as lasting at least 4 hours, where an event was counted as a single occurrence, whether the duration was 1 day or a series of consecutive unscheduled pto days. this approach was chosen as the most accurate measure to evaluate the trial 's hypothesis that alcohol - based hand sanitizer usage prevented communicable illness, as opposed to reducing severity of the illness, which is a different study question and would best be evaluated by length of pto. secondary outcomes focused on employee knowledge of appropriate hand hygiene practice and satisfaction at the workplace, as assessed by a thorough knowledge, attitudes, and practices (kaps) survey. another secondary outcome was estimation of hand hygiene frequency by employees in the intervention group. historic data for health care claims and absenteeism were compiled for each subject for the 4 years before the study (2010 to 2014), which allowed more robust statistical analysis and higher confidence in conclusions. the kaps survey was administered to all participants before the start of the trial (baseline) and 4 months into the trial (post study). the postsurvey was conducted at four months rather than later, for example, at the study 's conclusion, to allow sufficient time for employees to familiarize themselves with the hand hygiene program, but not to allow so much time that their initial reactions to the program would be lost. the kaps survey was a focused evaluation yielding quantifiable data that measures change in kaps in response to a specific intervention. questions included demographics, knowledge of, and compliance with appropriate hand hygiene practice, perceptions and usage of the alcohol - based hand sanitizer, concerns regarding illness and cleanliness in the office, and impressions of the workplace environment and its amenities. an e - mail was sent to all employees in january, 2014, stating that a hand hygiene research study was being conducted at the office and participation was voluntary. an incentive of 25 wellness points was offered to each employee who completed both the baseline and poststudy kaps survey. employees at medical mutual of ohio earn wellness points for various health - related activities over the course of the year. when a certain point threshold is reached, monetary compensation toward health care premiums for the next year is granted. the 25 additional wellness points for completing a hand hygiene survey contributed to as much as 7% toward participating employees attaining monetary compensation in the medical mutual of ohio 2014 wellness incentive. entry into a raffle for 1 of 100 $ 25 gift cards was offered as an added incentive for completing both surveys. the baseline survey also included demographic information and important covariates including age, gender, number of people in household, number of children less than 17 years of age in household, number of children in daycare, type of transportation to work (car, car pool, public transportation, bike, walk or other), and if employee received a flu vaccination in the fall of 2013. on february 6, 2014, 11 days before the commencement of data collection, hand hygiene supplies were placed in the offices of the two intervention sites. alcohol - based hand sanitizer (purell advanced, gojo industries inc, akron, ohio) was installed in high traffic common areas (eg, near elevators, at entrances) and other appropriate public spaces, including the coffee area, break rooms, conference rooms, training rooms, lobbies, and reception areas, as wall - mounted dispensers, stands, or free - standing bottles (depending on the environment and space available). an 8-ounce bottle of hand sanitizer (purell advanced) and a 100-count canister of hand wipes (purell wipes) were delivered to each cubicle. every employee in the intervention group was also given a 1-ounce bottle of hand sanitizer (purell advanced) for personal use. replenishment product was stored in the supply room and made easily available to individual employees upon request (a simple process in case they ran out). the restrooms in both the control and intervention sites provided foam handwash (gojo green certified foam handwash) as well as an alcohol - based hand sanitizer foam wall - mounted dispenser (purell, gojo industries) near the restroom exit, which had been in place at all sites for months before the study. we also ensured that the soap in all restrooms was identical, so the quality or personal preference of soap (which could impact usage behaviors) and hand hygiene options at the restroom was not a variable within the study. the intervention and control groups received identical education on hand hygiene and illness prevention. a brief (less than one - minute) educational video about proper hand hygiene technique, for both washing and sanitizing hands, was embedded at the end of the baseline online kaps survey. the same signage to wash your hands, promoting hand hygiene compliance, was posted next to restroom exits at both the control and intervention sites, and they were in place in advance of the study, not because of the study. to evaluate health care claims, the international classification of diseases, 9th revision, clinical modification (icd-9) codes for illnesses with a hand - to - mouth mode of transmission (eg, cold and influenza, adenovirus, etc.) were selected before the implementation of the intervention. the study assessed 24 of the most common and appropriate diagnosis codes for these communicable, hand - to - mouth transmitted diseases considered to be preventable through effective hand hygiene (see table 1). the study included only paid facility (inpatient and outpatient) and professional medical claims for dates of service from february 17, 2014, to march 28, 2015, allowing for a three - month claims run - out time period to increase accuracy and eliminate invalid claims. additional historical facility and professional claims were also evaluated for trending, including claims from february 18, 2010, to february 16, 2014. cold and influenza claims were identified using the primary diagnosis associated with each claim and evaluated by claim volume and cost. the number of employees to be included in this study was calculated to detect a 20% reduction in the number of unscheduled pto events between the intervention and the control groups, assuming a 0.05 p value and 80% power. assuming an episode sick rate of 0.7 for 6 months and taking into consideration intracluster correction between the two groups and a potential nonresponse rate of 10%, the sample size was estimated at 495 individuals for each group. to compare the incidence of claims and absenteeism between the two groups over time, the fixed effects in the model were group (control or intervention), intervention period (pre- and post-), and the two - way interaction. to account for repeated measures from each subject, office building, and time period (1 to 6 : five 12-month periods over the 4-year retrospective period and the first year of the intervention, and an additional 1.5-month period at the end of the study), random effects were included for time period, building, and subject. the model accounted for the total number of months worked by the employees in each group. because the data were zero - inflated and no significant correlation was found among subjects in the same building, the data were aggregated by group and the random effect due to office building, was dropped for the final statistical analysis.. statistical analysis of the subjective survey data (kaps) was done by chi - square, with p values less than 0.05 considered statistically significant. demographic variables were compared using chi - square for categorical variables and the student t test for continuous variables. a total of 1609 employees were asked to participate in the study ; 1386 were included in the study of claims and absenteeism (782 in the control group and 604 in the intervention group) ; 1183 completed the baseline pre - study kaps survey (627 in the control group and 556 in the intervention group). the two groups did not differ significantly in gender, age, percentage receiving influenza vaccination, number of household members, or number of households with children aged 16 years or younger or in daycare. the only demographic profile characteristic that was statistically significant was mode of transportation to work. the finding that fewer employees in the control population drove their own car and took public transportation was not surprising given the more urban setting of that office building. baseline characteristic details of the participants are shown in table 2. during the first full year of the intervention period versus the prior 12 months, the intervention group had a statistically significant 24.3% lower incidence of hand hygiene preventable health care claims compared with the control group (p = 0.016). when factoring in the full 13.5-month intervention period and full 4 years of historical data, the intervention group still had a statistically significant 20.9% lower incidence of claims than the control group (p = 0.030), which is an even stronger conclusion regarding the efficacy and health outcome benefit of the intervention. the average number of health care claims per employee was 0.30 in the intervention group (179 claims among 604 subjects) compared with 0.37 for the control group (293 claims among 782 subjects). the claims data comparing the two groups for the intervention period and the four years before the study initiation is shown in fig. before the study began, the intervention group actually had a 17.2% higher incidence of claims than the control group. if there had been no effect of the intervention (ie, no interaction between time and the intervention group), the claims rates would have risen similarly to the control group. however, the actual incidence of claims in the intervention group was 32.5% less than this prediction, which was statistically significant (p = 0.002). health care claims per month per 1000 employees for the study period and prior four years. for the second primary outcome measure of absenteeism, during the first full year of the intervention period versus the prior 12 months, the intervention group had 7.7% less absences (unscheduled pto) compared with the control group, which was not statistically significant (p = 0.344). when factoring in the full 13.5-month intervention period and full 4 years of historical data, the intervention group had 5.0% less absenteeism episodes than the control group (p = 0.302). the average number of absences per employee in the intervention group was 1.45 (875 episodes among 604 subjects) compared with 1.53 for the control group (1193 episodes among 782 subjects). the absences data comparing the two groups for the intervention period and the four years before the study initiation are shown in fig. analysis within the intervention group only was executed because it was hypothesized that the survey and video may have increased hand hygiene awareness of the control group. for the intervention group only during the first full year of the intervention period versus the prior 12 months showed employees with the intervention had a statistically significant 13.4% lower incidence of absences (p = 0.012), whereas the control group during the same one - year time interval had no significant change in absences. in the year before the study began, the intervention group actually had a 7.3% higher incidence of absences than the control group. if there had been no effect of the intervention (ie, no interaction between time and the intervention group), the absence rates would have risen similarly to the control group. however, the actual incidence of absences in the intervention group was 11.5% less than predicted that was statistically significant (p = 0.030). the average cost of each claim for the hygiene - preventable illnesses included in both the control and intervention groups was $ 104 for the intervention period versus an average of $ 89 for the four years prior (see table 3). in total, across the entire approximately five - year timeframe, the average cost per claim was $ 92. it should be noted that the cost of the health care claims assessed in the study does not necessarily translate into the severity of the illness, that is, a lower cost of a claim should not be construed to mean that the illness treated was less severe than a more costly claim. this is due to the fact that multiple factors comprise the claim 's cost, including type of facility visited (doctor 's office vs emergency room, etc.), cost differences due to geography, variance in negotiated contract rates by insurer with provider, etc. table 4 assesses 14 companies health care expenditures across a broad range of industries for the year 2013. the % of total costs for the icd-9 codes analyzed in this study was determined by comparison to each company 's total health care cost. the % of total costs is similar across the employer categories, with a range of 0.7 to 1.6% and a midpoint of 1.2%. neither the size of the company nor the level of the copay appears to have a notable effect on the result. hand hygiene knowledge at baseline did not differ between the control and intervention groups (see table 5). knowledge of hand hygiene practice was high, with at least nine in 10 employees citing the need of hand hygiene in six of the nine situations presented. knowledge regarding technique and reason hand hygiene is effective were also high and did not differ between control and intervention groups. implementation of the program significantly improved self - reported hand hygiene practice and attitudes in the intervention group, with increased frequency of hand washing (self - reported), employee satisfaction with office cleanliness, and perception that company cared for their well - being and disease prevention in the workplace (p < 0.05). at the intervention sites, the availability of the product significantly increased participant 's sense of control of their health / well - being, ability to interact with coworkers in the workplace environment without worry about transmissible illness, satisfaction with hand hygiene products provided by their employer, likelihood to comply with optimum hand hygiene practice, and overall positive impression of their company (p < 0.05). following introduction of an alcohol - based hand sanitizer in the office, 40% more employees in the intervention group reported cleaning their work area regularly to prevent illness compared with both the baseline (p < 0.001) and control group (p < 0.001). the intervention group was also significantly more likely to keep the hand sanitizer with them and use it throughout the day at work (p < 0.001), home (p = 0.017), and in public places (p = 0.037), such as grocery stores, malls, restaurants, health care facilities, banks, and airports (see fig. employees in the intervention group reported significant increases in alcohol - based hand sanitizer use for every activity assessed, including before eating (p = 0.001), after sneezing (p < 0.001), coughing (p < 0.001), handling money (p < 0.001), using the restroom (p = 0.005), returning to their desk (p < 0.001), and interacting with others who may be sick (p < 0.001). overall frequency of carrying and using alcohol - based hand sanitizer per study group and pre- versus postsurvey. surprisingly, the availability of purell hand wipes at individual desks had a stronger impact on workers impression of the office space than many other amenities, including filtered water, a recycling program, low - cost food, free coffee / soda, and atm / banking. a total of 81% employees in the intervention group ranked the availability of alcohol - based hand sanitizer wipes at their individual desk as one of the top two amenities in the workplace compared with 69% before the intervention (p < 0.001) and 71% of controls (p = 0.001). employees in the intervention group were significantly more likely than the control group to have a positive impression of medical mutual of ohio because of the presence of alcohol - based hand sanitizers in the workplace (80% vs 69%, p < 0.001). there was also a significant increase in employee perception that their company was concerned about the spread of germs and illness in the workplace (80% vs 60%, p < 0.001). the intervention group reported higher satisfaction with the overall cleanliness of the office space than control group personnel as well (p < 0.001). importantly, 88% of the employees in the intervention group postsurvey liked the intervention products provided. this is the first prospective workplace study evaluating a comprehensive hand hygiene program with an alcohol - based hand sanitizer to report actual medical insurance claims. the results clearly demonstrate that intervention of a healthy office program with provision of alcohol - based hand sanitizer throughout a building and hand sanitizer along with hand wipes in the personal workspace improves employee health outcomes and job satisfaction. for the intervention group, there were significant increases in frequency of hand hygiene for all activities assessed in the study. the intervention group was significantly more likely to clean their work area with sanitizing wipes as well as a surface spray (not provided) in order to prevent illness. increased hand hygiene practice was documented in all of the settings recommended by cdc guidance : after sneezing, coughing, and contact with others who may be sick, before eating, and after use of the restroom. the cdc states that hand hygiene is one of the best ways to reduce absenteeism and avoid contracting and spreading illness in the workplace and recommends that employers promote handwashing among employees and their family. to prevent influenza in the workplace, the cdc recommends that employers provide alcohol - based hand sanitizers and gels when sinks and soaps are not available and place handwashing reminders in bathrooms, kitchens, break rooms, and other communal areas with sinks. antibiotic resistance has grown into a crisis of alarming proportion, with the hospital setting currently recognized by public health agencies and the us government as posing an unacceptable risk for infection ; one of every 25 inpatients in acute care hospitals in the united states contracts one or more infections. each year, in the united states, approximately 2 million people become infected with drug - resistant bacteria, resulting in at least 23,000 deaths. moreover, few new antibiotics are being invented, due to the expense and time it takes to develop novel drug classes coupled with limited projected revenue. prevention of infections in any setting, including workplaces, reduces the need for antibiotics and thereby reduces the risk of developing antibiotic resistance. according to the national institutes of health, the best strategy to prevent the spread of drug - resistant bacteria is for everyone to keep their hands clean. many leading professional medical associations and the recently convened white house task force on antibiotic stewardship also recommend prevention as one of most important strategies to combat the crisis of antibiotic resistance and rising health care costs. hygiene and alcohol - based hand sanitizers are an important modality in the fight to combat antibiotic resistance, because, unlike other interventions, there is no mechanism for bacteria to develop resistance to alcohol. alcohol kills bacteria by physically destroying the cell membrane and denaturing proteins within the bacteria ; doing so while evaporating from skin within seconds, leaving no residual active behind that could lead to mutation.. proper formulation of soaps, surface cleaners, and alcohol - based hand rubs is required to maximize antimicrobial efficacy and achieve satisfying human factors (eg, likeability, skin feel, skin conditioning, etc.). it has been found that poor formulation and delivery system design in hand soaps can lead to microbial contamination and growth. a study of 12 hand sanitizer gel and foam products evaluating antibacterial efficacy on hands found that formulation matters and is a more important factor than alcohol concentration alone. therefore, it should not be assumed that intervention with different hand hygiene products will produce similar health benefits. as a corollary to product selection, this study sets out to understand the impact the specific products and their placement had on product usage. this was achieved through monitoring of product shipments into the sites and physical collection of the soap, sanitizer, and wipes products from the intervention sites at two times in the study (evening collection with full replacement product was provided, so there was no disruption of the intervention test conditions). the collected samples were measured and usage rates were estimated (given that the office worker could use product at their desk or in the general work areas, the results should be considered directional in nature). our estimates suggest that an average employee used the sanitizer 1.8 to 3.0 times per day, the soap 2.1 to 4.4 times per day, and the wipes at their desk 1.4 to 1.5 times per week. these data suggest very reasonable, realistic levels of usage, and contradict any notion that the positive health outcomes were due to extremely high frequency of hand hygiene. rather, an average sanitizer usage rate of two to three times per day per employee and sanitizing wipes usage rates of one to two times per week per employee should be considered highly attainable and fits well with expected behaviors (eg, to clean hands before eating, after sneezing, etc.). further study of the relationship of hand hygiene rates and timing with health outcomes would be interesting. the practice of attending work while sick, also known as presenteeism, hinders employee productivity and has negative economic implications. the estimated annual cost of presenteeism caused by respiratory disorders exceeds $ 33 per employee. although this study did not attempt to quantify the impact of the hand hygiene intervention on costs linked to presenteeism, it is reasonable to assume that the intervention 's demonstrated reduction in health care claims would have a similarly positive impact on reducing presenteeism costs caused by respiratory disorders. this is especially relevant given that the hygiene - preventable infections assessed in this study do not frequently lead a person to seek professional medical attention. in fact, frequency of doctor visits for common cold - type illness has been reported to be as low as 4%. workplaces share some of the same risks of health care settings : employees work in close quarters, share open spaces, are often a significant distance from sinks, and may be too occupied with the task at hand to go to the restroom to wash their hands with soap and water. recommendations accrued from years of study of hand hygiene techniques and compliance in health care settings are now starting to be applied to other settings, such as schools, military, and more recently office based workplaces. hospital - based public health researchers have learned that a key factor influencing adherence to optimum hand hygiene protocol is the product 's availability at the point of need. the world health organization promotes the alcohol - based handrub as the international standard of care for hand hygiene, as it is the most efficacious, well - tolerated and well - researched product which can be placed ergonomically and safely at the point of care. research accumulated over the past three decades shows that well - designed wellness programs based on evidence - based principles of health achieve significant positive health and financial outcomes in the workplace, for both the employer and employees. a meta - analysis of 72 studies revealed that every $ 1 spent on workplace wellness programs yielded an average return of $ 3.50. a harvard study found that, over a 3-year period, medical costs fell by $ 3.27 for every dollar spent on wellness programs and absenteeism costs fell by about $ 2.73 for every dollar spent. according to another meta - analysis evaluating 62 peer - reviewed studies that met stringent inclusion criteria, worksite health programs reduce sick leave absenteeism by 25% on average and worker 's compensation and disability claims costs by 32% on average, with an overall $ 5.56 to $ 1 savings - to - cost ratio. the control group having more exposure to other people via public transportation may have impacted employee health outcomes, but that is not well understood. other factors besides hygiene preventable illnesses likely contributed to absences, and it is well known that absenteeism, self - reported or measured by unscheduled pto as in this case, is an ambiguous metric prone to error for a variety of reasons (eg, staying home to care for a loved one, etc.). the rough estimation of actual hand hygiene frequency in this study still does not determine what level of hand hygiene is needed to reduce illnesses at an individual level. finally, the seasonal effects and relationship with this hygiene intervention are not well understood. further analysis should be done with these data and future studies should attempt to better determine whether health outcome results are different in the winter germ season, during peak cold and flu season, or during the summer. in summary, the simplest and most cost - effective strategy to combat common infectious agents in the workplace is to provide hand hygiene options at the point of exposure. alcohol - based hand rubs are more effective than routine hand washing in reducing viable bacteria and viruses on hands, require less time to use, are more accessible at the point of care, increase adherence to recommended hand hygiene protocol, and cause less hand irritation and dryness with repeated use than other products. this prospective, randomized, cluster - controlled trial demonstrated that a healthy office program based on comprehensive hand hygiene improvement at the individual employee level, used in conjunction with alcohol hand sanitizers strategically placed in the workplace, significantly reduced actual health care claims for hand hygiene preventable infections (eg, cold and influenza). these findings support the recommendations of many leading public health organizations to implement hygiene programs as a key nonpharmaceutical strategy to reduce the health and economic burden of illness and reduce the risk of infection during work.	objective : the aim of this study was to determine the efficacy of a multimodal hand hygiene intervention program in reducing health care insurance claims for hygiene preventable infections (eg, cold and influenza), absenteeism, and subjective impact on employees.methods:a 13.5-month prospective, randomized cluster controlled trial was executed with alcohol - based hand sanitizer in strategic workplace locations and personal use (intervention group) and brief hand hygiene education (both groups). four years of retrospective data were collected for all participants.results:hygiene-preventable health care claims were significantly reduced in the intervention group by over 20% (p < 0.05). absenteeism was positively impacted overall for the intervention group. employee survey data showed significant improvements in hand hygiene behavior and perception of company concern for employee well-being.conclusion:providing a comprehensive, targeted, yet simple to execute hand hygiene program significantly reduced the incidence of health care claims and increased employee workplace satisfaction.
almost all newborn infants develop some degree of hyperbilirubinemia as a normal transition in physiology. high levels of unbound unconjugated bilirubin can cross the blood brain barrier and cause neurological symptoms. the association between hyperbilirubinemia and encephalopathy was first described in 1847 by hervieux ; the term kernicterus was first used by schmorl in 1903 to describe yellow staining of the basal ganglia. the terms bilirubin induced neurological dysfunction (bind) and kernicterus are often used interchangeably, although some authors consider bind to refer to the clinical presentation and kernicterus to be an anatomical diagnosis. in this paper, the term kernicterus will be used to describe both the neuropathology of bilirubin induced brain injury and the associated clinical presentation. kernicterus is a preventable condition ; the unconjugated bilirubin levels can be decreased to safe levels by the use of phototherapy or exchange transfusion. phototherapy is an effective way of decreasing the bilirubin level in neonates, by converting unconjugated bilirubin into isomers such as lumirubin that are water soluble and can be excreted in the urine. exchange transfusion (et), however, is considered to be the most effective and quickest method to lower the bilirubin level in infants at high risk of kernicterus. an et is indicated when hyperbilirubinemia remains at dangerous levels despite intensive phototherapy and is particularly useful when there is excessive haemolysis. the actual bilirubin level at which to implement phototherapy or et has been a subject of controversy for many years. in south africa, consensus was reached in 2006 on a nationally accepted nomogram for the management of hyperbilirubinemia. kernicterus is a preventable condition ; however cases still occur, even in high - income countries like the usa. reasons include early discharge of neonates without predischarge screening, lack of knowledge regarding neonatal hyperbilirubinemia among both health workers and caregivers, inadequate follow - up, and an increase in breastfeeding rates without adequate support. kernicterus and severe hyperbilirubinemia are even more prevalent in low- and middle - income countries, due to delays, at all levels of care, in babies with severe hyperbilirubinemia receiving adequate treatment. although et is effective in preventing kernicterus, the procedure has significant complications, including cardiovascular, biochemical, and haematological abnormalities ; the risk of death may be as high as 5%. the aim of this study was to review neonates undergoing et at charlotte maxeke johannesburg academic hospital (cmjah.) objectives included describing the characteristics of babies undergoing et, comparing readmitted babies with babies who were inpatients after birth, and describing complications and outcome of et. this was a retrospective review of all newborns undergoing et for severe hyperbilirubinemia at cmjah between 01 june 2006 and 30 december 2011. babies who underwent et included those who were discharged at birth and readmitted to the general paediatric wards (readmitted babies) and those who were still inpatients after birth (in - hospital babies). subjects were identified from the cmjah neonatal database, admission registers for the paediatric wards, and the south african national blood bank database. neonates were managed according to the south african consensus guidelines at the discretion of the attending paediatrician. phototherapy was commenced in all neonates with severe hyperbilirubinemia ; et was done if the bilirubin remained above the et levels in the consensus nomogram. ethics approval was obtained from the human research ethics committee of the university of the witwatersrand. results were described using measures of central tendency, mean and standard deviation for continuous data with a normal distribution or median and range for skewed data. comparisons between continuous variables were done using paired t - tests for data with a normal distribution and wilcoxon signed rank test was used to compare skewed data. records could not be traced in 5 babies, so there were 64 babies included in the analysis who underwent 67 et. the median age of discharge after et was 8 days (range 3 to 71). readmitted and in - hospital babies are compared in table 2. in comparison to the in - hospital babies, readmitted babies were of significantly greater birth weight and gestational age, had a higher initial total bilirubin, were more likely to be breastfed, and had et at a later stage (see table 2). in most cases the cause of neonatal hyperbilirubinemia was undetermined (19/26 (73%) of readmitted babies compared to 32/38 (84%) in in - hospital babies (p = 0.17)). a total of 26/64 (40.6%) babies were admitted to the general paediatric wards for et. six babies (23.1%) had neurological signs compatible with kernicterus, including hypertonia, hypotonia, opisthotonus, high pitched cry, and seizures. all six of these babies with neurological signs had a total bilirubin level above 460 mol / l. changes in haematology and blood chemistry before and after exchange transfusion are shown in table 3. the total bilirubin and platelet counts were significantly decreased after the et, whereas calcium and phosphate levels both significantly increased after et (see table 3). most babies who underwent et were in - hospital babies (38/64 ; 59.4%) ; 17/38 (44.7%) were very low birth weight (vlbw) infants. there were 6468 neonatal admissions during the study period ; thus there were 5.8 et per 1000 neonatal admissions. one in - hospital infant required a second et ; this was a term infant with rh incompatibility. two of the babies died of presumed sepsis at 4 and 6 days of age, respectively ; both had raised c reactive protein with clinical signs of sepsis but negative cultures. the third infant was premature and died of escherichia coli sepsis with perforated necrotising enterocolitis, three days after exchange transfusion. changes in haematology and chemistry for in - hospital babies are shown in table 4. the total and direct bilirubin levels as well as the platelet count decreased significantly after et. severe hyperbilirubinemia remains a problem in neonatal care in lmics. in the present study, there were 64 babies who underwent et over a period of 4.5 years corresponding to 0.9 et per 1000 live births. this is considerably less than that reported in lagos, nigeria, where 1.9% of all neonates had an et. reasons for the lower rate of et in the present study may reflect the fact that the hospital is in a metropolitan area, where most babies are delivered within a health facility and g6pd deficiency is much less prevalent in south africa than in central and west africa. it is worrying to note that six (23%) of the babies readmitted for et had isoimmune haemolysis, suggesting that this condition was overlooked at birth. isoimmune haemolysis is a definite risk factor for severe hyperbilirubinemia and these babies should have been closely monitored after birth. in the present study, most babies with hyperbilirubinemia were male, breastfed, and delivered vaginally, which is in keeping with other reports. the present study highlights the fact that there are two populations of newborn babies who undergo et, premature and sick babies who remain in hospital after birth and well term babies who are discharged on the day of birth. for all babies, it is important to know the mother 's blood group and to screen babies for jaundice in the first 48 hours after birth. the fact that the majority of babies undergoing et were in - hospital patients may reflect suboptimal care ; however the rate of et in hospital was relatively low at 5.8 per 1000 neonatal admissions. reasons for inadequate monitoring of total serum bilirubin (tsb) in hospital were not evaluated in this study but may reflect inadequate staffing with high volumes of patients. prevention of severe hyperbilirubinemia in premature and sick infants in hospital includes implementing a protocol for monitoring tsb, either using a transcutaneous bilirubin meter (tcb) or taking blood to determine tsb. house staff must be adequately trained and supervised to ensure that tsb results are obtained timeously and that babies are properly managed. blood results may often be overlooked in busy, short staffed neonatal units, particularly after hours. it is also essential to ensure that phototherapy is effective ; for example, the baby needs to be fully exposed to the light (not covered in a diaper), the luminescence of the lights must be adequate, and the lights must be the correct distance away from the baby. the avoidable factors associated with severe hyperbilirubinemia were unknown in the majority of readmitted babies in the current study. it is, however, standard practice in the study hospital for healthy newborn babies and their mothers to be discharged within 6 hours of birth. prevention of severe hyperbilirubinemia in babies discharged on the day of birth should focus more on factors outside the hospital setting. prevention of severe hyperbilirubinemia includes educating expectant mothers and their families at antenatal clinic, how to detect jaundice, the correct steps to take if their baby is jaundiced, the dangers of haemolytic agents and certain traditional remedies, and the need for follow - up of babies discharged on the day of birth, especially those with risk factors for hyperbilirubinemia [7, 13 ]. education of primary health care workers about the dangers, signs, and management of neonatal hyperbilirubinemia is also essential. establishing breastfeeding with proper lactation support at home after hospital discharge, especially in circumstances where most well mothers and babies are discharged on the day of birth, is also very important. although tcb is ideal for this purpose, these instruments are expensive and may not be freely available in lmics. there were few complications of et ; these included a relative decrease in platelet count and increase in serum phosphate and calcium levels. the avoidable factors resulting in severe hyperbilirubinemia and kernicterus were not evaluated in the current study. the study was conducted in a metropolitan area and tertiary hospital, so it is not necessarily representative of all babies with hyperbilirubinemia in south africa. unfortunately there is no long term follow - up data available on the babies in the present study, so the rate of neurodevelopmental problems and hearing loss from severe hyperbilirubinemia is not known. although severe neonatal hyperbilirubinemia is less common in cmjah than in other african countries, six normal term babies were readmitted with signs of kernicterus. there is still a need for vigilant screening and correct management of babies with severe hyperbilirubinemia to prevent the occurrence of kernicterus.	background. severe hyperbilirubinaemia requiring exchange transfusion has become less common in recent years ; however, kernicterus still occurs. the aim of this study was to review babies undergoing exchange transfusion for severe hyperbilirubinaemia in a johannesburg hospital. methodology. this was a retrospective review of babies who required exchange transfusion in both the neonatal and the paediatric wards from june 1, 2006, to december 31, 2011. results. there were 64 patients who underwent 67 exchange transfusions. isoimmune haemolysis (both rh and abo incompatibility) was the cause of jaundice in 9/64 (14%). most babies who underwent exchange transfusion were sick or preterm and were admitted in hospital after birth (38/64 ; 59.5%) ; three of these babies died, but not during the exchange transfusion (3/38 ; 7.9%) ; all three had signs suggestive of neonatal sepsis. the remaining 26 babies (40.6%) were readmitted to the paediatric wards for exchange transfusion. six of these babies (6/26 ; 23.0%) had signs of kernicterus. the most significant complication of exchange transfusion was apnoea requiring mechanical ventilation in three patients (3/64 ; 4.6%). conclusion. despite a relatively low number of babies undergoing exchange transfusion, kernicterus still occurs and must be prevented. proper protocols for screening and management of severe hyperbilirubinaemia need to be enforced.
recent studies have shown that the classic circulation model of cerebrospinal fluid (csf) is incomplete.1 production of csf is not only dependent on choroid plexus but also on water flux in the pericapillary (virchow robin) space.2, 3 historically, csf flow through the pericapillary space is known as interstitial flow, and is considered to play a role equivalent to the systemic lymphatic system.4, 5, 6, 7, 8, 9, 10 advancements in modern magnetic resonance imaging (mri) technologies have allowed for the noninvasive investigation of water flow in vivo. these studies revealed that water dynamics of the pericapillary space, ie, interstitial flow, is controlled by aquaporin4 (aqp4), the main subset of the aquaporin water channel family in the brain.11, 12, 13 it has also been demonstrated that inhibition of aqp4 is strongly coupled with an increase in regional cerebral blood flow (rcbf).14 these observations have led to a better understanding of the architectural significance and functionality of the cerebrovascular system.15, 16 this article is a concise review of the modern concept of neural flow coupling (nfc) and its relationship to water dynamics in the pericapillary space.5, 6, 7, 8, 9, 10, 16 cerebral autoregulation signifies an intrinsic ability of the cerebral vasculature to maintain cerebral blood flow at a relatively constant rate of approximately 50 ml per 100 g brain tissue per minute in the face of blood pressure changes.17, 18, 19, 20, 21, 22 autoregulation generally functions between mean blood pressures of 60 to 150 mmhg. it is maintained in parasympathetically and/or sympathetically denervated animals,21 and the system is independent from extrinsic neural control. instead, intrinsic neural nitric oxide (no) control22 and release of vasoactive substrates by the brain are believed to play essential roles in maintaining constant cerebral perfusion.19, 20 perfusion is held constant by means of the cerebral vasculature smooth muscle that constricts and dilates in response to elevated and decreased systemic pressure, respectively.17, 18, 19, 20, 21, 22 although this upstream control of inflow pressure appears to be rather straightforward, the physiologic mechanisms underlying nfc, neural activityassociated rcbf increase, were until now poorly understood. fluidfilled canals surrounding perforating arteries and veins in the parenchyma of the brain were recognized in early modern medicine and described in detail by rudolph virchow and charles philippe robin.23, 24 the space is commonly referred to as the virchow robin space. it is now clearly understood that the fluid in the virchow robin space constitutes interstitial flow that drains into the csf system (fig 1). virchow robin interstitial flow is believed to play a role similar to systemic lymphatics.2, 3, 4, 5, 6, 7, 8, 9, 10 virchow robin space and interstitial flow. the ventricles and subarachnoid space represent the cerebrospinal fluid (csf) space in the brain. contrary to the classical concept of csf flow, water csf within the subarachnoid space is now believed to be dependent on interstitial flow in the virchow robin space. although not as yet mainstream, the virchow robin space likely surrounds the medullary veins and subependymal veins as well. as shown in figure 3, water influx from the systemic circulation into csf is strongly dependent on interstitial flow in the virchow robin space through aquaporin4 (aqp4). the basic function of systemic lymphatics is drainage of cellular debris subjected to molecular scrutiny before returning to the venous circulation. although there is no conventional lymphatic system in the brain, interstitial flow of the virchow robin space constitutes its equivalent, and plays an essential role in clearing toxic proteins from brain parenchyma. interstitial flow, and, hence, csf circulation, eventually drains into the venous system through the cerebral dural sinuses (pacchionian bodies), the latter playing a role similar to the thoracic duct of the systemic lymphatic system. an important and intriguing example of interstitial flow protein clearance is amyloid clearance.3, 5, 7, 8, 14, 15, 16 amyloid is essential for synaptic formation.25 nonetheless, excess amyloid can result in aggregation of the protein and senile plaque formation. drainage of amyloid by interstitial flow through the virchow robin space into csf is likely critical for maintaining proper homeostasis of amyloid production and clearance. the role of prealbumin, abundant in csf, as amyloid chaperon and in preventing amyloid 's natural tendency to plaque formation, further supports the amyloid clearance hypothesis.26 the aquaporin family is a large collection of integral membrane proteins that enable the movement of water across biological membranes. three isoforms, namely aqp1, aqp4, and aqp9, have been identified in brain in vivo. expression of aqp1 within cns capillaries is actively suppressed, and aqp1 in the brain is uniquely found in the choroid plexus epithelium. aqp9 is only scarcely expressed in the cns and is considered to have no significant role.12, 27 by contrast, aqp4 is expressed abundantly in the brain and has a specific distribution : the subpial and perivascular endfeet of astrocytes.2, 10, 11, 12, 13, 14 active suppression of aqp1 expression in brain capillaries is essential for proper maintenance of the blood brain barrier, preventing excessive movement of water across capillary walls.27, 28 active water influx into the csf system from the blood stream has been shown to be regulated by aqp4, not aqp1, indicating that interstitial flow plays an important role in csf dynamics.2 as cerebral equivalent of the systemic lymphatic system, interstitial flow dysfunction can be expected to result in reduction of amyloid clearance. indeed, senile plaque bearing transgenic mice showed significant decline of water influx into the csf system, to the extent similar to that found in aqp4 knockout mice.29 positron emission tomography studies in ad patients have shown virtually identical results.14 increased rcbf associated with brain activation is a wellrecognized phenomenon that is known as nfc. since this is a micro, rather than macroenvironmental event occurring within an area limited to 250 m around the site of neural activity, the regulatory mechanism for nfc should be within the capillaries.30 considering blood flow to be steady, laminar flow within a long cylindrical pipe (fig 2), the hagenpoiseuille equation gives volumetric blood flow,, as =8plr4where p is pressure loss (differences in inflow and outflow pressure), l is the length of the vessel tube, is blood viscosity, and r is the radius of the vessel.31 vessel diameter is determined by tension of smooth muscle in artery, arteriole, venule, and vein (brain vessels). capillaries are devoid of muscle and in capillaries with tight endothelium such as brain capillaries, capillary caliber is determined by the pressure balance between luminal and outer fluid pressures (brain capillary). for capillaries with leaky endothelium (common capillary), pressure balance is quickly equalized without capillary caliber changes. given that steady inflow pressure is rigorously controlled by upstream arterial autoregulation17, 18 and constant venous pressure, under physiological conditions, cerebral blood flow is virtually determined by the radius of the vessel and increases parallel to its fourth power r4 the relationship implies that even small changes in capillary caliber have significant effects on rcbf. the perforating vessels of the cerebral cortex are surrounded by a fluidfilled perivascular (virchow robin) space. at the capillary level, fluid pressure within the vessel lumen therefore, the parameter that determines capillary caliber is the pressure balance between luminal (intracapillary) and outer (pericapillary) fluid pressures. since intracapillary pressure reflects the inner pressure of arterioles, and is therefore a function of upstream arterial autoregulation,17, 18 it is the fluid pressure of the pericapillary space that inversely determines cerebral capillary caliber changes and, hence, rcbf, as follows : r41/ppericapillary aqp4 controls the water dynamics of the pericapillary space in the brain.2, 10, 14 therefore, aqp4 activities play a role in controlling rcbf. rcbf1/aqp4activities indeed, reduced aqp4 activities by its inhibitor tgn020 effectively increased rcbf in mice.13 under physiological conditions, aqp4 is believed to be inhibited by extracellular protons similar to other aqp isoforms.32 therefore, rcbf is predicted to correlate with extracellular proton density (figs 3 and 4). water permeability of brain capillaries is restricted due to the tight endothelium, presence of tight junctions and active suppression of aqp1. by contrast, significant water flow is present in the virchow robin space (interstitial flow) and is supported by active water inflow through aqp4. although it has not been clearly confirmed (?), interstitial flow may similarly be present along the medullary and subependymal veins. neural activation. proton inhibition of aqp4 results in a reduction of water flow from astrocytes into the pericapillary virchow robin space, astrocyte swelling and capillary expansion due to reduction of pericapillary fluid pressure. since the original description by urbanics extracellular (interstitial) acidification associated with neural activities has been extensively studied by various investigators.34, 35, 36 modern mri technologies demonstrated unequivocally that regional neural activities in humans are accompanied by extracellular acidosis found in a virtually identical distribution as the neural activityinduced increase in rcbf detected by blood oxygenation leveldependent contrast.37 therefore, at least from a phenomenological stand point, neural activityinduced extracellular acidification plays a role in nfc. although the precise underlying mechanisms remain to be elucidated, it appears clear that neural activityinduced interstitial acidification, and the resultant inhibition of aqp4, is indeed a main mediator of neural activityassociated rcbf increase. acetazolamide (diamox) is a carbonic anhydrase (ca) inhibitor and a powerful agent for increasing rcbf. diamox effect is well known to be accompanied by interstitial acidosis in the brain.38 within the large ca family, ca type iv (caiv) represents the dominant ca in the cerebral cortex and is anchored to the luminal surface of cerebral capillaries.39 it has been shown that interstitial ca activity in the brain is attributable to caiv.40 the human nbc1 sodium bicarbonate cotransporter directly interacts with caiv. the tethering of intracellular ca type ii (caii) and extracellular caiv in proximity to the nbc1 hco3 transport site maximizes the transmembrane hco3 gradient local to nbc1 and thereby activates the transport rate.41 since proton permeability through the tight junctions is significantly higher than for other small molecules, owing to the grotthuss proton tunneling mechanism,42 capillary caiv with nbc1 and caii effectively function as scavenger of extracellular protons generated by neural activation (fig 5). ca inhibition by acetazolamide or excess of carbon dioxide (co2) in capillary blood results in accumulation of extracellular protons which in turn inhibit water flux through aqp4. the resultant negative pressure relation with respect to intraluminal capillary pressure affects capillary dilatation and an increase in rcbf. complex of caiv anchored to luminal surface of cerebral capillary, human nbc1 sodium bicarbonate cotransporter and intracellular caii. their proximity maximizes the transmembrane hco3 gradient local to nbc1 and thereby activates the transport rate. because of the high proton permeability through tight junctions, capillary caiv with nbc1 and caii effectively function as scavenger of extracellular protons generated by neural activation. ca inhibition by acetazolamide or excess of co2 in capillary blood results in accumulation of extracellular protons. technological advancements, especially those in the field of mri, have led to a new level of understanding of the physiologic underpinnings of neural activationinduced rcbf increase, a phenomenon known as nfc. excess protons inhibit aqp4 activities in the pericapillary virchow robin space, resulting in a reduction in the pericapillary pressure. the negative balance between pericapillary and intraluminal capillary pressure induces dilatation of capillaries and an increase in rcbf. acetazolamide or excess co2 blocks active clearance of interstitial protons which are ordinarily highly permeable through the tight junctions and, similar to neural activities, causes interstitial acidification and an increase in rcbf. the precise molecular mechanism of extracellular acidification associated with neural activities remains to be elucidated. such acidification has been shown to be associated with intracellular alkalinization of astrocytes.36 active proton extrusion by astrocytes appears to be the most attractive explanation.14, 36 the functional significance of nfc has been linked to elimination of heat production brought about by neural activities. a heatsensitive voltagegated proton channel similar to neutrophil hv1 may play a role, although much remains to be investigated.14, 43	abstractthe phenomenon known as neural flow coupling (nfc) occurs at the capillary level where there are no known pressure controlling structures. recent developments in advanced magnetic resonance imaging technologies have made possible in vivo direct investigations of water physiology that have shed new insight on the water dynamics of the cortical pericapillary space and their complex functionality in relation to nfc. neural activities initiate a chain of events that ultimately affect nfc. first, neural activities generate extracellular acidification. extracellular acidosis in turn produces inhibition of aquaporin4 (aqp4) located at the end feet of pericapillary astrocytes, the water channel which regulates water influx into the pericapillary space and, hence, interstitial flow. reduction of pericapillary water pressure results in a negative balance between pericapillary and intraluminal capillary pressure, allowing for capillary caliber expansion. proton permeability through the tight junctions of the blood brain barrier is significantly high owing to the grotthuss proton tunneling mechanism and, therefore, carbonic anhydrase (ca) type iv (caiv) anchored to the luminal surface of brain capillaries functions as scavenger of extracellular protons. caiv inhibition by acetazolamide or carbon dioxide results in the accumulation of extracellular protons, causing aqp4 inhibition and a secondary increase in rcbf.
it is the leading cause of acquired disability in adults and has a tremendous socioeconomic impact on patients, their relatives and health systems. in switzerland, the incidence of stroke has been estimated to be 150/100,000 (year 2000). in 2004, the overall stroke event rate was 296.3/100,000 (287.7/100,000 in women, and 305.6/100,000 in men). the age - standardized event rate was 146/100,000 overall. during the same year, the age - standardized mortality rate was significantly higher for men (31.4/100,000) than for women (25.6/100,000). acute stroke care provided by stroke units (su) has been found to be more costly but also more cost - effective than conventional care., reported a mean cost of $ 3,200 (usd) for ischemic stroke patients. in comparison with care provided in regular neurological wards, this amount corresponds to a 7% increase of the mean cost per admission. however, the modified rankin scale was improved and post - acute inpatient costs were decreased. the scope of this article is to illustrate the guidelines for establishing su as these have been recently (2012) proposed by the swiss stroke society. these guidelines could be applicable not only in developed but also in developing countries worldwide, given sufficient resources. according to the swiss stroke society, a distinction is to be made between su and stroke centers (sc). a su is effective for all grades and all age groups of patients with stroke. it is equipped with monitored and non - monitored treatment beds. on the other hand, a sc comprises a su and extends the concept of su to specific structural, neuroradiological and neurosurgical services. personnel : medical:10-hour presence of a neurologist in the hospital during the day. at night and on weekends call service available (a consultant neurologist present within 35 minutes).the medical director is a neurologist with proven expertise in stroke treatment and at least 2 years of experience in cerebrovascular diseases.neurologist with proven expertise in neurosonology and treatment of cerebrovascular diseases.physician with at least 2 years training / work in a neurorehabilitation department.internist available in the institution on a 24/7 basis (24/7).cardiologist at the bedside (< 60 minutes).nursing : specialized in stroke (24/7).therapy : physiotherapists : onset of therapeutic interventions within 24 hours, at least one treatment session per day (weekends included).occupational and speech therapists : onset of therapeutic interventions within a day (monday - friday) in case of deficits, considering the therapeutic requirements (ability of the patient to cooperate, clinically stable state).social workers : interventions that allow the patient to participate in social life and achieve the greatest possible independence in everyday life.diagnostic modalities : brain computed tomography (spiral ct) or magnetic resonance imaging (mri) (visualization of head and neck arteries) within 25 minutes.systematized and documented swallowing evaluation (24/7) possible.neurosonological investigation (extra-/transcranial) available within 24 hours.implementation of cerebral angiography in cooperation with a sc (24/7).etiologic diagnosis and differential diagnosis of stroke (e.g., transesophageal echocardiography, hemostasis, electroencephalography) within the institution.neuropsychological investigation within two working days possible.monitoring:24/7 control (in monitored beds) of electrocardiogram (ecg), oxygen saturation, temperature, blood pressure, pulse, respiration, glucose (blood pressure measurements performed in a minimum of 15-minute intervals).control (in non - monitored beds) of ecg, oxygen saturation, temperature, blood pressure, pulse, respiration, glucose (up to 4-hourly).at least 6-hourly monitoring of neurological findings (early detection of stroke progression, relapse, and other complications). after acute interventions : more frequent monitoring.specific acute treatment : immediate availability of intravenous thrombolytic therapy (24/7) (the neurologist is responsible for the indications and the administration of thrombolysis).emergency neurosurgical and interventional neuroradiological interventions by neurosurgeons and radiologists (diagnostic and invasive neuroradiology or equivalent expertise). transfer in 60 minutes according to a written agreement between the su and the sc.carotid endarterectomy by qualified surgeons (neuro- or vascular surgeons) within 24 hours in their own center or in a sc.infrastructure:locally defined unit (su) for stroke patients and treatment - defined path.minimum total number of beds : 6.minimum number of monitored beds for acute stroke patients in a certain locally defined unit : 3.non-monitored beds for acute stroke patients in a certain locally defined unit : 3.minimum number of admissions or evaluations of acute stroke patients per year (further transfers from su to sc are also considered) : 200.minimum number of acute thrombolyses or endovascular treatments per year : 20.available and sufficiently staffed emergency department within the institution.recognized multidisciplinary intensive care unit within the institution with invasive and non - invasive ventilation options.outpatients consultation availability by a neurologist with proven expertise in stroke treatment. alternatively, this is done in a sc or in a su by a sc doctor.processes and quality assurance : standardized treatment and allocation protocols in coordination with local emergency services, acute care hospitals and other su / sc.the sc or the su physician is responsible for the beds disposal / planning.acute rehabilitation concept (early initial assessment and rehabilitation within the acute care environment).swallow concept.collaboration with neurorehabilitation.defined treatment protocols and patient pathways for diagnosis, treatment, care, early rehabilitation, prevention, and transition to rehabilitation.stroke register.documentation of quantifiable quality indicators.training and research : further education and training programs concerning stroke patients. medical:10-hour presence of a neurologist in the hospital during the day. at night and on weekends call service available (a consultant neurologist present within 35 minutes).the medical director is a neurologist with proven expertise in stroke treatment and at least 2 years of experience in cerebrovascular diseases.neurologist with proven expertise in neurosonology and treatment of cerebrovascular diseases.physician with at least 2 years training / work in a neurorehabilitation department.internist available in the institution on a 24/7 basis (24/7).cardiologist at the bedside (< 60 minutes).nursing : specialized in stroke (24/7).therapy : physiotherapists : onset of therapeutic interventions within 24 hours, at least one treatment session per day (weekends included).occupational and speech therapists : onset of therapeutic interventions within a day (monday - friday) in case of deficits, considering the therapeutic requirements (ability of the patient to cooperate, clinically stable state).social workers : interventions that allow the patient to participate in social life and achieve the greatest possible independence in everyday life. 10-hour presence of a neurologist in the hospital during the day. at night and on weekends call service available (a consultant neurologist present within 35 minutes).the medical director is a neurologist with proven expertise in stroke treatment and at least 2 years of experience in cerebrovascular diseases.neurologist with proven expertise in neurosonology and treatment of cerebrovascular diseases.physician with at least 2 years training / work in a neurorehabilitation department.internist available in the institution on a 24/7 basis (24/7).cardiologist at the bedside (< 60 minutes). 10-hour presence of a neurologist in the hospital during the day. at night and on weekends call service available (a consultant neurologist present within 35 minutes). the medical director is a neurologist with proven expertise in stroke treatment and at least 2 years of experience in cerebrovascular diseases. cardiologist at the bedside (< 60 minutes). specialized in stroke (24/7). specialized in stroke (24/7). physiotherapists : onset of therapeutic interventions within 24 hours, at least one treatment session per day (weekends included).occupational and speech therapists : onset of therapeutic interventions within a day (monday - friday) in case of deficits, considering the therapeutic requirements (ability of the patient to cooperate, clinically stable state).social workers : interventions that allow the patient to participate in social life and achieve the greatest possible independence in everyday life. physiotherapists : onset of therapeutic interventions within 24 hours, at least one treatment session per day (weekends included). occupational and speech therapists : onset of therapeutic interventions within a day (monday - friday) in case of deficits, considering the therapeutic requirements (ability of the patient to cooperate, clinically stable state). social workers : interventions that allow the patient to participate in social life and achieve the greatest possible independence in everyday life. diagnostic modalities : brain computed tomography (spiral ct) or magnetic resonance imaging (mri) (visualization of head and neck arteries) within 25 minutes.systematized and documented swallowing evaluation (24/7) possible.neurosonological investigation (extra-/transcranial) available within 24 hours.implementation of cerebral angiography in cooperation with a sc (24/7).etiologic diagnosis and differential diagnosis of stroke (e.g., transesophageal echocardiography, hemostasis, electroencephalography) within the institution.neuropsychological investigation within two working days possible. brain computed tomography (spiral ct) or magnetic resonance imaging (mri) (visualization of head and neck arteries) within 25 minutes. etiologic diagnosis and differential diagnosis of stroke (e.g., transesophageal echocardiography, hemostasis, electroencephalography) within the institution. 24/7 control (in monitored beds) of electrocardiogram (ecg), oxygen saturation, temperature, blood pressure, pulse, respiration, glucose (blood pressure measurements performed in a minimum of 15-minute intervals).control (in non - monitored beds) of ecg, oxygen saturation, temperature, blood pressure, pulse, respiration, glucose (up to 4-hourly).at least 6-hourly monitoring of neurological findings (early detection of stroke progression, relapse, and other complications). 24/7 control (in monitored beds) of electrocardiogram (ecg), oxygen saturation, temperature, blood pressure, pulse, respiration, glucose (blood pressure measurements performed in a minimum of 15-minute intervals). control (in non - monitored beds) of ecg, oxygen saturation, temperature, blood pressure, pulse, respiration, glucose (up to 4-hourly). at least 6-hourly monitoring of neurological findings (early detection of stroke progression, relapse, and other complications). specific acute treatment : immediate availability of intravenous thrombolytic therapy (24/7) (the neurologist is responsible for the indications and the administration of thrombolysis).emergency neurosurgical and interventional neuroradiological interventions by neurosurgeons and radiologists (diagnostic and invasive neuroradiology or equivalent expertise). transfer in 60 minutes according to a written agreement between the su and the sc.carotid endarterectomy by qualified surgeons (neuro- or vascular surgeons) within 24 hours in their own center or in a sc. immediate availability of intravenous thrombolytic therapy (24/7) (the neurologist is responsible for the indications and the administration of thrombolysis). emergency neurosurgical and interventional neuroradiological interventions by neurosurgeons and radiologists (diagnostic and invasive neuroradiology or equivalent expertise). transfer in 60 minutes according to a written agreement between the su and the sc. carotid endarterectomy by qualified surgeons (neuro- or vascular surgeons) within 24 hours in their own center or in a sc. locally defined unit (su) for stroke patients and treatment - defined path.minimum total number of beds : 6.minimum number of monitored beds for acute stroke patients in a certain locally defined unit : 3.non-monitored beds for acute stroke patients in a certain locally defined unit : 3.minimum number of admissions or evaluations of acute stroke patients per year (further transfers from su to sc are also considered) : 200.minimum number of acute thrombolyses or endovascular treatments per year : 20.available and sufficiently staffed emergency department within the institution.recognized multidisciplinary intensive care unit within the institution with invasive and non - invasive ventilation options.outpatients consultation availability by a neurologist with proven expertise in stroke treatment. alternatively, this is done in a sc or in a su by a sc doctor. locally defined unit (su) for stroke patients and treatment - defined path minimum number of monitored beds for acute stroke patients in a certain locally defined unit : 3. non - monitored beds for acute stroke patients in a certain locally defined unit : 3. minimum number of admissions or evaluations of acute stroke patients per year (further transfers from su to sc are also considered) : 200 recognized multidisciplinary intensive care unit within the institution with invasive and non - invasive ventilation options. alternatively, this is done in a sc or in a su by a sc doctor. processes and quality assurance : standardized treatment and allocation protocols in coordination with local emergency services, acute care hospitals and other su / sc.the sc or the su physician is responsible for the beds disposal / planning.acute rehabilitation concept (early initial assessment and rehabilitation within the acute care environment).swallow concept.collaboration with neurorehabilitation.defined treatment protocols and patient pathways for diagnosis, treatment, care, early rehabilitation, prevention, and transition to rehabilitation.stroke register.documentation of quantifiable quality indicators. standardized treatment and allocation protocols in coordination with local emergency services, acute care hospitals and other su / sc. the sc or acute rehabilitation concept (early initial assessment and rehabilitation within the acute care environment). collaboration with neurorehabilitation. defined treatment protocols and patient pathways for diagnosis, treatment, care, early rehabilitation, prevention, and transition to rehabilitation. training and research : further education and training programs concerning stroke patients. further education and training programs concerning stroke patients. standardized treatment and allocation protocols along with an acute rehabilitation concept seem to be the core of the swiss stroke management system. coordinated multidisciplinary care provided by specialized medical, nursing, and therapy staff is of utmost importance for achieving a significant reduction of dependency or death. to this end, the swiss paradigm of su organization could serve as a benchmark for future health policy decisions.	stroke represents the leading cause of acquired disability in adults and poses a tremendous socioeconomic burden both on patients and the society. in this sense, prompt diagnosis and urgent treatment are needed in order to radically reduce the devastating consequences of this disease. herein the authors present the new guidelines recently adopted by the swiss stroke society concerning the establishment of stroke units. standardized treatment and allocation protocols along with an acute rehabilitation concept seem to be the core of the swiss stroke management system. coordinated multidisciplinary care provided by specialized medical, nursing and therapy staff is of utmost importance for achieving a significant dependency and death reduction. it is believed that the implementation of these guidelines in the stroke care system would be beneficial not only for the stroke patients, but also for the health system.
cell - to - cell adhesion in epithelial cell sheets is maintained mainly through two types of junctions : adherens junction and tight junction. a number of studies have focused their attention on the transmembrane protein of the adherens junction.1,2 only in recent years has the importance of tight junction proteins in epithelial cell proliferation, survival, apoptosis, and differentiation been recognized. tight junctions are involved in cell - to - cell adhesion and serve two major functions in epithelial cell layers : the barrier (or gate) function and the fence function. the barrier function of tight junctions regulates the passage of ions, water, and various macromolecules, even cancer cells, through paracellular spaces. thus, the barrier function is relevant to edema, jaundice, diarrhea, and blood - borne metastasis. on the other hand, in other words, tight junctions work as a fence to prevent the intermixing of molecules in the apical membrane with those in the lateral membrane. this fence function is highly involved in cancer cell biology because loss of cell polarity occurs in many types of cancer cells. the fence and barrier functions of the tight junction have a common feature of compartmentalization : the fence function is performed at the subcellular level and the barrier function is performed at the organ level. finally, because of the ability of tight junction proteins to recruit signaling proteins, tight junctions have also been hypothesized to be involved in the regulation of cell proliferation, differentiation, and many other cellular functions.3,4 claudins were first cloned and named in 1998 by mikio.5 the name claudin comes from the latin word claudere claudins are a multigene family and encode tetraspan membrane proteins that are crucial structural and functional components of tight junctions. claudins have important roles in regulating paracellular permeability and maintaining cell polarity in epithelial and endothelial cell sheets.6,7 there are currently 24 claudin members in mammals, but claudin-13 is missing in humans. claudin members are divided into classic and non - classic claudins based on their sequence similarity. sequence similarity is determined by the alignment and phylogenetic tree analysis of whole - length sequences of claudins. classic claudins include claudins 110, 14, 15, 17, and 19, and non - classic claudins contain claudins 1113, 16, 18, and 2024.8 classic claudins exhibit a much stronger sequence homology than non - classic claudins. the subdivision of claudin members into classic and non classic groups was initially suggested from the sequence analysis of mouse claudin proteins. this analysis was subsequently extended to human claudins.7,8 in recent years, the roles of claudin proteins in human physiology and pathophysiology, including carcinoma development, are just beginning to be unraveled. several claudin knockout mouse models have been generated over the past 10 years, and their diverse phenotypes clearly demonstrate the importance of claudin proteins in maintaining the tissue integrity and homeostasis in various organs. although the underlying mechanisms of claudin regulation in various tissues and their exact roles in normal physiology as well as in disease states are being elucidated, more research work remains to be done.914 in this review, we discuss the conceptual framework concerning claudins and their potential implications in cancer. we anticipate that, in the next several years, our understanding of the potential role of claudins in the regulation of tumorigenesis will be significantly increased, which may, in turn, provide new approaches for the targeted therapy. tight junctions seal the paracellular cleft of epithelia and endothelia and form crucial barriers between tissue compartments. tight junctions consist of integral membrane proteins including occludin, claudins, and tight junction - associated proteins, such as zo-1. recent studies demonstrate the multilateral interactions between tight junction proteins.3,4,6 of these molecules, claudins are responsible for the formation of tight junction strands and are connected to the actin cytoskeleton mediated by zo-1.3,4,6 claudins are the most important components of tight junctions. they form the paracellular barrier that controls the flux of ions and small molecules in the intercellular space between epithelial cells. the first extracellular loop consists of about 53 amino acids and the second one is much smaller, with about 24 amino acids. the n - terminal end is usually very short (four to ten amino acids), while the c - terminal end ranges from 21 to 63 amino acids and is necessary for the localization of these proteins in the tight junctions (see figure 1). it is anticipated that the cysteines of an individual claudin can form intramolecular or intermolecular disulfide bonds. all human claudins (with the exception of claudin-12) contain a motif at the c - terminus that let them bind to pdz (psd-95/dlg / zo-1) domains of scaffold proteins.1517 claudins are critical for sealing the epithelial sheets and controlling paracellular flux of ions and small molecules. claudins are present in normal tissues, hyperplastic conditions, benign neoplasms, and cancers that exhibit epithelial differentiation. differential expression of various claudin family members in cancer can potentially be used to confirm the histologic identity of certain types of cancer and exclude others.7,913 the expression pattern of claudins is highly tissue - specific, and most tissues express multiple claudins. claudins can interact with claudins from adjacent cells in a homotypic or heterotypic fashion to form tight junctions. many studies suggest that the combination of claudins determines the selectivity and permeability of tight junctions in a given tissue.68 claudins can be polymerized together between epithelial cells to form an adhesive structure. the function of claudins in the maintenance of normal epithelial cell homeostasis has been well studied ; however, their role in the process of tumorigenesis is less clear. cancer cells can spread from the primary site to other parts of the body, a process known as metastasis. during cancer metastasis, several important steps need to be undertaken. an important step in cancer progression is the epithelial mesenchymal transition. during this process, epithelial cells downregulate cell cell adhesion structures, alter their polarity, reorganize their cytoskeleton, and become isolated and motile.18 tight junctions are involved in this cancer metastatic process. claudin-6 decreases in breast invasive ductal carcinomas and is inversely correlated with lymph node metastasis.19 reduced expression of claudin-7 is correlated with higher tumor grade and locoregional and distant metastases, including locoregional recurrences.20 it has been reported that claudin-2 level is elevated in liver metastases. hepatocyte interaction and the ability of breast cancer cells to form liver metastases in vivo.21 claudin-3 and -4 control tumor growth and metastases by sustaining expression of e - cadherin and limiting -catenin signaling.22 the association between altered claudin expression and cancer has been widely reported since the discovery of claudins.23,24 as shown in table 1,2590 the level of claudin-1 has been found to be reduced in breast cancer as well as in colon cancer.28,30 claudin-7 has also been found to be downregulated in invasive breast cancer and in head and neck cancers.66,68 these reports of decreased tight junction protein expression in cancer are consistent with the generally accepted idea that tumorigenesis is accompanied by the disruption of tight junctions, a process that may play an important role in the loss of cohesion, invasiveness, and lack of differentiation observed in cancer cells. paradoxically, other studies have shown that certain claudin proteins are upregulated in cancer (see table 1).29,67 in fact, many published studies reported an overexpression of claudins in various cancers (see table 1).35,36,56,58 for example, gene expression study of ovarian cancer showed that claudin-3 and -4 were among the most highly upregulated genes in this cancer. several additional reports have since confirmed the high expression of these two claudins in ovarian cancer. in addition, claudin-3 and -4 have also been reported to have an increased expression in other cancers, such as breast, prostate, and pancreatic cancers. the loss of claudins and other tight junction proteins in cancer has been interpreted as a mechanism for the loss of cell adhesion and an important step in the progression of cancer to metastasis. on the other hand, as discussed previously, several claudins, including claudin-3 and -4 are often upregulated in many types of cancer (table 1), suggesting that these proteins may have a positive effect on tumorigenesis. recent research has shown that, at least in the case of ovarian cells, the expression of claudin-3 and -4 may lead to an increase in cell invasion, motility, and survival, all of which are characteristics important for metastasis.91 consistent with these in vitro findings is a report that claudin-4 expression in pancreatic intraductal papillary mucinous neoplasms was associated with a more invasive phenotype.92 similarly, expression of claudin-3 and -4 was observed in advanced ovarian cancer but not in ovarian cystadenomas.93,94 it has been reported, however, that re - expression of claudin-1 in breast cancer cells can lead to the increased apoptosis in three - dimensional cultures.95 therefore, the functions of claudins in cancer may be highly tissue - specific and may depend on the type and stage of cancer. several other claudin members have been reported to play an important role in various types of tissues ; however, their roles in tumorigenesis are unknown. for example, cldn13 is a mouse - specific gene mainly expressed in tissues associated with hematopoietic function.96 claudin-13 messenger rna (mrna) and protein are observed in colon, but they are undetectable in the rest of the intestines.97 mutations in cldn14 gene are known to be involved in autosomal recessive deafness in humans.98 baker recently reported that cldn14 heterozygous mice, but not cldn14 null mice, displayed several blood vessel - related phenotypes, including abnormal distribution of basement membrane laminin around tumor blood vessels, increased intratumoral leakage, and enhanced endothelial cell proliferation.99 patients with cldn19 mutations have a high risk of progression to chronic renal disease.100 in human polycystic kidneys, decreased expression and dyslocalization of claudin-19 are noticed, suggesting a possible correlation between claudin-19 and renal disorders.101 presently, not much is known about tissue distributions or the physiological functions of claudins 2027. claudin-21 and claudins 2427 are expressed in the intestines, stomach, liver, and kidney.102 the mechanisms responsible for the differential expression of claudins in cancer are largely unknown ; however, recent studies have identified several growth factors, cytokines, and transcription factors that affect claudin expression.25,103 the tumor - promoting factors, hepatocyte growth factor and epidermal growth factor, have been shown to decrease claudin-7 expression and increase claudin-1, -3, and -4 expressions, respectively.25,103 in recent years, claudin s potential value as a target for therapeutic intervention has been increasingly recognized regardless of its roles in tumorigenesis. this is because claudin proteins are expressed at the cell surface and contain two extracellular domains that can serve as potential targeting sites (figure 1). in addition, many studies (see table 1) report that some claudins are overexpressed in certain types of cancer while others are downregulated in different types of cancer, thus creating differential expression patterns between tumor and normal cells. tight junction permeability is often higher in tumor tissues than in normal tissues, which makes claudins more accessible. therefore, a therapeutic intervention could be achieved. due to the high specificity of claudin expression patterns in cancer, it has been suggested that claudins may serve as useful molecular biomarkers for certain cancers. for example, claudin expression may be used as a prognostic indicator because low claudin-1 expression has been shown to be associated with a poor prognosis in stage ii colon cancer.30 claudin-10 expression has also been shown to be an independent prognostic factor for hepatocellular carcinoma recurrence after curative hepatectomy.81,104 it is known that claudin-3 and -4 are receptors for the bacterial toxin clostridium perfringens enterotoxin (cpe). the high expression levels of claudin-3 and -4 in multiple types of cancer may provide a unique opportunity for anticancer therapy using cpe. prostate adenocarcinoma cells expressing claudin-3 and -4 have been shown to be sensitive to cpe - mediated cytolysis.55,105,106 this cpe - mediated cytolysis was specific because prostate cancer cells lacking claudin-3 and -4 were unaffected by cpe treatment. similar experiments have also shown that breast, ovarian, and pancreatic cancer cells were sensitive to cpe treatment as long as these cancer cells were expressing claudin-3 and/or -4.53,105,107 the challenge, however, is that claudin-3 and/or -4 are also expressed in several normal human tissues, including gut, lungs, and kidneys. therefore, whether this approach will be useful in the clinical setting remains to be seen. to overcome this hurdle, it has been suggested that a nontoxic c - terminal cpe fragment could be delivered locally to normal tissues and prevent cpe toxicity during cancer treatment. other potential problems with the use of cpe in cancer treatment include the possible immune response against cpe in patients receiving the treatment, the level of surface claudin expression, and the penetration of cpe into the tumor mass.53,55,105107 therefore, additional studies are required to solve these issues before cpe can be used as a therapeutic approach. a study has shown that claudin peptides can be internalized by specific and nonspecific pathways.108 the cellular uptake of the claudin-1 peptide follows the clathrin - mediated endocytosis as indicated by inhibitors and respective tracers for colocalization. in addition, macropinocytosis and caveolae - mediated endocytosis of the peptide have also been observed. in contrast, the claudin-5 peptide is mainly internalized via the caveolae - mediated endocytosis as evidenced by the colocalization with respective tracers and vesicle markers, whereas the nonselective macropinocytosis seems to be involved in a less effective manner.108 since claudins are transmembrane proteins and contain two extracellular loops, they may also offer promising targets for antibody - based therapy. antibodies that recognize different claudins extracellular loops have been produced and shown to specifically bind to claudins on the surface of the cell, providing a proof of principle for this approach. besides antibody - based treatment, many small molecules or compounds can affect tight junction functions and, therefore, could potentially be used for anticancer therapy.109 for example, it has been reported that hydroxycamptothecin - loaded fe3o4 nanoparticles induce human hcc827 lung cancer cell apoptosis and disrupt tight junctions by internalizing claudin-1, -3, -4, and -7 proteins and decreasing their protein expressions.110 hangamdan - b, an anti - invasive agent extracted from eight korean medical animals and plants, can inhibit the cell migration and invasion of nci - h460 lung cancer cells and tighten the tight junctions through down - regulating claudin-1, -2, -3, and -4 at both transcriptional and translational levels.111 butyrate improves the barrier function of intestinal epithelia and has the potential to treat inflammatory bowel disease. it restores the tight junctions in inflammatory bowel disease patients by downregulating the expression of claudin-1 and -2 and upregulating occludin, cingulin, zo-1, and zo-2.112 it has been suggested from the gene expression studies of breast and ovarian cancers56,67 that the identification of specific expression patterns of claudin family members could be used as potential biomarkers for these cancers. a cancer biomarker refers to a substance or process that is indicative of the presence of cancer in the body. not all of the claudins in table 1 are considered as biomarkers. up until now for example, claudin-7 may serve as an immunohistochemical biomarker in the differential diagnosis of chromophobe renal cell carcinoma and oncocytoma ; claudin-4 could serve as an immunohistochemical biomarker in the differential diagnosis of undifferentiated pancreatic cancers and highly invasive pancreatic cancers ; and the expression of claudin-10 in hepatocellular carcinomas can potentially serve to predict disease recurrence after curative hepatectomy.60,76,81 these findings are important because changes in expression patterns of claudins allow for detection, diagnosis, and potential treatment of drug - resistant cancers. clinical trials are certainly required to establish this potential, but research studies on claudin functions and regulations as well as their roles in cancer are critically needed for providing important insight in relation to normal and neoplastic cellular physiology. the fact that the expression levels of many claudin family members are altered in various types of cancers and that claudins are localized at the cell surface make claudins potentially attractive molecular targets for cancer therapy. the clinical application of using claudin - targeted therapy, however, will present several challenges. the most important challenge is the systemic toxicity. because claudins are expressed in the epithelia of most organs in the body, the toxicity issue must be addressed. the small molecules or synthetic compounds designed to disrupt tight junctions may also be a double - edged sword, because an increase in tight junction permeability can enhance the uptake of anticancer agents, but, at the same time, it may also increase the nutritional uptake to promote tumor progression. therefore, further studies, especially at the animal level, are needed to determine the toxicity issue of claudin - targeted therapy and to evaluate whether this approach can be applied safely and practically in a clinical setting. claudins play an indispensable role in tissue homeostasis and barrier formation ; our knowledge about the role of claudin proteins in cancer biology is, however, still limited. nevertheless, with our increasing understanding of specific functions of claudins in various cancers, claudins may serve as promising tumor biomarkers as well as therapeutic targets in the near future. claudins are the main structural and functional proteins of tight junctions in epithelial cells and maintain the tissue homeostasis through regulating epithelial barriers, paracellular transport, and signal transduction. numerous studies have demonstrated the altered expression patterns of different claudin members in a variety of diseases, particularly in cancers. identifying the specific functions of claudins in tumorigenesis has become one of the main research focuses in the field of cell biology. it is still unclear what the association between altered claudin expression and tumorigenesis is, despite great research efforts in the last decade. with rapid research advancement and newly developed technology, however, the role of claudins in cancer and its clinical applications in cancer detection, diagnosis, and potential therapeutic intervention may become a valid approach in the near future.	tight junctions, or zonula occludens, are the most apical component of the junctional complex and provide one form of cell cell adhesion in epithelial and endothelial cells. nearly 90% of malignant tumors are derived from the epithelium. loss of cell cell adhesion is one of the steps in the progression of cancer to metastasis. at least three main tight junction family proteins have been discovered : occludin, claudin, and junctional adhesion molecule (jam). claudins are the most important structural and functional components of tight junction integral membrane proteins, with at least 24 members in mammals. they are crucial for the paracellular flux of ions and small molecules. overexpression or downregulation of claudins is frequently observed in epithelial - derived cancers. however, molecular mechanisms by which claudins affect tumorigenesis remain largely unknown. as the pivotal proteins in epithelial cells, altered expression and distribution of different claudins have been reported in a wide variety of human malignancies, including pancreatic, colonic, lung, ovarian, thyroid, prostate, esophageal, and breast cancers. in this review, we will give the readers an overall picture of the changes in claudin expression observed in various cancers and their mechanisms of regulation. downregulation of claudins contributes to epithelial transformation by increasing the paracellular permeability of nutrients and growth factors to cancerous cells. in the cases of upregulation of claudin expression, the barrier function of the cancerous epithelia changes, as they often display a disorganized arrangement of tight junction strands with increased permeability to paracellular markers. finally, we will summarize the literature suggesting that claudins may become useful biomarkers for cancer detection and diagnosis as well as possible therapeutic targets for cancer treatment.
statins are a very widely used class of medication and controlled studies have demonstrated clear benefits with respect to cardiac disorders and also stroke and cognitive function. because of this there are moves toward their use in primary prevention of atherosclerosis (1). the literature includes numerous reports of cognitive dysfunction (2) even though their occurrence was not borne out as a general effect in the controlled trials (e.g.3). however the previously published reports have not mentioned aphasia or dysphasia as a specific side effect except as part of a much wider and more serious problem (4). despite this a general search of the internet however as at the 30th march 2011 the australian register of drug adverse reactions records six cases of aphasic disturbance with atorvastatin, one with rosuvastatin and two with simvastatin (goodwin, personal communication). this case is presented as a reasonably well documented occurrence of dysphasia associated with the use of atorvastatin and rosuvastatin and a consideration of some of the factors that might be involved in both the genesis of the syndrome and the absence of documented reports. mrs. x. y. a 58-yr - old caucasian woman, presented for medicolegal examination on the 14th of april 2010 with regard to a compensation claim involving allegations of harassment at work producing anxiety and depression. at the time of her initial presentation for treatment her general practitioner had noted that her blood pressure was higher than usual and had prescribed the statin lipitor (atorvastatin) 10 mg per day together with indapamide 2.5 mg per day. x. y. reported that she had developed problems in " word finding " in that her speech would be interrupted because she would be unable to find a word to describe an object. x. y. had ceased the lipitor after a few days and said that her symptoms had resolved quite quickly. she had seen her doctor four weeks later and the doctor had noted " had symptoms of haziness and confusion with the lipitor tablets so patient had stopped them. nil symptoms since then. claims x. y. had been commenced on crestor (rosuvastatin) 5 mg daily while continuing on indapamide. x. y. was continuing to take indapamide 2.5 mg per day. a review of mrs. x. y. 's investigations indicated that a the time she had been prescribed lipitor her total cholesterol was 6.1 mm (hdl 1.27, ldl 3.77), trigycerides 2.34 mm and fasting glucose 5.8 mm. x. y. had developed dysphasia as a direct side effect of the use of simvastatin. that this is likely to have been a generic statin effect is supported by the recurrence of milder symptoms on rosuvastatin and their remission on its cessation. using the method of attribution recommended by naranjo and colleagues the greater effect resulting from the rosuvastatin is likely to reflect the co - incident prescription of indapamide as both drugs are metabolised through the cyp 450 3a4 pathway whereas rosuvastatin is metabolised via the cyp 450 2c9 pathway (6, 7). there is clear evidence that aphasia can be included in the syndrome of mitochondrial encephalopathy (melas) (8) but in this case there is no history of other mitochondrial dysfunction such as muscle weakness. wagstaff and colleagues (2) suggest that inhibition of membrane synthesis may affect the neuronal membrane. this is supported by baker and tarnopolsky (9) who also suggest that decreased ubiquinone (co - enzyme q10) synthesis may lead to decreased atp production and reduced free radical scavenging, and by ihara and colleagues who report that the cerebral pathology occurring in their melas patients reflected damage at a cellular rather than vascular level (6). it may be that speech requires a selective increase in neuronal metabolism and is therefore a vulnerable function. slow cyp 450 metabolisers are likely to have proportionately higher blood levels and there may also be a genetically determined increased sensitivity to lower ubiquinone levels within the mitochondria in some patients (11). given the history of the episodes in this patient and the comments written in the attending practitioners notes it would seem that other episodes of similar syndromes may be more common than reported. i subsequently have had one further patient retrospectively report transient cognitive symptoms on a statin. accad (12) notes that one of the problems in the use of statins is the immediacy of side effects and the long delay of benefits. however another problem would seem that there tends to be a " one size fits all " approach and that because of the substantial overall benefits of statin use significant side effects are masked in large trials. some greater attention to the group reporting side effects may demonstrate significant markers such as cyp 450 slow metabolising that would allow prediction of the at risk group as well as defining specific genetic abnormalities in cerebral lipid metabolism such as those reported by hollingworth and colleagues (13). also this particular case draws attention to a need for greater awareness of possible drug interactions through the cyp 450 system amongst primary care physicians.	this paper presents a case of reversible dysphasia occurring in a patient prescribed atorvastatin in combination with indapamide. a milder dysphasia recurred with the prescription of rosuvastatin and was documented on clinical examination. this resolved following cessation of rosuvastatin. the case highlights both a need for a wider understanding of potential drug interactions through the cyp 450 system and for an increased awareness, questioning and reporting of drug side - effects.
mobility limitations are defined by impairment or dependence in movement and affect between one third and one half of adults aged 65 or older. lack of physical activity in older individuals can lead to loss of muscle mass (sarcopenia), loss of bone density (osteoporosis), and an increase in fat mass (obesity) [2, 3 ]. isolation and loss of social ties resulting from reduced mobility can lead to depression and other adverse mental health outcomes. a lack of access to resources such as fresh foods and medical care which can result from limited mobility can also have negative impacts on health. individuals with mobility limitations are also at higher risk of health service utilization [68 ] and institutionalization [6, 9, 10 ]. ultimately, further frailty and disability and an increased risk of premature mortality can result from restricted mobility [1, 11 ]. methods of assessing mobility limitations vary. in assessment of mobility, it is important to distinguish between capacity to function what an individual could do and enacted function what an individual does do. in this way, assessments of an individual 's walking behavior represent an enacted form of mobility while questions that assess an individual 's perception of their ability represent functional capacity. mobility restrictions are not typically the result of a single cause, but arise from an interaction of risk factors in various domains, both individual and environmental. traditionally, disability research had been based on the medical model in which the focus is on the individual and pathology. more recently, following on the work of lawton [14, 15 ], verbrugge and jette, and the world health organization 's international classification of functioning, disability, and health (icf), disability models have focused on the interaction of the individual with their environment. lawton stressed the importance of the environment in determining the well - being of older adults where an individual 's competence to deal with their environment combines with the stresses, or press, that the environment places on that individual. thus, lawton 's model adds the possibility that mobility may be enhanced through environmental buoys as compared to the medical model that assumes decline. both the icf and verbrugge stress the importance and bidirectionality of environmental as well as personal factors on individual health [16, 17 ]. environmental characteristics are hypothesized to limit or promote an individual 's ability to complete purposeful actions and fulfill role expectations, affecting physical functioning and disability (see figure 1). older adults may be more vulnerable to influence of their residential environment as they tend to travel outside their own neighborhoods less often than do younger adults and children who travel for work and school and tend to have a longer duration of exposure to neighborhood influences than younger individuals. declining physical and mental health, shrinking social networks, loss of social support, and increased fragility may also reduce the ability of older individuals to cope with environmental demands [5, 19, 20 ]. therefore, neighborhood environment likely has a greater impact on the elderly than on those in other age groups and evidence suggests that supportive environments improve quality of life in older adults. lawton proposed several dimensions of environment that are important for older adults : personal environment (family, friends), suprapersonal environment (i.e., neighborhood racial or age composition), social environment (norms or values related to society or culture), and physical environment (e.g., built environment). the built environment is defined as the human - made or human - altered space in which individuals live out their daily lives and is the focus of this paper. much of the existing research regarding neighborhoods and health has been conducted in younger or middle - aged adults and has focused on aspects of the environment other than the physical or built environment [19, 20, 23 ]. the built environment 's effect on health has been conceptualized into three domains : transportation systems which include street networks and transit systems, land use patterns which includes density and land - use mix, and urban design which includes safety, attractiveness, and site design. transportation systems are defined as the network of physical infrastructure, such as its street network, transit systems, and trails (e.g., for jogging or biking,). transportation systems influence how easy it is to travel through a neighborhood and get to places a person wants to go. land use patterns reflect where and how residential, commercial, and industrial uses are distributed in a neighborhood. density of land use represents an increased compactness of neighborhoods with easier access to pedestrian destinations. urban design characteristics such as number and width of traffic lanes, size and extensiveness of sidewalks, traffic calming devices influence safety and attractiveness and ultimately decisions about whether or not to walk. pleasant pedestrian environments that promote feelings of belonging to a neighborhood and trust in ones neighbors can be created through positive urban design. in contrast, evidence of decay, such as vandalism and poorly maintained vacant lots, can reduce mobility by creating feelings of discomfort in one 's neighborhood. all three of these domains can potentially impact mobility in the elderly (see figure 1). use of self - reported measures of the environment is common in the existing literature but relies on participant 's perception of problems rather than actual presence of barriers. evidence consistently shows differences between objective and perceived measures of the local environment [19, 24 ]. the two measurement types are likely capturing different constructs both of which are important in determining mobility of older adults. we focus on objective measures here in an attempt to summarize the direct effects of built environment factors as these can be ideal targets for public policy interventions. the goal of this paper is to summarize the recent published literature on objective measures of the built environment and mobility or disability in older adults and provide a critical analysis of the limitations. searches of medline and web of science were conducted for english - only articles published between 1 january, 1990 and 7 december, 2010 with the following keyword search terms : neighborhood, built environment, or physical environment and elderly, older adults, aging, mobility, disability, walking, or physical function. additional articles were identified through consultation with experts and review of reference lists of included articles. inclusion criteria were (1) the study population consisted of community - dwelling adults aged 60 years or older or if no range was provided, the average age was 65 years, (2) built environment was objectively measured either through use of administrative datasets or research rater assessments, (3) outcomes included measures of mobility or disability and physical functioning as described in verbrugge 's disablement model. articles were excluded if they were a review or commentary or if they provided qualitative data only. of these, 28 articles were reviewed for inclusion criteria, with seventeen articles meeting our criteria. four studies were longitudinal [2528 ] ; the remainder assessed cross - sectional associations. one study used nationally representative data from the usa and one was conducted outside the usa. seven of the studies (41%) were conducted in the pacific northwest [28, 3035 ]. enacted function, or walking in some form, was the most commonly assessed outcome, though there was little overlap in the way in which walking was assessed. walking has been measured as specifically for exercise, for utilitarian purposes [30, 36 ], by frequency of neighborhood walking on a likert scale [3234 ], by whether individuals met physical activity recommendations for walking (> 150 hours / week) [27, 29, 37 ], and by other measures of walking frequency [3, 28, 31 ]. one study used accelerometers to directly measure the number of steps taken by participants in a day. there were also a wide range of definitions for neighborhood, including specified distances from an individual 's home (i.e., quarter - mile radius), census tracts, and other administratively defined neighborhoods. subgroup analyses were completed in only 5 studies, including gender, lower body functional status [37, 39 ], age, and neighborhood socioeconomic status. fewer than half of the studies explicitly stated the theoretical framework or causal model that guided their research in the article [26, 28, 30, 34, 3739 ]. effect sizes tended to be small : approximately three - quarters of the statistically significant estimates had relative risks or odds ratios below 2.0 (range was 1.08 to 4.12). traffic - related street characteristics have been assessed in relation to mobility, with high - traffic volume positively associated with walking. however, presence of through routes, representing high - traffic volume, was not associated with disability. a high percentage of car commuters, indicating a greater reliance on driving rather than walking for transportation, was positively associated with increased walking difficulty among those aged 75 and older, but not among younger age groups. living within a specified area of bogot, columbia in which streets are closed to vehicular traffic on sundays and holidays, creating a pedestrian corridor, was positively associated with walking among older residents. proximity to walking paths and trails was associated with amount of daily walking but not with frequency of neighborhood walking. finally, presence of nearby transit stops, providing access to areas outside the immediate neighborhood via public transit, was not associated with walking in two studies [29, 31 ]. street connectivity, indicating shorter blocks with more intersections and resulting in easier pedestrian links between two points, have been studied in relation to walking in older adults with mixed results. nagel and colleagues and satariano and colleagues found no association [31, 37 ], li and colleagues found a positive association, and gomez and colleagues found an unexpected negative association. differences in study site, neighborhood definitions, and operationalization of walking likely accounted for some differences in results for street connectivity. neighborhoods were specified differently in the four studies : those studies finding no association, nagel. and satariano., used a specified distance from homes, li. used city - defined neighborhoods, and gomez. used neighborhoods defined by socioeconomic status. and li.) and another two discordant studies both assessed walking as meeting physical activity recommendations (satariano. and gomez.). housing density was associated with greater levels of walking and with less disability among those with lower body functional limitations. however, mix of land use, representing proximity to a variety of destinations such as places of employment and retail establishments, has been assessed in several studies with inconsistent results. more mixed land use was negatively associated with walking in one study, negatively associated with disability among those with lower body limitations in another, and unassociated with disability in a third. proximity to particular destinations has been widely assessed as a promoter of mobility among older adults. presence of destinations may increase mobility by providing locations for recreational walking or by providing access to needed services such as grocery stores. no associations have been found between walking and presence of recreational facilities [28, 38 ], gyms, or schools. in contrast, shopping malls and overall retail destinations have been associated with walking [31, 32 ]. more general measures of destinations have been used, including a measure of total places of employment which was positively associated with walking and two separate measures of select destinations, including places such as retail businesses and parks, neither of which was associated with walking [36, 37 ]. front entrance characteristics that promote social interactions, such as presence of a stoop and a shallow housing setback, were positively associated with physical functioning among older adults in a hispanic neighborhood. neighborhood decay, represented by presence of graffiti or vandalism, was not associated with disability. graffiti or vandalism was associated with less walking in one study but not associated in another. differences in results for the two walking studies can not be attributed to size of the studies or to assessment of neighborhood as these were similar for both studies. however, the study finding no association evaluated walking as frequency of any neighborhood walking and the one reporting a positive association measured walking for errands only. neither presence nor condition of sidewalks was associated with walking in several studies [31, 32, 36 ] but presence of safety measures for pedestrians against traffic was associated with walking. presence of parks has been positively associated with walking in two studies [33, 34 ], but no association was found in three others [29, 31, 38 ]. these inconsistencies may be a result of different localities, differences in neighborhood definitions, or differences in outcomes assessments as these all differed between those with positive findings and those with findings of no association. michael and colleagues demonstrated a positive association between proximity to parks or paths and increases in walking over a 36-year period among men living in neighborhoods classified as having high socioeconomic status but not among those living in low socioeconomic status neighborhoods. for some study questions, a theoretical framework was used to guide the development of a built environment summary score. if the items in the summary score are similarly correlated with mobility, it may provide a more robust exposure than a single measure. urban sprawl represents density of land use with more sprawling areas often having poorer accessibility and greater reliance on automobiles for transportation. urban sprawl measured by census data was negatively associated with walking in cross - sectional analysis, but no association was found between movement to an area classified as more or less sprawling and change in walking behavior. neighborhood walkability scores have included land use mix, residential density, street connectivity, park and trail presence, and vehicular traffic information. frank and colleagues demonstrated a positive association between their walkability score and walking, whereas berke and colleagues found a positive association only among women. patterson and chapman developed a scale that combines elements of urban sprawl and walkability and found it was positively associated with walking among older adults in their study. another study reported negative street characteristics, defined as low density of intersections, few shade trees and few transit stops, were associated with greater disability. the evidence provides empirical support for an association between aspects of the built environment and mobility in older adults. this paper suggests that built environment characteristics from three domains (transportation systems, land use patterns, and urban design) can impact both functional limitations and disability in positive and negative directions. however, it is still unclear if these associations represent direct influences on the disablement process. the most promising evidence points to high density of intersections, street and traffic conditions, and proximity to select destinations and green space as the most likely factors to impact mobility, though results have been inconsistent. there are many differences between studies regarding neighborhood definition, exposure measurements, and outcome assessment. theoretical and methodological limitations are present in much of the existing literature on this topic. a number of papers lacked an explicit theoretical framework to guide determination of which neighborhood factors may impact mobility, at what spatial resolution effects should be assessed, and which individual and neighborhood level factors should be considered as confounders or mediators [19, 23, 41 ]. a majority of the existing literature is cross - sectional, making causal inferences impossible [19, 20, 22, 24 ]. it is unknown whether individuals adapt their mobility based on environmental presses and buoys or whether they choose neighborhoods with fewer environmental demands as their potential mobility decreases. however, there is some evidence that an effect of built environment on walking persists even after accounting for selection factors. it is unlikely that built environment characteristics affect all neighborhood residents in the same manner [19, 24 ]. assessing subpopulations among older adults may prove important as the socially disadvantaged among them women, minorities, and those with low income may be more vulnerable to environmental factors and have a higher propensity to live in disadvantaged neighborhoods [5, 20 ]. in addition, results should be replicated in different localities as the existing research has been limited in its geographic scope and it is unclear if differences may be due to unique characteristics of a locality. greater use of nationally representative data may help to confirm results and assess effect modification by location, although these studies may suffer from less detailed measures of the built environment. finally, this research field would benefit from use of broader measures of enacted mobility. this paper has identified walking measures as the primary measure of mobility ; however, general mobility may be more important than walking, specifically. use of assistive devices, public transportation, and personal automobiles allow for increased mobility and access to services such as healthcare and healthy foods. general mobility assessments are available, such as the university of alabama birmingham life - space assessment [43, 44 ]. life - space is defined as the spatial area traveled by an individual in their daily life over a specified period of time. the life - space assessment assesses extent of movement in the past month, how frequently that movement occurred, and whether assistance was used. new technologies are also allowing objective measures of mobility through use of individual global positioning system (gps) monitors. gps monitors do not rely on individual recall, allow assessment of individual trips into the community, and can provide information on specific location and speed of movement. the current review is limited in that it addresses only objective measures of the built environment. while objective characteristics are more relevant to policy interventions, perceived measures capture important information about an individual 's relationship with their environment. perceived environmental measures can more easily assess quality and access to resources within the built environment that are often not apparent from objective data (e.g., residents underreport neighborhood parks because they are not safe to use). studies using perceived measures face a number of methodological challenges and bias issues that complicate their interpretation. perceived and objective measures are known to capture different conceptual aspects of many environmental factors. only five articles included in this review assessed perceived as well as objective measures, though only two included comparable variables [29, 32, 34, 37, 38 ]. more research is needed that allows direct comparison of the two types of measures and allows evaluation of independent and combined effects on mobility. an additional limitation was the use of broad search terms resulting in a large number of abstracts. the lack of dual review may have resulted in missed articles, but the use of reference lists as an additional review should have at least partially addressed this. for this field to advance, research must have a strong theoretical framework, identify associations of the built environment with incident mobility restrictions, assess how changes in the built environment affect mobility, and characterize subpopulations among which these associations are strongest, areas that have not been adequately addressed in previous research. in general, effect sizes of associations between built environment characteristics and functioning in older adults are small to moderate. however, a large percentage of the population is exposed to these conditions, indicating that the potential public health impact of policy interventions could be great. the advantage of population level interventions over those that target only high - risk individuals has been demonstrated [49, 50 ]. in general, older adults wish to age in place, remaining in their homes rather than moving to potentially more accommodating locations. in order to facilitate aging in place and maintaining quality of life as people age, it is important to understand the role of the built environment on mobility limitations and disability while addressing the limitations of the current body of evidence.	mobility restrictions in older adults are common and increase the likelihood of negative health outcomes and premature mortality. the effect of built environment on mobility in older populations, among whom environmental effects may be strongest, is the focus of a growing body of the literature. we reviewed recent research (19902010) that examined associations of objective measures of the built environment with mobility and disability in adults aged 60 years or older. seventeen empirical articles were identified. the existing literature suggests that mobility is associated with higher street connectivity leading to shorter pedestrian distances, street and traffic conditions such as safety measures, and proximity to destinations such as retail establishments, parks, and green spaces. existing research is limited by differences in exposure and outcome assessments and use of cross - sectional study designs. this research could lead to policy interventions that allow older adults to live more healthy and active lives in their communities.
coronary artery fistula (caf) is an abnormality in the termination of coronary artery and it was first described in 1865 by krause (1). it is a communication between one or more coronary arteries and a cardiac chamber or great vessel resulting in a left to right shunt. caf is rare with an estimated prevalence of 0.002% in the general population and 0.05 - 0.25% among patients who undergo coronary angiography (2). the majority of the caf originate from the right coronary artery and drain into the right ventricle (3). herein, we report a rare case of caf from the left circumflex artery to the coronary sinus. a 35-year - old woman with no co - morbidity was referred to the cardiology unit for palpitations that she had been experiencing since childhood. the episode occurred at rest, lasting for less than 10 minutes and happened 2 - 3 times a week. she denied having any chest pain or symptoms of heart failure. on examination, her hemodynamic status was stable. there was a soft pan - systolic murmur at the precordial area and grade-1 continuous murmur at the left sternal border. transthoracic 2-dimensional echocardiography demonstrated dilation of both the atrium and left circumflex artery with a maximum diameter of 15 mm color doppler echocardiography showed the course of the left circumflex artery emptying into the coronary sinus (figure 1 a). continuous turbulence flow on color doppler at the level of coronary artery - coronary sinus connection as well as in the coronary sinus indicated left - to - right shunt flow (figure 1 b) for further delineation of the fistulous communication, ecg - gated contrast - enhanced coronary ct angiography was performed. the patient subsequently underwent an ecg - gated contrast - enhanced coronary ct angiography study using a dual - tube 64-slice multi - detector ct (siemens, erlangen germany). as per standard protocol in our institution, to achieve a resting heart rate of not more than 70 beats / minute, she was given oral metoprolol 50 mg, and lorazepam 1 mg. in addition, sublingual glyceryltrinitrate 0.5 mg was given immediately before the scan to improve visualization of the coronary artery. electrocardiographically (ecg)-gated ct coronary angiogram was performed by intravenous injection of 50 ml of non - ionic low osmolar contrast medium (iopromide 370 mg / ml) via 18 gaugebranula at a rate of 5 ml / s. the ct scan revealed a tortuous fistulous communication between the left circumflex artery and the coronary sinus 13.6 mm in diameter for the left circumflex artery and 11.8 mm (axial) and 24 mm (coronal) diameter for the coronary sinus (figures 2 and 3). the circumflex artery was remarkably large and originated directly from the left coronary cusp of the aorta. left anterior descending artery originated from the left circumflex artery. the coronary sinus was bulky in size draining into the right atrium causing right atrial enlargement due to volume overload. the patient was referred for cardiac catheterization, which confirmed a giant coronary arterial - venous (a - v) fistula arising from a dilated and mildly tortuous circumflex artery (figure 4). the vessel course could not be well delineated because of its poor contrast opacification. at present coronary artery fistulas (caf) are anomalous terminations of the coronary arteries and are considered a major congenital anomaly (4). caf is a rare abnormality and usually occurs alone (5). congenital cafs are thought to arise as a result of incomplete embryonic development ; normally the coronary arteries communicate with the great vessels and chambers of the heart via sinusoids and during development, these sinusoids transform into a normally calibrated capillary network. it has been postulated that incomplete closure of these sinusoids can result in caf (4). acquired caf can occur as a result of inflammation, atherosclerosis, trauma and collagen vascular disease. in our case, the patient had no significant previous surgical or medical history to suggest that the caf is acquired. the main difference between congenital and acquired caf is mainly based on history. in terms of vessels involvement and symptoms, the congenital and acquired forms can appear identical (6). caf originates from the right coronary artery in 52% of cases followed by left anterior descending artery in 30% and left circumflex in 18% of cases (5). more than 90% of cafs drain into the right side of the heart (5). the most common drainage sites in order of decreasing frequency are the right ventricle (41%), right atrium (26%), pulmonary artery (17%), coronary sinus (7%), left atrium (5%), left ventricle (3%) and the superior vena cava (1%) (4, 7). most cafs are single communication, but multiple fistulae have been reported too (8). the clinical symptoms of caf depend on their anatomy, the relative size of the fistula and their flow reserve (9, 10). the majority of patients with caf are asymptomatic especially during the first two decades of life (5, 11, 12). the most common clinical finding in this group of patients is continuous heart murmur that leads to further evaluation and diagnosis of caf (8). this murmur is usually heard at the middle left or right sternal border or even at the lower sternal border (9). however, symptoms can develop later in life due to gradual enlargement of the fistula leading to an increase in the left to right shunt (8). at this stage, the patient can present with symptoms of congestive heart failure that presents as reduced effort tolerance and paroxysmal nocturnal dyspnea. apart from that, they can also present with myocardial ischemic symptoms such as angina due to coronary artery steal (5, 8, 11). rare complications include stroke, endocarditis, endarteritis, fistula thrombosis that may cause acute myocardial infarction, atrial and ventricular arrhythmia (5, 12). in this case, our patient presented with palpitation and blackout that are rare presentations of caf, but may happen as a result of atrial or ventricular arrhythmia. tortuous and ectatic coronary artery is an important clue of caf ; however, the tortuous vascular course also makes the detailed anatomy difficult with echocardiogram. cardiac catheterization and angiography has traditionally been the main diagnostic technique in the assessment of caf. the precise course of the coronary artery and its relation to the surrounding structure is not shown. in addition, this modality is invasive with a small but not negligible procedure - related morbidity and mortality. most of cafs are small and are found incidentally during coronary angiography. however, with more frequent use of multidetector computed tomography (mdct) in cardiac imaging, the number of incidental findings of caf has been increasing. in contrast to catheter angiography, ct coronary angiography is noninvasive and has multiplanar capability to evaluate caf. with the introduction of mdct and the development of ecg - gated scanning and reconstruction technique, ct coronary angiography has emerged as a new opportunity for noninvasive cardiac imaging (13, 14). the high spatial and temporal resolution of mdct with faster volume coverage permits direct visualization and analysis of the coronary artery system to detect any enlarged fistula (13). it allows systematic evaluation of the aorta, pulmonary vessels, cardiac chamber and ventriculoatrial connection as well as evaluation of aneurysmal dilatation or thrombus formation. in addition, ct via volume rendering enables 3-dimensional ct data evaluation of the heart and coronary arteries and gives an excellent overview of the complex cardiovascular anatomy for pre - operative planning (14). furthermore, multiplanar reconstruction (mpr) analysis permits specification of the drainage site in a patient with caf (13, 14). in congenital caf, the involved coronary artery is usually tortuous and dilated, as in this case. true aneurysm formation can also be seen along the fistulous tract in the congenital form. magnetic resonance imaging (mri) is another noninvasive technique that can be used in the assessment of caf to evaluate anatomy, flow and function. cine mri sequence has the advantage of demonstrating dynamics and turbulence flow at the fistula entry site (9). black blood imaging allows better visualization of the coronary lumen and wall over conventional spin echo sequence by improving the image quality (9). besides that, mri has the superiority of not using ionizing radiation. however, it is not as widely available as ct and requires longer scanning time. spontaneous closure of the fistula is uncommon and may occur due to spontaneous thrombosis especially in small cafs (4). most cafs will eventually enlarge and warrant intervention by either trans catheter closure or surgical ligation. indication of treatment includes symptoms attributable to caf, multiple fistula connection, myocardial ischemia and fistula rupture with cardiac tamponade (11, 15). trans catheter closure is usually indicated for proximal location of the fistulous vessel, single drain site, extra anatomic termination of fistula away from the normal coronary artery and older age group (10). on the other hand, surgical ligation is indicated for large cafs, multiple communications, multiple terminations, very tortuous pathway, significant aneurysm formation and presence of large vascular branches (10). trans catheter occlusion is associated with lower morbidity and mortality rate as compared with surgical ligation (15). long - term follow - up is recommended due to possible post - operative recanalization, persistent dilatation of the involved artery, thrombus formation and myocardial infarction (16). management of caf (either congenital or acquired) mainly depends on the symptoms and size of the fistula. small caf in an asymptomatic patient does not require immediate intervention but a regular follow up and reassessment of the fistula are indicated (15). however, asymptomatic caf should be repaired as symptoms and fistula related complications increase with age (8, 12). for this reason, our patient was planned for surgical ligation. in conclusion, even though cardiac catheterization and angiogram is the gold standard diagnostic method, mdct is a noninvasive and useful alternative in determining the accurate anatomic relationship in caf. therefore, in addition to evaluation of the coronary arteries for stenosis and plaques, special attention should be paid to their courses and terminations in every ct study of the heart to detect these potentially fatal anomalies. the choice between embolization and surgical ligation should depend on anatomical and functional characteristics of the fistula.	coronary artery fistula (caf) is a rare anomaly of the coronary artery. patients with this condition are usually asymptomatic. however, cardiac failure may occur later in life due to progressive enlargement of the fistula. diagnosis is traditionally made by echocardiogram and conventional angiogram. however with the advantage of new technologies such as computed tomography (ct) coronary angiography, the course and communications of these fistulae can be delineated non - invasively and with greater accuracy. we report a case of a left circumflex artery fistula to the coronary sinus which was suspected on echocardiogram and the diagnosis was clinched on ecg - gated ct.
all subjects gave written informed consent, and the study was approved by the local ethics committee. monocytes were separated using superparamagnetic polystyrene beads coated with a primary monoclonal antibody specific for the cd14 membrane antigen expressed on human monocytes (invitrogen, groningen, germany) and resuspended in hanks balanced solution containing (in mmol / l) nacl 136, kcl 5.40, cacl2 1, kh2po4 0.44, na2hpo4 0.34, hepes 10, ph 7.4. monocytes were counted in neubauer chamber and adjusted in each experiment. to evaluate the effects of high glucose and oxidative stress on trp channel expression, monocytes were exposed to 5.6 mmol / l d - glucose (control), 30 mmol / l d - glucose, or 100 mol / l peroxynitrite (onoo) for 4 h. additional experiments were performed using 30 mmol / l l - glucose or 30 mmol / l d - glucose in the presence of the superoxide dismutase mimetic tempol (tmp, 100 mol / l). we also evaluated the effects of lipopolysaccharide - induced oxidative stress, tumor necrosis factor- (tnf-)-induced activation of nadph oxidase, and production of superoxide radicals as well as reduction of superoxide radicals using diphenylene iodonium. next, the effects of selective inhibition of phosphatidylcholine - specific phospholipase c by tricyclodecan-9-yl xanthogenate (d609) or the inhibition of phospholipase c activation by 1-[6-[((17)-3-methoxyestra-1,3,5 -trien-17-yl)amino[hexyl]-1h - pyrrole-2,5-dione (u73122) on trp expression in monocytes. total rna was isolated from monocytes using the rneasy mini kit including rnase - free dnase set (qiagen, hilden, germany). using the transcriptor first - strand cdna synthesis kit (roche diagnostics, mannheim, germany), cdna was synthesized from 2 g of total rna using oligo dt (1218) and 5 units avian myeloblastosis virus reverse transcriptase at 50c for 60 min, followed by heating to 85c for 5 min. quantitative (q) real - time rt - pcrs for trpc1, trpc3, trpc5, trpc6, trp melastatin type 6 (trpm6), trpm7, tnf-, and glyceraldehyde-3-phosphate dehydrogenase (gapdh) were performed using a lightcycler - faststart dna master sybr green i kit (roche diagnostics). the primers were as follows : trpc1 (reference sequence [refseq ] database accession number : nm_003304.4), forward, 5tgcttaccaaactgctggtg3 ; reverse, 5aactgttttgccgtttgacc3. trpc3 (nm_003305), forward, 5gactttgggatgctgtccat3 ; reverse, 5gtacgcaatccgagagaagc3. trpc5 (nm_012471.2), forward, 5ccaccagctatcagataagg3 ; reverse, 5cgaaacaagccacttatacc3. trpc6 (nm_004621), forward, 5gccaatgagcatctggaaat3 ; reverse, 5tggagtcacatcatgggaga3. trpm6 (nm_017662.4), forward, 5tgattcctctcggagtgaacagcac3 ; reverse, 5ttatgattggcacctggagtccttg3. trpm7 (nm_017672.3), forward, 5cttatgaagaggcaggtcatgg3 ; reverse, 5catcttgtctgaaggactg3. tnf- (nm_000594.2), forward, 5cccagggacctctctctaatc3 ; reverse, 5atgggctacaggcttgtcact3. gapdh (nm_002046), forward, 5aactgcttagcacccctggc3 ; reverse, 5atgaccttgcccacagcctt3. the expected and observed sizes of the pcr products were (in bp) trpc1 243 ; trpc3 249 ; trpc5 161 ; trpc6 243 ; trpm6 347 ; trpm7 214 ; tnf- 84 ; and gapdh 200. lightcycler - faststart dna master sybr green i kit and 500 nmol / l of each primer were used in a final volume of 20 l. the reaction was initiated at 95c for 10 min, followed by 40 cycles of denaturation at 95c for 10 s ; annealing for 10 s at 68c (trpm6), at 60c (trpc3, trpm7, tnf-), at 57c (trpc1, trpc6), or at 54c (trpc5, gapdh) ; and extension at 72c for 15 s. melting curve analysis was performed from 65c to 95c with a heating rate of 0.1c / s. data were recorded on a lightcycler 2.0 instrument using lightcycler software version 4.0 (roche diagnostics). the relative quantification method was used whereby the change in expression of the target genes (trpc1, trpc3, trpc5, trpc6, trpm6, trpm7, tnf-) relative to the housekeeping gene (gapdh) was calculated. for the identification of trpc channel proteins, quantitative in - cell western assays of human monocytes were performed using the odyssey infrared imaging system (licor biosciences, bad homburg, germany). human monocytes in 96-well plates were incubated with rabbit anti - human trpc3 or trpc6 antibodies (1:1,000 ; alomone labs, jerusalem, israel) for 2 h, washed, and incubated with irdye800-infrared fluorescent dye - conjugated sheep anti - rabbit antibodies (1:1,000 ; biomol, hamburg, germany) overnight at 4c. conventional immunoblotting was performed as described previously by our group (13). for ratiometric imaging experiments, mol / l of the calcium - sensitive, cell - permeable, intracellular fluorescence dye 1-[2-(5-carboxyoxazol-2-yl)-6-aminobenzofuran-5-oxy]-2-(2-amino-5-methyl - phenoxy)-ethane - n, n, nn-tetra acetic acid penta acetoxymethyl ester (fura-2/am ; merck biosciences, darmstadt, germany) at room temperature for 60 min and washed to remove extraneous dye. fluorescence measurements were performed in a temperature - controlled 96-well fluorescent plate reader at 37c (fluoroskan ascent fluorometer ; thermo labsystems oy, helsinki, finland) at 510-nm emission with excitation wavelengths of 340 and 380 nm. baseline fluorescence was measured for 10 min, and stable fluorescence readings were obtained throughout. calcium influx was activated after administration of membrane - permeable 1-oleoyl-2-acetyl - sn - glycerol. we used the membrane - permeable 2-aminoethoxydiphenylborane (2-apb) to inhibit calcium influx through trpc channels as previously described (15,16). monocytes were incubated with the dye 2,7-dichlorofluorescein diacetate (dcf - da, 50 mol / l) for 60 min and then were washed and resuspended in hanks ' balanced salt solution. dcf - da is a nonpolar compound that readily diffuses into cells, where it is hydrolyzed to the nonfluorescent polar derivative dcfh and thereby trapped within the cells. in the presence of reactive oxygen species, dcfh is oxidized to the highly fluorescent dcf, which was monitored spectrophotometrically at 530 nm with an excitation wavelength of 485 nm. comparisons between groups were analyzed using nonparametric mann - whitney test (graphpad prism 5.0 ; graphpad software, la jolla, ca). data from multiple groups were analyzed using the nonparametric kruskal - wallis and dunn multiple comparison post hoc test. where error bars do not appear on the figure, error was within the symbol size. all subjects gave written informed consent, and the study was approved by the local ethics committee. monocytes were separated using superparamagnetic polystyrene beads coated with a primary monoclonal antibody specific for the cd14 membrane antigen expressed on human monocytes (invitrogen, groningen, germany) and resuspended in hanks balanced solution containing (in mmol / l) nacl 136, kcl 5.40, cacl2 1, kh2po4 0.44, na2hpo4 0.34, hepes 10, ph 7.4. monocytes were counted in neubauer chamber and adjusted in each experiment. to evaluate the effects of high glucose and oxidative stress on trp channel expression, monocytes were exposed to 5.6 mmol / l d - glucose (control), 30 mmol / l d - glucose, or 100 mol / l peroxynitrite (onoo) for 4 h. additional experiments were performed using 30 mmol / l l - glucose or 30 mmol / l d - glucose in the presence of the superoxide dismutase mimetic tempol (tmp, 100 mol / l). we also evaluated the effects of lipopolysaccharide - induced oxidative stress, tumor necrosis factor- (tnf-)-induced activation of nadph oxidase, and production of superoxide radicals as well as reduction of superoxide radicals using diphenylene iodonium. next, the effects of selective inhibition of phosphatidylcholine - specific phospholipase c by tricyclodecan-9-yl xanthogenate (d609) or the inhibition of phospholipase c activation by 1-[6-[((17)-3-methoxyestra-1,3,5 -trien-17-yl)amino[hexyl]-1h - pyrrole-2,5-dione (u73122) on trp expression in monocytes. total rna was isolated from monocytes using the rneasy mini kit including rnase - free dnase set (qiagen, hilden, germany). using the transcriptor first - strand cdna synthesis kit (roche diagnostics, mannheim, germany), cdna was synthesized from 2 g of total rna using oligo dt (1218) and 5 units avian myeloblastosis virus reverse transcriptase at 50c for 60 min, followed by heating to 85c for 5 min. quantitative (q) real - time rt - pcrs for trpc1, trpc3, trpc5, trpc6, trp melastatin type 6 (trpm6), trpm7, tnf-, and glyceraldehyde-3-phosphate dehydrogenase (gapdh) were performed using a lightcycler - faststart dna master sybr green i kit (roche diagnostics). the primers were as follows : trpc1 (reference sequence [refseq ] database accession number : nm_003304.4), forward, 5tgcttaccaaactgctggtg3 ; reverse, 5aactgttttgccgtttgacc3. trpc3 (nm_003305), forward, 5gactttgggatgctgtccat3 ; reverse, 5gtacgcaatccgagagaagc3. trpc5 (nm_012471.2), forward, 5ccaccagctatcagataagg3 ; reverse, 5cgaaacaagccacttatacc3. trpc6 (nm_004621), forward, 5gccaatgagcatctggaaat3 ; reverse, 5tggagtcacatcatgggaga3. trpm6 (nm_017662.4), forward, 5tgattcctctcggagtgaacagcac3 ; reverse, 5ttatgattggcacctggagtccttg3. trpm7 (nm_017672.3), forward, 5cttatgaagaggcaggtcatgg3 ; reverse, 5catcttgtctgaaggactg3. tnf- (nm_000594.2), forward, 5cccagggacctctctctaatc3 ; reverse, 5atgggctacaggcttgtcact3. gapdh (nm_002046), forward, 5aactgcttagcacccctggc3 ; reverse, 5atgaccttgcccacagcctt3. the expected and observed sizes of the pcr products were (in bp) trpc1 243 ; trpc3 249 ; trpc5 161 ; trpc6 243 ; trpm6 347 ; trpm7 214 ; tnf- 84 ; and gapdh 200. lightcycler - faststart dna master sybr green i kit and 500 nmol / l of each primer were used in a final volume of 20 l. the reaction was initiated at 95c for 10 min, followed by 40 cycles of denaturation at 95c for 10 s ; annealing for 10 s at 68c (trpm6), at 60c (trpc3, trpm7, tnf-), at 57c (trpc1, trpc6), or at 54c (trpc5, gapdh) ; and extension at 72c for 15 s. melting curve analysis was performed from 65c to 95c with a heating rate of 0.1c / s. data were recorded on a lightcycler 2.0 instrument using lightcycler software version 4.0 (roche diagnostics). the relative quantification method was used whereby the change in expression of the target genes (trpc1, trpc3, trpc5, trpc6, trpm6, trpm7, tnf-) relative to the housekeeping gene (gapdh) was calculated. for the identification of trpc channel proteins, quantitative in - cell western assays of human monocytes were performed using the odyssey infrared imaging system (licor biosciences, bad homburg, germany). human monocytes in 96-well plates were incubated with rabbit anti - human trpc3 or trpc6 antibodies (1:1,000 ; alomone labs, jerusalem, israel) for 2 h, washed, and incubated with irdye800-infrared fluorescent dye - conjugated sheep anti - rabbit antibodies (1:1,000 ; biomol, hamburg, germany) overnight at 4c. for ratiometric imaging experiments, monocytes were loaded with 2 mol / l of the calcium - sensitive, cell - permeable, intracellular fluorescence dye 1-[2-(5-carboxyoxazol-2-yl)-6-aminobenzofuran-5-oxy]-2-(2-amino-5-methyl - phenoxy)-ethane - n, n, nn-tetra acetic acid penta acetoxymethyl ester (fura-2/am ; merck biosciences, darmstadt, germany) at room temperature for 60 min and washed to remove extraneous dye. fluorescence measurements were performed in a temperature - controlled 96-well fluorescent plate reader at 37c (fluoroskan ascent fluorometer ; thermo labsystems oy, helsinki, finland) at 510-nm emission with excitation wavelengths of 340 and 380 nm. baseline fluorescence was measured for 10 min, and stable fluorescence readings were obtained throughout. calcium influx was activated after administration of membrane - permeable 1-oleoyl-2-acetyl - sn - glycerol. we used the membrane - permeable 2-aminoethoxydiphenylborane (2-apb) to inhibit calcium influx through trpc channels as previously described (15,16). monocytes were incubated with the dye 2,7-dichlorofluorescein diacetate (dcf - da, 50 mol / l) for 60 min and then were washed and resuspended in hanks ' balanced salt solution. dcf - da is a nonpolar compound that readily diffuses into cells, where it is hydrolyzed to the nonfluorescent polar derivative dcfh and thereby trapped within the cells. in the presence of reactive oxygen species, dcfh is oxidized to the highly fluorescent dcf, which was monitored spectrophotometrically at 530 nm with an excitation wavelength of 485 nm. comparisons between groups were analyzed using nonparametric mann - whitney test (graphpad prism 5.0 ; graphpad software, la jolla, ca). data from multiple groups were analyzed using the nonparametric kruskal - wallis and dunn multiple comparison post hoc test. where error bars do not appear on the figure, error was within the symbol size. the induction of reactive oxygen species by high glucose was investigated using the dye dcf - da. compared with control conditions (d - glucose, 5.6 mmol / l), the administration of 30 mmol / l d - glucose for 90 min significantly increased reactive oxygen species from 1.0 0.01 to 1.84 0.17 arbitrary units [au ] (p < 0.01). furthermore, the effect of d - glucose was blocked by the concurrent administration of the superoxide dismutase mimetic tmp (100 mol / l) to 0.78 0.07 au (p < 0.01 compared with d - glucose alone). to investigate whether high glucose induced oxidative stress may affect trp channels, we first analyzed trp mrna in human monocytes from healthy control subjects using qrt - pcr. the melting curve analysis showed the presence of one single peak in monocytes after 4-h treatment under control conditions, with high glucose or onoo. the expected and observed product sizes using gel electrophoresis were (in bp) trpc1 243 ; trpc3 249 ; trpc5 161 ; trpc6 243 ; trpm6 347 ; trpm7 214 ; and gapdh 200. we determined the effects of high glucose and oxidative stress on trpc3 and trpc6 mrna in human monocytes. as shown in fig. 1, compared with control conditions with 5.6 mmol / l d - glucose, administration of high d - glucose (30 mmol / l) significantly increased trpc3 mrna by 1.55-fold (p < 0.01 ; n = 6) and trpc6 mrna by 2.58-fold (p < 0.01 ; n = 12). the administration of high l - glucose (30 mmol / l) did not significantly affect trpc3 or trpc6 mrna. concurrent administration of superoxide dismutase mimetic tmp (final concentration 100 mol / l) blocked the stimulating effect of high d - glucose on trpc3 and trpc6 mrna expression, indicating that high d - glucose causes its effects by increased oxidative stress. compared with control conditions, oxidative stress induced by 100 mol / l onoo also significantly increased the trpc3 mrna by 1.77-fold (p < 0.01 ; n = 15) and trpc6 mrna by 3.47-fold (p < 0.01 ; n = 11). changes of mrna expression of (a) trpc3, (b) trpc6, (c and d) trpc1, trpc5, trpm6, trpm7, and tnf- induced by high glucose and onoo. exposure of monocytes to high glucose (hg ; 30 mmol / l d - glucose) or onoo (100 mol / l) for 4 h significantly increased the trpc3 and trpc6 mrna expression. the effect of high glucose is attenuated by superoxide dismutase mimetic tmp (100 mol / l). control (open bar) indicates control glucose (5.6 mmol / l d - glucose). data are mean sem from at least four to six independent experiments. p < 0.05 ; p < 0.01 compared with control conditions. e : bar graph showing trpc3 mrna and trpc6 mrna expression (normalized ratio) in monocytes from 28 age - matched control subjects (open bars) and from 18 patients with type 2 diabetes (filled bars). p < 0.05 compared with control. the administration of high d - glucose significantly increased mrna from trpc1, trpc5, trpm6, or trpm7 by 1.81-, 3.10-, 7.22-, or 7.99-fold compared with control conditions, respectively (each p < 0.05 ; n = 4). the administration of onoo significantly increased mrna from trpc1, trpc5, trpm6, or trpm7 by 4.57-, 3.53-, 12.91-, or 3.51-fold, respectively (each p < 0.05 ; n = 4). we now investigated whether upregulated trp expression was associated with elevated monocyte inflammatory gene expression. indeed, after the administration of high d - glucose or onoo and upregulation of trp channels, mrna of the inflammatory cytokine tnf- was also significantly increased by 6.11- or 2.32-fold (each p < 0.05 ; next, we evaluated whether induction of oxidative stress by several pathways may affect trpc expression. induction of oxidative stress using lipopolysaccharide significantly increased trpc3 mrna expression in monocytes from 1.00 0.48 to 9.60 0.40 (each n = 5 ; p < 0.05) and trpc6 mrna expression from 1.00 0.23 to 3.90 0.11 (each n = 5 ; p < 0.05). it is known that tnf-induced activation of nadph oxidase increases superoxide radicals (17). tnf- significantly increased trpc3 mrna expression in monocytes from 1.00 0.01 to 1.58 0.21 (each n = 4 ; p < 0.05) and trpc6 mrna expression from 1.00 0.00 to 1.32 0.08 (each n = 4 ; p < 0.05). in agreement with these findings, the reduction of superoxide radicals using diphenylene iodonium (18) significantly reduced trpc3 mrna expression in monocytes from 1.00 0.06 to 0.52 0.05 (each n = 5 ; p < 0.05) and trpc6 mrna expression from 1.00 0.12 to 0.36 0.03 (each n = 5 ; p < 0.05). these data indicate that trpc3 and trpc6 mrna are regulated by oxidative stress, in particular by superoxide radicals. we also investigated a possible role of phospholipase c on glucose - induced trpc expression. compared with control conditions, the inhibition of phosphatidylcholine - specific phospholipase c by d609, or the inhibition of phospholipase c activation by u73122, did not significantly affect high d - glucose induced trpc3 mrna expression (control 1.00 0.01 ; high d - glucose 1.57 0.10 [p < 0.05 compared with control ] ; high d - glucose plus d609 1.47 0.03 [not significant compared with high d - glucose alone ] ; high d - glucose plus u73122 1.95 0.03 [not significant compared with high d - glucose alone ] ; each n = 4). it is known that trpc - induced calcium influx is regulated by phospholipase c. however, phospholipase c seems not to be involved in glucose - induced upregulation of trpc mrna expression. to evaluate whether increased trpc mrna is a feature of diabetes, we compared trpc1, trpc3, trpc5, and trpc6 mrna in monocytes from 18 patients with type 2 diabetes (10 women, 8 men ; mean age 57 5 years ; systolic blood pressure 133 3 mmhg ; diastolic blood pressure 79 2 mmhg ; serum sodium 135 1 mmol / l ; serum potassium 4.4 0.1 mmol / l ; hemoglobin 11.2 0.5 g / dl ; a1c 7.5 0.3%) and from 28 age - matched control subjects (10 women, 18 men ; mean age 56 4 years ; systolic blood pressure 132 4 mmhg ; diastolic blood pressure 81 2 mmhg ; serum sodium 136 1 mmol / l ; serum potassium 4.4 0.2 mmol / l ; hemoglobin 12.3 0.5 g / dl ; a1c 5.6 0.1%). trpc6 mrna was significantly higher in monocytes from patients with type 2 diabetes compared with control subjects (trpc6 normalized ratio 0.028 0.014 [n = 18 ] vs. 0.015 0.006 [n = 28 ] ; p < 0.05 ; fig. on the other hand, trpc1, trpc3, or trpc5 mrna was not significantly different between the two groups (trpc1 0.025 0.012 vs. 0.025 0.006 [p = 0.62 ] ; trpc3 0.010 0.005 vs. 0.003 0.001 [p = 0.40 ] ; trpc5 0.007 0.004 vs. 0.003 these data support the view that increased trpc6 expression is a characteristic feature of peripheral blood cells from patients with type 2 diabetes. trpc protein expression in monocytes was quantified using a quantitative in - cell western assay. as shown in fig. 2, compared with control conditions with 5.6 mmol / l d - glucose, administration of high d - glucose (30 mmol / l) significantly increased trpc3 protein expression by 1.58-fold (p < 0.01 ; n = 10) and trpc6 protein expression by 1.57-fold (p < 0.01 ; n = 8). the administration of high l - glucose (30 mmol / l) did not significantly affect trpc3 or trpc6 protein expression. concurrent administration of tmp (100 mol / l) blocked the stimulating effect of high d - glucose on trpc3 and trpc6 protein expression. quantitative in - cell western assay of trpc3 and trpc6 channel protein expression in monocytes treated with hg (30 mmol / l d - glucose) in the absence and presence of tmp (100 mol / l), onoo (100 mol / l), l - glucose (30 mmol / l), or control (5.6 mmol / l d - glucose). a : representative conventional western assay (trpc3 protein and gapdh protein for loading control with top values indicating densitometric analysis of blots). b and d : representative in - cell western assays and (c and e) summary data are shown. data are means sem from at least eight independent experiments. p < 0.01 compared with control conditions. compared with control conditions, oxidative stress induced by 100 mol / l onoo also significantly increased the trpc3 protein expression by 1.70-fold (p < 0.01 ; n = 9) and trpc6 protein expression by 1.8-fold (p < 0.01 ; n = 9). 1-oleoyl-2-acetyl - rac - glycerol (oag) increased cytosolic calcium to 2.41 0.01 (n = 15), whereas oag in the presence of high d - glucose increased cytosolic calcium to 2.79 0.03 (n = 14 ; p < 0.01). furthermore, it should be noted that concurrent preincubation of cells with tmp (100 mol / l) and high d - glucose normalized oag - induced calcium influx (2.49 0.02 ; n = 13 ; not significant compared with control). these data indicate that high d - glucose associated oxidative stress promotes increased trpc - mediated calcium influx. recordings of fura-2 fluorescence in human monocytes. a : oag - induced calcium influx was measured under control conditions (5.6 mmol / l d - glucose,) and in the presence of high glucose (30 mmol / l d - glucose) without () and with () tmp (100 mol / l). b : summary data showing intracellular calcium levels after treatment of monocytes with high d - glucose for 4 h (control) stimulated with onoo in the absence and presence of the membrane - permeable trpc blocker, 2-apb. p < 0.01. after treatment of monocytes with high d - glucose for 4 h, the administration of onoo subsequently increased intracellular calcium levels. in the presence of a membrane - permeable trpc blocker, 2-apb, the onoo - induced calcium increase was significantly attenuated (3.99 0.05 vs. 4.56 0.04 ; each n = 15 ; p < 0.01 compared with onoo alone ; fig. the induction of reactive oxygen species by high glucose was investigated using the dye dcf - da. compared with control conditions (d - glucose, 5.6 mmol / l), the administration of 30 mmol / l d - glucose for 90 min significantly increased reactive oxygen species from 1.0 0.01 to 1.84 0.17 arbitrary units [au ] (p < 0.01). furthermore, the effect of d - glucose was blocked by the concurrent administration of the superoxide dismutase mimetic tmp (100 mol / l) to 0.78 0.07 au (p < 0.01 compared with d - glucose alone). induced oxidative stress may affect trp channels, we first analyzed trp mrna in human monocytes from healthy control subjects using qrt - pcr. the melting curve analysis showed the presence of one single peak in monocytes after 4-h treatment under control conditions, with high glucose or onoo. the expected and observed product sizes using gel electrophoresis were (in bp) trpc1 243 ; trpc3 249 ; trpc5 161 ; trpc6 243 ; trpm6 347 ; trpm7 214 ; and gapdh 200. we determined the effects of high glucose and oxidative stress on trpc3 and trpc6 mrna in human monocytes. as shown in fig. 1, compared with control conditions with 5.6 mmol / l d - glucose, administration of high d - glucose (30 mmol / l) significantly increased trpc3 mrna by 1.55-fold (p < 0.01 ; n = 6) and trpc6 mrna by 2.58-fold (p < 0.01 ; n = 12). the administration of high l - glucose (30 mmol / l) did not significantly affect trpc3 or trpc6 mrna. concurrent administration of superoxide dismutase mimetic tmp (final concentration 100 mol / l) blocked the stimulating effect of high d - glucose on trpc3 and trpc6 mrna expression, indicating that high d - glucose causes its effects by increased oxidative stress. compared with control conditions, oxidative stress induced by 100 mol / l onoo also significantly increased the trpc3 mrna by 1.77-fold (p < 0.01 ; n = 15) and trpc6 mrna by 3.47-fold (p < 0.01 ; n = 11). changes of mrna expression of (a) trpc3, (b) trpc6, (c and d) trpc1, trpc5, trpm6, trpm7, and tnf- induced by high glucose and onoo. exposure of monocytes to high glucose (hg ; 30 mmol / l d - glucose) or onoo (100 mol / l) for 4 h significantly increased the trpc3 and trpc6 mrna expression. the effect of high glucose is attenuated by superoxide dismutase mimetic tmp (100 mol / l). control (open bar) indicates control glucose (5.6 mmol / l d - glucose). data are mean sem from at least four to six independent experiments. p < 0.05 ; p < 0.01 compared with control conditions. e : bar graph showing trpc3 mrna and trpc6 mrna expression (normalized ratio) in monocytes from 28 age - matched control subjects (open bars) and from 18 patients with type 2 diabetes (filled bars). p < 0.05 compared with control. the administration of high d - glucose significantly increased mrna from trpc1, trpc5, trpm6, or trpm7 by 1.81-, 3.10-, 7.22-, or 7.99-fold compared with control conditions, respectively (each p < 0.05 ; n = 4). the administration of onoo significantly increased mrna from trpc1, trpc5, trpm6, or trpm7 by 4.57-, 3.53-, 12.91-, or 3.51-fold, respectively (each p < 0.05 ; n = 4). we now investigated whether upregulated trp expression was associated with elevated monocyte inflammatory gene expression. indeed, after the administration of high d - glucose or onoo and upregulation of trp channels, mrna of the inflammatory cytokine tnf- was also significantly increased by 6.11- or 2.32-fold (each p < 0.05 ; n = 4), respectively. next, we evaluated whether induction of oxidative stress by several pathways may affect trpc expression. induction of oxidative stress using lipopolysaccharide significantly increased trpc3 mrna expression in monocytes from 1.00 0.48 to 9.60 0.40 (each n = 5 ; p < 0.05) and trpc6 mrna expression from 1.00 0.23 to 3.90 0.11 (each n = 5 ; p < 0.05). it is known that tnf-induced activation of nadph oxidase increases superoxide radicals (17). tnf- significantly increased trpc3 mrna expression in monocytes from 1.00 0.01 to 1.58 0.21 (each n = 4 ; p < 0.05) and trpc6 mrna expression from 1.00 0.00 to 1.32 0.08 (each n = 4 ; p < 0.05). in agreement with these findings, the reduction of superoxide radicals using diphenylene iodonium (18) significantly reduced trpc3 mrna expression in monocytes from 1.00 0.06 to 0.52 0.05 (each n = 5 ; p < 0.05) and trpc6 mrna expression from 1.00 0.12 to 0.36 0.03 (each n = 5 ; p < 0.05). these data indicate that trpc3 and trpc6 mrna are regulated by oxidative stress, in particular by superoxide radicals. we also investigated a possible role of phospholipase c on glucose - induced trpc expression. compared with control conditions, the inhibition of phosphatidylcholine - specific phospholipase c by d609, or the inhibition of phospholipase c activation by u73122, did not significantly affect high d - glucose induced trpc3 mrna expression (control 1.00 0.01 ; high d - glucose 1.57 0.10 [p < 0.05 compared with control ] ; high d - glucose plus d609 1.47 0.03 [not significant compared with high d - glucose alone ] ; high d - glucose plus u73122 1.95 0.03 [not significant compared with high d - glucose alone ] ; each n = 4). it is known that trpc - induced calcium influx is regulated by phospholipase c. however, phospholipase c seems not to be involved in glucose - induced upregulation of trpc mrna expression. to evaluate whether increased trpc mrna is a feature of diabetes, we compared trpc1, trpc3, trpc5, and trpc6 mrna in monocytes from 18 patients with type 2 diabetes (10 women, 8 men ; mean age 57 5 years ; systolic blood pressure 133 3 mmhg ; diastolic blood pressure 79 2 mmhg ; serum sodium 135 1 mmol / l ; serum potassium 4.4 0.1 mmol / l ; hemoglobin 11.2 0.5 g / dl ; a1c 7.5 0.3%) and from 28 age - matched control subjects (10 women, 18 men ; mean age 56 4 years ; systolic blood pressure 132 4 mmhg ; diastolic blood pressure 81 2 mmhg ; serum sodium 136 1 mmol / l ; serum potassium 4.4 0.2 mmol / l ; hemoglobin 12.3 0.5 g / dl ; a1c 5.6 0.1%). trpc6 mrna was significantly higher in monocytes from patients with type 2 diabetes compared with control subjects (trpc6 normalized ratio 0.028 0.014 [n = 18 ] vs. 0.015 0.006 [n = 28 ] ; p < 0.05 ; fig. on the other hand, trpc1, trpc3, or trpc5 mrna was not significantly different between the two groups (trpc1 0.025 0.012 vs. 0.025 0.006 [p = 0.62 ] ; trpc3 0.010 0.005 vs. 0.003 0.001 these data support the view that increased trpc6 expression is a characteristic feature of peripheral blood cells from patients with type 2 diabetes. trpc protein expression in monocytes was quantified using a quantitative in - cell western assay. as shown in fig. 2, compared with control conditions with 5.6 mmol / l d - glucose, administration of high d - glucose (30 mmol / l) significantly increased trpc3 protein expression by 1.58-fold (p < 0.01 ; n = 10) and trpc6 protein expression by 1.57-fold (p < 0.01 ; n = 8). the administration of high l - glucose (30 mmol / l) did not significantly affect trpc3 or trpc6 protein expression. concurrent administration of tmp (100 mol / l) blocked the stimulating effect of high d - glucose on trpc3 and trpc6 protein expression. quantitative in - cell western assay of trpc3 and trpc6 channel protein expression in monocytes treated with hg (30 mmol / l d - glucose) in the absence and presence of tmp (100 mol / l), onoo (100 mol / l), l - glucose (30 mmol / l), or control (5.6 mmol / l d - glucose). a : representative conventional western assay (trpc3 protein and gapdh protein for loading control with top values indicating densitometric analysis of blots). the trpc3/gapdh ratio (fold over control) is also indicated. b and d : representative in - cell western assays and (c and e) summary data are shown. data are means sem from at least eight independent experiments. p < 0.01 compared with control conditions. compared with control conditions, oxidative stress induced by 100 mol / l onoo also significantly increased the trpc3 protein expression by 1.70-fold (p < 0.01 ; n = 9) and trpc6 protein expression by 1.8-fold (p < 0.01 ; n = 9). 1-oleoyl-2-acetyl - rac - glycerol (oag) increased cytosolic calcium to 2.41 0.01 (n = 15), whereas oag in the presence of high d - glucose increased cytosolic calcium to 2.79 0.03 (n = 14 ; p < 0.01). furthermore, it should be noted that concurrent preincubation of cells with tmp (100 mol / l) and high d - glucose normalized oag - induced calcium influx (2.49 0.02 ; n = 13 ; not significant compared with control). these data indicate that high d - glucose associated oxidative stress promotes increased trpc - mediated calcium influx. a : oag - induced calcium influx was measured under control conditions (5.6 mmol / l d - glucose,) and in the presence of high glucose (30 mmol / l d - glucose) without () and with () tmp (100 mol / l). b : summary data showing intracellular calcium levels after treatment of monocytes with high d - glucose for 4 h (control) stimulated with onoo in the absence and presence of the membrane - permeable trpc blocker, 2-apb. p < 0.01. after treatment of monocytes with high d - glucose for 4 h, the administration of onoo subsequently increased intracellular calcium levels. in the presence of a membrane - permeable trpc blocker, 2-apb, the onoo - induced calcium increase was significantly attenuated (3.99 0.05 vs. 4.56 0.04 ; each n = 15 ; p < 0.01 compared with onoo alone ; fig. our present data show that high d - glucose induced oxidative stress causes increased trp expression and calcium influx in human monocytes. an increased calcium influx through trp channels may be responsible for an increased activation of monocytes and enhanced atherosclerosis in patients with diabetes. the presence of high glucose levels is a characteristic feature of diabetes and is considered a major pathogenic factor for increased atherosclerosis and consecutive diseases including cardiovascular disease (19). both an increased activation of monocytes and an increased generation of reactive oxygen species in monocytes have been described in patients with diabetes (6,20). the production of mitochondrial superoxide has been implicated as a major underlying mechanism linking high glucose and cellular dysfunction (21,22). in the present study, we confirmed that high glucose increases reactive oxygen species in monocytes. the high glucose induced increase of reactive oxygen species was blocked by the superoxide dismutase mimetic tmp. activated monocytes in patients with diabetes are characterized by increased calcium concentrations (911). according to our present results, increased trpc channel expression in monocytes may be responsible for an increased calcium influx after high glucose we observed that high d - glucose induced oxidative stress increased the expression of both trpc3 and trpc6 mrna and trpc3 and trpc6 channel proteins in monocytes. the stimulating effect of high glucose could be blocked by concurrent administration of tmp, supporting the relevance of increased oxidative stress after high d - glucose. recently, shanmugam. (23) showed that exposure of monocytes to high glucose increased the expression of several inflammatory cytokines, including tnf- in an oxidant stress our present results support these findings, indicating that high glucose induced upregulation of trp expression was associated with enhanced mrna levels of the inflammatory cytokine tnf-. we observed that high glucose elevates the expression of tnf- even higher than onoo. the increased tnf- response after high glucose compared with onoo indicates that irrespective of oxidative stress, other pathways (e.g., the polyol pathway) contribute to increased inflammatory response in diabetes (24). induced oxidative stress activates monocytes by enhancing inflammatory cytokines and trp channel expression promoting transmembrane calcium influx. (25) suggested that trpc channels are the molecular basis of oxidant - activated cation channels in endothelial cells. poteser. (26) reported that redox modulation of trpc channels is responsible for oxidative stress the present study extends their findings, showing that oxidative stress increased the expression of both trpc3 and trpc6 mrna and proteins. induced oxidative stress in patients with diabetes may activate monocytes both by interaction with trpc channels and by enhanced trpc expression. the present study indicates that induction of oxidative stress by several pathways may affect trp expression. induction of oxidative stress using lipopolysaccharide- or tnf-induced activation of nadph oxidase significantly increased trpc3 mrna expression, whereas the reduction of superoxide radicals using diphenylene iodonium significantly reduced trpc3 mrna expression. in the present study, we also confirmed that high d - glucose induced oxidative stress increases trpm6 and trpm7 mrna expression in agreement with data from yamamoto. (27), who showed the regulation of trpm expression by oxidative stress. to evaluate whether increased trpc mrna is a feature of diabetes, we also compared trpc mrna in monocytes from patients with type 2 diabetes and control subjects. we observed increased trpc6 mrna in monocytes from patients with type 2 diabetes. increased trpc6 protein expression has already been reported in platelets from patients with diabetes compared with control subjects (28), supporting the view that increased trpc6 expression is a characteristic feature of peripheral blood cells from patients with diabetes. furthermore, hu. (29) showed increased trpc6 expression in the adrenal medulla from ossabaw miniature pigs with pre - diabetic metabolic syndrome. however, differences might be explained in part by use of native blood cells and cultured cells. in our study, however, several pathways including phospholipase c, protein kinase c, or phosphatidylinositol 3-kinase may modulate trp channel protein expression and function, as suggested by recent literature (3133). in conclusion, the present study shows that high glucose induced oxidative stress increases trpc3 and trpc6 channel expression and calcium influx in human monocytes. these data point to a novel pathway for an increased activation of monocytes and hence atherosclerosis in patients with diabetes.	objectivetransient receptor potential (trp) channel induced cation influx activates human monocytes, which play an important role in the pathogenesis of atherosclerosis. in the present study, we investigated the effects of high glucose induced oxidative stress on trp channel expression in human monocytes.research design and methodshuman monocytes were exposed to control conditions (5.6 mmol / l d - glucose), high glucose (30 mmol / l d - glucose or l - glucose), 100 mol / l peroxynitrite, or high glucose in the presence of the superoxide dismutase mimetic tempol (100 mol / l). trp mrna and trp protein expression was measured using quantitative real - time rt - pcr and quantitative in - cell western assay, respectively. calcium influx and intracellular reactive oxygen species were measured using fluorescent dyes.resultsadministration of high d - glucose significantly increased reactive oxygen species. high d - glucose or peroxynitrite significantly increased the expression of trp canonical type 1 (trpc1), trpc3, trpc5, trpc6, trp melastatin type 6 (trpm6), and trpm7 mrna and trpc3 and trpc6 proteins. high d - glucose plus tempol or high l - glucose did not affect trp expression. increased oxidative stress by lipopolysaccharide or tumor necrosis factor- increased trp mrna expression, whereas the reduction of superoxide radicals using diphenylene iodonium significantly reduced trp mrna expression. increased trpc3 and trpc6 protein expression was accompanied by increased 1-oleoyl-2-acetyl - sn - glycerol induced calcium influx, which was blocked by the trpc inhibitor 2-aminoethoxydiphenylborane. trpc6 mrna was significantly higher in monocytes from 18 patients with type 2 diabetes compared with 28 control subjects (p < 0.05).conclusionshigh d - glucose induced oxidative stress increases trp expression and calcium influx in human monocytes, pointing to a novel pathway for increased activation of monocytes and hence atherosclerosis in patients with diabetes.
mucocutaneous leishmaniasis often occurs in new world mostly due to leishmania(l) braziliensis and less commonly l. panamensis and l. amazonensis(1). there are also several reports of mucocutaneous leishmaniasis in old world (24). recently a case of mucocutaneous leishmaniasis due to l. major has been reported from iran (1). in leishmaniasis, laryngeal involvement often occurs in active cigarette smokers and in patients with chronic respiratory diseases (5). a case of visceral leishmaniasis caused by l. major with skin and oral mucosal lesions in a man who was suffering from hoarseness and weight loss a 28-year - old otherwise healthy, non - smoking man with the chief complaint of hoarseness from southeastern part of iran was referred to our dermatology center in may 2014. he had a few indurated, erythematous plaques on his face (chin and upper lip) and legs, a violaceous plaque on his hard palate, and complained of hoarseness for the past 7 years (fig. 1 and 2). he also complained of dysphagia to solid diet, and about 20 kilograms weight loss in the last year. hoarseness was the presenting symptom and lasted for about 5 years during the time that the cutaneous lesions were present. skin lesions : erythematous plaque on chin and upper lip oral mucosal lesion : an erythematous plaque on the palate near the opening of the pharynx the study was approved by the local ethics committee and an informed consent was taken from the patient. routine laboratory tests were normal except for a mild normocytic normochromic anemia, which was justified with chronic disease anemia. erythrocyte sedimentation rate, complement levels (c3 c4 ch50), antinuclear antibody (ana), and angiotensin converting enzyme (ace) tests were all within normal limits. wright, 2-mercaptoethanol (2me), and widal tests were done for his constitutional symptoms and low back pain, which all came back negative. vdrl and viral markers (hivab hbsag hcvab) were negative, and a ppd skin test was negative. abdominal sonography showed mild hepatomegaly and a 6 8 mm lymph node in retroperitoneal near the superior mesenteric artery origin. sonography of the neck showed bilateral internal jugular and submandibular lymphadenopathy (9 17 mm 9 13 mm). a biopsy from his oral lesion was done with the differential diagnosis of lymphoma, tuberculosis, leishmaniasis, wegener s granulomatosis, sarcoidosis, squamous cell carcinoma, granular cell tumor and histiocytosis. the hematoxylin and eosin stain (h&e) preparation of histopathologic slides of the mucosal and skin lesions showed loose granuloma formation with lymphoplasma cells. in specimen of mucosal biopsy leishman bodies his cutaneous and mucosal lesions were examined by direct microscopy for acid - fast bacilli and the test was negative. lastly, pcr was performed on the specimens of skin, bone marrow, mucosa and saliva. the result of pcr was positive, and for the determination of pathogenic agent, amplification and sequencing analysis were performed as follow. in order to determine the possibility of leishmania infection, external primers csb2xf and csb1xr in the first round of pcr, and internal primers 13z and lir in the second round of pcr were utilized (invitrogen, uk). as a positive control, genomic dnas of standard l. major (mrhom / ir/75/er) and l. tropica (mohm / ir/09/khamesipour - mashhad) were used in parallel. nested pcr amplification of kdna extracted from skin, bone marrow, mucosa and saliva of the patient which then confirmed by sequence analyses lane 1 : molecular weight marker 100bp lane 2 : l. tropica lane 3 : patient sample lane 4 : l. major lane 1 : molecular weight marker 100bp lane 3 : patient sample as it is shown, the nested pcr analysis of the patient sample was l. major. for confirmation of the species identification, the 560bp pcr product of kdnas from the patient as well as standard l. major were eluted by promega wizard sv gel and pcr clean up system (promega, usa). then the eluted dnas were ligated into the topo vector pcr2.1 (invitrogen, usa), transformed in top 10 e. coli, and plated in lb agar containing 100g / ml ampicillin. the positive colonies were first isolated and screened with ecori (roche, germany) as the restriction enzyme. after digestion, plasmid dna was purified (qiagen, plasmid mini kit) and sequenced with the m13f and m13r as flanking primers using the dideoxy chain termination method on an automated sequencer. the sequence of kdna of the patient sample was the same as the iranian strain of l. major (mrhom / ir/75/er). pcr of skin, mucosa, saliva and bone marrow revealed l. major. with regard to diagnosis of leishmaniasis and probable visceral involvement, the direct agglutination test (dat) (7) with a remarkable high titer (1:102400) was positive, and the indirect fluorescent antibody test (ifat) for leishmania infection was also positive (1:800). based on the histopathologic findings, the high titer of dat and ifat, and the results of pcr, a diagnosis of leishmaniasis with visceral involvement were confirmed. since miltefosine has been used for visceral involvement and l. major infections, the following combination was used to treat the patient (8). miltefosine with the dose of 50 mg orally thrice daily was applied in combination with meglumine antimoniate (glucantime) 20 mg / kilograms / day for 28 days. the only side effect of miltefosine was nausea, which was controlled with the ingestion of metoclopramide a half hour before taking miltefosine. the oral and cutaneous lesions, as well his hoarseness, improved to a significant extent. in order to determine the possibility of leishmania infection, nested pcr method was applied. the primers were already designed by noyes (6). external primers csb2xf and csb1xr in the first round of pcr, and internal primers 13z and lir in the second round of pcr were utilized (invitrogen, uk). as a positive control, genomic dnas of standard l. major (mrhom / ir/75/er) and l. tropica (mohm / ir/09/khamesipour - mashhad) nested pcr amplification of kdna extracted from skin, bone marrow, mucosa and saliva of the patient which then confirmed by sequence analyses lane 1 : molecular weight marker 100bp lane 2 : l. tropica lane 3 : patient sample lane 4 : l. major lane 1 : molecular weight marker 100bp lane 3 : patient sample as it is shown, the nested pcr analysis of the patient sample was l. major. for confirmation of the species identification, the 560bp pcr product of kdnas from the patient as well as standard l. major were eluted by promega wizard sv gel and pcr clean up system (promega, usa). then the eluted dnas were ligated into the topo vector pcr2.1 (invitrogen, usa), transformed in top 10 e. coli, and plated in lb agar containing 100g / ml ampicillin. the positive colonies were first isolated and screened with ecori (roche, germany) as the restriction enzyme. after digestion, plasmid dna was purified (qiagen, plasmid mini kit) and sequenced with the m13f and m13r as flanking primers using the dideoxy chain termination method on an automated sequencer. the sequence of kdna of the patient sample was the same as the iranian strain of l. major (mrhom / ir/75/er). pcr of skin, mucosa, saliva and bone marrow revealed l. major. with regard to diagnosis of leishmaniasis and probable visceral involvement, the direct agglutination test (dat) (7) with a remarkable high titer (1:102400) was positive, and the indirect fluorescent antibody test (ifat) for leishmania infection was also positive (1:800). based on the histopathologic findings, the high titer of dat and ifat, and the results of pcr, a diagnosis of leishmaniasis with visceral involvement were confirmed. since miltefosine has been used for visceral involvement and l. major infections, the following combination was used to treat the patient (8). miltefosine with the dose of 50 mg orally thrice daily was applied in combination with meglumine antimoniate (glucantime) 20 mg / kilograms / day for 28 days. the only side effect of miltefosine was nausea, which was controlled with the ingestion of metoclopramide a half hour before taking miltefosine. the oral and cutaneous lesions, as well his hoarseness, improved to a significant extent. to the best of our knowledge through internet search, the first report of mucosal involvement of leishmania in iran dated back to 1968 when ziai. reported a case of leishmaniasis with mucosal involvement from shiraz, iran (2). since then there have been several additional reports of mucosal involvement of leishmaniasis from iran (3, 4). according to a recent report, l. tropica, l. major, and l. infantum may be the causative agents, but l. major was the pathogenic agent in most of the patients (3). the case presented herein with the high titers of anti - leishmania antibodies using dat and ifat were in favor of visceral involvement. dat, which is positive when the titer is higher than 1/3200, is used for the diagnosis and seroepidemiology of visceral leishmaniasis in endemic areas (9). in the current patient, these findings and the involvement of bone marrow confirmed the diagnosis of visceral leishmaniasis in the patient. pcr findings of the cutaneous, bone marrow, mucosa and saliva samples were in favor of l. major as a causative agent. recently, karamian. have reported l. major as a causative agent of visceral leishmaniasis in the south of iran (10). according to search in the literature, there are a few reports of the coexistence of visceral leishmaniasis with cutaneous lesions in patients with hiv infection (1113). there is a report from iran in which a patient showed visceral and cutaneous lesions due to leishmania but, immunological tests in this case were negative and diagnostic splenectomy revealed the leishmania as the causative agent (14). our patient also presented with simultaneous visceral and cutaneous leishmaniasis, an hiv test was negative. the case presented herein was a non - smoker, otherwise healthy man, with visceral leishmaniasis, who had a history of a long period of hoarseness, which can be a symptom of visceral leishmaniasis in smokers or people with chronic respiratory disease (5). this patient was presented as a rare case of visceral leishmaniasis with the presenting symptom of hoarseness, l. major as the causative agent, and simultaneous muco - cutaneous lesions. treatment with the combination of miltefosine and meglumine antimoniate was effective and the dat titer decreased to the level of 1/52000 one month after the patient was discharged from the dermatology ward.	herein, a 28-year - old man with hoarseness, skin and oral lesions is presented. at the time of admission, the patient had an erythematous plaque on his chin near his lower lip and an erythematous - violaceous plaque on his palate near the opening of the pharynx and 20 kg weight lost in last one year. the biopsy of his skin lesions by hematoxylin and eosin staining revealed an infiltration of the dermis by lymphoplasma and histiocytic cells with a loose granuloma formation suggestive of leishmaniasis. biopsy of mucosal lesions revealed leishman bodies in dermis. pcr was performed on the specimens of skin, bone marrow, mucosa, and saliva, the results were positive. the pathogenic agent was identified as leishmania major by the nested pcr. serologic tests including direct agglutination test (dat) and indirect immunofluorescence test (ifat) were positive with high titers of anti - l. infantum antibodies (1:102400 versus 1:800, respectively), indicative of visceral involvement. the patient responded to a combination of miltefosine and meglumine antimoniate (glucantime). visceral involvement due to l. major is rarely reported. to the best of our knowledge, probably hoarseness due to l. major has not been previously reported from iran.
male sprague - dawley rats (charles river, wilmington, ma) weighing 275350 g were individually housed in the yale animal resource center in temperature - controlled (2223c) and humidity - controlled rooms. the animals were fed rat chow (agway prolab 3000, syracuse, ny), given water ad libitum, and acclimatized to a 12-h light / dark cycle. seven to 10 days before each study, all animals were anesthetized with an injection (1 ml / kg i.p.) of a mixture of xylazine (20 mg / ml anased ; lloyd laboratories, shenandoah, ia) and ketamine (100 mg / ml ketaset ; aveco, fort dodge, ia), in a ratio of 1:2 (vol / vol), before undergoing vascular surgery for the implantation of vascular catheters in a carotid artery and jugular vein. microinjection guide cannulae were then bilaterally inserted into the vmh, targeting the ventromedial nucleus (coordinates from bregma : anteroposterior 2.6 mm, mediolateral 0.8 mm, and dorsoventral 8.0). on the morning of the study, after an overnight fast and 60 min after opening the catheters, 22-gauge microinjection needles, designed to extend 1 mm beyond the tip of the guide cannula (plastics one, roanoke, va), were inserted through the guide cannula bilaterally into each vmh. the rat was then microinjected over 2 min (0.5 l / min) using a cma-102 infusion pump (cma microdialysis, north chelmsford, ma). the animals were microinjected immediately before the initiation of a hyperinsulinemic - hypoglycemic clamp with 1 l of one the following pharmacologic agents : artificial extracellular fluid as a control (n = 12) ; 1 mol / l concentration of the b2ar antagonist ici-118,551 (n = 12) ; or 1 mol / l concentration of the b2ar agonist formoterol (n = 10). the doses of b2ar agonists and antagonists selected were based on preliminary dose - ranging studies using a 1 nmol / l to 200 mol / l concentration of the agonist and antagonist. in another set of studies, we microinjected 1 mol / l cgp 20712 dihydrochloride, a potent, selective b1ar (n = 7), or 1 mol / l sr59230a hydrochloride, a potent, selective b3ar antagonist (n = 6). a primed - continuous intravascular infusion of 20 mu kg min regular insulin was started, and a variable infusion of 20% dextrose was adjusted in response to 10-min measurements of plasma glucose to reach a target value of 50 mg / dl within 30 min. thereafter, plasma glucose was monitored at 10-min intervals using a glucose analyzer (analox instruments, lunenburg, ma) to adjust the dextrose infusion rate to maintain a stable 50 mg / dl glucose level until the end of the study at 90 min. blood was drawn at baseline and at 30, 60, and 90 min for measurement of plasma glucagon, epinephrine, norepinephrine, and insulin. at the end of experiments, the rats were killed with an overdose of sodium pentobarbital (sleepaway ; fort dodge animal health, fort dodge, ia). catecholamine analysis was performed by high - performance liquid chromatography using electrochemical detection (esa, acton, ma). plasma insulin and glucagon baseline comparisons were performed using anova. a mixed - model analysis with an unstructured covariance matrix analyses were performed using sas 9.2 software (sas institute, inc., cary, nc), with a threshold p < 0.05 considered as statistically significant. seven to 10 days before each study, all animals were anesthetized with an injection (1 ml / kg i.p.) of a mixture of xylazine (20 mg / ml anased ; lloyd laboratories, shenandoah, ia) and ketamine (100 mg / ml ketaset ; aveco, fort dodge, ia), in a ratio of 1:2 (vol / vol), before undergoing vascular surgery for the implantation of vascular catheters in a carotid artery and jugular vein. microinjection guide cannulae were then bilaterally inserted into the vmh, targeting the ventromedial nucleus (coordinates from bregma : anteroposterior 2.6 mm, mediolateral 0.8 mm, and dorsoventral 8.0). on the morning of the study, after an overnight fast and 60 min after opening the catheters, 22-gauge microinjection needles, designed to extend 1 mm beyond the tip of the guide cannula (plastics one, roanoke, va), were inserted through the guide cannula bilaterally into each vmh. the rat was then microinjected over 2 min (0.5 l / min) using a cma-102 infusion pump (cma microdialysis, north chelmsford, ma). the animals were microinjected immediately before the initiation of a hyperinsulinemic - hypoglycemic clamp with 1 l of one the following pharmacologic agents : artificial extracellular fluid as a control (n = 12) ; 1 mol / l concentration of the b2ar antagonist ici-118,551 (n = 12) ; or 1 mol / l concentration of the b2ar agonist formoterol (n = 10). the doses of b2ar agonists and antagonists selected were based on preliminary dose - ranging studies using a 1 nmol / l to 200 mol / l concentration of the agonist and antagonist. in another set of studies, we microinjected 1 mol / l cgp 20712 dihydrochloride, a potent, selective b1ar (n = 7), or 1 mol / l sr59230a hydrochloride, a potent, selective b3ar antagonist (n = 6). a primed - continuous intravascular infusion of 20 mu kg min regular insulin was started, and a variable infusion of 20% dextrose was adjusted in response to 10-min measurements of plasma glucose to reach a target value of 50 mg / dl within 30 min. thereafter, plasma glucose was monitored at 10-min intervals using a glucose analyzer (analox instruments, lunenburg, ma) to adjust the dextrose infusion rate to maintain a stable 50 mg / dl glucose level until the end of the study at 90 min. blood was drawn at baseline and at 30, 60, and 90 min for measurement of plasma glucagon, epinephrine, norepinephrine, and insulin. at the end of experiments, the rats were killed with an overdose of sodium pentobarbital (sleepaway ; fort dodge animal health, fort dodge, ia). catecholamine analysis was performed by high - performance liquid chromatography using electrochemical detection (esa, acton, ma). plasma insulin and glucagon were measured by radioimmunoassay (linco, st. charles, mo). baseline comparisons were performed using anova. a mixed - model analysis with an unstructured covariance matrix analyses were performed using sas 9.2 software (sas institute, inc., cary, nc), with a threshold p < 0.05 considered as statistically significant. as summarized in table 1, the groups of rats did not differ with respect to body weight or concentrations of plasma glucose, insulin, glucagon, epinephrine, and norepinephrine at baseline. during the hyperinsulinemic - hypoglycemic clamp studies, plasma glucose and insulin in each animal group reached levels that were not significantly different (table 2). baseline metabolic status of animals in the morning before the study data are presented as mean sem. plasma glucose and insulin concentrations during the final 60 min of the hyperinsulinemic - hypoglycemic clamp study for rats in each study group data are presented as mean sem. as shown in fig. 1a, vmh delivery of the b2ar agonist reduced the exogenous glucose infusion rates (gir) required to maintain target glucose concentration by 32% during the entire hypoglycemic clamp (p < 0.01), whereas b2ar blockade in the vmh raised exogenous glucose requirements by 27% (p < 0.05) compared with the control study. b2ar modulation in the vmh and its effect on gir and counterregulatory hormones during the hypoglycemic clamp study. gir (a) and hormonal responses for plasma epinephrine (b), glucagon (c), and norepinephrine (d) for rats receiving microinjection of the artificial extracellular fluid vehicle (control ; n = 12), the b2ar antagonist ici-118,551 (n = 12), or the b2ar agonist formoterol (n = 10) during the hyperinsulinemic - hypoglycemic glucose clamp. post hoc linear contrasts to localized effects ; p < 0.05, p < 0.01, and p < 0.001 vs. controls. these changes were accompanied by alternations in peak and in overall epinephrine responses during hypoglycemia. delivery of b2ar agonist to the vmh increased peak epinephrine responses by 37% (p < 0.01) and epinephrine levels during the entire 90-min period of hypoglycemia by 50% (p < 0.01) compared with the control group. in contrast, vmh delivery of the b2ar antagonist suppressed the peak by 53% (p < 0.001) and epinephrine levels during the entire 90-min period of hypoglycemia by 32% (p < 0.05) compared with the control group (fig. peak and overall glucagon response was also increased by activation of vmh b2ar by 53 and 63%, respectively (p < 0.01 for both vs. control) (fig. however, administration of the b2ar antagonist had only a small inhibitory effect on the peak glucagon response, which failed to reach statistical significance (p = 0.051 vs. control at 30 min) (fig. norepinephrine levels were also slightly higher in the b2ar agonist group, but at 90 min only (p < 0.05 vs. control) (fig. targeted blockade of vmh b1ar or b3ar failed to suppress counterregulatory hormone responses to hypoglycemia or increase the gir needed to maintain hypoglycemia (fig. 2a) but did produce a modest increase in the overall epinephrine response (p < 0.05 vs. control) (fig. 2b). vmh b3ar blockade produced a small 21% decrease in the gir required during hypoglycemia (p < 0.05 vs. control). however, b3ar blockade had no significant effect on the release of epinephrine, glucagon, and norepinephrine during hypoglycemia compared with controls (fig. 2). effect of vmh b1ar or b3ar blockade on gir and counterregulatory hormones during the hypoglycemic clamp study. gir (a) as well as epinephrine (b), glucagon (c), and norepinephrine (d) responses for rats receiving microinjection of the artificial extracellular fluid vehicle (control ; n = 12), the b1ar antagonist cgp 20712 (n = 7), and the b3ar antagonist sr59230a (n = 6) during the hyperinsulinemic - hypoglycemic glucose clamp. previous studies have suggested a potential role for local vmh norepinephrine neurotransmission in modulating glucose counterregulation. this view is supported by data showing that 1) norepinephrine delivery into the vmh increases blood glucose and counterregulatory hormone levels (16,17) ; 2) glucopenia stimulates norepinephrine turnover in the mediobasal hypothalamus, including the vmh (18,19) ; and 3) levels of norepinephrine increase in vmh interstitial fluid during hypoglycemia (12,13). the current study was undertaken to assess whether norepinephrine acts to promote glucose counterregulation via specific vmh bars. the data demonstrate that local vmh delivery of a specific b2ar agonist increases both epinephrine and glucagon responses to acute hypoglycemia, whereas delivery of a b2ar antagonist suppresses epinephrine release and tends to reduce the initial glucagon response. in contrast, blockade of vmh b1ar or b3ar failed to have a significant inhibitory effect on counterregulatory responses. it should be noted that for these studies we used similar concentrations of bar agonists and antagonists (1 mol / l) as were used in previous in vivo (12,20) and in vitro (11) studies examining the specific receptors mediating the effects of norepinephrine on vmh neurons. although these concentrations exceed the nanomolar norepinephrine concentrations present in the vmh interstitial fluid, if one takes into account the dilution of the agent in the vmh and in vivo clearance from the tissue during the study, the active local dose level in the vmh was considerably lower. nevertheless, it seems unlikely that the changes we observed represent off - target effects. we have observed that if the dose of b2ar antagonist is diminished 10-fold, there is a similar degree of suppression of epinephrine responses to hypoglycemia and that if much higher doses of the compound are given, the effect on epinephrine release is less pronounced (b.s., unpublished data). taken together, our data suggest that norepinephrine release into the vmh during hypoglycemia acts to promote glucose recovery, at least in part via stimulation of b2ar. these findings are consistent with previous studies showing that norepinephrine activates isolated glutamatergic neurons derived from the rat vmh via b2ar (11). it is noteworthy that earlier studies suggested that norepinephrine s central actions to regulate peripheral glucose levels were mediated via 2-receptors. smythe. (18,19,21) reported that yohimbine, an 2-receptor antagonist, markedly inhibited stress induced hyperglycemia as well as the hyperglycemic effects of 2-deoxyglucose administration. moreover, beverly. (20) reported that during hypoglycemia the norepinephrine rise within the vmh followed a bimodal pattern. the initial peaks disappeared when yohimbine was locally delivered, whereas the second rise was suppressed in the presence of timolol, a nonselective bar antagonist. neither of these studies, however, examined the effect of hypothalamic adrenergic receptor modulation specifically on the responses of counterregulatory hormones to hypoglycemia. it is noteworthy in this regard that previous studies suggest that the activation of an appropriate counterregulatory response to hypoglycemia is associated with inhibition of gaba tone (9) and activation of glutamate neurons within the vmh (10). it is intriguing to speculate that norepinephrine might act via different adrenergic receptors to exert complementary effects on vmh glutamate and gaba neurotransmission to promote counterregulatory responses to hypoglycemia. it is now recognized that hypoglycemia is detected by specialized glucose - sensing neurons located within a variety of brain regions (6,7) as well as periphery (5). watts and donovan, in a recent review (14), proposed that brainstem catecholaminergic neurons receive neural input from peripheral glucose sensors and then transmit this information to hypothalamic glucose - sensing neurons, including those in the vmh. thus, these catecholaminergic projections might serve to integrate the vmh into a wide network glucose - sensing neurons. we conclude that synaptic release of catecholamines acting via b2ar within the vmh plays an important role in modulating the magnitude of the epinephrine responses and, to lesser extent, glucagon responses to insulin - induced hypoglycemia. these observations are consistent with previous studies suggesting that administration of the b2ar agonist terbutaline may restore hypoglycemia awareness and reduce nocturnal hypoglycemia (22,23). this effect may be particularly useful in humans with homozygosity for glycine at codon 16 (glygly) of the b2ar who appear to show reduced b2ar sensitivity to antecedent hypoglycemia (24). moreover, the current data are consistent with recent data indicating that repeated adrenergic receptor activation might also be involved in the generation of hypoglycemia - associated autonomic failure (25) and raise the possibility that b2ar receptor downregulation might play a role in this phenomenon. in our study given that hypoglycemia remains the major limiting factor in the use of intensified insulin therapy in the management of diabetes, our study may have potential therapeutic implications for strategies aimed at reducing the risk of severe hypoglycemia in diabetes.	objectivenorepinephrine is locally released into the ventromedial hypothalamus (vmh), a key brain glucose - sensing region in the response to hypoglycemia. as a result, this neurotransmitter may play a role in modulating counterregulatory responses. this study examines whether norepinephrine acts to promote glucose counterregulation via specific vmh -adrenergic receptors (bar).research design and methodsawake male sprague - dawley rats received, via implanted guide cannulae, bilateral vmh microinjections of 1) artificial extracellular fluid, 2) b2ar agonist, or 3) b2ar antagonist. subsequently, a hyperinsulinemic - hypoglycemic clamp study was performed. the same protocol was also used to assess the effect of vmh delivery of a selective b1ar or b3ar antagonist.resultsdespite similar insulin and glucose concentrations during the clamp, activation of b2ar in the vmh significantly lowered by 32% (p < 0.01), whereas vmh b2ar blockade raised by 27% exogenous glucose requirements during hypoglycemia (p < 0.05) compared with the control study. these changes were associated with alternations in counterregulatory hormone release. epinephrine responses throughout hypoglycemia were significantly increased by 50% when the b2ar agonist was delivered to the vmh (p < 0.01) and suppressed by 32% with the b2ar antagonist (p < 0.05). the glucagon response was also increased by b2ar activation by 63% (p < 0.01). neither blockade of vmh b1ar nor b3ar suppressed counterregulatory responses to hypoglycemia. indeed, the b1ar antagonist increased rather than decreased epinephrine release (p < 0.05).conclusionslocal catecholamine release into the vmh enhances counterregulatory responses to hypoglycemia via stimulation of b2ar. these observations suggest that b2ar agonists might have therapeutic benefit in diabetic patients with defective glucose counterregulation.
a 47-year - old postmenopausal woman presented with slowly increasing abdominal girth with a palpable abdominal mass and vaginal bleeding. at the age of 15, she underwent abdominal surgery due to intussusception of the small bowel of unknown cause. during the preoperative evaluation, colonoscopy identified eight hamartomatous polyps, nine hyperplastic polyps, and two tubulovillous adenomas in her large intestine. she had abundant mucocutaneous melanin pigmentation around the lips. based on her clinical features and the histopathological diagnosis of hamartomatous polyps and mucocutaneous pigmentation, no other family members had clinical signs of pjs. on pelvic and abdominal ultrasonography and computed tomography, she was found to have huge bilateral ovarian cystic masses with ascites in the pelvic cavity. on exploratory laparotomy, the left ovarian mass was ruptured, and approximately 1,500 ml of ascitic fluid was identified. the patient underwent hysterectomy, bilateral salpingo - oophorectomy, and small bowel polypectomy via small bowel enterostomy. grossly, the left ovarian tumor was a multilocular cyst measuring 22206 cm (fig. 1a), whereas the right ovarian tumor was an oligolocular cyst measuring 875 cm (fig. microscopically, both ovarian tumors showed cysts of varying sizes lined by a single layer of columnar epithelium, and the architecture of the glandular arrangement was characterized by clusters of small glands budding from surrounding a centrally located large duct - like structures, forming a lobular arrangement at lower magnification (fig. the uterine cervix, endometrium, and fallopian tubes were meticulously examined, but no histologic evidence of mucinous epithelial lesions or metaplasia was identified. polyps of the small intestine showed a branching polypoid structure with crypts and villi of variable lengths and cystically dilated glands, which were divided by muscularis mucosa branching in various directions (fig. on combined alcian blue (ph 2.5) and periodic acid - schiff after diastase (dpas) staining, the intracytoplasmic mucin in the epithelium of the ovarian tumor was negative for alcian blue ph 2.5 and positive for dpas. the cytoplasm stained bright pink for combined alcian blue ph2.5/dpas, implying that the mucinous contents of the ovarian tumor were neutral (fig. 1 g), in contrast to mucin in the normal endocervical mucosa, which was positive for both alcian blue ph 2.5 and dpas and showed a purple - violet color for combined alcian blue ph2.5/dpas (fig. we performed immunohistochemical staining using formalin - fixed, paraffin - embedded, 4-m - thick tissue sections with an optiview dab immunohistochemical detection kit (roche diagnostics, mannheim, germany) on a benchmark xt autoimmunostainer (ventana medical system, tucson, az, usa). the mucinous epithelium of the ovary showed diffuse immunoreactivity for muc6 (novo, newcastle upon tyne, uk), moderately intense immunoreactivity for carbonic anhydrase - ix (novus biologicals, littleton, co, usa), and focal immunoreactivity for muc5ac (marker of foveolar - type mucin ; novo) and hik1083 (toyo 2chome, tokyo, japan) (fig. d). the epithelium did not show immunoreactivity for p16 (santa cruz biotechnology, santa cruz, ca, usa), estrogen receptor (novo), progesterone receptor (novo), or p53 (oncogene, uniondale, ny, usa). genomic dna was extracted from peripheral blood samples by a qiaamp dna blood kit (qiagen gmbh, hilden, germany) and from fresh frozen tissue of the left ovarian tumor by a quickgene dna tissue kit (fujifilm life science, tokyo, japan). the stk11 gene was amplified via polymerase chain reaction by using 10 sets of primers in intronic flanking regions containing all exons (table 1). sequencing analysis was performed by a cycle sequencing kit (thermo fisher scientific, waltham, ma, usa) following the manufacturer s instructions. multiple ligation - dependent probe amplification (mlpa) was performed to detect deletions and duplications in the stk11 gene by stk11 mlpa kit p101 (mrc - holland, amsterdam, the netherlands). the peak height of the probes was analyzed using genemarker software v.1.7 (softgenetics llc, state college, pa, usa). a peak ratio less than 0.65 was interpreted as a deletion, whereas a peak ratio greater than 1.35 was interpreted as a duplication. sequencing analysis did not detect any mutation in the exons and exon - intron boundaries of the stk11 gene in the blood and ovarian tumor samples. using mlpa analyses, however, peripheral blood leukocytes showed a germline heterozygous deletion mutation at exons 17 of the stk11 gene (c.1-?_920+?del) and the tumor tissue showed mosaic loss of heterozygosity due to the mutation (heteroplasmy) (fig. we performed immunohistochemical staining using formalin - fixed, paraffin - embedded, 4-m - thick tissue sections with an optiview dab immunohistochemical detection kit (roche diagnostics, mannheim, germany) on a benchmark xt autoimmunostainer (ventana medical system, tucson, az, usa). the mucinous epithelium of the ovary showed diffuse immunoreactivity for muc6 (novo, newcastle upon tyne, uk), moderately intense immunoreactivity for carbonic anhydrase - ix (novus biologicals, littleton, co, usa), and focal immunoreactivity for muc5ac (marker of foveolar - type mucin ; novo) and hik1083 (toyo 2chome, tokyo, japan) (fig. d). the epithelium did not show immunoreactivity for p16 (santa cruz biotechnology, santa cruz, ca, usa), estrogen receptor (novo), progesterone receptor (novo), or p53 (oncogene, uniondale, ny, usa). genomic dna was extracted from peripheral blood samples by a qiaamp dna blood kit (qiagen gmbh, hilden, germany) and from fresh frozen tissue of the left ovarian tumor by a quickgene dna tissue kit (fujifilm life science, tokyo, japan). the stk11 gene was amplified via polymerase chain reaction by using 10 sets of primers in intronic flanking regions containing all exons (table 1). sequencing analysis was performed by a cycle sequencing kit (thermo fisher scientific, waltham, ma, usa) following the manufacturer s instructions. multiple ligation - dependent probe amplification (mlpa) was performed to detect deletions and duplications in the stk11 gene by stk11 mlpa kit p101 (mrc - holland, amsterdam, the netherlands). the peak height of the probes was analyzed using genemarker software v.1.7 (softgenetics llc, state college, pa, usa). a peak ratio less than 0.65 was interpreted as a deletion, whereas a peak ratio greater than 1.35 was interpreted as a duplication. sequencing analysis did not detect any mutation in the exons and exon - intron boundaries of the stk11 gene in the blood and ovarian tumor samples. using mlpa analyses, however, peripheral blood leukocytes showed a germline heterozygous deletion mutation at exons 17 of the stk11 gene (c.1-?_920+?del) and the tumor tissue showed mosaic loss of heterozygosity due to the mutation (heteroplasmy) (fig. minimal deviation adenocarcinoma (an extremely well differentiated form of gastric type adenocarcinoma) of the cervix and ovarian sex cord tumor with annular tubules are the most well - known tumors of the female genital organs associated with pjs, but association with ovarian mucinous tumors has rarely been described. moreover, gastric phenotype of the mucinous epithelium in patients with pjs has not been clearly determined, and there is only one case briefly mentioning ovarian mucinous tumor with pyloric / gastric differentiation. in that case report, the pyloric gland differentiation involved the lesions of multiple organs, including the jejunum, urinary bladder, uterine cervix, fallopian tube, and ovary. in the extragenital organs, peutz - jeghers polyps in duodenum and jejunum have small areas of normal superficial gastric - type epithelium, suggesting that the proliferations of gastric - type mucinous epithelium are common features in any organs of the patients with pjs. although the gastric subtype is very rare among mucinous tumors, it must be a distinct subtype of the ovarian mucinous tumors, which should be differentiated from the usual intestinal subtype. legh in the uterine cervix is thought to be a precursor lesion of gastric - type cervical adenocarcinoma, which is often identified in patients with pjs. therefore, the premalignant potential of an ovarian mucinous tumor resembling legh should be closely monitored. in our case, a germline heterozygous deletion mutation in stk11 (c.1-?_920+?del) (exon17del) and mosaic loss of heterozygosity were detected in the left ovarian mucinous cystadenoma by mlpa assay, but direct sequencing did not detect the deletion of the large exon. in conclusion, our case combined with previously described cases suggests that stk11 gene mutations play an important role in the proliferation of pyloric gland - phenotype mucinous epithelium in various anatomical locations.	we describe an ovarian mucinous neoplasm that histologically resembles lobular endocervical glandular hyperplasia (legh) containing pyloric gland type mucin in a patient with peutz - jeghers syndrome (pjs). although ovarian mucinous tumors rarely occur in pjs patients, their pyloric gland phenotype has not been clearly determined. the histopathologic features of the ovarian mucinous tumor were reminiscent of legh. the cytoplasmic mucin was stained with periodic acid - schiff reaction after diastase treatment but was negative for alcian blue ph 2.5, suggesting the presence of neutral mucin. immunohistochemically, the epithelium expressed various gastric markers, including muc6, hik1083, and carbonic anhydrase - ix. multiple ligation - dependent probe amplification detected a germline heterozygous deletion mutation at exons 17 of the stk11 gene (c.1-?_920+?del) in peripheral blood leukocytes and mosaic loss of heterozygosity in ovarian tumor tissue. considering that legh and/or gastric - type cervical adenocarcinoma can be found in patients with pjs carrying germline and/or somatic stk11 mutations, our case indicates that stk11 mutations have an important role in the proliferation of pyloric - phenotype mucinous epithelium at various anatomical locations.
facial tissue loss or defects can be acquired, congenital, tumoral lesions or accidental. facial deformity can cause functional and serious psychological problems that can affect an individual 's social behavour.1,2 the field of maxillofacial prosthetics is concerned with the prosthetic reconstruction of missing / disfigured head and neck tissue. a prosthetic replacement of an exterior part is termed as epithesis, which is described as early as seventh century.3 auricular reconstruction is challenging task in which a wide array of reconstructive options must be considered.4 prosthetic replacement of missing facial tissues has several advantages over surgical reconstruction. the process is relatively inexpensive, allows for periodic evaluation and cleaning of the site. it is a short process and the maxillofacial clinician has complete control of color, shape and position of the prosthesis. disadvantages include possible irritation of the tissue site, need for periodic remake and depending on adhesives or some other form of retention.5 the first well documented account of facial prosthetics is provided by ambroise pare who made varied contribution to standardize the indications for and materials used in facial prosthetics. amongst the large number of materials that have been tried out in the history of anaplastology as for example porcelain, natural rubber, gelatin and latex, two have established themselves : methacrylates and silicones.6 long term success of a facial prosthesis depends mainly on retention.7 these prostheses are retained with different methods of retention such as medical adhesives, anatomical undercuts, and mechanical devices like spectacles, hair bands, magnets and implants.8 since the introduction of percutaneous endosseous implants for use with bone conduction hearing aids in 1977, implants have acquired important role in the prosthetic rehabilitation of patients with craniofacial defects.9 implants can vastly improve the retention and stability of a facial prosthesis. the co - ordinated participation of surgeon and maxillofacial prosthodontist is required in presurgical planning to determine the number, type and positioning of the implants in the defect.10 the aim of maxillofacial rehabilitation should provide a suitable prosthesis for patients with facial defects so that they are rehabilitated back to the society to face and accept the challenges of life. it encourages the best possible quality of life and upholds their self image during their traumatic psychological adjustment. this article describes an economical procedure for fabricating acrylic auricular prosthesis for a female patient who had bilaterally deformed ears resulting from trauma. two stage impression technique was used and auricular prosthesis was fabricated in two parts, utilizing the external auditory canal for improving the retention of the prosthesis. a 24 year, young female patient was referred to the department of prosthodontics, in vidharbha youth welfare society, dental college and hospital, amravati (india) with bilateral auricular deformity. she was not willing to provide any information, including the reason for deformed ears. her hearing was normal, without any intrauricular problem as evaluated by speech recognition tests and signals to noise ratio by an otorhinolaryngoloist auricular prosthesis was planned for her in consultation with an otorhinolaryngologist. patient education and counseling was done regarding the nature, function and limitation of the prosthesis. she was draped, and her hair was protected by surgical cap covering the hairline. impressions of the auricular defect were made using irreversible hydrocolloid (algitex, dpi, mumbai, india) following standard procedures. prebent l shaped paper clips were used for reinforcement and quick setting plaster of paris (kaldent, kalahai karson, mumbai, india) was added for backing. impressions were removed, boxed and poured and in type 3 gypsum material (kalstone, kalabhai karson, mumbai, india).11 wax patterns of the ears were prepared on stone models using modelling wax (deepti dental products, ratnagiri india) by comparing with the appropriate size of the ear of another female of the same age group. the wax patterns were not very retentive and stable on her face. after consulting an otorhinolaryngologist and performing an otoscopic examination of the ears, it was planned to utilize the external auditory canal for added retention of the prosthesis. she had the shape, curvature, extension of the canal and the anatomic undercuts of the existing deformed ears would be utilized for improving the retention and stability of the prosthesis. patient was put at ease by educating her regarding the impression procedure, which was carried in assistance with an audiometrist. lubricated cotton otodams of appropriate diameter were pushed in the canal beyond the second bend, with the tip of earlite to seal the canal and ensure safety of ear drum.12 putty silicone impression material (green echo., ettlingen, germany) was manipulated and loaded in a plastic syringe (cetylcide, siemens ' erlangen, germany) with tapered nozzle of approximately 5 mm diameter. using proper bracing technique, the tip of the syringe was placed approximately 6 mm inside the canal opening. the material was gently expressed into the ear canal, allowing the material to flow back over the syringe tip. once the material started to flow past the tip, the pressure of the material itself pushed the syringe out slowly, filling the surrounding concha and helix region. during the procedure her vagus / cough reflex, her gag and watering eyes reflexes were noted. she was asked to open and close her mouth along with jaw movements, like chewing motion etc.13,14 after curing the impression were gently removed from the canal by pulling her pinna up and back to break the seal (fig. the internal component was processed in heat polymerized clear acrylic resin (trevalon, dentsply, york, pa, usa). a polyethylene hollow tube of approximately 3 - 4 mm in diameter was cemented to maintain the opening of canal and prevent the occluding effect (fig. 3).15 the internal component were attached to previous wax patterns and checked to verify the fit. gentle clockwise rotational movement in open jaw position was done to place the prosthesis in place. anticlockwise rotational movement for removal of the prosthesis was tried. after making necessary corrections, 4) and invested in varsity flasks. packing with heat polymerized polymethyl - methacrylate (pmma) (trevalon ; dentsply, york, pa, usa) was done in patient 's presence for accurate color simulation. combination of oil colors was used to obtain desired shade of skin which was incorporated in monomer. monomer and polymer were mixed in proper proportion and the dough was packed in the mould. the prosthesis was tinted with acrylic paint suspension (fevicryl, pidilite industries, mumbai, india) for final characterization (fig. she was advised to remove the prosthesis at night, wipe the internal component with a dry soft cloth and keep it free of dirt and ear wax. a small brush and wax removing tool for cleaning the vent (used for cleaning hearing aids) hair oil, creams etc were not to be used with the prosthesis seated as they can clog the vent. excessive exposure to sun should be avoided to prevent discoloration of prosthesis. during the recall visits she was assessed for her vagus and lymphatic reflexes. auricular defect can be repaired16 or reconstructed with autogenous tissue,17 but this may not be feasible for personal / medical reasons.18 a good alternative is to develop an auricular prosthesis with a suitable material silicone is the material for choice for facial prosthesis because of its flexibility and life like appearance.19 in this case pmma was used. although this material has shortcomings of being inflexible and having esthetic limitations, it provided an economic rehabilitation to the patient, improving her quality of life and reintegrating her back to the society. the use of external auditory canal for achieving retention requires a sound knowledge of anatomy of ear and associated structures.13 the average length of the canal from tragus to tympanic membrane is 25 - 26 mm long and 6 - 7 mm in diameter. the cartilaginous part of the canal is about 8 mm and the osseous part is 16 mm in length. the length of the impression extended about 17 - 18 mm in length, which was still far from the ear drum.15 whenever feasible implant retained prosthesis should be given prime consideration, which has improved retention, stability, and comfort of the patient.1,20 recent advances in techniques, including a new generation of computed tomography scanner and three dimensional (3d) systems facilitate the production of mirror image of auricular prosthesis with high level of accuracy, alleviating most of the limitations of conventional prosthesis21 limitation to its use is high cost. development in the field of tissue engineering has resulted in the formation of new tissue equivalents of bone and cartilage that will augment the outcome of prosthodontic rehabilitation in future.22 evidenced based studies pertaining to the value of facial prosthetics have to be addressed to better understanding of the economical, functional and psychological burden of having a facial ablative procedure involving the orofacial, ocular, auricular and nasal tissues.5 maxillofacial defects can be emotionally traumatizing considering the societal emphasis on physical appearance. an attempt to provide a cost effective and cosmetically acceptable bilateral auricular prosthesis for a female patient patient 's participation in the decision making process with realistic expectations is of vital significance.	maxillofacial prosthodontics is an art and science which provides life like appearance to the person with facial deformity. maxillofacial prosthetic rehabilitation for acquired defects has become more complex and sophisticated with advancement in techniques and materials. this case report describes the clinical and laboratory procedure for fabricating an auricular prosthesis for a patient with trauma related bilateral auricular deformity. ear prosthesis was fabricated in two parts taking retention from external auditory canal.
staphylococcus aureus is a well - adapted human / zoonotic colonizer which can also cause a wide range of diseases and its treatment is becoming more difficult because of increasing rates of drug resistance both in hospital and community settings. community - acquired methicillin - resistant s. aureus (ca - mrsa) has been a subject of interest in the last decade. traditionally, the risk factors for ca - mrsa are chronic illness, history of recurrent use of antibiotics and intravenous drug abuse. moreover, new risk factors such as attendance in military service and day care centers, homosexuality, tattooing, contact sports, sharing soaps and towels, having pets and age 2 years have been proposed, yet several patients with ca - mrsa infections do not have any recognized risk factor for methicillin resistance (1 - 6). in addition to epidemiological differences, ca - mrsa and hospital - acquired methicillin - resistant s. aureus (ha - mrsa) differ in antibiotic resistance pattern. ca - mrsa clones are usually resistant only to -lactams and erythromycin and are usually susceptible to co - trimoxazole, clindamycin and fluoroquinolones (1, 2, 5, 7). from a molecular perspective, ha - mrsa strains usually carry staphylococcal cassette chromosome mec (sccmec) types i - iii while ca - mrsa strains carry sccmec types iv or v (1, 4, 5, 8). the aim of this study was to determine the frequency of invasive ca - mrsa in children admitted to the pediatric wards of imam reza and ghaem teaching hospitals. in this retrospective observational study, data of s. aureus - positive cultures from sterile body sites (i.e. blood, bone puncture, joint fluid and lymph node aspiration) was gathered from microbiology laboratory files from march 20 2006 to march 19 2012. the community or hospital origin of s. aureus infection was determined by hospital files and telephone communication with the patients parents according to the cdc criteria (1, 6). during this 6-year period, 23 invasive community - acquired s. aureus cultures were recovered from pediatric patients (8 girls and 15 boys). isolates were from blood (n = 15), synovial fluid (n = 2), bone puncture (n = 3) and lymph node aspiration (n = 3). seventeen isolates (74%) were resistant to methicillin. septic arthritis, osteomyelitis and sepsis (table 1) the resistance rate for erythromycin, cotrimoxazole, ciprofloxacin, tetracycline, and genta - micin was 71%, 53%, 36%, 50% and 44% for ca - mrsa and 0%, 0%, 20%, 50%, 33% for community - acquired methicillin susceptible s. aureus, respectively. invasive staphylococcal infections like osteomyelitis, septic arthritis and pneumonia are common causes of admission to pediatric wards. however, based on our daily clinical observations, there is a high incidence of ca - mrsa in our institutions. this research confirms that the rate of methicillin resistance among invasive community - acquired isolates has been very high (74%) in pediatric patients during the past six years. there is a high difference in the prevalence of ca - mrsa in different geographic areas. for example in the us, ca - mrsa prevalence varies between 15% in north eastern states up to 72% in southern states (3). in middle east countries, the prevalence of ca - mrsa is 62% in saudi arabia (9) and 52% in turkey (10), 11% in south of india (11), and 74% in taiwan, (12) which is close to our estimation in this study. ca - mrsa was more common in boys in our study (male / female ratio = 2). also in a study of the nicu of texas children hospital, most subjects (65 of 89) were male (14). sex difference in our study can be explained by considering the fact that bone and joint infections are more common in boys (15). resistance of ca - mrsa to non--lactam antibiotics like co - trimoxazole and ciprofloxacin has been reported 0% and 10.7% in the us and 11% and 10% in saudi arabia, respectively (8, 9). in this study, high rate of resistance to co - trimoxazole and ciprofloxacin was observed among our invasive ca - mrsa isolates. interestingly, multidrug resistant ca - mrsa has been recently reported from other asian countries (16). the rate of ca - mrsa in our community is very high and similar to asian ca - mrsa clones which are also resistant to co - trimoxazole and ciprofloxacin. although further epidemiological and molecular investigations are needed to confirm the results of this study, we recommend that in these two hospitals, for invasive community - acquired s. aureus infections treatment should be started with drugs like clindamycin, vancomycin, linezolid or daptomycin.	background and objectivecommunity - acquired methicillin - resistant staphylococcus aureus (ca - mrsa) is increasingly reported worldwide. we aimed to determine the frequency of invasive ca - mrsa in children admitted to the pediatric wards of imam reza and ghaem hospitals of mashhad, iran.materials and methodsin this retrospective study, data regarding s. aureus isolates from pediatric patients sterile body sites (i.e. blood joint, bone and lymph node aspiration) were retrieved in a time period from march 2006 to march 2012. disc diffusion data was analyzed to determine the resistance pattern of the isolates, and differentiation between community - acquired and nosocomial s. aureus was done according to cdc guidelines.resultstwenty three invasive community - acquired s. aureus isolates from sterile body sites were identified, of which seventeen (74%) were ca - mrsa. the ca - mrsa isolates showed high frequency of resistance to non--lactam antibiotics (71% to erythromycin 53% to co - trimoxazole, 44% to gentamicin and 36% to ciprofloxacin).conclusionin this study, the majority of invasive community - acquired s. aureus isolates were found to be ca - mrsa. therefore, we recommend that primary treatment should be with antibiotics such as clindamycin, vancomycin, linezolid or daptomycin for any invasive infection suspected to be caused by s. aureus in these two hospitals.
for some, brachytherapy (bt) is something on the brink of extinction and their arguments are not scarce. brachytherapy might not sound too appealing for the average radiation oncologist because it implies transition from behind the screen to the or. blood appears as a real scenario and most of them chose from the beginning to avoid it willingly. it is not only about the lack of surgical skills, but also that most junior radiation oncologists do not actually have the chance to see or practice the technique in their centers. moreover, bt is by itself a niche domain, as there are rather few indications for it, as compared to external beam radiotherapy (ebrt). therefore, for most of them, bt is something more like see not touch. last but not least, in a domain driven by ebrt, investing in bt might not seem too appealing for developers. fortunately, some of these issues can be corrected. with proper indications and good technique thus, in their effort to keep the domain alive, doctors that advocate for it tried to replace the human hand for the bloody part while keeping the radiation therapy spirit friendly to radiation oncologists. as a result of this struggle for accessibility, safety, precision, and accuracy, bt robotic systems appeared. the aim of this paper is to evaluate the current situation in the field of robotic brachytherapy, briefly outline the existing systems, their technical aspects, and limitations, and to present a custom - made solution to the problem, a universal brachytherapy robotic system, para - brachyrob. the purpose of bt is to achieve, by interstitial radioactive seed implantation (low - dose - rate hdr, or pulse - dose - rate pdr brachytherapy), a high conformal dose distribution to cover the target volume. at the same time it is thus an efficient treatment for virtual any small to medium sized well defined tumor, which can be reached by visual / palpable guidance, provided that correct indications and accurate technique are met. while the indication is based only on knowledge, usually set by multi - disciplinary team (mdt) decision, the technique requires a high degree of skill and the use of real - time image guidance, which can be improved by automation. the report of the joint task group 192 of the american association of physicists in medicine (aapm) and the groupe europen de curiethrapie (gec)-european society for radiotherapy & oncology (estro) reviews the robotics institute of america 's (ria) definition and classification of robots, and makes a clear distinction between automation and autonomy. it raises two fundamental questions on autonomy by an automatic system : autonomy from whom ? and autonomy to do what ? the first addresses the matter of permission for the robot to conduct its operations without human supervision. described by sheridan (plan, teach, monitor, intervene, learn) and refers to treatment execution, supervision of treatment planning, monitoring, and intervention. it also proposes the modification of system performance based on previous learning or teaching experiences. based on these degrees, the report proposes a new classification of automatic systems, more appropriate for bt robots and different from that elaborated by the ria. instead of subdividing robots into classes (1 - 4), it puts them on four levels of autonomy (i - iv). the denomination class (1 - 4) robot operating at level of autonomy (i - iv) might not be uncommon. there are currently no available level iv medical robots, i.e. machines capable to create and complete all the tasks without human interaction. as they yet do not possess full autonomy and work in a human environment, bt robotic systems are required to meet the saur (safety, accuracy, user - friendliness, and reliability) criteria. indeed, apart from widening the indications of the technique, increasing its availability by automation and by reducing the learning curve, these robots aim at improving accuracy. when applied for permanent bt, this relates to precise seed placement, finding optimal seed locations, decreasing surgical trauma, and finally protecting medical staff from radiation exposure. an extensive list of the additional functional recommendations on robotic bt systems can be consulted in the joint task group 192 's report. however, the ultimate purpose is not to bring a machine to the existing level of human expertise but to better implants and enhance the quality of care in a consistent, reproducible way. this means extending the indications of bt while keeping it at the same level of minimal invasiveness or even increasing the efficacy / toxicity ratio. a checklist that should be satisfied by every bt robotic system in this respect is provided by the same report. in terms of accuracy, manual seeds placement have an accuracy of 3 - 6 mm when placed in vivo with a rigid template. conversely, robotic systems are required to acquire a spatial accuracy of less than 1 mm in phantom models. they are also demanded to solve issues such as tissue deformation (by rotational needle insertion), needle deviation (fixed needle trajectory, sensors for pressure and pulsations), and to avoid edema, which would prevent the correct distribution of the delivered dose as planned pre - implant and intra - operatively (dynamic planning by update of dosimetry). patient position and existing imaging technology can be limiting the robotic system 's degree of freedom (dof), and construction materials (for example, the dorsal - lithotomic position for prostate brachytherapy might impair the transperineal insertion with direct visualization on ct and/or mri because of the limited space in the ct / mri / bore ; all the cables for mri guided robot must be with no magnetizable material such iron or copper, rising significantly the costs). system adaptability is advised so that the future advances in 3d imaging technology could offer a real advantage to these systems. prostate deformation / rotation during implant and bevel - tip needle steering effect lead also to problems such as significant target displacements and spinning, respectively. at the same time, reaching a higher level of autonomy is hindered by the operator 's need of manual control and the consequent preference for a master - slave interface. from this perspective, the catheter placement in the abdomen, pelvis, or thorax can be guided by the da vinci surgery robot, after resection, biopsy, or if the cancer is judged inoperable. image - guided brachytherapy (igbt) comprises bt robotic systems that currently use mri (magnetic resonance imaging), ct (computed tomography), or trus (trans - rectal ultrasound). while the first provides the best soft tissue contrast, there are a dozen of robotic systems developed worldwide, few to have been used on patients (first, euclidean, and jhu1). only one has received the fda and ce approvals and become commercially available for prostate bt applications : fully integrated real - time seed treatment (first system, oncentra integrated prostate solution device, elekta - nucletron, veenendaal, the netherlands, a level ii robotic system). the aapm and gec - estro guideline for image - guided robotic bt report of task group 192 issued in october 2014 provides an exhaustive table with all the existing brachytherapy robotic systems. they are analyzed by : (1) ria class, (2) level of autonomy, (3) application, (4) imaging modality, (5) dof, (6) number of channel / needle, (7) needle insertion, (8) needle rotation, (9) angled insertion, (10) seed delivery, (11) needle withdraw, (12) physical template, (13) template / perineum area coverage, (14) depth movement, (15) tps, (16) needle - tip positioning accuracy in the air, (17) needle - tip positioning accuracy in phantom, (18) accuracy in seed deposition, (19) emergency stop, (20) provision for reverting to conventional mode, (21) force - torque sensor, (22) fda approval. a brief summary of the current brachytherapy robotic systems, their developers, applications, and imaging modality is given in figure 1. the mean calibration error for the prostate bt robots is in the range of 0.5 mm. in tissue mimicking phantoms, the mean needle angulations error at 10 cm depth is around 0.5, translating into a seed placement overall mean error of around 3 mm. in practice, the main contributor for error is the needle deflection through the real prostate (due to different tissue densities including cancer stiffness, adenoma elasticity, prostate calcifications, or previously inserted seeds, etc.). picturing the centers currently involved in developing brachytherapy robotic systems. key : name, institution / company, targeted organ, imaging modality ; # the only systems used on patients for clinical brachytherapy ; the only commercially available system (approved by fda and ce) the majority of systems have thus been tailored for prostate and lung source implantation (the latter to a lesser extent). therefore, implementing a universal bt robotic system is one of the field 's main directions of development [7, 8 ]. a solution to the above mentioned limitations was proposed by the research center for industrial robots simulation and testing (cester) cluj - napoca, romania, which developed a family of modular parallel robots for brachytherapy (br1, br2, br3) (figure 2) for hdr brachytherapy. the aim was to obtain ct - based dosimetry for inoperable cancers with robotic assisted needle placement (thoracic, abdominal, and pelvic cancers) (figure 3). based on simulation results and on the expertise of radiation oncology specialists, the last system, br3, the constructive solution is a ct - compatible, remote control, and portable system with 5 degrees of freedom (dof) : x, y, z, angulation and rotation. it is small enough to fit the 80 cm gantry when mounted on the ct - table but it can be also fixed to the ground. para - brachyrob brachytherapy system components and use : a) cylindrical modules and arms ; b) control unit ; c) system fixed on the ct - table ; d) system fixed on the ground 3d simulation of para - brachyrob robotic assisted brachytherapy with the cylindrical modules mounted on the ct - table (from top left) : applications in lung, liver, prostate, and kidney cancers the kinematic scheme of pbr consists of two cylindrical modules of 3 dof each. besides the similar first two active joints, which perform a translational movement, they both associate two distal passive joints, while an additional active joint is characteristic of the needle insertion module. thanks to this structure, the br3 model of pbr eliminates the fixed frame of the previous two models, br1 and br2. in brief, the system 's technical requirements include : (1) 5-dof (x, y, z,,), (2) double rigid grip for needles of various lengths (5 - 25 cm), (3) sterile cap for needle contact, (4) sensor for resistance and for vibration, with dual signalization (audio and visual), (5) precision of in vivo contact < 3 mm in any direction, (6) automatic charger for up to 20 needles, and (7) double safety blocking mechanism. a contiguous 2 mm slice thickness ct acquisition of the zone of interest is done. as principle, the coordinates of the target are linked with the external tattoos (as in ebrt), the attaching points of the robot to the couch, and with the fiducials placed in the tumor or in its close proximity. the contouring of the target and organs at risk is done like for a classical ebrt planning. the software proposes solutions for needle placement, avoiding the organs at risk (pre - plan). optimization is performed by different angles insertions if needed, until all the dosimetry predefined constraints are fulfilled. the next day, the patient, under local, spinal or general anesthesia (as required by the tumor localization) is repositioned the same way on the ct - couch (laser alignment on the tattoos, as for ebrt), and the robot is rigidly attached to the couch in the specially designed articulation points (visible on the ct images). then the robot automatically moves to the insertion start position, according to the shifts generated by the planning system and starts the implantation, with the most safe needle, under ct guidance in any particular moment asked by the operating team. the procedure is checked periodically from outside the room by couples of ct slices (or alternatively from inside the operating room by trans - abdominal ultrasound) and pursuit catheter by catheter, if only minor deviations are encountered. final ct acquisition is done for the real dosimetry, and hdr (or pdr) bt plan can be delivered. at present, automate (partial or full procedure) seems to be the best solution for bringing bt back to stage. by increasing its availability and consequently reducing the technique 's learning curve, more junior radiation oncologists are expected to turn their attention to bt, and, consequently, more patients could benefit. for the time - being, the oncentra integrated prostate solution device is the only robotic system commercially available for ldr seeds bt. among a dozen of custom - made and under development systems, our parallel robot para - brachyrob, thanks to its versatility and technical capabilities, might be a pioneer of the next generation precision tools in bt.	in a field dominated by external beam radiation therapy (ebrt), both the therapeutic and technical possibilities of brachytherapy (bt) are underrated, shadowed by protons and intensity modulated radiotherapy. decreasing expertise and indications, as well as increasing lack of specific bt training for radiation therapy (rt) residents led to the real need of shortening its learning curve and making it more popular. developing robotic bt devices can be a way to mitigate the above issues. there are many teams working at custom - made robotic bt platforms to perfect and overcome the limitations of the existing systems. this paper provides a picture of the current state - of - the - art in robotic assisted bt, as it also conveys the author 's solution to the problem, a parallel robot that uses ct - guidance.
epidural (cse) technique is a very commonly used method for central neuraxial blockade. it combines the advantages of spinal as well as epidural blocks and avoids their disadvantages. several cse techniques are described, but needle - through - needle is the most widely reported technique in the literature and is likely to be the most frequently used. needle - through - needle cse requires that subarachnoid blockade is initiated before placing and securing the epidural catheter. this results in an inevitable delay in attending to the developing neural blockade and in cases of significant delay, the final characteristics of the block may be altered. while injecting hyperbaric local anaesthetic solutions in the sitting position, any delay in positioning can lead to settling down of spinal anaesthetic and unacceptably low level of block. when the patient is made supine after this, the cephalad spread of local anaesthetics is limited by the lumbar lordosis. this problem can be overcome and adequate level of block can be achieved in cases of delayed patient positioning if lumbar lordosis can be flattened by using some manoeuvre. it was also used along with the trendelenburg position as a rescue strategy to increase the spinal anaesthetic level after the spinal block. however, in trauma patients with lower limb fractures, flexion of only uninjured limb is possible. the literature does not mention the effect of unilateral hip flexion on extent of lordosis obliteration and level of spinal block. this study was conducted to find out if unilateral hip flexion could extend the level of spinal anaesthesia following a prolonged cse technique. following approval from institutional ethics committee, 50 american society of anesthesiologists (asa) i and ii male patients, aged 1860 years, with unilateral femur fractures, scheduled for elective fracture fixation under cse were included. patients having bilateral fractures were excluded. those with height less than 150 cm or more than 180 cm were also excluded. the patients were randomly allocated, using a sealed envelope technique, to one of the two groups control or flexion. in the operation theatre, 18 g intravenous (iv) cannula was inserted on the dorsum of hand and 500 ml ringer lactate was infused. cse was performed in the sitting position using needle - through - needle technique at l 2 - 3 interspace and 2.6 ml 0.5% hyperbaric bupivacaine injected intrathecally. the sitting position was maintained for a minimum of 4 min, i.e., 240 s from the end of spinal injection even if the time to epidural fixation was less than that. patients were made supine at the end of this 4-min period or later if epidural placement took longer. the control group patients (n=25) lay supine with legs straight, whereas the flexion group patients (n=25) had their uninjured hip and knee flexed and the hip slightly externally rotated. in addition to asking the patients to flex the hip and the knee as much as possible, an assistant helped them to maintain the flexion. this position was maintained for 5 min after which patients were returned to the supine position with legs straight. levels of sensory and motor block were assessed every 5 min for initial 30 min after the end of spinal injection and then every 15 min until regression of sensory block by two dermatome levels or complaints of pain or discomfort by the patient, whichever was earlier. this time point was considered as the end point of the study period. epidural test - dose followed by top - up dose, the sensory block level was assessed by pinprick with the 21 g needle and bromage score modified by breen. was used to assess the motor block level in the uninjured limb [table 1 ]. the first assessment was performed 5 min following spinal injection, i.e., 1 min after the patient was changed from sitting to supine position. in the flexion group patients, this time point was after the patients were returned to the supine position after maintaining hip flexion for 5 min. thus, the patients in both the groups were in the supine position at this time. the 5 and 10 min readings were missed in patients in whom it took longer than 5 and 10 min, respectively, to fix the epidural catheter. initial two readings (5 and 10 min from the spinal injection) of the spinal blockade were recorded by the anaesthetist present at the time of performance of cse. after this, all the assessments were carried out by the second anaesthetist blinded to the patient grouping as by this time all the patients had been returned to the supine position with legs straight. modified bromage score (breen.) the times to the maximum sensory level and motor block and the time to epidural drug requirement were noted. heart rate and non - invasive blood pressure were monitored throughout anaesthesia and surgery and recorded every 5 min for initial 30 min after the spinal injection. to analyze the sensory level attained, the dermatomal levels were counted in sequence starting from the lowest level so that s5=1, s1=5, l5=6, l1=10, t12=11 and so on. due to the supine position of the patients, the lowest level noted was s1. if there was no effect at the s1 level or readings were missed due to epidural catheter fixation taking longer than 5 or 10 min, the level was recorded as 0 for the purpose of statistical analysis. statistical analysis was performed using spss version 13.0. on the basis of the results of initial 10 cases, 25 patients in each group were required to detect a difference of two levels in the maximum sensory block using the mann the demographic profile was analyzed by student 's t - test, whereas sensory and motor blocks were analyzed using the mann the mean (sd) age of the patients was 38.1 (14.7) years in the control group and 35.5 (13.4) years in the flexion group. the mean (sd) weights in the control and flexion groups were 63.9 (8.9) kg and 62.3 (8.3) kg, respectively, and the mean (sd) heights were 168.8 (4.4) cm and 167.0 (5.3) cm, respectively. there was no significant difference in the heart rate and systolic blood pressure during first 30 min in the two groups [figures 1 and 2](p>0.05). one patient in the control group developed hypotension which was treated with fast iv fluids and injection mephentermine 3 mg. all the other patients in both the groups maintained their heart rate and blood pressure and did not require administration of atropine or any vasopressor throughout anaesthesia and surgery. changes in heart rate changes in systolic blood pressure there was no statistically significant difference in the time taken from the spinal injection to epidural catheter fixation in control and flexion groups [195 (121) s and 231 (163) s, respectively, p=0.20 ]. it ranged from 90 s to 525 s in the control group and from 120 s to 840 s in the flexion group. in the control group time from spinal injection to epidural catheter fixation exceeded 240 s in four patients (350, 410, 505, and 525 s). blood came in the catheter in two patients while cerebrospinal fluid (csf) was aspirated in the other two ; catheters were removed and reinserted in adjacent intervertebral spaces. in the flexion group, epidural catheter fixation took more than 240 s in six patients (295, 335, 370, 375, 545, and 840 s). in one case, it was due to difficulty in threading the catheter ; in two patients, dura got punctured at the time of catheter insertion so that the epidural technique was repeated in the adjacent space ; and in the other three cases, blood appeared in the catheter at the time of insertion necessitating removal of catheter as well as needle and repeating the space identification and catheter insertion. the median (range) sensory block levels at different time points were not different in the two groups (p > 0.05). there was no significant difference among the groups in the median (range) maximum sensory block level, median (range) maximum motor block, mean (sd) time to achieve maximum sensory level and mean (sd) time to achieve maximum motor block [table 2 ]. although the mean time to achieve the maximum sensory level was statistically similar in the two groups, it ranged from 10 to 30 min in the flexion group in contrast to a much wider range of 560 min in the control group. in the control group, four patients achieved the maximum sensory level after 30 min ; three patients at 45 min and one at 60 min. pattern of sensory blockade after spinal injection block characteristics mean time to epidural drug requirement appeared to be longer in the flexion than in the control group, i.e., 120.8 (24.7) s vs. 100.6 (47.7) s ; however, this difference could not achieve any statistical significance (p=0.476). four patients in the control group did not achieve a sufficient level of block and thus required supplementation through epidural catheter before start of surgery. on the other hand, adequate surgical level of block was attained in all the patients in the flexion group. the time from spinal injection to epidural catheter fixation in all the four control group patients requiring supplementation before the start of surgery was less than 240 s, and these patients were made supine at 240 s as per the protocol. as in some cases, time to epidural catheter fixation was longer than 240 s and therefore, these patients sat for a longer period than others. the statistical analysis was repeated after excluding these cases to rule out the effect of long duration of sitting. however, no significant difference could be seen in different variables between the two groups (p>0.05). following this, we studied patients with longer sitting periods, i.e. four patients in the control group and six patients in the flexion group. the maximum sensory block levels in these patients varied from t8 to t11 in the control group and t9 to t10 in the flexion group. spearman 's correlation was applied in these patients to find out any association between time from spinal injection to epidural catheter fixation and other variables, i.e. maximum sensory and motor blocks, times to achieve maximum sensory and motor blocks and time to epidural drug requirement. this study examined the potential of unilateral hip flexion to extend the level of spinal block in cases of delayed positioning after needle - through - needle cse. while using needle - through - needle technique of cse, the drug is injected in the subarachnoid space before inserting and fixing the epidural catheter. this necessitates cse patients to sit for 34 min longer than the patients receiving only subarachnoid block. spinal injection in the sitting position causes a hyperbaric solution to pass caudally due to influence of gravity and amount of the solution passing caudally depends on the time the patient remains sitting. therefore, considerable delays in making the patient supine can lead to dependent pooling of the local anaesthetic resulting in the saddle block. in this study, all the blocks were performed in the sitting position as our patients had their lower limbs fractured and thus the lateral position was uncomfortable for them. we made the patients supine 4 min after the spinal injection to mimic delays of 34 min. although we could not find any statistically significant difference in the maximum levels of block between the two groups, four patients in the control group needed supplementation through epidural catheter before starting surgery due to very low levels of the block. during performance of needle - through - needle cse, sometimes very long delays can occur due to unexpected problems, e.g., catheter entering a blood vessel, difficulty in catheter insertion, paraesthesia during advancement or dural puncture with the catheter. in this study, the positioning of patients in the supine position was delayed for much longer periods because of such reasons in 10 patients. in most of these cases, roberts and brighouse reported a case where the cse technique was performed in the sitting position. following spinal injection of heavy bupivacaine, there was a difficulty in inserting the epidural catheter resulting in a delay in making the patient supine. adequate level of block could not be achieved that necessitated administration of general anaesthesia to this patient. according to lesser. while giving cse anaesthetic, brisk action is required at the end of the intrathecal injection if an epidural catheter is to be placed before the local anaesthetic has fixed as delays in catheter placement are likely to result in inadequate spread of local anaesthetic. similarly, familton and morgan, while discussing the needle - through - needle technique for cse anaesthesia in the lateral position in obstetrics, suggested that if extradural catheter fails to thread after the spinal injection, further insertion attempts should be abandoned and the patient should be turned onto the other side to produce a bilateral block. despite this evidence of inadequate spread of local anaesthetic in cases of a prolonged sitting or lateral position, studies assessing the effect of the prolonged sitting position on the level of spinal block have shown controversial results. povey. and veering. did not find significant differences in the maximum spread of sensory levels in the different groups ; however, the time to attain maximum levels was more in the patients who sat for the longest time. the maximum cephalic spread of sensory analgesia was almost similar, but the time to maximum spread was 12.5 min in the 2 min group vs. 75 min in the 60 min group. the patients studied by veering. were elderly and received 3 ml hyperbaric bupivacaine. it appears from these studies that even after a prolonged sitting position, adequate levels of block can be achieved but it may take longer to achieve these levels. in clinical practice, it may not be always possible to wait for such long durations and hence there may be a need for some positional manipulations to attain the required block levels within the appropriate time period. the peak of lumbar lordosis is at the l4 vertebral level or l3 - 4 intervertebral space. the drug pooled in the sacral region can ascend upward if the lumbar lordosis can be flattened. the effect of unilateral hip flexion on obliteration of lumbar lordosis has not been studied. therefore, we hypothesized that unilateral hip flexion should increase the level of spinal block during the needle - through - needle cse technique with delay in completing the procedure in the sitting position. however, it may be less effective if cephalad spread of hyperbaric local anaesthetic is limited by lumbar lordosis. kim. used hip flexion along with the trendelenburg position as a rescue strategy to increase the spinal anaesthetic level after the spinal block. they were successful in increasing the level of the sensory block by using hip flexion ; however, the combination of hip flexion and trendelenburg position resulted in very high levels of block, i.e. median (range) of t4 (t8-c6) for a maximum level of pinprick and t3 (t6-c2) for a maximum cold sensory block. this uncontrolled spread of spinal drug also resulted in a higher incidence of hypotension and bradycardia in the hip flexion group. in the present study, the trendelenburg position was not used along with hip flexion to avoid the possibility of such uncontrolled spread of spinal bupivacaine. in this study, no significant difference could be seen in sensory levels, motor blocks and mean time to epidural drug requirement between the two groups. however, all the patients in the flexion group had attained a maximum sensory level by 30 min, whereas four patients in the control group took longer than 30 min to achieve the maximum block level. moreover, all the patients in the flexion group attained adequate block levels to start surgery whereas four patients in the control group required epidural drug before surgery. thus, there may be some potential benefit of unilateral hip flexion in extending the level of spinal block, though we could not demonstrate any obvious advantage of this technique in this study. it may be argued that there is no need to flatten the lumbar lordosis in order to extend the level of spinal block in the cse technique as more local anaesthetic can be administered through the epidural catheter. moreover, any beneficial effect of unilateral hip flexion in the cse technique could be extrapolated to the spinal anaesthetic technique without epidural catheter in situ or situations when there is failure to insert epidural catheter. during spinal anaesthesia, low levels of block can result because of technical, pharmacologic, or anatomical variables. failure to insert epidural catheter during the cse technique, though not very common, has been reported in many studies. if unilateral hip flexion was successful in extending the level of spinal block, it could be used in such situations to achieve adequate block levels in patients with unilateral lower limb fractures. first, four patients in the control group and six in the flexion group sat for longer periods than others. an attempt was made to find out the correlation between this duration of sitting and the quality of block. however, this number was very small and the negative results could have been because of the small number of patients included in the analysis. second, the level of block below s1 could not be assessed as the patients were lying in the supine position and we did not want to move them during the initial post - block period. therefore, the effect of spinal block could only be seen once the level reached s1. for the same reason, the median sensory block level at 5 min was recorded as 0 in both the groups. hirabayashi. examined the mechanical effects of the leg position on vertebral structures by magnetic resonance imaging. however, they did not study the effect of flexion of one limb on lumbar lordosis. we feel this concept of unilateral hip and knee flexion needs to be explored by radiological imaging and further clinical studies so that its potential benefits, if any, can be utilized in managing trauma patients with unilateral lower limb fractures in whom bilateral flexion of knees and hips is not possible. in conclusion, unilateral hip flexion did not extend the spinal anaesthetic level in cases of delayed patient positioning while performing needle - through - needle cse.	needle - through - needle combined spinal epidural (cse) may cause significant delay in patient positioning resulting in settling down of spinal anaesthetic and unacceptably low block level. bilateral hip flexion has been shown to extend the spinal block by flattening lumbar lordosis. however, patients with lower limb fractures can not flex their injured limb. this study was conducted to find out if unilateral hip flexion could extend the level of spinal anaesthesia following a prolonged cse technique. fifty american society of anesthesiologists (asa) i / ii males with unilateral femur fracture were randomly allocated to control or flexion groups. needle - through - needle cse was performed in the sitting position at l2 - 3 interspace and 2.6 ml 0.5% hyperbaric bupivacaine injected intrathecally. patients were made supine 4 min after the spinal injection or later if epidural placement took longer. the control group patients (n=25) lay supine with legs straight, whereas the flexion group patients (n=25) had their uninjured hip and knee flexed for 5 min. levels of sensory and motor blocks and time to epidural drug requirement were recorded. there was no significant difference in sensory levels at different time - points ; maximum sensory and motor blocks ; times to achieve maximum blocks ; and time to epidural drug requirement in two groups. however, four patients in the control group in contrast to none in the flexion group required epidural drug before start of surgery. moreover, in the control group four patients took longer than 30 min to achieve maximum sensory block. to conclude, unilateral hip flexion did not extend the spinal anaesthetic level ; however, further studies are required to explore the potential benefits of this technique.
a statistically significant increase (19762009) has been reported in the age - standardized incidence rate (asir) for distant stage breast cancer diagnosed in women at age 2539 years in the population covered by population - based cancer registries of the national cancer institute 's surveillance, epidemiology, and end results (seer) program. the report raised concerns regarding increasing rates of aggressive breast cancer in young women [2, 3 ], especially because the increases were largest for age 2539 years in the most recent time period examined (i.e., 200009) with a slight increase also at age 4054 years. support for stage migration as an explanation for the long - term trends was regarded as limited, and the increase in distant stage incidence in young women is unexplained. the present report focused on recent trends (20002011) in stage - specific asirs at age < 50 years in relation to the hypothesis of stage migration, which could result from improvements in the detection of distant metastases, as shown for lung cancer. if the prognosis of cases migrating to distant (metastatic) stage tends to be worse than most other patients classified as regional stage but better than most classified as distant, then spurious improvements may occur in survival rates for both stages. the present report included examination of recent trends in stage - specific survival rates for younger breast cancer cases in seer registries. seerstat version 8.1.5 software was used with the november 2013 seer submission database that included cancers diagnosed in 20002011 for 18 seer registries, which together cover about 28% of the us population [5, 8 ]. invasive breast cancer was defined by international classification of diseases for oncology version 3 (icd - o-3) site codes c500c509, excluding icd - o-3 morphology (m) codes m9140 (kaposi sarcoma) and m9590 - 9992 (mainly lymphomas). the focus was on women diagnosed at ages 2539, an age group used in the previous report, and 4049 years. the variable labeled summary stage 2000 (1988 +) was used, as in most seer publications (including survival rates). summary stage is derived by converting data from two detailed seer staging systems for diagnoses prior to 2004 versus 20042011, including localized (i.e., confined to breast), regional (i.e., spread to adjacent lymph nodes or chest wall), and distant (i.e., distant sites such as bone and/or lymph nodes involved). only 705 (2.1%) of all 33,704 invasive cancers diagnosed in 20002011 at age 2539 years and 1858 (1.6%) of 115,035 at age 4049 years had unknown summary stage. inflammatory breast carcinomas that are regional by direct extension only, and cases with ipsilateral infraclavicular lymph node involvement only, are defined as regional in summary stage (versus distant in historic stage) ; any supraclavicular node involvement is distant stage in both schemes. ipsilateral infra- or supraclavicular node cases are stage iii (regional) in the american joint committee on cancer (ajcc) 6th edition tnm system (i.e., t for tumor size, n for node involvement, and m for distant metastasis). thus, summary stage involves fewer distant but more regional cases and is closer to ajcc 6th edition, compared to historic stage. also used was the seer breast - adjusted ajcc 6th stage (1988 +) variable [7, 11 ] modified from the ajcc 6th edition ; in merging codes from two different detailed seer staging systems, for consistency, all distant lymph node involvements were coded as n3, rather than m1 (distant), in breast - adjusted stage. for this study, however, breast - adjusted stage was used only to define subgroups within regional summary stage, which excludes distant metastatic sites. in breast - adjusted stage, however, infraclavicular lymph node involvement was coded as n3 only if other criteria were met (e.g., clinically apparent ipsilateral internal mammary nodes or pathologic finding of 10 + axillary nodes). thus, breast - adjusted iiic (i.e., any t, with n3) differs from iiic in ajcc 6th edition. other subgroups analyzed included stages iiib (i.e., t4, n0n2), iiia (i.e., t0t2, n2 or t3, n1-n2), and ii (i.e., t0 or t1, n1, or t2, n0, or t2, n1) [10, 11 ]. data were available in the seer database for estrogen receptor (er) and progesterone receptor (er) tumor markers for 20002011, but not for the human epidermal growth factor 2 receptor (her2) expression marker (available only for 2010 - 11). er and pr status were coded in the database as positive (+), negative (), borderline, and unknown. asirs per 100,000 per year for women within ages 2539 years and 4049 years (using 5-year subgroups) directly standardized to the age distribution of the 2000 us population and 95% confidence limits (cl) were obtained using seerstat. age - specific rates for older ages were obtained for comparison. the annual percent change (apc), estimated by fitting regression models (least squares) to the natural logarithm of each annual rate, p values (two - sided, with null hypothesis of apc = zero), and lower and upper 95% cl on apcs were obtained using seer joinpoint regression program version 4.0.1 january 2013. using the seerstat survival session (ederer ii actuarial method) [3, 7 ], 3-year relative survival rates (rsr) were adjusted (by age, gender, and race) for expected mortality in the general us population ; 100% rsr indicates no survival disadvantage in patients versus the general population. with follow - up on vital status through the end of 2011, the 3-year rsr included diagnoses through 2008. cl (95%) on each rsr were estimated as [(standard error) 2 ]. rsr analyses, by age at diagnosis group, included only persons diagnosed with invasive breast cancer as their first or only reportable tumor in the database and excluded cases ascertained in seer only by death certificate (i.e., date of diagnosis unknown) or autopsy (i.e., with no survival after diagnosis). for age 2539 years, the asir for distant summary stage increased with an apc of 5.4% (p <.001, table 1) ; the higher asir for regional summary stage tended to decline (apc = 0.4%, table 1) but fluctuated, with an increase from 2010 to 2011 (figure 1(a)). the asir at age 2539 years increased for localized summary stage (table 1, figure 1(a)) ; the asir declined for unknown summary stage from 2000 (asir = 1.1, n = 99) to 2005 (asir = 0.5, n = 39) but not thereafter (asir = 0.6, n = 45, in 2011) (data not shown). for age 4049 years, the asir for distant summary stage increased (apc = 3.6%, p <.001), whereas the asir for regional summary stage declined (table 1) (apc = 0.9%, p <.001) (figure 1(b)) ; the asir for unknown summary stage declined from 2000 (4.3, n = 262) to 2004 (1.8, n = 116) but not thereafter (2.1, n = 131, in 2011) (data not shown). a previous study using distant historic stage reported a small positive apc for 20002009 for the asir in the broader age group 4054 years. using distant historic stage the apc for 20002011 for the asir for the age group 4049 years, however, was statistically significant (2.4%, cl = 1.3, 3.6%, p =.009) (data not tabulated). using distant summary stage, the apc (20002011) tended to decline with rising age that is, 6.2% (cl = 3.2, 9.3%) at age 2534, 5.0% (cl = 3.1, 8.9%) at 3539 years, 4.6% (cl = 2.8, 6.3%) at 4044 years, 3.0% (cl = 1.2, 4.8%) at 4549, 1.6% (cl = 0.1, 3.0%) at 5054 years, 2.1% (cl = 0.9, 3.2%) at 5559 years, and 1.4% or less at older 5-year age groups through 7579 years. within regional summary stage, the asir for age 2539 years for breast - adjusted ajcc stage iiic declined (apc = 4.5%, p <.001, table 1) (figure 2), with a smaller decline for iiib and no decline for iiia or iia - iib (table 1) ; the remainder were 144 coded as stage iii not otherwise specified (nos), 111 as other, and 475 as unknown (including 44 cases in 2000 and 46 in 2011) (data not tabulated). within regional summary stage, the asir for age 4049 years declined for breast - adjusted ajcc stage iiic (apc = 3.7%, p <.001, table 1) (figure 2), with a smaller decline for stage iiib (table 1) ; the remainder were 341 coded as iii - nos, 390 as other, and 1362 as unknown (including 88 cases in 2000 and 87 in 2011) (data not tabulated). using historic (instead of summary) regional stage, statistically significantly negative apcs in rates were also obtained for iiic at ages 2539 (total n = 1315 cases) and 4049 years (total n = 3278 cases). the asir for all invasive breast cancers did not increase over time for age 2539 years (apc = 0.1%, cl = 0.2, + 0.4) or for age 4049 years (apc = 0.1%, cl = 0.2, + 0.4). the age - specific rate for all invasive cancers for age 5054 years declined (apc = 1.1%, cl = 1.6, 0.6%, p =.001) but increased for distant summary stage (apc = 1.6%, cl = 0.1, 3.0%, p =.037) while declining for regional summary stage (apc = 2.0%, cl = 2.5, 1.5%, p <.001) ; the pattern was similar for age groups 5559, 6064, 6569, and 7074 years (data not shown). in analyses by er / pr markers, data for ages 2539 and 4049 were combined due to small samples of distant stage cancers within each age group. er+/pr+ comprised 83,375 (57%) of all 146,176 cancers with known stage, with 33,103 er/pr (23%), 11,540 (8%) er+/pr, 2,657 (2%) er/pr+, 13,012 (9%) unknown for both er and pr, and 2,489 (2%) all other categories combined (comprised mainly of er+/pr unknown, and er and/or pr borderline). the asir increased for distant stage but declined for regional stage in the er/pr subgroup, which also showed a decline for ajcc breast - adjusted iiic within regional stage that was large enough to account for the increase in the distant stage asir (table 2). the apc was negative for er+/pr cancers with breast - adjusted stage iiic within regional stage but numbers were small. for er+/pr+ cancers, however, asirs increased for regional and localized stages as well as for distant stage (table 2). stage - specific rates for unknown er status declined, especially from 2003 to 2004 (with the advent of a new staging system), but were too small to explain the increase in distant stage er+ rates or the absence of a post-2004 decline in breast - adjusted iiic regional stage er+ rates (data not tabulated). the 3-year rsr for women aged 2539 years at diagnosis increased substantially from 2000 - 01 to 2007 - 08 for both regional and distant summary stages, with only a slight increase for localized summary stage (table 3). the trends were similar for women diagnosed at age 4049 years (table 3). the increases in 3-year rsr for distant and regional stages at age 2549 years were greater for er/pr cancers than for er+/pr+ cancers (which had much higher rsr rates) (table 3). increases in distant summary stage asirs for ages 2539 and 4049 years were similar in magnitude to the declines for breast - adjusted ajcc iiic stage within regional summary stage (table 1, figures 1 and 2), suggesting the hypothesis of stage migration. the decline in the rates for regional summary stage for age 4049 years (and older ages) could have been affected by trends in breast cancer screening, but increases in mammography screening rates have not been reported since 2000. the greater increase in distant stage rates at ages < 50 years versus older ages could reflect the tendency toward more aggressive cancers at younger ages, with a greater opportunity for an impact of technical advances in detection of distant metastases (versus older ages). for lung cancer, a decline in diagnoses at stage iii and an increase for stage iv coincided with increased use of positron emission tomography (pet) recorded in cancer registries in california. for breast cancer, recent changes in staging include combining standard bone scans (scintigraphy) with mri and computed tomography (ct) with fluorodeoxyglucose- (fdg-) pet scans which reportedly have higher sensitivity and specificity than conventional imaging in detecting distant metastases [1517 ]. bone scans are sensitive in detecting osseous metastases, and mri or pet - ct also may be considered for some cases with abnormal radionuclide uptake. pet / ct examines the chest, bone, and abdomen in a single session, with a nonnegligible yield of evidence for occult distant metastases in patients with an initial diagnosis of clinical stage ii or (especially) iii cancer. fdg - pet was described in a 2001 report as likely to become more widely used for staging and in a 2003 report as rapidly proliferating (including insurance coverage by the centers for medicare and medicaid services in late 2002). fdg - pet is optional in some clinical guidelines but may be especially useful for detecting metastases in patients diagnosed clinically as ajcc stage iiic. an american society of clinical oncology report did not find evidence supporting use of pet, ct, and radionuclide bone scans for staging of patients with newly diagnosed early clinical stage (0, i or ii) breast cancer, but these techniques were considered appropriate for stage iii because of the higher likelihood of occult metastases in patients with clinical stage iii or with inflammatory cancer. a limitation of the seer database used, however, is lack of information on the specific techniques used in staging, as well as on the specific metastatic site(s) involved. seer - medicare linkages have examined trends in imaging modalities for breast cancer patients, but data are limited to diagnoses at age 65 + years ; other administrative databases may be useful for studies of younger patients. other study limitations include the use of a summary staging scheme that involves merging of codes from two different detailed staging systems for pre-2004 versus 2004 + diagnoses ; however, the trends continued after 2004 (figures 1 and 2). also, the database used did not include adjustment for delayed reporting of incident cases ; however, such adjustment had little or no impact on apcs for asirs in 19922010 for all invasive breast cancer in seer [5, 8 ]. the evidence for stage migration in er but not er+ cancers (table 2) may be related to the probability of distant metastases. er negative cancers, more common at younger ages, have distinct morphological features at diagnosis, including larger size and higher tumor grade, and the higher risk of recurrences in the early years after diagnosis suggests the presence of dormant micrometastases at diagnosis. hence, improvements over time in detection of clinically occult metastases at initial diagnosis would be more relevant to patients with er than er+ cancer at diagnosis. for er+ cancers at age 2549 years temporal increases in asirs were evident for each stage (although largest for distant stage), with only a slight decline for breast - adjusted stage iiic within regional stage (table 2). a previous study reported trends by er / pr status in young women only for distant stage cancers. analyses of seer data on overall (not stage - specific) incidence rates have shown increases for er+ versus declines for er breast cancers (including age 3049 years), and these divergent trends are unexplained ; the limitations of hormone - receptor data from cancer registries must be acknowledged, including missing data and temporal changes in sensitivity of tests. these findings on trends in stage - specific incidence rates within the er+/pr+ subgroup (table 2), if confirmed, suggest that the stage migration hypothesis is not the only potential explanation for the recent increase (20002011) in overall distant stage incidence rates at age < 50 years. certain risk factors differ by er / pr status in women < 50 years of age at diagnosis (e.g., nulliparity and older age at first childbirth may be stronger risk factors for er+/pr+ versus er/pr cancers) and these risk factors should be examined in future studies using other databases. three hypotheses involving temporal changes in potential risk factors for breast cancer have been proposed for the increase in distant stage cancer rates at age < 50 years, but the fact that cancer registries do not routinely collect data on risk factors [1, 4, 30 ] makes such hypotheses speculative. johnson. discussed these three hypotheses : folate supplementation of grain products which became mandatory in 1998 ; the introduction of vaccines preventing certain childhood viral infections that might conceivably have protected against cancer development in later life ; and increasing age at first pregnancy in us women. these hypotheses, however, did not appear to explain the specific age group (i.e., younger women) and stage category (i.e., metastatic) showing the increasing breast cancer incidence rates. advanced age at first full term pregnancy among us women has probably resulted in increasing numbers of pregnancy - associated breast cancers (i.e., variously defined as diagnosed during pregnancy and within either a year or a few years postpartum) that may have a tendency toward late stage at diagnosis. a response to this hypothesis, however, noted that distant stage incidence rates in seer showed the largest temporal increase (19922009) for women aged 2534 years, and the magnitude of the increase (apc) declined progressively with rising age [1, 4 ] as also found in the present study of rates for 20002011. in contrast, an increase in us women having their first childbirth at age 35 + (predominantly 3544) years had the largest impact on the rising average age at first childbirth in us women over time, and this trend was greater during the 1970s and 1980s than in later years. clearly, studies are needed using databases other than seer [1, 4 ]. linkages of cancer registries with birth databases, for example, could be used to examine temporal trends in pregnancy - associated breast cancers, as done in australia, but apparently studies have not reported trends for these breast cancers by stage at diagnosis and tumor markers. the temporal increase in 3-year rsr for age 2549 years within both regional and distant summary stages but not localized stage, especially within the er/pr subgroup (table 3), studies are needed, however, that include data on systemic therapies (endocrine therapy and chemotherapy) which were not included in the database because routinely collected seer data are incomplete. limited studies on temporal trends in survival among patients with an initial (de novo) diagnosis of metastatic breast cancer have included data on systemic therapies but suggest modest increases in survival that may be due in part to improvements in endocrine therapy and the recent introduction of trastuzumab for certain subgroups of patients. findings provide some support for the hypothesis of stage migration as one potential factor in the increase in distant stage breast cancer incidence rates at age < 50 years, mainly for er negative cancers. future studies should involve databases that can document the specific staging techniques used by year of diagnosis but also should consider alternative hypotheses involving temporal changes in risk factors for er+ cancers (especially those diagnosed at distant stage). studies should assess the impact of temporal advances in systemic therapies on trends in stage - specific survival rates for subgroups defined by tumor markers (er, pr, and her2) in addressing the hypothesis of the will rogers phenomenon.	background. unexplained increases have been reported in incidence rates for breast cancer diagnosed at distant stage in younger u.s. women, using data from the surveillance, epidemiology and end results (seer) program. methods. this report focused on recent seer trends (20002011) in age - standardized incidence rates of invasive breast cancer at ages 2539 and 4049 years and the hypothesis that stage migration may have resulted from advances in detecting distant metastases at diagnosis. results. increases in the rates for distant stage were roughly equal to decreases in the rates for the most advanced stage subgroups within regional stage ; this was evident for estrogen receptor (er) negative cancers, associated with poorer prognosis, but not for er positive cancers. the 3-year relative survival rate increased over time for distant stage (especially in the er positive subgroup) and regional stage but not for localized stage ; these trends do not contradict the stage - migration hypothesis. conclusions. findings provide some support for stage migration as one explanation for the recent increase in incidence of distant stage breast cancer, but additional studies are needed using other databases.
lymphedema, an incurable health condition, occurs when an impairment of the lymphatic system results in a lymphatic load that is greater than lymphatic transport capacity. the consequence is accumulation of protein - rich fluid in the interstitial space [1, 2 ]. over time, this high concentration of protein stimulates an inflammatory response leading to fibrotic changes in subcutaneous tissue and hypertrophy of adipose tissue. protein - rich lymph provides a fertile medium for bacterial growth. if untreated, lymphedema can progress, causing continued proliferation of fibrotic tissue, an increase in size of the affected limb, an increased risk for wounds [4, 5 ], life - threatening infections, loss of functional ability, and decreased quality of life [7, 8 ]. causes of secondary lymphedema include surgery for carcinoma that involves damage or dissection of lymph nodes, radiation therapy, trauma to lymph nodes or vessels, chronic infection, chronic venous insufficiency, tumors that obstruct the lymphatic flow, and/or a combination of the these conditions [6, 10, 11 ]. the return of fluids via the venous and lymphatic system is facilitated by muscle contractions of the legs. sitting for long periods of time applies pressure to capillaries and lymphatic vessels that also impedes flow. poor body trunk alignment negatively affects the normal respiratory pump for the lymphatic system and further reduces lymphatic flow. complete decongestive therapy (cdt) is the gold standard treatment for management of chronic lymphedema [1316 ]. the goal of cdt is to reduce swelling and tissue fibrosis, improve functional ability, prevent infections [13, 16 ], and stop the progression of the disease. it consists of manual lymphatic drainage (specialized massage) to facilitate central lymph flow and promote movement of the lymph out of the effective limb, multilayer short stretch compression bandaging of the extremity, diaphragmatic breathing and exercise to further enhance lymph flow, a low salt diet, and meticulous skin care [2, 9, 10, 13, 1618 ]. phase ii involves the continued maintenance of these labor - intensive activities for life by the patient. first, there are few certified lymphedema therapists and those available are primarily located in urban areas. most third - party payers limit the number of paid visits per year and require copayments. only 43% of people with disabilities earn wages for employment and 17% report they have no health care insurance. in order to address barriers faced by people with limited mobility in achieving access to treatment and management of chronic swelling one such alternative is the use of telerehabilitation to provide a remote self - management program. the application of telecommunications, remote sensing and operation, and computing technologies to the delivery of medical rehabilitation services at a distance [23, p. 115 ]. considered a subspecialty of telehealth these include face - to - face videoconferencing, telehomecare to coordinate in - home therapy and patient support, in - home patient telemonitoring, and teletherapy for exercise supervision by a remote therapist. selection of the most appropriate mode requires consideration of the needs of the patient population, equipment capabilities, available bandwidth, and clinician skills. tr has the potential to improve access to specialty care and provide services within the home environment, thereby meeting needs expressed by those with mobility limitations. studies have shown tr to be a valid and reliable modality for assessment of patients with mobility limitations. tr applications range from determining appropriate wheelchair seating to management of skin ulcers to providing complex treatment modalities [2528 ]. tr has been shown to increase functional mobility in patients after stroke, [29, 30 ] after knee arthroplasty, with cerebral palsy, and with multiple sclerosis. telecommunication has also been shown to be effective in providing remote self - management programs for chronic conditions, resulting in improved health care outcomes [3436 ]. patients have reported high levels of satisfaction with health care delivered by tr [31, 37, 38 ]. self - management is defined as an individual 's ability to manage the symptoms, treatment, physical and psychosocial consequences and lifestyle changes inherent in living with a chronic disease [39, p.563 ]. lorig and holman describe five core skills for self - management of chronic conditions. the first is problem solving, that is, the ability to identify both problems and possible solutions. decision - making is the second skill, that is, having the knowledge to make appropriate decisions in response to one 's current status. the third skill is developing the ability to find and utilize appropriate resources, that is, the internet, library, community resources, and support groups. the fourth skill is the ability to develop a true partnership with health care professionals. patients must work in conjunction with health care providers to appropriately evaluate and monitor their responses to therapy, to know when to ask for help, and determine when to modify their care in order to meet their needs. the fifth and final skill is the ability to implement and evaluate a plan of self - care. patients need to learn how to develop their own short - term measurable goals, evaluate the level of their success in meeting those goals, and determine when they need to modify or set new goals to achieve optimum self - management of their chronic condition. self - management theory is grounded in the expectation that increasing patients ' belief in their ability to manage their illness will result in positive change and better health care outcomes. the confidence a person feels about performing a particular activity, including confidence in overcoming the barriers to performing that behavior [42, p. 173 ]. according to albert bandura 's social cognitive theory of self - regulation, a person 's perception of their self - efficacy will impact their decisions in life, their goals, and how they respond to adversity. the more competent a person believes themselves to be, the higher the goals they will establish and the more determined they will be to overcome adversity in meeting those goals. research has shown a positive correlation between self - efficacy and health care outcomes [44, 45 ], and high self - efficacy is a predictor of the success of behavioral interventions [46, 47 ]. self - management programs have been shown to increase self - efficacy, improve health behaviors, improve healthcare outcomes [45, 48, 49 ], and decrease health care utilization [50, 51 ]. therefore, the intent of telerehabilitation : empowering you to manage and prevent swelling (tr - pumps) was to deliver a standardized educational program for self - management of chronic lower limb swelling, monitor health status, and assess the ability to perform required skills via real - time teleconferencing in a population of persons with limited mobility. in order to address barriers faced by people with limited mobility, the tr - pumps educational program was developed as a critical component of a clinical trial to evaluate the effects of a tr for immobile individuals with chronic edema / lymphedema of the lower limbs (nidrr grant in the clinical trial, tr was chosen as a novel delivery method for a modified lymphedema treatment protocol including advanced pneumatic compression. a review of the literature revealed no previous studies of self - management strategies for swelling in this high - risk population with limited mobility. based on current best practice for treatment of chronic edema / lymphedema, a draft version of the educational protocol was developed with input from three certified lymphedema therapists. based on current best practice for treatment of chronic edema / lymphedema, the script identified 10 learning goals central to self - management for chronic edema of the lower extremities (see table 1). the next challenge was to develop evidence - based content for each of these steps at a suitable reading level. studies have shown that patient educational materials often have a higher readability level than recommended by the american medical association (5th to 6th grade) [5256 ]. patient comprehension had been shown to increase when presented at a 5th - grade level. thus, after developing draft content for the educational program, the next step involved testing readability level. formulas frequently used to evaluate the grade level of a written text include the flesh reading ease scale, flesch - kincaid, gunning fog index, smog formula, and fry formula. mailloux,. performed a study to compare results obtained when using readability formulas with those obtained when using four software packages : corporate voice, grammatix iv, microsoft word for windows, and rightwriter. results showed significant differences between the several formulas, but no significant difference in the means of overall grade levels produced by the corporate voice, grammatrix iv, and rightwriter software programs. because of the variability in readability level that could result from these various tools, we followed the recommendations to use several formulas and software programs [58, 59 ]. rightwriter employs two readability formulas, the flesch - kincaid and the gunning fog index and also evaluates for active versus passive voice and jargon. next, the final revised scripts were used to develop videos for the tr protocol. a video was developed for each of the 10 steps with the length of each video ranging from 1.5 to 11 minutes. the videos illustrated specific skills such as decongestive exercises and donning and doffing of compression garments. each video was subdivided into individual skills or tasks to permit ease of locating and viewing during tr sessions. to establish content validity, the videos were viewed by eight additional board - certified lymphedema therapists who anonymously ranked each video on accuracy and completeness of the information as well as the clarity of the presentation. a 5-point likert scale (5 = strongly agree to 1 = strongly disagree) was used to determine the therapists ' level of agreement with descriptive statements about the content of each video (see table 2). when the tr program is operational, the videos will be available electronically via a portal that participants can access from their home computer. the videos will also be used during teleconferencing to teach the 10-step program and to reinforce teaching during review sessions. to supplement the videos, an educational booklet was developed using the same 10-step approach. the booklet was evaluated for suitability utilizing the suitability assessment of materials (sam) [60, 61 ]. suitability refers to the ability of the material to be understood and acceptable by the targeted patient population. the sam rates educational material using 6 criteria : (1) content, (2) literacy demand, (3) graphics, (4) layout and typography, (5) learning stimulation, and (6) motivation and cultural appropriateness. each factor is scored superior (2 points), adequate (1 point), or not suitable (0 point). scores are totaled for an overall rating expressed as a percentage (actual score divided by total possible score). educational material with a score of 0%39% is given a rating of inadequate suitability, 40%69% is given a rating of adequate suitability, and 70% and above is rated as superior suitability [60, 61 ]. the versatile and integrated system for telerehabilitation (visyter) software platform was chosen for use in this self - management program and tailored to specific educational needs. visyter was developed at the university of pittsburgh, school of health and rehabilitation sciences, department of rehabilitation science and technology with funding from the national institute for disability and rehabilitation research via the rehabilitation engineering and research center on telerehabilitation. it was selected because of its demonstrated effectiveness and flexibility in conducting remote face - to - face evaluations. visyter is a secure system that provides users the ability for real - time teleconferencing with multiple remote camera control, sharing of educational videos through microsoft windows media player, and the ability to archive teleconferencing sessions and still images. minimum computer requirements include pentium dual core processor 2 ghz with 2 gb of ram and an nvidia geforce 4 series graphic card. visyter requires an internet connection with an upstream and downstream speed of approximately 1.5 mbps for medium quality video. the use of the visyter system was tailored for use in the delivery of educational materials by loading the videos onto the system and performing laboratory testing of all capabilities prior to actual participant use. the first step when used in the home involves downloading the software onto a participant 's home computer. if no built - in web cam is available, a logitech hd c910 web cam will be used for face - to - face videoconferencing. a second camera, the logitech orbit af, can be connected to the participant 's computer for use in skin and skill assessments. the logitech orbit af will provide clinicians with the ability to remotely control the camera 's movement and zoom capabilities. the clinician at the remote computer site will use a logitech hd c910 web cam and a logitech usb headset. a personal user i d and password will be assigned to each participant to enable them to log on to visyter. each participant will also be assigned his or her own virtual clinic room. visyter 's virtual clinic rooms are housed on the server and can only be accessed by authorized users. an assigned room administrator will determine the user 's access and specific access capabilities which might vary depending upon their role. training will be provided to participants on how to use the visyter software to connect to the remote clinician (see figure 1). to implement the self - management program, the participant and clinician will connect to a visyter virtual clinic room via the portal in what is termed the lymphedema venue for each teleconferencing session. during the initial session a plan of action will be developed in a collaborative effort between the participant and clinician. the participant 's comprehension on lymphedema self - management will be evaluated, and any barriers that could negatively affect the participant 's ability to perform the 10 steps of the self - management program will be identified (see figure 2). real - time interactive education and evaluation sessions will occur a minimum of once per week for six weeks. the frequency of sessions will be determined by mutual agreement based on a joint review of the participant 's current knowledge of their condition and self - management skills. educational videos will be used to train the participants using the media sharing capabilities of the visyter software. comprehension and retention of the educational material will be evaluated through participant verbal recall and performance of return demonstrations. tr interventions can be recorded and saved in an archived data base within the server. the final step involved uploading the videos to the lymphedema venue and the testing of the visyter software 's performance in the delivery of the educational protocol within a laboratory setting. to conduct this evaluation, we transmitted from our virtual clinic workstation to distant rooms to test transmission in a simulated home setting. bandwidth was tested to determine the speed necessary for providing the self - management program. when evaluated for readability utilizing the computer software rightwriter (elite minds, inc.), flesh kincaid results indicated a readability level of a 4.01 grade level. the average of these two formulas resulted in an overall readability level below the 5th - grade level. a second evaluation using the microsoft word for windows readability program resulted in a flesh kincaid readability level at a 3.4-grade level. when content validity of the educational videos was determined by eight experienced, board - certified lymphedema therapists, the mean score was 4.5 0.35 with a range of 4.14.9 (see table 3). the supplemental educational booklet, developed using the same script as the videos, was evaluated for suitability utilizing the suitability assessment of materials. a score of 77% the video file format, quicktime format, used for the videos was not compatible with the visyter software platform. the video file format was therefore changed to the windows media video format to allow sharing of the videos during video conferencing. the ability for participants to access and download videos from the lymphedema portal was verified. transmission speed was determined using two cameras plus audio upload on the participants ' side and one camera and media sharing and audio download on the clinician 's side. it was determined that a medium - quality video was sufficient for the face to - face interaction. however, high video quality was required for the remote camera for visualization during skin assessments. results of the laboratory testing determined that speeds of 1220 kbps upload and download were the minimum requirements and the speed of 1620 + kbps upload and download provided optimal teleconferencing audio and visual quality. the study 's researchers ' collaborative efforts resulted in the development of a comprehensive self - management program for patients with chronic lymphedema with appropriate readability and suitability scores that was highly rated by external evaluators in regard to its content validity and selection of a software platform with the potential to provide in - home teleconferencing and assessment capabilities. healthy people 2010 defines health literacy as the degree to which individuals have the capacity to obtain, process, and understand basic health information and services needed to make appropriate health decisions. the 2003 national assessment of adult literacy (naal) survey results showed that only 12% of adults in the usa had proficient health literacy. inadequate health literacy has been associated with a decreased ability to communicate with health care providers, decreased knowledge and self - management skills of chronic conditions [6870 ], and poorer health care outcomes [71, 72 ]. in order to address health literacy disparity, health care professionals need to provide education materials that are appropriate for all health literacy levels. adult readers of all reading levels prefer and learn better with easy - to - read instructions. self - management programs that are tailored for patients with inadequate health literacy have been shown to overcome learning barriers, increase self - management skills, and reduce the rate of hospitalization and death [49, 73 ]. a concern, as shown in our study, is that different readability formulas can produce discrepancies in grade - level results with scores deviating as high as 41%. consequently, we advise using several formulas and averaging the results [58, 59 ]. our study produced results using several tools that ranged from 3.4 to 5.61, supporting findings of prior studies [58, 59 ]. to obtain additional information on readability formulas, the website for the plain and simple project from the iowa department of public health this website provides information on commonly used readability formulas and access to readability calculating software at no cost. readability level is not the only factor that determines the effectiveness of written material when attempting to address health literacy disparity [55, 61, 74 ]. suitability of the material for the targeted population also needs to be evaluated. to perform this assessment, we chose the suitability assessment of materials (sam) developed by cecila doak and jane root. sam was validated in a study enrolling 172 health care professionals from various countries and has been widely used to evaluate educational material related to a variety of diseases [56, 7578 ]. additional information on sam may be found in teaching patients with low literacy skills (2nd ed) by doak.. this text may be downloaded at no cost from http://www.hsph.harvard.edu / healthliteracy / resources/. with advances in information technology, telecommunications offers health care providers the opportunity to utilize new approaches to health care delivery. the current health care delivery system is focused on acute care. with the aging population and the increase in chronic conditions chronic conditions result in seven out of ten deaths in the usa. as of 2005 the increase in the prevalence of chronic conditions is contributed to the increasing age of the population and an increase in risk factors such as obesity which predispose chronic illness. the occurrence of people having multiple chronic conditions increases with age, with 25% of medicare recipients having at least four chronic conditions. this rise in chronic conditions is creating an increased financial burden on the health care industry with costs associated with the management of these chronic diseases accounting for 75% of all health care costs. a redesigning of the current health care system to provide a continuum of health care to people with chronic conditions is necessary. recommendations for redesign of health care delivery systems by the institute of medicine (iom) include that patients be informed decision makers in their health care, health care should be customized according to patients ' needs and values, and health care should be readily available and provided not just by face - to - face visits but also by internet or telephone. in 2007, only 13.6% of people reported using the internet as a source of communication with their health care provider. the utilization of tr to provide self - management programs for chronic conditions can be a potential resource in facilitating a continuum of care that is patient - centered and focused on providing patients with the knowledge and skills to enable them be actively involved in the management of their chronic conditions. the evidence - based educational materials developed as part of the self - management program for lower limb chronic swelling / lymphedema in persons with limited mobility were found to be valid, accurate, and complete with high ratings of clarity. the readability and suitability ratings indicated that the materials are appropriate for various levels of health literacy in the study population. the self - management program described may be applicable to address other chronic conditions such as diabetes, heart failure, and chronic obstruction pulmonary disease. we believe tr is a viable method of providing a home - based self - management program on lower limb chronic swelling / lymphedema in people with mobility limitations and can decrease the burden associated with lifelong management of this debilitating condition.	this paper describes design and development of a self - management program, delivered by telerehabilitation (tr), to address the problem of chronic lower limb swelling in persons with limited mobility. the 18.6 million persons with limited mobility in the usa are at increased risk for chronic lower limb swelling and related secondary complications, including cellulitis and skin ulcers. over time, chronic swelling often progresses to lymphedema, an incurable condition requiring lifelong care. without successful self - management, lymphedema and its related complications inevitably worsen. access and adherence to appropriate treatment are challenging for persons with limited mobility. program development involved a structured process to establish content validity (videos and manuals), readability, suitability, and selection of a tr platform to deliver the educational program. our goal was to develop a program that would engage patients in self - management skills. the tr software platform chosen, versatile and integrated system for telerehabilitation (visyter) was designed to facilitate face - to - face delivery of an interactive home - based self - management program via the internet in real time. results demonstrated validity of the educational program and ease of use with tr. future plans are to evaluate ability of this approach to promote self - management skills, home monitoring, and improved management of persons with lymphedema and limited mobility.
high - throughput genomics technology has made possible the era of precision medicine, an approach to healthcare that involves integrating a patient 's genetic, lifestyle, and environmental data and then comparing these data to similar data collected for thousands of other individuals to predict illness and determine the best treatments. precision medicine aims to tailor healthcare to patients by using clinically actionable genomic mutations to guide preventive interventions and clinical decision making. in the past 25 years in addition, more than 80 million genetic variants have been uncovered in the human genome [3, 4 ]. clinical pharmacology research using electronic health record (ehr) systems has recently become feasible as ehrs have been implemented more widely. also, studies such as the electronic medical records and genomics - pharmacogenomics (emerge - pgx) project, gani_med project, scan - b initiative, and cancer 2015 study have been designed to assess the value of next - generation sequencing (ngs) in healthcare. combining the functional characterization of identified genomic mutations with comprehensive clinical data available in ehrs has the potential to provide compelling evidence to implicate novel disease- and/or drug - associated mutations in phenotypically well - characterized patients. ngs technological advances in clinical genome sequencing and adoption of ehrs will pave the way to create patient - centered precision medicine in clinical practice. ngs technology is an essential component supporting genomic medicine but the volume and complexity of the data pose challenges for its use in clinical practice. sequencing a single human genome generates megabytes of data ; therefore, investment in a bioinformatics infrastructure is required to implement ngs in clinical practice. gartner defines big data as high - volume, high - velocity, and/or high - variety information assets that demand cost - effective, innovative forms of information processing that enable enhanced insight, decision making, and process automation (http://www.gartner.com/it-glossary/big-data/) while others define it as the 5 vs, which are volume, velocity, variety, verification / veracity, and value. in this review, we describe how one source of big data, in the form of genomic data generated by ngs, is processed and being used to improve healthcare and clinical research. we give an overview of ngs technologies, bioinformatics processing of ngs data, bioinformatics approaches for identifying clinically actionable variants in sequence data, guidelines for maintaining high standards when generating genomic data for clinical use, bioinformatics infrastructures of studies aimed at implementing precision medicine, and methods for ensuring the security of genomic data. ngs includes dna sequencing and rna sequencing (rna - seq) (table 1). dna sequencing approaches include (1) whole - genome sequencing (wgs), (2) whole exome sequencing (wes) of the coding regions of all known genes, and (3) targeted sequencing of genomic regions or genes implicated in a disease. in addition, rna - seq is used in transcriptome profiling to sequence all rna transcripts (the transcriptome) in cells at a given time point to measure gene expression, targeted sequencing for measuring the expression of transcripts encoded by a specific genomic region, and sequencing of small rnas. targeted dna sequencing is already being applied in some areas of clinical practice such as pharmacogenomics (e.g., the emerge - pgx project), while wgs, and particularly wes, is emerging into the clinic for the evaluation of developmental brain disorders such as intellectual disability, autism, and seizures. with continuing decreases in the costs of sequencing, it is expected that the use of wes / wgs and rna sequencing in healthcare will become more common. ngs involves breaking dna into fragments and determining the order of the nucleotide bases in each fragment. because the distribution of reads across the genome is uneven (due to biases in sample preparation, sequencing - platform chemistry, and bioinformatics methods for genomic alignment and assembly of the reads) [17, 18 ], some bases are present in more reads and others in fewer reads. read depth refers to the number of reads that contain a base ; for example, a 10x read depth means that each base was present in an average of 10 reads. for rna - seq, read depth is more often stated in terms of the number of millions of reads. variant calling is more reliable with increasing read depth, and a greater depth is advantageous for detecting rare genetic variants with confidence. the read depth needed can depend on multiple factors including guidelines from the scientific community, the presence of repetitive genomic regions (these are more difficult to sequence), the error rate of the sequencing platform, the algorithm used for assembling reads into a genomic sequence, and gene expression level (for rna - seq). read depth recommendations from the scientific literature include 100x for heterozygous single nucleotide variant detection by wes, 35x for genotype detection by wgs, 60x for detecting insertions / deletions (indels) by wgs, 1025 million reads for differential gene expression profiling by rna - seq, and 50100 million reads for allele - specific gene expression by rna - seq. commercially available sequencing platforms use a variety of methods to generate sequence data (table 2). sequencing - by - synthesis (miseq and hiseq 4000 platforms) is the enzymatic synthesis of a dna strand complementary to a template dna strand. for ngs, the procedure involves dna fragmentation, creation of a dna library by attaching adaptors to each fragment, amplification of the fragments on a solid surface, synthesis of a dna strand complementary to each template dna fragment (using dna polymerase), and fluorescence imaging to identify each newly incorporated nucleotide on the synthesized dna strands. single - molecule, real - time sequencing (pacbio rs ii platform) is a modification of sequencing - by - synthesis. in this approach, each dna polymerase molecule is immobilized at the bottom of a nanoscale well called a zero - mode waveguide. a laser light illuminates the well from below and emits a pulse of light when a fluorescent - labelled nucleotide is added to the nascent dna strand by dna polymerase (bound to a template dna fragment), allowing detection of the incorporated nucleotide. semiconductor sequencing (ion s5 platform) is another modification of sequencing - by - synthesis that uses a semiconductor - sensing device to detect the addition of unmodified nucleotides during dna synthesis. pyrosequencing (454 gs flx titanium xl+ platform) is a technique that couples sequencing - by - synthesis to a chemiluminescent enzyme (luciferase) reaction that generates visible light allowing detection of nucleotide incorporation during dna synthesis. oligonucleotide ligation (solid 5500xl w platform) involves ligating oligonucleotide probes to template dna strands to determine the sequence of the template. sequencing by dideoxynucleotide (ddntp) chain termination (sanger genetic analyzer 3500xl platform), often called sanger sequencing, involves incorporation of ddntps by dna polymerase during dna synthesis. fluorescence labelling allows identification of each of the ddntps added to the synthesized dna strands. the miseq, pacbio rsii, and ion s5 sequencers were designed for targeted sequencing and sequencing small genomes (e.g., the genomes of microorganisms) whereas the hiseq 4000, 454 gs flx titanium xl+, and solid 5500xl w can be used for wes and wgs of human genomes (table 2). the instruments most often used in precision medicine programs performing wes / wgs of the human genome in clinical care settings are the hiseq sequencers that have the advantages of a relatively high sample throughput and a low sequencing error rate. however, all of the ngs technologies are being applied to health research [3136 ]. the single - molecule, real - time sequencing technology generates the longest reads (table 2), making the pacbio rs ii instrument well suited for de novo sequencing (by assembly of reads into long contiguous sequences) of the genomes of organisms that do not have a reference genome (e.g., many microbial genomes). the sequencers that cost the least are the bench - top ion s5 and miseq instruments (table 2), and for many laboratories it would be feasible to buy more than one of these instruments. while they can be used to perform wes of the human genome, the sequencing cost per base would be much higher compared with wes on the hiseq instrument. the hiseq 4000, 454 gs flx titanium xl+, and solid 5500xl w instruments are more expensive, costing between $ 500,000 and $ 900,000 each, but they are capable of sequencing several human genomes or exomes within a few days to one week. large laboratories that expect to assay many samples routinely by wes / wgs might consider it cost - efficient to buy more than one of these sequencers to meet assay demand. all six next - generation sequencers in table 2 produce at least 0.5 gigabases per run and most output several gigabases per run, giving an idea of the volume of data that needs to be considered when planning for the data storage and processing capabilities of bioinformatics pipelines to be used in clinical laboratories that perform ngs assays. with continued refinement in technology, many ngs platforms have demonstrated a low rate of errors in variant detection (1/1000 to 1/50 bases depending on the instrument and read depth) [38, 39 ]. previous reports have compared sequencing accuracy among the technologies presented in table 2. in a comparison of the hiseq 2000 and solid 5500xl platforms for wgs of human dna samples, the hiseq 2000 had higher sensitivity for calling single nucleotide variants but the solid 5500xl had a lower false positive rate. when the ion pgm, miseq, and pacbio rs sequencers were compared by sequencing four microbial genomes, the pacbio rs had the highest sequencing error rate, and ion pgm data had slightly more variant calls and a higher false positive rate than miseq data. compared with other technologies, the 454 and pacbio rs platforms have demonstrated the most unbiased read distribution in genomic regions with a high gc content [41, 42 ], an important factor affecting the probability of calling a variant in these regions. however, the 454 platform has a tendency to assess the length of homopolymer tracts incorrectly, resulting in false positive single nucleotide variant calls in these tracts. in comparison with ngs technologies, sanger sequencing is widely considered the most accurate sequencing method (error rate as low as 1 in 10,000 bases) and remains the gold standard. genetic variants detected using ngs should always be validated by an independent method if the variants are relevant to clinical care or are associated with health outcomes in research studies. other methods of validation, especially for common single nucleotide variants, indels, or structural variants, include polymerase chain reaction (pcr) and genotype / copy number variant arrays. data files generated by next - generation sequencers contain raw sequence reads, each with a unique identifier, and their quality scores. sequence reads need to be evaluated for data quality and to exceed minimum quality thresholds, before being processed for read alignment, variant calling, and variant annotation [46, 47 ] in a bioinformatics pipeline (figure 1). read alignment involves aligning the sequence reads to a reference sequence [48, 49 ] of the human genome to allow comparison of sequence data from the patient sample with the reference sequence. reads with an uncertain alignment location alignment allows a number of quality control measures to be determined, for example, the percentage of all reads that align to a reference sequence, the percentage of unique reads that align to a reference sequence, and the number of reads that align at a specific locus (read depth). these measures influence the reliability of variant calling, the next step in a ngs bioinformatics pipeline. variant calling tools, such as samtools, gatk, and others, are used to identify differences in sequence between the patient sample and a reference. these differences can include changes of one nucleotide (single nucleotide variants, snvs), a few nucleotides (small indels), or larger regions, such as copy number variants (cnvs) and other structural variations (svs). these software programs allow users to specify different parameters to adjust for minimizing false positive and false negative variant calls. variant annotation depends on biological knowledge and provides information on the known or likely impact of variants on gene and protein function [46, 47 ]. to produce a patient report, annotated variants are interpreted in a disease - specific context and are often classified based on their known or expected clinical impact. for instance, the clinvar variant database, released on may 4, 2015 (http://www.ncbi.nlm.nih.gov/clinvar/), by the national center for biotechnology information (ncbi), contained more than 110,000 unique genetic variants having clinical interpretations. in clinical care, the american college of medical genetics and genomics (acmg) has recommended the identification and return of incidental findings (ifs) for clinically significant variants in a set of 56 highly medically actionable genes associated with 24 inherited conditions [53, 54 ]. also, the national heart, lung, and blood institute (nhlbi) exome sequencing project (esp) has reported actionable exomic ifs from 112 genes in 6,503 participants. the 112 genes included 52 acmg genes and an additional 60 actionable genes. to infer biological insights from massive amounts of ngs data and comprehensive clinical data in a short period of time, we have developed an analysis pipeline within a software framework called seqhbase (figure 2) to quickly identify disease- or drug - associated genetic variants. there were more than 27 million unique variants among 300 patients with wgs data that we analyzed using seqhbase. likely pathogenic by clinvar, we compiled a list of low frequency or rare variants that are possibly damaging, and novel loss - of - function (lof) variants that are absent in the clinvar database, to allow clinical geneticists to review the potential pathogenicity of these variants further. as seqhbase is a big data - based toolset, it takes only a few minutes to analyze wgs data for 300 individuals and to generate a candidate list of actionable genomic variants. seqhbase is one of several, freely accessible bioinformatics tools for prioritization of variants from wes / wgs data. reported a web - based tool for identifying clinically actionable variants in the 56 acmg genes, and zhou. developed a variant characterization framework for targeted analysis of relevant reads from high - throughput sequencing data. other tools include phive which prioritizes variants in genes responsible for mouse model phenotypes that are similar to the phenotypes of patients being tested by wes and ova that performs prioritization by integrating data on human and model organism phenotypes, gene function, and known biological pathways. identifying clinically actionable variants remains a challenge despite the availability of variant prioritization tools. a workshop convened by the national human genome research institute and the wellcome trust identified limited evidence of the clinical significance of genetic variants and the lack of a comprehensive database of genetic variant - phenotype associations as barriers to the implementation of precision medicine. it was noted that existing catalogs of clinically actionable variants are not standardized, are maintained by different entities (e.g., laboratories or government organizations), and are not designed to interact with ehrs. to speed the incorporation of genomic data into clinical care, the workshop advocated for a dynamic, centralized database that can be updated with available, reliable evidence on variant pathogenicity. the clinical genome resource (clingen) program, developed in response to this recommendation, provides resources (e.g., clinvar) to aid the understanding of genetic variation and the use of genetic variation in clinical practice. best practices for quality control in the bioinformatics processing of ngs data have been reported in the scientific literature [45, 62 ]. quality control metrics include total reads, ratio of unique reads to total reads, proportion of bases covered at a specified minimum read depth, mean read depth, raw sequence error rates, ratio of transitions (pyrimidine - to - pyrimidine or purine - to - purine mutation) to transversions (pyrimidine - to - purine mutation or vice versa), missingness (proportion of genomic sites at which a variant could not be called), homozygosity, heterozygosity, and distribution of known and novel variants relative to those contained in the dbsnp database. for targeted or exome sequencing, an additional metric is capture efficiency, the percentage of targeted bases that are covered by one or more reads. these metrics can be calculated using the plink / seq (https://atgu.mgh.harvard.edu/plinkseq/) or vcftools software programs that can readily be incorporated into a bioinformatics pipeline, allowing assessment of ngs data quality in both clinical and research settings. values for the first four metrics depend on the type of sequencing assay performed but, in general, higher values indicate better data quality. the raw sequence error rates and missingness should be as low as possible. the ratio of transitions to transversions (ti / tv ratio) is expected to be ~2.02.1 for wgs data overall, 2.10 for known variants in wgs data, 2.07 for new variants in wgs data, ~3.03.3 for wes data overall, 3.5 for known variants in wes data, and 3.0 for new variants in wes data. homozygosity and heterozygosity depend on the type of population : heterozygosity is expected to be more frequent in admixed populations and homozygosity to be more frequent in inbred populations. it is estimated that each person has ~200 novel snps not present in the dbsnp database ; therefore, a value that is much larger than 200 is indicative of a high false positive rate of single nucleotide variant calls. there are no existing, quality control standards that relate to generating clinical interpretations for genetic variants. however, substantial efforts are being made to identify clinically actionable pharmacogenetics variants, and it is instructive to review the approach being used. the coriell personalized medicine collaborative, the clinical pharmacogenetics implementation consortium, the pharmacogenetics working group established by the royal dutch association for the advancement of pharmacy, and the evaluation of genomic applications in practice and prevention initiative sponsored by the centers for disease control and prevention have independently developed similar processes for selecting candidate drugs, reviewing the published literature to identify drug - gene associations, scoring the evidence supporting associations between genetic variants and drug response, and interpreting the evidence to provide treatment guidelines. this approach involving review and interpretation of the scientific literature by an expert committee can be considered the gold standard for determining whether a variant is clinically relevant or actionable but also can be expensive and time - consuming. it will not be feasible for experts, either individually or in committees, to review the large number of genetic variants identified in ngs data. tools such as polyphen-2, vep, mutationassessor, and sift can be used to predict variant effects. however, because these tools are sometimes inaccurate and often differ in their predictions for the same variant [75, 76 ], there will likely be many variants that have no clear predicted, clinical interpretation. furthermore, an additional problem is that the predictions made by these tools are not specific to a given gene or class of genes. for example, many genes would tolerate the substitution of glycine for another amino acid, but, in a gene that encodes a collagen fibril, loss of a glycine would impair fiber assembly resulting in a significant phenotype. new methods that are both accurate and efficient need to be developed for predicting the pathogenicity of genetic variants found by ngs. a limitation of using the clinvar database to identify clinically actionable genomic mutations is that a genetic variant in clinvar can be described as having a different potential for pathogenicity by different submitters. for example, of the 12,895 unique variants with multiple clinical interpretations that have been submitted by more than one laboratory, 2,229 (17%) were interpreted differently by different submitters, with one- or two - step differences between any of three major levels : pathogenic or likely pathogenic, differences in interpreting the pathogenicity of variants have also been reported by the clinical sequencing exploratory research (cser) program, an initiative designed to trial the use of wes / wgs data in clinical practice. the program compared cser laboratories on their clinical interpretations of 98 variants and observed one - step differences in interpretation for 42% of variants and two - step or larger differences for 20% of variants. to estimate and interpret the pathogenicity of new variants that are absent in the clinvar database and to achieve some level of consensus on the clinical interpretations of variants, evaluations from experts, such as clinical geneticists, and/or further biological functional studies bioinformatics pipelines are constituted of multiple databases and software programs to convert raw sequence reads to a list of clinically actionable or candidate variants. to promote the transparency of pipeline processes and data flow, the acmg, the college of american pathologists (cap), weiss., and gargis. have offered guidelines for ngs and the operation of bioinformatics pipelines in a clinical setting. the recommendations of these guidelines include thorough documentation of the pipeline and of deviations from pipeline standard operating procedures (e.g., software updates, changes in software settings, operator error, hardware failure, or other failures in the pipeline), validation of the pipeline, development of a pipeline quality management program, and implementation of policies to ensure secure data storage and data transfer. the recommendations for written patient reports state that gene names should be provided according to hugo gene nomenclature committee nomenclature (http://www.genenames.org/) and genetic variants according to the nomenclature guidelines of the human genome variation society (http://www.hgvs.org/). laboratories should follow the recommendations of the acmg [53, 54 ] for interpreting the clinical significance of variants. patient reports should also include the genome build and reference sequence used for variant detection, the genomic coordinates of identified variants, and mention of whether clinically significant variants were confirmed by an independent assay method. laboratories should also report genetic variant data (gene name, zygosity, cdna nomenclature, protein nomenclatures, exon number, and clinical significance) in a structured format according to hl7 standards (hl7 version 2 implementation guide : clinical genomics, http://www.hl7.org/implement/standards/). this is aimed at providing sufficient data to facilitate both clinical decision support and the display of genetic information in the ehr. challenges to implementing these guidelines include the constantly evolving nature of ngs technologies, bioinformatics tools (necessitating frequent updates of the bioinformatics pipeline), clinical interpretation (necessitating frequent updates of genetic variant annotation), the limited capacity of health care organizations / laboratories to store the voluminous data generated by ngs platforms (data storage options considered must ensure security of the stored genetic data), and the need for personnel trained in bioinformatics and statistics to develop a bioinformatics pipeline and to process and analyze ngs data. however, these challenges are not insurmountable, and it is likely that health care institutions that want to use ngs data in clinical care will attempt to overcome these hurdles and follow the guidelines. clinical laboratories that develop clinical laboratory improvement amendments- (clia-) certified ngs assays based on cap standards can seek accreditation from cap, an agency that can provide accreditation on behalf of the clia program. the accreditation process involves a site visit inspection by a peer institution / laboratory once every two years and a self - inspection in alternate years (figure 3). for the self - inspection, cap sends the laboratory a list of items, specific to the ngs assay, that need to be checked by the laboratory. completing the self - inspection for a ngs assay would allow the laboratory to determine how closely it adheres to the cap standards for the assay. for the site visit, the inspectors would observe a sample being taken through the entire assay procedure. any deficiencies found must be corrected, and cap should be provided with a report describing the corrective measures within 30 days after the site visit. through the mechanism of cap accreditation, the laboratory would inform external entities that it provides a clia - certified assay that meets cap standards for the assay. welch. have proposed an infrastructure comprised of independent, interacting databases for processing and storing genomic data in a clinical setting (figure 4). these databases include a full variant database to store all genetic variants for each patient, a clinical genome database to store only the clinically relevant variants for each patient, a clinical decision support knowledge base that integrates decision rules and guidelines for providing care (e.g., drug dosing rules) with genomic and clinical information, and a genome variant knowledge base to store known genetic variants and their clinical interpretations. clinvar is an example of a freely accessible genome variant knowledge base but clinical laboratories will likely also maintain their own internal genome variant knowledge bases (based on the genomic data of patients they test). the proposed infrastructure can potentially accommodate large amounts of genomic data because it involves warehousing the data external to ehrs. however, it would require investment in data storage capacity external to the ehr database system and the development and maintenance of interfaces between the genomic databases and the ehr database system. cloud computing, involving the use of remote servers to store and access data and software programs (figure 5), has also been proposed for genomic data processing and storage. cloud computing providers offer infrastructure, software, and programming platforms as services and incur the costs for developing and maintaining these services. because clients pay only for the services they use, cloud computing offers an economical approach to genomic data management compared with investment in the creation and maintenance of databases by healthcare entities to house genomic data. hadoop is an open - source programming platform that is already being used to develop software for genomic data processing in a cloud computing environment. hadoop breaks data into small fragments, distributes the fragments over many computers, distributes computation to where the fragments are located so all fragments are processed in parallel, and aggregates the results at the end of computation. examples of open - source software developed on the hadoop platform for processing genomic data are crossbow, gatk, and hadoop - bam. challenges to the use of cloud computing for genomic data include the long data transfer times for uploading ngs data files to the cloud, the perceived lack of data security in the cloud computing environment, and the need for advanced programming skills in java to develop software using hadoop. the separation of genomic and clinical data repositories facilitates the use of genomic data in research as well as clinical care. to engage in collaborative research, infrastructure for sharing genomic data with researchers internal and external to the institution that generated the data the global alliance for genomics and health (ga4gh), an international coalition of healthcare and academic centers that aims to advance the sharing of genomic and clinical data to improve health, has launched efforts to create such an infrastructure. the group has developed an application programming interface (api) to support the sharing of data on dna sequences and genomic variants across organizations and bioinformatics pipelines. ga4gh is also developing apis for other types of genomics - related data including variant annotations, rna - seq, and genotype - phenotype associations. these tools will allow genomic data from multiple organizations to be analyzed in aggregate, increasing statistical power to identify genetic variants that have a clinical effect. genomic data is protected health information ; therefore, its privacy and confidentiality should be maintained similarly to other protected health information. safeguards include the use of data encryption, password protected files, secure data transfer, audits of data transfer processes, and the implementation of institutional policies against data breeches and malicious use of the data. the use of cloud computing presents added security concerns because data storage and/or processing services are provided by an entity external to the healthcare organization. measures that the cloud service provider can take to address these concerns include logging access to the data, creating a role - based access system (level of access depends on the type of user), complying with third - party certifications for information security (e.g., the international organization for standardization / international electrotechnical commission 21001:2013 information security standard http://www.iso.org/iso/home/standards/management-standards/iso27001.htm/), protecting the security of the computer network, using notification alarms to track when changes are made to stored data, and guaranteeing the complete removal of data from its servers once the cloud storage service is no longer being used. a survey of six health centers participating in the cser consortium has described how the centers have integrated genomic data into the ehr. five centers performed sequencing at their own laboratories, and one site used an external laboratory but confirmed variants on - site using sanger sequencing. each center created a local bioinformatics pipeline for variant annotation, but all used multiple online catalogs of variants (e.g., clinvar and dbsnp) for annotation. each site also built and maintained its own genome variant knowledge base (based on genetic variants ascertained in patients at the site) and created tools to use data from this internal database in variant annotation. additionally, sites used manual or semiautomated methods to search the scientific literature or online gene - specific databases to determine the clinical significance of variants. ehr software was obtained from commercial providers at four centers and was locally developed at two centers. the laboratories at all six centers generated a human - readable pdf document, containing genetic results, that was designed to be incorporated into the ehr. the two sites with custom - built ehrs, and one site with commercial ehr software, also reported results in a structured, machine - readable format. active clinical decision support (automated alerts through the ehr) for genetic variants was available at two of the centers. only one center had an automated system for sending alerts to physicians when new genomic findings resulted in the reclassification of a genetic variant 's clinical significance (e.g., a variant initially classified as being of unknown significance was subsequently discovered to have serious clinical consequences). sites in the emerge network are also engaged in pilot efforts to incorporate genomic data, particularly data relevant to pharmacogenetics, into ehrs. at one emerge site, separate data repositories were created for unprocessed sequence / genotype data and for variants of known pharmacogenetics relevance. software that applied approved pharmacogenetics - medication guidelines to patients ' genetic data was used to determine a patient 's pharmacogenetics phenotype (e.g., predicted poor metabolizer of a specific drug), and the phenotype data were stored as a laboratory result in the ehr. the site developed software that extended its existing, custom - built medication alert system, enabling the system to check for a relevant pharmacogenetics laboratory result when a physician prescribes a pharmacogenetics - related drug. if a patient has a pharmacogenetics phenotype, the system sends an alert to the physician and suggests alternative treatment. another emerge site reported developing similar infrastructure that supported storage of all genetic variants separately from variants with pharmacogenetics relevance, the translation of genetic data into genotype - phenotype associations, and active clinical decision support for physicians prescribing pharmacogenetics - related drugs. changes in the clinical interpretation of genetic variants (based on new knowledge) that resulted in phenotype reassignment prompted the site to update its genotype - phenotype translation database to reflect the newly determined genotype - phenotype relationships. because this database was linked to the site 's clinical information system, pharmacogenetics data in the ehr was automatically updated. the cser and emerge pharmacogenetics programs are in progress and have not yet reported on improvements in patient outcomes as a result of incorporating genomic data into clinical care. each site in these programs had its own customized bioinformatics pipeline, laboratory information management system, clinical decision support capabilities, and electronic health records that would not be generalizable to other sites. this presents a challenge as a more uniform infrastructure for genomic data processing could be adopted more widely and easily. based on their experiences, sites in both programs identified a number of factors that need to be addressed to facilitate the integration of genomic data into healthcare : (1) the requirement for active clinical decision support ; (2) tools to examine and interpret sequence variants, especially new, undefined variants ; (3) approaches to update changes in the clinical significance of sequence variants over time ; (4) giving healthcare providers access to consultants trained in genetics ; (5) infrastructure for secure and reliable delivery of results to external healthcare providers ; and (6) methods for explaining genomic information to patients. the ideal, preventive model of patient care is to understand as much about a patient as possible, as early in his / her life as possible, to detect warning signs of serious but preventable illness at an early stage so that preemptive health interventions can be simpler and/or less expensive than treatment implemented at a later stage. also, knowing a person 's individual characteristics is often relevant for providing effective treatment against disease because patients can respond differently to the same treatment. by facilitating precision medicine, advances in genomics however, the translation of these advances into reality for patient care depends mainly on our ability to discover disease- and/or drug - associated clinically actionable genetic mutations and on our understanding of the roles of these mutations in the disease process. healthcare centers that are conducting pilot studies of the integration of genomic data into clinical care have developed a bioinformatics infrastructure for processing ngs data that consists of a group of databases ancillary to the ehr [30, 93, 94 ]. the infrastructures were, for the most part, locally developed and proprietary, but this is because these centers are among the first healthcare providers to use genomic data in clinical care and there are no established infrastructures to meet their bioinformatics needs. the infrastructures were built along the same general plan : a bioinformatics pipeline for processing ngs data, a database for storing all genetic variants detected in patient samples, a genome variant knowledge base for storing known genetic variants and their clinical interpretation, a database for the subset of variants deemed to be clinically actionable (with variants linked to a specific clinical phenotype), links between databases allowing data transfer, and a method for reporting the results of clinically actionable variants in the ehr. developing and maintaining a bioinformatics infrastructure for ngs data requires substantial investment in resources and personnel and can be too expensive for small clinical laboratories. however, because genetic variant databases are maintained separately from the ehr, it might be possible for multiple, small laboratories to pool resources to build and share a common bioinformatics infrastructure. the storage and bioinformatics processing of raw ngs data output by sequencing platforms might exceed the infrastructure capacity of even some large healthcare organizations. therefore, healthcare providers might want to consider cooperatively establishing a cloud computing service designed to store and process genomic data securely for the healthcare community. clinical laboratories must also consider the cost of sequencing instruments as part of infrastructure costs. bench - top instruments used for targeted sequencing are less expensive and output less data than instruments that perform wes / wgs. for these reasons, more laboratories are likely to perform targeted sequencing before, or instead of, attempting to build infrastructure to support wes / wgs. a major challenge to incorporating genomic data into clinical care is the lack of standards for generating ngs data, bioinformatics processing, data storage, and clinical decision support. standards would promote consistency in data quality, and adherence to standards would facilitate the routine use of genomic data in clinical practice, but it is difficult to create standards when ngs technology and bioinformatics software are constantly evolving. further, approaches to clinical decision support vary across healthcare institutions. in a survey of 17 health centers participating in the cser program or the emerge network, most centers did not have active clinical decision support for genetic data in the ehr although there were existing mechanisms for clinically actionable information to trigger alerts in the majority of the ehr systems. centers with active clinical decision support either built their own software locally or customized the clinical decision support capabilities of commercial ehr software. most centers reported that genetics results were available as a portable document format (pdf) file in the ehr and recommended the development of clinical decision support for disease - defining and pharmacogenetics variants and creation of a clinical decision support knowledge base to advise on appropriate clinical actions (e.g., a change in treatment). appropriately integrating ehrs with genomic data for the discovery of clinically actionable variants can generate new insights into disease mechanisms and provide better predictions about effective treatments, all leading to improved targeting of interventions to patients. to generate knowledge on the nature of disease from comprehensive ehr data, new methods such as machine learning, natural language processing, and other artificial intelligence methods are needed. however not all patients are likely to benefit from the use of big data in healthcare due to our current knowledge gaps on how to extract useful information from large - volume genomic and clinical data and how to interpret discovered genetic variants appropriately. at the same time, targeted therapies are not yet available for many important genes, and regulatory issues need to be resolved before some useful bioinformatics tools can be applied in a healthcare setting. finally, as ehrs are extremely personal, measures to protect patient data have to be put in place to make certain that patient information is only shared with those who need to see it. despite this challenge, the potential advantages that genomic data can bring to healthcare far outweigh the potential disadvantages. the growing trend towards integration of genomic data and ehrs will cause concern, but as long as patient privacy and data security can be rigorously maintained, genomic data is certain to play an essential role in precision medicine. to reach the goal of precision medicine, healthcare institutions need to invest in a bioinformatics infrastructure and in personnel trained in bioinformatics and genetics, to develop the capacity to process, store, and interpret genomic data and to link these data with ehrs. in addition, more efforts are needed to distinguish genetic variants that are truly clinically actionable ; that is, the variants are useful for guiding clinical decisions regarding interventions to improve health outcomes. clinical research studies of the implementation of genomic data in healthcare can provide valuable lessons about how genomic data should be managed, and patient privacy protected, when incorporating genomic data into clinical practice on a larger scale. these lessons can alert healthcare institutions to the scientific and technical challenges of using genomic data in precision medicine.	advances in genomic medicine have the potential to change the way we treat human disease, but translating these advances into reality for improving healthcare outcomes depends essentially on our ability to discover disease- and/or drug - associated clinically actionable genetic mutations. integration and manipulation of diverse genomic data and comprehensive electronic health records (ehrs) on a big data infrastructure can provide an efficient and effective way to identify clinically actionable genetic variants for personalized treatments and reduce healthcare costs. we review bioinformatics processing of next - generation sequencing (ngs) data, bioinformatics infrastructures for implementing precision medicine, and bioinformatics approaches for identifying clinically actionable genetic variants using high - throughput ngs data and ehrs.
nutritional support is essential for patients undergoing major surgery, and nutritional therapies such as total parenteral nutrition or enteral nutrition are integral to the management of these patients. however, surgery causes a state of insulin resistance, and changes in glucose metabolism occur after surgery, and overfeeding with high loads of carbohydrates has been associated with clinical complications. therefore, knowledge of the optimal energy requirements is very important in the nutritional management of the patients undergoing surgery. an evaluation of the energy requirements of patients undergoing surgery is critical in planning optimal nutritional therapy. typically, the total energy of the parenteral or enteral nutrition is determined by using the predicted resting expenditure (pree) calculated by the harris - benedict equation, and the total energy requirement is calculated by the pree activity factor stress factor. on the other hand, there have been several studies reporting that the energy expenditure of patients undergoing surgery changes to a hyper - metabolic status. however, there have not been any reports on the energy metabolism of patients undergoing a pancreatoduodenectomy. currently, the pylorus - preserving pancreatoduodenectomy (pppd) is generally accepted as the preferred procedure for pancreatic head cancer or bile duct tumors. in this study, we evaluated the change in the energy metabolism of patients undergoing pppd, and determined the optimal energy requirements for their nutritional management. twelve patients with bile duct cancer or pancreatic tumors (5 women and 7 men, median age 70.1 years old) were enrolled in this study. the patients were admitted to the gastrointestinal surgery unit of shiga university of medical science hospital. four patients had pancreatic cancers, 6 patients had bile duct carcinomas, and 2 patients had intraductal papillary mucinous neoplasms (ipmn). parenteral nutrition was started before surgery in three patients, and parenteral nutrition and enteral nutrition were started on postoperative day (pod) 1 in other patients. the total energy of the parenteral nutrition (tpn), enteral nutrition (en) and oral diet was 33.2 7.6 kcal / kg / day before surgery, 29.5 7.8 kcal / kg / day on pod 7 and 24.3 8.4 kcal / kg / day on pod 14. the mrees and non protein respiratory quotients (nprq) were measured by computed open - circuit indirect calorimetry (ae-300s ; minato medical science co., osaka, japan). indirect calorimetry (ic) was performed in the hospital room on the morning after a 10-h overnight fast before surgery. however, the infusion of parenteral nutrition was maintained on pod 7 and pod 14. the period flow and gas calibration were performed prior to all measurements. after resting for a minimum of 30 min, after equilibrium was reached for 10 min, the respiratory exchange was performed continuously over 30 min. the mree was calculated from the oxygen consumption (vo2) and carbon dioxide production (vco2) by the weir equation. : mree = (3.94 vo2 + 1.11 vco2) 1.44 measurement of the non protein rq was calculated as rq = vco2/vo2. the measured mree was then compared with the pree (predicted resting energy expenditure) calculated by the harris and benedict equation. : men : pree = 66.47 + 13.75 w [weight (kg) ] + 5.0 h [height (cm) ] 6.75 a [age (year) ]. women : pree = 665.09 + 9.56 w [weight (kg) ] + 1.84 h [height (cm) ] 4.67 a [age (year) ]. the results are presented as mean sd, and a p value < 0.05 was considered to be statistically significant. twelve patients with bile duct cancer or pancreatic tumors (5 women and 7 men, median age 70.1 years old) were enrolled in this study. the patients were admitted to the gastrointestinal surgery unit of shiga university of medical science hospital. four patients had pancreatic cancers, 6 patients had bile duct carcinomas, and 2 patients had intraductal papillary mucinous neoplasms (ipmn). parenteral nutrition was started before surgery in three patients, and parenteral nutrition and enteral nutrition were started on postoperative day (pod) 1 in other patients. the total energy of the parenteral nutrition (tpn), enteral nutrition (en) and oral diet was 33.2 7.6 kcal / kg / day before surgery, 29.5 7.8 kcal / kg / day on pod 7 and 24.3 8.4 kcal / kg / day on pod 14. the mrees and non protein respiratory quotients (nprq) were measured by computed open - circuit indirect calorimetry (ae-300s ; minato medical science co., osaka, japan). indirect calorimetry (ic) was performed in the hospital room on the morning after a 10-h overnight fast before surgery. however, the infusion of parenteral nutrition was maintained on pod 7 and pod 14. the period flow and gas calibration were performed prior to all measurements. after resting for a minimum of 30 min, after equilibrium was reached for 10 min, the respiratory exchange was performed continuously over 30 min. the mree was calculated from the oxygen consumption (vo2) and carbon dioxide production (vco2) by the weir equation. : mree = (3.94 vo2 + 1.11 vco2) 1.44 measurement of the non protein rq was calculated as rq = vco2/vo2. the measured mree was then compared with the pree (predicted resting energy expenditure) calculated by the harris and benedict equation. : men : pree = 66.47 + 13.75 w [weight (kg) ] + 5.0 h [height (cm) ] 6.75 a [age (year) ]. women : pree = 665.09 + 9.56 w [weight (kg) ] + 1.84 h [height (cm) ] 4.67 a [age (year) ]. the results are presented as mean sd, and a p value < 0.05 was considered to be statistically significant. the bmi of these patients was 21.4 3.8 kg / m, and the average total protein, serum albumin, total cholesterol, prealbumin and retinol - binding protein levels were normal. the mree in these patients determined by indirect calorimetry before the surgery was 1198.0 191.7 kcal / day. on the other hand, the pree calculated by the harris - benedict equation was 1174.5 175.2 kcal / day. there was a positive correlation between the pree and mree (p<0.05) (fig. 1). the mree / body weight measured before the operation was almost the same as the pree / body weight (mree : 22.4 3.9 kcal / kg / day vs pree : 21.7 2.0 kcal / kg / day), and the mree / pree ratio, which reflects the stress factor, was 1.02 0.11. there were no significant differences among mrees of the patients with pancreas cancer, bile duct carcinoma and ipmn. the mree / body weight of these patients was almost the same as that of the controls reported previously. the nprq of these patients measured by indirect calorimetry before surgery was 0.87 0.06, and was almost the same as that of the controls reported previously. as shown in fig. 2, a significant increase in energy expenditure was observed after pppd. the mree of the patients undergoing a pppd was 25.7 3.5 kcal / kg / day on pod 7 and 25.4 4.9 kcal the mree / pree ratio was 1.16 0.14 on pod 7, and 1.16 0.18 on pod 14 respectively. however, the nprq did not change significantly during the perioperative period (fig. 3). this is the first report on the resting energy expenditure in patients undergoing a pppd. in this study, we showed that the mree measured by ic in patients with bile duct carcinomas or pancreatic tumors was not elevated before surgery. their mree was the same as the pree calculated by harris - benedict equation, and was the same as the mree of healthy controls. previous studies have suggested that the mree may be elevated in patients with specific types of tumors. it has been reported that patients with lung cancers or sarcomas have increased energy expenditure. falconer. also reported that the ree was significantly elevated in pancreatic cancer patients who were losing weight. this elevated ree was reported to be associated with some proinflammatory cytokines such as il-6 or tnf-. a progressive increase in tumor size is associated with an increase in oxygen consumption. in our study, however, the patients with bile duct cancer or pancreatic tumors enrolled in this study had an operative indication for pppd, and hence cachexic patients were not included in this study. the bmis and other nutritional parameters of these patients were within the normal range, and had a good nutritional condition. this must be the reason why the preoperative ree in these patients was not elevated in this study. the resting energy expenditure (pree), calculated by the harris - benedict equation, has been widely used to evaluate the energy status of patients. theoretically, the pree is expected to be equal to the mree in healthy humans, and the mree / pree ratio is a marker for a hyper - metabolic status. in this study, the mree was increased after pppd, and was significantly higher than the pree, and was also higher than the preoperative mree (p<0.05). the mree / pree, which reflects the stress factor, was elevated to 1.16 on pod 7 and pod 14. from these results, it is apparent that the stress factor for bile duct cancer or pancreatic tumors surgery should be 1.2 in patients without major complications. surgical trauma is generally considered to produce an increase in energy metabolism, and surgical stress, as well as burns or sepsis, causes an increase in the mree. systemic inflammatory response syndrome (sirs) describes a clinical response arising from a non - specific origin. the elevated mree after surgery was associated with operative sirs, and the mree was further increased in patients with infectious complications. previously, it has been reported that the ree was significantly increased after abdominal surgery, and tpn therapy consisting 45 kcal / kg day was optimal for these patients. this means that measurement of energy requirement can be calculated by the pree 1.75. 1.752.0 kcal / day should be optimal for tpn in the patients undergoing major surgery. however, federix. showed a 10% increase in the mree in patients undergoing gastrointestinal surgery without major complication. shaw. also reported that the infusion of 110% of ree may be suitable for tpn in patients with gastrointestinal surgery. our results showed that the mree was almost 25.5 kcal / kg / day just after pppd surgery, and the mree / pree ratio was 1.16 on pod 7 and pod 14. the measurement of energy requirement is very critical for nutritional management in patients undergoing major surgery such as pancreatic cancer or esophageal cancer, because over feeding has been associated with some clinical complications. from our findings, the stress factor of patients undergoing pppd should be set at 1.2 in patients without major complications. this factor was compatible to that of patients undergoing esophageal cancer surgery reported by sato. although one would be more likely to find stress - induced hypermetabolism on the earlier postoperative days, the increase in the mree of patients undergoing an esophagectomy was almost the same as during the first seven days. recently in particular, infection control has been advanced, and may prevent infection induced sirs in the patients undergoing major surgery. in this study, a significant change in the nprq after pppd was not observed. in previous reports, this fact means that the energy substrate of the remnant liver is principally fatty acids rather than glucose after a liver resection. in patients undergoing pppd, however, glucose is mainly utilized after the surgery as well as in patients undergoing an esophagectomy. in conclusion, patients undergoing pppd have a hyper - metabolic status just after surgery, and the mree / pree ratio was significantly increased to 1.16. from our results, the daily energy requirements for patients undergoing pppd are recommended at 30 kcal / body weight (mree 25.7 kcal 3.5 kcal / kg	we measured the energy expenditure weekly in patients undergoing a pylorus preserving pancreatoduodenectomy for bile duct cancer or pancreatic tumors. twelve patients (5 women and 7 men ; mean age 70.1 years) were enrolled in this study, and their resting energy expenditure levels were determined by indirect calorimetry. in these patients, a significant correlation was observed between the measured resting energy expenditures and the predicted resting energy expenditures calculated by the harris - benedict equation. the resting energy expenditures measured before surgery were almost the same as the predicted resting energy expenditures (measured resting energy expenditure : 22.4 3.9 kcal / kg / day vs predicted resting energy expenditure : 21.7 2.0 kcal / kg / day). the measured resting energy expenditure / predicted resting energy expenditure ratio, which reflects the stress factor, was 1.02 0.10. after the pylorus preserving pancreatoduodenectomy, a significant increase in energy expenditure was observed, and the measured resting energy expenditure was 25.7 3.5 kcal / kg / day on postoperative day 7 and 25.4 4.9 kcal / kg / day on postoperative day 14. the measured resting energy expenditure / predicted resting energy expenditure ratio was 1.16 0.14 on postoperative day 7, and 1.16 0.18 on postoperative day 14 respectively. in conclusion, patients undergoing a pylorus preserving pancreatoduodenectomy showed a hyper - metabolic status as evaluated by their measured resting energy expenditure / predicted resting energy expenditure ratio. from our observations, we recommend that nutritional management based on 30 kcal / body weight / day (calculated by the measured resting energy expenditureactivity factor 1.21.3) may be optimal for patients undergoing a pylorus preserving pancreatoduodenectomy.
globally, preterm birth (defined as birth at < 37 weeks of gestation) affects around 11% of deliveries (blencowe., 2013) and it is closely associated with cerebral palsy, cognitive impairment and neuropsychiatric disease in later life (kerr - wilson., 2012 ; moore., 2012). individuals born preterm are more likely to experience behavioral and emotional disturbance (clark., 2008 ; elgen., 2012), autistic spectrum disorder (johnson., 2010), attention deficit hyperactivity disorder (bhutta., 2002) and psychiatric disease, and these problems persist into adulthood (crump., 2010 ; halmoy., 2012 ; moster., 2008 ; nosarti., white matter disease is a core feature of the encephalopathy of prematurity and it is associated with reduced connectivity of neural circuitry (ball., 2013 ; boardman., 2006 ; fischi - gomez., 2014 ; pandit., 2014 ; woodward antenatal magnesium sulfate (mgso4) is often given to women expected to deliver preterm because it is associated with reduced rates of cerebral palsy (doyle.. however, there are uncertainties about its long - term effects, and studies have not been designed or powered to investigate its influence on non - motor functions (chollat., 2014 ; doyle., 2014) biomarkers of tissue integrity in the tracts of neural systems that sub - serve a range of functions are required to evaluate more pervasive neuroprotective effects. diffusion mri (dmri) and tractography enable measures of white matter tract integrity to be determined in specific tracts - of - interest (tois) (basser., 2000)., 1999) or probabilistic (behrens., 2007) approaches to identify the major pathways, with tracts initiated at seed points and typically constrained by operator - defined waypoints segmented pathways can then be analyzed as 3-dimensional regions - of - interest and water molecule diffusion parameters extracted. neonatal dmri data present challenges to tractography algorithms because of smaller head size, resolution difficulties, wide anatomic variation, increased brain water content, and lack of reference atlas data from typically developing newborns. consequently, neonatal studies have tended to focus on a relatively small number of tois, none has provided information about tract topology, and few have included control data. an alternative technique for segmenting tois single seed point tractography is used to segment the same toi across a group of subjects by modeling how individual tracts compare with a predefined reference in terms of length and shape (bastin., 2010 ; to achieve this, candidate seed points are automatically placed in a cubic neighborhood of native space voxels, with the tract that best matches the reference tract chosen as its representation in each subject (bastin., 2010 ; clayden., 2006 ; the output includes tract - averaged water diffusion tensor parameters, mean diffusivity (d) and fractional anisotropy (fa), and the goodness - of - fit of the best - matched tract to the reference (r). the approach has been useful for mapping white matter change in normal development (clayden., 2010), and amyotrophic lateral sclerosis (bastin., 2013). pnt overcomes the bias inherent to user - defined waypoint placement, does not require thresholding of connectivity values, and is unique in providing information about tract topology. in this paper, we generated an atlas of reference tracts for eight tois using pnt to test the hypotheses that : 1) tract topology, and tract - averaged d and fa, are altered by preterm birth ; 2) tois are separable in the newborn brain based on water diffusion parameters ; and 3) pnt is sensitive to detecting perinatal neuroprotective treatment effects. ethical approval was obtained from the national research ethics service (south east scotland research ethics committee), and informed written parental consent was obtained. preterm infants were recruited from the royal infirmary of edinburgh between july 2012 and september 2014. infants were eligible if they had a birth weight < 1500 g and/or were born at < 31 completed weeks ' postmenstrual age (pma). exclusion criteria for the study were infants with congenital infection, major chromosomal abnormalities, cystic periventricular leucomalacia, post - hemorrhagic ventricular dilatation and porencephalic cysts. mri data from 24 healthy infants born at full term and 87 preterm infants (mean pma at birth 29 weeks, range 2334 weeks) were acquired at term equivalent age (mean pma 39 weeks, range 3742 weeks) (table 1). infants were examined in natural sleep with pulse oximetry, temperature and electrocardiography data monitoring. ear protection was used for each infant, comprising earplugs placed in the external ear and neonatal earmuffs (minimuffs, natus medical inc. a siemens magnetom verio 3 t mri clinical scanner (siemens ag, healthcare sector, erlangen, germany) and 12-channel phased - array head coil were used to acquire : t1-weighted mprage volume (~1 mm resolution), t2-weighted stir (~0.9 mm resolution), t2-weighted flair (~1 mm resolution), and dmri (11 t2- and 64 diffusion encoding direction (b = 750 s / mm) single - shot spin - echo echo planar imaging (epi) volumes with 2 mm isotropic voxels) data. dmri data were pre - processed using fsl tools (fmrib, oxford, uk ; http://www.fmrib.ox.ac.uk). this included brain extraction, and removal of bulk infant motion and eddy current induced artifacts by registering the diffusion - weighted to the first t2-weighted epi volume for each subject. bedpostx / probtrackx algorithm was run with its default parameters : 2-fiber model per voxel, 5000 probabilistic streamlines for each tract with a fixed separation distance of 0.5 mm between successive points to generate the underlying white matter connectivity data (behrens. eight reference tois were created using pnt in standard space from the tractography output produced from a training set of 20 term controls : genu and splenium of corpus callosum, left and right projections of the corticospinal tract (cst), cingulum cingulate gyri (ccg) and inferior longitudinal fasciculi (ilf). candidate tracts were generated by seeding within a 7 7 7 neighborhood of native space voxels centered around a standard space seed point located within the center of the white matter structure - of - interest and transferred to the native space of each control. these standard space seed points were defined using an age specific t2-weighted neonatal template (http://www.brain-development.org) (kuklisova - murgasova., 2011). then, an experienced observer (da) selected candidate tracts from each control subject that best matched the anatomical shape of the white matter structure - of - interest. using these visually - assessed best - matching tracts, tract shape models were fitted to the tractography data using maximum likelihood (clayden., 2007), thereby capturing the shape and length variation amongst the controls ' tracts. once the reference tracts and shape models had been created, pnt was re - run over a neighborhood of 3 3 3 voxels centered on the reference tract and transferred to native space for all participants ; the seed point that produced the best matching tract to the reference was then determined. all the computational analysis was implemented in tractor (http://www.tractor-mri.org.uk) (clayden., 2011). two experienced raters (da, meb) visually assessed the best - matched tracts. any subject with deviated, aberrant or truncated pathways that were not anatomically plausible representations of the toi were excluded from further analysis (table 2). the tractography masks of the best match tracts were applied to the d and fa volumes, which permitted tract - averaged values of these biomarkers to be determined for each toi in every subject. finally, the goodness - of - fit of the best match tract to the reference (r) was determined from the log - ratio between the matching likelihood of the chosen candidate tract and the matching likelihood of the reference tract under the model. the more negative the r value, the less good the fit between the reference and best match tract. the lateral ventricles were segmented in 59 out of 101 subjects for whom high resolution t1w and t2w structural data were available (10 controls and 49 preterms). an atlas - based image segmentation approach was used that included lateral ventricles and choroid plexus, but excluded the third and fourth ventricle, cavum septum pellucidum and vergae (serag., 2012). this was done so that lateral ventricular size could be added as a co - variate to account for possible partial volume effects in the model testing independent effects of antenatal mgso4 on dmri parameters, and to investigate correlation between r and ventricular size. the distributions of d, fa and r in each tract were assessed for normality using the shapiro whitney u test was used to compare r values between groups ; spearman 's rho was used to investigate correlations between r and pma at scan. because age at scan differed between the two cohorts, and water diffusion parameters are dynamic over this developmental period, glm univariate anova was used to investigate the effect of prematurity on these biomarkers in each toi with gestational age as a fixed factor and pma at scan as a covariate. type 1 error was controlled using false discovery rate (fdr) (p < 0.05). to investigate the effect of antenatal mgso4 exposure on tract - averaged d and fa, and r, independent of potential confounders, we first examined the association between these biomarkers with the following factors : exposure to a complete course of antenatal steroids, exposure to antenatal mgso4, gender and the presence of bronchopulmonary dysplasia (bpd). 0.05) were included in a multivariate linear regression model that included pma at birth. fa volumes were blurred in eight preterm infants and two controls due to motion ; these subjects were removed from further analysis leaving 79 preterm and 22 control infants in the analysis sample (demographic shown in table 1). two preterm infants required laser treatment for retinopathy of prematurity and 1 had a grade 3 intraventricular hemorrhage (ivh) identified on cranial ultrasound. fig. 1 displays the reference tois that were identified reliably in the control training set in standard space. across both preterm and control subjects, visual assessment of the individual segmented tracts indicated that pnt provided anatomically acceptable representations of the toi for the vast majority of tracts (table 2) ; for the preterm cohort this ranged from 100% (79/79) for cst to 82% (65/79) for right ccg. there was a significant difference in r between groups, with the preterm cohort having larger negative values, and hence greater topological difference from the reference compared to controls for all tois except the splenium (table 3). 2 illustrates the range of values for r observed in the preterm cohort and how they correspond to tract shape for genu. there were no significant correlations between age at scan and r, with the exception of left cst. r correlated with ventricular volume for left ilf (p = 0.009) and left cst (p = 0.004), but not with any other toi. table 2 shows tract - averaged water diffusion parameter values for each toi for all participants. in bivariate analysis, tract - averaged d was higher in all tracts in preterm infants at term equivalent age compared with term controls, while fa was lower in all tracts except the right ccg. after adjusting for pma at scan, tract - averaged d was increased in preterm infants at term equivalent age compared with controls in genu (f = 17.57, p < 0.001), splenium (f = 19.22, p < 0.001), left ilf (f = 8.92, p = 0.004) and right ilf (f = 8.36, p = 0.005). tract - averaged fa was reduced in the splenium (f = 7.16, p = 0.009) and left ilf (f = 6.73, p = 0.01) in preterm infants compared with controls after adjustment for age at scan. 3 displays a scatterplot of tract - averaged d versus fa values for the eight tois. this figure indicates that cst, ccg, splenium and, to a lesser extent, ilf and genu are separable. forty (51%) of the preterm cohort had been exposed to antenatal mgso4, and this was associated with lower d in splenium (mean difference 0.089 mm / s, 95% ci 0.161 to 0.017, p = 0.016). in multivariate analysis, antenatal mgso4 was associated with a modest but significant decrease in d in splenium independent of age at birth and bpd (beta 115.0, 95% ci 43.4186.5, p = 0.002). factors included in the model were : pma at birth because there was a difference between those who had [mean pma 28 weeks ] and had not been exposed to antenatal mgso4 [mean 29 weeks ] ; and bpd, because it influenced fa on univariate analysis (mean difference 0.03, 95% ci 0.05 to 0.005, p = 0.015). there was no effect of pma at scan, which did not differ between the two groups (mean 39 weeks versus mean 40 weeks), or gender in univariate analysis, so these variables were not included. ventricular volumes were available for a subset of 28 of the treated group and 21 of the untreated group. there was no significant difference in ventricular volume between treated and untreated infants (8.4 versus 9.8 cm, p = 0.11), and in a subset analysis of infants where ventricular volume was entered into the model, antenatal mgso4 exposure retained significance (beta 100.1, 95% ci 28.8172.3, p = 0.007). these data suggest that the observed difference in d is unlikely to be attributable to the partial volume effects from csf. we developed a single seed point tractography - based segmentation algorithm (pnt) that incorporates tract shape modeling for use in neonates, and have segmented reliably eight major fasciculi. the algorithm is unique in providing a metric of tract topology, r, which measures the goodness - of - fit of the best matched tract with respect to an age specific tract template, and enables the extraction of tract - averaged water diffusion parameters including d and fa. the advantages of pnt over region - of - interest and voxel - based methods for group - wise comparisons of d and fa are that it avoids the need for waypoint placement and setting of connectivity thresholds, and tracts are segmented in native space, which minimizes operator bias and takes account of individual differences in white matter structure. the method uses connectivity data produced by a probabilistic tractography algorithm, fsl 's bedpostx / probtrackx, that can model multiple fiber populations and track through regions of reduced anisotropy, which has particular utility in neonates. furthermore, by modeling the tracts of the whole study group with respect to reference tracts generated from an age specific training set, it is possible to perform group - wise analyses to study perinatal influences on r, and tract - averaged d and fa. the measurement r, which indicates how the length and shape of the best - matched tract in each subject differs from reference tract topology, was significantly altered in preterm infants at term equivalent age compared with term controls in all tracts except splenium. to our knowledge our data suggest that tract shape change occurs independently of d and fa, and is less influenced by age at scan than these measures. therefore, r may add value beyond other biomarkers that are affected by age at scan, which can be challenging to standardize in neonatal studies. a measure of tract shape is also particularly relevant given the wide anatomic variability of the brain at this stage of life, which is not captured in most tractography models. further work is required to understand the functional correlates of r and whether it alters over time, but longitudinal studies of preterm infants suggest that alterations in structure and connectivity that are apparent in the neonatal period persist through early childhood into adulthood (fischi - gomez., 2014 ; nosarti., 2014 ; pandit., 2014). toga and thompson, 2005), and the incorporation of geometric information about tracts has proven useful for studying heritability of brain integrity and connectivity inferred from dmri in adults (jin., 2011). we propose that r may offer a new tool for studying genetic contributions to brain structure in the newborn, which to date has been investigated using fa and morphometry but has not included shape analysis of major fasciculi (boardman., 2014). tract - averaged values of d were higher and fa values were lower in all eight tois in preterm infants at term equivalent age compared with controls in bivariate analysis. after adjustment for pma at scan, which was necessary because both metrics change rapidly during perinatal brain development (huppi., 1998), d was only increased in genu and splenium, while fa was reduced in the splenium and left ilf. our findings are in broad agreement with previous region - of - interest (counsell., 2006 ;, 2002 ; rose., 2007 ; skiold., 2010), voxel - based (gimenez., 2008 ; thompson., 2014), and tractography approaches (aeby., 2009 ; anjari., 2007 ; thompson., 2011), which show that preterm infants at term equivalent age have higher d and lower fa in white matter compared with term controls, although the anatomic localization of these changes is inconsistent between studies and the role of confounding morbidities is uncertain. the relationship between water diffusion biomarkers and white matter development is complex because the maturational processes of axonal fasciculation, pre - myelination (proliferation of glial cell bodies, extension of oligodendroglial processes, increase in macromolecules and membrane density), and true myelination (ensheathment of axons) are all anisotropic (beaulieu, 2002 ; nossin - manor., 2013 ; zanin., 2011), and the sequence of these processes is not uniform across neural systems. therefore, while dmri biomarkers provide sensitive measures of tissue microstructure, they are also non - specific. we found that tracts were separable based on water diffusion parameters, with the greatest difference observed between cst, ccg and splenium. this suggests that adult patterning of neural systems (bastin., 2010) is present very early in development, and before the onset of widespread myelination. systematic review of 5 randomized controlled trials shows that antenatal mgso4 reduces the burden of cerebral palsy and other motor impairments in the offspring of women who deliver very preterm (doyle., 2007), but there is some doubt about long term benefit and none of the studies were designed to assess function in other domains as a primary outcome (chollat., 2014 ; doyle., 2014). magnesium is thought to act on a number of cellular targets and processes in preterm brain injury, which are not restricted to motor systems, so it is plausible that tissue effects might be apparent in other neural systems. we found a modest but significant reduction in d in the splenium of preterm infants who had been exposed to antenatal mgso4 compared with untreated infants, after adjustment for relevant confounders. the splenium connects parietal, temporal and visual cortices, so these data indicate that antenatal mgso4 exposure has beneficial tissue effects that extend beyond motor systems. detailed evaluation across all developmental domains of infants exposed to antenatal mgso4 is needed to understand fully its treatment effects. finally, our data suggest that tract - averaged water diffusion parameters may provide useful biomarkers to complement voxel - wise approaches (such as tract - based spatial statistics) for evaluating neuroprotective strategies in the newborn (o'gorman., 2015 ; porter., 2010 first, we were unable to identify uncinate and arcuate fasciculi in the training these tracts can be segmented from adult data using pnt (clayden., 2007) ; this is likely due to lower resolution inherent to neonatal dmri or relative under - development of these tracts at term equivalent age. second, the success of pnt varied from 100% for cst to 82% for right ccg in the preterm group, which may be explained by differential susceptibility to partial volume effects for different tracts. a further potential limitation relates to multiple testing : eight simultaneous tests were carried out for the d and fa data respectively. bonferroni correction is inappropriate here because tract - averaged fa and d values are correlated across the brain (penke., 2010), so we chose to control the effects of multiple testing with fdr at a threshold of 0.05. finally, the choice of reference template is a potential source of bias : we chose a reference based on healthy controls born at term because it provided the most biologically further work would be required to determine whether a reference template drawn from a representative sample of the entire study group influences the results. we have shown that pnt, an automated single seed point tractography method, segments tois with a high degree of accuracy in the newborn brain. it is unique in providing information about tract topology, and it enables calculation of tract - averaged dmri biomarkers. tract topology is a marker of preterm birth that is relatively robust to age at scan. we found that discrete neural systems can be separated by water diffusion parameters, reflecting specific microstructural properties of tracts that are apparent in early life, and that tract - averaged dmri biomarkers provide a sensitive metric for evaluating risk factors for preterm brain injury and neuroprotective treatment effects. the approach may have utility for investigating early life determinants of long - term neurologic and psychiatric disorders.	preterm birth is associated with altered connectivity of neural circuits. we developed a tract segmentation method that provides measures of tract shape and integrity (probabilistic neighborhood tractography, pnt) from diffusion mri (dmri) data to test the hypotheses : 1) preterm birth is associated with alterations in tract topology (r), and tract - averaged mean diffusivity (d) and fractional anisotropy (fa) ; 2) neural systems are separable based on tract - averaged dmri parameters ; and 3) pnt can detect neuroprotective treatment effects.dmri data were collected from 87 preterm infants (mean gestational age 29 + 1 weeks, range 23 + 2 34 + 6) at term equivalent age and 24 controls (mean gestational age 39 + 6 weeks). pnt was used to segment eight major fasciculi, characterize topology, and extract tract - averaged d and fa.tract topology was altered by preterm birth in all tracts except the splenium (p < 0.05, false discovery rate [fdr ] corrected). after adjustment for age at scan, tract - averaged d was increased in the genu and splenium, right corticospinal tract (cst) and the left and right inferior longitudinal fasciculi (ilf) in preterm infants compared with controls (p < 0.05, fdr), while tract - averaged fa was decreased in the splenium and left ilf (p < 0.05, fdr). specific fasciculi were separable based on tract - averaged d and fa values. there was a modest decrease in tract - averaged d in the splenium of preterm infants who had been exposed to antenatal mgso4 for neuroprotection (p = 0.002).tract topology is a biomarker of preterm brain injury. the data provide proof of concept that tract - averaged dmri parameters have utility for evaluating tissue effects of perinatal neuroprotective strategies.
acute myocardial infarction (ami) is a leading cause of morbidity and mortality worldwide with approximately one - half of deaths occurring in the prehospital setting. in the united arab emirates, mortality statistics from 2008 to 2010 showed that cardiovascular disease was the leading cause of death among both the united arab emirates nationals and expatriates. in the emirate of abu dhabi, early diagnosis and care by emergency medical services (ems) can play a crucial role in improving the management and ultimate outcome of patients with ami. use of ems may result in the faster initiation of reperfusion therapies, and facilitate quicker and more efficient treatment decisions. of particular importance is the role of ems in caring for patients with st - segment elevation myocardial infarction (stemi), the most serious and time - sensitive type of ami. stemi is potentially reversible provided that revascularization is initiated rapidly, as evidence has shown increased mortality associated longer culprit vessel occlusion times. while several international studies have emphasized the need for early activation of ems in patients with ami, ems use is generally low in patients with stemi. these low ems use rates were also found in the first gulf registry of acute coronary events (gulf race) and again in the second gulf race-2, which reported ems use rates of 17% and 25%, respectively, as well as in other studies of middle eastern countries. several studies have examined the issue of ems transport to the hospital versus self - transport and found that patient characteristics, american community survey (acs) characteristics, and patient 's knowledge of acs symptoms, influence the use of ems as well. patient perception and knowledge of ems care is critical to proper utilization of such services. the purpose of this study was to estimate the utilization, knowledge, and perceptions of prehospital ems among patients with stemi in the emirate of abu dhabi to determine if demographic and background variables or event characteristics were related to these factors. cardiac catheterization services are provided at five government operated hospitals, four of which are under the abu dhabi health services company (seha) and one operated by the united arab emirates armed forces. ems is operated by the abu dhabi police emergency and public safety department, in conjunction with national ambulance company llc, which provides emergency technicians and paramedics. the ems is able to provide advanced cardiac life support and early stemi recognition by means of 12 lead ecg acquisition and paramedic interpretation. this was an 18-month, multicenter, prospective study of consecutive patients admitted with stemi to four government hospitals in the emirates of abu dhabi. the united arab emirates armed forces hospital, zayed military hospital, was excluded from our research due to ems not transporting to this hospital. we performed telephonic or face - to - face semi - structured interviews, to assess their rationale for choosing their prehospital mode of transport and their knowledge of ems contact details. mode of transport was ascertained by the way of both ems and hospital electronic medical record data and confirmed with the patient at interview. the following questions were asked of all patients regardless of mode of transport utilized : do you know what the emergency number is to call an ambulance?when you decided to go to the hospital, how did you get there, by ambulance or did you use private transport ? when you decided to go to the hospital, how did you get there, by ambulance or did you use private transport ? patients who made the use of private transport instead of ems were asked the following additional question : what made you not call for an ambulance, but instead make use of private transport ? what made you not call for an ambulance, but instead make use of private transport ? these questions were asked in the patient 's native language with the assistance of staff in the hospital or with the assistance of follow - up investigators if the patient was discharged before interview. descriptive statistics were computed for all the study variables including the demographic and background variables as well as the reasons for using private transportation. inferential analyses were performed to determine if relationships existed between the demographic and background variables, on the one hand, and the reasons for taking private transportation on the other. most of the demographic and background variables were also categorical, and therefore, a series of chi - square tests of independence were performed. one demographic variable, age, was continuous, and therefore, a one - way anova was performed to determine if the participants ' reasons for using private transportation differed according to their age. analyses were performed using spss version 22.0 (ibm corporation, armonk, ny, usa) and a p 0.05 was considered to be statistically significant. the study protocol was approved by the research ethics committees of sheikh khalifa medical city, mafraq, al ain, and tawam hospitals as well as the university of cape town human research ethics committee (hrec 286/2013). written consent to follow - up was obtained from patients before discharge, and an explanation of the research was provided in the patient 's native language. ems and in - hospital electronic medical records were also utilized for patients ' data collection. cardiac catheterization services are provided at five government operated hospitals, four of which are under the abu dhabi health services company (seha) and one operated by the united arab emirates armed forces. ems is operated by the abu dhabi police emergency and public safety department, in conjunction with national ambulance company llc, which provides emergency technicians and paramedics. the ems is able to provide advanced cardiac life support and early stemi recognition by means of 12 lead ecg acquisition and paramedic interpretation. this was an 18-month, multicenter, prospective study of consecutive patients admitted with stemi to four government hospitals in the emirates of abu dhabi. the united arab emirates armed forces hospital, zayed military hospital, was excluded from our research due to ems not transporting to this hospital. we performed telephonic or face - to - face semi - structured interviews, to assess their rationale for choosing their prehospital mode of transport and their knowledge of ems contact details. mode of transport was ascertained by the way of both ems and hospital electronic medical record data and confirmed with the patient at interview. the following questions were asked of all patients regardless of mode of transport utilized : do you know what the emergency number is to call an ambulance?when you decided to go to the hospital, how did you get there, by ambulance or did you use private transport ? when you decided to go to the hospital, how did you get there, by ambulance or did you use private transport ? patients who made the use of private transport instead of ems were asked the following additional question : what made you not call for an ambulance, but instead make use of private transport ? what made you not call for an ambulance, but instead make use of private transport ? these questions were asked in the patient 's native language with the assistance of staff in the hospital or with the assistance of follow - up investigators if the patient was discharged before interview. descriptive statistics were computed for all the study variables including the demographic and background variables as well as the reasons for using private transportation. inferential analyses were performed to determine if relationships existed between the demographic and background variables, on the one hand, and the reasons for taking private transportation on the other. most of the demographic and background variables were also categorical, and therefore, a series of chi - square tests of independence were performed. one demographic variable, age, was continuous, and therefore, a one - way anova was performed to determine if the participants ' reasons for using private transportation differed according to their age. analyses were performed using spss version 22.0 (ibm corporation, armonk, ny, usa) and a p 0.05 was considered to be statistically significant. the study protocol was approved by the research ethics committees of sheikh khalifa medical city, mafraq, al ain, and tawam hospitals as well as the university of cape town human research ethics committee (hrec 286/2013). written consent to follow - up was obtained from patients before discharge, and an explanation of the research was provided in the patient 's native language. ems and in - hospital electronic medical records were also utilized for patients ' data collection. most participants (n = 557, 94.9%) were male, and the average age was 51 (11) years. however, this finding is not surprising considering that the united arab emirates has a large expatriate workforce which is predominately male. the most common countries of origin were the india subcontinent (n = 421, 71.7%). arabic was the most common language (n = 183, 31.2%), with substantial percentages of these participants being able to comprehend basic english (n = 96, 16.4%), hindi (n = 104, 17.7%), and urdu (n = 100, 17.0%). english was the first language of only 23.7% (n = 139) of the participants [table 1 ]. most participants (n = 501, 85.3%) used private transportation to get to the hospital, and only a small percentage (n = 86, 14.7%) used ems. descriptive statistics for reasons for mode of transport (n=587) the reasons for using private transportation are shown in table 2. the most common responses were that it was quicker (232, 46.3%) and easier (67, 13.4%) to go through private means. a smaller percentage of participants stated that they had not called ems because they did not think their symptoms were cardiac - related (40, 8.0%). descriptive statistics for reasons for using private transportation (n=501) over half (323, 55.0%) of the participants stated that they did not know the telephone number for ems in abu dhabi. there were no differences between males and females in terms of their reasons for using private transportation rather than ems (p = 0.26). there was also no statistically significant differences in age between individuals citing different reasons for using private transportation (p = 0.68) participants from pakistan were less likely to feel that it was quicker to go through private transportation (37.2%) compared to between 42.3% and 56.6% for individuals from other countries, and individuals from the united arab emirates and syria were less likely to feel that it was easier to go through private transportation (3.8% and 5.6%, respectively, compared to between 12.2% and 16.8% for individuals from other countries). participants with knowledge of the ems number and those without that knowledge were compared in terms of their reason for using private transportation, and the results indicated a significant difference between the groups (p = 0.03) [table 3 ]. participants who knew the number for ems 15.4% (but nevertheless took private transportation) were more likely to think that their event was not a cardiac event or did not warrant an ems call than those who did not know the number 7.1% [table 4 ]. cross - tabulation of gender, nationality, language, and english as the first language versus reasons for using private transportation (n=501) cross - tabulation of city of event, transfers, and knowledge of the emergency medical services number versus reasons for using private transportation there was a significant difference in reasons for using private transportation between the two cities (p < 0.001) [table 4 ]. residents of abu dhabi city were more likely to feel it was quicker to use private transportation (50.9%). however, the residents of al ain city were more likely to feel it was easier to use private transportation (27.8%). there was no significance difference in reasons for using private transportation and those who were transferred (p = 0.75). most participants (n = 557, 94.9%) were male, and the average age was 51 (11) years. however, this finding is not surprising considering that the united arab emirates has a large expatriate workforce which is predominately male. the most common countries of origin were the india subcontinent (n = 421, 71.7%). arabic was the most common language (n = 183, 31.2%), with substantial percentages of these participants being able to comprehend basic english (n = 96, 16.4%), hindi (n = 104, 17.7%), and urdu (n = 100, 17.0%). english was the first language of only 23.7% (n = 139) of the participants [table 1 ]. most participants (n = 501, 85.3%) used private transportation to get to the hospital, and only a small percentage (n = 86, 14.7%) used ems. the most common responses were that it was quicker (232, 46.3%) and easier (67, 13.4%) to go through private means. a smaller percentage of participants stated that they had not called ems because they did not think their symptoms were cardiac - related (40, 8.0%). descriptive statistics for reasons for using private transportation (n=501) over half (323, 55.0%) of the participants stated that they did not know the telephone number for ems in abu dhabi. there were no differences between males and females in terms of their reasons for using private transportation rather than ems (p = 0.26). there was also no statistically significant differences in age between individuals citing different reasons for using private transportation (p = 0.68) participants from pakistan were less likely to feel that it was quicker to go through private transportation (37.2%) compared to between 42.3% and 56.6% for individuals from other countries, and individuals from the united arab emirates and syria were less likely to feel that it was easier to go through private transportation (3.8% and 5.6%, respectively, compared to between 12.2% and 16.8% for individuals from other countries). participants with knowledge of the ems number and those without that knowledge were compared in terms of their reason for using private transportation, and the results indicated a significant difference between the groups (p = 0.03) [table 3 ]. participants who knew the number for ems 15.4% (but nevertheless took private transportation) were more likely to think that their event was not a cardiac event or did not warrant an ems call than those who did not know the number 7.1% [table 4 ]. cross - tabulation of gender, nationality, language, and english as the first language versus reasons for using private transportation (n=501) cross - tabulation of city of event, transfers, and knowledge of the emergency medical services number versus reasons for using private transportation there was a significant difference in reasons for using private transportation between the two cities (p < 0.001) [table 4 ]. residents of abu dhabi city were more likely to feel it was quicker to use private transportation (50.9%). however, the residents of al ain city were more likely to feel it was easier to use private transportation (27.8%). there was no significance difference in reasons for using private transportation and those who were transferred (p = 0.75). our findings showed persistent underuse of ems, with rates comparable to those of previous regional studies. it has been shown that ems use rates vary between countries but were predominantly low, including 2% in yemen, 7% in kuwait, 17% in the united arab emirates, 23% in bahrain, and 30% in qatar. interestingly, a study conducted in turkey found that despite a high knowledge of the emergency services number, only 29% of stemi patients used ems. in other countries such as the united states and china, ems utilization rates varied between 20% and 50%. however, higher rates of ems have been reported in other studies. for example of 619 patients with an stemi presenting to a singapore hospital, 58.6% arrived by ems. mathews. reported that in data from the national cardiovascular registry (action registry gwtg), detailing almost 40,000 stemi patients, ems transport was used by 60%. our study also indicated that public awareness of how to access ems was a barrier to utilization. a high percentage of patients were not aware of the emergency contact number for the ems in abu dhabi. our research found that majority of the patients who used private transport did so as they thought that it would be a quicker means to access emergency health care. in our study, we found that many participants were from foreign countries and with arabic or english not as their first language, raising the question could complicate any public education campaigns to benefit future cardiac patients ? our findings emphasize the need for greater public education and awareness, with regards to not only the benefits of using ems during chest pain events but also the signs and symptoms of cardiac emergencies. the public should be educated to the fact that ems is not only a transport modality, but that early treatment can be initiated en route, and cardiac interventions services can be activated before patient arrival. education should also be directed at lower - income patients such as those involved with manual labor and encompass languages including urdu, hindi, malayalam, and bengali, as these patients comprised a large percentage of our study population. strategies should focus on enhancing awareness of this particular population demographic, in their native languages dialects, with greater emphasis perhaps placed on newspapers and television as well as education in the workplace and the accommodations facilities under the auspices of government health - care programs. the internet and electronic social media platforms may not be the best way to educate these potential patients. we acknowledge the potential for referral bias, as a disproportionate number of patients may also have presented to private facilities that have interventional cardiology services in these two cities. we also acknowledge that despite previous research in the middle east describing low ems use rates, our results may not be generalizable due to postresearch recommendation changes in these countries having been initiated. we acknowledge the potential for referral bias, as a disproportionate number of patients may also have presented to private facilities that have interventional cardiology services in these two cities. we also acknowledge that despite previous research in the middle east describing low ems use rates, our results may not be generalizable due to postresearch recommendation changes in these countries having been initiated. patient knowledge and perceptions may contribute to this underutilization, and public education efforts are needed to raise awareness of both the signs and symptoms of acs and the importance of ems utilization. current public education appears to be ineffective and needs to target more specific demographic groups. it is hoped that the results of this study can be used as a foundation for future research and assist with public education strategies.	background : data on the use of emergency medical services (ems) by patients with cardiac conditions in the gulf region are scarce, and prior studies have suggested underutilization. patient perception and knowledge of ems care is critical to proper utilization of such services.objectives:to estimate utilization, knowledge, and perceptions of ems among patients with st - elevation myocardial infarction (stemi) in the emirate of abu dhabi.methods:we conducted a multicenter prospective study of consecutive patients admitted with stemi in four government - operated hospitals in abu dhabi. semi - structured interviews were conducted with patients to assess the rationale for choosing their prehospital mode of transport and their knowledge of ems services.results:of 587 patients with stemi (age 51 11 years, male 95%), only 15% presented through ems, and the remainder came via private transport. over half of the participants (55%) stated that they did not know the telephone number for ems. the most common reasons stated for not using ems were that private transport was quicker (40%) or easier (11%). a small percentage of participants (7%) did not use ems because they did not think their symptoms were cardiac - related or warranted an ems call. stated reasons for not using ems did not significantly differ by age, gender, or primary language of the patients.conclusions:ems care for stemi is grossly underutilized in abu dhabi. patient knowledge and perceptions may contribute to underutilization, and public education efforts are needed to raise their perception and knowledge of ems.
sympathetic innervation of the eye is a third - order neuron pathway which emerges from the hypothalamus and runs along a well - known route before reaching the eye [1, 2, 3 ]. the third - order neuron is located in the superior cervical ganglion dividing itself into two branches which innervate the mller 's muscle of the eyelids, lacrimal gland, iris dilator muscle, facial sweat glands and the small skin vessels [1, 2, 3 ]. horner 's syndrome, also called oculosympathetic paresis, results from any lesion that interrupts the sympathetic neuronal pathway from the hypothalamus to the eye. it manifests ipsilaterally to the lesion, consisting mainly of miosis, slight ptosis and enophthalmos, but can present other findings [1, 2, 3 ]. horner 's syndrome can be caused by many benign and malignant conditions [1, 2, 3, 4 ]. neoplasia is the most common cause and accounts for 3560% of all cases [2, 3, 4 ]. the purpose of this paper is to present the case of a woman with a left cervical mass corresponding to a t - cell - rich b - cell non - hodgkin lymphoma that manifested horner 's syndrome due to a sympathetic third - order neuron lesion at diagnosis. to our knowledge, this is the first case of horner 's syndrome secondary to a lesion in the post - ganglionic level of the sympathetic pathway in a non - hodgkin lymphoma. a 35-year - old woman was admitted with a cervical lymphadenopathy which had progressively grown over the last 3 months. it consisted of a coalescent group of hard lymph nodes that infiltrated adjacent tissues and skin, posteriorly located on the left side of the neck (fig. simultaneously she presented ipsilateral miosis, slight superior eyelid ptosis, and enophthalmos typical for horner 's syndrome (fig. the ocular phenylephrine 1%-test revealed minimal dilatation in the normal right pupil and pronounced dilatation in the left affected pupil (fig. ct scan of the neck confirmed a lymphadenopathy that occupied the carotid and paravertebral spaces. thoracic ct scan did not show any tumor in the mediastine or left lung apex. cervical tumor biopsy revealed a t - cell - rich b - cell non - hodgkin lymphoma [immunohistochemistry : 100% large lymphocytes cd20(+) ; 40% large lymphocytes cd45(+) ; background lymphocytes cd3(+) ; cd15() ; cd30() ; alk-1() ]. as liver and bone marrow were both compromised but without b symptoms, the tumor was classified as stage iva by the ann arbor staging system, and she was treated with 6 cycles of r - chop. until present, the patient has been receiving salvage chemotherapy with ifosfamide, carboplatin and etoposide due to a relapse affecting the lungs occurring after 2 years of complete clinical remission. as soon as she reaches the second remission, she will undergo an autologous bone marrow transplant. we found a small number of papers citing or describing horner 's syndrome related to non - hodgkin lymphomas [5, 6, 7, 8, 9 ]. they were reported as tumors that primarily affected the intramedullary spinal cord (c3-c6), lung apex (pancoast 's syndrome presentation) [6, 7 ], the thyroid gland, or which were spread throughout the patient 's body including a supraclavicular lymphadenopathy. these published cases, however, seem to be the result of sympathetic neuronal pathway interruption in the first- or second - order neuron pathways [6, 7, 8 ]. in 1958, giles and henderson cited a case of malignant lymphoblastoma that caused horner 's syndrome in one of their study patients. this tumor could correspond to a non - hodgkin lymphoma, but the sympathetic lesion level was not specified. according to danesh - meyer., the phenylephrine test finding observed in our patient locates the lesion in the third - order neuron level (post - ganglionic). this can be explained by the principle of denervation supersensitivity which occurs in the affected side. as the patient did not show hemifacial anhydrosis or flushing, it seems that the lesion specifically affected the third - order neural branch along the internal carotid artery. it is well - known that neck lymphadenopathy from any cause can result in horner 's syndrome. nonetheless, our paper illustrates a rare presentation of non - hodgkin lymphoma, mainly because it seems to be the first well - documented case of a third - order sympathetic neuron lesion caused by this kind of malignancy.	in this paper, we present the rare case of a patient with cervical lymphadenopathy diagnosed as a t - cell - rich b - cell non - hodgkin lymphoma that manifested horner 's syndrome due to a post - ganglionic sympathetic neuron lesion caused by the tumor.
from october to november 2002, a cluster of skin and soft tissue infections due to mrsa involving pediatric and maternity patients occurred at a new york city hospital. the hospital has a labor and delivery unit and 2 units that house both healthy newborns and maternity patients. after the outbreak was recognized, the following interventions were implemented : 1) nursing and medical personnel from the involved areas were informed of the outbreak and potential modes of transmission of staphylococci, 2) contact precautions were emphasized for all patients with suspected or proven skin infections, 3) alcohol - based hand sanitizers were placed in involved areas, 4) healthcare workers from involved units were screened for nasal mrsa colonization, and 5) environmental surfaces (including cord clamps, antitheft transponders, and temperature sensors of baby warmers) were tested for mrsa contamination. healthcare workers colonized with mrsa were treated with intranasal mupirocin and furloughed until repeat cultures were negative. to identify any other potential case - patients, letters concerning the outbreak were sent to pediatricians who cared for newborns discharged from the affected units during the outbreak period. cases were defined as mrsa infections in patients who stayed on the labor and delivery, nursery, or maternity units at any time from october 2002 to december 2002. the medical records of the patients were reviewed for information regarding prior healthcare exposures, receipt of antimicrobial agents, underlying medical conditions, treatment, and clinical outcome. cultures related to the outbreak were grown on tryptic soy agar plates supplemented with 3% sheep blood ; colonies consistent with s. aureus were identified according to standard techniques. all isolates underwent susceptibility testing with the etest method (ab biodisk, solna, sweden). ribotyping was performed with the riboprinter microbial characterization system (qualicon, wilmington, de, usa), as previously noted (13). in addition, isolates of mrsa collected during the outbreak were fingerprinted by pulsed - field gel electrophoresis (pfge), as previously described (13). sccmec typing was performed by using multiplex polymerase chain reaction (pcr), under conditions described by oliveira. primers to detect the meca gene were included as an internal positive control (15). multilocus sequence typing (mlst) was performed on selected isolates as described by enright. bidirectional dna sequencing of 7 amplified housekeeping genes was performed with an automated fluorescent dye - terminator sequencing system (applied biosystems, foster city, ca, usa). the presence of genetic sequences encoding several staphylococcal toxins was also investigated for the outbreak isolates. based on the previously reported distribution of enterotoxins in ca - mrsa from the united states (7), the following toxins were selected for investigation : staphylococcal enterotoxin a (sea), b (seb), c (sec), h (seh), and k (sek). in addition, strains were screened for pvl and toxic shock syndrome toxin-1 (tsst-1). previously published primers and conditions were used to detect sequences encoding for sea, seb, sec, seh, pvl, and tsst-1 (1719). genes encoding for sek were detected with the following primers : sek forward : 5-tggatcaatggaaatcacaaaa-3 and reverse : 5-tttggtagcccatcatctcc-3 (predicted product size 287 bp). the identification of mw2 in the outbreak of the neonatal - maternity unit prompted a retrospective investigation to determine the regional prevalence of mrsa resembling this strain. in 1999, 2001, and 2003, surveillance studies were performed in brooklyn, new york. each surveillance study involved collecting all single - patient isolates of s. aureus from clinical microbiology laboratories during a 3-month interval. susceptibility testing was performed in the central research laboratory by using the agar dilution method according to nccls methodology (20). all mrsa isolates were then screened for a phenotype of susceptibility to clindamycin and ciprofloxacin (typical for mw2). the study was approved by the institutional review board at the state university of new york (suny) health science center and maimonides medical center. from october to november 2002, a cluster of skin and soft tissue infections due to mrsa involving pediatric and maternity patients occurred at a new york city hospital. the hospital has a labor and delivery unit and 2 units that house both healthy newborns and maternity patients. after the outbreak was recognized, the following interventions were implemented : 1) nursing and medical personnel from the involved areas were informed of the outbreak and potential modes of transmission of staphylococci, 2) contact precautions were emphasized for all patients with suspected or proven skin infections, 3) alcohol - based hand sanitizers were placed in involved areas, 4) healthcare workers from involved units were screened for nasal mrsa colonization, and 5) environmental surfaces (including cord clamps, antitheft transponders, and temperature sensors of baby warmers) were tested for mrsa contamination. healthcare workers colonized with mrsa were treated with intranasal mupirocin and furloughed until repeat cultures were negative. to identify any other potential case - patients, letters concerning the outbreak were sent to pediatricians who cared for newborns discharged from the affected units during the outbreak period. cases were defined as mrsa infections in patients who stayed on the labor and delivery, nursery, or maternity units at any time from october 2002 to december 2002. the medical records of the patients were reviewed for information regarding prior healthcare exposures, receipt of antimicrobial agents, underlying medical conditions, treatment, and clinical outcome. cultures related to the outbreak were grown on tryptic soy agar plates supplemented with 3% sheep blood ; colonies consistent with s. aureus were identified according to standard techniques. all isolates underwent susceptibility testing with the etest method (ab biodisk, solna, sweden). ribotyping was performed with the riboprinter microbial characterization system (qualicon, wilmington, de, usa), as previously noted (13). in addition, isolates of mrsa collected during the outbreak were fingerprinted by pulsed - field gel electrophoresis (pfge), as previously described (13). sccmec typing was performed by using multiplex polymerase chain reaction (pcr), under conditions described by oliveira. primers to detect the meca gene were included as an internal positive control (15). multilocus sequence typing (mlst) was performed on selected isolates as described by enright. bidirectional dna sequencing of 7 amplified housekeeping genes was performed with an automated fluorescent dye - terminator sequencing system (applied biosystems, foster city, ca, usa). the presence of genetic sequences encoding several staphylococcal toxins was also investigated for the outbreak isolates. based on the previously reported distribution of enterotoxins in ca - mrsa from the united states (7), the following toxins were selected for investigation : staphylococcal enterotoxin a (sea), b (seb), c (sec), h (seh), and k (sek). in addition, strains were screened for pvl and toxic shock syndrome toxin-1 (tsst-1). previously published primers and conditions were used to detect sequences encoding for sea, seb, sec, seh, pvl, and tsst-1 (1719). genes encoding for sek were detected with the following primers : sek forward : 5-tggatcaatggaaatcacaaaa-3 and reverse : 5-tttggtagcccatcatctcc-3 (predicted product size 287 bp). the identification of mw2 in the outbreak of the neonatal - maternity unit prompted a retrospective investigation to determine the regional prevalence of mrsa resembling this strain. in 1999, 2001, and 2003, surveillance studies were performed in brooklyn, new york. each surveillance study involved collecting all single - patient isolates of s. aureus from clinical microbiology laboratories during a 3-month interval. susceptibility testing was performed in the central research laboratory by using the agar dilution method according to nccls methodology (20). all mrsa isolates were then screened for a phenotype of susceptibility to clindamycin and ciprofloxacin (typical for mw2). the study was approved by the institutional review board at the state university of new york (suny) health science center and maimonides medical center. from october 18 to november 28, 2002, a total of 8 patients with skin and soft tissue infections due to mrsa were identified. during this period, 3.5 cases of mrsa infection occurred each month in the nursery and maternity units. in contrast, no mrsa infections had been reported from the involved units in the 10 months before the outbreak. two patients were mothers, and 6 were neonates ; in no instance were both the mother and her child infected. all had been hospitalized on an involved unit at some point from october 16 to november 6, 2002. review of medical records showed that none of the patients had prior hospital exposure, underlying chronic medical conditions, or recent antibiotic therapy. patients stayed on the unit for an average of 5 days (range 212 days). clinical infection developed in 4 of the newborns and 1 mother while in the hospital. symptoms developed in 2 newborns and 1 mother 2, 10, and 24 days, respectively, after discharge. definitive therapy generally consisted of topical or systemic antimicrobial agents active against mrsa ; 1 patient required surgical drainage. time course of hospitalizations and onset of methicillin - resistant stpahylococcus aureus illness during the outbreak at hospital a. solid bars represent period of hospitalization ; arrows represent onset of clinical infection. the first was in an infant, born in november 2002, who was seen as an outpatient for pustulosis ; however, the site was not cultured. the second case involved another infant, also born in november 2002, who was readmitted to the hospital 4 days later for treatment of omphalitis. no additional cases were reported from december10, 2002, to december 31, 2003. susceptibility testing showed that all 8 isolates were susceptible to clindamycin, ciprofloxacin, trimethoprim - sulfamethoxazole, rifampin, doxycycline, linezolid, and vancomycin. of the 8 clinical isolates, 7 (isolates p1-p7) belonged to 1 ribotype that was identical to the prototypical mw2 strain (figure 2). pfge confirmed that the 7 isolates were identical and closely related to mw2 (figure 2). since the 7 isolates appeared identical, mlst was performed on one of the isolates and showed sequence type 1. the pfge and mlst pattern are the same as ca - mrsa clone usa 400, which also includes mw2 (21). among these 7 isolates, all contained sek and pvl, 6 contained sec and seh, and 5 contained sea. the eighth clinical isolate, from a catheter - site infection, was distinct from the outbreak strain by ribotyping and pfge (figure 2). for this isolate, sccmec was nontypable, and mlst typing confirmed a distinct allelic profile. a) ribotype and b) pulsed - field gel electrophoresis patterns of 8 clinical isolates of methicillin - resistant staphylococcus aureus. clinical isolate p8 and the 3 isolates from healthcare workers (s1s3) are unrelated to the outbreak strain. a total of 189 healthcare workers worked on the involved units during the outbreak period. screening cultures of the anterior nares were performed in 176 of the workers in november 2002. three of the cultures were positive for mrsa, including 2 from the nursing staff and 1 from a pediatrician. the 3 mrsa strains possessed a susceptibility pattern typical for the multidrug - resistant hospital strains, with resistance to clindamycin and ciprofloxacin. they belonged to ribotypes distinct from the outbreak clone, and pfge confirmed these isolates were unrelated to mw2 (figure 2). none of the 27 environmental samples collected in november 2002 yielded positive cultures for mrsa. a total of 4,345 isolates of s. aureus were collected in the 3 surveillance studies conducted in 1999, 2001, and 2003 ; susceptibility data for these isolates are given in table 2. the 1,913 mrsa isolates, 118 (6%) possessed the screened phenotype (susceptible to both clindamycin and fluoroquinolones). among the 118 isolates, a total of 11 isolates possessed the same ribotype pattern as the outbreak clone, mw2. sources of the cultures included skin and soft - tissue in 7 patients, blood / sterile body fluid in 3 patients, and the genital tract in 1 patient. the number of isolates resembling mw2 remained relatively constant during the 3 surveillances (4 in 1999, 3 in 2001, and 4 in 2003). from october 18 to november 28, 2002, a total of 8 patients with skin and soft tissue infections due to mrsa were identified. during this period, 3.5 cases of mrsa infection occurred each month in the nursery and maternity units. in contrast, no mrsa infections had been reported from the involved units in the 10 months before the outbreak. two patients were mothers, and 6 were neonates ; in no instance were both the mother and her child infected. all had been hospitalized on an involved unit at some point from october 16 to november 6, 2002. review of medical records showed that none of the patients had prior hospital exposure, underlying chronic medical conditions, or recent antibiotic therapy. patients stayed on the unit for an average of 5 days (range 212 days). clinical infection developed in 4 of the newborns and 1 mother while in the hospital. symptoms developed in 2 newborns and 1 mother 2, 10, and 24 days, respectively, after discharge. definitive therapy generally consisted of topical or systemic antimicrobial agents active against mrsa ; 1 patient required surgical drainage. time course of hospitalizations and onset of methicillin - resistant stpahylococcus aureus illness during the outbreak at hospital a. solid bars represent period of hospitalization ; arrows represent onset of clinical infection. the first was in an infant, born in november 2002, who was seen as an outpatient for pustulosis ; however, the site was not cultured. the second case involved another infant, also born in november 2002, who was readmitted to the hospital 4 days later for treatment of omphalitis. no additional cases were reported from december10, 2002, to december 31, 2003. susceptibility testing showed that all 8 isolates were susceptible to clindamycin, ciprofloxacin, trimethoprim - sulfamethoxazole, rifampin, doxycycline, linezolid, and vancomycin. of the 8 clinical isolates, 7 (isolates p1-p7) belonged to 1 ribotype that was identical to the prototypical mw2 strain (figure 2). pfge confirmed that the 7 isolates were identical and closely related to mw2 (figure 2). since the 7 isolates appeared identical, mlst was performed on one of the isolates and showed sequence type 1. the pfge and mlst pattern are the same as ca - mrsa clone usa 400, which also includes mw2 (21). among these 7 isolates, all contained sek and pvl, 6 contained sec and seh, and 5 contained sea. the eighth clinical isolate, from a catheter - site infection, was distinct from the outbreak strain by ribotyping and pfge (figure 2). for this isolate, sccmec was nontypable, and mlst typing confirmed a distinct allelic profile. a) ribotype and b) pulsed - field gel electrophoresis patterns of 8 clinical isolates of methicillin - resistant staphylococcus aureus. clinical isolate p8 and the 3 isolates from healthcare workers (s1s3) are unrelated to the outbreak strain. a total of 189 healthcare workers worked on the involved units during the outbreak period. screening cultures of the anterior nares were performed in 176 of the workers in november 2002. three of the cultures were positive for mrsa, including 2 from the nursing staff and 1 from a pediatrician. the 3 mrsa strains possessed a susceptibility pattern typical for the multidrug - resistant hospital strains, with resistance to clindamycin and ciprofloxacin. they belonged to ribotypes distinct from the outbreak clone, and pfge confirmed these isolates were unrelated to mw2 (figure 2). none of the 27 environmental samples collected in november 2002 yielded positive cultures for mrsa. a total of 4,345 isolates of s. aureus were collected in the 3 surveillance studies conducted in 1999, 2001, and 2003 ; susceptibility data for these isolates are given in table 2. the 1,913 mrsa isolates, 118 (6%) possessed the screened phenotype (susceptible to both clindamycin and fluoroquinolones). among the 118 isolates, a total of 11 isolates possessed the same ribotype pattern as the outbreak clone, mw2. sources of the cultures included skin and soft - tissue in 7 patients, blood / sterile body fluid in 3 patients, and the genital tract in 1 patient. the number of isolates resembling mw2 remained relatively constant during the 3 surveillances (4 in 1999, 3 in 2001, and 4 in 2003). this report characterizes the nosocomial transmission of the ca - mrsa strain mw2 among healthy newborns and, possibly, a postpartum woman. symptoms developed in 3 patients 224 days after hospitalization ; 2 may have acquired the bacteria in the hospital or the community. an eighth patient, a mother with catheter - site infection, had an unrelated strain with a pattern suggestive of a hospital - associated strain. the source of the outbreak and mechanism of transmission were not evident, as no cultures of staff members or the environment yielded this particular strain of mrsa. transmission may have occurred after mw2 was introduced into the hospital by transient colonization of healthcare workers or by contamination of shared medical equipment. the infection control measures enacted in response to the initial cases may have had a role in controlling the outbreak. widespread screening of healthcare workers for mrsa did not detect the outbreak strain in this and another report (12). while a potential role for this practice can not be excluded, current evidence does not support routinely implementing widespread screening for ca - mrsa. in the pediatric population, risk factors associated with mrsa infections include premature birth or low birth weight, chronic underlying diseases, prolonged hospitalization, invasive or surgical procedures, indwelling catheters, and prolonged use of antimicrobial agents (2225). prior outbreaks involving the pandemic strain phage type 80/81 were characterized by high colonization rates among infants discharged from nurseries and subsequent transmission to family members (26). in this report, infection developed in the outpatient setting for 2 patients (following an admission on the involved unit), which suggests carriage of mw2 from the hospital back into the community. unrecognized ca - mrsa colonization during hospitalization could become an additional method of its dissemination in the community. increased prevalence of ca - mrsa has been reported in chicago, los angeles, texas, and minnesota (2,3,27,28). in new york city, ca - mrsa appears less common ; 1 investigation reported mrsa carriage in 0.26% of children and their guardians (29). in our present report, a retrospective analysis of isolates collected from citywide surveillance studies conducted from 1999 to 2003 suggests that 1% of all mrsa isolates in brooklyn are genotypically related to the prototypical north american ca - mrsa, mw2. since only mrsa isolates that were susceptible to both clindamycin and ciprofloxacin were analyzed, this analysis probably underestimates the true prevalence. other strains of ca - mrsa (e.g., usa 300) and usa 400 strains that acquired resistance to these antimicrobial agents would have been missed by our screening methods. the introduction of ca - mrsa strains into neonatal units represents an especially serious challenge. many of the infections caused by these strains, including some in our report, can be unusually severe and life - threatening (11). careful vigilance involving surveillance, identification of these dangerous strains, and implementation of infection control measures, should be helpful in preventing further transmission both within and outside of the hospital.	community - associated methicillin - resistant staphylococcus aureus (ca - mrsa) has rarely been reported in the hospital setting. we report an outbreak of 7 cases of skin and soft tissue infections due to a strain of ca - mrsa. all patients were admitted to the labor and delivery, nursery, or maternity units during a 3-week period. genetic fingerprinting showed that the outbreak strain was closely related to the usa 400 strain that includes the midwestern strain mw2. all isolates contained the staphylococcal chromosome cassette mec type iv. genes for panton - valentine leukocidin and staphylococcal enterotoxin k were detected in all isolates, and most contained other enterotoxin genes. testing of nearly 2,000 mrsa isolates collected during citywide surveillance studies from 1999 to 2003 showed that 1% were genetically related to mw2. ca - mrsa strain mw2 has been present in this region at least since 1999. this study documents the spread of this strain among healthy newborns at 1 hospital.
it has been claimed that tertian malaria had been completely eradicated in the latter part of 1970 in korea. but since 1993, this tertian malaria has reemerged to infect soldiers and civilians living near the armistice line, resulting in 1,724 cases in 1997. also, imported malaria from an overseas trip has become a medical problem to the extent of calling attention. reports have appeared calling attention to what has been termed primaquine resistance in plasmodium vivax in korea. we present a case of primaquine resistant tertian malaria which was thought to be relapsed because of loss of radical cure at initial treatment. a 50-year - old man presented on november, 1997 with high fever, chills and splenomegaly. three weeks before admission, he had traveled to ethiopia where he had remained for 10 days without prophylactic chemotherapy against malaria. the temperature was 39c, the pulse was 100/min and the respiration rates were 22/min. a physical examination was normal, except for a nontender, firm splenomegaly exceeding 5 cm below the costal margin. laboratory examinations showed hemoglobin 16.1 gm / dl, white blood cell count 7,510/mm, platelet count 49,100/mm, alkaline phosphatase 248 iu / l, alanine aminotransferase 165 iu / l, aspartate aminotransferase 89 iu / l. at that time, microscopic examination of a blood smear was said to show malaria (p.vivax) and a diagnosis of malaria was made. after treatment with chloroquine (750 mg as a loading dose and then 350 mg each 6, 24, 48 hours later), he felt well but subsequently did not receive primaquine because of the physician s mistake. laboratory examinations showed hemoglobin 16.5 gm / dl, white blood cell count 4,150/mm, platelet count 26,300/mm. microscopic examination of a stained blood smear for malarial organism (38,180/l) was positive. the patient was given a conventional three - day course of chloroquine with relapsed malaria. on the following day, he became afebrile and reevaluation of blood smears showed decrease in the number of parasite counts(3,480/l). he subsequently was given primaquine (15 mg base daily for 14 days) with improvement. the test of g-6pdh (glucose-6-phosphate dehydrogenase) deficiency was negatived(11.7 u / g). about three months after the first relapse, however, he revisited the hospital with fever, headache and chills. physical examination showed no change, except that the spleen was felt 4 cm below the costal margin. the patient was treated with chloroquine in the same dose as the in first attack. on the next day he subsequently received primaquine (22.5 mg daily for 21 days) without side effects from the drug. although it has been eradicated from temperate zones, increasing numbers of travelers from temperate areas each year visit tropical countries where the disease remains a major cause of morbidity and death. relapse occurs with p.vivax infections because delayed developmental forms of the parasite, called hypnozoites, are present in the liver. hypnozoites can mature months to years later to cause clinical disease. after maturing and multiplying in the liver, a radical cure is achieved for p.vivax infections by the use of both blood - stage antimalarial drugs and primaquine, which is the only available drug that can destroy hypnozoites. to provide radical cure of p.vivax malaria, treatment must be prescribed to eliminate the liver stage of the parasites, otherwise intermittent relapses with clinical symptoms will continue. usually, after acute phase therapy with chloroquine, patients with p.vivax are treated with the standard course of primaquine, i.e. 15 mg base / day for 14 days, as curative therapy. primaquine - resistant strains have been reported from papua new guinea, south - east asia and central and south america. cases of primaquine treatment failure have also been reported in patients who visited kenya, sudan and ethiopia. the interval between primary infection and relapse varies with differing strains of p.vivax-chesson strain from papua new guinea relapsing rapidly, at intervals of 28 days ; strains from southern china may relapse on an approximately annual basis. such strains appear to show intrinsic differences in sensitivity to 8-aminoquinolines, the agents most commonly used to eradicate the liver stage. studies carried out in the western pacific region soon after world warii, and predominantly involving the chesson strains, indicated that a regimen of primaquine base 15 mg / day for 14 days led to failure in over 30 % of cases. it would appear that this investigation regimen was selected solely on the basis of limiting potential toxicity. common practice over subsequent decades within this region has been to use a regimen of primaquine base 22.530 mg / day for 14 days to ensure a high chance of parasite eradication. in contrast, however, studies during the vietnam war determined that strains from south - east asia were more primaquine - sensitive and were almost entirely eradicated with primaquine base 15 mg / day for 14 days. strains from south - east asia and central and south america have also been reported to relapse after standard regimens of primaquine. most authorities agree that it is reasonable to treat patients who acquire their infections from these areas with a higher dose regimen. to reduce side effects, a regimen of 15 mg daily of primaquine base for 28 days has been used instead of 30 mg base daily for 14 days, under the assumption that it is the total, cumulative dose of primaquine that is important in eliminating hypnozoites. unfortunately, there are no data to support the longer duration regimen. human and animal studies have only used total doses scheduled over a shorter time interval (60 mg base daily for 7 days versus 30 mg base daily for 14 days) in showing equivalent cure rates. it is curious that primaquine resistance emanates from areas where higher doses of primaquine have been used for longer periods. whether this increased anti - animal and human studies of sub - therapeutic doses of primaquine in p.vivax infections resulted only in resistance in the erythrocytic stages of the life cycle. while it has been suggested that the apparent increasing resistance to primaquine in p.vivax actually reflects unrecognized chloroquine - resistance in this parasite, at present, recurrence of vivax parasitemia after primaquine therapy and > 28 days from initial infection more often represents primaquine rather than chloroquine failure. cause of the first relapse in our patient is thought to be inadequate regimen rather than chloroquine resistance : primaquine was not prescribed at initial infection. second attack was due to primaquine resistance, since the peripheral blood smear of our patient was normal up to three days after the treatment (chloroquine) and relapse took place after three months. primaquine may cause nausea and abdominal pain, particularly if taken on an empty stomach and, more important, oxidant hemolysis with methemglobinemia, anemia and, sometimes, hemoglobinuria. patients with a deficiency of glucose-6-phosphate dehydrogenase are particularly vulnerable to oxidant hemolysis, and primaquine is contraindicated in patients with severe form of the deficiency. in places where mild variants of glucose-6-phosphate dehydrogenase deficiency are common, primaquine (0.8 mg of base per kilogram ; adult dose, 45 mg) should be given once a week for six weeks for a radical cure. it is imperative to establish the most appropriate regimen with primaquine for the curative treatment of relapsed vivax malaria after the completion of chloroquine - primaquine therapy.	in plasmodium vivax and plasmodium ovale malaria, some of the liver stage parasites remain dormant. the activation of these dormant forms (called hypnozoite) can give rise to relapse weeks, months or years after the initial infection.to prevent relapses, a course of primaquine may be given as terminal prophylaxis to patients. different strains of plasmodium vivax vary in their sensitivity to primaquine and, recently, cases of relapse of plasmodium vivax after this standard primaquine therapy were reported from various countries.we reported a case of primaquine resistant malaria which initially was thought to be relapsed caused by loss of terminal prophylaxis.
in general, the gastric tube is used for reconstruction after an esophagectomy, and the reconstruction may be performed via the posterior mediastinum, retrosternal, or presternal route. as the posterior mediastinum route is the shortest and most natural, this route is most often chosen. however, in cases of locally advanced esophageal cancer where there are concerns about local recurrence, the retrosternal route may be chosen in order to minimize the risk of tumor invasion or irradiation of the gastric tube. in which route, we adopted a cervical anastomosis, so that the anastomosis was located behind the sternum. in gastric tube reconstructions, slow peripheral circulation of the gastric tube, tension, and anastomotic complications, such as leakage or stricture, occasionally occur. leakage induces local inflammation around the anastomosis, with scarring occurring as a result of the inflammation ; ultimately an anastomotic stricture is formed. when we perform gastric tube reconstructions, we always carefully perform end - to - side esophagogastric anastomoses, using a circular stapler to avoid bending the anastomosis, but regardless of this, strictures occasionally occur. for anastomotic strictures, bougie dilations or endoscopic balloon dilation techniques are often performed, but in some cases, frequent dilation is required and the resultant expansion may still be insufficient. additionally, new or recurrent cancer may occur in the esophageal remnant or at the anastomotic site. however, in the case of cervical anastomoses, approaching the anastomosis is difficult because it is located on the dorsal side of the sternum, and advanced adhesions to the surrounding tissues are often encountered. for such cases, we have adopted a procedure to approach the anastomosis via the sternum ; the procedure involves resection of the proximal left clavicle and manubrium. first, an incision is made in the left half of the neck wound that resulted from the previous operation, followed by a midline incision (fig. the platysma is peeled back and the sternocleidomastoid, sternothyroid, sternohyoid, and the left pectoralis major muscle are detached from the sternum and left clavicle (fig. release of the left sternoclavicular joint is accomplished by cutting through the center of the left clavicle with a wire saw, and removing the proximal left clavicle (fig. resection of the manubrium is then performed. because the gastric tube is extensively adherent to the manubrium, the manubrium is carefully shaped, using luer bone rongeur forceps, from the left proximal side of the manubrium to ensure an appropriate field of view (fig. 1d), thereby maximizing patient safety. in the case of cancer, a neck dissection may be performed, if necessary. subsequently, the esophagus and the gastric tube around the stricture are totally exposed and resected (fig. since the adhesion is not as severe around the proximal side of the remnant esophagus, the esophagus is encircled and lifted with cotton tape, prior to the anastomotic site being carefully detached. in this series of operations the left recurrent nerve is difficult to identify due to the severe adhesions ; we attempt to stay as far away from the trachea as possible and promote the dissection along the esophagus and gastric tube.fig. a an incision is made in the left half of the neck wound, created during the previous operation, along with a midline incision. b the sternocleidomastoid, sternothyroid, sternohyoid, and the left pectoralis major muscle are detached from the sternum and left clavicle. c release of the left sternoclavicular joint, by cutting the center of the left clavicle and removing the proximal left clavicle. d the manubrium is resected and shaped using luer bone rongeur forceps, from the left proximal side. e exposure and resection of the esophagus and gastric tube around the stricture. at first, the esophagus is encircled and lifted with a cotton tape. the anastomotic site is carefully detached, being careful not to damage the left recurrent nerve. a an incision is made in the left half of the neck wound, created during the previous operation, along with a midline incision. b the sternocleidomastoid, sternothyroid, sternohyoid, and the left pectoralis major muscle are detached from the sternum and left clavicle. c release of the left sternoclavicular joint, by cutting the center of the left clavicle and removing the proximal left clavicle. d the manubrium is resected and shaped using luer bone rongeur forceps, from the left proximal side. e exposure and resection of the esophagus and gastric tube around the stricture. at first, the esophagus is encircled and lifted with a cotton tape. the anastomotic site is carefully detached, being careful not to damage the left recurrent nerve. f reconstruction is completed when the excision range is small, re - anastomosis is possible but requires a free jejunal interposition. in the case of re - anastomosis, we perform an end - to - end manual anastomosis with the albert lembert procedure. in the case of free jejunal interposition, we usually perform an end - to - side anastomosis for the proximal anastomosis and an end - to - end procedure for the distal one, using a circular stapler. the left cervical transverse artery, the left internal thoracic artery, the left internal or external jugular vein, or the left vertebral vein can be used for revascularization, depending on the position and length of the jejunal graft. finally, the surgical field is washed thoroughly with saline, vacuum drains are placed on both sides of the anastomosis, and the incised wound is sutured. this procedure was used for seven patients between april 2000 and march 2011 ; a summary of these cases is shown in table 1. three cases involved cancer of the esophageal remnant and four involved anastomotic strictures, with one of the anastomotic stricture cases being complicated by a gastric tube - bronchial fistula. the mean age of the patients was 69.9 years (range, 6576 years) and all of the patients were men. the mean operative time was 506 min (range, 374845 min), with an average blood loss of 297 ml (range, 180606 ml). esophagogastric anastomoses were performed in two cases, and free jejunal graft transplantations were performed in five cases. for the arterial grafts, the left internal mammary artery was chosen in one patient and the left cervical transverse artery was chosen in four patients. for the venous grafts, the left external jugular vein was chosen in two patients, and the left internal jugular vein, the left vertebral vein, and the left internal thoracic vein were each chosen in one patient.table 1summary of seven patients who underwent surgical reparation of anastomotic stricturescaseage (years)gendertime from first operation (months)causeoperation time (min)bleeding (ml)reconstructiongraft vesselsother findingscomplications174male20anastomotic stricture590606free jejunal graft interpositionleft transverse cervical arterydysphagialeft external jugular vein276male15anastomotic stricture400229esophagogastric anastomosisneck dissectionnone367male250residual esophageal cancer415180free jejunal graft interpositionleft transverse cervical arteryneck dissectionnoneleft internal jugular vein473male290residual esophageal cancer845418free jejunal graft interpositionleft transverse cervical arterypharyngolaryngoesophagectomy with neck dissectionnoneleft external jugular vein565male4anastomotic stricture375282esophagogastric anastomosissurgical site infection667male10anastomotic stricture480181free jejunal graft interpositionleft internal thoracic arteryjejunal graft necrosisleft internal thoracic vein767male190residual esophageal cancer435187free jejunal graft interpositionleft transverse cervical arterycombined resection of the left internal jugular vein with neck dissectiondysphagialeft vertebral vein summary of seven patients who underwent surgical reparation of anastomotic strictures surgical complications included jejunal graft necrosis in one patient (a reoperation was required) ; grade 2 dysphagia, by the clavien dindo classification, occurred in two patients ; and a deep, surgical site infection occurred in one patient. however, oral intake became possible in all cases, and none of the patients developed limited range of motion or other movement disorders of the neck and upper limbs as a result of the upper sternum and clavicle resections. in the case of a gastric tube reconstruction, leakage and scarring may occur at the site of the anastomosis, with an anastomotic stricture eventually forming. the bend in the anastomosis may worsen the stricture, leading to the patient s worsening nutritional status and an increased risk of aspiration. certainly, these strictures decrease the post - surgical quality of life (qol) for patients with esophageal cancer and also negatively impact the patient s prognosis. therefore, when an anastomotic stricture develops, bougie dilation or endoscopic balloon dilations are commonly performed. one report has suggested that these dilation techniques have an initial success rate of 78100 %, but approximately 50 % of the patients require a repeat dilation.1 in some cases, the cancer may also recur or new cancer may develop in the esophageal remnant or anastomosis. in addition, some patients require frequent dilation or sufficient extension can not be obtained even after repeated dilation. in patients with refractory benign esophageal strictures, electrocautery incisions, steroid injections, and esophageal stents24 however, these techniques are limited when a long stricture is present or when it is bent. in our division, anastomotic strictures are normally treated by endoscopic balloon dilation, but we have adopted the currently described surgical procedure for patients with severely degraded qol, resulting from the complications described earlier. the operation takes approximately 500 min, or longer, as it requires revascularization. nonetheless, the intraoperative blood loss is only approximately 300 ml. in the 1970s, orringer has already reported that resection of the manubrium, adjacent clavicles and ribs provides access to the upper thoracic esophagus.5 one published report described a tracheal approach, with a manubrium resection.6 there is also a report of an approach to the anastomotic stricture involving a manubrium resection.7 because resection of the manubrium and the left clavicle causes depression of the anterior chest wall, this procedure is cosmetically inferior to the manubrium resection approach. resection of the manubrium and left clavicle allows the motion of the neck and the upper limbs to be preserved. in terms of the surgical procedure, if only manubrial dissection is performed, then a sufficient field of view can not be obtained or the surgical field may be deepened. if advanced adhesions are present, adhesiolysis between the manubrium and the anastomosis may become difficult or cause damage to other organs. at first, we removed the proximal left clavicle, which makes the dissection relatively easy, and preserves the field of view and the working space. the manubrium can then be excised, piece by piece, using luer bone rongeur forceps from the left proximal side of the manubrium. as a means of repairing a cervical esophagogastric anastomosis complication it is believed that stricturoplasty may be sufficient when the length of the stricture is short ; however, the indications for stricturoplasty are known to overlap with the indications for other interventions, such as electrocautery incisions or esophageal stents. for these reasons, and to ensure a complete cure of the stenosis, we do not perform simple stricturoplasties because we want to ensure complete cure of the stricture. the described procedure may be an acceptable alternative for patients who have life - threatening consequences or a significant decrease in qol and are resistant to conservative treatment.	in gastric tube reconstruction, anastomotic leakage and stricture occasionally occur. additionally, new or recurrent cancer may occur in the esophageal remnant or at the anastomotic site. such complications, after cervical anastomoses, led to our adoption of a procedure to approach the anastomosis by manubrium and proximal left clavicle resection. this procedure was applied to seven patients between april 2000 and march 2011. the mean age of the patients was 69.9 years (range, 6576 years) ; all were men. the mean operative time was 506 min (range, 374845 min), with an average blood loss of 297 ml (range, 180606 ml). esophagogastric anastomoses were performed in two cases, and free jejunal graft transplantations were performed in the remaining five cases ; oral intake became possible for all patients. limited range of motion or other movement disorders of the neck and upper limbs, due to the upper sternum and clavicle resection, were not observed. this invasive surgical procedure can be acceptable for patients who are facing life - threatening consequences or significant decreases in quality of life and are resistant to conservative treatment.
experimental birds : white leghorn chicks (n=12, male) at one day of age were commercially obtained from komatsu shukeijyo (matsumoto, japan) and reared in our laboratory given a commercial diet and water ad libitum and under controlled light condition (12 hr light : 12 hr darkness) up to one week of age. chicks were treated in accordance with the guideline for regulation of animal experimentation (1997) of faculty of agriculture, shinshu university. tissue samples : chicks were perfused with a mixture of 4% paraformaldehyde and 0.01% glutaraldehyde in phosphate buffer (ph7.6) following 0.75% nacl solution under anesthesia with diethyl ether. proximal and distal portions of ileum were immediately dissected out as the tissue samples and then immersed in the same perfusate for 5 hr at 4c. tissue samples were cut into small blocks and pieces and embedded in paraffin wax and epoxy resin, quetol 812, respectively according to each standard procedure. immunofluorescent technique : paraffin sections cut at 5 m thickness were treated with 2.5% normal donkey serum (ihr-8135, immunobioscience, mukilteo, wa, u.s.a.) for 20 min and incubated with the mouse monoclonal antibody against synthetic human glp-1 (aa 736 amide) (diluted to 1:2,000, a6104.1, immunodiagnostik, bensheim, germany) for 24 hr. after several washing with phosphate buffered saline (pbs), paraffin sections were subsequently incubated with rabbit anti - human (arg)-glp-2 serum (1:500, h-028 - 14, phenix pharmaceuticals, burlingame, ca, u.s.a.) for 24 hr. incubation of sections with the cocktail of fitc - labeled donkey anti - mouse ig g (1:100, gtx85337, genetex, irvine, ca, u.s.a.) and rhodamine - labeled donkey anti - rabbit ig g (1:100, 611 - 700 - 127, rockland immunochemicals, gillbertsville, pa, u.s.a.) thermo fisher scientific, fremont, ca, u.s.a.), observed and photomicrographed under a fluorescent microscope (axioimager, zeiss, gttingen, germany). the specificities of primary antibodies used in this study were documented by the manufacturers and in previous reports [6, 19 ]. primary antibodies against glp-1 and glp-2 mentioned above were preabsorbed with chicken / common turkey glp-1(736) amide (10m / ml, h-5824, bachem, bubendorf, switzerland) at 4c for 24 hr and then used for confirming the specificities of them. preabsorbed glp-1 monoclonal antibody showed the negative reaction, but preabsorbed glp-2 antiserum did the specific immunoreactivity. moreover, single immunofluorescent staining was carried out for each primary antibody and compared with double immunofluorescent staining. negative control sections were incubated with the normal donkey serum instead of the specific primary antibody or in the absence of the primary antibody. paraffin sections from rat ileum were used for positive control sections and showed the specific immunoreactivity for each primary antibody. the specificity of the secondary antiserum was controlled by the omission of the primary antibody. immunocytochemistry : ultrathin sections were made with an ultramicrotome (super nova, reichert - jung, vienna, austria) by using glass knives and mounted on nickel grids. ultrathin sections, pretreated with 1% sodium periodate solution and 1% normal donkey serum subsequently, were incubated with the mouse monoclonal antibody against glp-1 (1:8,000) overnight. after several washing with pbs, they were treated with colloidal gold (12 nm in diameter)-labeled donkey anti - mouse ig g serum (1:200, 715 - 205 - 150, jackson immuno research, west grove, pa, u.s.a.) for 2 hr, stained with ti blue (nisshin - em, tokyo, japan) and observed under a transmission electron microscope (jem-1400, jeol, tokyo, japan). double immunocytochemical staining was applied for the detection of colocalization of glp-1 with glp-2 at electron microscopic level. after incubation with the monoclonal antibody against glp-1, sections were subsequently incubated with rabbit anti - glp-2 serum (1:2,000). and then, ultrathin sections were treated with a mixture of colloidal gold (12 nm in diameter)-labeled donkey anti - mouse ig g serum mentioned above and colloidal gold (6 nm in diameter)-labeled donkey anti - rabbit ig g serum (1:200, 711 - 205 - 152, jackson immuno research) for 2 hr, stained with ti blue and observed under a transmission electron microscope. the specificity of the colloidal gold - labeled secondary antiserum was controlled by the omission of the primary antibody. morphometry : morphometrical analysis was carried out to characterize secretory granules of l - cells. the shortest and longest diameters of secretory granules were measured by using an image analyzer (ks400, carl zeiss, gttingen, germany). single immunofluorescent staining for glp-1 and glp-2 revealed that endocrine cells showing immunoreactivity for each peptide were scattered in the villous epithelium and crypt of the chicken ileum (fig. 1.immunofluorescent staining for glp-1 (a, c) and glp-2 (b, c) in the chicken distal ileum. a, b : single immunofluorescent staining for glp-1 (a) and glp-2 (b). both immunoreactive cells are scattered in villous epithelium and crypt of the distal ileum and show the similar localization to that indicated by double immunofluorescent staining. c, c : double immunofluorescent staining for glp-1 (c) and glp-2 (c). both immunoreactive cells showed the similar localization in the ileum to that indicated by double immunofluorescent staining as mentioned below and our previous observation. immunofluorescent staining for glp-1 (a, c) and glp-2 (b, c) in the chicken distal ileum. a, b : single immunofluorescent staining for glp-1 (a) and glp-2 (b). both immunoreactive cells are scattered in villous epithelium and crypt of the distal ileum and show the similar localization to that indicated by double immunofluorescent staining. c, c : double immunofluorescent staining for glp-1 (c) and glp-2 (c). bar=20 m. l - cells showing immunoreactivity for both glp-1 and glp-2 were observed in the whole ileum (figs. 1c, 1c and 2). they were located in epithelium of crypts and lower part of intestinal villi and showed comma - like or flask - like shape (fig. 2.double immunofluorescent staining for glp-1 (a) and glp-2 (b) in villous epithelium of the chicken distal ileum. l - cells showing immunoreactivity for both glp-1 and glp-2 have a long cytoplasmic process (small arrow) and are in contact with intestinal lumen (large arrows). l - cells showing immunoreactivity for only glp-1 were located in epithelium of lower and middle parts of intestinal villi (fig. double immunofluorescent staining for glp-1 (a) and glp-2 (b) in villous epithelium of the chicken distal ileum. l - cells showing immunoreactivity for both glp-1 and glp-2 have a long cytoplasmic process (small arrow) and are in contact with intestinal lumen (large arrows)., l - cells labeled with gold particles of 12 nm in diameter were found in epithelium of crypts and lower and middle parts of intestinal villi (fig. (a) low magnification view of l - cell showing glp-1-immunoreactivity and located in villous epithelium. bar=1 m. (b) high magnification view of a secretory granule from l - cell. particles of colloidal gold (12 nm in diameter) are diffusely arranged on a granule. (c) low magnification view of l - cells showing glp-1 and -2-immunoreactivity and located in epithelium of crypt. bar=1 m. (d) high magnification view of a secretory granule from l - cell. both sizes of particles of colloidal gold (6 and 12 nm in diameter) are diffusely arranged on a granule. (e) high magnification view of secretory granules of ec cell in chicken small intestine. gold particles were mainly found on secretory granules, but rarely on cytosol or other organelles. l - cells were flask - like or comma - like in shape (fig. they were covered apically with microvilli, so - called open - type endocrine cells. their secretory granules without halo were accumulated mainly in the basal cytoplasm of l - cells. they were round to oval in shape and labeled with gold particles of 12 nm in diameter (fig. 3b and 3d). they showed lower electron - density than that of secretory granules in enterochromaffine (ec) cells. ec cells having polymorphous secretory granules with the high electron density were observed in the intestinal epithelium, but gold particles were not located on their secretory granules (fig. morphometrical analysis indicated that the shortest and longest diameters of secretory granules of l - cells were 355 62 nm (mean sd) and 287 48 nm, respectively. electron micrographs of l - cells in the chicken distal ileum. (a) low magnification view of l - cell showing glp-1-immunoreactivity and located in villous epithelium. note that its apical surface is covered with microvilli. bar=1 m. (b) high magnification view of a secretory granule from l - cell. particles of colloidal gold (12 nm in diameter) are diffusely arranged on a granule. (c) low magnification view of l - cells showing glp-1 and -2-immunoreactivity and located in epithelium of crypt. bar=1 m. (d) high magnification view of a secretory granule from l - cell. both sizes of particles of colloidal gold (6 and 12 nm in diameter) are diffusely arranged on a granule. (e) high magnification view of secretory granules of ec cell in chicken small intestine. double immunocytochemistry showed that secretory granules of l - cells labeled with gold particles of 12 nm in diameter were also labeled with those of 6 nm in diameter, showing glp-2 immunoreactivity. these two sizes of gold particles were diffusely arranged on secretory granules (fig. the ratio between these two sizes of gold particles was almost equal on a secretory granule of l - cells. the present study clarified the colocalization of glp-1 with glp-2 as well as ultrastructural features of l - cells in the chicken small intestine by colloidal gold - labeling immunocytochemistry. l - cells in the chicken small intestine are characterized by microvilli covering their apical surface and many secretory granules showing moderate electron density. secretory granules without halo are relatively large and round or oval in shape, and glp-1 and glp-2 are stored in them. our previous studies at the light microscopic level have reported the morphological features and the distributional pattern of glp-1-immunoreactive cells in the chicken small intestine [11, 12 ]. according to these studies, glp-1-immunoreactive cells show comma - like or flask - like shape and are in contact with the intestinal lumen by their apical cytoplasmic process. in the present study, at the electron microscopic level, we also revealed that l - cells come into contact with the intestinal lumen by microvilli covering their apical surface. these findings indicate that l - cells are namely open - type of endocrine cells and receive chemical signals in the intestinal lumen, such as digests of ingested meal. in fact, glp-1 is released in response to food intake and exerts its physiological actions in mammals [2, 7 ]. our finding suggests that glp-1 is the meal - induced hormone also in the chicken. enteroendocrine cells have been classified into several types according to morphological features, e.g. shape, size and electron density of their secretory granules. some ultrastructural studies in the mammalian intestine have shown that l - cells are characterized by round, homogenous, large (about 300 nm in diameter) and electron - dense granules [3, 10, 14, 23 ]. in the present study, l - cells in the chicken intestine were also characterized with secretory granules showing similar features to those in mammalian l - cells mentioned above. electron density of secretory granules in chicken l - cells, however, is not similar to those in mammals. we identified ec cells together with l - cells in this study and found that these ec cells contained polymorphous and electron dense granules as reported in the previous study in the chicken duodenum. compared with secretory granules in ec cells, those in l - cells this difference in electron density of secretory granules is likely to be one of characteristic features of chicken intestinal l - cells. human glp-2 is a gastrointestinal hormone with 33% sequence homology to glucagon and shows the intestinotrophic endocrine / paracrine actions. this peptide, consisting of 33-amino acids, is derived from proglucagon by its posttranslational processing and secreted from intestinal l - cells. thus, two forms of glp, glp-1 and -2, are synthesized from the same precursor and secreted from the same cells in the mammalian intestine. our immunocytochemical findings provide the prediction of cosecretion of glp-1 with glp-2 from the same l - cells also in the chicken small intestine. a double immunofluorecent study demonstrated that l - cells showing the colocalization of glp-1 with glp-2 were mainly located in epithelium of crypts and lower part of villi of chicken small intestine. moreover, l - cells showing immunoreactivity for glp-1 only were observed in epithelium of lower and middle parts of villi. considering these findings at electron and light microscopic levels, it is possible that glp-1 and -2 are costored in the same secretory granules, but secreted from the same l - cells separately. in conclusion, l - cells in the chicken small intestine are characterized with microvilli covering their apical surface and large secretory granules showing moderate electron density. colocalization of glp-1 with glp-2 in the same l - cells is also demonstrated, but it is suggested that these two hormones are secreted from the same cells separately.	abstractcolocalization of glucagon - like peptide (glp)-1 with glp-2 in l - cells was investigated in the chicken ileum by using double immunofluorescent and immunocytochemical techniques. ultrastructural features of l - cells were also clarified in this study. l - cells showing immunoreactivity for both glp-1 and glp-2 were distributed in the whole ileum. they showed comma - like or flask - like shape and were located in epithelium of crypts and lower part of intestinal villi. l - cells showing glp-1-immunoreactivity only were found in epithelium of lower and middle parts of intestinal villi. transmission electron microscopy indicated that l - cells identified by colloidal gold - labeled immunocytochemistry were covered apically with microvilli, open - type and contained many secretory granules in their perikarya. these secretory granules without halo were round to oval in shape and showed moderate electron density. the longest and shortest diameters of secretory granules were 355 62 nm (mean sd) and 287 48 nm, respectively. double labeling immunocytochemistry using two different sizes of particles (6 and 12 nm in diameter) of colloidal gold revealed that glp-1 colocalized with glp-2 in the same secretory granules. this study advances new morphological data about the endocrine system of the chicken small intestine.
insulin resistance (ir) plays a crucial role in the pathophysiology of metabolic syndrome (mets), which is associated with an increased risk of cardiovascular disease and type 2 diabetes. from the standpoint of primary prevention, it is important to identify the patients at risk of mets, especially at an early stage when ir contributes to the clustering of borderline metabolic risk factors. homeostasis model assessment of ir (homair) is a useful model for assessing ir in largescale clinical research, and it has been validated by the gold standard method the hyperinsulinemiceuglycemic clamp technique. healthassociated reference interval of homair, which covers the central 95% of 2153 healthy japanese subjects, by applying the stringent c28a3 document from the clinical and laboratory standards institute. we have established the reference interval for homair as between 0.4 and 2.4, and proposed that homair 2.5 be considered a reasonable indicator of ir in a japanese population as recommended by the japan diabetes society. healthassociated reference interval and is defined for use by clinicians to diagnose or manage patients. the present study focused on ir as a marker of earlystage mets and aimed to establish a an optimal cutoff point for homair to discriminate mets in nondiabetic japanese subjects was determined by receiver of the 7305 healthcheck examinees (4042 men and 3263 women) who first visited the health evaluation and promotion center at tokai university hachioji hospital between april 2007 and march 2011, 6868 examinees (3727 men and 3141 women) were included in the present study after exclusion of those with fasting plasma glucose (fpg) 126 mg / dl and those on medication for diabetes. the present study was crosssectional in design, and was approved by the ethics committee of tokai university school of medicine (11r096) and complied with the helsinki declaration. waist circumference (wc) was assessed at the end of expiration, measuring the minimum circumference at the level of the umbilicus to the nearest 0.1 cm. blood pressure (bp) was measured at the right upper arm with the patient in a sitting position. fasting serum immunoreactive insulin (iri) was measured by fluorescenceenzyme immunoassay (st aiapack iri ; toso, tokyo, japan). the intra and interassay coefficients of variation were 1.42.3 and 2.64.6%, respectively, and crossreactivity with proinsulin molecules was 2.0%. homair was calculated as : fpg (in mg / dl) iri (in u / ml)/405. mets was diagnosed if subjects had increased waist circumference (85 cm for men and 90 cm for women) plus at least two of the following criteria : fpg 110125 mg / dl, hypertension (systolic bp 130 mmhg, diastolic bp 85 mmhg, or on medication) and dyslipidemia (tg 150 mg / dl, highdensity lipoprotein cholesterol < 40 mg / dl, or on medication). the roc curve of homair for detecting mets was produced, and the area under the curve (auc) with its 95% confidence interval (ci) was calculated. to determine the optimal point, the square root of [(1 sensitivity) + (1 specificity) ] was calculated, which is the point on the roc curve with the shortest distance from the upper left corner. spss statistics version 19.0 software (spss, chicago, il, usa) was used for statistical analyses. the average homair was 1.63 for men and 1.36 for women. among the 3727 men and 3141 women, mets was diagnosed in 594 men (15.9%) and 81 women (2.6%). homair values were significantly higher in mets subjects (2.68 1.70 for men and 3.21 2.44 for women) compared with nonmets subjects (1.43 0.90 for men and 1.31 0.83 for women). the auc (95% ci) was 0.794 (0.7750.813) for men and 0.883 (0.8520.913) for women. the optimal point of homair yielding the minimum value of the square root of [(1 sensitivity) + (1 specificity) ] was 1.7 for both sexes, which was lower than the upper limit of the reference interval. a homair value of 1.7 was also the point that maximized the product of sensitivity and specificity, with a sensitivity and specificity of 73.4% and 70.5% for men, and 81.5% and 77.0% for women, respectively. the prevalence of homair 1.7 was 36.5% in men and 24.5% in women. hypertension is defined as systolic blood pressure (bp) 130 mmhg, diastolic bp 85 mmhg, or on medication. dyslipidemia is defined as triglycerides (tg) 150 mg / dl, highdensity lipoprotein cholesterol (hdlc) < 40 mg / dl, or on medication. bmi, body mass index ; firi, fasting immunoreactive insulin ; fpg, fasting plasma glucose ; homair, homeostasis model assessment of insulin resistance ; mets, metabolic syndrome. the receiver operating characteristic curves of homeostasis model assessment of insulin resistance (homair) for detecting metabolic syndrome in men and women. the optimal points were determined by calculating the square root of [(1 sensitivity) + (1 specificity) ]. the present study aimed to determine the optimal cutoff point for homair to discriminate mets, and the proposed optimal cutoff value was 1.7, based on the point producing the greatest discriminatory ability on roc analysis. the concept of ir as a common etiology of mets, proposed around 1990 and given various names including syndrome x and the insulin resistance syndrome, was included in the first diagnostic criteria for mets by the world health organization in 1998. however, in the later mets definitions, the central feature of the syndrome has shifted entirely away from ir to a collective of metabolic abnormalities that have better predictive value for cardiovascular disease, perhaps because there has been hardly any consensus on the cutoff points for the classification of ir. it is also problematic that the types of range or limit for homair (i.e. healthassociated or reference interval that is derived from the central 95% of a normal distribution of healthy reference individuals, there is no single standard method to determine a decisionbased range or limit. rather, it depends on the type of decision to be made, such as screening, assessment of risk, diagnosis of disease or disease management. roc analysis was used in the present study, which is one of the most useful approaches to specify the cutoff points that have the greatest clinical value in discrimination. in the present study, the optimal cutoff value for homair to discriminate mets was 1.7, as determined by roc analysis using 6868 nondiabetic japanese subjects. to the best of our knowledge, this is the first study to determine a cutoff point for homair to discriminate mets in a japanese population. several reports have determined homair cutoff points for the diagnosis of mets as 1.22, 1.7, 2.3 and 2.34 by roc analysis in other ethnic populations (table 2). the possible reasons for the inconsistency might be the differences in ethnicity and clinical backgrounds, including body mass index. therefore, the cutoff value specific for the japanese population is needed, and the present result shows higher sensitivity and specificity than the values of the other studies. aha / nhlbi, american heart association / national heart, lung, and blood institute ; atp iii, adult treatment panel iii ; homair, homeostasis model assessment of insulin resistance ; idf, international diabetes federation ; m, men ; w, women. the prevalence of homair 1.7 was 36.5% in men and 24.5% in women, whereas 15.9% of men and 2.6% of women had mets. the discrepancy between the prevalence of homair 1.7 and that of mets was larger in women than in men. when maximal sensitivity, as well as maximal specificity, is to be prioritized, the issue of a high falsepositive rate is inevitable. from the standpoint of primary prevention, we consider that it is much more important not to overlook mets than to exclude nonmets, and to give advice on lifestyle modifications to as many people as possible. in addition, we consider that it is not appropriate to diagnose mets by homair, because the prevalence of mets was 32.1% for men and just 8.6% for women, even in the subjects with homair 1.7. in conclusion, homair = 1.7 was determined as the optimal cutoff value for identifying subjects at high risk for mets. with the aim of health guidance for mets, we propose that homair < 1.7 should be considered as a target.	abstractwe have recently established a healthassociated reference interval of homeostasis model assessment of insulin resistance (homair) between 0.4 and 2.4. in the present study, the aim was to establish a decisionbased limit of homair for the discrimination of metabolic syndrome (mets) in nondiabetic japanese subjects. the receiver operating characteristic curve of homair for detecting mets was developed using data from 6868 nondiabetic subjects (3727 men, 3141 women). the optimal cutoff point was determined based on the point that yielded the minimum value of the square root of [(1 sensitivity)2 + (1 specificity)2 ]. homair = 1.7 was determined as the optimal cutoff value, with a sensitivity and specificity of 73.4% and 70.5% for men, and 81.5% and 77.0% for women, respectively. in conclusion, the optimal cutoff value for homair to discriminate mets in nondiabetic japanese subjects appears to be 1.7. (j diabetes invest, doi : 10.1111/j.20401124.2012.00194.x, 2012)
composite pheochromocytoma (pc) is a rare neoplasm that typically arises in the adrenal medulla as a mixture of pc and other tumors of neural origin, including peripheral neuroblastic tumors, malignant peripheral nerve sheath tumors, and neuroendocrine carcinomas (1, 2). the frequency of composite pcs in the adrenal gland has been estimated to be 4%, and the absence of s-100 protein as new criteria for recurrence and a high risk of malignancy. it has also been revealed that the incidence of malignancy in pcs is much greater with sdhb mutations than without (58). a deletion of the sdhb gene has recently been associated with composite paraganglioma with nbl (59). in the present case, the pc component was stained positively for sdhb but had histological features consistent with a pass of 7 points, a ki-67 proliferative index of 5.1%, and the focal absence of sustentacular cells staining positive for s-100 protein on immunohistochemical analysis. these findings suggested that the pc component of the present case of composite pc might be malignant but lacking any clinically detectable metastases at the current stage. in our previous report (37), erk5 participated in neuronal growth and catecholamine biosynthesis, and ankrd1, a target molecule of erk5, regulated th in an erk5-dependent manner. unlike normal chromaffin cells in the adrenal medulla, erk5 regulation of catecholamine levels is disrupted in human pcs (37), which may be because some cases of pc show few sympathetic symptoms associated with catecholamine overproduction while others behave marginally in malignancy, as a consequence of the aberrant role of erk5 in tumor biology. further follow - up of the present case and examination of more cases of composite pcs is therefore necessary to clarify whether the tumor itself is benign or malignant. we herein reported on a very rare case of adrenal composite pc concomitant with gnbl that was incidentally detected and clinically asymptomatic, despite catecholamine overproduction, and had not been metastatic or recurrent in the approximate 6.5 years since initial diagnosis. the pc component of the tumor demonstrated pathological characteristics consistent with a pass of 7 points, a maximum ki-67 proliferative index of 5.1%, the focal absence of sustentacular cells, and a lack of any genetic aberration in the sdhb gene. the gnbl component of the tumor showed dna hyperploidy but no amplification of n - myc. tumor cells of the pc and gnbl components expressed erk5 and ankrd1 protein variably cell by cell, inconsistent with diffuse expression of th, a key enzyme which produces catecholamines. these findings suggest that the erk5/ankrd1 signaling cascade may aberrantly play more roles in tumor growth in composite pcs than in the normal adrenal medulla. our findings support the potentially malignant nature of the pc component in the present case of composite pc - gnbl. however, further long - term follow - up and large - scale studies of this rare disease will be needed to more definitively evaluate the oncological outcome. written informed consent was obtained from the patient for publication of this case report, any accompanying images, the clinical data, and the results of the tumor genetics analyses. a copy of the written consent form is available for review by the editor of this journal. the present study was performed in accordance with the principles embodied in the declaration of helsinki and was approved by the ethical committee of yamagata university faculty of medicine (h25 - 98 and h27 - 122). written informed consent was obtained from the patient for publication of this case report, any accompanying images, the clinical data, and the results of the tumor genetics analyses. a copy of the written consent form is available for review by the editor of this journal. the present study was performed in accordance with the principles embodied in the declaration of helsinki and was approved by the ethical committee of yamagata university faculty of medicine (h25 - 98 and h27 - 122).	composite pheochromocytoma (cpc) is extremely rare, arising in the adrenal medulla as a mixture of pc and other tumors of neural origin. we herein report on a case of adrenal incidentaloma post - operatively diagnosed as cpc with ganglioneuroblastoma (gnbl). the pc component had 7 points on the pass, a ki-67 index of 5.1%, a focal absence of sustentacular cells, and no genetic aberrations in succinate dehydrogenase subunit b. the gnbl component exhibited no n - myc amplification. tumor cells of both components were stained positively for extracellular signal - regulated kinase 5 and ankyrin repeat domain 1. the aberrant activation of growth signaling may play a role in the marginal malignancy of cpc.
sarcoidosis is a systemic disease of unknown etiology with systemic inflammation leading to formation of granulomas. macrophages and activated lymphocytes, an immunological hallmark of sarcoidosis, are also involved in the process of thrombin activation and fibrin formation [2, 3 ]. the association between sarcoidosis and venous thromboembolism (vte) has been reported recently [4, 5 ], nevertheless it is still not clear if sarcoidosis is a risk factor for vte. thus, the aim of the present study was to describe possible mechanisms that could be responsible for the increased occurrence of vte in sarcoidosis. a higher risk of pulmonary embolism (pe) in sarcoidosis patients has been reported recently, according to data from the uk, with a risk ratio of 2.0 (95% ci : 1.1 - 3.4), in patients under 65 years of age, comparing to a reference cohort. swigris. found pe in 2.5% of us decedents with sarcoidosis, regardless of gender, race or age. in the retrospective analysis of clinical outcome and comorbidities among 798 sarcoidosis patients who have been hospitalized in the 2 pulmonary department of our institution between 2004 and 2014 the mechanisms that could predispose sarcoidosis patients to the development of vte may be related to several factors : activity of inflammation, clinical picture of sarcoidosis or comorbidities. a close anatomic relation between the site of active sarcoidosis and thrombus formation was described in the literature : mural thrombus in myocardial sarcoidosis, cerebral vein thrombosis in neurosarcoidosis [79 ], thoracic vein thrombosis in mediastinal sarcoidosis [1012 ], portal vein hypertension in hepatic sarcoidosis, suggesting the local hypercoagulability status as the cause of thrombosis. local hypercoagulability might have been the consequence of active granulomatous inflammation with an increased concentration of inflammatory markers [1419 ]. we have found recently features of disease activity : elevated crp, esr, and ace, monocytosis and hypergammaglobulinemia in our patients with sarcoidosis who developed vte (unpublished data). nonspecific hypergammaglobulinemia reflecting the b cell activation, which is observed in the active disease may indicate a more generalized inflammatory process, although the definitive role for humoral immunity in the pathogenesis of sarcoidosis is not established. the regulatory influence of cytokines produced by local mononuclear phagocytes results in granulomatous inflammation in sarcoidosis patients [3, 21, 22 ]. demonstrated that peripheral blood monocytes incubated with highly purified (> 90%) human crp for 6 hours present a significant increase in the tissue factor (tf) expression and acquire a significant pro - coagulant activity. the same phenomenon might be responsible for the increased pro - coagulant ability of granulomatous inflammation in sarcoidosis. in sarcoidosis patients, as compared to normal control subjects, an enhanced activity of bal fluid tf and plasma factor vii were found. only patients with stage ii or stage iii disease had a consistently elevated procoagulant activity that corresponded to the site most involved radiographically. found that dd plasma levels correlate with activation of the proinflammatory cytokine cascade [interleukin (il)-6, il-8, tumor necrosis factor (tnf-) but not with il-10. tumor necrosis factor (tnf-) is a key cytokine in the pathogenesis of sarcoidosis and may indicate the activity of the disease [26, 27 ]. elevated tnf- concentration in active sarcoidosis might be responsible for the increased risk of vte. locally derived il-6 and il-8 were increased in sarcoidosis and correlated with activity of this granulomatous lung disease. interleukin 10, an anti - inflammatory cytokine, expresses protective potential against venous thrombosis [14, 28 ]. a down - modulating mechanism resulting in the spontaneous resolution of sarcoid alveolitis is partially controlled by an increased local secretion of il-10. the question whether an increased il-10 concentration is combined with the protection against vte in sarcoidosis, needs further investigations. the risk factor for the development of vte in sarcoidosis might be related to clinical characteristics such as : compression of pulmonary arteries by the enlarged mediastinal lymph nodes. nevertheless, according to the literature, mediastinal lymphadenopathy was combined rather with thoracic vein thrombosis than pulmonary artery thrombosis [1012 ]. patients with chronic disabling sarcoidosis on steroid therapy (resulting in immobilization because of pulmonary fibrosis, pulmonary hypertension, osteoporosis with fractures, obesity etc.) should be at the highest risk of vte. nevertheless, our own experience indicates that sarcoidosis patients in whom vte was recognized, recruited from a group with active stage ii sarcoidosis, receiving no treatment at the time of this complication, and not disabled otherwise. in recently recognized three cases of pe in the course of sarcoidosis we have found some similarities. all of them concerned middle - aged, non - smoking males with active sarcoidosis according to international consensus. none of them had severe disabling sarcoidosis with respiratory insufficiency at the time of pe development. none of our patients suffered from pulmonary hypertension prior to pe diagnosis and no - one was on immunosuppressive treatment. no clinically significant organ involvement was seen although in one case splenomegaly and peripheral lymph nodes sarcoidosis were diagnosed. extrinsic arterial compression at a mediastinal or hilar level was not diagnosed in pulmonary angiography. as the histopathological diagnosis was based on fine needle biopsy, it was impossible to conclude about the presence of vascular granulomata as a risk factor for local thrombosis [13, 32 ]. in all our cases, the vte had favorable course with no serious late complications. in all cases we observed favorable course of pulmonary sarcoidosis with no impact on pft and exercise ability. regarding some similarities in the clinical picture of sarcoidosis in our set of patients, we hypothesized that there might exist a prothrombotic phenotype of sarcoidosis, probably related rather to the inflammatory process than to clinical characteristics of patients. nevertheless, swigris. found that sarcoidosis decedents with pe were even less likely than those without pe to have certain other conditions predisposing to pe, including myocardial infarction or ischemia, congestive heart failure, cardiomyopathy, cardiac dysrhythmia, sudden cardiac death, pneumonia or stroke contributing to death. one of the diagnostic criteria for antiphospholipid syndrome (aps) which by definition are characterized by recurrent thromboembolic events, were detected in 38% of sarcoidosis patients. the presence of antiphospholipid antibodies was associated with extra - thoracic lesions and persistence of abnormal radiological findings in sarcoidosis, and were judged by the authors to be a useful marker for prolonged disease. the authors did not search for vte occurrence in that group of sarcoidosis patients, although they should be considered at a high risk of such events. on the other hand, in numerous case reports concerning sarcoidosis complicated by vte, the level of antiphospholipid antibodies was not examined [610, 13 ]. thus, so far it has been impossible to conclude based on the literature whether the increased risk of vte in sarcoidosis is combined with the presence of aps. in our group of patients with sarcoidosis complicated by vte nevertheless, at least 50% of thrombotic episodes in individuals with factor v leiden mutation are provoked by additional predisposing factors. to the best of our knowledge, only one case of sarcoidosis with factor v leiden mutation, presenting with cerebral venous thrombosis was described in the literature. authors concluded that since most factor v leiden gene heterozygous individuals do not develop clinical thrombosis, the venous thrombosis of their patient suggested convergence of an inherited predisposition (heterozygous factor v leiden mutation) with an acquired thrombogenic stimulus (sarcoidosis). we have recently described a case of sarcoidosis complicated by pe in a sarcoidosis patient, in whom subsequently congenital factor v leiden mutation was found (data not published). we observed the favorable course of pulmonary sarcoidosis (total resolution of chest lymphadenopathy) with no impact on pft and exercise ability during anticoagulation therapy in our patient with pe. a persistent disappearance of the pulmonary infiltrates in the patient with sarcoidosis during anticoagulant treatment for venous thrombosis has already been observed. unfractionated heparin (ufh) and lmwh proved to have the anti - inflammatory properties. a close anatomic relation between the site of active sarcoidosis and thrombus formation was described in the literature : mural thrombus in myocardial sarcoidosis, cerebral vein thrombosis in neurosarcoidosis [79 ], thoracic vein thrombosis in mediastinal sarcoidosis [1012 ], portal vein hypertension in hepatic sarcoidosis, suggesting the local hypercoagulability status as the cause of thrombosis. local hypercoagulability might have been the consequence of active granulomatous inflammation with an increased concentration of inflammatory markers [1419 ]. we have found recently features of disease activity : elevated crp, esr, and ace, monocytosis and hypergammaglobulinemia in our patients with sarcoidosis who developed vte (unpublished data). nonspecific hypergammaglobulinemia reflecting the b cell activation, which is observed in the active disease may indicate a more generalized inflammatory process, although the definitive role for humoral immunity in the pathogenesis of sarcoidosis is not established. the regulatory influence of cytokines produced by local mononuclear phagocytes results in granulomatous inflammation in sarcoidosis patients [3, 21, 22 ]. demonstrated that peripheral blood monocytes incubated with highly purified (> 90%) human crp for 6 hours present a significant increase in the tissue factor (tf) expression and acquire a significant pro - coagulant activity. the same phenomenon might be responsible for the increased pro - coagulant ability of granulomatous inflammation in sarcoidosis. in sarcoidosis patients, as compared to normal control subjects, an enhanced activity of bal fluid tf and plasma factor vii were found. only patients with stage ii or stage iii disease had a consistently elevated procoagulant activity that corresponded to the site most involved radiographically. found that dd plasma levels correlate with activation of the proinflammatory cytokine cascade [interleukin (il)-6, il-8, tumor necrosis factor (tnf-) but not with il-10. tumor necrosis factor (tnf-) is a key cytokine in the pathogenesis of sarcoidosis and may indicate the activity of the disease [26, 27 ]. elevated tnf- concentration in active sarcoidosis might be responsible for the increased risk of vte. locally derived il-6 and il-8 were increased in sarcoidosis and correlated with activity of this granulomatous lung disease. interleukin 10, an anti - inflammatory cytokine, expresses protective potential against venous thrombosis [14, 28 ]. a down - modulating mechanism resulting in the spontaneous resolution of sarcoid alveolitis is partially controlled by an increased local secretion of il-10. the question whether an increased il-10 concentration is combined with the protection against vte in sarcoidosis, needs further investigations. the risk factor for the development of vte in sarcoidosis might be related to clinical characteristics such as : compression of pulmonary arteries by the enlarged mediastinal lymph nodes. nevertheless, according to the literature, mediastinal lymphadenopathy was combined rather with thoracic vein thrombosis than pulmonary artery thrombosis [1012 ]. patients with chronic disabling sarcoidosis on steroid therapy (resulting in immobilization because of pulmonary fibrosis, pulmonary hypertension, osteoporosis with fractures, obesity etc.) should be at the highest risk of vte. nevertheless, our own experience indicates that sarcoidosis patients in whom vte was recognized, recruited from a group with active stage ii sarcoidosis, receiving no treatment at the time of this complication, and not disabled otherwise. in recently recognized three cases of pe in the course of sarcoidosis we have found some similarities. all of them concerned middle - aged, non - smoking males with active sarcoidosis according to international consensus. none of them had severe disabling sarcoidosis with respiratory insufficiency at the time of pe development. none of our patients suffered from pulmonary hypertension prior to pe diagnosis and no - one was on immunosuppressive treatment. no clinically significant organ involvement was seen although in one case splenomegaly and peripheral lymph nodes sarcoidosis were diagnosed. extrinsic arterial compression at a mediastinal or hilar level was not diagnosed in pulmonary angiography. as the histopathological diagnosis was based on fine needle biopsy, it was impossible to conclude about the presence of vascular granulomata as a risk factor for local thrombosis [13, 32 ]. in all our cases, the vte had favorable course with no serious late complications. in all cases we observed favorable course of pulmonary sarcoidosis with no impact on pft and exercise ability. regarding some similarities in the clinical picture of sarcoidosis in our set of patients, we hypothesized that there might exist a prothrombotic phenotype of sarcoidosis, probably related rather to the inflammatory process than to clinical characteristics of patients. nevertheless, swigris. found that sarcoidosis decedents with pe were even less likely than those without pe to have certain other conditions predisposing to pe, including myocardial infarction or ischemia, congestive heart failure, cardiomyopathy, cardiac dysrhythmia, sudden cardiac death, pneumonia or stroke contributing to death. one of the diagnostic criteria for antiphospholipid syndrome (aps) which by definition are characterized by recurrent thromboembolic events, were detected in 38% of sarcoidosis patients. the presence of antiphospholipid antibodies was associated with extra - thoracic lesions and persistence of abnormal radiological findings in sarcoidosis, and were judged by the authors to be a useful marker for prolonged disease. the authors did not search for vte occurrence in that group of sarcoidosis patients, although they should be considered at a high risk of such events. on the other hand, in numerous case reports concerning sarcoidosis complicated by vte, the level of antiphospholipid antibodies was not examined [610, 13 ]. thus, so far it has been impossible to conclude based on the literature whether the increased risk of vte in sarcoidosis is combined with the presence of aps. in our group of patients with sarcoidosis complicated by vte nevertheless, at least 50% of thrombotic episodes in individuals with factor v leiden mutation are provoked by additional predisposing factors. to the best of our knowledge, only one case of sarcoidosis with factor v leiden mutation, presenting with cerebral venous thrombosis was described in the literature. authors concluded that since most factor v leiden gene heterozygous individuals do not develop clinical thrombosis, the venous thrombosis of their patient suggested convergence of an inherited predisposition (heterozygous factor v leiden mutation) with an acquired thrombogenic stimulus (sarcoidosis). we have recently described a case of sarcoidosis complicated by pe in a sarcoidosis patient, in whom subsequently congenital factor v leiden mutation was found (data not published). we observed the favorable course of pulmonary sarcoidosis (total resolution of chest lymphadenopathy) with no impact on pft and exercise ability during anticoagulation therapy in our patient with pe. a persistent disappearance of the pulmonary infiltrates in the patient with sarcoidosis during anticoagulant treatment for venous thrombosis has already been observed. unfractionated heparin (ufh) and lmwh proved to have the anti - inflammatory properties. pulmonary embolism should be considered in all patients with sarcoidosis and worsening respiratory symptoms in presence of a high plasma dd level although elevated plasma dd should be interpreted in the context of an active inflammatory process. in our opinion, an increased risk of vte in sarcoidosis patients may depend mostly on a procoagulative phenotype related to the activity of inflammation.	the association between venous thromboembolism (vte) and sarcoidosis has been reported recently, nevertheless the true incidence of co - incident sarcoidosis and vte is unknown. sarcoidosis as a chronic disease of immune dysregulation might be associated with an increased risk of vte. the mechanisms responsible for vte development are not clear and may be influenced by several factors : activity of inflammation, clinical characteristics of sarcoidosis and comorbidities. pulmonary embolism (pe) as a potentially fatal condition should be considered in all of the patients with sarcoidosis in whom worsening of the respiratory status is diagnosed. a high plasma d - dimers (dd) level may be suggestive of vte, nevertheless elevated plasma dd should be interpreted with caution, in the context of the active inflammatory process. if sarcoidosis appears to be one of risk factors for vte development, further investigations are needed to define the pro - thrombotic phenotype of this disease.
infectious bronchitis (ib), caused by the infectious bronchitis virus (ibv), is a highly contagious viral disease of chickens with a worldwide distribution. it is characterized by respiratory symptoms, nephritis, poor performance and reduced egg reproduction. despite extensive vaccination, ib has been a perpetual problem in the korean poultry industry since the disease was first reported in 1986 [7,9 - 11,16,17 ]. recently, phylogenetic analysis revealed that korean field isolates of ibv constitute at least three distinct phylogenetic types : k - i, k - ii and k - iii. k - i type strains are native viruses associated with localized incidence in korea, k - ii type strains are closely related to nephropathogenic ibv strains isolated in china, and k - iii type strains are closely related to enteric ibv variants of chinese strains. in particular, the k - ii type nephropathogenic ibv is associated with a high mortality rate, and has been the source of great economic losses in the poultry industry in korea, despite the availability of a vaccine based on the km91 strain of korean nephropathogenic ibv [7,9 - 11,17 ]. molecular epidemiological evidence suggests that k - ii type qx - like viruses (k - iib type) isolated since 2003 form a different cluster than those (k - iia type) isolated prior to 2003 (e.g., strain km91). nevertheless, antigenic differences between k - iia and k - iib type viruses have yet to be fully investigated. the purpose of this study was to investigate the pathogenic and antigenic characteristics of k - iib type ibv strains currently circulating in korea to determine whether available ibv vaccines based on k - iia type strains will confer cross - protection against field ibv strains. two korean ibv strains, km91 and kr / q43/06 (national veterinary research and quarantine service, korea), were analyzed. strain km91 is a nephropathogenic k - iia type virus that was isolated in early 1990s, and strain kr / q43/06 is a k - iib type virus isolated in 2006. the pathogenicity of ibv strain kr / q43/06 was determined using specific pathogen free (spf) 1-week - old layer type chickens (lohmann, germany). ten chickens were inoculated with ibv kr / q43/06 (10eid50/dose) by eye drop inoculation. five birds that served as the inoculation control group were inoculated with phosphate buffered saline. all birds were maintained in isolators with negative pressure and monitored daily for 14 days for overt clinical symptoms (depression, respiratory signs, diarrhea, etc.) and mortality. six days post inoculation (dpi), all of the birds in the ibv group started to exhibit mild respiratory symptoms, including sneezing and rales. clinical signs became more severe by 10 dpi, when most of the affected birds (7/10) exhibited severe depression and dyspnea, which continued to progress until the end of the experiment (14 dpi). birds in the control group showed no clinical signs of ibv infection throughout the experimental period. in the infected birds, gross lesions were mainly confined to the kidney, which was pale, swollen with interstitial nephritis and showed evidence of severe urate deposition. ibv was recovered from the trachea (90%, or 9/10) and kidney (80%, or 8/10) of infected birds by inoculating tissue homogenate into the allantoic cavity of 9 to 11 day - old spf embryonated chicken eggs (lohmann, germany) using standard methods and identified by dot - immunoblotting assay using monoclonal antibodies. control birds exhibited no pathological lesions in the kidney, and no evidence of viral load. cross virus neutralization tests were performed using anti - sera against strains km91, kr / q43/06 and h120 to determine the antigenic relationship between kr / q43/06 and km91. ibv anti - sera were raised in our laboratory according to the immunization protocol of gelb. cross - virus neutralization tests were performed using spf embryonated chicken eggs and the alpha method, as previously described. briefly, serial dilutions of ibv are incubated with a standard dilution of serum (1/5 dilution), and then the serum - virus mixtures in each dilution were incubated into 5 spf embryonated chicken eggs. end - points were calculated by the reed and muench method. a neutralization index (ni) was calculated, representing the difference (in logarithmic units) in viral titer between virus alone and the corresponding virus - antiserum mixture. an ni value of > 4.5 indicated homologous strains, a value of 1.5~4.5 indicated heterologous strains, and a value of 70% indicated little or no difference between the two viruses tested ; an r value between 33% and 70% indicated a minor subtype difference ; an r value between 11% and 32% indicated a major subtype difference ; and an r value between 0% and 10% indicated different serotypes. the r value for strains kr / q43/06 and km91 was 30%, which indicated that nephropathogenic strain kr / q43/06 is distantly related to strain km91 (table 2). thus, strain kr / q43/06 represents a new variant that is antigenically distinct from strain km91. to our knowledge, this is the first report of a new antigenic variant of nephropathogenic ibv in chickens from korea. in a previous study, phylogenetic analyses showed that type k - iib ibv isolates are more closely related to strain qx than the k - iia type strain km91 at the level of the hyper - variable region of the s1 gene of ibv. it is worth noting that the qx - like ibv is distributed worldwide, including in the far east of russia, italy, the netherlands, the united kingdom and japan. thus, k - iib type strains of ibv might have emerged in korea as a result of introduction from foreign countries rather than through immune pressure due to vaccination in the field, or recombination between field viruses. interestingly, during viral surveillance in 2003 in quangdong, china, a nephropathogenic strain of ibv was isolated from an asymptomatic teal (anas) of the order anseriformes. this observation raises the possibility of widespread dissemination of ibv by wild birds, such as wild migratory ducks, as proposed by bochkov. while the role of wild birds in trans - boundary transmission of ibv has not been demonstrated, additional viral surveillance studies of wild birds, particularly wild ducks, are needed. in vivo cross protection studies should also be considered to determine whether currently available k - iia type or mass type ibv vaccines confer cross - protection against new k - iib type variants. if currently available ibv vaccines do not provide cross - protection against new variant strains that emerge in the field, the development of alternative vaccines should be considered for the effective control of ib in korea.	despite the existence of an active vaccination program, recently emerged strains of nephropathogenic infectious bronchitis virus (ibv) in korea have caused significant economic losses in the poultry industry. in this study, we assessed the pathogenic and antigenic characteristics of a k - iib type field strain of ibv that emerged in korea since 2003, such as kr / q43/06. specific pathogen free 1-week - old chickens exhibited severe respiratory symptoms (dyspnea) and nephropathogenic lesions (swollen kidneys with nephritis and urate deposits) following challenge with the recent ibv field strain. the antigenic relatedness (r value), based on a calculated virus neutralization index, of the k - iib type field strain and k - iia type strain km91 (isolated in 1991) was 30%, which indicated that the recent strain, kr / q43/06, is a new variant that is antigenically distinct from strain km91. this report is the first to document the emergence of a new antigenic variant of nephropathogenic ibv in chicken from korea.
renal hyperparathyroidism (rhpt) is a serious complication of long - term dialysis treatment. the european dialysis and transplant association (edta) report published in 1991 showed that up to 40% of patients undergo surgical treatment for rhpt after 15 years of dialysis. rhpt is a form of renal osteodystrophy that causes increased bone fragility, and in addition, it has also been reported that hypercalcaemia and hyperphosphataemia associated with rhpt induce ectopic calcification in the vascular walls and heart valves, thereby significantly affecting the patient 's survival prognosis [49 ]. in patients with severe rhpt refractory to medical treatment there are two types of such methods, percutaneous ethanol injection therapy (peit) and a parathyroidectomy (ptx). determining which of these methods is the most appropriate intervention for individual cases is therefore a major issue for clinicians. peit is easy to perform on an outpatient basis ; however, it has been associated with a significant adverse event, namely adhesion formation. an indistinct margin of the parathyroid gland is often found during surgery following peit due to the firm fibrous membrane. ptx is considered to be the last treatment option in patients with severe rhpt resistant to medical treatment and peit. this study was conducted to determine whether similar results can be expected when ptx is performed in patients who underwent peit by investigating the effect of peit on subsequent ptx. the patients had a diagnosis of rhpt, for which surgery was indicated, from january 2004 to december 2005. the subjects were divided according to whether they underwent peit (peit group) or not (non - peit group). an analysis was performed to compare the pre- and postoperative biochemistry results as well as intact pth levels (preoperative, postoperative and year 1 postoperatively), number of the parathyroid glands detected by ultrasonography, operation time, the amount of bleeding, the number of parathyroid glands removed, the total weight of the removed glands and the frequency of the postoperative complication of hoarseness. informed consent was obtained from all subjects. for comparisons of the peit and non - peit groups, the homogeneity of variance for each group was confirmed using the f - test, and testing was performed using student 's t - test. if neither group had a normal distribution, then the mann in addition, for the analysis using a 2 2 contingency table, such as testing for the frequency of postoperative complications and patients with high postoperative pth levels, fisher 's exact probability test was performed. the results were shown as mean sd. a p - value < 0.05 was considered to be statistically significant. for comparisons of the peit and non - peit groups, the homogeneity of variance for each group was confirmed using the f - test, and testing was performed using student 's t - test. if neither group had a normal distribution, then the mann in addition, for the analysis using a 2 2 contingency table, such as testing for the frequency of postoperative complications and patients with high postoperative pth levels, fisher 's exact probability test was performed. there were 19 patients in the peit group and 61 in the non - peit group, with no significant difference in the background of patients in these groups. the operation time was significantly longer in the peit group, but no significant differences were noted in the amount of bleeding or the frequency of recurrent nerve paralysis (table 1). pre- and postoperative blood test results showed no significant difference to exist in the preoperative biochemistry results and intact pth levels ; however, the intact pth levels immediately following surgery were slightly higher in the peit group. no difference was noted in the intact pth levels between the peit and non - peit groups at 1 year after the operation. pg / ml on postoperative day 1 was significantly higher in the peit group (table 1). a comparison of patients who underwent one course of peit and those who underwent two or more courses of therapy revealed no difference in the number of the parathyroid glands removed, the total weight of the removed glands and the operation time, although the postoperative intact pth levels were found to be significantly higher in those who underwent two or more courses of peit (table 2). there were 19 patients in the peit group and 61 in the non - peit group, with no significant difference in the background of patients in these groups. the operation time was significantly longer in the peit group, but no significant differences were noted in the amount of bleeding or the frequency of recurrent nerve paralysis (table 1). pre- and postoperative blood test results showed no significant difference to exist in the preoperative biochemistry results and intact pth levels ; however, the intact pth levels immediately following surgery were slightly higher in the peit group. no difference was noted in the intact pth levels between the peit and non - peit groups at 1 year after the operation. pg / ml on postoperative day 1 was significantly higher in the peit group (table 1). a comparison of patients who underwent one course of peit and those who underwent two or more courses of therapy revealed no difference in the number of the parathyroid glands removed, the total weight of the removed glands and the operation time, although the postoperative intact pth levels were found to be significantly higher in those who underwent two or more courses of peit (table 2). peit and ptx are both options for the treatment of severe rhpt refractory to medical treatment. peit can be performed with minimal invasiveness and it is easily performed on an outpatient basis. however, its efficacy is somewhat uncertain in some patients. a previous study showed that patients in whom these intact pth levels sufficiently decreased to the target levels were those with a lower density of blood flow distribution in the parathyroid glands. although the therapeutic outcome of ptx has been reported to be reliable and stable, it is difficult to perform ptx following peit due to adhesion, which is a significant adverse event associated with peit. postoperative data were studied to assess the degree of difficulty of surgery due to adhesions associated with peit. there was no significant difference in the amount of bleeding, which is an index for the difficulty of surgery ; however, a significant difference was observed regarding the operation time. in addition, the postoperative intact pth levels were somewhat but not significantly higher in the peit group than in the non - peit group. these findings suggest that repeated peit damages the capsule of the parathyroid gland, thus causing the dissemination of hyperplastic parathyroid cells. some residual parathyroid tissue caused by adhesions and dissemination might exist during a parathyroidectomy, thus leading to higher postoperative intact pth levels. peit can be a useful strategy for controlling rhpt if it is performed for patients who are likely to respond to the therapy. however, based on the surgical outcomes for patients who underwent peit, repeated peit should be avoided and surgical treatment is preferable in patients who demonstrate a poor response to the initial peit. in conclusion, peit prior to a ptx can affect subsequent surgical outcomes due to associated adhesion and dissemination ; therefore, peit should be performed only for those who are likely to respond to the therapy, and repeated peit should be avoided. peit should be administered with a full understanding of its advantages and disadvantages. for patients with a possibility of either a decreased efficacy or lack of efficacy for peit,	background. renal hyperparathyroidism (rhpt) is a serious complication of long - term dialysis treatment. two intervention methods can be administered to treat rhpt, namely percutaneous ethanol injection therapy (peit) and a parathyroidectomy (ptx). peit is associated with a significant adverse event, adhesion formation. this study was performed to investigate the effect of peit on subsequent ptx.methods. a total of 80 subjects were included in the study. the patients had a diagnosis of rhpt for which surgery was indicated. they were divided according to whether they underwent peit (peit group) or not (non - peit group). the outcomes of ptx following peit were evaluated.results. there were 19 patients in the peit group and 61 in the non - peit group. the operation time was significantly longer in the peit group but no significant differences in the amount of bleeding or frequency of recurrent nerve paralysis were observed. the intact pth levels immediately following surgery were slightly higher in the peit group. the postoperative intact pth levels were found to be significantly higher in those who received two or more courses of peit. the number of patients with an intact pth level > 60 pg / ml on postoperative day 1 was significantly higher in the peit group.conclusions. these findings suggested that peit prior to ptx can affect the subsequent surgical outcome due to associated adhesions and dissemination. for patients with a possibility of either a decreased efficacy or a lack of efficacy for peit, it is therefore important to consider ptx from the very beginning of the treatment.
mountainous ecosystems are highly sensitive to any disturbances in natural balance, what makes them especially interesting for observations of chemical and radiochemical contamination. the area of the babia gra national park (bpn), being located along the main ridge of the flysch carpathian mountains, is just the proper place in this respect. the terrain belongs to the young folded mountains, built mainly of flysch and some other lithology. the highest summit of the babia gra mountain s massif (west part of the beskid ywiecki chain of mountains) is diablak reaching 1,725 m asl. to protect this unique area the area of the bpn, like other regions of poland, was exposed to substantial contamination with radionuclides due to the chernobyl accident in 1986 and nuclear weapon tests since the fifties of the twentieth century [16 ]. researches on radionuclides distribution in the environment are important not only because these are perfect markers of the environment pollution but also because radioactive isotopes are not immobilized in soil but are constantly interchanged between inorganic matter and living organisms. the aim of the work was to establish the spatial distribution of -radionuclides i.e. anthropogenic cs (t1/2 = 30.07 years) and natural k (t1/2 10 years) in the soil samples collected in the described above area. 10 cm thick soil core samples were collected with the use of a cylindrical corer (10 cm in diameter). 13 sampling points were selected in the studied area, most of them localized along the mountains main ridge. each of the sampling points was described by its geographical coordinates and height above the sea level. in case of few points it was impossible to determine their precise coordinates (the lack of gps signal), so the closest available coordinates were interpolated. in the laboratory, the cores were divided into three sub - samples each to enable radioisotopes determination in various depths. the samples were then dried at 105 c and the total weight was determined. after removal of organic macro - particles and small stones, the samples were sieved mechanically (2 mm mesh). after preparation, the samples were analysed by means of gamma ray spectrometry with the use of hpge (high purity germanium) coaxial detectors of relative efficiency 7 and 21 %. prior to the measurements, each measurement lasted 72 h. the reference materials iaea-154, iaea-375, and iaea-447 of the international atomic energy agency (vienna, austria) were used in the measurements. in the present work cs radioactivity in the for the whole core samples, cs and k activities were expressed in bq m units. after gamma spectrometric measurements organic matter content in the soil samples was determined by means of incineration at 600 c. to extract relevant information out of the obtained data, chemometric tools i.e. cluster analysis (ca) and principal components analysis were used (using statistica 10 software). the most important values are written in bold.table 1the babia gra national park sampling points descriptionpoint no.geographical coordinatesheight (m asl)place description1n 49st 34,7971,515red hiking trail, after sokolica, right from this red routee 19st 33,4142n 49st 34,6161,577near zimny staw lake, at the top of babia grae 19st 32,7723n 49st 34,3411,707by green hiking trail from babia gra to lipnicae 19st 31,8244n 49st 34,4261,701the yellow hiking trail from babia gra, on the right sight of this routee 19st 31,7695n 49st 34,3861,695the route from diablak (red hiking trail)e 19st 31,6896no data1,600the route from diablak below cross (red hiking trail)7no data1,530krzywka szlakw na markowe szczawiny i ma babi.8no data950mokry stawek lake, from the site of krowiarki pass9no data951brona pass10n 49st 34,5281,463by yellow hiking trail, dwarf pine zonee 19st 31,45311n 49st 34,6671,350yellow hiking trail, at the end of higher montane zonee 19st 31,30112n 49st 34,9531,257at the intersection of szumica woda valley with the route to markowe szczawinye 19st 31,46713n 49st 34,293836hala mietanowa, above little bridge on syhlec streame 19st 35,609table 2 cs and k radioactivities, density and organic matter content in the soil samples collected in the babia gra national park areapoint no.height (m asl)soil density (g cm)organic matter content (%) activity cs (bq kg) (layer a)activity cs (bq m) (whole core)activity k (bq m) (whole core)11,5150.7017416 118,837 2416,900 61921,5770.1790405 163,757 2114,127 37431,7070.5520304.1 9.26,591 2247,914 71541,7010.6515 831 21 28,551 72016,477 1,49751,6950.7014246.2 8.48,166 27510,848 97761,6000.2473697 217,231 2192,134 19471,5300.2281214 103,276 1777,869 71389500.99936.8 2.11,783 119 25,654 2,28899510.,703765.8 6.42,119 15212,907 1,164101,4630.5021137.3 6.11,916 838,368 775111,3500.5719309 105,472 230 25,200 2,255121,2570.1782326 152,030 951,642 151138360.4023408 1316,152 48417,480 1,573 the babia gra national park sampling points description cs and k radioactivities, density and organic matter content in the soil samples collected in the babia gra national park area soil in the bpn originates from the carpathian flysch waste. as in the area vegetation levels the resulting soil type classification is given in table 3.table 3prevailing soil types of the considered sampling pointsvegetation levelheight (m asl)prevailing soil typesampling pointsalpine zone1,6501,725lithic leptosol,3, 4, 5regosol skeletic, podzolic ranker (leptosol)dwarf pine zone1,3901,650haplic podzol,1, 2, 6, 7, 10tangel ranker(umbric leptosol)higher montane zone1,1501,390dystric cambisol12, 11partially haplic podzollower montane zone7001,150eutric and dystrict cambisol13, 8, 9 prevailing soil types of the considered sampling points chemometric tools are widely used in the environmental data analysis especially when high variability and uncertainty of the data may be expected. for the obtained set of data the ca according to ward and principal components analysis (pca) after initial normalization / auto - scaling, the outcome of the analyse is presented in figs. 1 and 2.fig. activity of cs [bqm ] represents activity in the whole profile ; activity of cs [bqkg ] represents activity in a layerfig. activity of cs [bqm ] represents activity in the whole profile ; activity of cs [bqkg ] represents activity in a layer cluster analysis (samples) in fig. the first one represents soil density and k radionuclide activity (k activity is in constant relation to the total potassium, about 31 bq k per 1 g of potassium). these two variables belong to the same cluster what suggests that potassium is incorporated mainly in mineral components of the soil. the higher is mineral content of soil, the higher is soil density (table 2). in the second cluster, radioactivities of artificial cs in the a soil layer and in the whole core as well as the sampling point height asl and organic matter content, similar course of changes of cs activity and soil organic matter content can be attributed to the sorptive properties of this soil fraction. as cs presence in the soil results only from the distant transport of the contaminant, its retention in soil is a direct result of its sorption. the other important factor is the amount of precipitation in the area (rain, snow). the higher is the location of the sampling point in the mountains, the higher is the amount of precipitation. thus, the variable altitude belongs to the same cluster. in fig. but the chosen criteria i.e. analysed variables, enabled proper and logical division of the sampling points into groups (clusters) for which the soil type is a common feature (table 3). however, it should be noted that in mountains, soil types are not sharply defined. as a result the revealed clusters do not classify soil types directly, but the obtained classification is relevant for a given soil complex structure (fig. 2 ; principal components are the linear combination of the previous variables. taking into consideration the kaiser criterion in further analysis only the first and the second principal component should be used (table 4). the scree diagram suggests however, that it would be reasonable to consider three components as they describe 92.36 % of global variation of the data (fig. 3scree diagram in table 5 factor loadings (after varimax rotation) for the three principal components are given.table 4eigenvaluesprincipal components analysiseigenvalues% total variancecumul.- eigenvaluecumul.-%12.7946.482.7946.4821.9732.784.7679.2630.7913.105.5592.3640.254.235.8096.5950.132.125.9398.7160.071.296.00100.00table 5factor loadings (varimax)vf-1vf-2vf-3altitude0.0900.232 0.942 density 0.950 0.1070.096radioactivity of cs (a layer)0.235 0.906 0.271radioactivity k 0.721 0.0940.556radioactivity cs (whole core)0.247 0.945 0.025organic matter 0.956 0.1080.050significant values are given in bold factor loadings (varimax) significant values are given in bold the first component (explaining 46 % of variability) covers mainly the following variables : density, organic matter content and potassium concentration. all these parameters are connected with the physical properties and chemical composition of the soil. the second principal component, explaining 33 % of variability, considers only anthropogenic variable i.e. radioactivity of cs. third principal component explaining 13 % of variability refers to the height asl of the sampling point. it should be stressed, that this component supplies additional information related to some aspects explained by the first two principal components. the height above sea level has the influence on such soil properties like density and organic matter content. with increasing altitude the pace of organic matter decomposition decreases (the same tendency is noted for temperature). simultaneously, anthropogenic cs was introduced to the soil mainly with rainfall in the mountains, the higher located is the place the more rain is precipitated. in fig. 4 it may be noted that the variables (soil density and potassium content) are positively correlated witch each other and negatively correlated with organic matter content. on the other hand it is clear that cs radioactivity is orthogonal to those variables (soil density and potassium content)no correlation was found.fig. 4projection of the variables onto the plane of the first two principal components projection of the variables onto the plane of the first two principal components it was established that : caesium radioactivity in the soils of the bpn is changeable. in the top (a layer) 3 cm thick soil layer it is in the range from 36 to 831 bq kg, while in the whole core (10 cm) it spans from 1,916 to 28,551 bq m. ca enabled grouping of the sampling points according to the soil type. it may be assumed that the sampling points are better characterized by the cs radioactivity expressed in surface units rather than radioactivity of the first layer only.the pca reduced the number of analysed variables to three principal components, explaining 92 % of the total variance of the variables. first three principal components differentiate the variables into : natural (connected with physical and chemical soil properties) like soil density, organic matter and potassium contents, anthropogenic cs radioactivity, and sampling points characteristic altitude above sea level. (a layer) 3 cm thick soil layer it is in the range from 36 to 831 bq kg, while in the whole core (10 cm) it spans from 1,916 to 28,551 bq m. ca enabled grouping of the sampling points according to the soil type. it may be assumed that the sampling points are better characterized by the cs radioactivity expressed in surface units rather than radioactivity of the first layer only. the pca reduced the number of analysed variables to three principal components, explaining 92 % of the total variance of the variables. first three principal components differentiate the variables into : natural (connected with physical and chemical soil properties) like soil density, organic matter and potassium contents, anthropogenic cs radioactivity, and sampling points characteristic altitude above sea level. presented above conclusions it is true especially for the neighbouring tatra mountains national park [3, 5, 12 ]. the similar positive correlation of cs activity with the sampling point altitude and organic matter content in the soil were found in the tatras. soils of the mountains neighbouring to the bpn constitute currently the subject of complementary research projects.	the aim of this work was to determine 137cs and 40k radioactivities in soil samples taken from the babia gra national park (bpn) in south poland. the cluster analysis (ca) and principal component analysis (pca) were used to discuss the obtained data. 10 cm thick soil cores were collected from the bpn area. each sample was divided into three sub - samples. the samples were dried, homogenized and packed in polyethylene containers. the radioactivities of 137cs and 40k were measured by means of gamma spectrometry. it was found that 137cs radioactivity in the whole 10 cm soil cores was in the range from 1,916 to 28,551 bq m2. the radioactivity of 40k varied from 1,642 to 25,654 bq m2. using ca it was possible to diverse the soils taking into account soil types. by use of the pca method, it was chosen three factors which are appropriate to characterize researched parameters.
the prevalence of human immunodeficiency virus (hiv) infection in india is 0.34%.(1) even though the survival of people living with hiv (plwh) has improved with the advent of anti - retroviral therapy (art), their life is affected by social factors like stigma / discrimination. hence, quality of life (qol) which gives a holistic picture of their health status has gained importance.(2) further, knowing the factors affecting the qol of plwh would be helpful in making important policy decisions and health care interventions. literature on the factors influencing qol was not consistent as qol depends on the socio - cultural milieu in which the individual lives.(3) one such variation observed in hiv was with relation to gender. in chennai, it was found that females experienced poor qol in the sociological domain, and men in the psychological domain,(4) whereas, the multicentric preliminary study of whoqol with two centers in india found that women experienced less qol across all domains.(5) on the contrary, in africa, it was found that gender does not influence qol.(6) since india accounts for nearly half of the asia 's hiv prevalence,(7) there is a definite need to study qol and the factors influencing it in the indian setting. measuring qol would help to identify the most affected domain, and knowledge on factors influencing it will aid in taking appropriate intervention. it would also provide regional and objective data for planning interventions for the betterment of plwh. to assess the quality of life of plwh.to study the socio - cultural and demographic determinants of quality of life in plwh. to assess the quality of life of plwh. to study the socio - cultural and demographic determinants of quality of life in plwh. to assess the quality of life of plwh.to study the socio - cultural and demographic determinants of quality of life in plwh. to assess the quality of life of plwh. to study the socio - cultural and demographic determinants of quality of life in plwh. this descriptive study was conducted in puducherry, a union territory of india with a population of 9,74,345.(8) two tertiary care government hospitals, jawaharlal institute of postgraduate medical education and research (jipmer) and general hospital (gh) of puducherry, and three non governmental organizations (ngo) namely pondicherry network of positives (pnp+), community care centre (ccc) and shanthi bhavan were providing care for plwh in puducherry. the pilot study found that plwh utilizing the services of puducherry gh were also utilizing the services of the ngo. hence, the study was conducted at jipmer and the three ngo 's during 2005 - 07. sample size of 200 was calculated using the mean domain score of 11.4 and standard deviation (sd) of 3.7 from the preliminary study of whoqol - hiv.(5) recruitment was continued till 200 subjects of > 18 years of age were interviewed. as plwh were utilizing the services of more than one centre, register was maintained to avoid duplication. based on feasibility, at each visit to these study centers, first three subjects were recruited from their registers. quality of life was assessed using hiv specific world health organization quality of life scale (whoqol - hiv) bref which was field - tested in six centers across the world, including two centers in india. it contains six domains namely physical, psychological, level of independence, social relationships, environment and spirituality / religiousness / personal belief (srpb).(5) social support and hiv related stigma and was assessed using multidimensional scale of perceived social support and hiv stigma scale, respectively. all these scales had an excellent internal consistency.(5911) interview schedules also included information on socio - demographic, clinical and social characteristics. it was translated into the local language tamil, back translated and reviewed by a panel of two clinicians and five medical social workers. non - judgmental attitude and non - responsive body language was followed to minimize bias. the study was approved by the institute research council and institute ethics committee at jipmer. during the first one year of the study period, facility for checking cluster differentiation 4 (cd4) count was not accessible to most subjects. hence, the performance scale in who classification system was used for staging the disease clinically which was as follows : stage i bedridden > 50% of the day during the last month.(12) data was analyzed using statistical package for the social sciences (spss) version 13 using the guidelines of the various scales. higher score in the multidimensional scale of perceived social support and hiv stigma scale indicated good social support and greater hiv related stigma, respectively. factors influencing qol were identified using backward stepwise multiple linear regression with the six domain scores as the dependent variables. age, gender, residence (urban / rural), marital status, years of education, per - capita income, change of income after the diagnosis of hiv infection, duration since diagnosis, disease stage and intake of anti - retroviral therapy (art), disclosure of hiv status, peer counseling, social support and hiv related stigma were the independent variables. mean age of the subjects was 35 years (standard deviation - sd 8.6). duration since diagnosis varied widely from 1 week to 12 years. most plwh contracted hiv through heterosexual route (153, 76.5%) and 71 (35.5%) subjects were under art. among the subjects in stage hundred (50%) subjects reported decrease in income after the diagnosis of their hiv status because of manifestations of the infection, decrease in work capacity and decrease in number of working days. but nine subjects earned more after the diagnosis of hiv as they felt the need to earn more money to meet their health care. psychological and srpb were the most affected domains [mean = 12.7, table 2 ]. level of independence was the least affected domain [mean = 14.7, table 2 ]. some common expressions of subjects regarding their present quality of life were i am not able to ask for my property, as my relatives are scaring me that they will disclose my hiv status. now i am alright, but if i start having diarrhea i can not even do my day - to- day activities..when i see very thin persons attending the clinic, i am afraid that one day i may also become like them. these comments showed the helpless situation, fear / concern for uncertainties in future, and the fluctuating health status of these plwh. however, a few plwh commented positively ; after the diagnosis of hiv, i have tried to find a new meaning in my life. demographic characteristic of study subjects mean scores in the domains and the human immunodeficiency virus. specific facets of world health organization quality of life scale (whoqol - hiv) bref table 3 shows the influence of the various factors on the qol domains. the regression models explained between 20% and 57% of the variance in the different domains. the determination coefficients (adjusted r) were highest for the social relationship domain (57%) followed by the psychological domain (51%). early stage of disease and better social support has significant positive influence on all domain of qol. disease stage was the most influential determinant of all domains except social relationship and environment. plwh experiencing greater hiv related stigma obtained lower scores in the psychological, environment and srpb domain. it is noteworthy to mention that decrease in income after the diagnosis of hiv negatively influenced psychological, social relationship and environment domain. females obtained lower scores in the psychological and the srpb domain. with time, the qol of plwh improved. other important significant determinants of qol identified by multivariate analysis were peer counseling, disclosure of hiv status, age and residence [table 3 ]. in our study, multiple linear regression of factors influencing quality of life of people living with human immunodeficiency virus infection in the study the study revealed that psychological domain and srpb which includes facets such as self - esteem, negative feelings, purpose in life, fear of death etc. similar results were also found in preliminary study of whoqol.(5) schonnesson reported that though symptoms due to hiv decreased with art ; stigma / discrimination and uncertainties had not decreased thereby affecting them psychologically.(13) the score of the present study in level of independence, social relationship and srpb domains were significantly better than that reported from bangalore (india). however the physical and psychological domains scores of the present study were lower than that from delhi (india).(5) this indicates a wide variation in qol even within the country. decrease in income after the diagnosis of hiv was not well studied in the indian scenario. in our study, about half of the subjects earned less after the diagnosis of hiv due to manifestations of hiv. less income decreased their access to resources, affecting their living environment and social life.(14) they also faced challenges for meeting their increased health care cost. hence, vocational counseling and support for self employment provided through the ngo would improve the qol of plwh. our study and the preliminary study of whoqol hiv, showed that disease stage significantly influenced all the six domains.(15) hence, art which delays the progression of disease should be made accessible to all. similarly rivero - mendez. also found that art had a positive effect on physical well - being.(16) factors such as younger age,(15) female gender,(415) rural background and shorter duration of hiv status(17) were the high risk for poor quality of life, as identified in our study and also in literature. our study and study by molassiotis. showed the positive influence of peer counseling on qol.(18) hence counseling and support from peer counselors for these high risk groups would improve their qol. the influence of social support and hiv related stigma was consistent with other studies conducted across various cultural background.(1923) noteworthy, that in our study, social support had a major influence on all domains of qol, especially social relationships and environment domain. lower hiv related stigma had a positive impact on the environment, srpb and the psychological domain. however, the study being descriptive, temporal ambiguity of the associations exists, for example whether good social support led to good qol, or good qol made the plwh perceive the available support as good. peer counseling and individual counseling at every contact with the health care professional should be encouraged for the high risk group. the qol of plwh will also benefit the stake holders such as family, community and organizations working for plwh.	context : with anti - retroviral therapy (art) for human immunodeficiency virus infection (hiv) coming into picture, quality of life (qol) has gained importance. knowledge on the factors affecting qol would be helpful in making important policy decisions and health care interventions.aims:the aim of this study is to assess the quality of life of people living with hiv (plwh) and to identify the factors influencing their qol.materials and methods : the study was done among 200 plwh attending a tertiary care hospital, and three non governmental organizations at puducherry, india, from november 2005 to may 2007. qol was assessed using hiv specific world health organization quality of life scale (whoqol - hiv) bref questionnaire which has six domains (physical, psychological, level of independence, social relationships, environment and spirituality / religiousness / personal belief). social support and stigma were measured using multidimensional scale of perceived social support and hiv stigma scale, respectively, using likert scale. factors influencing qol were identified using backward stepwise multiple linear regression with the six domain scores as the dependent variables.results:male : female ratio was 1:1 and 58% were in early stage of the disease (stage i / ii). psychological and srpb (spirituality religiousness and personal beliefs) domains were the most affected domains. all the regression models were statistically significant (p<0.05). the determination coefficient was highest for the social relationship domain (57%) followed by the psychological domain (51%). disease stage and perceived social support significantly influenced all the domains of whoqol. younger age, female gender, rural background, shorter duration of hiv, non - intake of art and greater hiv related stigma were the high risk factors of poor qol.conclusion:interventions such as art, family, vocational and peer counseling would address these modifiable factors influencing qol, thereby improving the qol of plwh.
equilibrium gated radionuclide ventriculography (ernv) is a non - invasive, reproducible and minimally operator - dependent study. ernv has been used widely for the assessment of wall motion abnormalities and left ventricular ejection fraction (lvef). fourier phase analysis on ernv in addition this loss of synchronous contraction is called lv dyssynchrony.[35 ] since fourier phase analysis is an effective tool for detecting dyssynchrony, ernv can differentiate synchronous and dyssynchronous contraction of heart. hence, we aim to establish the range of phase parameters in normal individuals and derive cut - off limits for parameters to detect cardiac dyssynchrony. the study group included 30 individuals (age 5323 years, 25 males and 5 females) with no history of cardiovascular disease. they all had normal lvef and wall motion (lvef 5570% on echocardiography), were in sinus rhythm, with normal qrs duration (120 msec) and either normal myocardial perfusion scintigraphy or normal coronary angiography. the electrodes used for cardiac gating were secured on the skin in order to ensure an optimal ecg signal. the cardiac rhythm was noted to rule out marked heart rate variability that could interfere with the procedure and interpretation of ernv results. after 20 minutes, 25 mci of tc 99 m pertechnate solution was injected intravenously. ernv was performed using dual head ge infinia hawkeye 4 gamma camera with low - energy, high - resolution, parallel hole collimator interfaced to a dedicated computer. the simultaneity of r wave triggered by the gating device and the qrs complex were verified before initiation of the study. a 15% r - r interval beat acceptance window was selected to include acceptable cardiac cycles. thirty - two frames per r - r interval were obtained for assessment of ventricular wall motion, assessment of ejection fraction and phase analysis. images were acquired so that the heart occupied ~50% of the usable field of view. supine imaging was performed in a minimum of three views to visualize all walls of the left ventricle. the left anterior oblique (lao) acquisition was obtained at an angle that allowed the best separation of the right and left ventricles (best septal or best separation view). a craniocaudal angulation of 1015, for separation of atria from ventricle, was not given due to technical limitation of the newer gamma camera. anterior and lateral views were acquired for 3 million counts. the data from best septal view were chosen for fourier phase analysis. scintigraphic data were processed on xeleris functional imaging workstation with the help of xt erna software. automatic processing was performed on laplacian images to define the end diastolic and end systolic frames. the phase angle referred to the timing or the placement of cosine curve within the cardiac cycle, from 0 to 360. the earliest ventricular phase angle relates to the time of onset of the ventricular contraction, the mean ventricular phase angle reflects the mean time of the onset of the ventricular contraction and the standard deviation of the ventricular phase angle relates to the synchrony of the ventricular contraction. phase angles were computed for each pixel and colored phase images with corresponding histograms were generated. phase angle was converted to milliseconds by the formula : (phase angle/360) rr interval (milliseconds). mean phase angle and standard deviation (sd) were computed for right and left ventricles. the results were initially expressed in degrees and later converted to milliseconds [figure 1a and b ]. interventricular mechanical delay (ivmd) was calculated by taking the absolute difference of mean phase angles of right and left ventricle. mean + 3sd was considered as the cut off since it included 99.7% normally distributed population. the parameters of cardiac dyssynchrony on ernv were left ventricular standard deviation (lvsd), ivmd and right ventricular standard deviation (rvsd). (b) a typical lv phase histogram showing earliest phase angle, mean phase angle and phase spread the statistical analysis was performed on medcalc 11.5.0 and epiinfo 3.5.3.0 for the analysis of the data, and microsoft word and excel were used to generate graphs and tables. results on continuous measurements were presented as meansd and on categorical measurements as number (%). wilk test was performed to test if the observations of phase parameters were normally distributed. the study group included 30 individuals (age 5323 years, 25 males and 5 females) with no history of cardiovascular disease. they all had normal lvef and wall motion (lvef 5570% on echocardiography), were in sinus rhythm, with normal qrs duration (120 msec) and either normal myocardial perfusion scintigraphy or normal coronary angiography. the electrodes used for cardiac gating were secured on the skin in order to ensure an optimal ecg signal. the cardiac rhythm was noted to rule out marked heart rate variability that could interfere with the procedure and interpretation of ernv results. after 20 minutes, 25 mci of tc 99 m pertechnate solution was injected intravenously. ernv was performed using dual head ge infinia hawkeye 4 gamma camera with low - energy, high - resolution, parallel hole collimator interfaced to a dedicated computer. the simultaneity of r wave triggered by the gating device and the qrs complex were verified before initiation of the study. a 15% r - r interval beat acceptance window was selected to include acceptable cardiac cycles. thirty - two frames per r - r interval were obtained for assessment of ventricular wall motion, assessment of ejection fraction and phase analysis. images were acquired so that the heart occupied ~50% of the usable field of view. supine imaging was performed in a minimum of three views to visualize all walls of the left ventricle. the left anterior oblique (lao) acquisition was obtained at an angle that allowed the best separation of the right and left ventricles (best septal or best separation view). a craniocaudal angulation of 1015, for separation of atria from ventricle, was not given due to technical limitation of the newer gamma camera. anterior and lateral views were acquired for 3 million counts. the data from best septal view were chosen for fourier phase analysis. scintigraphic data were processed on xeleris functional imaging workstation with the help of xt erna software. automatic processing was performed on laplacian images to define the end diastolic and end systolic frames. the phase angle referred to the timing or the placement of cosine curve within the cardiac cycle, from 0 to 360. the earliest ventricular phase angle relates to the time of onset of the ventricular contraction, the mean ventricular phase angle reflects the mean time of the onset of the ventricular contraction and the standard deviation of the ventricular phase angle relates to the synchrony of the ventricular contraction. phase angles were computed for each pixel and colored phase images with corresponding histograms were generated. phase angle was converted to milliseconds by the formula : (phase angle/360) rr interval (milliseconds). mean phase angle and standard deviation (sd) were computed for right and left ventricles. the results were initially expressed in degrees and later converted to milliseconds [figure 1a and b ]. interventricular mechanical delay (ivmd) was calculated by taking the absolute difference of mean phase angles of right and left ventricle. mean + 3sd was considered as the cut off since it included 99.7% normally distributed population. the parameters of cardiac dyssynchrony on ernv were left ventricular standard deviation (lvsd), ivmd and right ventricular standard deviation (rvsd). (b) a typical lv phase histogram showing earliest phase angle, mean phase angle and phase spread the statistical analysis was performed on medcalc 11.5.0 and epiinfo 3.5.3.0 for the analysis of the data, and microsoft word and excel were used to generate graphs and tables. results on continuous measurements were presented as meansd and on categorical measurements as number (%). wilk test was performed to test if the observations of phase parameters were normally distributed. the study group [age 5323 years, 25 (83%) males and 5 (17%) females ] included normal individuals, selected according to the criteria mentioned in the section materials and methods. the average r - r interval (duration of cardiac cycle) was 868.9114.5 msec. it was observed that majority (83%) of study population belonged to the age group of 4069 years [figure 2 ]. age and sex distribution in the study population this test was performed to evaluate the null hypothesis that the observations of lvsd, rvsd and the mean phase angles of left and right ventricles came from a normally distributed population. the test statistic (w) was assessed at various thresholds of p value : threshold (p = 0.01) = 0.8999 threshold (p = 0.05) = 0.9269 threshold (p = 0.10) = 0.9390 if w was greater than p value, then the null hypothesis was accepted. at thresholds of p = 0.01, p = 0.05 and p = 0.10, the shapiro hence, null hypothesis was accepted for lvsd, rvsd, lv and rv mean phase angles. results of shapiro wilk test on study group for parameters of dyssynchrony the average mean phase angles for left and right ventricles in normal individuals are 396.945.52 msec and 408.6348.89 msec, respectively [table 1 ]. the cut - off value for lvsd (mean + 3sd) is 80 msec. the cut - off value for rvsd (mean + 3sd) is 85 msec. cut - off value for ivmd (mean + 3sd) is 75 msec [table 2 ]. this test was performed to evaluate the null hypothesis that the observations of lvsd, rvsd and the mean phase angles of left and right ventricles came from a normally distributed population. the test statistic (w) was assessed at various thresholds of p value : threshold (p = 0.01) = 0.8999 threshold (p = 0.05) = 0.9269 threshold (p = 0.10) = 0.9390 if w was greater than p value, then the null hypothesis was accepted. at thresholds of p = 0.01, p = 0.05 and p = 0.10, the shapiro hence, null hypothesis was accepted for lvsd, rvsd, lv and rv mean phase angles. results of shapiro wilk test on study group for parameters of dyssynchrony the average mean phase angles for left and right ventricles in normal individuals are 396.945.52 msec and 408.6348.89 msec, respectively [table 1 ]. the cut - off value for lvsd (mean + 3sd) is 80 msec. the cut - off value for rvsd (mean + 3sd) is 85 msec. cut - off value for ivmd (mean + 3sd) is 75 msec [table 2 ]. there are several imaging modalities for the evaluation of cardiac mechanical synchrony and lv function. phase analysis on ernv is known for decades and is grossly underutilized for the evaluation of cardiac dyssynchrony. heart failure patients with lvef 35%, symptomatic (nyha iii / iv) despite optimal pharmacological therapy and qrs duration > 120 msec should be selected for cardiac resynchronization therapy (crt) if significant cardiac mechanical dyssynchrony is detected, to get the best results. cardiac mechanical dyssynchrony is prevalent in heart failure patients and predicts the response to crt.[79 ] to separate the heart failure patients with dyssynchrony from those without, it is essential that we define the range of phase spread on ernv and derive a cut - off limit for the parameters by using the locally available software. the cut - off values for lvsd, rvsd and ivmd were determined to be > 80 msec, > 85 msec and > 75 msec, respectively. fauchier., in their study using ernv, established the cut - off values for lvsd, rvsd and ivmd as > 45 msec, > 50 msec and > 40 msec, respectively. the discrepancy in the cut - off limits between the studies could be explained by considering several factors. second, mean + 2sd was considered for setting the cut - off limit ; while this study considered mean + 3sd. third, the software (xt erna) used for performing fourier phase analysis in the present study was different from the one used in laurent fauchier 's study. fourth, in the present study, caudal tilt was not given during acquisition of scintigraphic data from the study population. the modern infinia hawk eye 4 gamma camera of ge, unlike single head gamma camera, does not come with this facility. a caudal tilt of the gamma camera prevents overlap of left atrium over left ventricle. an overlap of left atrium over left ventricle might increase the left ventricular phase standard deviation. the cut - off values from the present study can further be validated by multicenter trials in india with the modern gamma camera, using the same xt erna based phase analysis of ernv. ernv is a known effective, non - invasive and reproducible method of assessment of lvef. fourier phase analysis is a robust tool for the evaluation of synchronicity of cardiac contractility. the range of phase spread and cut - off limits defined in normal individuals can be used to distinguish heart failure patients with cardiac dyssynchrony from those without. the normative phase analysis data from the present study will be applicable to all those ernv procedures performed with modern dual head gamma camera that does not allow a craniocaudal tilt. ernv is useful for the assessment of lvef, wall motion abnormalities and cardiac dyssynchrony, especially in those heart failure patients who may be potential candidates for crt. the cut - off limits from the present study need further validation from a larger sample size. the cut - off limits from the present study need further validation from a larger sample size.	aim : to define the range of phase spread on equilibrium gated radionuclide ventriculography (ernv) in normal individuals and derive the cut - off limit for the parameters to detect cardiac dyssynchrony.materials and methods : ernv was carried out in 30 individuals (age 5323 years, 25 males and 5 females) who had no history of cardiovascular disease. they all had normal left ventricular ejection fraction (lvef 5570%) as determined by echocardiography, were in sinus rhythm, with normal qrs duration (120 msec) and normal coronary angiography. first harmonic phase analysis was performed on scintigraphic data acquired in best septal view. left and right ventricular standard deviation (lvsd and rvsd, respectively) and interventricular mechanical delay (ivmd), the absolute difference of mean phase angles of right and left ventricle, were computed and expressed in milliseconds. mean + 3 standard deviation (sd) was used to derive the cut - off limits.results:average lvef and duration of cardiac cycle in the study group were 62.5%5.44% and 868.9114.5 msec, respectively. the observations of lvsd, rvsd and right and left ventricular mean phase angles were shown to be normally distributed by shapiro wilk test. cut - off limits for lvsd, rvsd and ivmd were calculated to be 80 msec, 85 msec and 75 msec, respectively.conclusion:fourier phase analysis on ernv is an effective tool for the evaluation of synchronicity of cardiac contraction. the cut - off limits of parameters of dyssynchrony can be used to separate heart failure patients with cardiac dyssynchrony from those without. ernv can be used to select patients for cardiac resynchronization therapy.
hepatitis b virus is one of the most important factors for infected diseases in the world. it was estimated that 350 million people infected with hepatitis b virus and almost 75% patients are living in asia (1). nearly one million people die annually from chronic liver diseases such as, chronic hepatitis b, cirrhosis and hepatocellular carcinoma (2). the prevalence of hepatitis b is reported various in different parts of the world, so this virus existed as hyper endemic in most asian countries. throughout the world, carrier variability rate for hepatitis b infection is estimated to be 0.1% to 20% which is different in various areas and is classified into three regions : the first group with areas as having low (8%) (3). the prevalence of hepatitis b infection is high in africa, southeast asia, the middle east, southern and western pacific island, (they are of endemic regions) intermediate areas consist of south central and southwest asia, israel, japan, eastern, southern europe and russia and prevalence of hepatitis b infection is low in northern and western europe, north america, australia, new zealand, mexico and southern america (4). in iran, a study showed that 35% of population were infected with hepatitis b and the percentage of chronic carriers is about 3% ; although after implementing control programs and public vaccination, the prevalence of hbv infection has reduced to less than 2 % (5). the hbv has ten genotypes (a - j), multiple subtypes and serotypes (adr, adw, ayr, ayw), showing genotypes vary in different geographic areas worldwide. there is a relation between serotype and genotype in the world (6). it seems that infected persons with different genotypes show various responses to therapy (7). also different in genotypes have shown influences in sever course of disease, infection and vaccination (8). some studies suggested that genotype d could increase the risk of cirrhosis than genotype c(9), on the other hand some evidences showed no difference between these types in infection risk to hcc(10). moreover some researches found that genotype a is more associated with higher risk of hcc than genotype d(11). recent study showed that genotype c was more strongly associated with hcc than infected patients with genotypes a, b and d (12). pre - core stop codon and basal core promoter mutations are of another difference in risk of hcc in various hbv genotypes. pre - core stop codon a1896 is less in genotype c than genotype b. basal core promoter mutations in x gene upstream of pre - core area is more in genotypes c (13). this mutation increases the risk of hcc in patients with chronic hepatitis (14). hbv genotypes have different distinguished biological and are able to influence the expression of antigen and immune functional, so recognizing hbv genotypes is important in a country. this article has investigated the hbv genotyping and was carried out iran based on papers that identified hbv genotype in iranian population published in english and persian languages. this genome of hbv includes circular dna that some part of it is bi - string and contains reverse transaction enzyme and/or polymerase dna full string genome contains 3020 - 3320 nucleotides and short length strand is 1700 - 2800 nucleotides. there are four areas encoded by hbv genome c, x, p, s. some mutants have found in hepatitis b. in many of this, mutation in pre - core genome is associated with inactivation of hbe ag (ymdd, s mutant) (15). in patients, this mutant is associated with severity of disease and less response to therapy (16). ymdd region in virus polymerase is located in places influenced by most of reverse transcriptase inhibitor such as lamivudine and lamivudine. variation of ymdd occurred as a result using lamivudinethus, after one year therapy with lamivudine, nearly 24% of patients have showed ymdd mutations (17). many of pre - core mutations are related to g - a changing in the 1896 nucleotide, causing the stop codon and preventing the functional of hbe ag genome. a study has reported that 58% of infections are the type of pre - core infection in iran(19). negative hbe ag carriers have been heterogeneous ; most of them have had less dna level and normal alanintransferase ; so they could not be able to completely respond to therapy. some evidences showed that 15 - 20 of hbe ag carriers have a high level of alt and hbv dna in mediterranean, eastern asia and southern europe (20). genotype a is divided into two sub - genotypes aa (a1), ae(a2). sub - genotype aa (a1) was found in africa / asia and philippine. genotype b is also divided into two sub genotype ba / b2 (asia) and bj / b2 (j - japan) and the prevalence of them has been reported in different areas. ba has classified to four classb2-b4, these sub genotypes have more virulence than bj (21). cs (c1) is more common in south east of asia and ce (c2) was observed in japan, china, korea, east of asia (22).c3 was reported in polynesia, caledonia areas and c4 was detected in australia, and c5 and c6 were found in philippine (23). genotype c, is associated with hepatocellular carcinoma in japanese patients and it was not found in taiwanese patients less than 50 years of age (24). genotype d is divided into seven sub - genotype (d1-d2) which are prevalent in pakistan, india, afghanistan, mediterranean areas (26). studies show that sub genotypes d1and d2 were found in turkey (27) but sub genotype d3 was observed more in asia (east india), south of africa and europe and sub genotype d4 was identified in australia (28). recently sub genotype d5 has been reported in east of india and japan (29). a study suggested that genotype d and serotype ayw2 with 94/4% are predominant in hbv positive in iran (30). genotype f has been divided into four sub genotype (f1-f4), also sub genotype f1 was classified to two sub genotype 1a, 1b. sub- genotypes f2, f1 were observed in venezuela and sub genotype f3 was found in east and west of america. some evidences showed that sub genotype 1a from f1 is derived from center of america, sub genotype f3 is found in north of america and sub genotype f4 had been identified from south of america, but sub genotypes of 1b from f2 is prevalent in most of united states instead of north of southern america and north of america (31). genotype f is predominant in brazil and genotype g is reported in france and united state ; also 4 - 8 % difference in subtypes of genotype e and f has been reported (32).genotype h is limited to center of america, mexico and california(33). it has been reported that genotype i was found in north east of india and genotype j was detected in japanese patients (33). epidemiology of hbv genotypes in the world (34) there are some significant differences in clinical characteristics and virology of infected patients with various genotypes. in this study we found 22 studies that were discussed about serotypes and genotypes of hbv in iran. in six studies, serotype ayw2 was reported as the predominant serotype with relatively abundance more than 94% (table 1). the first study about genotypes of hbv was done in 2005 in iran and genotype d is defined as predominant genotype in iran (table 2). in this article, 22 studies were discussed about serotypes and genotypes of hbv in iran. the results of these studies indicate that the predominant genotype and serotype in iran is d and ayw2, respectively. in other studies, there is genotype d in south asia and east asia, such as iran, afghanistan and india (57). this genotype was found the oldest type widely spread in the world. also, addition to ancient civilization, evolving a special genotype for hbv shows its evolution. in addition, the importance of geographical distribution by presenting genotype d has been reported 46 % in the areas surrounding iran such as pakistan, north india (58). in the south of japan (okinawa) it was indicated that genotype b is the predominant genotype (59) while in mainland genotype c is predominant (60). this relations show that factors for the area of human and racial populations are more important than the geographical factors. in asian countries such as india genotype d and sub - genotype d3 genetically research dna mitochondria chromosome y in indians showed the integration of migrators ' genotypes from europe countries that defines in the northern area more than india (62). other studies have showed that abundance of genotype hbv can be the reflection of geographical close relation among this transformation. genotype d is the oldest type that has spread widely in the world (nicobar and andaman islands). also, there are genotypes a and d in the north of india and much more probably it is due to migration from europe which resulted in high prevalence of genotype d in most parts of india. in iran, it can be deduced that aryans was first habitants of caspian sea, then migrated to the other areas of india and europe. it is possible that some persons infected with genotype d were infected before migration and caused to spread it. therefore, in iran, india and most of europian countries, genotype d is seemingly prevalent (63). besides the old civilization ; genotype b is predominant in southern japan (okinawa) (64) ; while genotype c has been reported as the dominant type in mainland japan (65). in various areas of japan genetic studies of mitochondrial dna and y chromosome in indian population indicates the integration of immigrants gene from european countries and in northern parts is more than of south india(67). another study showing the prevalence of hbv genotype and changing geographical ; so that genotype d is more prevalent in west india. that genotypes a and d are in the north of india, is likely related to the migration of people from europe to india and led to genotype d is replaced by genotype a in main areas. in iran, we can know that the aryans have been in the north caspian sea, and then they moved to other parts of iran, india and europe. it seems that genotype d patients have been infected with virus before migration, and then they led to increasing this genotype so genotype d is prevalent in iran, india and most of europe (68). because hbv genotypes show distinct geographical distribution, genotype d is predominant in iran. despite the different geographical areas in different parts of iran, genotype d is considered as the predominant genotype. with regard to surveillance, hepatitis in iranian health system, defining sequences among different isolates of hbv by appropriate intervals or disease outbreaks also, knowing infection to hbv genotypes can help in the standardization of treatment interference and selection of proper regimens for this disease.	hepatitis b virus (hbv) infection is a public health problem as a cause of liver diseases including hepatocellular carcinoma and cirrhosis. it is estimated that 350 million people live with chronic infection and about one million people die every year from complication of this chronic disease in the world. so far, ten hbv genotypes (a - j) has been identified which show a geographical distribution. throughout the world, carrier variability rate for hepatitis b infection is estimated to be 0.1% to 20%, with regions classified as having low endemicity (8%). the prevalence of hepatitis b infection is estimated at 2 to 7 percent in iran. after hbv vaccination program the prevalence of hepatitis b infection has been reported less than 2%, so iran can be considered one of the countries with low hbv infection endemicity. in iran several studies were shown that the only genotype of hbv(100%)was found genotype d as the prominent type in some provinces, but some studies reported genotype b(5%)as well as genotype d(95%).the distribution of hbv genotypes may guide us in determining disease burden, prognosis and antiviral responses. so, it is important to know the epidemiologically of hbv genotyping as well.
it is a benign locally aggressive tumor usually involving the distal end of the femur, proximal tibia and distal radius in young adults. the main variables to be considered for planning treatment include the site of involvement and campanacci stage of the tumor. different treatment options are available which include intralesional curettage, extended curettage, wide resection and reconstruction. functional and oncological outcome of these treatment options varies widely, the predominant detrimental factor being tumor recurrence rate. reconstruction of endoprosthesis after wide excision of the tumor offers good short - term and mid - term functional and oncological outcomes as established by previous studies. this study was conducted to evaluate the long - term outcome of 11 patients with gct who underwent wide excision and customized endoprosthetic replacement. this study included 11 patients (eight men and three women) aged 2448 (mean 32) years with primary gct of proximal femur campanacci stage - iii who were available for mean follow - up duration of 10.6 (range 10.214) years. the definite diagnosis was established on histopathological confirmation with incisional biopsy. computed tomography scan of chest and bone scan none of the patients had pulmonary metastasis, and all the 11 patients had a solitary lesion in the proximal femur. these patients underwent wide resection of the tumor using postero - lateral approach to the proximal femur. the proximal femur was reconstructed using a customized, titanium, cemented endoprosthesis [figure 1 ]. hip abductors, short external rotators and iliopsoas tendon were secured onto the prosthesis and hip capsule repair was performed. postoperative rehabilitation protocol included nonweight bearing and abduction splinting of the limb for 6 weeks followed by nonweight bearing crutch walking for another 6 weeks. once the hip abductors and quadriceps strength was regained weight bearing was allowed. long - term functional outcome was evaluated at minimum 10 years duration using revised musculoskeletal tumor society rating scale. (a) radiogragh showing giant cell tumor of proximal femur in a 34-year - old man. (b) magnetic resonance imaging showing giant cell tumor of proximal femur with soft tissue extension. there were no instances of prosthesis related complications like aseptic loosening or dislocation. at the end of mean 10.6 years six patients had good hip function without any restrictions, four patients had intermediate functional restriction whereas one had the recreational restriction of function. nine patients enthusiastically accepted the outcome of the procedure whereas two patients had satisfactory emotional acceptance. eight patients were walking without any support with unlimited walking abilities whereas three patients were using a cane for support while walking. the mean is revised musculoskeletal tumor society score was 26.8 out of 30 [table 1 ]. traditional treatment of gct has been a difficult problem in orthopaedic oncology owing to high recurrence rates following conventional treatment with curettage or extended curettage. ideally treatment currently with improvement in reconstructive surgical techniques and availability of high quality biomechanically designed megaprosthesis, wide resection of tumor with proximal femur endoprosthesis replacement is being considered as a treatment option for campanacci stage - iii lesions in proximal femur with extensive osteolysis and soft tissue extension. it offers good local control of s with least recurrence rate and favorable functional outcome. the previous studies have shown satisfactory short- and mid - term functional and oncological outcomes. this study shows good long - term functional, and oncological outcomes of the procedure and hence the authors recommended as an endoprosthetic replacement for advanced gct of the proximal femur. furthermore, randomized control trials are required to established this modality as a standard treatment.	introduction : giant cell tumor (gct) of bone is locally aggressive benign tumor involving the epiphysis of long bones in young adults. various treatment options include intralesional curettage, extended curettage, wide resection, resection and reconstruction and amputation. the main variables to be considered for planning treatment include the site of involvement and campanacci stage of the tumor. functional and oncological outcomes of these treatment options vary widely, the predominant detrimental factor being tumor recurrence rate.aim:a study was conducted to evaluate the long - term oncological and functional outcome of patients with gct of the proximal femur that underwent tumor resection and endoprosthetic replacement.materials and methods : eleven patients with campanacci stage - iii gct of proximal femur who underwent wide excision of tumor and endoprosthesis replacement with a mean follow - up the duration of 10.6 years were assessed using standard proforma. the treatment outcome was evaluated using the revised musculoskeletal tumor society rating scale for the lower extremity.results:at mean follow - up the duration of 10.6 years, none of the cases had tumor recurrence, infection, prosthesis loosening or dislocation. all the patients were community ambulators among whom eight patients were walking without support while three patients were using a cane for support. the mean total musculoskeletal tumor society score was 26.8 out of 30 indicating the good outcome.conclusions:the authors recommend that wide resection and endoprosthetic replacement should be considered as a preferred treatment option for proximal femur gct as the functional, and oncological outcome is satisfactory with this modality of treatment.
iridodialysis is not an uncommon complication during phacoemulsification procedures or any intraoperative maneuver, since the iris root is the thinnest and weakest portion of the stroma. when the eye is contused or the iris is accidentally engaged during an operation, separation occurs most frequently at this site.1 superior defects covered by the upper eyelid may be less symptomatic ; however, an iridodialysis in any other quadrant can result in potentially debilitating visual sequelae, including monocular diplopia, glare, and photophobia. in the pseudophakic state, corectopic pupils can potentially expose the edge of an intraocular lens, with the attendant undesired optical phenomena.2 iridodialysis may also cause cosmetic problems. for all these reasons, such conditions must be treated properly.3 several previously described techniques have addressed ways for management of such a problem ; however, complications of inappropriate management can be disastrous, making skilled repair a must and the search for novel techniques an ongoing project. complications vary widely ; for example, inadvertent engagement of the ciliary body causing hemorrhage or increased cyclitis, pulling the iris tissue more peripherally than its initial origin causing corectopia, and if the suture is tightened and the iridodialysis is reduced to the scleral wall, the iris within the suture bite, not the actual iris root, is reapproximated near the iris base, leaving less stroma between the pupil margin and the scleral wall. corectopia can be further exaggerated by the fibrotic response that commonly occurs in the band of disinserted iris stroma. furthermore, the disinserted sector of sphincter muscle is deprived of its radial innervation and blood supply and thus has reduced tone that acts to counteract the curling up of this delicate iris tissue.2 techniques described to repair iridodialysis can be classified into two groups : open chamber and closed chamber techniques.4 open chamber techniques access the iridodialysis site through a limbal self - sealing incision (one of the phaco incisions) or a scleral tunnel incision.5 on the contrary, access to the anterior chamber (ac) is attained with a needle in closed chamber techniques.4 in the continuous search for new, less traumatizing, and more physiological ways for repair of iridodialysis, i hereby present my technique, an emergency technique that has the advantage of the ability to be used intraoperatively, if such a complication occurred during any intraocular surgery, and that can be used as a second - step procedure for any cold case having iridodialysis. this technique has proved validity, efficacy, as well as anatomical and physiological satisfactory results. my technique was first used in an emergency situation (video 1), where during a phacoemulsification case in a 50-year - old patient with faint posterior subcapsular cataract, the patient s iris was severely traumatized due to several maneuvers trying to reposit a prolapsed iris, with the irrigation probe still inside the ac, raising the intracameral pressure and increasing the prolapsed tissue, while the surgeon was trying to reposit the iris in the face of such a prolapsing power, and that was totally opposing laws of nature and physics of fluidics (figures 1a and 2a). such iris traumatization resulted in a large iridodialysis, extending nearly the whole vertical 180 (figures 1b and 2b), necessitating a rapid innovative repair technique ; by this time, the patient still had remaining unremoved epinucleus and cortex, and an intraocular lens to be implanted. my technique involved fixing the iris back to its root using a double - armed 10 - 0 polypropylene suture with two straight needles (stc-6 ; ethicon, somerville, nj, usa). conjunctival peritomy centered over the area of iridodialysis was performed, followed by cauterization of the underlying scleral bed around any broken blood vessels. a partial thickness triangular scleral flap centered over the dialysis area introduction of the first needle was not done through the main phaco wounds, so as to be able to control entry sites allowing proper accessibility of these two faraway ends of the large iridodialysis area, and also to avoid any inadvertent trauma to intraocular structures, such as the bare posterior capsule. the first needle was introduced through the patient s cornea in a way resembling mccannell suture opposing the first end of the dialysis. a 27-gauge needle was introduced below the scleral flap at the proposed anatomical site of the iris root, which was ~1.5 mm posterior to the limbus, consistent with the landmark adopted by agarwal as an external anatomical landmark for the iris root. the direction of needle passage also affects significantly where the needle will come out inside the eye, and so the 27-gauge needle was used to help guide the straight needle out of the ac avoiding any possible injury and making sure it comes out at a point 1.5 mm posterior to the limbus (figures 1d and 2d). the second polypropylene needle was then also passed through the cornea facing the other end of the large iridodialysis and through iris periphery and guided outside to the base of the scleral flap using an insulin syringe. now, with the two needles coming out below the scleral flap, two polypropylene threads will be passing through the ac (figures 1e and 2e). these two threads were then withdrawn through the main phaco wound using a sinskey hook forming two loops arising from the main wound (figures 1f and 2f). cutting these two loops (figures 1 g and 2 g) and tying the cut ends together (figures 1h and 2h) gives rise to a single loop whose two ends are now passing through the two ends of the dialysis and coming out right below the scleral flap. holding the iris tissue with this loop allows full control on iris, repositioning back to its root, and full ability of suture tension control (figures 1i and 2i). the knot is then extruded to outside the eye by pulling on one of the two sutures (figures 1j and 2j), and then, pulling on the other suture in the opposite direction is performed (figures 1k and 2k) to correct any wrinkles in the iris periphery that might have occurred by the first pull, aiming at inhibition of any form of corectopia. the free ends of the suture are then tied (figures 1l and 2l), and the scleral flap is then sutured with single nylon 10 - 0 suture (figures 1 m and 2 m), with the knot now below it. phacoemulsification was then completed with removal of the remaining lens matter, hydration of the main wounds, and closure of the main phaco wound with a single buried nylon 10 - 0 stitch for safety. this technique proved a huge success with postoperative visual acuity of 20/20 only 1 week after, and with near absence of all feared complications of iridodialysis repair ; there was no increase in the patient s intraocular pressure (iop) and only minimal uveitic reaction in the first postoperative day with round regular pupil shape and perfect centration, denying any possible corectopia or irregularity. being encouraged by such results and in pursuit of trying to prove this technique as a valid and completely safe technique for iridodialysis repair, another case was subsequently managed using the same exact technique, but this time in a cold case of iridodialysis that occurred during a phacoemulsification in a 64-year - old patient, that was not managed intraoperatively, and was 1 week old. the same satisfying results were obtained except only for the presence of < 1 hour peripheral anterior synechia on gonioscopy. both patients received the usual postoperative treatment of prednisolone acetate eye drops 1% qid and topical gatifloxacin 0.3% five times per day. they were followed up for 1 year with the aim of exclusion of any late complications that might have not appeared during the early postoperative period. follow - up visits were at 1 week, 1 month, 3 months, 6 months and 1 year interval with the assessment of uncorrected visual acuity (ucva), best - corrected visual acuity (bcva), iop, full anterior segment slit lamp examination, fundus examination, and gonioscopy for the angle of the ac. for the first patient, the ucva and bcva were 20/20 at all follow - up visits, mild ac reaction was noticed on the first postoperative day, the iop ranged between 15 mmhg and 18 mmhg in all visits, and gonioscopy done at 3 months and 6 months postoperatively revealed pigment dispersion only on the trabecular meshwork with no peripheral anterior synechia. for the second patient, i suggested that the defective vision was due to the moderate - to - severe ac reaction caused by the delayed repair and not by the maneuver itself ; the bcva was 20/20 at the remaining follow - up visits. the iop ranged between 16 mmhg and 20 mmhg at all visits, and gonioscopy performed at 3 months and 8 months postoperatively revealed pigment dispersion over the trabecular meshwork, in addition to a band of peripheral anterior synechia taking only 1 hour. my technique was first used in an emergency situation (video 1), where during a phacoemulsification case in a 50-year - old patient with faint posterior subcapsular cataract, the patient s iris was severely traumatized due to several maneuvers trying to reposit a prolapsed iris, with the irrigation probe still inside the ac, raising the intracameral pressure and increasing the prolapsed tissue, while the surgeon was trying to reposit the iris in the face of such a prolapsing power, and that was totally opposing laws of nature and physics of fluidics (figures 1a and 2a). such iris traumatization resulted in a large iridodialysis, extending nearly the whole vertical 180 (figures 1b and 2b), necessitating a rapid innovative repair technique ; by this time, the patient still had remaining unremoved epinucleus and cortex, and an intraocular lens to be implanted. my technique involved fixing the iris back to its root using a double - armed 10 - 0 polypropylene suture with two straight needles (stc-6 ; ethicon, somerville, nj, usa). conjunctival peritomy centered over the area of iridodialysis was performed, followed by cauterization of the underlying scleral bed around any broken blood vessels. a partial thickness triangular scleral flap centered over the dialysis area introduction of the first needle was not done through the main phaco wounds, so as to be able to control entry sites allowing proper accessibility of these two faraway ends of the large iridodialysis area, and also to avoid any inadvertent trauma to intraocular structures, such as the bare posterior capsule. the first needle was introduced through the patient s cornea in a way resembling mccannell suture opposing the first end of the dialysis. a 27-gauge needle was introduced below the scleral flap at the proposed anatomical site of the iris root, which was ~1.5 mm posterior to the limbus, consistent with the landmark adopted by agarwal as an external anatomical landmark for the iris root. the direction of needle passage also affects significantly where the needle will come out inside the eye, and so the 27-gauge needle was used to help guide the straight needle out of the ac avoiding any possible injury and making sure it comes out at a point 1.5 mm posterior to the limbus (figures 1d and 2d). the second polypropylene needle was then also passed through the cornea facing the other end of the large iridodialysis and through iris periphery and guided outside to the base of the scleral flap using an insulin syringe. now, with the two needles coming out below the scleral flap, two polypropylene threads will be passing through the ac (figures 1e and 2e). these two threads were then withdrawn through the main phaco wound using a sinskey hook forming two loops arising from the main wound (figures 1f and 2f). cutting these two loops (figures 1 g and 2 g) and tying the cut ends together (figures 1h and 2h) gives rise to a single loop whose two ends are now passing through the two ends of the dialysis and coming out right below the scleral flap. holding the iris tissue with this loop allows full control on iris, repositioning back to its root, and full ability of suture tension control (figures 1i and 2i). the knot is then extruded to outside the eye by pulling on one of the two sutures (figures 1j and 2j), and then, pulling on the other suture in the opposite direction is performed (figures 1k and 2k) to correct any wrinkles in the iris periphery that might have occurred by the first pull, aiming at inhibition of any form of corectopia. the free ends of the suture are then tied (figures 1l and 2l), and the scleral flap is then sutured with single nylon 10 - 0 suture (figures 1 m and 2 m), with the knot now below it. phacoemulsification was then completed with removal of the remaining lens matter, hydration of the main wounds, and closure of the main phaco wound with a single buried nylon 10 - 0 stitch for safety. this technique proved a huge success with postoperative visual acuity of 20/20 only 1 week after, and with near absence of all feared complications of iridodialysis repair ; there was no increase in the patient s intraocular pressure (iop) and only minimal uveitic reaction in the first postoperative day with round regular pupil shape and perfect centration, denying any possible corectopia or irregularity. being encouraged by such results and in pursuit of trying to prove this technique as a valid and completely safe technique for iridodialysis repair, another case was subsequently managed using the same exact technique, but this time in a cold case of iridodialysis that occurred during a phacoemulsification in a 64-year - old patient, that was not managed intraoperatively, and was 1 week old. the same satisfying results were obtained except only for the presence of < 1 hour peripheral anterior synechia on gonioscopy. both patients received the usual postoperative treatment of prednisolone acetate eye drops 1% qid and topical gatifloxacin 0.3% five times per day. they were followed up for 1 year with the aim of exclusion of any late complications that might have not appeared during the early postoperative period. follow - up visits were at 1 week, 1 month, 3 months, 6 months and 1 year interval with the assessment of uncorrected visual acuity (ucva), best - corrected visual acuity (bcva), iop, full anterior segment slit lamp examination, fundus examination, and gonioscopy for the angle of the ac. for the first patient, the ucva and bcva were 20/20 at all follow - up visits, mild ac reaction was noticed on the first postoperative day, the iop ranged between 15 mmhg and 18 mmhg in all visits, and gonioscopy done at 3 months and 6 months postoperatively revealed pigment dispersion only on the trabecular meshwork with no peripheral anterior synechia. for the second patient, the ucva was 20/60 that corrected to only 20/40 on the first postoperative day. i suggested that the defective vision was due to the moderate - to - severe ac reaction caused by the delayed repair and not by the maneuver itself ; the bcva was 20/20 at the remaining follow - up visits. the iop ranged between 16 mmhg and 20 mmhg at all visits, and gonioscopy performed at 3 months and 8 months postoperatively revealed pigment dispersion over the trabecular meshwork, in addition to a band of peripheral anterior synechia taking only 1 hour. during the ongoing pursuit for newer surgical techniques in all ophthalmological aspects, emergency management techniques remain a priority. i hereby might have achieved advantages over most of these previous techniques, not only by the technique itself, but also because it can be used as a rescue measurement if such a complication occurred during phacoemulsification or any kind of intraocular surgery. although my technique might seem to be a little bit complicated at first, once mastered and performed even a single time, it is much easier to perform and much less time consuming compared with most other techniques. bardak,3 for instance, introduced a technically challenging procedure for closed chamber iridodialysis repair using a needle with a distal hole, where the technique involved 10 - 0 polypropylene suture attached to the hole at the tip of the needle. the needle was inserted into the ac from the point of initial entry ; it was pushed forward to ~1.0 mm behind the separated iris tissue. it was then pushed through the ac and pulled out through the sclera ~1.0 mm behind the limbus. one loop of the suture was taken off the needle, while the second loop was still attached. the needle was pulled back into the ac, and the procedure was repeated using a different needle two to four times depending on the size of the iridodialysis.3 my technique is a single - pass technique as mentioned, making it easy, fast, and less traumatizing to the iris, sclera, and cornea. the technique also has the advantage of burying the final polypropylene knot below the scleral flap, unlike in the study of bardak,3 where their knot was either rotated into the iris tissue or left sub - conjunctivally according to their estimated iris status. if the iris status allowed such a knot rotation, the rotation increases the incidence of corectopia ; if the iris condition did not allow such a rotation, the knot was left directly subconjunctival, which can significantly increase the risk of subconjunctival bleeding this technique also increased the postoperative hyphema, chemosis and, surprisingly, iridodialysis appeared in one of their patients postoperatively.3 khokhar described what they called the stroke and dock technique for iridodialysis repair. their technique involved a 2.75 mm limbal incision 180 opposite to the center of the dialysis to introduce two double - armed polypropylene suture needles through the central area of the periphery of the iris dialysis, and guide them outside to the base of scleral flap using a 27-gauge syringe. although this technique is simple and carries the same concept as my technique, i tried to avoid the restriction of the entry site to a limbal incision that is 180 opposite to the iridodialysis point, which might hinder the ergonomic movement needed to direct the needle to where the surgeon suggests as an ideal position of peripheral iris bite, especially if the iridodialysis is large. my technique offers the flexibility of what the surgeon sees as more suitable for any entry site, and allows the 10 - 0 polypropylene suture needle to enter easily and engage the two points at the dialyzed iris periphery, even if way below or above the horizontal 180. this can be case - tailored or customized according to what fits the situation and to where sutures are supposed to produce a more regular contour. the procedure was performed without being obliged to introduce the two needles of the double - armed polypropylene suture through the same limbal incision, and hence, restricting iris sutures to points that are too close to each other and are 180 opposite to that incision. despite repairing such dialysis as an emergency this is in contrast to what was done by snyder and lindsell2 where, despite being a cold case of repair, intraocular carbachol was injected into the ac in a trial to cause iris stretch. i tried to avoid injecting miotics to minimize postoperative uveitic reaction that might be induced by them. additionally, i still had a phaco case to complete where injecting a miotic would not allow for the proper visualization or removal of the remaining epinuclear or cortical matter, or implantation of an intraocular lens. snyder and lindsell2 also implied that multiple sutures might be needed to repair a larger dialysis than what they presented or any dialysis of large size. on the contrary, in my technique, i was already challenged by the first case of large iridodialysis, and the idea of my loop successfully repairing such a large dialysis (~5 hours) by only one knot, two guided passes and one loop would, in my judgment, cause unnecessary traumatization of delicate ocular structures. snyder and lindsell2 also adopted the idea of rotating the knot into the scleral wall. this caused a centripetal displacement of the pupil that they stated was temporary but might be permanent if the iris was tightly secured to the scleral wall. the idea of a suture left in the ac was suggested by zdek and zmen4 as a solution, instead of leaving the irritating knot unburied or directly below the conjunctiva. as i described in my technique, there are two opposite pulls on the two ends of the loop : the first pull aims at knot extrusion from the ac, while the second and opposite pull on the other end of the loop allows for removal of any peripheral iris wrinkles that might have occurred from the first pull. this maneuver results in absence of a knot in the ac, avoiding unnecessary chronic iris irritation. at the same time, the idea of having two successive pulls in two opposite directions results in the advantage of total absence of corectopia with rounded, regular, and fully reactive pupils. i also adopted the suggestion of agarwal,6 stating the most anatomically suitable position for the scleral exit of the 10 - 0 polypropylene suture straight needle, which is to be at 1.5 mm posterior to the limbus. in order to prove the validity of such a hypothesis, two patients had gonioscopic examination at every single visit throughout their 1-year follow - up period, which showed only pigment dispersion over the trabecular meshwork (as mentioned earlier), with < 1-hour peripheral anterior synechia in the second patient and no recorded elevation of the iop in both cases. as far as we know, trials for repair of the dialysis (once it had occurred intraoperatively, not as a second - step maneuver), have not, up until now, clearly established a suitable and widely accepted technique, except for a single mention by oshika.8 even then, the technique was not fully described, as they mentioned just one case report, that included only a 1-month follow - up period with no adequate record of complications thereafter. from my first case, and apart from the repair itself, i definitively conclude that, as stated earlier, the iris is one of the most sensitive and delicate intraocular structures and there is always a right way to deal with it. i can introduce what appears to be an effective method to use whenever an iris gets prolapsed. first and foremost, we always have to decrease iop and intracameral pressure, not push against a push, or against high positive pressure, as it is not wise trying to reposit a prolapsed tissue while placing the irrigation probe inside. this only increases tension and traumatization, and might end in a disastrous iridodialysis. beside simplicity, reproducibility, and safety, we can summarize the added value of my technique over previously used techniques in three main points : first, the use of customized entry points through the corneal periphery to access customized peripheral locations of the dialyzed iris tissue, using two guided passes and single polypropylene suture, allows better and more precise anatomical apposition and more tension control without excessive manipulation of the delicate iris tissue ; second, the knot extrusion outside the ac results in less chronic iris irritation and induced uveitis ; third, the further suture pull in the opposite direction of knot extrusion treats any induced corectopia. video 1 video representing how an inadvertent way of iris repositioning using the spatula opposite to the direction of irrigation fluid current leads to a large iridodialysis extending throughout the vertical 180. notes : this large iridodialysis was repaired by fixing the iris periphery back to its root using single double - armed polypropylene suture. i started by creation of partial thickness triangular scleral flap centered over the dialysis area using a crescent knife. this was followed by introduction of the first straight needle of a double - armed polypropylene suture through the cornea and then through one end of the dialysis and then getting it out to the base of the scleral flap at a point that was 1.5 mm posterior to the limbus using a 27-gauge needle as a guide track. the same maneuver was repeated with the other needle of the double - armed suture but with gripping the iris periphery at a point that was a bit far from the first one. the two threads were then withdrawn from the ac through the main phaco wound using a sinskey hook forming two loops arising from the main wound. the two ends of the polypropylene loop were pulled from beneath the scleral flap to reposit the iris back to its root. this was followed by pulling on one of the two suture ends to extrude the knot from the ac and then pulling on the other suture in the opposite direction to correct any wrinkles in the iris periphery that might have occurred by the first pull. finally, the free ends of the sutures were tied below the scleral flap and the scleral flap was sutured with single nylon 10 - 0 nylon suture at the apex.	managing large iridodialysis that may occur during phacoemulsification is challenging. i describe how a procedure to reposit a prolapsed iris while the anterior chamber is markedly inflated by a current of infusion fluid may inadvertently lead to large iridodialysis, and discuss how to avoid such a complication. i describe a fast and efficient technique for managing large iridodialysis both immediately, once it occurs, or as a secondary maneuver. my technique involved fixing the iris periphery back to its root at the anterior chamber angle using 10 - 0 polypropylene suture with two straight needles introduced directly through the cornea at distant points, and an insulin syringe as a guide track to a point 1.5 mm from the limbus at the base of a triangular scleral flap that was designed to be centered on the area of iridodialysis. i confirmed the simplicity, efficacy, and safety of my technique through a 1-year follow - up period.
in patients with obstructive colorectal cancer, where conventional colonoscopy can not traverse obstruction, clearance of the proximal colon remains a problem. a 58-year - old woman presented to her physician with rectal bleeding and intermittent diarrhea. conventional colonoscopy revealed a bulky tumor which was diagnosed as rectal cancer. slim optical colonoscopy (pcf - p240al / i, olympus, tokyo, japan) showed obstructive cancer in the rectosigmoid junction (fig. 1, arrow a) and no information of the proximal side of the obstruction. the patient then underwent multidetector - row computed tomographic (ct) colonography (virtual colonoscopy) for further evaluation of the proximal colon. three - dimensional endoluminal fly - through images revealed another protruded lesion (fig. diagnosis of synchronous double cancer was made by ct air - contrast enema image (fig. this ct data was not only used to create three - dimensional images but also to decide on a preoperative clinical staging. laparoscopy - assisted high anterior resection was performed and t3 rectal cancer and t1 sigmoid colon cancer were confirmed in the resected specimen (fig. between 4.6 and 11% of patients with colorectal cancer have a second synchronous cancer [1, 2, 3 ]. preoperative evaluation of the whole colon and rectum in patients with colorectal cancer is widely recommended. optical colonoscopy is the current gold standard method as it examines the whole colon and rectum. however, preoperative examination by optical colonoscopy may be hampered by occlusive colorectal cancer, and failure to find the presence of a synchronous cancer will change the surgical approach from circumscribed resection to resection of the involved segments. ct colonography might be offered in preference to barium enema for incomplete colonoscopy [5, 6 ]. ct colonography has recently become a popular preoperative examination tool with significant improvement in quality of image due to a rapid progress in computer technology [7, 8 ]. ct colonography correctly showed synchronous double cancer in our case and provided crucial information for planning surgery. we recommend that ct colonography should be used for evaluating the proximal side of obstructive colorectal cancer, as it is well tolerated and less invasive [6, 9 ].	a 58-year - old woman presented to her physician with rectal bleeding and intermittent diarrhea. optical colonoscopy revealed a bulky tumor which was diagnosed as rectal cancer. she was referred to our institution for further evaluation and treatment. slim optical colonoscopy showed an obstructive cancer in the rectosigmoid junction and no information of the proximal side of the obstruction. the patient then underwent computed tomographic (ct) colonography for further evaluation of the proximal side. three - dimensional endoluminal fly - through images revealed another protruded lesion in the proximal side of the obstruction. diagnosis of synchronous double cancer was made by ct colonography. this ct data was not only used to create three - dimensional images but also to decide on a preoperative clinical staging. laparoscopy - assisted high anterior resection was performed and t3 rectal cancer and t1 sigmoid colon cancer were confirmed in the resected specimen. follow - up optical colonoscopy revealed no other tumors. ct colonography has recently become a popular preoperative examination tool with significant improvement in quality of image due to a rapid progress in computer technology. ct colonography correctly showed synchronous double cancer in our case and provided crucial information for planning surgery. we recommend that ct colonography should be used for evaluating the proximal side of obstructive colorectal cancer.
venous thromboembolic (vte) disease encompasses deep venous thrombosis (dvt) and pulmonary embolus (pe). it is an important source of morbidity and mortality in hospitalized patients. with an increasing focus on patient safety and quality of care, vte has become a target measure of quality by multiple quality improvement organizations and also consumer watch groups. despite the implementation of screening protocols and guidelines for dvt prophylaxis, there are no uniformly accepted dvt surveillance programs in the united states, and as a result, the reported incidence of dvt varies greatly depending on which studies are evaluated. it has been reported that trauma centers that aggressively screen for dvt have a tendency to report a higher incidence of these events. most vte screening programs are focused solely on the evaluation of the lower extremity deep venous system. we hypothesize that for trauma patients in the intensive care unit (icu) the incidence of upper extremity dvt (uedvt) is higher than the incidence of lower extremity dvt (ledvt), and as a result, trauma centers that aggressively screen for dvt should include the upper extremities in their surveillance protocols. after approval by the institutional review board, a retrospective trauma registry and chart review of icu trauma patients with upper and ledvts detected on surveillance duplex ultrasound from january 2010 to december 2014 was carried out at our institution. all patients 18 years of age or older who were admitted to the icu and received an upper and lower extremity surveillance duplex study that demonstrated a dvt were included in this study. patients with a known preexisting dvt and dvts identified outside of the icu setting were excluded. all patients received prophylaxis with low molecular weight heparin unless there was an existing contraindication to anticoagulation. variables reviewed were patient age, injury severity score (iss), icu length of stay, total length of stay, gender, mechanism of injury, whether the patient was on a ventilator, presence of central venous pressure (cvp) line, presence of cvp line in same extremity as dvt, presence of large bore vascular access catheter, presence of prior cvp line, presence of prior cvp line in same extremity as dvt, presence of a fracture in the same extremity as dvt, presence of an inferior vena cava filter before dvt detection, clot location, and development of pe. continuous variables were described using mean and standard deviation (sd) while categorical variables with frequency and proportion. the student 's t - test was used to access the difference between upper and ledvt in the continuous variable. fishers ' exact test was used to access the difference between upper and ledvt in the categorical variables. statistical analysis system v9.3 (cary, nc, 27513, usa) was used for the analysis. mean icu and total hospital length of stay were 18.7 days (sd 12.9) and 24.7 days (sd 17.4), respectively. when looking at the mechanism of injury for our study population, 126 dvts were from patients that sustained blunt injury, and 10 dvts were from patients with penetrating injury, which is representative of our trauma patient population. when looking at the location of dvt, 75 or 55.1% were in the upper extremities, and 61 or 44.9% were in the lower extremities. the anatomic distribution of the identified uedvts is brachial (62), axillary (26), subclavian (11), and internal jugular (10). the anatomic distribution of ledvt is femoral (58), popliteal (14), below knee (4), and iliac (2). five of these patients had a uedvt, and nine had an ledvt [table 1 ]. descriptive summary on the variables (n=136) when looking at the association between upper and lower dvt on selected variables, none of the variables had a statistically significant association with dvt. only presence of a cvp line in the same extremity and presence of a fracture in the same extremity trended toward a statistically significant association [table 2 ]. association between upper and lower dvt on some selected variables twenty - six patients with uedvt underwent a repeat duplex scan with 16 showing a persistent clot and ten showing resolution of clot. eighteen patients with ledvt had a repeat duplex scan with nine showing a persistent clot and another nine showing resolution of clot. four new uedvts and five new ledvts were identified on repeat duplex scan. repeating a duplex scan to the best of our knowledge, ours is the only study of a dvt surveillance protocol to examine the upper extremities as well as the lower extremities, and the higher incidence of uedvt than ledvt is a striking finding. in addition, 6.7% of the patients with uedvt also developed a pe. while the rate of pe for patients with ledvt was higher (14.8%), the number of patients with uedvt and pe was higher than we expected. the results of our study indicate a need for further assessment of screening protocols for dvt in high - risk trauma patients. the reported incidence rates vary widely (0.36%58%) and depend on diagnostic procedures, patient demographics, iss, medications, and other factors. in addition, screening protocols are not uniform across institutions, and some studies suggest that institutions with more aggressive screening protocols have higher dvt rates. pierce. found that for every 1% increase in ultrasound rate there is a + 1.07% in dvt rate. described an aggressive prophylaxis and screening protocol during which lower extremity duplex scans were performed on a weekly basis, and duplex examinations of the upper extremities were performed only if a patient was symptomatic. this study found low rates of vte and 86% of ledvts in this study were found during routine screening as opposed to symptomatic patients. jawa. also found no significant difference in the incidence of dvt after implementation of a surveillance protocol which resulted in a 5-fold increase in the number of duplex scans and substantial increase in cost. yet another analysis of neurosurgical patients by patel. suggests that routine surveillance after 7 days may not be needed. prior studies have focused on the incidence of dvt in the context of surveillance protocols with a focus on the lower extremities. there is a growing body of literature showing the clinical importance of uedvt and its complications in medical, surgical, and trauma patients. analyzed the mortality and incidence of pe in patients diagnosed with subclavian / axillary / internal jugular vein dvt and compared it to patients diagnosed with brachial dvt. contrary to their hypothesis there was no significant difference in the relationship between the incidence of pe and mortality and the site of uedvt. it is, therefore, not unreasonable to think that if surveillance for uedvt is not carried out, some uedvt will not be identified and some of these may progress to pe or patients may develop other complications such as postthrombotic syndrome. our data are limited by a relatively small, single institution patient population and as a result did not show any statistically significant association between development of upper or ledvt and the analyzed variables. future multi - institutional studies may help clarify whether the increased incidence of uedvt is reproducible outside of our institution. reproducibility may also be hindered by different practice patterns across the nation, including timing to initiation of vte prophylaxis and different screening practices. further study could help identify individual risk factors which may aid in selection of a subset of high - risk patients for surveillance for dvt. some studies argue against surveillance and cite an increase in cost with no significant increase in identification of dvt. if more studies are done to further tease out individual risk factors, perhaps a better selection of patients can maximize the utility of a screening protocol without compromising cost efficiency and decrease selection bias. this would be particularly beneficial in the age of increasing concerns for patient safety and pay for performance models. with the currently available data, it is evident that dvt rate is a poor quality indicator and that selection bias plays an important role in dvt rates at different institutions. further study is, therefore, needed to identify a subset of patients that will benefit from surveillance protocols without compromising an institution 's perceived quality of care provided. trauma centers that perform aggressive surveillance duplex screening for dvt have demonstrated a higher incidence of ledvt in high - risk trauma patients than centers that do not routinely screen. one can debate the merits of an aggressive thromboembolic screening program, especially since hospitals may receive financial penalties resulting from the affordable care act due to the latest iteration of the american college of chest physicians practice guidelines recommend against periodic surveillance for identification of dvt with compression ultrasound in critically ill and high - risk trauma patients. on the other hand, many studies have documented that severely injured trauma patients are at significant risk of developing venous thromboembolisms despite appropriate prophylaxis. published guidelines by the eastern association for the surgery of trauma have supported the use of ultrasound to assess asymptomatic patients for dvt. this study in a level one trauma center demonstrated that with a weekly four extremity ultrasonographic screening program, uedvt 's were shown to be more common than ledvt 's. in fact, uedvt 's which were de novo and not induced by cvp line and fracture proved to have a higher incidence that ledvt 's. this was an unexpected finding with ramifications for screening recommendations, treatment, and financial consequences. we propose that for trauma centers that aggressively screen the lower extremities with venous duplex ultrasound, surveillance to include the upper extremities is warranted. department of surgery, texas tech university health sciences center el paso, el paso, texas, usa. there are no conflicts of interest. department of surgery, texas tech university health sciences center el paso, el paso, texas, usa.	background : due to the high incidence of thromboembolic events (deep venous thrombosis [dvt ] and pulmonary embolus [pe ]) after injury, many trauma centers perform lower extremity surveillance duplex ultrasounds. we hypothesize that trauma patients are at a higher risk of upper extremity dvts (uedvts) than lower extremity dvts (ledvts), and therefore, all extremities should be evaluated.materials and methods : a retrospective chart and trauma registry review of intensive care unit trauma patients with upper and ledvts detected on surveillance duplex ultrasound from january 2010 to december 2014 was carried out. variables reviewed were age, gender, injury severity score, injury mechanism, clot location, day of clot detection, presence of central venous pressure catheter, presence of inferior vena cava filter, mechanical ventilation, and fracture.results : a total of 136 patients had a dvt in a 5-year period : upper - 71 (52.2%), lower - 61 (44.9%), both upper and lower - 4 (2.9%). overall, 75 (55.2%) patients had a uedvt. upper dvt vein : brachial (62), axillary (26), subclavian (11), and internal jugular (10). lower dvt vein : femoral (58), popliteal (14), below knee (4), and iliac (2). 10.3% had a pe : uedvt - 5 (6.7%) and ledvt - 9 (14.8%) p = 0.159.conclusions:the majority of the dvts in the study were in the upper extremities. for trauma centers that aggressively screen the lower extremities with venous duplex ultrasound, surveillance to include the upper extremities is warranted.
cancer is a prothrombotic condition that predisposes patients to various thromboses such as lower extremities thromboses and pulmonary embolism [1, 2 ]. obstruction of blood flow from external compression, frequently from lymph node masses, is also common, especially malignancy of the lower abdomen and pelvis which can cause lower extremity edema and in the mediastinum which can cause superior vena cava syndrome from mediastinal lymphadenopathy. in contrast, compression of pulmonary vessels from mediastinal lymphadenopathy is less common but is important to correctly diagnose because the treatment and prognosis are different from those of pulmonary embolism. we report the case of a man with metastatic bladder carcinoma who had massive mediastinal lymphadenopathy causing external pulmonary artery compression leading to a rapidly fatal outcome. a 59-year - old man was admitted to the hospital with severe fatigue and dyspnea at rest. he had undergone a radical cystectomy with neobladder construction for transitional cell carcinoma of the urinary bladder seven months previously and had received five cycles of adjuvant dose - dense mvac (methotrexate, vinblastine, adriamycin, and cisplatin) chemotherapy after the operation. a few days before admission, restaging cts showed multiple liver metastases, two right kidney lesions, a lytic lesion in the thoracic spine, massive right hilar lymphadenopathy, right pelvic lymphadenopathy, and a right pleural effusion. on admission, the patient was pale, with dyspnea at rest, tachypnea, and tachycardia, but he had no chest pain, cough or hemoptysis. his blood pressure was 110/70 mmhg and the o2 saturation was 97% when the patient was on room air. laboratory evaluation showed a leukocytosis at 45,000 /l with neutrophilia at 43,700 /l and lymphopenia at 500 /l as well as a hemoglobin of 9.5 gm / dl and platelets at 66,000 /l. other abnormal values from the biochemical evaluation included the alkaline phosphatase at 218 iu / l (normal range 35104 iu / l), the ldh at 590 iu / l (normal range 135225 iu / l), crp at 12.66 mg / dl (normal range 010 mg / dl), inr at 1.52, and fibrinogen at 567 mg / dl. a chest x - ray showed right middle lobe atelectasis and bilateral infiltrates (figure 1). ct angiography of pulmonary arteries showed absence of arterial thrombi in the vessels but confirmed extensive mediastinal and hilar lymphadenopathy obstructing and impeding blood flow in both pulmonary vessels (figure 2). in preparation for emergency radiation treatment, the constellation of symptoms as described in this patient 's acute presentation is suggestive of acute pulmonary embolism, a condition not uncommon in patients with neoplastic diseases. cancer is a prothrombotic state and cancer patients frequently have other causes promoting thromboses such as reduced mobility, central catheters, and surgery. in addition to pulmonary embolism due to thrombosis, cancer patients may suffer from embolism due to neoplastic emboli, a condition termed pulmonary tumor embolism. this has been seen in up to 26% of cancer patients in autopsy studies [5, 6 ] and has been documented in transitional cell carcinoma of the bladder. contrast - enhanced computer tomographic (ct) arteriography of the pulmonary vessels and ventilation - perfusion scintigraphy (v / q scanning) are the studies used for diagnosis of pulmonary embolism. contrast - enhanced ct arteriography has the advantage over ventilation - perfusion scintigraphy in being able to visualize and characterize nonvascular structures. it is also particularly useful in the presence of pleural effusions, a common occurrence in malignancy, where v / q scanning loses its diagnostic accuracy. signs of pulmonary embolism with ct arteriography include intraluminal filling defects, total cutoff of vascular enhancement, enlargement of the occluded vessel, pleural - based wedge - shaped areas with no contrast enhancement, and linear atelectasis [8, 9 ]. in contrast, ct arteriography can not distinguish pulmonary embolism from the rare intra - arterial tumor masses. in this case diagnosis ct arteriography in our patient did not show pulmonary embolism but instead revealed external pressure on the pulmonary arteries from metastatic adenopathy, illustrating this advantage of ct arteriography. lymphadenopathy compressing the circulation of lower extremities is a common problem in patients with pelvic malignancies while mediastinal lymphadenopathy, most commonly from lung cancers, is a common cause of the superior vena cava syndrome. bladder cancer has a tendency to metastasize to intraabdominal lymph nodes, liver, bones, and lung [1113 ] while thoracic lymphadenopathy is also common although less than intraabdominal lymphadenopathy. mediastinal metastases from transitional cell carcinoma of the bladder either are asymptomatic or may more commonly produce the superior vena cava syndrome or dysphagia from esophageal invasion or compression. pulmonary arterial compression as seen in our patient is far less common and indeed this is to the best of our knowledge the first case with this occurrence reported in the english literature. nevertheless it needs to be included in the differential diagnosis of a cancer patient presenting with symptoms suggestive of acute pulmonary embolism because the treatments of the two conditions are different. prompt initiation of anticoagulation is mandatory in a patient diagnosed with pulmonary embolism while treatment for external compression includes radiation therapy with the possible addition of steroids to reduce concomitant soft tissue edema and improve reactive bronchoconstriction. as the molecular biology of metastatic bladder cancer becomes clearer and therapeutic options increase with both conventional chemotherapy and targeted therapies [1618 ], successful management of these patients may become more relevant.	transitional cell carcinoma of the urinary bladder is a malignancy that metastasizes frequently to lymph nodes including the mediastinal lymph nodes. this occurrence may produce symptoms due to compression of adjacent structures such as the superior vena cava syndrome or dysphagia from esophageal compression. we report the case of a 59-year - old man with metastatic transitional cell carcinoma for whom mediastinal lymphadenopathy led to pulmonary artery compression and a rapidly fatal outcome. this rare occurrence has to be distinguished from pulmonary embolism, a much more frequent event in cancer patients, in order that proper and prompt treatment be initiated.
over the past years, the design and synthesis of nanostructured materials with desired size, shape, and morphology have attracted considerable attention for achieving novel morphology - dependent chemical physical properties.[1 - 8 ] particularly, porous nanostructure materials have received significant interest owing to the pore structure features and the large specific surface area, which make them suitable for applications in catalysis, sensing, energy storage, etc.[9 - 16 ] glucose monitoring is vital in clinical diagnostics, biotechnology, and the food industry. specifically, there has been great interest in the development of electrochemical glucose sensors. compared with other detection approaches, the use of an electrochemical technique is one of the most promising in the construction of simple and low - cost glucose sensors because of its high sensitivity, good selectivity, and ease of operation. the conventional glucose biosensors based on glucose oxidase (god) exhibit high sensitivity and selectivity. however, due to the intrinsic features of enzymes, these god - based biosensor approaches suffer greatly from the influences of various environmental factors such as temperature, humidity, ph value, organic reagents, and toxic chemicals.[18 - 21 ] to solve these problems, nonenzymatic glucose biosensors based on the direct detection of glucose have been developed for practical applications. recent research has shown that nanomaterials can be applied as sensors for glucose detection because of their unique physical and chemical properties. for example, noble metals, metal alloys, and metal oxides have been successfully used in the construction of nonenzymatic glucose sensors,[22 - 28 ] suggesting that nanostructured materials are potential candidates for application as nonenzymatic glucose sensors. as an important ii vi semiconductor material, zns has been extensively studied due to its luminescent, photochemical, and electrochemical properties., nis has also been widely studied and has widespread applications in lithium ion batteries, supercapacitors, waste water treatment, etc.[31 - 33 ] the individual physical and chemical properties of zns or nis materials have been extensively studied ; however, there have been few reports on zns recently, much attention has been focused on improving the related physical and chemical performance of materials based on mixed transition metal sulfides, which can provide a synergistic effect of all individual constituents and efficient rapid pathways for ion and electron transport not only at the surface of materials, but also throughout the bulk of materials.[34 - 36 ] although many simple metal sulfides have been prepared, the controllable preparation of mixed transition metal sulfides with desirable composition and morphology still remains a great challenge. thus, developing simple routes to prepare mixed transition metal sulfides is necessary. in this work nis composite has two advantages : 1) it provides a large enough inner space and a high active surface area due to a strong synergistic effect from zns and nis ; 2) as electrochemical active materials for nonenzymatic glucose sensors, the synthesized zns moreover, the sensor is also highly selective to the target analyte. the mesoporous zns nis mesoporous materials was performed via a simple ion - exchange reaction between ni and zns nanospheres. figure 1 presents the x - ray diffraction (xrd) patterns of the prepared samples. all the diffraction peaks can be perfectly indexed to the pure hexagonal phase of zns with lattice parameters a=0.3821 nm and c=0.6257 nm, which are in good agreement with the international center for diffraction datas joint committee on powder diffraction standards (jcpds) card 36 - 1450. the xrd pattern shows that the diffraction peaks of (100) and (101) overlap with the diffraction peak of (002) because of widening, which is a result of the small crystallite size. no characteristic peaks corresponding to other impurities were observed in the pattern, which indicates that the products are pure zns (figure 1 a). figure 1 b shows the xrd pattern of the prepared zns nis composites. x - ray diffraction (xrd) patterns of a) zns and b) zns nis composite materials. to gain further information on the elemental compositions of the zns nis composites, x - ray photoelectron spectroscopy (xps) was used to further characterize the sample. the two strong peaks at 1020.8 and 1044.1 ev, assigned to the binding energies of zn 2p3/2 and zn 2p1/2, respectively, suggest the existence of zn. the ni 2p xps spectrum is shown in figure 2 c ; two major peaks with binding energies at 855.3 and 872.8 ev in addition, a weak peak corresponding to the satellite peak at around 861.2 ev was also observed, which was ascribed to the multi - electron excitation (shake - up signal). high - resolution scans of the s element in figure 2 d reveal a peak centered at around 160.6 ev, which can be accordingly assigned to the binding energy of s 2p. the corresponding energy dispersive x - ray spectroscopy (eds) maps of the zns nis composites were also recorded (figure s1, supporting information) to further confirm the zn, ni, and s elements. in figure s1 three color mapping images are shown : red : znk, green : nik, and blue : sk. for the different element contents, the green nik color is much lighter than the red znk images, which reveals that the ni content is much lower than the zn content. it was found that the ni element content is about 4.5 at %. high resolution x - ray photoelectron spectroscopy (xps) survey scan spectra of the zns nis composites : a) full survey scan ; b) zn 2p ; c) ni 2p ; d) s 2p. the morphology of zns and zns nis composites were investigated by electron microscopy. typical scanning electron microscopy (sem) and transmission electron microscopy (tem) images are shown in figure 3 a d. the prepared zns particles are monodisperse solid spheres with average diameters of 500 nm, and the surfaces of these spheres are relatively rough (figure 3 a, b), suggesting that the zns solid nanospheres contain a large number of packed nanoparticles, which is further confirmed by the corresponding highly enlarged tem image (see inset in figure 3 d). a high - resolution tem image (figure 3 e) displays several sets of lattice fringes with a spacing of 0.33 nm, corresponding to the (100) planes of hexagonal phase zns crystals. the selected area electron diffraction (saed) patterns confirm that the obtained zns are polycrystalline. nis composites were also examined using tem. the tem image in figure 4 a shows zns nis composite nanospheres becomes rougher (figure 4 b), suggesting the formation of nis crystallites on the zns surface. nis composites in figure 4 d displays the lattice planes of zns (100) and nis (110) with lattice spacings of 0.33 and 0.17 nm, respectively. scanning electron microscopy (sem) images of zns (a, b) ; transmission electron microscopy (tem) images of zns (c, d), inset : highly enlarged section of the image ; e) high - resolution tem image of the zns shell ; f) selected area electron diffraction (saed) patterns of zns. nis composites (a c) ; d) high - resolution tem image of the area marked with a white circle in panel c. the specific surface areas and pore size of the prepared zns and zns nis composites were further studied by nitrogen adsorption desorption measurements, as indicated in figure 5. the hysteresis loop of the zns and zns nis composites typically belongs to type iv, indicating the characteristics of a mesoporous material. as shown in figure 5 a, the specific surface area of zns nis composites (137.9 m g) is much larger than that of zns (68.9 m g). halenda (bjh) pore size distribution curves (figure 5 b) show that the zns and zns nis composites present a monomodal pore distribution, and the average pore diameter is about 2.4 nm. as widely reported, a large effective surface area usually offers many nanochannels for contacting the electrolyte through surface interface interactions of nanoporous micro-/nano - structures. desorption isotherms of the prepared samples ; b) corresponding pore volume distribution (dv dr) against pore diameter curves of the prepared samples. to evaluate the electrochemical property of the prepared mesoporous zns nis composites, we carried out the cyclic voltammetry (cv) to investigate glucose oxidation and reduction. nis composites using a modified glassy carbon (gc) electrode and a bare gc electrode in the absence and presence of 5 mm glucose in 0.1 m naoh. as shown for the bare gc electrode, there is only a small background current observed (figure 6 a), whereas a big increase in signal can be noted when the electrode was modified by the prepared mesoporous zns nis composites (figure 6 b). upon the addition of 5 mm glucose, a more dramatic increase can be found after the gc electrode was modified (figure 6 c). cyclic voltammetry (cv) traces : a) bare gc electrode in glucose (5 mm) and naoh (0.1 m) ; gc electrode modified with zns nis composites in naoh (0.1 m) in the b) absence or c) presence of glucose (5 mm) ; scan rate=50 mv s. we also carried out cv to investigate glucose oxidation and reduction in physiological ph values (ph 7.2). after the addition of 5 mm glucose, a small increase of signal can be noted (figure s2, supporting information). nis composites have an excellent electroanalytical ability in 0.1 m naoh solution compared with solutions at physiological ph and an enhanced response that can be attributed to many transport channels in the mesoporous zns nis composites materials owing to its high specific surface areas. time responses at a potential of 0.6 v after successive injections of different amounts of glucose into the 0.1 m naoh solution under stirring are presented in figure 7 a. it can be seen from the insets of figure 7 a that a gc electrode modified with mesoporous zns nis composites shows an obvious increase in current response after successive additions of glucose, and it takes less than 5 s to achieve the steady - state current upon addition of glucose to the stirring support electrolyte. nis composites could be attributed to the synergistic effect of the composites, which include highly active catalytic sites for glucose oxidation owing to the high specific surface areas. the high electron - transfer rate can be associated with the many transport channels throughout the mesoporous zns nis composite materials. in figure 7 b, we find the glucose detection concentration range to be 0.125 m0.12 mm (r=0.9968), and the calculated sensitivity is 48.5 a mm. in the glucose concentration range of 0.15 mm1.0 mm (r=0.9935), the calculated sensitivity is 26.4 a mm. the performance of the prepared mesoporous zns nis composites is comparable with some nonenzymatic glucose sensors, as shown in table s1 (supporting information). the sensitivity and detection limit of glucose for the mesoporous zns nis composite electrocatalyst are better than those of many nonenzymatic sensors, such as ptni nanoparticles / graphene (20.42 a mm cm, 0.01 mm), palladium nanotube (33.19 a mm, 0.1 mm), and nio / dna - dispersed graphene hybrid (9 a mm cm, 2.5 m)., however, the sensitivity and detection limit of some nonenzymatic sensors are better than our results, such as for porous ni networks (2900 a mm cm, 0.07 m) and cuo nio microfibers (3165.53 a mm cm, 1 nm). a) current time response diagram of a gc electrode modified with mesoporous zns nis composites upon successive addition of glucose in naoh (0.1 m) (inset : magnified diagram at glucose concentrations of 0.1255 m) ; b) plot of electrocatalytic current of glucose versus its concentrations in the range of 0.125 m1.0 mm ; c) amperometric response of modified electrodes with successive addition of glucose, ascorbic acid (aa), uric acid (ua), dopamine (da), kcl, and glucose in naoh (0.1 m). one of the major challenges in nonenzymatic glucose detection is to eliminate the electrochemical response generated by some easily oxidizable endogenous interfering compounds such as ascorbic acid (aa), uric acid (ua), dopamine (da), and kcl. owing to their higher electron transfer rates nis composite electrode with highly active surfaces can favor a kinetically controlled sluggish reaction (the oxidation of glucose) to a greater extent than diffusion - controlled reactions (the oxidation of interfering species). therefore, interference tests were carried out by adding 100 m glucose, followed with additions of 200 m aa, 200 m ua, 200 m da, and 200 m kcl in 0.1 m naoh. the results shown in figure 7 c demonstrate that almost negligible interference from aa, ua, da, and kcl is present at the sensor. nis composites exhibit high selectivity, which is might attributed to the morphological characteristics of a mesoporous structure with high specific surface area and a rational composition of the two constituents. nis composites on the surface of electrodes can be used to modify the mass transport regime, and under favorable circumstances, this alteration can facilitate the amperometric discrimination between species.[45 - 47 ] thus, zns nis sensors exhibit high selectivity. nis mesoporous materials were made, and their current responses to 10 m glucose were investigated. the relative standard deviation (rsd) was 3.51 % with a mean current response of 0.0739 a. nis / gc electrodes response current over 4000 s after the addition of 10 m glucose. after 4000 s, there is only a 6 % loss in the specific response current of the electrode, which is stable enough for use as an electrochemical sensor of glucose. nis composites after the addition of glucose (10 m) measured over 4000 s. based on the discussion above, the prepared mesoporous zns nis composites can offer a larger accessible surface area for the nanopores, a short diffusion path for ions, and good conductivity. nis composites could have novel interfaces (between the zns and nis nanoparticles), which can provide a synergistic effect from individual constituents and efficient, rapid pathways for ion and electron transport not only at the materials surface, but also throughout the bulk of the material. physical adsorption desorption abilities towards ions and their diffusion paths, resulting in a better electroanalytical detection of glucose.[48 - 50 ] nis composites have been prepared by ion - exchange reactions using zns as a precursor. as a result of novel interface characteristics, conductivity, and synergistic effects from zns and nis constituents, the mesoporous zns nis composites provide an efficient and rapid pathway for ion and electron transport not only at the materials surface, but also throughout the bulk of the material. the results of the electrochemical detection show the mesoporous zns nis composites exhibit high selectivity and a low detection limit for the oxidation of glucose. this present study is important as it provides us with an effective approach in preparing novel mesoporous zns this synthesis method can be extended to the preparation of other materials for many applications. materials preparation : zns nanospheres were prepared as follows : zn(ac)26 h2o (0.5 mmol) was dissolved in glycerol (8.0 ml) and h2o (9.0 ml) with magnetic stirring, then nh3 solution (3.0 ml, 25 %, analytically pure) and l - cysteine (3.0 mmol) were added, respectively. after 10 min of stirring at rt, the mixture was transferred into a 50 ml teflon - lined autoclave reactor and heated in an oven at 140 c for 6 h. the precipitate was centrifuged (4000 rpm for 10 min) and washed with deionized h2o (10 ml) and absolute ethanol (10 ml), and dried in a vacuum oven at 50 c for 12 h. to prepare zns nis mesoporous composites, zns (1.0 mmol) nanospheres were dispersed in deionized h2o (20 ml). then, ni(ac)24 h2o (248.8 mg, 1.0 mmol) was added to the solution while stirring. the resulting mixture was then transferred into a 100 ml round - bottom flask and heated at 80 c for 24 h using a water bath. the precipitate was collected by centrifugation (4000 rpm for 10 min) and washed with deionized h2o (10 ml) and absolute ethanol (10 ml), then dried at 50 c for 12 h. preparation of the glucose sensor : the glassy carbon (gc) electrode (3 mm diameter) was carefully polished using a polishing cloth with alumina slurry (1.0, 0.3, and 0.05 m in sequence), then rinsed thoroughly with deionized h2o, and allowed to dry at rt. to prepare the gc electrode modified with the zns nis composite (1 mg ml) was prepared, and the suspension (5 l) was cast onto the surface of the pretreated gc electrode. the solvent was allowed to evaporate at rt, leaving the zns nis mesoporous material immobilized on the gc electrode surface. apparatus and measurements : cyclic voltammetry (cv) measurements were performed on a chi 660d electrochemical station (chen hua, shanghai, china), a three - compartment electrochemical cell containing a saturated calomel reference electrode, a platinum wire auxiliary electrode, and a modified gc electrode as the working electrode. for the cv measurements, the potential scan was taken from 0.60 to 1.00 v at a scan rate of 50 mv s. for the amperometric detection, all measurements were performed by applying an appropriate potential to the working electrode and allowing the transient background current to decay to a steady - state value prior to the addition of glucose. characterization : the morphology of the obtained sample was observed by a hitachi s-4800 field emission scanning electron microscope (fe - sem) at an acceleration voltage of 10.0 kv. the phase analyses of the samples were characterized by x - ray diffraction (xrd) on a shimadzu xrd-6000 powder x - ray diffractometer with cu- radiation (=1.5418). standard and high - resolution (hr) transmission electron microscopy (tem) images were obtained on a jeol jem-2100 microscope at an acceleration voltage of 200 kv. the surface area, pore size, and pore size distribution of the materials were determined by brunauer desorption and barett joyner halenda (bjh) methods on a micromimetrics asap2020 physisorption analyzer. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors.	mesoporous zns nis composites are prepared via ion- exchange reactions using zns as the precursor. the prepared mesoporous zns nis composite materials have large surface areas (137.9 m2 g1) compared with the zns precursor. more importantly, the application of these mesoporous zns nis composites as nonenzymatic glucose sensors was successfully explored. electrochemical sensors based on mesoporous zns nis composites exhibit a high selectivity and a low detection limit (0.125 m) toward the oxidation of glucose, which can mainly be attributed to the morphological characteristics of the mesoporous structure with high specific surface area and a rational composition of the two constituents. in addition, the mesoporous zns nis composites coated on the surface of electrodes can be used to modify the mass transport regime, and this alteration can, in favorable circumstances, facilitate the amperometric discrimination between species. these results suggest that such mesoporous zns nis composites are promising materials for nonenzymatic glucose sensors.
patients aged between 10 and 65 years with type 1 diabetes diagnosed for more than 1 year, with reasonable metabolic control assessing carbohydrate intake and self - adjusting insulin, and an hba1c level 180 mg / dl or > 250 mg / dl), and in the target range (70 to 180 mg / dl or 90 to 180 mg / dl) for each patient. the number of hypoglycemic excursions (180 mg / dl or > 250 mg / dl), and in the target range (70 to 180 mg / dl or 90 to 180 mg / dl) for each patient. the number of hypoglycemic excursions (20 days (corresponding to one third of the required time in the control group) were included (44 of 53 pediatric and 53 of 63 adult patients), the primary outcome was reduced by 64% (p 250 mg / dl was shorter in the continuous monitoring group compared with control group (mean hours per day, 1.14 and 1.66), although this was not statistically significant. four serious adverse events were reported although none were related to the study or device (supplementary table 2). there was an incident of mild diabetic ketoacidosis (dka) in a patient in the continuous monitoring group, because of the patient disconnecting his or her insulin pump. however, this patient had stopped wearing the continuous glucose monitoring system 2 weeks before the incident. in the period from october 2008 to may 2009, 122 eligible patients were screened. of these, two patients dropped out before randomization, and 58 were randomized to the control and 62 were randomized to the continuous glucose monitoring group. the study was completed by 48 patients (83%) and 53 patients (85%), respectively baseline characteristics of the patients differences between the control and the continuous monitoring group were not statistically significant. mdi, multiple daily injection. during the one - month run - in period, the mean concentration and frequency of home blood glucose monitoring was similar in the control and continuous monitoring groups (table 1). mean hba1c measured at the end of the run - in period before randomization was 6.9 0.7 and 6.9 0.6%, respectively. in the six - month randomized study period, median sensor wear was 5.6 (pediatric 5.6, adults 4.9) and 6.1 (pediatric 6.1, adults 6.1) days per week of instructed use in the control and continuous monitoring groups, respectively. median sensor wear in the continuous monitoring group in month 6 was 5.9 days per week. detailed data on sensor wear are presented in supplementary table 1 and supplementary figs. 2 and 3. the primary outcome, time spent in hypoglycemia below 63 mg / dl, was significantly shorter in the continuous glucose monitoring group (ratio of means 0.49 [95% ci 0.260.76 ], p = 0.03) (supplementary fig. time spent in hypoglycemia below 70 mg / dl and below 55 mg / dl was statistically significantly shorter in the continuous glucose monitoring group (p = 0.01 and p = 0.05, respectively ; table 2). the reduction in the primary outcome was evident from the first month and was sustained throughout the 6 months (fig. an excursion is defined as all consecutive recordings outside the boundary and covering at least 10 min. the duration of an excursion is defined as the elapsed time from first excursion to the first reading indicating return inside the excursion boundary. mean values ses for hours per day spent 20 days (corresponding to one third of the required time in the control group) were included (44 of 53 pediatric and 53 of 63 adult patients), the primary outcome was reduced by 64% (p 250 mg / dl was shorter in the continuous monitoring group compared with control group (mean hours per day, 1.14 and 1.66), although this was not statistically significant. four serious adverse events were reported although none were related to the study or device (supplementary table 2). there was an incident of mild diabetic ketoacidosis (dka) in a patient in the continuous monitoring group, because of the patient disconnecting his or her insulin pump. however, this patient had stopped wearing the continuous glucose monitoring system 2 weeks before the incident. this randomized controlled trial, designed to evaluate the effect of continuous glucose monitoring on hypoglycemia in type 1 diabetes, demonstrated a significant reduction by half in time spent in hypoglycemia in relatively well - controlled children and adults with type 1 diabetes. notably, this finding was paralleled by a significant decrease in hba1c, contrary to the results in the diabetes control and complication trial (dcct) study where the rate of hypoglycemia increased considerably with lower hba1c levels (21). in the juvenile diabetes research foundation (jdrf) trial in children and adults with hba1c < 7% at randomization (15), hypoglycemia below 60 mg / dl was less pronounced in the continuous monitoring group than in the control group at the end of 6 months (median 18 vs. 35 min / day, p = 0.05). moreover, combined outcomes of hypoglycemia and hba1c were significantly better in the continuous glucose monitoring patients than in the control patients, which corroborate our findings. a recent randomized controlled trial named sensor - augmented pump therapy for a1c reduction 3 (star 3) comparing sensor - augmented pump therapy with multiple - injection therapy demonstrated a significant reduction of hba1c in adults and children without an increase in hypoglycemia (22). however, the area under the curve < 70 mg / dl and < 50 mg / dl did not differ between the two treatment modalities. it is possible that the relatively small amount of continuous sensor data in the multiple - injection therapy group lacked sufficient power to show a difference. additionally, the baseline hba1c was considerably higher in the star 3 trial as compared with the current study. none of the participants or parents in the current study reported an event of severe hypoglycemia. similarly, severe hypoglycemia episodes were infrequent in the jdrf trial (less than 10% of the patients) (15) and the star 3 trial (around 13 per 100 patient - years) (22) and did not differ between the study groups. neither the jdrf trial nor ours was powered to detect differences in the rate of severe hypoglycemic episodes. in the open extension phase of the jdrf trial, episodes of severe hypoglycemia decreased by almost 50% in the control patients after they were switched to continuous glucose monitoring, but this was not statistically significant (p = 0.08) (16). although the number of hypoglycemic excursions below 55 mg / dl was not significantly different between the two groups per 24 h, it was significantly lower in the continuous monitoring group during the night. in the jdrf trial, a higher incidence of nocturnal hypoglycemia is associated with lower hba1c in the continuous glucose monitoring group ; however, no comparison is made with the control group (23). taken together, previous and present data may suggest that the risk of hypoglycemia is alleviated by continuous glucose monitoring. several studies have demonstrated that the use of continuous monitoring above 70% of the time is associated with significantly increased benefit and with a significant lowering of hba1c in all age groups (17,22,24). compliance with the sensor wear in the current study in the continuous monitoring group was more than 6 days per week (86%) and did not decrease significantly with time, with an average of around 5.8 days / week (84%) at the end of the 26-week period (supplementary fig. this is roughly similar to the adult group and considerably more than the adolescent or children group of the jdrf trial (16). this study protocol stated that the control group should wear a masked sensor for 5 days every second week, amounting to 65 days or around 9 weeks during the 26-week study period. in fact, compliance with the sensor wear in the control group was lower than intended (around 80%). however, when compared with previous studies, the amount of masked continuous monitoring data from the control group was substantial. combined with the high compliance of sensor use in the continuous monitoring group, this contributed to the power of the statistical analysis. our results must be interpreted with caution since the patients and their families were highly motivated, demonstrating good metabolic control with an average of more than five blood glucose measurements per day before randomization, and all three participating centers were academic with high penetration of diabetes - related technology. additionally, because of its nature, the intervention could not be blinded, rendering the results less compelling. the results may therefore not be simply generalized, and further studies are needed to evaluate the hypoglycemia - preventive effects of continuous glucose monitoring in less well - controlled and less motivated patient populations. in conclusion, the results of the current study demonstrated significantly shorter time spent in hypoglycemia in children and adults with type 1 diabetes who used continuous glucose monitoring compared with standard smbg, with a concomitant significant decrease of hba1c.	objectiveto assess the impact of continuous glucose monitoring on hypoglycemia in people with type 1 diabetes.research design and methodsin this randomized, controlled, multicenter study, 120 children and adults on intensive therapy for type 1 diabetes and a screening level of glycated hemoglobin a1c (hba1c) < 7.5% were randomly assigned to a control group performing conventional home monitoring with a blood glucose meter and wearing a masked continuous glucose monitor every second week for five days or to a group with real - time continuous glucose monitoring. the primary outcome was the time spent in hypoglycemia (interstitial glucose concentration < 63 mg / dl) over a period of 26 weeks. analysis was by intention to treat for all randomized patients.resultsthe time per day spent in hypoglycemia was significantly shorter in the continuous monitoring group than in the control group (mean sd 0.48 0.57 and 0.97 1.55 h / day, respectively ; ratio of means 0.49 ; 95% ci 0.260.76 ; p = 0.03). hba1c at 26 weeks was lower in the continuous monitoring group than in the control group (difference 0.27% ; 95% ci 0.47 to 0.07 ; p = 0.008). time spent in 70 to 180 mg / dl normoglycemia was significantly longer in the continuous glucose monitoring group compared with the control group (mean hours per day, 17.6 vs. 16.0, p = 0.009).conclusionscontinuous glucose monitoring was associated with reduced time spent in hypoglycemia and a concomitant decrease in hba1c in children and adults with type 1 diabetes.
traumatic brain injury (tbi) is a clinical condition which can have substantial and long - lasting effects not only upon brain structure, but also upon motor ability, attention, memory, higher cognition, personality, and affect. due to the wide range of mechanisms whereby brain injury can be inflicted, the etiology of this condition is varied and often complex, as is the host of potential effects that tbi can have upon life quality and expectancy. monitoring primary tbi evolution and optimizing clinical care in response to secondary injury are often challenging due to the structural heterogeneity of brain insults across patients, as well as the multifaceted nature of metabolic, neurochemical, and electrophysiological responses prompted by neural injury. currently, a wide range of experimental techniques are used to probe brain function changes which occur after tbi. because of the intimate relationship between brain structure and function, a complementary relationship exists between structural and functional neuroimaging, and a large proportion of functional neuroimaging studies of tbi involve the use of structural neuroimaging as well. in a previous review,1 we highlighted the importance of structural neuroimaging in identifying neuroimaging biomarkers with predictive clinical value, and discussed the role of magnetic resonance imaging (mri) and diffusion tensor imaging (dti) in formulating next - generation approaches for the treatment of tbi. combining imaging modalities can lead to substantial insights into brain structure and function, which can not be obtained using only one technique by itself. this is the case to such an extent2 that multimodal neuroimaging using an ever - increasing number of imaging methods has been a pervasive trend since at least the mid-1990s. for example, a thorough review by the pediatric tbi neuroimaging workgroup3 identified no fewer than 15 structural or functional macroscopic neuroimaging modalities which have been approved for use in human subjects. these include not only widely available techniques such as mri, functional mri (fmri), and dti, but also mri sequences which are tailored to tbi, including susceptibility weighted imaging, fluid - attenuated inversion recovery, and gradient - recalled echo mri. functional modalities also include magnetic resonance spectroscopy (mrs), single - photon emission tomography, positron emission tomography (pet), electroencephalography (eeg), magnetoencephalography (meg), and multispectral imaging. from among these, fmri, pet, and eeg are the most commonly available techniques in both clinical and research settings. in the present review, we explore the importance of functional neuroimaging techniques including fmri, pet, mrs, and eeg for advancing the state of the art in tbi patient clinical care and rehabilitation. specifically, we highlight the clinical utility of functional neuroimaging in understanding tbi dysfunction and in advancing clinical care by discussing, in turn, several functional domains which are typically affected by tbi, namely consciousness, motor function, attention, memory, higher cognition, personality, and affect. for each of these categories, we summarize important findings of functional neuroimaging studies, which were published in or after 2010 and which have contributed to our understanding of brain function changes which occur after tbi. we conclude by providing recommendations that can aid in setting the direction of future neuroimaging research for understanding brain function changes after this type of brain injury. there has been renewed interest, throughout the past decade, in the use of functional neuroimaging to distinguish between patients in the vegetative state versus individuals who are in a minimally conscious state or who exhibit locked - in syndrome. garcia - panach for example, used fluorodeoxyglucose (fdg)-pet to study correlations and differences in glucose metabolism between the thalamus and cortical structures in 49 severe tbi patients and ten healthy control subjects, including 17 patients in either vegetative or minimally conscious state. because of connections which link the thalamus to the ascending reticular system and which regulate sleep wake transitions, the thalamus plays a central role in the maintenance of awareness after tbi, in conjunction with the precuneus and frontal lobe areas.5 with this knowledge in mind, garcia - panach used voxel - based morphometry to test the hypothesis that functional connectivity between these structures is involved in tbi - related neurological and functional outcome. a general linear model framework was used to compare glucose metabolism levels in tbi patients to those in huntington s chorea and to those with posttraumatic amnesia. the most significant statistical differences in glucose utilization were found between healthy control subjects and the minimally - conscious / vegetative - state group, where the precuneus and temporal cortex showed the largest effect sizes across the brain regions inspected. tbi severity was found to be associated significantly with glucose hypometabolism, and a significant correlation was found between cortico - thalamo - cortical metabolism and functional outcome. although the authors did not compare vegetative - state patients with minimally - conscious patients, posttraumatic hypometabolism was found to resolve in tandem with improvements in neurological outcome. metabolic abnormalities were found to be smallest in the posttraumatic amnesia group, which may suggest that fdg - pet can be useful for distinguishing between vegetative - state and minimally - conscious patients, although further research focused on metabolic differences between these groups is needed. of particular interest is determining whether thalamic hypometabolism is due to direct focal lesions, damage in the white matter resulting from diffuse axonal injury (dai), or remote axonal disconnection and deafferentation. though the latter mechanism appears to be best supported by evidence presented by garcia - panach future multimodal studies should attempt to combine functional techniques such as fdg - pet and fmri with techniques for mapping structural connectivity such as dti and diffusion spectrum imaging to identify the neuroanatomical changes which modulate thalamic and cortical hypometabolism in tbi patients. in a fascinating review of famous patients exhibiting locked - in syndrome, bruno proposed that patients who show nonbehavioral evidence of consciousness or communication, which is only measurable via paraclinical testing (eg, via fmri, pet, or eeg), should be considered to exhibit a functional locked - in syndrome. this suggestion finds support in the groundbreaking fmri study of owen and coleman,7 who asked patients in vegetative state to perform mental imagery tasks and then found robust activation in the supplementary motor area or in the parahippocampal gyrus, depending on the task the volunteers had been instructed to perform. in studies by schnakers,9 electromyography recordings even helped in detecting consciousness in a patient with a rare case of complete locked - in syndrome, who had been behaviorally diagnosed as comatose. these and other studies indicate that functional neuroimaging holds considerable promise in the effort to classify tbi patients as being in either vegetative, minimally - conscious, or locked - in state, and to formulate clinical treatments and strategies for rehabilitation based on measures of event - related blood flow changes, glucose utilization, and electrophysiological activity. motor coordination and acuity are very frequently affected by tbi, and recovery of motor abilities can require a substantial amount of physical therapy in brain injury patients. this is the case partly because the coordination and successful completion of motor actions frequently rely upon the information - processing speed of patients as well as upon their ability to sustain attention and to switch between tasks.10 because the latter three brain functions are very often affected by tbi, this implies that the neural mechanisms underlying motor control are frequently affected by injury. when this is the case, patients ability to lead their lives without frequent assistance from caregivers may be compromised for prolonged periods of time if the deficits are sufficiently severe. even in cases of moderate damage to motor function, the ability to perform tasks which require complex motor control (eg, walking, writing, typing, driving) may be compromised to the extent that the resumption of routine activities is quite problematic. because of such challenges which affect a substantial proportion of tbi survivors, much effort has been devoted to studying the mechanisms whereby primary and secondary injuries to the brain lead to the deterioration of motor function. important recent research has been performed to identify which functional networks involved in movement are degraded by tbi and how. eg, sustained attention, task switching, and information - processing speed are localized in distinct brain regions and additionally involve neuronal networks which are spatially distributed. thus, the scenario according to which highly focal lesions cause brain - wide disruptions to motor function is not compatible with the distributed nature of these networks. with such considerations in mind, kasahara posited that damage to abilities which affect motor function may in fact be partially due to dai. these authors investigated how tbi - induced damage affects brain networks far from primary lesion sites in 12 tbi patients and in nine healthy control subjects while they performed a finger thumb opposition task. a psychophysiological interaction analysis which examined the integrity of functional connectivity across brain sites was used in conjunction with fmri to determine how blood - oxygen - level dependent (bold) signals change differently in tbi patients compared to healthy control subjects. in the tbi patients examined, this led to the finding that the primary motor cortex (m1), cerebellum, and supplementary motor area exhibit reduced interhemispheric interactions as well as abnormal ipsilateral interactions with the supramarginal gyrus. it is perhaps not a coincidence that the supramarginal gyrus and other structures of the parietal lobe have been involved in the default mode network (dmn) of the brain,12 in its connectivity scaffold,13,14 in the interpretation of sensory data,15 and in perceiving space and limb location.16 the poor interaction observed between the cerebellum and m1 resonates with the possibility that dai may be partly responsible for the loss of motor acuity observed in tbi patients, whereas the functional deterioration associated with the supramarginal gyrus is consistent with previous hypotheses which assign a causal relationship between dmn damage, on the one hand, and loss of motor function after tbi, on the other hand. incidentally, structural neuroimaging methods previously allowed us to quantify substantial decreases in cerebellar volume in severe tbi patients 6 months after injury,17 which highlights the challenge of patient rehabilitation in the face of such brain tissue losses difficult to reverse. based on evidence provided by their functional neuroimaging study, kasahara concluded that the abnormal activation patterns observed in their tbi patients are probably due to the massive reorganization of motor activation networks after tbi.11,23 intimately related to motor acuity is task - switching ability. leunissen used fmri in conjunction with dti tractography to study tbi brain function changes associated with motor switching performance in 23 young adults with moderate - to - severe tbi. in their study, visual cues were used to prompt the initiation and termination of spatially and temporally coupled bimanual circular movements. specifically, the right hand was cued to either switch or to continue its circling direction movement, and the time to initiate the switch (switch response time) was measured in both tbi patients and control subjects. as expected, the study group was found to exhibit longer switch response times as well as a higher incidence of complete contralateral movement disruptions. although both groups activated their basal ganglia, supplementary motor cortex, and bilateral inferior frontal cortex, tbi patients showed increased activation of the presupplementary motor area and left inferior frontal cortex, as well as underactivation of the subthalamic nucleus region. the authors found that the differences between the control group and the study group were due to altered white matter circuitry in tbi between brain regions involved in the task, suggesting that damage to these key pathways causes tbi patients to perform more poorly. of substantial importance in motor function is interhemispheric coordination, which can be conveniently quantified using an interhemispheric transfer time measure. babikian for example, studied dai secondary to tbi and attempted to characterize the relationship between structural damage (dai) and metabolic status in the anterior and posterior corpus callosum. these authors acquired mrs, fmri, and dti volumes from a total of 18 patients, who were dichotomized into two groups, namely postacute (5 months postinjury) and chronic (15 months postinjury). creatine a biomarker of energy metabolism was not found to differ across groups, though choline a biomarker of membrane degeneration and inflammation was elevated acutely, but not chronically. n - acetyl aspartate is a surrogate biomarker of neuronal / axonal integrity, which was found to be lower than normal in the acute stage of tbi, although closer to normal levels in the chronic tbi group. interestingly, n - acetyl aspartate in the posterior corpus callosum was positively correlated with neurocognitive function and negatively correlated with the interhemispheric transfer time. the findings of the study highlighted the usefulness of studying, in addition to changes in the bold response, the temporal evolution of metabolic biomarkers when attempting to identify the mechanisms underlying motor deficits due to tbi. because the relationship between the bold response and glucose utilization is nonlinear and complex,20 obtaining measures of metabolic dynamics such as fdg utilization, creatine, choline, n - acetyl aspartate, and serum measurements obtained via microdialysis or otherwise should be prioritized in tbi research studies. although posttraumatic amnesia and other memory problems are frequent consequences of tbi,21 very little is currently known about how brain function differs in the posttraumatic amnesia stage of tbi compared to the stage where recovery from amnesia has occurred. garcia - panach lamented this lack of knowledge and suggested that future studies should strive to provide substantial insight into how functional connectivity particularly between the frontal and the temporal lobe modulates recovery from amnesia. these authors implemented an fdg - pet study which included 12 patients with posttraumatic amnesia and 20 patients who had recovered from it, all of whom were found to exhibit metabolic dysfunction in subfrontal and medial temporal areas. given that memory consolidation and retrieval are two prominent functions of medial temporal lobe areas,22 this finding is intuitive. nevertheless, tbi is more likely to affect temporal and orbitofrontal areas due to the anatomy and positioning of the brain within the skull in the context of tbi mechanics. for this reason, it is difficult to discern whether these areas exhibit metabolic dysfunction because of their involvement in memory processes or rather because tbi physics implies that these areas are injured more often. despite recent neuroimaging findings on which brain regions are involved in posttraumatic amnesia, the mechanisms responsible for the relationship between its duration and widespread brain dysfunction remain unknown. as in the case of motor function, however, both metabolic and blood oxygenation deficits in the parietal lobe have been implicated in abnormal memory encoding and retrieval. kasahara used fmri during an n - back working memory task in nine chronic tbi patients and nine matched controls to investigate the impact of injury upon functional brain networks which mediate working memory. at high working memory loads, as expected, tbi patients made a larger percentage of errors, with significant reductions in the activation of the left inferior parietal gyrus and increases in activity within the right inferior frontal gyrus. psychophysiological interaction analysis further indicated that functional connectivity between these two structures was compromised in tbi patients, suggesting that abnormal interaction between the areas may underlie the observed working memory deficits and abnormal brain activation patterns of tbi patients. some tbi studies have identified overlaps of abnormal activity between working memory networks and the dmn, suggesting that dmn function is altered in patients who perform poorly on working memory tasks. palacios for instance, implemented an fmri n - back task experiment and acquired dti volumes from 19 chronic tbi patients with evidence of axonal injury, as well as from an equal number of matched control subjects. after identifying both the working memory network and the dmn of each patient, the authors found correlations between the fractional anisotropy of a number of white matter tracts involved in functional activation, on the one hand, and the functional activation patterns of these fasciculi, on the other hand. by combining both structural and functional neuroimaging data, the researchers were able to describe structural brain changes which lead to functional network alterations and to lower working memory performance in the chronic tbi group. in one such study, kim used a perfusion fmri approach which dissociates resting- and task - related cerebral blood flow changes to investigate the neural correlates of cognitive dysfunction and recovery after tbi. perfusion fmri using arterial spin labeling was employed by the authors to investigate cerebral blood flow both during the resting state as well as during a working memory task. a total of 21 tbi patients and 18 demographically matched healthy control subjects completed a sustained visual attention tasks as well as a 2-back working memory task. the tbi patients exhibited poorer behavioral performance on both tasks, with task - induced cerebral blood flow changes being localized to the superior occipital cortex bilaterally as well as to the left superior temporal cortex. control subjects were found to deactivate these areas during task performance, but tbi participants were found to activate these areas, with a disproportionate amount of hypoperfusion at rest. distinct patterns of correlation between performance and task - related cerebral blood flow changes were identified between the study group and the control group. activation correlation between tbi patients and healthy control subjects were consistent with the hypothesis that sensory and attentional modulation deficits due to tbi contribute to higher memory dysfunction in this patient group long after brain injury. as in the case of memory function, interhemispheric coordination plays a central role in the modulation of attention and reaction time. marquez de la plata examined the functional connectivity of the hippocampus and of selected frontal lobe circuits in 24 patients with dai as well as in 16 age- and sex - matched healthy volunteers. bold signals from the hippocampus, anterior cingulate cortex, and dorsolateral prefrontal cortex were recorded, and the functional connectivity between these regions and their contralateral counterparts was computed using a pearson s correlation coefficient. as expected, tbi patients were found to exhibit lower interhemispheric connectivity for the hippocampus and the anterior cingulate cortex, and more limited recruitment of dmn components located in the dorsolateral prefrontal cortex. in another study by scheibel fmri was used to investigate brain reactions to an event - related stimulus - response compatibility task in 15 subjects with mild, chronic, or blast - related tbi and to compare their activation patterns to those of matched controls. after controlling for reaction time, a between - group analysis found increased activation during stimulus - response incompatibility within the anterior cingulate gyrus, medial frontal cortex, and the occipital lobes. the study also found evidence for increased task - related activation following tbi as well as other functional changes associated with emotional symptoms. although functional neuroimaging studies have shed light upon how brain tissue metabolism and oxygenation are impaired when tbi patients perform memory tasks, further research is needed to understand how this information can be translated for clinical use at the bedside. for example, there are very few studies which explore how memory rehabilitation protocols affect brain structure or hemodynamic / metabolic measures, and thus, it is currently very difficult to associate specific functional neuroimaging profiles with neuropsychological measures, which could aid in predicting and/or improving memory function. the studies reviewed here illustrate the intricate relationship between attention, response time, and memory, indicating that future studies should attempt to explore these three aspects of brain function in the same sample of tbi patients to avoid the potential presence of variables which confound efforts to compile meta - analyses. such confounding variables include patient age, intellectual capacity, mechanism of injury, spatial injury profile, and dai profile, all of which can pose substantial challenges when attempting to integrate scientific knowledge across multiple studies in a common frame of reference. the deterioration of cognitive control abilities is among the most common sequelae of tbi, and recent functional neuroimaging studies have identified plausible mechanisms which may be responsible for the progressive loss and potentially slow recovery of cognitive control which occur after injury. sponheim for example, used eeg and dti to study cognitive deficits as well as disrupted coordination of brain activity in a group of nonimpact blast - related mild tbi patients who were soldiers returning from deployment to afghanistan and iraq. these researchers attempted to find whether neural communication between brain regions and coordination of neural function was associated with white matter integrity measures. using a time frequency method for measuring phase synchronization between eeg sensors, the authors found that tbi patients exhibited diminished eeg phase synchrony between frontolateral sites and contralateral brain regions, which suggested diminished interhemispheric coordination as a consequence of brain injury. these abnormal findings were also associated with diminished structural integrity of white matter tracts connecting the left anterior thalamic radiations and the forceps minor, including the anterior corpus callosum. combat stress symptoms such as posttraumatic stress disorder or clinical depression and psychotropic medications were not found to be correlated significantly with the presence of diminished phase synchrony recorded using eeg. this may indicate that poor coordinates of frontal neural function after blast injury may be the consequence of damaged anterior white matter tracts in the tbi patient group studied. for a thorough review which summarizes the use of eeg to study cognitive control in tbi patients, the reader is referred to the excellent work of duncan who analyzed brain event - related potentials as indices of functional pathophysiology in tbi survivors. studies have shown that the dmn is heavily involved in the modulation of cognitive control,30 and it is thus no surprise that abnormalities in the function of the former are also associated with failures of the latter. because the activation of deep - brain structures is difficult to study using eeg or meg,31,32 fmri and pet remain methods of choice for investigating the involvement of the midbrain in cognitive tasks which activate these structures, despite their relatively low temporal resolution compared to the former two methods. in an fmri study, palacios studied abnormalities in low - frequency fluctuations of bold signal amplitudes as well as resting - state connectivity in relationship to cognitive outcome in patients with severe dai. the authors implemented independent component analysis, dual regression, and seed - based connectivity analysis to investigate functional connectivity within the dmn. they found that tbi patients had larger bold signal fluctuations in frontal areas, where fmri signal variability was correlated with cognitive performance. connectivity between the frontal lobe and parietal regions was found to be increased in tbi patients, and the fractional anisotropy of the cingulate fasciculus was correlated with increased frontal lobe connectivity within the dmns of tbi patients. the authors suggested that loss of connectivity due to cingulum tract damage could be explained by compensatory increases in functional connectivity within frontal lobe portions of the dmn. aside from dmn studies, recent advances in connectomics and white matter tractography have allowed researchers to study the topological properties of brain networks and how these properties are affected by brain injury. for example, pandit tested the hypothesis that brain networks involved in cognitive function may lose part of their small - world characteristics following tbi. these authors investigated resting - state functional connectivity using fmri in a sample of 20 tbi patients and 21 age - matched controls, and then used graph - theoretical methods and multivariate statistical models to infer relationships between changes in functional connectivity, on the one hand, and tbi - related white matter damage as measured using dti, on the other hand. as expected, it was found that tbi leads to cognitive impairments associated with white matter damage as well as longer average path lengths and reduced network efficiency in tbi patients compared to control subjects. the posterior cingulate cortex a brain network hub was found to be particularly affected, likely due to the effect of dai. importantly, the study confirmed that functional networks in tbi patients shift away from small - world characteristics compared to those of healthy control subjects. in an interesting study concerning the relationship between cognitive control, reaction time, and tbi effects, wilde investigated the neural correlates of working memory using the sternberg item recognition task. structural, functional, and diffusion mri volumes were acquired from 40 children with moderate - to - severe tbi and 41 demographically matched control subjects who had orthopedic injuries. it was found that children with tbi had decreased cortical thickness compared to the control group, and additionally that left parietal lobe volume was negatively correlated to reaction time. the authors attributed their findings to the disruption of frontoparietal function during attention tasks, as quantified in both groups using dti tractography. decreased white matter integrity in the frontal lobes and in the cingulum bundle was associated with longer reaction times on the sternberg item recognition task, and the cingulum was found to emerge as a common structure related to performance after tbi. although cognitive control has traditionally been quantified using neuropsychological measurements, psychometric techniques can not provide a mechanistic understanding of the causal links between injuries, their location, subsequent deterioration in structural connectivity, and functional deficits experienced by patients in their day - to - day lives. to accomplish this, studies are required to establish which structural and connectivity variables can be most confidently associated with changes in cognitive function after brain injury, and thereby to determine the causal chain which links neural impairment to high - level dysfunction. it is expected that functional neuroimaging will play an important role in this endeavor throughout the following decade, especially in studies of focal tbi, which offers otherwise unavailable opportunities to undertake case studies of localized human brain function. although motor function, cognitive control, attention, and memory are often impaired after tbi, few factors impact the relationships between tbi survivors and society as much as tbi - related changes in personality and disorders of affect.36 a classic example involves the well - known 19th century case of phineas gage, who miraculously survived a severe tbi to the left frontal lobe only to develop personality changes which prompted those who knew him to declare that he was no longer gage.37 in an insightful longitudinal study, mayer investigated the temporal dynamics associated with the neural correlates of cognitive and emotional dysfunction across the first 6 months following tbi. the motivation of the study lay in the current difficulty to identify tbi patients at an early stage, who then fail to recover their cognitive acuity and emotional well - being. in a group of 27 mild tbi patients and 26 healthy control subjects, the researchers investigated spontaneous fluctuations in the dmn and in frontoparietal task - related networks as measured using fmri. despite the absence of positive findings on t1 and t2 scans acquired from these patients, significant differences in self - reported cognitive, emotional, and somatic function were identified in the tbi group. this may indicate that dti tractography and white matter connectivity analysis should be undertaken in patients who suffer from personality changes, particularly when patients have negative findings on structural t1 and t2 scans. in a review of mild tbi pathophysiology in the pediatric population, choe acknowledged that, although postconcussion symptoms are typically short - lived, longer - lasting deficits can be particularly disruptive to the developing brain, and may result in changes of personality and in psychiatric complications later in life. concussions do not typically result in structural damage which is visible on conventional computed tomography or mri, whereas advanced neuroimaging modalities such as dti and diffusion spectrum imaging reveal both microstructural as well as functional neurobiological changes, including dai, metabolic impairment, neural activation changes, and cerebral blood flow perturbations which can contribute to acute symptomatology. although such functional changes generally recover to baseline within approximately 1 week postinjury, sustaining recurrent injuries before full recovery was identified as a factor which can increase the potential for chronic deficits such as personality changes and mental disease. because mild tbi can be difficult to identify using standard mri methods, functional studies should be prioritized for this large subpopulation. for example, in addition to fmri, the use of electrophysiological techniques such as eeg and meg has led to promising results in identifying physiological correlates of personality change, affective lability, and depression symptoms, as illustrated in a recent study by huang.40 these authors studied both blast- and non - blast - related tbi patients and found that meg slow wave generation in prefrontal areas is positively correlated with personality changes. the overall findings of the study suggest that meg may be capable of detecting the effects of dai - related deafferentation as well as of abnormal cholinergic signaling after injury, which may support meg as a tool for assisting the diagnosis of mild tbi. in military personnel returning from conflicts overseas, posttraumatic stress disorder, clinical depression, and tbi are often comorbid. in addition, collegiate and professional athletes involved in contact sports are more likely to suffer from multiple concussions compared to the general population.41 studies have shown that such traumatic events increase the risk for chronic traumatic encephalopathy, a potentially serious neurodegenerative condition whose diagnosis can be attempted only postmortem based on currently available technology.42 american national football league players such as jovan belcher (kansas city chiefs, age at suicide : 25), chris henry (cincinnati bengals, age at death : 26), justin strzelczyk (pittsburgh steelers, age at suicide : 36), and many others were diagnosed with chronic traumatic encephalopathy in a postmortem study of athletes who had exhibited symptoms of this condition during their lives.43 simmons and matthews44 reviewed the neural circuitry associated with posttraumatic stress disorder both in the presence as well as absence of mild tbi in an effort to distinguish between the distinct effects of these two conditions upon the brain. they suggested that the middle frontal gyrus is implicated in both conditions, with additional involvement of the dorsolateral prefrontal cortex, orbital cortex, and hippocampus. nevertheless, whereas the middle frontal gyrus is overactivated in posttraumatic stress disorder, this structure is underactivated in tbi patients, which suggests that additional research is warranted to understand the role of the middle frontal gyrus in mediating posttraumatic stress disorder in the presence of tbi. clinical depression is frequently comorbid with tbi, although it is not well established whether its presence is due to the neurochemical and structural changes prompted by injury or rather to the emotional burden of disability.45 motivated by evidence that hippocampal dysfunction plays a role in the etiology of mood disorders, jorge imaged 37 tbi patients using mri and found a significant statistical interaction between the presence of tbi and that of mood disorders, as well as a significant inverse correlation between hippocampal volumes and mood disturbance severity. unfortunately, an insufficient amount of functional neuroimaging research like this has been carried out, despite repeated recommendations such as those of vaishnavi who pointed out the scarcity of empirical data which can guide psychiatric treatment of tbi patients. based on literature discussed in this review, we identify five major clinical goals whose achievement can greatly benefit from functional neuroimaging studies. as listed in the table 1, these are : distinguishing between vegetative, minimally - conscious and locked - in patientsdesigning novel interventions to reduce motor deficits after tbidetermining how clinical care can be improved to alleviate memory deficitsidentifying how rehabilitation can minimize loss of cognitive control after brain injuryformulating clinical strategies to alleviate personality changes and mental health sequelae. distinguishing between vegetative, minimally - conscious and locked - in patients designing novel interventions to reduce motor deficits after tbi determining how clinical care can be improved to alleviate memory deficits identifying how rehabilitation can minimize loss of cognitive control after brain injury formulating clinical strategies to alleviate personality changes and mental health sequelae. to assist the reader in summarizing our findings, table 1 also lists the major findings and conclusions of the studies discussed. in the case of the first clinical goal, determining whether a patient is in a vegetative, minimally - conscious, or locked - in state is of tremendous clinical utility for establishing basic communication with patients who appear to be unresponsive and for formulating clinical care appropriately.48 in the case of the second goal, reducing motor deficits in tbi patients is very important because it can help tbi survivors resume normal day - to - day activities and minimize caregiver assistance. alleviating memory deficits and reversing the deterioration of cognitive control are also important goals of rehabilitation, partly because improvements in life quality, the resumption of gainful employment, and other aims often require substantial recovery of intellectual capacity. finally, alleviating personality changes and mental health sequelae can allow tbi survivors to reintegrate into society, achieve and maintain emotional stability, and avoid social conflicts. the challenges of understanding what happens to the human brain after traumatic injury stem not only from the inherent complexity of brain function, but also from the patient - to - patient variability in injury types and in the neural, metabolic, and hemodynamic responses to them. in this review, we have attempted to highlight some of the most important trends in tbi functional neuroimaging and to provide suggestions that can help in translating the findings of neuroimaging studies into clinically useful information. to assist in the clinical care of patients with prolonged loss of consciousness, more functional studies are needed to distinguish between minimally - conscious patients and those in a vegetative state, and also to understand how minimal consciousness and the vegetative state influence the duration and extent of posttraumatic amnesia. such studies should preferably be multimodal and should include at least one modality which offers insight on brain metabolism (eg, pet) and one modality which provides a measure of blood oxygenation (eg, bold fmri). this is because the relationship between glucose metabolism and oxygen consumption is complex enough to make inferences of metabolic dysfunction based on blood oxygenation levels or vice versa which is challenging and frequently unreliable. of all the functional domains discussed in this review, the area of personality changes prompted by tbi appears to have received the least amount of attention from functional neuroimaging researchers. a detailed scientific literature search focused on articles covering this topic and published in the past 5 years has yielded surprisingly few studies which used functional neuroimaging to study personality changes after tbi. this paucity of research is both surprising and troubling, particularly given that personality changes are quite frequent following tbis of all severities.49 though psychometric studies of posttraumatic personality change abound in the recent literature,5052 the relationship between psychometric measures and functional neuroimaging metrics remains almost entirely unexplored. this indicates the existence of a significant knowledge gap on tbi, which should be promptly addressed by future studies. although many of the studies discussed have identified functional relationships between distinct brain regions which exhibit abnormal function after tbi, these findings are difficult to generalize across the tbi population due to its heterogeneity as well as the great variety of functional protocols used in different experiments. for this reason, greater sample sizes are needed (particularly in fmri studies) to account for the statistical variability of bold measurements across subjects and brain areas. in addition, experimental protocols involving tasks should be standardized to facilitate meta - analyses and large population studies. we advocate the creation of an international repository of functional tbi neuroimaging data which can allow researchers from across the world to pool and analyze not only resting - state data from distinct study sites, but also data which involves event - related brain activations. such a database would facilitate the study of specific domains of brain function (eg, motor ability, attention, memory, cognitive control, etc) in an effort to gain deeper understanding of how tbi affects brain function domains differently and how such understanding can be translated into clinically useful information.	functional deficits due to traumatic brain injury (tbi) can have significant and enduring consequences upon patients life quality and expectancy. although functional neuroimaging is essential for understanding tbi pathophysiology, an insufficient amount of effort has been dedicated to the task of translating functional neuroimaging findings into information with clinical utility. the purpose of this review is to summarize the use of functional neuroimaging techniques especially functional magnetic resonance imaging, diffusion tensor imaging, positron emission tomography, magnetic resonance spectroscopy, and electroencephalography for advancing current knowledge of tbi - related brain dysfunction and for improving the rehabilitation of tbi patients. we focus on seven core areas of functional deficits, namely consciousness, motor function, attention, memory, higher cognition, personality, and affect, and, for each of these, we summarize recent findings from neuroimaging studies which have provided substantial insight into brain function changes due to tbi. recommendations are also provided to aid in setting the direction of future neuroimaging research and for understanding brain function changes after tbi.
scheme 1 outlines the synthesis of novel thioacetamide (compounds 4a4z) and sulfinylacetamide (compounds 5a5 g) analogues of ()-1. the thioacetamide analogues 4a4z were generated via three different synthetic routes. the first route (procedure a) affords the thioacetamides in one step and was employed in the synthesis of compound 4a and the n - methylthioacetamides 4g4i. as opposed to the previously reported two - step synthesis, thioacetamide 4a was synthesized in one step by coupling 2-mercaptoacetamide with diphenylmethanol in trifluoroacetic acid (tfa) at room temperature. similarly, n - methylthioacetamides 4g4i were synthesized via the coupling reaction between 2-mercapto - n - methylacetamide and diphenylmethanol (for 4 g) or the corresponding bis(halophenyl)methanol (for 4h and 4i) in tfa. to improve product yields, the reactions for compounds 4h and 4i required heating to 60 c. reagents and conditions : (a) 2-mercaptoacetamide or 2-mercapto - n - methylacetamide, tfa, room temperature (60 c for substituted phenyl analogues), 20 h (procedure a) ; (b) (i) thioglycolic acid, tfa, room temperature (5560 c for substituted phenyl analogues), overnight ; (ii) ch3i, k2co3, acetone, reflux, overnight ; (iii) nh4oh, nh4cl, meoh, 50 c, 72 h (procedure b) ; (c) (i) thioglycolic acid, tfa, room temperature (5560 c for substituted phenyl analogues), overnight ; (ii) cdi, thf, room temperature, 2 h ; (iii) rnh2, thf, 0 c to room temperature, overnight (procedure c) ; (d) h2o2 (30%), acoh meoh (1:3), 40 c, overnight. the second synthetic route (procedure b), used for the synthesis of thioacetamides 4b4f, required three steps, similar to previously described methods. mono- or disubstituted diphenylmethanol was coupled with thioglycolic acid in tfa, followed by esterification with iodomethane in acetone under reflux conditions. the resulting methyl esters were converted into the primary amides 4b4f through aminolysis with ammonium hydroxide in methanol. the third route (procedure c) also involved three steps and was employed for the synthesis of n - substituted thioacetamides 4j4z. first, diphenylmethanol or the appropriate bis(halophenyl)methanol was coupled with thioglycolic acid in tfa. the desired n - substituted thioacetamides 4j4z were then synthesized by coupling the carboxylic acid to the corresponding primary amine via an in situ n, n-carbonyldiimidazole coupling reaction. oxidation of the appropriate thioacetamide (4b4 g and 4x) using hydrogen peroxide (h2o2 ; 30%) in an acetic acid methanol solution mixture gave sulfinylacetamides 5a5 g. scheme 2 outlines the synthesis of the thioethanamine (6a6i) and sulfinylethanamine (7a7e) analogues of ()-1. thioethanamines 6a6c were synthesized by coupling diphenylmethanol or the appropriate bis(halophenyl)methanol with cysteamine hydrochloride in glacial acetic acid in the presence of the lewis acid catalyst boron trifluoride diethyl etherate (bf3oet2) (procedure d). the n - substituted thioethanamine 6d was synthesized by a reductive amination reaction between the hydrochloride salt of compound 6a and cyclopropanecarboxaldehyde using sodium cyanoborohydride as the reducing agent. similarly, n - substituted thioethanamine 6e was synthesized by coupling n - butyl bromide to the free base of compound 6a in the presence of csohh2o (cs ions served as templating catalysts). n - substituted thioethanamines 6f6h were synthesized by the reduction of thioacetamides 4u4w using alane (lialh4sulfuric acid mixture). lastly, n - substituted thioethanamine 6i was prepared from thioacetamide 4x by reduction with borane in thf (bh3thf). sulfinylethanamines 7a7e were synthesized from the appropriate thioethanamines (6a, 6e, or 6g6i) by oxidation of the thioether function using either sodium periodate (naio4) in an ethanol water solution (compounds 7a and 7b) or h2o2 (30%) in an acetic acid methanol solution (compounds 7c7e). reagents and conditions : (a) cysteamine hydrochloride, bf3oet2, glacial acoh, 8090 c, 20 min (4050 min for substituted analogues (procedure d)) ; (b) (i) procedure d ; (ii) cyclopropane carboxaldehyde, nabh3cn, meoh, 1,2-dichloroethane, room temperature, overnight ; (c) (i) procedure d ; (ii) bubr, csohh2o, 4 ms, dmf, room temperature, 20 h ; (d) lialh4, h2so4, thf ; (e) bh3thf, thf, reflux, overnight ; (f) naio4, h2o, etoh, 0 c to room temperature, overnight ; (g) h2o2 (30%), acoh meoh (1:3), 40 c, 24 h. a series of novel thio- and sulfinylacetamide and -ethanamine analogues of ()-1, with or without substituents on the diphenyl rings, were synthesized to investigate the contributions of structural variations to selectivity across mats. previous sars had suggested that the sulfinyl (s = o) function was not critical for binding to the dat, but differential interactions with y156 of dat and y176 of sert may affect selectivity for sert. in addition, we showed that reduction of the amide function to the amine not only improved water solubility, but also enhanced dat affinity. in the current study para- or meta - substitution of the phenyl rings of ()-1 with cl or br gave several amide analogues with improved selectivity for dat over sert and net, whereas selectivity was improved at sert over dat and net for the amine analogues. overall, we identified five highly dat - selective amide analogues (e.g., 4e, 2900-fold over sert) and two sert - selective amine analogues with high affinity (ki 30 nm). computational modeling of dat and sert led to the identification of key amino acid residues in tm10 that form part of the s1 binding pocket in both dat and sert. by switching the t497 in sert to ala and the a480 in dat to thr and then testing a selected subgroup of analogues, the role of tm10 in dat and sert binding moreover, we propose that this tm10 position faces the s1 binding site and plays a role in the binding of this class of compounds to the dat similar to the atypical dat inhibitors exemplified by the benztropines, but not to cocaine. interestingly, in the benztropine class of atypical dat inhibitors similar observations were made in that (1) converting the tropane amine nitrogen to an amide significantly reduced the binding affinity (e.g., n - acetyl-3-[bis(4-fluorophenyl)methoxy]tropane, dat ki = 2340 nm) to an affinity virtually identical to that of ()-1, and (2) the same order of halogen effect on the amine analogues described herein on decreasing dat affinity (f > cl > br) was also reported for the benztropines, and this is in direct opposition to the order observed in the cocaine - like 3-phenyltropane analogues (e.g., win 35,428, 2-carbomethoxy-3-(4-fluorophenyl)tropane). this divergence in dat sar between the benztropines and 3-phenyltropane analogues formed one of the early foundations for our hypothesis that these compounds bind differently to the dat, and these differences may be related to their different behavioral profiles. importantly, as it was shown that tm10 plays a critical role in propagating the conformational changes of the homologous leut from the s1 binding site to the intracellular gate, such divergent interactions with tm10 are likely to have an impact on the overall transporter conformation and may contribute to the mechanism underlying the unique pharmacology of ()-1 and its analogues at dat. anhydrous solvents were purchased from aldrich and were used without further purification, except for tetrahydrofuran, which was freshly distilled from sodium benzophenone ketyl. all other chemicals and reagents were purchased from sigma - aldrich co. llc, combi - blocks, tci america, ochem incorporation, acros organics, maybridge, and alfa aesar. the diphenylmethanols (3a c, 3e i) were commercially available, except 3d, which was synthesized as outlined below. unless otherwise stated, amine final products were converted into oxalate salts, typically by treating the free base in 2-propanol with a 1:1 molar ratio of oxalic acid in acetone. as described, some of the oxalate salts were recrystallized from hot methanol or a methanol acetone solvent mixture. spectroscopic data and yields refer to the free base, except for compounds 6b and 6c, which were synthesized as the hydrochloride salts., 230400 mesh, 60). compounds 4u and 6f were purified using a teledyne isco combiflash rf instrument. h and c nmr spectra were acquired using a varian mercury plus 400 spectrometer at 400 and 100 mhz, respectively. chemical shifts are reported in parts per million (ppm) and referenced according to deuterated solvent for h spectra (cdcl3, 7.26 ppm, or dmso - d6, 2.50 ppm) and c spectra (cdcl3, 77.2 ppm, or dmso - d6, 39.5 ppm). gas chromatography / mass spectrometry (gc / ms) data were acquired (where obtainable) using an agilent technologies (santa clara, ca) 6890n gas chromatograph equipped with an hp-5ms column (cross - linked 5% ph me siloxane, 30 m 0.25 mm i.d. 0.25 m film thickness) and a 5973 mass - selective ion detector in electron - impact mode. ultrapure grade helium was used as the carrier gas at a flow rate of 1.2 ml / min. the injection port and transfer line temperatures were 250 and 280 c, respectively, and the oven temperature gradient used was as follows : the initial temperature (100 c) was held for 3 min, then increased to 295 c at 15 c / min over 13 min, and finally maintained at 295 c for 10 min. (norcross, ga), and the results agree within 0.5% of the calculated values. melting point determination was conducted using a thomas - hoover melting point apparatus, and the melting points are uncorrected. on the basis of nmr and combustion data, all final compounds compound 3d was synthesized by adapting a literature method from bis(4-bromophenyl)methanone (10.2 g, 30.0 mmol) and nabh4 (2.55 g, 67.4 mmol) in anhydrous ethanol (65 ml) at 0 c under argon. the product 3d (9.8 g, 95% yield) was recovered as a white solid. h nmr (cdcl3) : 7.46 (d, j = 8.6 hz, 4h), 7.22 (d, j = 8.6 hz, 4h), 5.76 (sd, j = 3.5 hz, 1h), 2.21 (sd, j = 3.5 hz, 1h). c nmr (cdcl3) : 142.4, 131.9, 128.3, 121.9, 75.2. a solution of 2-mercapto - n - methylacetamide (10 mmol) and diphenylmethanol, 3a, or the appropriate substituted diphenylmethanol, 3c or 3d (10 mmol), in trifluoroacetic acid (tfa ; 200 mmol) was stirred at room temperature (60 c for substituted analogues) for 20 h. the solvent was removed in vacuo, and the thick oily residue was washed with water (30 ml). after the water was decanted, a crude solid product was isolated by addition of diisopropyl ether (20 ml) to the oily residue and vigourous mixing. the crude solid was filtered and purified by flash column chromatography using 5% meoh / ch2cl2 to give the pure, desired product. step 1 : thioglycolic acid (1 mmol) was reacted with the appropriate substituted diphenylmethanol, 3e3i (1 mmol), in tfa (14 mmol) overnight at room temperature. after solvent removal in vacuo, the residue obtained was washed with water (5 ml) and hexanes (15 ml) to give the carboxylic acid product, which was carried to the next step without further purification. step 2 : the acid product (3 mmol) from step 1 was reacted with k2co3 (4.5 mmol) and iodomethane (ch3i ; 4.5 mmol) in acetone (50 ml) overnight under reflux conditions. after solvent removal in vacuo, the residue was suspended in water (20 ml) and extracted with ch2cl2 (3 20 ml). the combined organic layer was dried over mgso4 and concentrated to give the methyl ester, which was carried to the next step without further purification. step 3 : a mixture of the ester (3 mmol), nh4cl (4.2 mmol), concentrated nh4oh (28.030.0%, 20 ml), and meoh (5.7 ml) was stirred at 50 c for 72 h. meoh was removed in vacuo, and the reaction mixture was diluted with water (50 ml), extracted with ethyl acetate (3 50 ml), and dried over na2so4. the solvent was evaporated, and the recovered crude product was purified by flash column chromatography using 1:1 ethyl acetate / hexanes to afford the pure product. thioacetamides 4l, 4p, 4s, 4v, and 4w were synthesized in two steps according to a published procedure, while compounds 4j, 4k, 4m4o, 4q, 4r, 4 t, 4u, and 4x4z were synthesized in two steps with slight modifications to the published procedure in the second step. step 1 is the same as step 1 for procedure b. step 2 : cdi (11 mmol) was added to a solution of the carboxylic acid product (10 mmol) from step 1 in anhydrous thf (25 ml). the reaction mixture was stirred at room temperature for 2 h and then cooled to 0 c. water (0.10.2 ml) was added to the reaction mixture (to quench excess cdi), followed by the dropwise addition of the appropriate amine (10 mmol, dissolved in thf). the solvent was removed under vacuum to give a crude residue, which was dissolved in diethyl ether or ethyl acetate. the organic solution was washed with aqueous 1.0 m hcl solution (55 ml), water (80 ml), dilute aqueous nahco3 solution (36 ml, 1:6 dilution of saturated nahco3 solution), and water (2 30 ml). the organic layer was dried over mgso4 and concentrated in vacuo to give the pure product. the bromo - substituted analogues 4q, 4 t, 4x, and 4z required further purification by flash column chromatography as indicated. compound 4a was synthesized by stirring a solution of 2-mercaptoacetamide (0.63 g, 6.9 mmol ; recovered from the 10% (w / v) methanol / nh3 solution) and diphenylmethanol, 3a (1.3 g, 7.1 mmol), in tfa (11.9 g, 104 mmol) at room temperature for 4 h. the solvent was removed in vacuo, and the brown oily residue was dissolved in chcl3 (30 ml) and washed with water (30 ml), followed by a dilute nahco3 solution (30 ml, 1:3 dilution of saturated nahco3 solution) and water (30 ml). the crude product was purified by flash chromatography using 1:1 ethyl acetate / hexanes to give pure 4a (0.31 g, 17% yield) as a white solid. h nmr (cdcl3) : 7.41 (d, j = 7.6 hz, 4h), 7.33 (t, j = 7.4 hz, 4h), 7.25 (tt, j = 7.2, 1.4 hz, 2h), 6.50 (br s, 1h), 5.57 (br s, 1h), 5.17 (s, 1h), 3.09 (s, 2h). c nmr (cdcl3) : 171.2, 140.3, 128.9, 128.4, 127.8, 54.9, 35.7. anal. (c15h15nos) c, h, n. compound 4b was synthesized according to general procedure b to give 4b (450 mg, 52% yield) as a yellow oil. h nmr (cdcl3) : 7.26 7.30 (m, 4h), 7.12 (d, j = 7.6 hz, 4h), 6.54 (br s, 1h), 5.53 (br s, 1h), 5.11 (s, 1h), 3.07 (s, 2h), 2.31 (s, 6h). compound 4c was synthesized according to general procedure b to give 4c (680 mg, 58% yield) as a white foam. h nmr (cdcl3) : 7.61 (d, j = 8.0 hz, 4h), 7.53 (d, j = 8.0 hz, 4h), 6.29 (br s, 1h), 5.72 (br s, 1h), 5.34 (s, 1h), 3.08 (s, 2h). compound 4d was synthesized according to general procedure b to give 4d (810 mg, 61% yield) as a yellow oil. h nmr (cdcl3) : 7.277.33 (m, 2h), 7.17 (d, j = 8.0 hz, 2h), 7.12 (dt, j = 10.0, 2.0 hz, 2h), 6.97 (td, j = 8.0, 2.4 hz, 2h), 6.43 (br s 1h), 6.09 (br s, 1h), 5.19 (s, 1h), 3.09 (s, 2h). compound 4e was synthesized according to general procedure b to give 4e (800 mg, 65% yield) as a yellow oil. h nmr (cdcl3) : 7.387.39 (m, 2h), 7.257.28 (m, 6h), 6.42 (br s, 1h), 6.05 (br s, 1h), 5.15 (s, 1h), 3.09 (s, 2h). c nmr (cdcl3) : 170.9, 141.6, 134.8, 130.1, 128.3, 128.1, 126.5, 53.4, 35.4. (c15h13cl2nos) c, h, n. compound 4f was synthesized according to general procedure b to give 4f (750 mg, 58% yield) as a yellow oil. h nmr (cdcl3) : 7.577.58 (m, 1h), 7.317.39 (m, 6h), 7.257.29 (m, 1h), 7.18 (t, j = 7.8 hz, 1h), 6.49 (br s, 1h), 6.32 (br s, 1h), 5.16 (s, 1h), 3.07 (s, 2h). compound 4 g was synthesized using 2-mercapto - n - methylacetamide and diphenylmethanol, 3a, according to general procedure a. the product 4 g (3.5 g, 59% yield) was obtained as a white solid. h nmr (dmso - d6) : 7.86 (br s, 1h), 7.42 (d, j = 8.2 hz, 4h), 7.33 (t, j = 7.6 hz, 4h), 7.23 (t, j = 7.2 hz, 2h), 5.40 (s, 1h), 2.96 (s, 2h), 2.54 (sd, j = 4.7 hz, 3h). c nmr (dmso - d6) : 169.6, 142.2, 129.5, 128.9, 128.1, 54.0, 35.8, 26.7. (c16h17nos) c, h, n. compound 4h was synthesized using 2-mercapto - n - methylacetamide and bis(4-chlorophenyl)methanol, 3c, at 60 c according to general procedure a. the product 4h (2.12 g, 79% yield) was obtained as a white solid. h nmr (dmso - d6) : 7.87 (br s, 1h), 7.387.44 (m, 8h), 5.45 (s, 1h), 2.99 (s, 2h), 2.53 (sd, j = 4.7 hz, 3h). c nmr (dmso - d6) : 169.3, 140.8, 132.8, 130.8, 129.6, 52.4, 35.8, 26.6. (c16h15cl2nos) c, h, n. compound 4i was synthesized from 2-mercapto - n - methylacetamide and bis(4-bromophenyl)methanol, 3d, at 60 c according to general procedure a. the product 4i (1.86 g, 74% yield) was obtained as a white solid. h nmr (dmso - d6) : 7.86 (br s, 1h), 7.53 (dt, j = 8.4, 2.2 hz, 4h), 7.35 (dt, j = 8.4, 2.2 hz, 4h), 5.42 (s, 1h), 2.99 (s, 2h), 2.53 (sd, j = 4.8 hz, 3h). c nmr (dmso - d6) : 168.3, 140.2, 131.5, 130.2, 120.4, 51.6, 34.9, 25.7. (c16h15br2nos) c, h, n. compound 4j was synthesized from 2-(benzhydrylthio)acetic acid and allylamine according to the modified general procedure c. the product 4j (1.97 g, 86% yield) was obtained as a viscous yellow oil that solidified over time. h nmr (cdcl3) : 7.40 (d, j = 7.2 hz, 4h), 7.32 (t, j = 7.4 hz, 4h), 7.25 (t, j = 8.0 hz, 2h), 6.67 (br s, 1h), 5.775.86 (m, 1h), 5.19 (d, jtrans = 17.6 hz, 1h), 5.15 (d, jcis = 10.6 hz, 1h), 5.13 (s, 1h), 3.84 (tt, j = 5.6, 1.6 hz), 3.14 (s, 2h). c nmr (cdcl3) : 168.0, 140.3, 133.8, 128.8, 128.2, 127.6, 116.8, 55.1, 42.1, 36.1. (c18h19nos) c, h, n. compound 4k was synthesized from 2-(benzhydrylthio)acetic acid and propylamine according to the modified general procedure c. the product 4k (1.05 g, 91% yield) was obtained as a yellow oil that solidified over time. h nmr (cdcl3) : 7.39 (d, j = 7.6 hz, 4h), 7.32 (tt, j = 7.2, 1.6 hz, 4h), 7.24 (t, j = 7.2 hz, 2h), 6.64 (br s, 1h), 5.11 (s, 1h), 3.18 (q, j = 6.8 hz, 2h), 3.11 (s, 2h), 1.471.56 (m, 2h), 0.93 (t, j = 7.4 hz, 3h). c nmr (cdcl3) : 168.2, 140.5, 128.9, 128.4, 127.7, 55.2, 41.6, 36.3, 22.9, 11.5. (c18h21nos) c, h, n. compound 4l was synthesized from 2-((bis(4-fluorophenyl)methyl)thio)acetic acid and propylamine according to general procedure c. the product 4l (320 mg, 95% yield) was obtained as a white solid. h nmr (cdcl3) : 7.327.37 (m, 4h), 6.99 7.05 (m, 4h), 6.55 (br s, 1h), 5.14 (s, 1h), 3.20 (q, j = 6.6 hz, 2h), 3.07 (s, 2h), 1.481.58 (m, 2h), 0.94 (t, j = 7.4 hz, 3h). c nmr (cdcl3) : 168.0, 162.1 (jcf = 247 hz), 136.0 (jcf = 3.7 hz), 129.8 (jcf = 8.1 hz), 115.7 (jcf = 21.4 hz), 53.2, 41.5, 36.0, 22.8, 11.4. (c18h19f2nos) c, h, n. compound 4 m was synthesized from 2-((bis(4-chlorophenyl)methyl)thio)acetic acid and propylamine according to the modified general procedure c. the product 4 m (2.06 g, 91% yield) was obtained as a viscous yellow oil that solidified over time. h nmr (cdcl3) : 7.30 (s, 8h), 6.34 (br s, 1h), 5.11 (s, 1h), 3.20 (q, j = 6.8 hz, 2h), 3.07 (s, 2h), 1.481.57 (m, 2h), 0.93 (t, j = 7.4 hz, 3h). c nmr (cdcl3) : 168.0, 138.6, 133.8, 129.7, 129.2, 53.6, 41.7, 36.1, 22.9, 11.5. (c18h19cl2nos) c, h, n. compound 4n was synthesized from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and propylamine according to the modified general procedure c. the product 4n (1.75 g, 80% yield) was obtained as a light yellow solid. h nmr (cdcl3) : 7.45 (d, j = 8.8 hz, 4h), 7.24 (d, j = 8.8 hz, 4h), 6.41 (br s, 1h), 5.08 (s, 1h), 3.19 (q, j = 6.8 hz, 2h), 3.07 (s, 2h), 1.471.56 (m, 2h), 0.93 (t, j = 7.2 hz, 3h). c nmr (cdcl3) : 168.0, 139.1, 132.1, 130.0, 121.9, 53.7, 41.7, 36.1, 22.9, 11.5. (c18h19br2nos) c, h, n. compound 4o was synthesized from 2-(benzhydrylthio)acetic acid and cyclopropylmethylamine according to the modified general procedure c. the product 4o (0.25 g, 94% yield) was obtained as a yellow oil. h nmr (cdcl3) : 7.41 (d, j = 7.6 hz, 4h), 7.33 (tt, j = 7.4, 1.9 hz, 4h), 7.25 (tt, j = 7.4, 1.7 hz, 2h), 6.73 (br s, 1h), 5.14 (s, 1h), 3.12 (s, 2h), 3.09 (dd, j = 7.2, 5.6 hz, 2h), 0.901.00 (m, 1h), 0.53 (q, j = 6.4 hz, 2h), 0.22 (q, j = 5.2 hz, 2h). c nmr (cdcl3) : 168.1, 140.5, 128.9, 128.4, 127.7, 55.1, 44.7, 36.3, 10.8, 3.6. (c19h21nos) c, h, n. compound 4p was synthesized from 2-((bis(4-fluorophenyl)methyl)thio)acetic acid and cyclopropylmethylamine according to general procedure c. the product 4p (320 mg, 92% yield) was obtained as a white solid. h nmr (cdcl3) : 7.35 (dd, j = 8.8, 5.2 hz, 4h), 6.997.05 (m, 4h), 6.58 (br s, 1h), 5.16 (s, 1h), 3.11 (dd, j = 7.0, 5.4 hz, 2h), 3.08 (s, 2h), 0.911.01 (m, 1h), 0.520.56 (m, 2h), 0.23 (q, j = 5.0 hz, 2h). c nmr (cdcl3) : 167.9, 162.1 (jcf = 248 hz), 136.0 (jcf = 3.0 hz), 129.8 (jcf = 8.1 hz), 115.7 (jcf = 21.4 hz), 53.3, 44.6, 36.0, 10.7, 3.4. (c19h19f2nos) c, h, n. compound 4q was synthesized from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and cyclopropylmethylamine according to the modified general procedure c. purification by flash column chromatography using 1:1 ethyl acetate / hexanes gave the pure product 4q (1.08 g, 94% yield) as a white solid. h nmr (cdcl3) : 7.49 (dt, j = 8.8, 2.2 hz, 4h), 7.25 (dt, j = 8.4, 2.4 hz, 4h), 6.56 (br s, 1h), 5.12 (s, 1h), 3.09 (dd, j = 7.2, 5.6 hz, 2h), 3.07 (s, 2h), 0.880.97 (m, 1h), 0.53 (q, j = 6.6 hz, 2h), 0.21 (q, j = 5.2 hz, 2h). c nmr (cdcl3) : 167.9, 139.0, 132.0, 130.0, 121.8, 53.5, 44.6, 35.9, 10.7, 3.5. (c19h19br2nos/4c4h8o2) c, h, n. compound 4r was synthesized from 2-(benzhydrylthio)acetic acid and n - butylamine according to the modified general procedure c. the product 4r (264 mg, 87% yield) was obtained as a yellow oil. h nmr (cdcl3) : 7.39 (d, j = 7.2 hz, 4h), 7.32 (t, j = 7.4 hz, 4h), 7.24 (tt, j = 7.2, 1.7 hz, 2h), 6.64 (br s, 1h), 5.11 (s, 1h), 3.21 (q, j = 6.7 hz, 2h), 3.10 (s, 2h), 1.431.51 (m, 2h), 1.301.39 (m, 2h), 0.93 (t, j = 7.2 hz, 3h). c nmr (cdcl3) : 168.2, 140.5, 128.9, 128.3, 127.7, 55.1, 39.6, 31.7, 20.2, 13.9. (c19h23nos) c, h, n. compound 4s was synthesized from 2-((bis(4-fluorophenyl)methyl)thio)acetic acid and n - butylamine according to general procedure c. the product 4s (350 mg, 100%) was obtained as a white solid. h nmr (cdcl3) : 7.34 (dd, j = 8.8, 5.2 hz, 4h), 6.997.05 (m, 4h), 6.49 (br s, 1h), 5.13 (s, 1h), 3.24 (q, j = 6.6 hz, 2h), 3.07 (s, 2h), 1.451.52 (m, 2h), 1.311.40 (m, 2h), 0.94 (t, j = 7.2 hz, 3h). c nmr (cdcl3) : 167.9, 162.1 (jcf = 247 hz), 136.0 (jcf = 3.7 hz), 129.8 (jcf = 8.1 hz), 115.7 (jcf = 21.4 hz, 4c), 53.3, 39.5, 36.0, 31.6, 20.1, 13.7. (c19h21f2nos) c, h, n. compound 4 t was synthesized from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and n - butylamine according to the modified general procedure c. purification by flash column chromatography using 10% meoh / chcl3 gave the pure product 4 t (0.50 g, 88% yield) as a yellow oil. h nmr (cdcl3) : 7.45 (dt, j = 8.4, 2.0 hz, 4h), 7.24 (dt, j = 8.8, 2.4 hz, 4h), 6.40 (br s, 1h), 5.07 (s, 1h), 3.22 (q, j = 6.8 hz, 2h), 3.07 (s, 2h), 1.431.51 (m, 2h), 1.301.39 (m, 2h), 0.94 (t, j = 7.2 hz, 3h). c nmr (cdcl3) : 167.9, 139.1, 132.1, 130.0, 121.9, 53.7, 39.7, 36.1 31.7, 20.2, 13.9. (c19h21br2nos) c, h, n. compound 4u was synthesized as previously described from 2-(benzhydrylthio)acetic acid and 3-phenyl-1-propylamine according to the modified general procedure c. purification on a teledyne isco combiflash rf instrument using 1:1 ethyl acetate / hexanes gave the pure product 4u (1.66 g, 94% yield) as a white solid. h nmr (cdcl3) : 7.377.39 (m, 4h), 7.287.33 (m, 6h), 7.167.27 (m, 5h), 6.61 (br s, 1h), 5.10 (s, 1h), 3.24 (q, j = 6.8 hz, 2h), 3.09 (s, 2h), 2.64 (t, j = 7.6 hz, 2h), 1.781.86 (m, 2h). c nmr (cdcl3) : 168.3, 141.3, 140.5, 128.9, 128.6, 128.5, 128.3, 127.7, 126.2, 55.2, 39.5, 36.3, 33.4, 31.2. (c24h25nos) c, h, n. compound 4v was synthesized from 2-((bis(4-fluorophenyl)methyl)thio)acetic acid and 3-phenyl-1-propylamine according to general procedure c. the product 4v (1.2 g, 100%) was obtained as a yellow oil. h nmr (cdcl3) : 7.267.35 (m, 6h), 7.167.22 (m, 3h), 6.987.04 (m, 4h), 6.48 (br s, 1h), 5.12 (s, 1h), 3.27 (q, j = 6.8 hz, 2h), 3.04 (s, 2h), 2.66 (t, j = 7.8 hz, 2h), 1.811.88 (m, 2h). c nmr (cdcl3) : 168.0, 162.1 (jcf = 247 hz), 141.1, 135.9 (jcf = 2.9 hz), 129.8 (jcf = 8.1 hz), 128.4 (jcf = 21.4 hz), 126.1, 115.8, 115.6, 53.3, 39.4, 36.0, 33.2, 31.1. (c24h23f2nos) c, h, n. compound 4w was synthesized as previously described from 2-((bis(4-chlorophenyl)methyl)thio)acetic acid and 3-phenyl-1-propylamine according to general procedure c. the product 4w (1 g, 75%) was obtained as a yellow oil. h nmr(cdcl3) : 7.157.31 (m, 13h), 6.38 (br s, 1h), 5.09 (s, 1h), 3.26 (q, j = 6.6 hz, 2h), 3.04 (s, 2h), 2.65 (t, j = 7.6 hz, 2h), 1.801.87 (m, 2h). c nmr (cdcl3) : 167.9, 141.1, 138.4, 133.6, 129.5, 129.0, 128.5, 128.3, 126.1, 53.4, 39.4, 35.9, 33.2, 31.0. (c24h23cl2nos) c, h, n. compound 4x was synthesized as previously described from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and 3-phenyl-1-propylamine according to the modified general procedure c. purification by flash column chromatography using 7:3 ethyl acetate / hexanes and trituration in boiling diisopropyl ether gave the pure product 4x (1.94 g, 76% yield) as a white solid. h nmr (dmso - d6) : 7.97 (t, j = 5.4 hz, 1h), 7.52 (dt, j = 8.8, 2.2 hz, 4h), 7.35 (dt, j = 8.8, 2.3 hz, 4h), 7.26 (t, j = 7.6 hz, 2h), 7.17 (d, j = 7.6 hz, 2h), 7.157.18 (m, 1h), 5.42 (s, 1h), 2.993.04 (m, 4h), 2.55 (t, j = 7.8 hz, 2h), 1.621.70 (m, 2h). c nmr (dmso - d6) : 168.9, 142.5, 141.1, 132.5, 131.1, 129.2, 126.7, 121.4, 52.6, 52.5, 39.3, 35.9, 33.4, 31.6. (c24h23br2nos) c, h, n. compound 4y was synthesized from 2-(benzhydrylthio)acetic acid and 4-phenyl-1-butylamine according to the modified general procedure c. the product 4y (0.73 g, 96% yield) was obtained as a yellow oil. h nmr (cdcl3) : 7.357.38 (m, 4h), 7.287.32 (m, 6h), 7.167.26 (m, 5h), 6.61 (br s, 1h), 5.08 (s, 1h), 3.22 (q, j = 6.7 hz, 2h), 3.10 (s, 2h), 2.64 (t, j = 7.4 hz, 2h), 1.611.69 (m, 2h), 1.481.55 (m, 2h). c nmr (cdcl3) : 168.2, 142.1, 140.4, 128.9, 128.52, 128.50, 128.3, 127.7, 126.0, 55.2, 39.7, 36.2, 35.6, 29.2, 28.8. (c25h27nos) c, h, n. compound 4z was synthesized from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and 4-phenyl-1-butylamine according to the modified general procedure c. purification by flash column chromatography using 1:1 ethyl acetate / hexanes gave the pure product 4z (1.2 g, 90% yield) as a yellow oil. h nmr (cdcl3) : 7.43 (dt, j = 8.0, 2.3 hz, 4h), 7.28 (t, j = 7.4 hz, 2h), 7.20 (d, j = 8.4 hz, 4h), 7.157.19 (m, 3h), 6.39 (br s, 1h), 5.04 (s, 1h), 3.23 (q, j = 6.7 hz, 2h), 3.05 (s, 2h), 2.64 (t, j = 7.6 hz, 2h), 1.611.69 (m, 2h), 1.481.55 (m, 2h). c nmr (cdcl3) : 168.0, 142.0, 139.0, 132.1, 130.0, 128.54, 128.52, 126.1, 121.9, 53.6, 39.8, 36.0, 35.6, 29.2, 28.8. (c25h25br2nos) c, h, n. compound 5a was synthesized following a literature procedure. briefly, h2o2 (0.11 ml, 1.1 mmol, 1 equiv) was added to a solution of compound 4b (310 mg, 1.1 mmol, 1 equiv) in a solvent mixture of acetic acid (1.1 ml) and meoh (3.3 ml). the solvent was removed in vacuo, and the isolated crude residue was purified by flash column chromatography using a gradient solvent system, viz., 1:1 ethyl acetate / ch2cl2 to 5% meoh / ch2cl2. the pure product 5a (310 mg, 72%) was obtained as a white solid. h nmr (cdcl3) : 7.36 (d, j = 8.2 hz, 2h), 7.30, (d, j = 8.2 hz, 2h), 7.20 (sd, j = 3.7 hz, 4h), 7.12 (br s, 1h), 5.72 (br s, 1h), 5.12 (s, 1h), 3.46 (d, j = 14.8 hz, 1h), 3.10 (d, j = 14.4 hz, 1h), 2.34 (s, 6h). c nmr (cdcl3) : 166.4, 138.8, 138.5, 131.3, 131.2, 130.1, 129.6, 129.2, 128.6, 71.2, 51.2, 21.1. (c17h19no2s/2h2o) c, h, n. compound 5b was synthesized as described for 5a using compound 4c (680 mg, 1.73 mmol) to give the product 5b (510 mg, 72%) as a white solid. h nmr (cdcl3) : 7.70 (dd, j = 8.0, 6.0 hz, 4h), 7.60 (dd, j = 8.6, 2.6 hz, 4h), 6.70 (br s, 1h), 5.71 (br s, 1h), 5.40 (s, 1h), 3.56 (d, j = 14.0 hz, 1h), 3.12 (d, j = 14.2 hz, 1h). c nmr (cdcl3) : 165.3, 137.8, 137.0, 131.4 (jcf = 33.2 hz), 131.2 (jcf = 33.2 hz), 129.9, 129.3, 126.6 (jcf = 3.7 hz), 126.0 (jcf = 3.7 hz), 123.8 (jcf = 272 hz), 123.6 (jcf = 273 hz), 69.6, 51.8. (c17h13f6no2s/2h2o) c, h, n. compound 5c was synthesized as described for 5a using compound 4d (810 mg, 2.76 mmol) to give the product 5c (600 mg, 70%) as a white solid. h nmr (cdcl3) : 7.347.42 (m, 2h), 7.147.27 (m, 4h), 7.047.10 (m, 2h), 6.98 (br s, 1h), 6.18 (br s, 1h), 5.33 (s, 1h), 3.49 (d, j = 13.6 hz, 1h), 3.23 (d, j = 14.0 hz, 1h). c nmr (cdcl3) : 166.0, 163.0 (jcf = 248 hz), 162.8 (jcf = 248 hz), 136.5, 135.8, 131.2 (jcf = 8.1 hz), 130.5 (jcf = 8.1 hz), 125.3, 124.5 (jcf = 3.0 hz), 116.5 (jcf = 22.8 hz), 115.9 (jcf = 22.1 hz), 69.7, 52.2. (c15h13f2no2s) c, h, n. compound 5d was synthesized as described for 5a using compound 4e (800 mg, 2.45 mmol) to give the product 5d (600 mg, 71%) as a white solid. h nmr (cdcl3) : 7.437.43 (m, 2h), 7.317.37 (m, 6h), 7.05 (br s, 1h), 6.36 (br s, 1h), 5.36 (s, 1h), 3.47 (d, j = 13.6 hz, 1h), 3.27 (d, j = 13.6 hz, 1h). c nmr (cdcl3) : 166.3, 136.3, 135.6, 135.4, 134.8, 130.8, 130.2, 129.6, 129.2, 129.0, 128.8, 127.7, 126.9, 69.4, 52.9. (c15h13cl2no2s) c, h, n. compound 5e was synthesized as described for 5a using compound 4f (750 mg, 2.23 mmol) to give the product 5e (540 mg, 69%) as a white solid. h nmr (dmso - d6) : 7.657.69 (m, 2h), 7.487.57 (m, 4h), 7.307.43 (m, 5h), 5.36 (s, 1h), 3.39 (d, j = 13.6 hz, 1h), 3.20 (d, j = 13.6 hz, 1h). c nmr (dmso - d6) : 166.2, 137.4, 136.7, 132.2, 130.8, 130.6, 129.7, 129.1, 128.7, 128.6, 128.4, 128.1, 121.6, 67.5, 56.4. (c15h14brno2s) c, h, n. compound 5f was synthesized as described for 5a using compound 4 g (500 mg, 1.84 mmol) to give the product 5f (427 mg, 81%) as a yellow oil. h nmr (cdcl3) : 7.357.49 (m, 10h), 7.02 (br s, 1h), 5.18 (s, 1h), 3.44 (d, j = 14.0 hz, 1h), 3.13 (d, j = 14.0 hz, 1h), 2.82 (sd, j = 4.7 hz, 3h). c nmr (cdcl3) : 164.9, 134.9, 134.2, 129.7, 129.6, 129.13, 129.08, 129.01, 128.9, 71.7, 52.3, 26.7. (c16h17no2s/4h2o) c, h, n. compound 5 g was synthesized as described for 5a using compound 4x (220 mg, 0.41 mmol) to give the product 5 g (100 mg, 44%) as a colorless oil. h nmr (cdcl3) : 7.517.55 (m, 4h), 7.167.31 (m, 9h), 6.69 (t, j = 5.4 hz, 1h), 5.13 (s, 1h), 3.42 (d, j = 14.0 hz, 1h), 3.33 (q, j = 7.0 hz, 2h), 3.05 (d, j = 14.0 hz, 1h), 2.67 (t, j = 7.8 hz, 2h), 1.851.89 (m, 2h). c nmr (cdcl3) : 163.7, 141.3, 133.4, 132.9, 132.5, 132.3, 131.3, 130.7, 128.7, 128.6, 126.3, 123.53, 123.47, 69.7, 52.4, 39.7, 33.4, 31.2. (c24h23br2no2s/2h2o) c, h, n. compounds 6a6c were synthesized following a literature procedure. a solution of cysteamine hydrochloride (10 mmol), diphenylmethanol, 3a, or the appropriate halogen - substituted diphenylmethanol, 3c or 3d (10 mmol), and bf3oet2 (11 mmol) in glacial acetic acid (40 ml) was stirred at 9095 c for 20 min (4050 min for substituted analogues). the reaction mixture was cooled to room temperature, and diethyl ether (200 ml) was added to precipitate a solid (the hydrochloride salt) from the mixture. the solid was filtered and dried under vacuum for 3 days in the presence of naoh pellets. the dried solid was dissolved in hot ethanol and filtered and the solvent removed in vacuo. finally, the solid was triturated in hot (boiling) ethyl acetate to give the pure product as the hydrochloride salt. compound 6a was synthesized from diphenylmethanol, 3a, according to general procedure d to give the hydrochloride salt in quantitative yield. the hydrochloride salt of 6a (10.1 g, 36.1 mmol) was converted to the free base by being dissolved in saturated aqueous nahco3 solution (120 ml) and extracted into chcl3 (150 ml). the layers were separated, and the organic layer was washed with distilled water (80 ml) and aqueous brine solution (100 ml) and dried over mgso4. the solvent was evaporated in vacuo to give the free base 6a (7.90 g, 90% yield) as a yellow oil. h nmr (cdcl3) : 7.43 (d, j = 8.0 hz, 4h), 7.31 (t, j = 7.4 hz, 4h), 7.22 (tt, j = 7.4, 1.5 hz, 2h), 5.16 (s, 1h), 2.81 (t, j = 6.2 hz, 2h), 2.51 (t, j = 6.4 hz, 2h). c nmr (cdcl3) : 141.5, 128.7, 128.4, 127.4, 54.0, 41.0, 36.7. (c15h17ns/4c2h2o4) c, h, n. compound 6b was synthesized from bis(4-chlorophenyl)methanol, 3c, according to general procedure d with a reaction time of 50 min. the hydrochloride salt product 6b (1.06 g, 62% yield) h nmr (hcl salt, dmso - d6) : 8.12 (br s, 3h), 7.48 (d, j = 8.4 hz, 4h), 7.42 (d, j = 8.8 hz, 4h), 5.56 (s, 1h), 2.94 (t, j = 7.6 hz, 2h), 2.60 (t, j = 7.2 hz, 2h). c nmr (hcl salt, dmso - d6) : 139.9, 132.0, 129.9, 128.7, 50.2, 38.0, 28.6. anal. (c15h15cl2ns/4hcl/4h2o) c, h, n. compound 6c was synthesized from bis(4-bromophenyl)methanol, 3d, according to general procedure d with a reaction time of 40 min. the hydrochloride salt product 6c (4.15 g, 72% yield) h nmr (hcl salt, dmso - d6) : 8.09 (br s, 3h), 7.55 (dt, j = 8.4, 2.3 hz, 4h), 7.41 (dt, j = 8.8, 2.2 hz, 4h), 5.53 (s, 1h), 2.94 (t, j = 7.4 hz, 2h), 2.59 (t, j = 7.4 hz, 2h). c nmr (hcl salt, dmso - d6) : 140.2, 131.6, 130.2, 120.5, 50.2, 37.9, 28.5. (c15h15br2nshcl) c, h, n. compound 6d was synthesized according to general procedure d starting with compound 6a. a suspension of the hydrochloride salt of 6a (1.0 g, 3.6 mmol) and cyclopropanecarboxaldehyde (0.28 g, 4.0 mmol) in 1,2-dichloroethane (62 ml) was stirred at room temperature under an argon atmosphere for 1.3 h. sodium cyanoborohydride (0.69 g, 11 mmol) dissolved in methanol (2.0 ml) was added to the reaction mixture, and the mixture was stirred at room temperature under an argon atmosphere overnight. after 19 h of reaction time, saturated nahco3 solution (30 ml), distilled water (30 ml), and ch2cl2 (15 ml) were added to the reaction mixture, and the resulting mixure was stirred vigorously for 1 h. the layers were separated, and the aqueous layer was washed with ch2cl2 (3 25 ml). the combined ch2cl2 extract was washed with water (50 ml), dried over mgso4, and concentrated in vacuo to give a crude product. the isolated crude was purified by flash column chromatography using an ethyl acetate / hexanes solvent gradient (from 4:1 to 1:4) to give the free base 6d (0.50 g, 47% yield) as a yellow oil. some of the isolated free base was converted into the hydrochloride salt in chcl3 using a 1.0 m hcl in ether solution. h nmr (cdcl3) : 7.42 (d, j = 7.4 hz, 4h), 7.30 (t, j = 7.4 hz, 4h), 7.22 (tt, j = 7.2, 1.6 hz, 2h), 5.17 (s, 1h), 2.76 (t, j = 6.4 hz, 2h), 2.59 (t, j = 6.6 hz, 2h), 2.40 (d, j = 6.8 hz, 2h), 0.810.97 (m, 1h), 0.440.48 (m, 2h), 0.09 (qd, j = 4.8, 1.2 hz, 2h). c nmr (cdcl3) : 141.6, 128.7, 128.4, 127.3, 54.7, 54.3, 48.1, 32.9, 11.4, 3.5. (c19h23nshcl/4h2o) c, h, n. compound 6e was synthesized by adapting a literature procedure using compound 6a (general procedure d). a mixture of csohh2o (0.29 g, 1.7 mmol) and activated 4 molecular sieves (0.52 g) in anhydrous dmf (8.3 ml, freshly distilled and stored over activated 4 molecular sieves) was purged of air under vacuum and flushed with argon gas. after the mixture was stirred for 13 min, the free base of compound 6a (0.41 g, 1.7 mmol), dissolved in anhydrous dmf (4.0 ml), was added. the reaction mixture was stirred under vacuum for 25 min and flushed with argon for 5 min, and n - butyl bromide (0.28 g, 2.04 mmol) was added. this was followed by another 10 min of vacuum purging, and the reaction was left to stir overnight at room temperature. the reaction mixture was filtered after 20 h of reaction time, and the undissolved solids were washed with ethyl acetate. the filtrate was evaporated in vacuo to give a liquid residue, which was taken up in aqueous 1 m naoh (30 ml) and extracted with ethyl acetate (2 25 ml). the organic extract was washed with brine (50 ml), dried over a 1:1 na2so4/mgso4 mixture, and concentrated in vacuo. the crude product was purified by flash column chromatography using 5% diethyl ether / hexanes (with 0.5% net3) to give the free base 6e (0.22 g, 44% yield) as a yellow oil. h nmr (cdcl3) : 7.42 (d, j = 7.2 hz, 4h), 7.30 (t, j = 7.6 hz, 4h), 7.22 (tt, j = 7.2, 1.6 hz, 2h), 5.17 (s, 1h), 2.74 (t, j = 6.4 hz, 2h), 2.58 (t, j = 6.2 hz, 2h), 2.53 (t, j = 7.2 hz, 2h), 1.401.47 (m, 2h), 1.271.37 (m, 2h), 0.90 (t, j = 7.6 hz, 3h). c nmr (cdcl3) : 141.6, 128.7, 128.4, 127.3, 54.2, 49.3, 48.3, 32.8, 32.3, 20.6, 14.1. (c19h25nsc2h2o4) c, h, n. compound 6f was synthesized from compound 4u. briefly, sulfuric acid (98% ; 305 mg, 3.11 mmol) in thf (8.0 ml) was added dropwise at 0 c to lialh4 (227 mg, 5.99 mmol) in thf (13 ml), and the mixture was stirred for 15 min at room temperature. compound 4u (563 mg, 1.50 mmol) in thf (11 ml) was added dropwise to the reduction mixture at room temperature and the resulting mixture stirred overnight. the reaction mixture was cooled to 0 c and quenched with water (5.0 ml) and 10% naoh (20 ml) successively. the mixture was filtered, the insolubles were washed with thf, and the filtrate was evaporated to dryness. the crude product was purified on a teledyne isco combiflash rf instrument using 97:3:0.03 chcl3/meoh / nh4oh to give the pure product 6f (312 mg, 58%) as a yellow oil. h nmr (cdcl3) : 7.42 (d, j = 7.6 hz, 4h), 7.277.32 (m, 6h), 7.167.23 (m, 5h), 5.16 (s, 1h), 2.73 (t, j = 6.4 hz, 2h), 2.63 (t, j = 7.8 hz, 2h), 2.542.58 (m, 4h), 1.741.82 (m, 2h). c nmr (cdcl3) : 142.2, 141.6, 128.7, 128.53, 128.47, 128.4, 127.4, 125.9, 54.2, 49.1, 48.3, 33.7, 32.8, 31.8. (c24h27ns c2h2o4) c, h, n. compound 6 g was synthesized as described for compound 6f using compound 4v, except that the reaction mixture was stirred at room temperature for 2 h (instead of overnight) before being quenched with water and naoh (15% instead of 10%).the crude product was purified by flash column chromatography (95:5:0.5 chcl3/meoh / nh4oh) to give the pure product 6 g (820 mg, 86.6%) as a yellow oil. the free base was converted to the oxalate salt, which was recrystallized from a methanol / acetone mixture. h nmr (cdcl3) : 7.337.37 (m, 4h), 7.167.30 (m, 5h), 6.977.02 (m, 4h), 5.13 (s, 1h), 2.72 (t, j = 6.4 hz, 2h), 2.64 (t, j = 7.8 hz, 2h), 2.52 (m, 4h), 1.751.82 (m, 2h). c nmr (cdcl3) : 161.9 (jcf = 246 hz), 142.0, 137.0 (jcf = 3.0 hz), 129.7 (jcf = 8.1 hz), 128.4, 125.8, 115.5 (jcf = 21.4 hz, 4c), 52.5, 48.8, 48.0, 33.6, 32.6, 31.6. (c24h25f2nsc2h2o4) c, h, n. compound 6h was synthesized as described for 6 g using compound 4w (1 g, 2.2 mmol). the crude product 6h (850 mg) was obtained as a yellow oil and carried to the next step without further purification. a solution of 1 m bh3thf complex (14 ml, 14.0 mmol) was added slowly (in two aliquots) to a solution of compound 4x (1.50 g, 2.81 mmol) in freshly distilled thf (15 ml) at 2 c. the reaction mixture was refluxed for 16 h, cooled to 0 c, quenched with ch3oh (30 ml), saturated with aqueous hcl (5.0 ml of concentrated hcl (37%)), and refluxed for another 23 h, successively. the solvent was removed in vacuo to give a yellow, oily residue which was taken up in chcl3 (50 ml) and washed with distilled water (2 50 ml). the combined aqueous extract was back - washed with chcl3 (3 30 ml) and then discarded. the combined chcl3 extract was washed with water (100 ml) and brine (100 ml) and concentrated in vacuo to give the hydrochloride salt of 6i. the salt was suspended in a small amount of water and the suspension made basic to a ph of 13 with 10 m naoh (20 ml). the basic solution was continuously extracted with chcl3 for 6 h, and the layers were separated. solvent was removed from the organic layer to give the crude free base of compound 6i, which was purified by flash column chromatography (5% meoh / ch2cl2). the pure product 6i (0.58 g, 40% yield) was obtained as a yellow oil and converted to the oxalate salt. h nmr (cdcl3) : 7.43 (dt, j = 8.4, 2.3 hz, 4h), 7.237.30 (m, 6h), 7.167.20 (m, 3h), 5.07 (s, 1h), 2.74 (t, j = 6.6 hz, 2h), 2.64 (t, j = 7.6 hz, 2h), 2.532.29 (m, 4h), 1.771.83 (m, 2h). c nmr (cdcl3) : 142.1, 140.1, 131.9, 131.6, 130.0, 128.5, 126.0, 121.5, 53.0, 49.0, 48.3, 33.7, 32.7, 31.7. (c24h25br2nosc2h2o4) c, h, n. compound 7a was synthesized with slight modifications to a published procedure. briefly, a solution of sodium periodate (naio4 ; 2.25 g, 10.5 mmol) in water (50 ml) was added in a dropwise manner to a solution of the hydrochloride salt of compound 6a (2.80 g, 10.0 mmol) in ethanol (150 ml) at 0 c. the reaction was allowed to stir and warm to room temperature for 20 h under an argon atmosphere. the reaction mixture, which contained a white precipitate, was cooled in an ice bath and filtered. the filtrate was concentrated in vacuo to give a dark yellow, oily residue. the oily residue (the hydrochloride salt) was dissolved in chcl3, washed with an aqueous nahco3 solution (2:3 dilution in water of saturated nahco3 solution), distilled water, and aqueous brine, and dried over na2so4, successively. after filtration, solvent was removed in vacuo to give the crude, free base of compound 7a. the crude product was purified by flash column chromatography using a meoh / chcl3 (with 0.1% nh4oh) gradient (from 0% to 1% meoh) to give pure 7a (1.12 g, 43% yield) as a yellow oil. h nmr (cdcl3) : 7.50 (d, j = 7.8 hz, 2h), 7.317.44 (m, 8h), 4.90 (s, 1h), 3.103.23 (m, 2h), 2.532.65 (m, 2h). c nmr (cdcl3) : 135.8, 135.2, 129.4, 128.9, 128.7, 128.5, 128.4, 73.1, 54.4, 36.5. (c15h17nosc2h2o4) c, h, n. compound 7b was synthesized as described for 7a from compound 6e (0.070 g, 0.23 mmol) and naio4 (0.053 g, 0.25 mmol) in an ethanol / water (etoh / h2o) mixture (4.0 ml/1.2 ml, v / v). the pure free base product 7b (0.020 g, 41% yield) was obtained as a yellow oil after purification of the crude by flash column chromatography using a meoh / chcl3 (with 0.1% nh4oh) gradient (from 0% to 2% meoh). h nmr (cdcl3) : 7.49 (d, j = 7.6 hz, 2h), 7.307.44 (m, 8h), 4.92 (s, 1h), 2.993.13 (m, 2h), 2.65 (t, j = 5.8 hz, 2h), 2.56 (t, j = 7.0 hz, 2h), 1.401.47 (m, 2h), 1.271.36 (m, 2h), 0.89 (t, j = 7.4 hz, 3h). c nmr (cdcl3) : 135.9, 135.2, 129.44, 129.42, 128.9, 128.8, 128.49, 128.44, 73.0, 51.1, 49.6, 43.6, 32.1, 20.5, 14.1. (c19h25nosc2h2o4/2h2o) c, h, n. compound 7c was synthesized as described for compound 5a using 6 g (900 mg, 2.27 mmol). the free base product 7c (820 mg, 87.5% yield) was obtained as a yellow oil and converted into the oxalate salt, which was recrystallized from a methanol / acetone mixture. h nmr (cdcl3) : 7.377.44 (m, 4h), 7.057.29 (m, 9h), 5.00 (s, 1h), 3.163.22 (m, 1h), 3.043.11 (m, 1h), 2.602.83 (m, 6h), 1.801.88 (m, 2h). c nmr (cdcl3) : 162.8 (jcf = 248 hz), 162.6 (jcf = 249 hz), 141.1, 131.0 (jcf = 8.1 hz), 130.3 (jcf = 8.1 hz), 130.1 (jcf = 3.7 hz), 128.4, 128.3, 126.0, 116.4 (jcf = 21.4 hz), 115.8 (jcf = 21.4 hz), 70.6, 48.7, 48.4, 43.1, 33.1, 30.1. (c24h25f2nosc2h2o4) c, h, n. compound 7d was synthesized as described for compound 5a using 6h (850 mg, 1.97 mmol). the free base product 7d (640 mg, two steps yield 72.6%) was obtained as a yellow oil and converted into the oxalate salt, which was recrystallized from hot meoh. h nmr (cdcl3) : 7.157.39 (m, 13h), 4.88 (s, 1h), 2.993.08 (m, 2h), 2.572.65 (m, 6h), 1.751.82 (m, 2h). c nmr (cdcl3) : 141.9, 134.7, 134.6, 134.0, 132.9, 130.6, 129.9, 129.6, 129.0, 128.4, 125.9, 70.6, 51.2, 49.1, 43.1, 33.5, 31.4. (c24h25cl2nosc2h2o4/2h2o) c, h, n. compound 7e was synthesized as described for compound 5a using 6i (230 mg, 0.443 mmol). the free base product 7e (130 mg, 55% yield) was obtained as a yellow oil and converted into the oxalate salt, which was recrystallized from hot meoh. h nmr (cdcl3) : 7.457.53 (m, 4h), 7.157.32 (m, 7h), 4.83 (s, 1h), 2.993.08 (m, 2h), 2.572.65 (m, 6h), 1.751.82 (m, 2h). c nmr (cdcl3) : 141.9, 134.5, 133.3, 132.5, 132.3, 132.0, 131.4, 130.9, 130.2, 128.4, 125.9, 122.9, 122.7, 70.7, 51.2, 49.1, 43.1, 33.5, 31.4. (c24h25br2nosc2h2o4) c, h, n. striata were dissected from male sprague dawley rat brains (supplied on ice from bioreclamation (hicksville, ny), prepared by homogenizing tissues in 20 volumes (w / v) of ice cold modified sucrose phosphate buffer (0.32 m sucrose, 7.74 mm na2hpo4, 2.26 mm nah2po4, ph adjusted to 7.4) using a brinkman polytron (setting 6 for 20 s), and centrifuged at 30000 g for 10 min at 4 c. the resulting pellet was resuspended in buffer, recentrifuged, and suspended in buffer again to a concentration of 10 mg / ml, original wet weight (oww). experiments were conducted in assay tubes containing 0.5 ml of sucrose phosphate buffer, 0.5 nm [h]win 35,428 (kd = 5.53, specific activity 84 ci / mmol ; perkin - elmer life sciences, waltham, ma), 1.0 mg of tissue oww, and various concentrations of inhibitor. the reaction was started with the addition of tissue, and the tubes were incubated for 120 min on ice. dawley rat brains (supplied on ice from bioreclamation) were homogenized in 20 volumes (w / v) of 50 mm tris buffer (120 mm nacl and 5 mm kcl, adjusted to ph 7.4) at 25 c using a brinkman polytron (at setting 6 for 20 s). the tissue was centrifuged at 30000 g for 10 min at 4 c. the final pellet was resuspended in cold buffer to a concentration of 15 mg / ml oww. experiments were conducted in assay tubes containing 0.5 ml of buffer, 1.4 nm [h]citalopram (kd = 1.94 nm, specific activity = 83 ci / mmol ; perkin - elmer life sciences), 1.5 mg of brain stem tissue, and various concentrations of inhibitor. the reaction was started with the addition of the tissue, and the tubes were incubated for 60 min at room temperature. membranes from frozen frontal cortex dissected from male sprague dawley rat brains (supplied on ice from bioreclamation) were homogenized in 20 volumes (w / v) of 50 mm tris buffer (120 mm nacl and 5 mm kcl, adjusted to ph 7.4) at 25 c using a brinkman polytron (at setting 6 for 20 s). the tissue was centrifuged at 30000 g for 10 min at 4 c. the final pellet was resuspended in cold buffer to a concentration of 80 mg / ml oww. experiments were conducted in assay tubes containing 0.5 ml of buffer, 0.5 nm [h]nisoxetine (kd = 1.0 nm, specific activity 82 ci / mmol ; perkin - elmer life sciences), 8 mg of frontal cortex tissue, and various concentrations of inhibitor. the reaction was started with the addition of the tissue, and the tubes were incubated for 180 min at 04 c. the solvent used to dissolve the various analogues of modafinil was typically methanol and was present at a final concentration of 5%. extensive studies previously in this and other laboratories determined that methanol has no effect on binding at the dat and sert. however, there is an effect of methanol on binding at the net, and therefore, the methanol concentration was controlled in all tubes in that assay. when compounds were not soluble in methanol, we used either ethanol or dmso at final concentrations of no greater than 5% or 6%, respectively. previous studies found no effect of either of these solvents at these concentrations on binding at any of the sites. for all three mat binding assays, incubations were terminated by rapid filtration through whatman gf / b filters, presoaked in 0.3% (sert) or 0.05% (dat, net) polyethylenimine, using a brandel r48 filtering manifold (brandel instruments, gaithersburg, md). the filters were washed twice with 5 ml of cold buffer and transferred to scintillation vials. cytoscint (mp biomedicals, solon, oh) (3.0 ml) was added, and the vials were counted the next day using a beckman 6000 liquid scintillation counter (beckman coulter instruments, fullerton, ca) or a tri - carb 2910-b liquid scintillation counter (perkin - elmer life sciences). the ki values for the modafinil derivatives were obtained using nonlinear least - squares regression (using graphpad prism software, graphpad software, inc., san diego, ca) of the displacement data, giving ic50 values, from which affinities (ki values) were calculated using the cheng prusoff equation. synthetic cdna encoding the human dat (syndat) was subcloned into pcdna3 (invitrogen, carlsbad, ca). cdna encoding the human sert (hsert) was cloned into the pubi1z expression vector. mutations herein were generated by the quickchange method (adapted from stratagene, la jolla, ca) and confirmed by restriction enzyme mapping and dna sequencing. positive clones were amplified by transformation into xl1 blue competent cells (stratagene), positive colony picked, and grown in lb media overnight at 37 c in an orbital incubator (infors) at 200 rpm. plasmids were harvested using the maxi prep kit provided by qiagen according to the manufacturer s manual. cos-7 cells were grown in dulbecco s modified eagle s medium 041 01885 supplemented with 10% fetal calf serum, 2 mm l - glutamine, and 0.01 mg / ml gentamicin at 37 c in 10% co2. wild - type and mutant constructs were transiently transfected into cos-7 cells with lipo2000 (invitrogen) according to the manufacturer s manual using cdna : lipo2000 ratios of 3:6 and 2:6 for hdat and hsert, respectively. uptake assays were performed essentially as previously described using [2,5,6,7,8-h](dihydroxyphenyl)ethylamine ([h]da ; 94.4 ci / mmol, perkin - elmer) or 5-[1,2-h(n)]hydroxytryptamine ([h]-5-ht ; 28 ci / mmol, perkin - elmer) for hdat- and hsert - expressing cells, respectively. transiently transfected cos-7 cells were plated in 12-well (3 10 cells / well) or 24-well (10 cells / well) dishes coated with polyornithine to achieve an uptake level of no more than 10% of the total added radioligand. prior to the experiment, the cells were washed once in 500 l of uptake buffer (25 mm hepes, 130 mm nacl, 5.4 mm kcl, 1.2 mm cacl2, 1.2 mm mgso4, 1 mm l - ascorbic acid, 5 mm d - glucose, and 1 m catechol o - methyltransferase inhibitor ro 41 - 0960 (sigma), ph 7.4) at room temperature. all the tested ligands were solubilized in dmso to obtain a stock concentration of 10 mm. from here the compounds were further diluted 10-fold in h2o, followed by consecutive dilutions in uptake buffer. the trace amounts of dmso (maximum 1% for the highest added concentration) did not influence the binding affinity (loland., unpublished experiments). the unlabeled ligand (e.g., modafinil [()-1 ] or analogues) was added to the cells in 10 concentrations from 1 nm to 0.1 mm equally distributed around the expected ic50 value, and uptake was initiated by addition of 10 nm radioligand in a final volume of 500 l. after 3 (for the hsert) or 5 (hdat) min of incubation, the reaction was stopped by rapid washing with 2 500 l of ice cold uptake buffer, lysed in 250 l (300 l for 12-well plates) of 1% sds, and left for 30 min at 37 c with gentle shaking. all samples were transferred to 24-well counting plates, and 500 l (or 600 l) of opti - phase hi safe 3 scintillation fluid (perkin - elmer) was added followed by counting of the plates in a wallac tri - lux -scintillation counter (perkin - elmer). nonspecific uptake was determined in the presence of 5 m paroxetine for hsert - expressing cells and 50 m nomifensine for hdat - expressing cells. uptake data were analyzed by nonlinear regression analysis using prism 5.0 from graphpad software. the ic50 values used in the estimation of km for uptake were calculated from the means of pic50 values and the se intervals from the pic50 se. the ki values were calculated from the ic50 values using the equation ki = ic50/(1 + (l / km)) (l = concentration of [h]da or [h]-5-ht). we docked the modafinil derivative compound 4h in our leut - based sert model. the preparation and md equilibration of the homology model of sert were previously described. the compound was constructed and prepared for docking using ligprep (schrodinger inc., docking of the compound was carried out with glide (schrodinger inc.). the binding modes shown in figure 2 were chosen on the basis of both the docking scores and the consistency with the ()-1 pose in the previously modeled dat()-1 complexes. a solution of 2-mercapto - n - methylacetamide (10 mmol) and diphenylmethanol, 3a, or the appropriate substituted diphenylmethanol, 3c or 3d (10 mmol), in trifluoroacetic acid (tfa ; 200 mmol) was stirred at room temperature (60 c for substituted analogues) for 20 h. the solvent was removed in vacuo, and the thick oily residue was washed with water (30 ml). after the water was decanted, a crude solid product was isolated by addition of diisopropyl ether (20 ml) to the oily residue and vigourous mixing. the crude solid was filtered and purified by flash column chromatography using 5% meoh / ch2cl2 to give the pure, desired product. step 1 : thioglycolic acid (1 mmol) was reacted with the appropriate substituted diphenylmethanol, 3e3i (1 mmol), in tfa (14 mmol) overnight at room temperature. after solvent removal in vacuo, the residue obtained was washed with water (5 ml) and hexanes (15 ml) to give the carboxylic acid product, which was carried to the next step without further purification. step 2 : the acid product (3 mmol) from step 1 was reacted with k2co3 (4.5 mmol) and iodomethane (ch3i ; 4.5 mmol) in acetone (50 ml) overnight under reflux conditions. after solvent removal in vacuo, the residue was suspended in water (20 ml) and extracted with ch2cl2 (3 20 ml). the combined organic layer was dried over mgso4 and concentrated to give the methyl ester, which was carried to the next step without further purification. step 3 : a mixture of the ester (3 mmol), nh4cl (4.2 mmol), concentrated nh4oh (28.030.0%, 20 ml), and meoh (5.7 ml) was stirred at 50 c for 72 h. meoh was removed in vacuo, and the reaction mixture was diluted with water (50 ml), extracted with ethyl acetate (3 50 ml), and dried over na2so4. the solvent was evaporated, and the recovered crude product was purified by flash column chromatography using 1:1 ethyl acetate / hexanes to afford the pure product. thioacetamides 4l, 4p, 4s, 4v, and 4w were synthesized in two steps according to a published procedure, while compounds 4j, 4k, 4m4o, 4q, 4r, 4 t, 4u, and 4x4z were synthesized in two steps with slight modifications to the published procedure in the second step. step 1 is the same as step 1 for procedure b. step 2 : cdi (11 mmol) was added to a solution of the carboxylic acid product (10 mmol) from step 1 in anhydrous thf (25 ml). the reaction mixture was stirred at room temperature for 2 h and then cooled to 0 c. water (0.10.2 ml) was added to the reaction mixture (to quench excess cdi), followed by the dropwise addition of the appropriate amine (10 mmol, dissolved in thf). the solvent was removed under vacuum to give a crude residue, which was dissolved in diethyl ether or ethyl acetate. the organic solution was washed with aqueous 1.0 m hcl solution (55 ml), water (80 ml), dilute aqueous nahco3 solution (36 ml, 1:6 dilution of saturated nahco3 solution), and water (2 30 ml). the organic layer was dried over mgso4 and concentrated in vacuo to give the pure product. the bromo - substituted analogues 4q, 4 t, 4x, and 4z required further purification by flash column chromatography as indicated. compound 4a was synthesized by stirring a solution of 2-mercaptoacetamide (0.63 g, 6.9 mmol ; recovered from the 10% (w / v) methanol / nh3 solution) and diphenylmethanol, 3a (1.3 g, 7.1 mmol), in tfa (11.9 g, 104 mmol) at room temperature for 4 h. the solvent was removed in vacuo, and the brown oily residue was dissolved in chcl3 (30 ml) and washed with water (30 ml), followed by a dilute nahco3 solution (30 ml, 1:3 dilution of saturated nahco3 solution) and water (30 ml). the crude product was purified by flash chromatography using 1:1 ethyl acetate / hexanes to give pure 4a (0.31 g, 17% yield) as a white solid. h nmr (cdcl3) : 7.41 (d, j = 7.6 hz, 4h), 7.33 (t, j = 7.4 hz, 4h), 7.25 (tt, j = 7.2, 1.4 hz, 2h), 6.50 (br s, 1h), 5.57 (br s, 1h), 5.17 (s, 1h), 3.09 (s, 2h). c nmr (cdcl3) : 171.2, 140.3, 128.9, 128.4, 127.8, 54.9, 35.7. (c15h15nos) c, h, n. compound 4b was synthesized according to general procedure b to give 4b (450 mg, 52% yield) as a yellow oil. h nmr (cdcl3) : 7.26 7.30 (m, 4h), 7.12 (d, j = 7.6 hz, 4h), 6.54 (br s, 1h), 5.53 (br s, 1h), 5.11 (s, 1h), 3.07 (s, 2h), 2.31 (s, 6h). compound 4c was synthesized according to general procedure b to give 4c (680 mg, 58% yield) as a white foam. h nmr (cdcl3) : 7.61 (d, j = 8.0 hz, 4h), 7.53 (d, j = 8.0 hz, 4h), 6.29 (br s, 1h), 5.72 (br s, 1h), 5.34 (s, 1h), 3.08 (s, 2h). compound 4d was synthesized according to general procedure b to give 4d (810 mg, 61% yield) as a yellow oil. h nmr (cdcl3) : 7.277.33 (m, 2h), 7.17 (d, j = 8.0 hz, 2h), 7.12 (dt, j = 10.0, 2.0 hz, 2h), 6.97 (td, j = 8.0, 2.4 hz, 2h), 6.43 (br s 1h), 6.09 (br s, 1h), 5.19 (s, 1h), 3.09 (s, 2h). compound 4e was synthesized according to general procedure b to give 4e (800 mg, 65% yield) as a yellow oil. h nmr (cdcl3) : 7.387.39 (m, 2h), 7.257.28 (m, 6h), 6.42 (br s, 1h), 6.05 (br s, 1h), 5.15 (s, 1h), 3.09 (s, 2h). c nmr (cdcl3) : 170.9, 141.6, 134.8, 130.1, 128.3, 128.1, 126.5, 53.4, 35.4. anal. (c15h13cl2nos) c, h, n. compound 4f was synthesized according to general procedure b to give 4f (750 mg, 58% yield) as a yellow oil. h nmr (cdcl3) : 7.577.58 (m, 1h), 7.317.39 (m, 6h), 7.257.29 (m, 1h), 7.18 (t, j = 7.8 hz, 1h), 6.49 (br s, 1h), 6.32 (br s, 1h), 5.16 (s, 1h), 3.07 (s, 2h). compound 4 g was synthesized using 2-mercapto - n - methylacetamide and diphenylmethanol, 3a, according to general procedure a. the product 4 g (3.5 g, 59% yield) was obtained as a white solid. h nmr (dmso - d6) : 7.86 (br s, 1h), 7.42 (d, j = 8.2 hz, 4h), 7.33 (t, j = 7.6 hz, 4h), 7.23 (t, j = 7.2 hz, 2h), 5.40 (s, 1h), 2.96 (s, 2h), 2.54 (sd, j = 4.7 hz, 3h). c nmr (dmso - d6) : 169.6, 142.2, 129.5, 128.9, 128.1, 54.0, 35.8, 26.7. (c16h17nos) c, h, n. compound 4h was synthesized using 2-mercapto - n - methylacetamide and bis(4-chlorophenyl)methanol, 3c, at 60 c according to general procedure a. the product 4h (2.12 g, 79% yield) was obtained as a white solid. h nmr (dmso - d6) : 7.87 (br s, 1h), 7.387.44 (m, 8h), 5.45 (s, 1h), 2.99 (s, 2h), 2.53 (sd, j = 4.7 hz, 3h). c nmr (dmso - d6) : 169.3, 140.8, 132.8, 130.8, 129.6, 52.4, 35.8, 26.6. (c16h15cl2nos) c, h, n. compound 4i was synthesized from 2-mercapto - n - methylacetamide and bis(4-bromophenyl)methanol, 3d, at 60 c according to general procedure a. the product 4i (1.86 g, 74% yield) was obtained as a white solid. h nmr (dmso - d6) : 7.86 (br s, 1h), 7.53 (dt, j = 8.4, 2.2 hz, 4h), 7.35 (dt, j = 8.4, 2.2 hz, 4h), 5.42 (s, 1h), 2.99 (s, 2h), 2.53 (sd, j = 4.8 hz, 3h). c nmr (dmso - d6) : 168.3, 140.2, 131.5, 130.2, 120.4, 51.6, 34.9, 25.7. anal. (c16h15br2nos) c, h, n. compound 4j was synthesized from 2-(benzhydrylthio)acetic acid and allylamine according to the modified general procedure c. the product 4j (1.97 g, 86% yield) was obtained as a viscous yellow oil that solidified over time. h nmr (cdcl3) : 7.40 (d, j = 7.2 hz, 4h), 7.32 (t, j = 7.4 hz, 4h), 7.25 (t, j = 8.0 hz, 2h), 6.67 (br s, 1h), 5.775.86 (m, 1h), 5.19 (d, jtrans = 17.6 hz, 1h), 5.15 (d, jcis = 10.6 hz, 1h), 5.13 (s, 1h), 3.84 (tt, j = 5.6, 1.6 hz), 3.14 (s, 2h). c nmr (cdcl3) : 168.0, 140.3, 133.8, 128.8, 128.2, 127.6, 116.8, 55.1, 42.1, 36.1. (c18h19nos) c, h, n. compound 4k was synthesized from 2-(benzhydrylthio)acetic acid and propylamine according to the modified general procedure c. the product 4k (1.05 g, 91% yield) was obtained as a yellow oil that solidified over time. h nmr (cdcl3) : 7.39 (d, j = 7.6 hz, 4h), 7.32 (tt, j = 7.2, 1.6 hz, 4h), 7.24 (t, j = 7.2 hz, 2h), 6.64 (br s, 1h), 5.11 (s, 1h), 3.18 (q, j = 6.8 hz, 2h), 3.11 (s, 2h), 1.471.56 (m, 2h), 0.93 (t, j = 7.4 hz, 3h). c nmr (cdcl3) : 168.2, 140.5, 128.9, 128.4, 127.7, 55.2, 41.6, 36.3, 22.9, 11.5. (c18h21nos) c, h, n. compound 4l was synthesized from 2-((bis(4-fluorophenyl)methyl)thio)acetic acid and propylamine according to general procedure c. the product 4l (320 mg, 95% yield) was obtained as a white solid. h nmr (cdcl3) : 7.327.37 (m, 4h), 6.99 7.05 (m, 4h), 6.55 (br s, 1h), 5.14 (s, 1h), 3.20 (q, j = 6.6 hz, 2h), 3.07 (s, 2h), 1.481.58 (m, 2h), 0.94 (t, j = 7.4 hz, 3h). c nmr (cdcl3) : 168.0, 162.1 (jcf = 247 hz), 136.0 (jcf = 3.7 hz), 129.8 (jcf = 8.1 hz), 115.7 (jcf = 21.4 hz), 53.2, 41.5, 36.0, 22.8, 11.4. (c18h19f2nos) c, h, n. compound 4 m was synthesized from 2-((bis(4-chlorophenyl)methyl)thio)acetic acid and propylamine according to the modified general procedure c. the product 4 m (2.06 g, 91% yield) was obtained as a viscous yellow oil that solidified over time. h nmr (cdcl3) : 7.30 (s, 8h), 6.34 (br s, 1h), 5.11 (s, 1h), 3.20 (q, j = 6.8 hz, 2h), 3.07 (s, 2h), 1.481.57 (m, 2h), 0.93 (t, j = 7.4 hz, 3h). c nmr (cdcl3) : 168.0, 138.6, 133.8, 129.7, 129.2, 53.6, 41.7, 36.1, 22.9, 11.5. (c18h19cl2nos) c, h, n. compound 4n was synthesized from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and propylamine according to the modified general procedure c. the product 4n (1.75 g, 80% yield) was obtained as a light yellow solid. h nmr (cdcl3) : 7.45 (d, j = 8.8 hz, 4h), 7.24 (d, j = 8.8 hz, 4h), 6.41 (br s, 1h), 5.08 (s, 1h), 3.19 (q, j = 6.8 hz, 2h), 3.07 (s, 2h), 1.471.56 (m, 2h), 0.93 (t, j = 7.2 hz, 3h). c nmr (cdcl3) : 168.0, 139.1, 132.1, 130.0, 121.9, 53.7, 41.7, 36.1, 22.9, 11.5. (c18h19br2nos) c, h, n. compound 4o was synthesized from 2-(benzhydrylthio)acetic acid and cyclopropylmethylamine according to the modified general procedure c. the product 4o (0.25 g, 94% yield) was obtained as a yellow oil. h nmr (cdcl3) : 7.41 (d, j = 7.6 hz, 4h), 7.33 (tt, j = 7.4, 1.9 hz, 4h), 7.25 (tt, j = 7.4, 1.7 hz, 2h), 6.73 (br s, 1h), 5.14 (s, 1h), 3.12 (s, 2h), 3.09 (dd, j = 7.2, 5.6 hz, 2h), 0.901.00 (m, 1h), 0.53 (q, j = 6.4 hz, 2h), 0.22 (q, j = 5.2 hz, 2h). c nmr (cdcl3) : 168.1, 140.5, 128.9, 128.4, 127.7, 55.1, 44.7, 36.3, 10.8, 3.6. (c19h21nos) c, h, n. compound 4p was synthesized from 2-((bis(4-fluorophenyl)methyl)thio)acetic acid and cyclopropylmethylamine according to general procedure c. the product 4p (320 mg, 92% yield) was obtained as a white solid. h nmr (cdcl3) : 7.35 (dd, j = 8.8, 5.2 hz, 4h), 6.997.05 (m, 4h), 6.58 (br s, 1h), 5.16 (s, 1h), 3.11 (dd, j = 7.0, 5.4 hz, 2h), 3.08 (s, 2h), 0.911.01 (m, 1h), 0.520.56 (m, 2h), 0.23 (q, j = 5.0 hz, 2h). c nmr (cdcl3) : 167.9, 162.1 (jcf = 248 hz), 136.0 (jcf = 3.0 hz), 129.8 (jcf = 8.1 hz), 115.7 (jcf = 21.4 hz), 53.3, 44.6, 36.0, 10.7, 3.4. (c19h19f2nos) c, h, n. compound 4q was synthesized from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and cyclopropylmethylamine according to the modified general procedure c. purification by flash column chromatography using 1:1 ethyl acetate / hexanes gave the pure product 4q (1.08 g, 94% yield) as a white solid. h nmr (cdcl3) : 7.49 (dt, j = 8.8, 2.2 hz, 4h), 7.25 (dt, j = 8.4, 2.4 hz, 4h), 6.56 (br s, 1h), 5.12 (s, 1h), 3.09 (dd, j = 7.2, 5.6 hz, 2h), 3.07 (s, 2h), 0.880.97 (m, 1h), 0.53 (q, j = 6.6 hz, 2h), 0.21 (q, j = 5.2 hz, 2h). c nmr (cdcl3) : 167.9, 139.0, 132.0, 130.0, 121.8, 53.5, 44.6, 35.9, 10.7, 3.5. (c19h19br2nos/4c4h8o2) c, h, n. compound 4r was synthesized from 2-(benzhydrylthio)acetic acid and n - butylamine according to the modified general procedure c. the product 4r (264 mg, 87% yield) was obtained as a yellow oil. h nmr (cdcl3) : 7.39 (d, j = 7.2 hz, 4h), 7.32 (t, j = 7.4 hz, 4h), 7.24 (tt, j = 7.2, 1.7 hz, 2h), 6.64 (br s, 1h), 5.11 (s, 1h), 3.21 (q, j = 6.7 hz, 2h), 3.10 (s, 2h), 1.431.51 (m, 2h), 1.301.39 (m, 2h), 0.93 (t, j = 7.2 hz, 3h). c nmr (cdcl3) : 168.2, 140.5, 128.9, 128.3, 127.7, 55.1, 39.6, 31.7, 20.2, 13.9. (c19h23nos) c, h, n. compound 4s was synthesized from 2-((bis(4-fluorophenyl)methyl)thio)acetic acid and n - butylamine according to general procedure c. the product 4s (350 mg, 100%) was obtained as a white solid. h nmr (cdcl3) : 7.34 (dd, j = 8.8, 5.2 hz, 4h), 6.997.05 (m, 4h), 6.49 (br s, 1h), 5.13 (s, 1h), 3.24 (q, j = 6.6 hz, 2h), 3.07 (s, 2h), 1.451.52 (m, 2h), 1.311.40 (m, 2h), 0.94 (t, j = 7.2 hz, 3h). c nmr (cdcl3) : 167.9, 162.1 (jcf = 247 hz), 136.0 (jcf = 3.7 hz), 129.8 (jcf = 8.1 hz), 115.7 (jcf = 21.4 hz, 4c), 53.3, 39.5, 36.0, 31.6, 20.1, 13.7. (c19h21f2nos) c, h, n. compound 4 t was synthesized from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and n - butylamine according to the modified general procedure c. purification by flash column chromatography using 10% meoh / chcl3 gave the pure product 4 t (0.50 g, 88% yield) as a yellow oil. h nmr (cdcl3) : 7.45 (dt, j = 8.4, 2.0 hz, 4h), 7.24 (dt, j = 8.8, 2.4 hz, 4h), 6.40 (br s, 1h), 5.07 (s, 1h), 3.22 (q, j = 6.8 hz, 2h), 3.07 (s, 2h), 1.431.51 (m, 2h), 1.301.39 (m, 2h), 0.94 (t, j = 7.2 hz, 3h). c nmr (cdcl3) : 167.9, 139.1, 132.1, 130.0, 121.9, 53.7, 39.7, 36.1 31.7, 20.2, 13.9. (c19h21br2nos) c, h, n. compound 4u was synthesized as previously described from 2-(benzhydrylthio)acetic acid and 3-phenyl-1-propylamine according to the modified general procedure c. purification on a teledyne isco combiflash rf instrument using 1:1 ethyl acetate / hexanes gave the pure product 4u (1.66 g, 94% yield) as a white solid. h nmr (cdcl3) : 7.377.39 (m, 4h), 7.287.33 (m, 6h), 7.167.27 (m, 5h), 6.61 (br s, 1h), 5.10 (s, 1h), 3.24 (q, j = 6.8 hz, 2h), 3.09 (s, 2h), 2.64 (t, j = 7.6 hz, 2h), 1.781.86 (m, 2h). c nmr (cdcl3) : 168.3, 141.3, 140.5, 128.9, 128.6, 128.5, 128.3, 127.7, 126.2, 55.2, 39.5, 36.3, 33.4, 31.2. (c24h25nos) c, h, n. compound 4v was synthesized from 2-((bis(4-fluorophenyl)methyl)thio)acetic acid and 3-phenyl-1-propylamine according to general procedure c. the product 4v (1.2 g, 100%) was obtained as a yellow oil. h nmr (cdcl3) : 7.267.35 (m, 6h), 7.167.22 (m, 3h), 6.987.04 (m, 4h), 6.48 (br s, 1h), 5.12 (s, 1h), 3.27 (q, j = 6.8 hz, 2h), 3.04 (s, 2h), 2.66 (t, j = 7.8 hz, 2h), 1.811.88 (m, 2h). c nmr (cdcl3) : 168.0, 162.1 (jcf = 247 hz), 141.1, 135.9 (jcf = 2.9 hz), 129.8 (jcf = 8.1 hz), 128.4 (jcf = 21.4 hz), 126.1, 115.8, 115.6, 53.3, 39.4, 36.0, 33.2, 31.1. (c24h23f2nos) c, h, n. compound 4w was synthesized as previously described from 2-((bis(4-chlorophenyl)methyl)thio)acetic acid and 3-phenyl-1-propylamine according to general procedure c. the product 4w (1 g, 75%) was obtained as a yellow oil. h nmr(cdcl3) : 7.157.31 (m, 13h), 6.38 (br s, 1h), 5.09 (s, 1h), 3.26 (q, j = 6.6 hz, 2h), 3.04 (s, 2h), 2.65 (t, j = 7.6 hz, 2h), 1.801.87 (m, 2h). c nmr (cdcl3) : 167.9, 141.1, 138.4, 133.6, 129.5, 129.0, 128.5, 128.3, 126.1, 53.4, 39.4, 35.9, 33.2, 31.0. (c24h23cl2nos) c, h, n. compound 4x was synthesized as previously described from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and 3-phenyl-1-propylamine according to the modified general procedure c. purification by flash column chromatography using 7:3 ethyl acetate / hexanes and trituration in boiling diisopropyl ether gave the pure product 4x (1.94 g, 76% yield) as a white solid. h nmr (dmso - d6) : 7.97 (t, j = 5.4 hz, 1h), 7.52 (dt, j = 8.8, 2.2 hz, 4h), 7.35 (dt, j = 8.8, 2.3 hz, 4h), 7.26 (t, j = 7.6 hz, 2h), 7.17 (d, j = 7.6 hz, 2h), 7.157.18 (m, 1h), 5.42 (s, 1h), 2.993.04 (m, 4h), 2.55 (t, j = 7.8 hz, 2h), 1.621.70 (m, 2h). c nmr (dmso - d6) : 168.9, 142.5, 141.1, 132.5, 131.1, 129.2, 126.7, 121.4, 52.6, 52.5, 39.3, 35.9, 33.4, 31.6. (c24h23br2nos) c, h, n. compound 4y was synthesized from 2-(benzhydrylthio)acetic acid and 4-phenyl-1-butylamine according to the modified general procedure c. the product 4y (0.73 g, 96% yield) was obtained as a yellow oil. h nmr (cdcl3) : 7.357.38 (m, 4h), 7.287.32 (m, 6h), 7.167.26 (m, 5h), 6.61 (br s, 1h), 5.08 (s, 1h), 3.22 (q, j = 6.7 hz, 2h), 3.10 (s, 2h), 2.64 (t, j = 7.4 hz, 2h), 1.611.69 (m, 2h), 1.481.55 (m, 2h). c nmr (cdcl3) : 168.2, 142.1, 140.4, 128.9, 128.52, 128.50, 128.3, 127.7, 126.0, 55.2, 39.7, 36.2, 35.6, 29.2, 28.8. (c25h27nos) c, h, n. compound 4z was synthesized from 2-((bis(4-bromophenyl)methyl)thio)acetic acid and 4-phenyl-1-butylamine according to the modified general procedure c. purification by flash column chromatography using 1:1 ethyl acetate / hexanes gave the pure product 4z (1.2 g, 90% yield) as a yellow oil. h nmr (cdcl3) : 7.43 (dt, j = 8.0, 2.3 hz, 4h), 7.28 (t, j = 7.4 hz, 2h), 7.20 (d, j = 8.4 hz, 4h), 7.157.19 (m, 3h), 6.39 (br s, 1h), 5.04 (s, 1h), 3.23 (q, j = 6.7 hz, 2h), 3.05 (s, 2h), 2.64 (t, j = 7.6 hz, 2h), 1.611.69 (m, 2h), 1.481.55 (m, 2h). c nmr (cdcl3) : 168.0, 142.0, 139.0, 132.1, 130.0, 128.54, 128.52, 126.1, 121.9, 53.6, 39.8, 36.0, 35.6, 29.2, 28.8. briefly, h2o2 (0.11 ml, 1.1 mmol, 1 equiv) was added to a solution of compound 4b (310 mg, 1.1 mmol, 1 equiv) in a solvent mixture of acetic acid (1.1 ml) and meoh (3.3 ml). the solvent was removed in vacuo, and the isolated crude residue was purified by flash column chromatography using a gradient solvent system, viz., 1:1 ethyl acetate / ch2cl2 to 5% meoh / ch2cl2. the pure product 5a (310 mg, 72%) was obtained as a white solid. h nmr (cdcl3) : 7.36 (d, j = 8.2 hz, 2h), 7.30, (d, j = 8.2 hz, 2h), 7.20 (sd, j = 3.7 hz, 4h), 7.12 (br s, 1h), 5.72 (br s, 1h), 5.12 (s, 1h), 3.46 (d, j = 14.8 hz, 1h), 3.10 (d, j = 14.4 hz, 1h), 2.34 (s, 6h). c nmr (cdcl3) : 166.4, 138.8, 138.5, 131.3, 131.2, 130.1, 129.6, 129.2, 128.6, 71.2, 51.2, 21.1 (c17h19no2s/2h2o) c, h, n. compound 5b was synthesized as described for 5a using compound 4c (680 mg, 1.73 mmol) to give the product 5b (510 mg, 72%) as a white solid. h nmr (cdcl3) : 7.70 (dd, j = 8.0, 6.0 hz, 4h), 7.60 (dd, j = 8.6, 2.6 hz, 4h), 6.70 (br s, 1h), 5.71 (br s, 1h), 5.40 (s, 1h), 3.56 (d, j = 14.0 hz, 1h), 3.12 (d, j = 14.2 hz, 1h). c nmr (cdcl3) : 165.3, 137.8, 137.0, 131.4 (jcf = 33.2 hz), 131.2 (jcf = 33.2 hz), 129.9, 129.3, 126.6 (jcf = 3.7 hz), 126.0 (jcf = 3.7 hz), 123.8 (jcf = 272 hz), 123.6 (jcf = 273 hz), 69.6, 51.8. (c17h13f6no2s/2h2o) c, h, n. compound 5c was synthesized as described for 5a using compound 4d (810 mg, 2.76 mmol) to give the product 5c (600 mg, 70%) as a white solid. h nmr (cdcl3) : 7.347.42 (m, 2h), 7.147.27 (m, 4h), 7.047.10 (m, 2h), 6.98 (br s, 1h), 6.18 (br s, 1h), 5.33 (s, 1h), 3.49 (d, j = 13.6 hz, 1h), 3.23 (d, j = 14.0 hz, 1h). c nmr (cdcl3) : 166.0, 163.0 (jcf = 248 hz), 162.8 (jcf = 248 hz), 136.5, 135.8, 131.2 (jcf = 8.1 hz), 130.5 (jcf = 8.1 hz), 125.3, 124.5 (jcf = 3.0 hz), 116.5 (jcf = 22.8 hz), 115.9 (jcf = 22.1 hz), 69.7, 52.2. (c15h13f2no2s) c, h, n. compound 5d was synthesized as described for 5a using compound 4e (800 mg, 2.45 mmol) to give the product 5d (600 mg, 71%) as a white solid. h nmr (cdcl3) : 7.437.43 (m, 2h), 7.317.37 (m, 6h), 7.05 (br s, 1h), 6.36 (br s, 1h), 5.36 (s, 1h), 3.47 (d, j = 13.6 hz, 1h), 3.27 (d, j = 13.6 hz, 1h). c nmr (cdcl3) : 166.3, 136.3, 135.6, 135.4, 134.8, 130.8, 130.2, 129.6, 129.2, 129.0, 128.8, 127.7, 126.9, 69.4, 52.9. (c15h13cl2no2s) c, h, n. compound 5e was synthesized as described for 5a using compound 4f (750 mg, 2.23 mmol) to give the product 5e (540 mg, 69%) as a white solid. h nmr (dmso - d6) : 7.657.69 (m, 2h), 7.487.57 (m, 4h), 7.307.43 (m, 5h), 5.36 (s, 1h), 3.39 (d, j = 13.6 hz, 1h), 3.20 (d, j = 13.6 hz, 1h). c nmr (dmso - d6) : 166.2, 137.4, 136.7, 132.2, 130.8, 130.6, 129.7, 129.1, 128.7, 128.6, 128.4, 128.1, 121.6, 67.5, 56.4. (c15h14brno2s) c, h, n. compound 5f was synthesized as described for 5a using compound 4 g (500 mg, 1.84 mmol) to give the product 5f (427 mg, 81%) as a yellow oil. h nmr (cdcl3) : 7.357.49 (m, 10h), 7.02 (br s, 1h), 5.18 (s, 1h), 3.44 (d, j = 14.0 hz, 1h), 3.13 (d, j = 14.0 hz, 1h), 2.82 (sd, j = 4.7 hz, 3h). c nmr (cdcl3) : 164.9, 134.9, 134.2, 129.7, 129.6, 129.13, 129.08, 129.01, 128.9, 71.7, 52.3, 26.7. (c16h17no2s/4h2o) c, h, n. compound 5 g was synthesized as described for 5a using compound 4x (220 mg, 0.41 mmol) to give the product 5 g (100 mg, 44%) as a colorless oil. h nmr (cdcl3) : 7.517.55 (m, 4h), 7.167.31 (m, 9h), 6.69 (t, j = 5.4 hz, 1h), 5.13 (s, 1h), 3.42 (d, j = 14.0 hz, 1h), 3.33 (q, j = 7.0 hz, 2h), 3.05 (d, j = 14.0 hz, 1h), 2.67 (t, j = 7.8 hz, 2h), 1.851.89 (m, 2h). c nmr (cdcl3) : 163.7, 141.3, 133.4, 132.9, 132.5, 132.3, 131.3, 130.7, 128.7, 128.6, 126.3, 123.53, 123.47, 69.7, 52.4, 39.7, 33.4, 31.2. compounds 6a6c were synthesized following a literature procedure. a solution of cysteamine hydrochloride (10 mmol), diphenylmethanol, 3a, or the appropriate halogen - substituted diphenylmethanol, 3c or 3d (10 mmol), and bf3oet2 (11 mmol) in glacial acetic acid (40 ml) was stirred at 9095 c for 20 min (4050 min for substituted analogues). the reaction mixture was cooled to room temperature, and diethyl ether (200 ml) was added to precipitate a solid (the hydrochloride salt) from the mixture. the solid was filtered and dried under vacuum for 3 days in the presence of naoh pellets. the dried solid was dissolved in hot ethanol and filtered and the solvent removed in vacuo. finally, the solid was triturated in hot (boiling) ethyl acetate to give the pure product as the hydrochloride salt. compound 6a was synthesized from diphenylmethanol, 3a, according to general procedure d to give the hydrochloride salt in quantitative yield. the hydrochloride salt of 6a (10.1 g, 36.1 mmol) was converted to the free base by being dissolved in saturated aqueous nahco3 solution (120 ml) and extracted into chcl3 (150 ml). the layers were separated, and the organic layer was washed with distilled water (80 ml) and aqueous brine solution (100 ml) and dried over mgso4. the solvent was evaporated in vacuo to give the free base 6a (7.90 g, 90% yield) as a yellow oil. h nmr (cdcl3) : 7.43 (d, j = 8.0 hz, 4h), 7.31 (t, j = 7.4 hz, 4h), 7.22 (tt, j = 7.4, 1.5 hz, 2h), 5.16 (s, 1h), 2.81 (t, j = 6.2 hz, 2h), 2.51 (t, j = 6.4 hz, 2h). c nmr (cdcl3) : 141.5, 128.7, 128.4, 127.4, 54.0, 41.0, 36.7. (c15h17ns/4c2h2o4) c, h, n. compound 6b was synthesized from bis(4-chlorophenyl)methanol, 3c, according to general procedure d with a reaction time of 50 min. the hydrochloride salt product 6b (1.06 g, 62% yield) h nmr (hcl salt, dmso - d6) : 8.12 (br s, 3h), 7.48 (d, j = 8.4 hz, 4h), 7.42 (d, j = 8.8 hz, 4h), 5.56 (s, 1h), 2.94 (t, j = 7.6 hz, 2h), 2.60 (t, j = 7.2 hz, 2h). c nmr (hcl salt, dmso - d6) : 139.9, 132.0, 129.9, 128.7, 50.2, 38.0, 28.6. anal. (c15h15cl2ns/4hcl/4h2o) c, h, n. compound 6c was synthesized from bis(4-bromophenyl)methanol, 3d, according to general procedure d with a reaction time of 40 min. the hydrochloride salt product 6c (4.15 g, 72% yield) h nmr (hcl salt, dmso - d6) : 8.09 (br s, 3h), 7.55 (dt, j = 8.4, 2.3 hz, 4h), 7.41 (dt, j = 8.8, 2.2 hz, 4h), 5.53 (s, 1h), 2.94 (t, j = 7.4 hz, 2h), 2.59 (t, j = 7.4 hz, 2h). c nmr (hcl salt, dmso - d6) : 140.2, 131.6, 130.2, 120.5, 50.2, 37.9, 28.5. (c15h15br2nshcl) c, h, n. compound 6d was synthesized according to general procedure d starting with compound 6a. a suspension of the hydrochloride salt of 6a (1.0 g, 3.6 mmol) and cyclopropanecarboxaldehyde (0.28 g, 4.0 mmol) in 1,2-dichloroethane (62 ml) was stirred at room temperature under an argon atmosphere for 1.3 h. sodium cyanoborohydride (0.69 g, 11 mmol) dissolved in methanol (2.0 ml) was added to the reaction mixture, and the mixture was stirred at room temperature under an argon atmosphere overnight. after 19 h of reaction time, saturated nahco3 solution (30 ml), distilled water (30 ml), and ch2cl2 (15 ml) were added to the reaction mixture, and the resulting mixure was stirred vigorously for 1 h. the layers were separated, and the aqueous layer was washed with ch2cl2 (3 25 ml). the combined ch2cl2 extract was washed with water (50 ml), dried over mgso4, and concentrated in vacuo to give a crude product. the isolated crude was purified by flash column chromatography using an ethyl acetate / hexanes solvent gradient (from 4:1 to 1:4) to give the free base 6d (0.50 g, 47% yield) as a yellow oil. some of the isolated free base was converted into the hydrochloride salt in chcl3 using a 1.0 m hcl in ether solution. h nmr (cdcl3) : 7.42 (d, j = 7.4 hz, 4h), 7.30 (t, j = 7.4 hz, 4h), 7.22 (tt, j = 7.2, 1.6 hz, 2h), 5.17 (s, 1h), 2.76 (t, j = 6.4 hz, 2h), 2.59 (t, j = 6.6 hz, 2h), 2.40 (d, j = 6.8 hz, 2h), 0.810.97 (m, 1h), 0.440.48 (m, 2h), 0.09 (qd, j = 4.8, 1.2 hz, 2h). c nmr (cdcl3) : 141.6, 128.7, 128.4, 127.3, 54.7, 54.3, 48.1, 32.9, 11.4, 3.5. (c19h23nshcl/4h2o) c, h, n. compound 6e was synthesized by adapting a literature procedure using compound 6a (general procedure d). a mixture of csohh2o (0.29 g, 1.7 mmol) and activated 4 molecular sieves (0.52 g) in anhydrous dmf (8.3 ml, freshly distilled and stored over activated 4 molecular sieves) was purged of air under vacuum and flushed with argon gas. after the mixture was stirred for 13 min, the free base of compound 6a (0.41 g, 1.7 mmol), dissolved in anhydrous dmf (4.0 ml), was added. the reaction mixture was stirred under vacuum for 25 min and flushed with argon for 5 min, and n - butyl bromide (0.28 g, 2.04 mmol) was added. this was followed by another 10 min of vacuum purging, and the reaction was left to stir overnight at room temperature. the reaction mixture was filtered after 20 h of reaction time, and the undissolved solids were washed with ethyl acetate. the filtrate was evaporated in vacuo to give a liquid residue, which was taken up in aqueous 1 m naoh (30 ml) and extracted with ethyl acetate (2 25 ml). the organic extract was washed with brine (50 ml), dried over a 1:1 na2so4/mgso4 mixture, and concentrated in vacuo. the crude product was purified by flash column chromatography using 5% diethyl ether / hexanes (with 0.5% net3) to give the free base 6e (0.22 g, 44% yield) as a yellow oil. h nmr (cdcl3) : 7.42 (d, j = 7.2 hz, 4h), 7.30 (t, j = 7.6 hz, 4h), 7.22 (tt, j = 7.2, 1.6 hz, 2h), 5.17 (s, 1h), 2.74 (t, j = 6.4 hz, 2h), 2.58 (t, j = 6.2 hz, 2h), 2.53 (t, j = 7.2 hz, 2h), 1.401.47 (m, 2h), 1.271.37 (m, 2h), 0.90 (t, j = 7.6 hz, 3h). c nmr (cdcl3) : 141.6, 128.7, 128.4, 127.3, 54.2, 49.3, 48.3, 32.8, 32.3, 20.6, 14.1. (c19h25nsc2h2o4) c, h, n. compound 6f was synthesized from compound 4u. briefly, sulfuric acid (98% ; 305 mg, 3.11 mmol) in thf (8.0 ml) was added dropwise at 0 c to lialh4 (227 mg, 5.99 mmol) in thf (13 ml), and the mixture was stirred for 15 min at room temperature. compound 4u (563 mg, 1.50 mmol) in thf (11 ml) was added dropwise to the reduction mixture at room temperature and the resulting mixture stirred overnight. the reaction mixture was cooled to 0 c and quenched with water (5.0 ml) and 10% naoh (20 ml) successively. the mixture was filtered, the insolubles were washed with thf, and the filtrate was evaporated to dryness. the crude product was purified on a teledyne isco combiflash rf instrument using 97:3:0.03 chcl3/meoh / nh4oh to give the pure product 6f (312 mg, 58%) as a yellow oil. h nmr (cdcl3) : 7.42 (d, j = 7.6 hz, 4h), 7.277.32 (m, 6h), 7.167.23 (m, 5h), 5.16 (s, 1h), 2.73 (t, j = 6.4 hz, 2h), 2.63 (t, j = 7.8 hz, 2h), 2.542.58 (m, 4h), 1.741.82 (m, 2h). c nmr (cdcl3) : 142.2, 141.6, 128.7, 128.53, 128.47, 128.4, 127.4, 125.9, 54.2, 49.1, 48.3, 33.7, 32.8, 31.8. (c24h27ns c2h2o4) c, h, n. compound 6 g was synthesized as described for compound 6f using compound 4v, except that the reaction mixture was stirred at room temperature for 2 h (instead of overnight) before being quenched with water and naoh (15% instead of 10%).the crude product was purified by flash column chromatography (95:5:0.5 chcl3/meoh / nh4oh) to give the pure product 6 g (820 mg, 86.6%) as a yellow oil. the free base was converted to the oxalate salt, which was recrystallized from a methanol / acetone mixture. h nmr (cdcl3) : 7.337.37 (m, 4h), 7.167.30 (m, 5h), 6.977.02 (m, 4h), 5.13 (s, 1h), 2.72 (t, j = 6.4 hz, 2h), 2.64 (t, j = 7.8 hz, 2h), 2.52 (m, 4h), 1.751.82 (m, 2h). c nmr (cdcl3) : 161.9 (jcf = 246 hz), 142.0, 137.0 (jcf = 3.0 hz), 129.7 (jcf = 8.1 hz), 128.4, 125.8, 115.5 (jcf = 21.4 hz, 4c), 52.5, 48.8, 48.0, 33.6, 32.6, 31.6. (c24h25f2nsc2h2o4) c, h, n. compound 6h was synthesized as described for 6 g using compound 4w (1 g, 2.2 mmol). the crude product 6h (850 mg) was obtained as a yellow oil and carried to the next step without further purification. a solution of 1 m bh3thf complex (14 ml, 14.0 mmol) was added slowly (in two aliquots) to a solution of compound 4x (1.50 g, 2.81 mmol) in freshly distilled thf (15 ml) at 2 c. the reaction mixture was refluxed for 16 h, cooled to 0 c, quenched with ch3oh (30 ml), saturated with aqueous hcl (5.0 ml of concentrated hcl (37%)), and refluxed for another 23 h, successively. the solvent was removed in vacuo to give a yellow, oily residue which was taken up in chcl3 (50 ml) and washed with distilled water (2 50 ml). the combined aqueous extract was back - washed with chcl3 (3 30 ml) and then discarded. the combined chcl3 extract was washed with water (100 ml) and brine (100 ml) and concentrated in vacuo to give the hydrochloride salt of 6i. the salt was suspended in a small amount of water and the suspension made basic to a ph of 13 with 10 m naoh (20 ml). the basic solution was continuously extracted with chcl3 for 6 h, and the layers were separated. solvent was removed from the organic layer to give the crude free base of compound 6i, which was purified by flash column chromatography (5% meoh / ch2cl2). the pure product 6i (0.58 g, 40% yield) was obtained as a yellow oil and converted to the oxalate salt. h nmr (cdcl3) : 7.43 (dt, j = 8.4, 2.3 hz, 4h), 7.237.30 (m, 6h), 7.167.20 (m, 3h), 5.07 (s, 1h), 2.74 (t, j = 6.6 hz, 2h), 2.64 (t, j = 7.6 hz, 2h), 2.532.29 (m, 4h), 1.771.83 (m, 2h). c nmr (cdcl3) : 142.1, 140.1, 131.9, 131.6, 130.0, 128.5, 126.0, 121.5, 53.0, 49.0, 48.3, 33.7, 32.7, 31.7. briefly, a solution of sodium periodate (naio4 ; 2.25 g, 10.5 mmol) in water (50 ml) was added in a dropwise manner to a solution of the hydrochloride salt of compound 6a (2.80 g, 10.0 mmol) in ethanol (150 ml) at 0 c. the reaction was allowed to stir and warm to room temperature for 20 h under an argon atmosphere. the reaction mixture, which contained a white precipitate, was cooled in an ice bath and filtered. the filtrate was concentrated in vacuo to give a dark yellow, oily residue. the oily residue (the hydrochloride salt) was dissolved in chcl3, washed with an aqueous nahco3 solution (2:3 dilution in water of saturated nahco3 solution), distilled water, and aqueous brine, and dried over na2so4, successively. after filtration, solvent was removed in vacuo to give the crude, free base of compound 7a. the crude product was purified by flash column chromatography using a meoh / chcl3 (with 0.1% nh4oh) gradient (from 0% to 1% meoh) to give pure 7a (1.12 g, 43% yield) as a yellow oil. h nmr (cdcl3) : 7.50 (d, j = 7.8 hz, 2h), 7.317.44 (m, 8h), 4.90 (s, 1h), 3.103.23 (m, 2h), 2.532.65 (m, 2h). c nmr (cdcl3) : 135.8, 135.2, 129.4, 128.9, 128.7, 128.5, 128.4, 73.1, 54.4, 36.5. (c15h17nosc2h2o4) c, h, n. compound 7b was synthesized as described for 7a from compound 6e (0.070 g, 0.23 mmol) and naio4 (0.053 g, 0.25 mmol) in an ethanol / water (etoh / h2o) mixture (4.0 ml/1.2 ml, v / v). the pure free base product 7b (0.020 g, 41% yield) was obtained as a yellow oil after purification of the crude by flash column chromatography using a meoh / chcl3 (with 0.1% nh4oh) gradient (from 0% to 2% meoh). h nmr (cdcl3) : 7.49 (d, j = 7.6 hz, 2h), 7.307.44 (m, 8h), 4.92 (s, 1h), 2.993.13 (m, 2h), 2.65 (t, j = 5.8 hz, 2h), 2.56 (t, j = 7.0 hz, 2h), 1.401.47 (m, 2h), 1.271.36 (m, 2h), 0.89 (t, j = 7.4 hz, 3h). 129.44, 129.42, 128.9, 128.8, 128.49, 128.44, 73.0, 51.1, 49.6, 43.6, 32.1, 20.5, 14.1. (c19h25nosc2h2o4/2h2o) c, h, n. compound 7c was synthesized as described for compound 5a using 6 g (900 mg, 2.27 mmol). the free base product 7c (820 mg, 87.5% yield) was obtained as a yellow oil and converted into the oxalate salt, which was recrystallized from a methanol / acetone mixture. h nmr (cdcl3) : 7.377.44 (m, 4h), 7.057.29 (m, 9h), 5.00 (s, 1h), 3.163.22 (m, 1h), 3.043.11 (m, 1h), 2.602.83 (m, 6h), 1.801.88 (m, 2h). c nmr (cdcl3) : 162.8 (jcf = 248 hz), 162.6 (jcf = 249 hz), 141.1, 131.0 (jcf = 8.1 hz), 130.3 (jcf = 8.1 hz), 130.1 (jcf = 3.7 hz), 128.4, 128.3, 126.0, 116.4 (jcf = 21.4 hz), 115.8 (jcf = 21.4 hz), 70.6, 48.7, 48.4, 43.1, 33.1, 30.1. (c24h25f2nosc2h2o4) c, h, n. compound 7d was synthesized as described for compound 5a using 6h (850 mg, 1.97 mmol). the free base product 7d (640 mg, two steps yield 72.6%) was obtained as a yellow oil and converted into the oxalate salt, which was recrystallized from hot meoh. h nmr (cdcl3) : 7.157.39 (m, 13h), 4.88 (s, 1h), 2.993.08 (m, 2h), 2.572.65 (m, 6h), 1.751.82 (m, 2h). c nmr (cdcl3) : 141.9, 134.7, 134.6, 134.0, 132.9, 130.6, 129.9, 129.6, 129.0, 128.4, 125.9, 70.6, 51.2, 49.1, 43.1, 33.5, 31.4. (c24h25cl2nosc2h2o4/2h2o) c, h, n. compound 7e was synthesized as described for compound 5a using 6i (230 mg, 0.443 mmol). the free base product 7e (130 mg, 55% yield) was obtained as a yellow oil and converted into the oxalate salt, which was recrystallized from hot meoh. h nmr (cdcl3) : 7.457.53 (m, 4h), 7.157.32 (m, 7h), 4.83 (s, 1h), 2.993.08 (m, 2h), 2.572.65 (m, 6h), 1.751.82 (m, 2h). c nmr (cdcl3) : 141.9, 134.5, 133.3, 132.5, 132.3, 132.0, 131.4, 130.9, 130.2, 128.4, 125.9, 122.9, 122.7, 70.7, 51.2, 49.1, 43.1, 33.5, 31.4.	2-[(diphenylmethyl)sulfinyl]acetamide (modafinil, ()-1) is a unique dopamine uptake inhibitor that binds the dopamine transporter (dat) differently than cocaine and may have potential for the treatment of psychostimulant abuse. to further investigate structural requirements for this divergent binding mode, novel thio- and sulfinylacetamide and ethanamine analogues of ()-1 were synthesized wherein (1) the diphenyl rings were substituted with methyl, trifluoromethyl, and halogen substituents and (2) substituents were added to the terminal amide / amine nitrogen. halogen substitution of the diphenyl rings of ()-1 gave several amide analogues with improved binding affinity for dat and robust selectivity over the serotonin transporter (sert), whereas affinity improved at sert over dat for the p - halo - substituted amine analogues. molecular docking studies, using a subset of analogues with dat and sert homology models, and functional data obtained with dat (a480 t) and sert (t497a) mutants defined a role for tm10 in the substrate / inhibitor s1 binding sites of dat and sert.
reversible left ventricular (lv) dysfunction and takotsubo 's cardiomyopathy has been described in endocrine conditions such as addison 's disease, isolated adrenocorticotropic hormone deficiency, primary adrenal insufficiency in adrenal crisis, pheochromocytoma, thyrotoxicosis, and multiple endocrine neoplasia. it has also been described in various neurological conditions such as stroke, guillian barre syndrome, seizures, subarachnoid bleed empty sella syndrome, and reversible posterior leukoencephalopathy syndrome. the most common cause of secondary adrenal insufficiency is a tumor of the hypothalamic - pituitary region, usually associated with panhypopituitarism caused by tumor growth or treatment with surgery or irradiation. however, takotsubo 's cardiomyopathy in a case of the pituitary tumor with secondary adrenal insufficiency has not been described to the best of our knowledge. a 48-year - old man with no known comorbid illness, presented to the emergency department with a progressive decrease in vision and headache for 2 months, vomiting for 1 day, and acute sensorium for 4 h. at admission, the patient was unresponsive with glasgow coma scale score of 6/15 (e1m4v1). he was resuscitated with intravenous (iv) fluids (2.0 l of crystalloid and 1.0 l of colloid within 1 h) and vasopressors (noradrenaline infusion at 0.2 mcg / kg / h). laboratory evaluation revealed hyponatremia (108 meq / l) and hyperkalemia (5.5 meq / l). the temperature was 36c. in view of the progressive loss of vision and altered sensorium, contrast it revealed a dense sellar - suprasellar mass lesion extending into the hypothalamus, right cavernous sinus, and anteriorly under the frontal lobe of size 40 mm 23 mm. hormonal profile revealed hypocortisolism [table 1 ]. a provisional diagnosis of hypopituitarism with secondary adrenal insufficiency in adrenal crisis was considered. hormonal profile of the patient resuscitation was continued, and central venous pressure (cvp) was maintained between 8 and 10 cm of h2o. after adequate fluid replacement (cvp-12), noradrenaline infusion (0.5 mcg / kg / h), and dobutamine (3 mcg / kg / h) infusions were started. despite continuing active resuscitation and hormonal replacement, there was persistent hypotension, tachycardia, and worsening acidosis. a 12 lead ecg revealed sinus tachycardia with t wave inversion and st - elevation in lead 1, 2, avf, avl, v1-v6, poor r wave progression in v1-v4 [figure 1 ]. serum biomarkers showed borderline elevation (troponin i - 0.55 ng / ml and cpk - mb -264). bedside transthoracic echocardiography revealed regional wall motion abnormality involving the left anterior descending artery territory with ejection fraction (ef) < 40% [figure 2 ]. an acute coronary event was suspected, and the patient was started on antiplatelets and anticoagulant (aspirin 300 mg, clopidogrel 600 mg, and iv heparin 600 iu / h). electrocardiogram changes at the time of hypotension left ventricular angiogram (a) hyperkinetic base (b) akinetic apex the patient developed two episodes of ventricular tachycardia, which reverted to sinus rhythm following defibrillation. in view of the refractory hemodynamic instability, coronary angiogram showed normal coronaries and ventriculogram revealed apical ballooning of left ventricle and severe lv dysfunction with an ef of < 30% [figure 3 ]. inotropic supports were slowly tapered over 24 h and stopped. (a and b) angiogram demonstrating normal coronaries beta - blocker therapy was initiated with atenolol 25 mg bd. the patient was weaned off mechanical ventilation and was continued on replacement doses of hydrocortisone and fludrocortisones. an echocardiogram was done after 7 days showed no wall motion abnormalities and complete recovery of lv function (ef 54%). stress cardiomyopathy, also referred to as takotsubo 's cardiomyopathy or lv apical ballooning syndrome, is a clinical syndrome which manifests as chest pain, st segment elevation, mild elevation of cardiac enzyme, biomarker levels, and transient apical systolic lv dysfunction. approximately, 1.22.2% of admissions for acute myocardial infarction have been ultimately diagnosed to be apical ballooning syndrome due to various etiologies. emotional stress and the corresponding increase in catecholamines have been reported in many patients following takotsubo 's cardiomyopathy. proposed mechanisms for catecholamine - mediated stunning in stress cardiomyopathy include epicardial spasm, microvascular dysfunction, hyperdynamic contractility with midventricular or outflow tract obstruction, and direct effects of catecholamines on cardiomyocytes. recent reviews have proved that the apical ballooning that characterizes takotsubo 's cardiomyopathy reflects toxic high local concentrations of catecholamines and not coronary artery or microvascular disease. the elevated catecholamine levels have been shown to cause direct myocyte injury via an increase in intracellular calcium and oxygen - free radicals. the pattern of lv dysfunction may result from both myocardial cellular rupture and withdrawal of beta - adrenoceptors. another proposed mechanism is that the cardiac functional and ecg abnormalities in takotsubo cardiomyopathy might reflect activation of central neurogenic mechanisms analogous to those evoked by subarachnoid hemorrhage. myocardial histopathological findings seen in acute myocardial dysfunction associated with brain injury are similar to that of takotsubo 's cardiomyopathy. although a reversible syndrome, it can lead to complications such as left heart failure, lv intracavitary obstruction, and arrhythmias. in extreme cases, it can lead to sudden and unexpected death. patients with hypopituitarism presenting with hemodynamic instability present a diagnostic dilemma as to whether it is primarily an addisonian crisis or a myocardial event. in this case, there was an acute hemodynamic worsening, with inverted t waves and elevated cardiac biomarkers indicative of a cardiac event, soon after the initial stabilization of the addisonian crisis. although the clinical picture resembled myocardial ischemia, coronary angiography did not reveal any obstructive lesions and prompt resuscitation and supportive measures helped in the management of a potentially lethal condition. therefore, in patients with pituitary adenoma with panhypopituitarism, cardiac dysfunction due to hyper catecholaminergic states may present as potentially reversible conditions such as takotsubo 's cardiomyopathy. with more reports of neurological conditions either precipitating or presenting as takotsubo 's cardiomyopathy being reported, it is to be an important differential diagnosis in patients with neurological conditions presenting with hemodynamic instability. although the exact pathogenesis is as yet unclear, the relationship between cardiac dysfunction secondary to neurological conditions is being firmly established.	we describe a case of takotsubo cardiomyopathy in a case of pituitary macroadenoma in acute adrenal crisis. a 48-year - old man presented with acute sensorium, vomiting, and gasping. on admission, he was unresponsive and hemodynamically unstable. he was intubated and ventilated and resuscitated with fluids and inotropes. the biochemical evaluation revealed hyponatremia, hyperkalemia, and hypocortisolism. hyponatremia was corrected with 3% hypertonic saline. contrast enhanced computed tomography (ct) scan of the brain revealed a sellar - suprasellar mass with hypothalamic extension with no evidence of pituitary apoplexy. a diagnosis of invasive pituitary adenoma with the addisonian crisis was made and steroid replacement was initiated. despite volume resuscitation, he had persistent refractory hypotension, recurrent ventricular tachycardia, and metabolic acidosis. electrocardiogram (ecg) showed st elevation and t - wave inversion in lateral leads ; cardiac - enzymes were increased suggestive of acute coronary syndrome. transthoracic echocardiography showed severe regional wall motion abnormalities (rwmas) involving left anterior descending territory and low ejection fraction (ef). coronary angiogram revealed normal coronaries, apical ballooning, and severe left ventricular dysfunction, consistent with a diagnosis of takotsubo 's cardiomyopathy. patient was managed with angiotensin - converting enzyme inhibitors and b - blockers. he improved over few days and recovered completely. at discharge, ecg changes and rwma resolved and ef normalized to 56%. in patients with addisonian crisis with persistent hypotension refractory to optimal resuscitation, possibility of takotsubo 's cardiomyopathy should be considered. early recognition of association of takotsubos cardiomyopathy in neurological conditions, prompt resuscitation, and supportive care are essential to ensure favorable outcomes in this potentially lethal condition.
munchausen syndrome is characterized by feigning physical symptoms to seek attention ; it was first reported by asher in 1951. we report a case of cutaneous munchausen syndrome in a patient who self - inflicted trauma to a postoperative wound. a 50-year - old japanese woman consulted the emergency department of our hospital in august 2015 for bleeding due to an intractable postoperative wound on the lower abdomen ; the postoperative wound was owing to a laparoscopic cholecystectomy performed 1 year previously for acute cholecystitis. the wound was sutured and the patient consulted with the dermatology department 3 days later (fig., she presented with a painful ulcer (diameter 6 cm) on her right lower abdomen, and its suture had disappeared (fig. she also presented with multiple scars, skin grafts on the extremities, and a missing left lower leg, the causes for all of which were unexplained (fig. 2). her white blood cell count, neutrophil number, platelet count, renal and liver functions, c - reactive protein level, and ch50 level were normal, except for the hemoglobin level (9.2 g / dl ; normal range 12.015.0 g / dl). negative results were obtained for cytoplasmic antineutrophil cytoplasmic antibodies, myeloperoxidase antineutrophil cytoplasmic antibodies, and anti - ss - a antibodies. a histology of the skin biopsy specimen from the margin of the abdominal ulcer did not show any specific findings such as pyoderma gangrenosum or vasculitis, although we had considered these as differential diagnoses. she had been presenting with repeated intractable wounds since she was a child, which resulted in the amputation of her left lower leg. although we asked her about the scar and amputation, she did not reveal any details. the previous surgeon who had performed the laparoscopic cholecystectomy 1 year before revealed that surgical wound dehiscence had occurred during her admission. after her medical records indicated that she had been admitted to the department of plastic surgery at our hospital for skin grafting of a leg ulcer 10 years before. during that admission, she refused to consult with the department of psychiatry, although the staff suspected mental disorders. therefore, we diagnosed her with cutaneous munchausen syndrome, although we could not determine how she had traumatized the postoperative wound. after vacuum - assisted closure (vac) therapy had been performed to prevent her from traumatizing the ulcer again, it rapidly became granulated and reepithelialized (fig. soon after we had told her that we had diagnosed her with cutaneous munchausen syndrome, she discharged herself. munchausen syndrome is a disorder characterized by a triad of features : simulated illness, pathological lying, and nomadic living. people with this syndrome self - inflict numerous lesions, keep getting admitted to different hospitals, and feign acute illness, usually spectacular diseases ; and they willingly undergo invasive diagnostic procedures and risky therapies [3, 4 ]. typical findings in cutaneous munchausen syndrome caused by the intracutaneous presence of foreign material are erythema, swelling, necrosis, and tissue breakdown, which present as ulcerations, abscesses, nodular panniculitis, and pyoderma gangrenosum [2, 5 ]. most patients with cutaneous munchausen syndrome inject foreign materials into their skin and soft tissue ; however, our patient traumatized her postoperative wound. the diagnosis of munchausen syndrome, which can sometimes be fatal, is often difficult to make. also, hospital room and personal - belonging searches can provide evidence of methods for faking symptoms, and video monitoring or a bedside sitter can be helpful, as these techniques often reduce or eliminate symptom frequency during observation. however, searches and monitoring should be performed after approval has been granted from the institution 's legal counsel. diagnostic clues include cultured organisms from cutaneous wounds that are uncommonly found on the skin, usually on the nondominant side of the body [1, 2 ]. cutaneous munchausen syndrome should be considered as a differential diagnosis when a patient 's skin lesions do not heal or when they repeatedly recur despite appropriate treatment, and if routine detailed examinations show negative or normal results.	a 50-year - old japanese woman consulted the emergency department of our hospital for bleeding due to an intractable postoperative wound on the lower abdomen ; the postoperative wound was owing to a laparoscopic cholecystectomy performed 1 year previously for acute cholecystitis. she presented with a painful ulcer on her right lower abdomen. she also presented with multiple scars, skin grafts on the extremities, and a missing left lower leg, the causes for all of which were unexplained. the results of her blood test were normal, except for the hemoglobin level. histology of the skin biopsy specimen from the ulcer did not show any specific findings. the previous surgeon who had performed the laparoscopic cholecystectomy revealed that surgical wound dehiscence had occurred during her admission. after a body restraint had been applied, the ulcer improved. medical records indicated that she had been admitted to the department of plastic surgery at our hospital for skin grafting of a leg ulcer. during that admission, she refused to consult with the department of psychiatry, al - though the staff suspected mental disorders. therefore, we diagnosed her with cutaneous munchausen syndrome. after vacuum - assisted closure (vac) therapy had been performed to prevent her from traumatizing the ulcer again, it rapidly became granulated and reepithelialized. munchausen syndrome is characterized by feigning physical symptoms to seek attention. patients self - inflict numerous lesions, keep getting admitted to different hospitals, and feign acute illness, usually spectacular diseases. vac therapy may be effective for preventing patients with cutaneous munchausen syndrome from traumatizing their wounds.
gastrointestinal stromal tumors (gists) are the most common mesenchymal neoplasms of the alimentary tract. it represents approximately 1% to 2% of all the alimentary malignancies. based on their phenotypic similarities, gists are considered to arise from muscularis propria of gastrointestinal tract, and derived from the interstitial cells of cajal (icc). histologically, the majority of gists display spindle cell morphology (70%), followed by epithelioid morphology (20%), and mixed morphology (10%). gain - of - function mutations in the c - kit proto - oncogene protein (kit) protooncogene in gists were demonstrated by hirota. gastrointestinal stromal tumors can occur anywhere throughout the gastrointestinal tract and are seen most commonly in the stomach (40%70%), small intestine (20%40%), and colon and rectum (5%15%). the reporting of esophageal gists has been limited to individual case reports and case series of small numbers. studies involving large numbers of esophageal gists are lacking, many questions remain unanswered regarding the clinicopathologic profiles and clinical outcomes. therefore, the aim of the current study was to explore the clinicopathologic characteristics and clinical outcome of esophageal gists, and to investigate the potential factors that may predict postoperative outcomes. gastrointestinal stromal tumor cases of the esophagus were from our center and in addition from the literature. from may 2010 to march 2015, 7 patients of esophageal gists were diagnosed and received treatment in our center. literature search of medline was performed for all articles in english published from 2000 through 2015. medline search resulted in 46 case reports, including 52 patients and 8 case series, including 76 cases. to this end, a total of 135 esophageal gists patients were identified (figure 1). in addition, the clinicopathologic characteristics and prognosis of 297 patients of gastric gists were analyzed and compared with esophageal gists. this study was approved by the ethics committee of xijing hospital, and written informed consent was obtained from the seven patients in our center. schematic diagram regarding selection of esophageal gastrointestinal stromal tumors. clinicopathologic data, including age, sex, accompanied tumor, symptoms, location, tumor size, surgical intervention, histologic type, lymph node metastasis, mitotic index, immunohistochemical features, mutational status, national institutes of health (nih) risk classification, adjuvant imatinib therapy, tumor recurrence or metastasis, and survival data were recorded from hospital medical records in our center or extracted from published reports and studies. the tumors were categorized into very low, low, intermediate, and high - risk groups according to the modified nih risk classification criteria reported by joensuu. for survival analysis, the exclusion criteria were listed as follows : accompanied with other malignant tumors, accompanied with gists in other locations, accompanied with distant metastasis, with neoadjuvant imatinib therapy, not receive r0 resection, with tumor rupture during operation, without follow - up data. owing to data acquisition, completeness of data the clinicophathologic characteristics, including age, sex, tumor size, histologic type, mitotic index, and nih risk classification were compared with gastric gists in our center. for survival analysis between the 2 groups, patients with gastric gists in our center were matched with esophageal gists based on the following parameters : tumor size : 2.0, 2.1 to 5.0, 5.1 to 10.0, or > 10.0 cm ; mitotic index : 5 or less, or more than 5/50 high power fields (hpfs) ; and adjuvant imatinib therapy : yes or no. data were processed using spss 16.0 for windows (spss inc, chicago, il). significant predictors for survival identified by univariate analysis were further assessed by multivariate analysis using the logistic regression analysis. evaluation for disease - free survival (dfs) and disease - specific survival (dss) were obtained by the kaplan meier method and differences between curves were compared using log - rank test. the clinicopathologic features were summarized in table 1. there were 81 men (60%) and 54 women (40%). the patient age ranged from 12 to 87 years (median, 60 years ; mean, 58.6 years). four patients accompanied with gists in other locations (4.6%), including 2 patients of liver metastasis, 1 patient of liver and pleural metastasis, and 1 patient of bone and lung metastasis. eleven patients accompanied with other malignant tumors (12.64%), including 7 patients of esophageal squamous cell carcinoma, 2 patients of barrett carcinoma, 1 case of cardia adenocarcinoma, and 1 case of bladder carcinoma. the most common symptom was dysphagia (50/129, 38.76%), followed by chest pain (16/109, 14.68%), bleeding (9/109, 8.26%), and other symptoms including fatigue, cough, and dyspnea (10/109, 9.17%). the most common location was lower esophagus (99/114, 86.84%), followed by middle esophagus (13/114, 11.4%), and upper esophagus (2/114, 1.76%). a total of 121 patients underwent complete surgical resection (121/135, 89.63%), 4 patients underwent palliative surgical resection (4/135, 2.96%), and 10 patients did not receive surgical resection (10/135, 7.41%). clinicopathologic characteristics of 135 patients of esophageal gastrointestinal stromal tumors the tumors ranged from 0.2 to 30 cm in maximum diameter (median, 6 cm ; mean, 7.3 cm). seventy - seven patients display spindle cell morphology (77/93, 82.8%), 8 patients display epithelioid morphology (8/93, 8.6%), and 8 patients display mixed morphology (8/93, 8.6%). among the 22 patients with lymph node dissection, cd117 positivity was detected in 119 patients (119/123, 96.75%), cd34 positivity was detected in 110 patients (110/117, 94.02%), and discovered on gist 1 positivity was detected in 11 patients (11/13, 84.62%). fifteen patients carried a mutation in exon 11 of kit (15/25, 60%). platelet - derived growth factor receptor variants were not detected in these 25 patients. according to nih risk classification, 15 patients were classified as very low risk (15/120, 12.5%), 18 patients were classified as low risk (18/120, 15%), 2 patients were classified as intermediate risk (2/120, 1.67%), and 85 patients were classified as high risk (85/120, 70.83%). information of adjuvant imatinib therapy was recorded in 134 patients, and 38 patients (28.36%) received imatinib therapy. among them, 6 patients received imatinib therapy before and after surgery, 2 patients only received imatinib therapy before surgery, 22 patients received imatinib therapy after surgery, and the remaining 8 patients received imatinib therapy only. the mitotic index was correlated with histologic type, mutational status, and tumor size. the mitotic index of all the mixed histologic type exceeded 5/50 hpf (p = 0.027). the mitotic index exceeded 5/50 hpf for the majority of kit exon 11 mutation but only for the minority of wild - type gists (p = 0.013). the mitotic index was positively correlated with tumor size (p = 0.025). the relationship between clinicopathologic characteristics survival data of esophageal gists were analyzed and summarized in table 3. survival data of 97 patients were eventually selected for analysis using exclusion criteria described in the materials and methods. the follow - up time ranged from 1 to 202 months (mean, 40.70 months ; median, 28 months). twenty - two patients showed recurrence or metastasis, 17 patients suffered from gists - related deaths. the 1-, 3-, and 5-year survival rate of dss was 100%, 88.1%, and 65.9%, respectively. the 1-, 3- and 5-year survival rate of dfs was 93.3%, 78.3%, and 65.1%, respectively. the dfs and dss of esophageal gists were analyzed using kaplan meier survival analyses and shown in figure 2. survival data of 97 cases of esophageal gastrointestinal stromal tumors disease - free - survival and disease - specific survival of esophageal gastrointestinal stromal tumors. prognostic factors for dfs and dss in patients with esophageal gists according to univariate and multivariate analysis were summarized in table 4. the results showed that tumor size, mitotic index, and nih risk classification were associated with prognosis of esophageal gists. only tumor size, however, was the independent risk factor for the prognosis of esophageal gists. the dfs and dss of esophageal gists according to tumor size, mitotic index, and nih risk classification were shown in figures 3 to 5. national institutes of health risk classification could not be included in the logistic regression analysis, although it showed significant correlation with prognosis, because no patients suffered from recurrence, metastasis, or death in nih risk category 1 and 2. when calculating the log of the odds, this null frequency caused a computational error because of the presence of logarithm of zero. prognostic factors for disease - specific survival and disease - free survival in patients with esophageal gastrointestinal stromal tumors according to univariate and multivariate analysis (n = 97) disease - free - survival and disease - specific survival of esophageal gastrointestinal stromal tumors by tumor size. disease - free - survival and disease - specific survival of esophageal gastrointestinal stromal tumors by mitotic index. disease - free - survival and disease - specific survival of esophageal gastrointestinal stromal tumors by national institutes of health risk category. the clinicophathologic features of 135 esophageal gists, including age, sex, tumor size, histologic type, mitotic index, and nih risk category were compared with 297 gastric gists in our center (table 5). the results showed that the distribution of tumor size, histologic type, and nih risk classification were significantly different between esophageal gists and gastric gists (both p = 0.000). comparison of selected clinicopathologic parameters between esophageal and gastric gastrointestinal stromal tumors to compare the prognosis of esophageal gists with gastric gists, patients were selected using the exclusion criteria described above. then the 2 groups were matched according to tumor size, mitotic index, and adjuvant imatinib therapy described above. finally, 73 patients of esophageal gists and 73 patients of gastric gists were selected. there were no intergroup differences in age, sex, tumor size, mitotic index, and adjuvant imatinib therapy (table 6). the survival analysis showed in figure 7 indicated that the dfs (p = 0.026) and dss (p = 0.041) in patients with esophageal gists were significantly lower than that of gastric gists (58.3% versus 94.7%, 71.8% versus 95.2%). comparison of predefined variables between esophageal and gastric gastrointestinal stromal tumors comparison of disease - free - survival and disease - specific survival between esophageal and gastric gastrointestinal stromal tumors. gastrointestinal stromal tumors located in the esophagus constitute a very rare subset of gists with limited data on the clinicopathologic features and clinical outcomes. therefore, we evaluated data of 135 cases of esophageal gists from our center and from literatures in medline. the current study represents the largest analysis of esophageal gists and indicates some features significantly associated with esophageal gists. we found that the most common location for esophageal gists was lower esophagus, and most of the esophageal gists are high - risk category. there is only 1 clinical study containing a relatively larger number of esophageal gists reported by lott. clinicopathologic features of 55 esophageal gists were analyzed in the study. in their series, the most common location of esophageal gists was lower esophagus, followed by middle esophagus. the most common location of esophageal gists was also lower esophagus, followed by middle esophagus, and upper esophagus. thus, the distribution of esophageal gists may be attributed to the distribution of iccs in the esophagus. radenkovic investigated the distribution of icc populations in human embryonal and fetal esophagus. they found that icc were abundant in the lower portion, less numerous in the middle region, and rare in the upper part. the reported distribution of icc was completely in accordance with the distribution of esophageal gists in our study. it was reported that kit gene mutation occurred in approximately 70% to 80% of gists. among them, most are exon 11 mutations, followed by exon 9, 13, and 17 mutations. only 20% to 25% of gastric gists were associated with platelet - derived growth factor receptor mutations, including exon 18 and exon 12 mutations. b - type raf kinase kinase mutation occurred rarely according to the previous report. in our current study, 25 esophageal gists received mutational analysis. among them, 15 patients (60%) harbor kit mutations in exon 11, the remaining 10 patients (40%) were kit wild type. we found that the mitotic index exceeded 5/50 hpf in the majority of esophageal gists with exon 11 mutation, but only in the minority of esophageal gists with kit wild type. even with early and r0 resection, there is a high risk of recurrence and metastasis. distant metastases are the more frequent treatment failure for gists and are associated with poor prognosis. metastases have a predilection to the liver, omentum, peritoneum, and other intra - abdominal sites, whereas metastases outside the abdomen are uncommon. in our current study, the most common site of distant metastasis in esophageal gists is liver, followed by lung, thoracic cavity, pleura, peritoneal, and subcutaneous. it is reported that the venous plexus of esophagus in the thorax drain through the hemiazygos and azygos veins in to the superior vena cava and also drain into the portal venous systems. thus, the difference between esophageal and other gists in respect to the site of metastasis may attribute to the different venous drainage and specific anatomic site of esophagus. the majority reports from the literature support a higher malignant potential of esophageal gists with an unfavorable outcome, and it was considered that the poor outcome is related to the significant higher rate of large tumor size and higher mitotic rate. in our current study, the clinicopathologic features of esophageal gists were compared with gastric gists in our center. the results showed that the distribution of tumor size, histologic type, and nih risk classification were significantly different between esophageal and gastric gists. the distribution of mitotic index between esophageal and gastric gists, however, was comparable in our current study. it is reported that tumor size and mitotic index are the best prognostic indicators for determining the malignant potential of gists. in our current study, larger tumor size, mitotic index more than 5/50 hpf, and high - risk category were associated with poorer prognosis. tumor size, however, was the only independent risk factor for prognosis of esophageal gists. rutkowski reported that primary tumor location was an independent prognostic factor for the prognosis of gists. considering the significantly different distribution of tumor size and nih risk category between esophageal and gastric gists, patients in the 2 groups were matched by tumor size, mitotic index, and adjuvant imatinib therapy to compare the prognosis between esophageal and gastric gists. the survival analysis showed that the dfs and dss of esophageal gists were significantly lower than that of gastric gists. second, the sample size of esophageal gists was not large enough, which will result in sampling error. third, because of the limited sample size of duodenal, small intestinal and rectal gists in our center, we could not compare the clinicopathologic features and prognosis of esophageal gists with nongastric gists. the most common location for esophageal gists was lower esophagus, and most of the esophageal gists are high - risk category.	abstractclinicopathologic features and clinical outcomes of gastrointestinal stromal tumors (gists) in esophagus are limited, because of the relatively rare incidence of esophageal gists. therefore, the aim of the current study was to investigate the clinicopathologic features and clinical outcomes of esophageal gists, and to investigate the potential factors that may predict prognosis.esophageal gist cases were obtained from our center and from case reports and clinical studies extracted from medline. clinicopathologic features and survivals were analyzed and compared with gastric gists from our center.the most common location was lower esophagus (86.84%), followed by middle and upper esophagus (11.40% and 1.76%). the majority of esophageal gists were classified as high - risk category (70.83%). mitotic index was correlated with histologic type, mutational status, and tumor size. the 5-year disease - free survival and disease - specific survival were 65.1% and 65.9%, respectively. tumor size, mitotic index, and national institutes of health risk classification were associated with prognosis of esophageal gists. only tumor size, however, was the independent risk factor for the prognosis of esophageal gists. in comparison to gastric gists, the distribution of tumor size, histologic type, and national institutes of health risk classification were significantly different between esophageal gists and gastric gists. the disease - free survival and disease - specific survival of esophageal gists were significantly lower than that of gastric gists.the most common location for esophageal gists was lower esophagus, and most of the esophageal gists are high - risk category. tumor size was the independent risk factor for the prognosis of esophageal gists. esophageal gists differ significantly from gastric gists in respect to clinicopathologic features. the prognosis of esophageal gists was worse than that of gastric gists.
the recurrent laryngeal nerve (rln) injury is one of the most important complications during thyroid surgery, leading to dysfunction, and palsy of the vocal cords. for years, surgeons have attempted to prevent this complication by improving surgical techniques and optimizing surgical strategies. the identification and preservation of the anatomical integrity of the rln during thyroid surgery is commonly accepted as a gold standard. however, even in the most experienced hands, rln injury occasionally occurs. in the last decade, intraoperative neuromonitoring (ionm) has been widely applied during thyroid surgery to aid in the localization and identification of the rln. one of the most important roles of ionm is assistance in intraoperative navigation and rapid identification of rln distribution. repetitive tissue stimulation in the vicinity of the nerve allows the nerve to be localized using a stimulation probe before visual identification. the reported stimulation intensity for mapping the path of the nerve ranges from 2 to 3 ma. this range is higher than that used for direct nerve stimulation, as the use of stronger stimulation current would depolarize a greater sphere of tissue around the probe tip however, failure to obtain signal deflection at 3 ma during nerve localization might occasionally occur, in which case a surgeon might consider increasing the stimulation intensity. however, electrical stimulation is also a potential risk factor for rln injury, and the nerve can become damaged in the case of over - stimulation. therefore, in this study, we developed an experimental canine model to determine whether supramaximal stimulation during ionm could induce nerve damage and investigated the safe range of stimulation current intensity. twenty adult, male beagle dogs weighing 1520 kg were obtained from the animal center of peking university health science center (institutional protocol no. the dogs were randomly divided into four groups of five each and maintained under standard laboratory conditions with free access to food and water. all animal experiments were approved by the institutional ethics committee (peking university people 's hospital), and all procedures were conducted according to our institutional animal care guidelines. the animals were fasted for 8 h and then anesthetized with intravenous 3% pentobarbital (merck kgaa, darmstadt, germany) 5 ml and vecuronium (organon pharmaceutical co., ltd., oss, the netherlands) 0.06 mg / kg, after which a neural monitoring tube (medtronic nim 2 emg ett # 6 ; medtronic, jacksonville, florida, usa) was inserted by a single anesthesiologist., new york, usa) to ensure that the middle of its blue - marked region (the exposed electrodes) formed a good contact with the true vocal cords. the tube was then fixed by balloon inflation. after performing routine surgical procedures such as disinfection and draping, a midline vertical cervical incision was made to expose the neck and the larynx, and total thyroidectomy was performed. a nerve integrity monitor (nim - response 2.0 ; medtronic, jacksonville, florida, usa) was applied for ionm approximately 20 min after the administration of muscle relaxant, at the moment of muscle recovery. the following parameters were set : stimulation rate, four times / s ; pulse width, 100 s ; and event threshold, 100 s. while exposing the bilateral rln, a stimulation current was delivered to the nerves by a bipolar probe at a 30 hz frequency. the electrode detected evoked electromyography (emg) activity, the parameters of which were recorded. after finishing the experimental procedures, the incisions were closed in multiple layers, and the animals were sacrificed by an intravenous bolus injection of potassium chloride. all surgeries were performed by the same surgeon, who is experienced in thyroid surgery. the stimulation threshold was defined as the lowest current required to obtain clear evoked emg. each nerve was initially stimulated using a 0.1 ma current, and the current was increased step - wise by 0.05 ma until emg was observed. the current was recorded as the stimulation threshold, and the corresponding amplitude was recorded as well. after exposure of the rln, the stimulation threshold and amplitude at the threshold level were measured as baseline parameters before any interventions. then, the rlns were continuously stimulated with a high - intensity current for 1 min at a point distal from the test point. each group of animals was exposed to a different stimulation intensity (5 ma, 10 ma, 15 ma, and 20 ma). the stimulation threshold and evoked emg amplitude were measured 1 min later at the same point as the prior test to determine poststimulation parameters. all interventions and recordings were performed completely on one side before treating the other side. the specimens were prepared using the following steps : (1) immediate fixing in 3% glutaraldehyde (sigma - aldrich co. llc., st. louis, usa) ; (2) three washes of 20 min each with phosphate - buffered solution (zoman bio co., ltd., beijing, china) ; (3) fixing in osmic acid (alfa aesar, massachusetts, usa) for 1.52.0 h ; (4) two washes with distilled water (sinopharm chemical reagent beijing co., ltd, beijing, china) ; (5) immersion in uranium (merck kgaa, darmstadt, germany) for 30 min ; (6) two washes with distilled water ; (7) dehydration with graded ethanol (beijing chemical works, beijing, china) (50%, 70%, 90%, and 100% for 15 min each) ; (8) embedding in 1:1 100% acetone (beijing chemical works, beijing, china) under vacuum for 23 h ; (9) embedding in 1:3 100% acetone : under vacuum for 23 h ; (10) embedding and immersion at 37c for 1620 h ; (11) polymerization at 60c for 48 h ; and (12) drying for 24 h. finally, the myelin sheath, neuraxon, and schwann cell nerve microstructures were observed under an electron microscope (jeol ltd., data were analyzed using spss 17.0 statistical software (spss inc., chicago, il, usa). paired t - tests were used to compare the average stimulation thresholds and amplitudes at the threshold level between normal and stimulated rlns. twenty adult, male beagle dogs weighing 1520 kg were obtained from the animal center of peking university health science center (institutional protocol no. the dogs were randomly divided into four groups of five each and maintained under standard laboratory conditions with free access to food and water. all animal experiments were approved by the institutional ethics committee (peking university people 's hospital), and all procedures were conducted according to our institutional animal care guidelines. the animals were fasted for 8 h and then anesthetized with intravenous 3% pentobarbital (merck kgaa, darmstadt, germany) 5 ml and vecuronium (organon pharmaceutical co., ltd., oss, the netherlands) 0.06 mg / kg, after which a neural monitoring tube (medtronic nim 2 emg ett # 6 ; medtronic, jacksonville, florida, usa) was inserted by a single anesthesiologist., new york, usa) to ensure that the middle of its blue - marked region (the exposed electrodes) formed a good contact with the true vocal cords. after performing routine surgical procedures such as disinfection and draping, a midline vertical cervical incision was made to expose the neck and the larynx, and total thyroidectomy was performed. a nerve integrity monitor (nim - response 2.0 ; medtronic, jacksonville, florida, usa) was applied for ionm approximately 20 min after the administration of muscle relaxant, at the moment of muscle recovery. the following parameters were set : stimulation rate, four times / s ; pulse width, 100 s ; and event threshold, 100 s. while exposing the bilateral rln, a stimulation current was delivered to the nerves by a bipolar probe at a 30 hz frequency. the electrode detected evoked electromyography (emg) activity, the parameters of which were recorded. after finishing the experimental procedures, the incisions were closed in multiple layers, and the animals were sacrificed by an intravenous bolus injection of potassium chloride. all surgeries were performed by the same surgeon, who is experienced in thyroid surgery. the stimulation threshold was defined as the lowest current required to obtain clear evoked emg. each nerve was initially stimulated using a 0.1 ma current, and the current was increased step - wise by 0.05 ma until emg was observed. the current was recorded as the stimulation threshold, and the corresponding amplitude was recorded as well. after exposure of the rln, the stimulation threshold and amplitude at the threshold level were measured as baseline parameters before any interventions. then, the rlns were continuously stimulated with a high - intensity current for 1 min at a point distal from the test point. each group of animals was exposed to a different stimulation intensity (5 ma, 10 ma, 15 ma, and 20 ma). the stimulation threshold and evoked emg amplitude were measured 1 min later at the same point as the prior test to determine poststimulation parameters. all interventions and recordings were performed completely on one side before treating the other side. the specimens were prepared using the following steps : (1) immediate fixing in 3% glutaraldehyde (sigma - aldrich co. llc., st. louis, usa) ; (2) three washes of 20 min each with phosphate - buffered solution (zoman bio co., ltd., beijing, china) ; (3) fixing in osmic acid (alfa aesar, massachusetts, usa) for 1.52.0 h ; (4) two washes with distilled water (sinopharm chemical reagent beijing co., ltd, beijing, china) ; (5) immersion in uranium (merck kgaa, darmstadt, germany) for 30 min ; (6) two washes with distilled water ; (7) dehydration with graded ethanol (beijing chemical works, beijing, china) (50%, 70%, 90%, and 100% for 15 min each) ; (8) embedding in 1:1 100% acetone (beijing chemical works, beijing, china) under vacuum for 23 h ; (9) embedding in 1:3 100% acetone : under vacuum for 23 h ; (10) embedding and immersion at 37c for 1620 h ; (11) polymerization at 60c for 48 h ; and (12) drying for 24 h. finally, the myelin sheath, neuraxon, and schwann cell nerve microstructures were observed under an electron microscope (jeol ltd., tokyo, japan). data were analyzed using spss 17.0 statistical software (spss inc., chicago, il, usa). paired t - tests were used to compare the average stimulation thresholds and amplitudes at the threshold level between normal and stimulated rlns. a value of p < 0.05 was considered statistically significant. the bilateral rlns of all 20 dogs were successfully exposed ; therefore, 10 nerves per group were available for experimentation. the average stimulation thresholds of the unstimulated rlns in the 15 ma group and 20 ma group were 0.315 0.097 ma and 0.300 0.103 ma, and the average amplitudes at the threshold level were 1,021 273 v and 1,200 258 v, respectively. the data from the groups stimulated with 5 ma and 10 ma were accidentally lost. after the experimental invention, no significant difference in average stimulation threshold was observed in any group [15 ma group : unstimulated 0.315 0.097 ma vs. stimulated 0.320 0.123 ma, p = 0.847 ; 20 ma group : unstimulated 0.300 0.103 ma vs. stimulated 0.305 0.101 ma, p = 0.758 ; table 1 ]. similarly, there was no statistically significant change in average evoked emg amplitude in any group, even the group stimulated with 20 ma [15 ma group : unstimulated 1,021 273 v vs. stimulated 1,026 268 v, p = 0.834 ; 20 ma group : unstimulated 1,200 258 v vs. stimulated 1,162 275 v, p = 0.148 ; table 2 ]. stimulation threshold changes for recurrent laryngeal nerves after electrical stimulation at different intensities sd : standard deviation. changes in evoked electromyography amplitude of the recurrent laryngeal nerve after electrical stimulation at different intensities sd : standard deviation. no significant pathological changes were observed among the specimens from the 5 ma, 10 ma, and 15 ma groups compared to the normal group under electron microscopy [figure 1 ]. aligned microfilaments, evenly distributed matrix, and normal organelles were clearly observed without schwann cell degeneration or proliferation [figure 2 ]. electron microscopic image of a normal recurrent laryngeal nerve (original magnification, 10,000). electron microscopic image of a recurrent laryngeal nerve continuously stimulated with a 15 ma current for 1 min (original magnification 10,000). electron microscopic image of a recurrent laryngeal nerve stimulated with a 20 ma current for 1 min. the bilateral rlns of all 20 dogs were successfully exposed ; therefore, 10 nerves per group were available for experimentation. the average stimulation thresholds of the unstimulated rlns in the 15 ma group and 20 ma group were 0.315 0.097 ma and 0.300 0.103 ma, and the average amplitudes at the threshold level were 1,021 273 v and 1,200 258 v, respectively. the data from the groups stimulated with 5 ma and 10 ma were accidentally lost. after the experimental invention, no significant difference in average stimulation threshold was observed in any group [15 ma group : unstimulated 0.315 0.097 ma vs. stimulated 0.320 0.123 ma, p = 0.847 ; 20 ma group : unstimulated 0.300 0.103 ma vs. stimulated 0.305 0.101 ma, p = 0.758 ; table 1 ]. similarly, there was no statistically significant change in average evoked emg amplitude in any group, even the group stimulated with 20 ma [15 ma group : unstimulated 1,021 273 v vs. stimulated 1,026 268 v, p = 0.834 ; 20 ma group : unstimulated 1,200 258 v vs. stimulated 1,162 275 v, p = 0.148 ; table 2 ]. stimulation threshold changes for recurrent laryngeal nerves after electrical stimulation at different intensities sd : standard deviation. changes in evoked electromyography amplitude of the recurrent laryngeal nerve after electrical stimulation at different intensities sd : standard deviation. no significant pathological changes were observed among the specimens from the 5 ma, 10 ma, and 15 ma groups compared to the normal group under electron microscopy [figure 1 ]. aligned microfilaments, evenly distributed matrix, and normal organelles were clearly observed without schwann cell degeneration or proliferation [figure 2 ]. electron microscopic image of a normal recurrent laryngeal nerve (original magnification, 10,000). electron microscopic image of a recurrent laryngeal nerve continuously stimulated with a 15 ma current for 1 min (original magnification 10,000). electron microscopic image of a recurrent laryngeal nerve stimulated with a 20 ma current for 1 min. rln injury is a major complication of thyroid surgery. such injury results in temporary or permanent recurrent laryngeal nerve palsy (rlnp), which manifests as hoarseness in unilateral injury or life - threatening acute airway obstruction in bilateral injury. temporary rlnp occurs in 1.438.4% of cases while permanent palsy occurs in 018.6% of cases. the strategy used for thyroid surgery has advanced to routine capsular dissection and direct visualization of the rln, which is accepted as the gold standard due to its association with a significantly lower rlnp rate. ionm was recently introduced to aid in the localization and identification of the rln and as a prognostic measure of postoperative nerve function. early and definite identification of the rln during thyroid surgery, especially in difficult cases, is important for preventing rln injury. previously reported stimulus intensities used to localize the nerve before visualization has ranged from 1 to 3 ma. many studies have confirmed that the stimulation current that is routinely used is safe and meets the demands required for surgery most of the time. however, it has been clearly demonstrated that over - stimulation induces tissue damage, which may result from the passage of current through the tissue. the range of stimulation current intensity that can be safely applied during clinical practice remains to be determined. in this study, we used twenty dogs to evaluate the functional and histological outcomes of applying supramaximal electrical stimulation to the rln. the safety of stimulation with 3 ma has been widely confirmed in clinical and animal experiments. in a study reported by ulmer., the maximal current used for stimulation was 5 ma, and no postoperative rlnp was detected. however, stimulation with 5 ma during ionm has rarely been used in the clinic. in the current study, we initially treated animals with a current of 5 ma and observed no functional and histological changes after the intervention, verifying its safety. previous studies in canine or porcine models that have characterized emg changes, such as amplitude decrements and increases in stimulation threshold level after neural injury, have suggested that these parameters can be used as predictors of nerve injury. even after stimulation with 20 ma, there was still no functional abnormality in the nerve based on the stimulation thresholds and evoked emg amplitudes observed. normal morphology was observed after stimulation with 15 ma, but acute microstructural morphological changes occurred after stimulation with 20 ma. the anatomical and functional correlations of our canine model might be translatable into a safe range of stimulation intensity for ionm during human thyroid surgery. despite losing the data from the groups stimulated with 5 ma and 10 ma, based on our results, we postulate that a stimulation intensity less than 15 ma will not induce any functional or histological changes to rlns during ionm. we chose to evaluate a canine model because dog thyroid glands have similar anatomy to human thyroid glands and therefore can be used to mimic human thyroid surgery. the canine thyroid is a dark red, elongated structure that is attached to the fascia along the ventrolateral surfaces of the proximal trachea, ventrally covered by the sternocephalicus and sternohyoideus muscles, and laterally covered by the sternothyroideus muscle. the caudal laryngeal nerves in dogs, termed rlns in humans, are dorsal to the thyroid lobes. one limitation of the current study is the loss of the data from the groups stimulated with the low - intensity current. another limitation was the lack of exclusion of influencing factors and the absence of functional evaluation of the nerves, such as the observation of vocal cord movement by video laryngoscopy. however, this study provides evidence for the safety of using electrical stimulation during ionm in clinical practice. in conclusion, our study indicates that a stimulation intensity less than 15 ma could be safely applied during ionm.	background : intraoperative neuromonitoring (ionm) of the recurrent laryngeal nerve (rln) has been widely applied during thyroid surgery. however, the safe range of stimulation intensity for ionm remains undetermined.methods:total thyroidectomies were performed on twenty dogs, and their rlns were stimulated with a current of 520 ma (step - wise in 5 ma increments) for 1 min. the evoked electromyography (emg) of vocal muscles before and after supramaximal stimulation were recorded and compared. acute microstructural morphological changes in the rlns were observed immediately postoperatively under an electron microscope.results:the average stimulating threshold for rlns stimulated with 15 ma and 20 ma showed no significant changes compared to the unstimulated rlns (15 ma group : 0.320 0.123 ma vs. 0.315 0.097 ma, p = 0.847 ; 20 ma group : 0.305 0.101 ma vs. 0.300 0.103 ma, p = 0.758). similar outcomes were shown in average evoked emg amplitude (15 ma group : 1,026 268 v vs. 1,021 273 v, p = 0.834 ; 20 ma group : 1,162 275 v vs. 1,200 258 v, p = 0.148). however, obvious acute microstructural morphological changes were observed in the nerves that were stimulated with 20 ma.conclusions:a stimulation intensity less than 15 ma might be safe for ionm of the rln.
conventional venoplasty of post - liver transplant inferior vena cava (ivc) stenoses is limited by a high primary treatment failure rate and problematic durability. while ivc stenting may deliver a successful outcome after failed angioplasty, this approach, however, is not always suitable. hepatic vein ostial coverage may not be desired, device migration may be a concern, and excessive risk for intra - stent stenosis may be perceived in specific cases, rendering definitive balloon dilation therapy as the lone possible minimally invasive treatment option. recognizing that single - session balloon venoplasty may not successfully and consistently address ivc stenoses, the percutaneous management approach of fibrotic, benign biliary strictures, namely, scheduled sequential balloon dilation sessions, may be adapted for the treatment of analogously scarred vascular lesions. herein, we describe the case of a young patient with an initially angioplasty - resistant post - transplant ivc stenosis who was successfully treated with programmed successive balloon dilation, and highlight the utility of this approach in managing cases where stent insertion is undesirable. institutional review board approval is not required for single retrospective case study at our institution. a 36-year - old woman with a history of autoimmune hepatitis and two prior orthotopic liver transplants in 1998 and 2008 (the second transplant was performed due to rejection of the first graft) presented 5 years after her most recent transplant with a chief complaint of progressive bilateral lower extremity edema and weight gain over the preceding 8 weeks. on physical examination, duplex ultrasonography and computed tomography (ct) imaging revealed a focal thrombus within the hepatic level ivc. compression stockings and diuretic therapy provided minimal symptomatic relief, and the patient 's condition continued to worsen in terms of leg swelling despite initiation of therapeutic anticoagulation. the patient was subsequently referred to interventional radiology (ir) for catheter - directed venous thrombolysis. she received intra - thrombus, low - dose (0.5 mg / h) tissue plasminogen activator (tpa) for 48 h, which resulted in complete clearance of the ivc clot, but revealed an underlying high - grade stenosis of the hepatic ivc at the level of the end - to - side transplant anastomosis just superior to the hepatic vein ostium [figure 1 ]. the lesion was dilated using a 10-mm balloon after thrombolysis termination, but recoil afforded no luminal caliber improvement. the patient 's lower extremity edema thus persisted [figure 2 ] despite systemic anticoagulation given for 2 months post - procedure. the patient also developed a mild increase in her bilirubin (1.7 mg / dl) and creatinine (1.5 mg / dl) levels ; further intervention was thus clinically indicated. her case was discussed among a multidisciplinary team comprising transplant surgeons, hepatologists, and interventional radiologists. stenting of the lesion was considered, but was felt to be undesirable given the relative young age of the patient, which placed her at high lifetime risk of intra - stent stenosis and future recurrent complications, while the preference of the transplant surgeon to avoid impeding the hepatic vein ostium limited the choice of stent to shorter models with a concomitantly higher risk of migration. 36-year - old woman with a history of autoimmune hepatitis and two prior orthotopic liver transplants who presented 5 years after her most recent transplant with a chief complaint of progressive bilateral lower extremity edema and weight gain was diagnosed with transplant - related, initially angioplasty - resistant ivc stenosis. inferior vena cavagram reveals high - grade stenosis of hepatic level ivc (arrowhead), with 2 - 3 mm luminal caliber at this site. 36-year - old woman with a history of autoimmune hepatitis and two prior orthotopic liver transplants who presented 5 years after her most recent transplant with a chief complaint of progressive bilateral lower extremity edema and weight gain was diagnosed with transplant - related, initially angioplasty - resistant ivc stenosis. sequential treatment sessions were scheduled at 2 - 3 week intervals. in general, the patient was positioned supine and her right neck prepared in standard sterile fashion. the right internal jugular vein was localized with ultrasound, after which the overlying soft tissue was anesthetized with 2% lidocaine and the vessel accessed with a 21-gauge needle under real - time sonographic guidance. the percutaneous access was then dilated to accept a 12-french vascular sheath, which was then advanced into the upper ivc. at the first treatment session, angioplasty of the lesion was performed using a 10-mm balloon (mustang ; boston scientific, natick, ma, usa) with prolonged (2 - 3 min) inflation., an 8-mm cutting balloon (peripheral cutting balloon ; boston scientific) and a 12-mm high - pressure balloon (mustang) were sequentially dilated at the site of the stenosis three times each, with the idea that the atherotomes would assist with disruption of fibrotic and scarred tissue, as in the case of benign anastomotic biliary strictures. further angioplasty was then performed using a 16-mm balloon (xxl vascular ; boston scientific) with three inflations until the balloon waist was fully expanded, followed by prolonged inflation. sequential dilation was performed using 14-mm (xxl vascular), 16-mm (xxl esophageal ; boston scientific), and 18-mm (maxi ld ; cordis, bridgewater township, nj, usa) balloons that were advanced to the stenosis and sequentially inflated twice each for 2 - 3 min per inflation. each of the balloons reached its nominal diameter except for the 18-mm balloon, which had a small residual waist. esophageal) and 18-mm (maxi ld) balloons sequentially inflated twice each for 2 - 3 min per inflation. upon completion of the sequential dilations, completion cavogram demonstrated an excellent response to treatment [figure 3 ]. 36-year - old woman with a history of autoimmune hepatitis and two prior orthotopic liver transplants who presented 5 years after her most recent transplant with a chief complaint of progressive bilateral lower extremity edema and weight gain was diagnosed with transplant - related, initially angioplasty - resistant ivc stenosis. inferior vena cavagram performed following multiple venoplasty sessions reveals excellent response to therapy, with luminal diameter enlargement to 10 - 11 mm (arrowhead). over the course of the next 3 - 4 weeks, the patient reported a fluid weight loss of approximately 90 pounds with concurrent reduction in her lower extremity edema [figure 4 ]. moreover, her serum creatinine value normalized from 1.5 mg / dl pre - procedure to 1.0 mg / dl post - procedure. a low - level pre - procedure total bilirubin elevation also normalized (from 1.7 to 0.9 mg / dl). the patient had returned to her baseline level of functioning without recurrence of edema, and ct venography confirmed stable caliber of the previously dilated hepatic ivc segment. future follow - up with clinical assessment and repeat ct venography at 6-month intervals was planned. 36-year - old woman with a history of autoimmune hepatitis and two prior orthotopic liver transplants who presented 5 years after her most recent transplant with a chief complaint of progressive bilateral lower extremity edema and weight gain was diagnosed with transplant - related, initially angioplasty - resistant ivc stenosis. in this report, we described the case of a 36-year - old woman with a recalcitrant ivc stenosis related to liver transplantation. after failing to respond to initial balloon angioplasty, the patient underwent four additional sessions over the course of 2 months, ultimately achieving dramatic clinical improvement in conjunction with expansion of the caval lumen from 2 - 3 mm to 10 - 11 mm. this case exemplifies the potential role of a programmed approach to balloon venoplasty employing multiple sessions and including use of a cutting balloon, similar to that used for benign biliary stricture dilation. this method affords a more vigorous approach to treatment of the fibrotic neointimal hyperplasia of vascular anastomotic stenoses refractory to single - session therapy, while averting the need for stent deployment. the small incremental gains in ivc luminal caliber achieved at each treatment session may have been deemed ineffective when taken on its own, but were markedly successful in enhancing ivc patency when taken together. ideally, the sequential dilation approach will result in sustained clinical and angiographic response ; at minimum, it may be employed as a temporizing measure that does not preclude the possibility of subsequent stenting or increase the technical difficulty of future surgical intervention. notably, however, ivc stenosis and/or hepatic veno - occlusive disease may increase the technical complexity of liver transplant surgery, and such circumstances may require arduous dissection requiring meticulous care, and may necessitate auxiliary or advanced vascular reconstructive maneuvers. venous outflow obstruction is a rare complication of liver transplantation, with an incidence below 2%. signs and symptoms of caval stenosis resemble those of budd chiari syndrome : abdominal pain, lower extremity edema, ascites, and hepatic dysfunction. obstruction occurring in the early postoperative period is typically the result of technical factors, whereas delayed presentation may be related to intimal hyperplasia, perivascular fibrosis, or extrinsic caval compression. recently, immune - mediated processes have been shown to contribute to graft failure and development of hepatic venous outflow obstruction, suggesting a role for preventative immunosuppressive strategies. data regarding post - transplant ivc obstruction, although limited to retrospective studies and case series, suggest that such lesions typically respond favorably to conventional percutaneous treatment. in a recent retrospective study, lorenz., reported technical and clinical success rates of 96% and 88%, respectively, in 25 patients with ivc obstruction who underwent primary venoplasty with additional stent placement for refractory or recurrent stenosis. in contrast, among the 17 patients stented for refractory or recurrent stenosis, the cumulative primary and primary assisted patency rates were 86% and 100% at 6 months and 7 years, respectively. given the proven and long - lasting efficacy of stent placement, several authors have advocated this approach as first - line treatment. stenting may increase the technical difficulty of future surgical interventions, while the risk of migration or fracture, though minor, must be considered. in the current report, stenting was deferred due to concern regarding the high likelihood of in - stent stenosis over the patient 's lifetime coupled with the need for a short stent with a high risk of migration. serial balloon dilation was pursued as an alternative to re - transplantation, which is a resource - intensive procedure associated with mortality rates as high as 41.6%. although long - term stricture recurrence may ensue in the reported patient, whose stenosis was felt to be most likely related to anastomotic perivascular fibrosis or intimal hyperplasia, long - term primary assisted patency may be nonetheless achieved ; the patient was thus enrolled in a clinical and imaging surveillance program to help identify any need for repeat balloon angioplasty intervention. in summary, sequential balloon angioplasty may produce a favorable outcome in cases of initially angioplasty - resistant ivc obstruction. although the report of a single case does not constitute evidence of efficacy, operators should not consider non - response to one session of balloon dilation a treatment failure, and may consider use of successive interventional procedures to achieve therapeutic success. as a final note, such a treatment plan warrants substantial patient cooperation, with an expectation for responsible follow - up for scheduled sessions.	obstruction of the inferior vena cava (ivc) is a rare complication of liver transplantation with significant consequences including intractable ascites and hepatic dysfunction. although venoplasty and stenting are effective in many cases, patients who fail first - line treatment may require surgical intervention or re - transplantation. scheduled sequential balloon dilation, an approach frequently used to treat fibrotic, benign biliary strictures, but less commonly vascular lesions, may avert the need for such high - risk alternatives while achieving favorable clinical and angiographic response. herein, we report the case of a 36-year - old woman with transplant - related, initially angioplasty - resistant ivc stenosis that was successfully treated with sequential balloon dilation.
cough, sputum, and shortness of breath are cardinal features of chronic obstructive pulmonary disease (copd). the natural history of copd is characterized by a progressive reduction in exercise tolerance and health - related quality of life (hrqol).1,2 the rate of decline in lung function, which is a strong predictor of morbidity and mortality in copd,3 as well as health care utilization,4 is higher in patients with mucus hypersecretion and recurrent exacerbations.57 there is currently a variety of methods to improve mucociliary clearance (mcc) that have been shown to be effective in chronic lung conditions associated with excess mucus production, such as cystic fibrosis (cf) and non - cf bronchiectasis. these include physical therapy techniques such as autogenic drainage, the active cycle of breathing technique,8 and adjuvant mechanical devices such as the flutter device9 and positive end - expiratory pressure. high - frequency chest wall oscillation (hfcwo) is a technique utilizing automated pneumatic chest wall percussion delivered through a vest and transmitted to the airways that allows patients to manage their condition independently in their own homes, thus reducing health care costs. hfcwo delivers pressurized air pulses to the external chest wall via the vest, which results in transient cephalad bias airflow spikes in the airways to loosen bronchial mucus so that the patient can more easily expel secretions by coughing. although hfcwo is well tolerated in children with cf1012 and has shown demonstrable improvement in mcc,13 as well as in some institutionally managed adults with amyotrophic lateral sclerosis, there is currently very little evidence of usage or benefit in adults with copd.14 the in vivo benefit of hfcwo in improving mcc is based on the hypothesis that cyclical mechanical stress on the airway mucosa may improve hydration of the airway surface layer by activation of the p2y2 receptors.15 intuitively, improved mcc may reduce airflow obstruction,16,17 subsequent exacerbations,18,19 and rate of lung function decline, leading to improvement in hrqol.20 this pilot study aimed to explore the impact of improved mcc by application of hfcwo on symptoms and hrqol in patients with advanced copd and mucus hypersecretion. all copd patients admitted to hospital or attending the emergency room in the preceding 12 months due to an exacerbation of their disease were invited to participate in the study. the minimum inclusion criteria were : forced expiratory volume in 1 second (fev1) 25 ml in the stable state for 3 consecutive days. exclusion criteria included history of osteoporosis, significant gastro - oesophageal reflux, hiatus hernia, recent acute cardiac event (6 weeks), congestive cardiac failure, any significant musculoskeletal disorders, bronchiectasis, and asthma (excluded by reversibility testing). patients were randomized to receive either hfcwo or conventional treatment in phase 1 for 4 weeks, followed by a 2-week washout phase. the smartvest airway clearance system (electromed, inc, new prague, mn) was used to deliver the hfcwo treatment for all patients in the hfcwo treatment group. the smartvest system consists of an inflatable vest, which is worn over the torso, and an air pulse generator that produces and delivers the oscillating air pulses to the vest via a connecting air hose. the hfcwo group received two treatment sessions per day of 20 minutes each (morning and evening). the smartvest air pulse generator was set at an optimum oscillating frequency of 1315 hz, based on individual patient tolerance during the tuning procedure, and a pressure setting to achieve a tight but comfortably snug fit. patients in the conventional treatment group followed their own copd management regimen including all prescription medications, advice on the benefits of regular exercise, and cough clearance of sputum. medication included a minimum of combination long - acting bronchodilator and inhaled corticosteroid as well as an acting anticholinergic inhaler. primary outcome measures included hrqol, patient tolerability, and compliance of the smartvest hfcwo device. hrqol was measured with the st george s respiratory questionnaire (sgrq)21 as well as with a nonstandardized symptom score measurement, which required subjects to rate five cardinal respiratory symptoms (cough, sputum, wheeze, shortness of breath, and exercise tolerance) as mild = 1, moderate = 2, or severe = 3. a paired sample t - test was used to compare the results between the hfcwo and conventional phase. an intention - to - treat analysis model was used for patients who dropped out during each phase of the study. eight patients developed exacerbations of copd within the trial period and were consequently withdrawn from the trial. the patients were elderly with a mean age of 71 (standard deviation [sd ] 10) years and were at the upper end of the normal range of body mass index (25 [sd 4.2 ] kg / m). the majority of patients had moderate to severe copd with a mean fev1% predicted of 41 (sd 15.6) and percentage predicted forced vital capacity (fvc%) of 73 (sd 17.7). the baseline daily wet sputum volume was variable with a mean volume of 39 (sd 23) ml / day, based on a 72-hour collection. daily sputum expectoration at baseline correlated with a lower fev1% predicted, as shown in figure 1 (linear regression adjusted r = 0.114, p < 0.05). sgrq scores at baseline were symptom score 72 (sd 18), activity score 77 (sd17), impact of disease score 51 (sd23), and total score 63 (sd19). three of the sgrq dimension scores showed a significant predictive relationship when modeled with fev1% predicted using a linear regression model : symptoms (coefficient = 0.5, p < 0.016), activity (= 0.7, p = 0.007), and total score (= 0.4, p < 0.05). there was no significant change in spirometry values (fev1 or fvc) with hfcwo baseline fev1 1.05 (sd 0.37) versus postintervention fev1 1.07 (sd 0.38) l or in the conventional phase (baseline fev1 0.97 [sd 0.37 ]) versus postintervention (fev1 1.01 [sd 0.36 ] l, p = not significant), as shown in figure 2. sputum expectoration remained individually variable but showed a trend toward a reduction after hfcwo. in the hfcwo phase, the mean change in sputum volume was 2.6 ml (range 53 to + 27 ml), and in the conventional phase the mean change was + 6 ml (range 70 to + 40 ml), p = 0.06. the baseline sputum volume significantly predicted the change in sputum volume with hfcwo, in a model including age, sex, fev1% predicted, fvc%, and body mass index (linear regression model coefficient = 0.7, p = 0.024), whereas in the conventional phase, none of the variables was found to be significant. there was a significant improvement in the mean total score in the five - symptom self - reported questionnaire in patients on hfcwo, p = 0.03. sgrq scores showed a significant improvement in the symptom dimension (= 8, p = 0.028), whereas impact of disease, activity, and total scores did not achieve a significant reduction (table 1). there was no significant change in sgrq scores in the conventional phase (figure 3). although the effect of hfcwo has been demonstrated to enhance mcc in children with cf,22 as well as in adults with bronchiectasis and neuromuscular disease,23 its use in copd24 is novel. in this pilot study, the authors set out to explore the suitability of using this modality to improve mcc in patients at the moderate to severe end of the copd spectrum, where increased sputum production and retention can lead to increased exacerbations, hospital admissions, and a more rapid decline in lung function.25 in addition to assessing the impact on hrqol and sputum, another aim was to assess the tolerability and acceptability of this form of treatment in elderly patients with disabling copd symptoms and often multiple comorbidities. toward this aim, it was found that patients demonstrated a significant improvement in hrqol dimensions of sgrq symptom control. the efficient daily clearance of sputum may have led to a decreased daily sputum volume at the end of the hfcwo phase. the hfcwo modality delivered by the smartvest system was well tolerated in patients who often had significant disability including shortness of breath at rest. the crossover study design was chosen to reduce the intersubject variability in physiological parameters, as each subject would act as their own matched control. it was decided to have two cohorts of patients, reversing the sequence of hfcwo / conventional versus conventional / hfcwo, to detect any residual effect on mcc after discontinuing the hfcwo treatment phase during the 2-week washout phase and none was detected. placebo intervention for this study was deliberately not chosen, as the authors wished to compare hfcwo with usual treatment, as is currently usual practice in a real - life setting. it was the authors hypothesis that patients with severe disabling symptoms from copd were likely to accept and comply with a treatment that involved setting up and using a vibrating vest around their chest for 20 minutes twice a day only if they experienced a detectable benefit. this has been demonstrated in several trials where compliance levels have been found to be below 50%.26,27 however, it is theoretically possible that a proportion of the benefit demonstrated in hrqol may indeed be due to a placebo device effect. although this pilot study was not statistically powered, a clinically significant improvement was found in the sgrq symptom score as well as the sgrq total score. the sgrq dimension scores are considered to demonstrate a clinically relevant change if there is a mean reduction in the score of four or more units.28 however, when the five - point clinical symptoms score was examined, there was a significant improvement in the hfcwo phase when compared with the conventional phase, which showed no change, although this symptom score was not standardized. when such disease - specific quality of life (qol) outcomes are compared with generic qol measures, the scores were found to demonstrate similar changes. although in the conventional phase the five - point symptom scores were marginally worse, both of these outcomes improved in the hfcwo arm. hence, it is likely that the size of improvement detected in the hfcwo phase is due to the intervention, rather than being entirely a placebo effect. analysis revealed a negative correlation between fev1 and sputum production and a positive correlation between fev1 and hrqol. not only did a low fev1 relate to a low hrqol but also to increased sputum production. this would add credence to the current consensus that increased sputum production (and retention) may lead to an increased frequency of exacerbations and, in turn, to an increased rate of decline in fev1. 29 as fev1 decline is still the most reliable parameter of survival, this is a very powerful determinant of outcome in copd patients. a 25 ml / day mucus production threshold was chosen as a criterion for entry into the study after a comprehensive search of the relevant literature. drawing on previous experience from trials in cf and non - cf bronchiectatics, the authors were keen to exclude these patients from this trial, intending primarily to focus on the phenotype of copd30 with airway obstruction and mucus hypersecretion as a novel area of use. the authors hypothesis of improved mcc leading to a reduction in exacerbation of copd and rate of decline of fev1 would be valid only in patients who exhibited both frequent exacerbations and increased mucus production. patients who had at least one exacerbation in the last 12 months requiring a visit to hospital were invited to take part in this study. the subset of patients who were predominantly suffering from chronic bronchitis rather than having predominantly emphysema, where improved mcc may not be a relevant outcome, were especially sought for inclusion in the study. clinical experience demonstrated that mucus production in generic copd patients varied around 10 10 ml / day. hence, the minimum mucus volume was set at a consensus level of 25 ml / day. high - resolution computed tomography scans were not routinely undertaken in these patients to exclude mild bronchiectasis. it is recognized that a proportion of copd patients with excess sputum production may have undetected areas of bronchiectasis in their lungs. however, clinical criteria of persistent sputum purulence (in the absence of a clinically detectable exacerbation) and chest radiographic examination were used to avoid patients with obvious bronchiectasis. mucus production was widely variable in the study subjects, reflecting the range of fev1 in this group. there was a consistent trend of reduction in mucus production in the hfcwo phase, when compared with the conventional phase, where the levels of sputum production remained stable or even increased. the baseline mucus production was the primary determinant in predicting the post - treatment mucus production during hfcwo treatment. overall, there was a trend of reduction in sputum production by the end of the 4-week intervention period. this is likely to be due to efficient daily clearance, as well as a possible reduction in actual sputum production. patterson explored sputum volumes in patients with bronchiectasis and also found significant variability, making this an unreliable measure of effectiveness of mcc modalities.31 in a canadian study, with 15 severe copd patients given a flutter device to improve mcc, the authors found an improvement in 2-hour postbronchodilator spirometry and exercise tolerance after 1 week of use.9 therefore, it is likely that effective mcc in copd patients may have an impact on the rate of decline in lung function in the future, although this was not demonstrated significantly in this pilot study. this study was designed to explore the feasibility of using the hfcwo modality of mucus clearance in patients with advanced copd. it was found that that the smartvest hfcwo device was well tolerated and that subjects demonstrated an improvement in symptom scores and qol. a significant effect on lung function was not demonstrated, and the wet mucus quantities remained individually variable between patients. it is therefore feasible that hfcwo may have a role in enhancing mucus clearance in copd patients with the mucus hypersecretory phenotype, and future studies may be able to explore the impact of mcc in lung function decline and prevention of exacerbations.	introductionchronic obstructive pulmonary disease (copd) patients with mucus hypersecretion tend to demonstrate increased frequency of infective exacerbations and a steeper slope of decline in lung function. enhanced mucociliary clearance with high - frequency chest wall oscillation (hfcwo) devices previously used in cystic fibrosis and bronchiectasis patients may offer the opportunity for community - based, self - managed therapy to improve quality of life and lung function.study design and methodsa randomized controlled crossover pilot study of hfcwo compared with conventional treatment was conducted in 22 patients with moderate to severe copd and mucus hypersecretion. patients spent 4 weeks using an hfcwo (smartvest) device and 4 weeks in a conventional phase with a 2-week washout. eleven patients started with hfcwo and changed to conventional treatment, whereas the other eleven patients started conventional treatment and crossed over to hfcwo.resultsthe patients were elderly with a mean age of 71 (standard deviation [sd ] 10) years and were at the upper end of the normal range of body mass index (25 [sd 4.2 ] kg / m2). the majority of patients had moderate to severe copd with a mean percentage predicted forced expiratory volume in 1 second of 41 (sd 15.6) and percentage predicted forced vital capacity of 73 (sd 17.7). baseline sputum production was negatively correlated to lung function and positively to st george s respiratory questionnaire. symptom scores and st george s respiratory questionnaire symptom dimension improved significantly (8, p < 0.05). sputum production showed a declining trend in the hfcwo phase, although not reaching statistical significance. the hfcwo device was well tolerated with good reported compliance.conclusionthis pilot study demonstrated that patients with advanced copd and mucus hypersecretion at increased risk of declining lung function tolerated the hfcwo treatment well, leading to improvement in quality of life and reduced symptoms.
codam participants were selected from a large cohort in the general population, as described in detail elsewhere (1820). briefly, subjects were selected if they were of caucasian ethnicity, aged > 40 years, and had at least one of the following inclusion criteria : positive family history of t2 dm (first - degree relatives), history of gestational diabetes, bmi 25 kg / m, use of antihypertensive drugs, postprandial glucose 6.0 mmol / l, or glycosuria. in total, 574 individuals were included, and their lifestyle and cardiovascular and metabolic profile was extensively characterized during two visits to the university s metabolic research unit. we performed the current cross - sectional analyses in the baseline evaluation of this cohort and excluded 13 participants with insulin therapy and 7 with a self - reported history of liver disease. to exclude possible hereditary hemochromatosis, we excluded 21 subjects with elevated serum ferritin (> 150 g / l for premenopausal women, > 400 g / l for men and postmenopausal women) and elevated transferrin saturation (> 45%), according to dutch guidelines (21). subjects with missing data on iron markers (n = 9), glucose or insulin (n = 6), adiponectin (n = 7), or important covariates (n = 19) were also excluded. the study protocol was approved by the medical ethical committee of the maastricht university medical centre, and all subjects gave written informed consent. participants were asked to stop their lipid - lowering drugs 14 days before the visit and to stop all other medication the day before the visit. after an overnight fast, venous blood samples were collected for assessment of several biomarkers, and an oral glucose tolerance test (ogtt) was performed. after centrifugation at 3,000 rpm for 15 min, serum aliquots were stored at 20c, and plasma (edta) aliquots were stored at 80c until use. ferritin, transferrin, total iron, and unsaturated iron - binding capacity (uibc) were determined in serum on a hitachi 912 autoanalyzer using assays # 1661400, # 1931628, # 1876996, and # 1030600, respectively (roche diagnostics, almere, the netherlands). non transferrin - bound iron (ntbi) levels were measured in serum by a method using iron - sensitive fluorescence - labeled apotransferrin, as described in detail previously (22). transferrin saturation was calculated as [total serum iron/(total serum iron + uibc) ]. plasma glucose levels were measured in naf / kox plasma with a hexokinase glucose-6-phosphate dehydrogenase method (abx diagnostics). insulin concentrations were determined in edta plasma using a two - sided immunoradiometric test using paired monoclonal antibodies (medgenix diagnostics). nonesterified free fatty acids (nefas) were measured in edta plasma using an enzymatic calorimetric nefa c method (wako diagnostics, richmond, va). the adipocyte ir index was calculated as the product of fasting insulin and fasting nefa concentrations, as described before (2325). this index provides a valid marker of the sensitivity of adipocytes to the antilipolytic effect of insulin, because nefa concentrations and fatty acid turnover in clamp studies are highly correlated and insulin suppresses lipolysis already at low (i.e., fasting) concentrations (1020 mu / l) (23,26). homa2-ir, which has correlated well with glucose disposal in clamp studies (27), was computed using the homa calculator (http://www.dtu.ox.ac.uk/homacalculator/index.php). total adiponectin was measured in edta plasma with a competitive elisa kit (biovendor laboratory medicine inc., waist circumference was measured in centimeters with a tape at the level midway between the lateral lower rib margin and the anterior superior iliac spine. smoking behavior and family history of t2 dm (first - degree relatives) were assessed by questionnaire. dietary calorie intake and mean alcohol consumption were estimated by a validated food frequency questionnaire (20). physical activity was derived from a validated short physical activity questionnaire (squash) (28). malondialdehyde (mda) was measured in edta with a reagent kit for high - performance liquid chromatography analyses (chromsystems instruments and chemicals, munich, germany ; interassay coefficient of variation, 411%), and total antioxidative status (tas) was measured in serum with an enzymatic kit (randox diagnostics, county antrim, u.k. ; interassay coefficient of variation 2.5%). serum interleukin-6, interleukin-8, tumor necrosis factor-, high - sensitivity c - reactive protein (hs - crp), serum amyloid a, and soluble intercellular adhesion molecule-1 were determined on a multiarray detection system based on electrochemiluminescence technology (sector imager 2400, meso scale discovery, gaithersburg, md) (29). creatinine levels were determined in edta plasma with a jaff diagnostic test (roche diagnostics), and estimated glomerular filtration rate (egfr) was calculated using the short modification of diet in renal disease equation (30). glucose metabolism status (i.e., normal, impaired, or t2 dm) was diagnosed according to the world health organization 1999 criteria, as previously described (1820). prior cvd was defined by self - reported history of cvd, signs of myocardial infarction or ischemia on electrocardiogram, or an ankle - arm index 40 years, and had at least one of the following inclusion criteria : positive family history of t2 dm (first - degree relatives), history of gestational diabetes, bmi 25 kg / m, use of antihypertensive drugs, postprandial glucose 6.0 mmol / l, or glycosuria. in total, 574 individuals were included, and their lifestyle and cardiovascular and metabolic profile was extensively characterized during two visits to the university s metabolic research unit. we performed the current cross - sectional analyses in the baseline evaluation of this cohort and excluded 13 participants with insulin therapy and 7 with a self - reported history of liver disease. to exclude possible hereditary hemochromatosis, we excluded 21 subjects with elevated serum ferritin (> 150 g / l for premenopausal women, > 400 g / l for men and postmenopausal women) and elevated transferrin saturation (> 45%), according to dutch guidelines (21). subjects with missing data on iron markers (n = 9), glucose or insulin (n = 6), adiponectin (n = 7), or important covariates (n = 19) were also excluded. the study protocol was approved by the medical ethical committee of the maastricht university medical centre, and all subjects gave written informed consent. participants were asked to stop their lipid - lowering drugs 14 days before the visit and to stop all other medication the day before the visit. after an overnight fast, venous blood samples were collected for assessment of several biomarkers, and an oral glucose tolerance test (ogtt) was performed. after centrifugation at 3,000 rpm for 15 min, serum aliquots were stored at 20c, and plasma (edta) aliquots were stored at 80c until use. ferritin, transferrin, total iron, and unsaturated iron - binding capacity (uibc) were determined in serum on a hitachi 912 autoanalyzer using assays # 1661400, # 1931628, # 1876996, and # 1030600, respectively (roche diagnostics, almere, the netherlands). non transferrin - bound iron (ntbi) levels were measured in serum by a method using iron - sensitive fluorescence - labeled apotransferrin, as described in detail previously (22). transferrin saturation was calculated as [total serum iron/(total serum iron + uibc) ]. plasma glucose levels were measured in naf / kox plasma with a hexokinase glucose-6-phosphate dehydrogenase method (abx diagnostics). insulin concentrations were determined in edta plasma using a two - sided immunoradiometric test using paired monoclonal antibodies (medgenix diagnostics). nonesterified free fatty acids (nefas) were measured in edta plasma using an enzymatic calorimetric nefa c method (wako diagnostics, richmond, va). the adipocyte ir index was calculated as the product of fasting insulin and fasting nefa concentrations, as described before (2325). this index provides a valid marker of the sensitivity of adipocytes to the antilipolytic effect of insulin, because nefa concentrations and fatty acid turnover in clamp studies are highly correlated and insulin suppresses lipolysis already at low (i.e., fasting) concentrations (1020 mu / l) (23,26). homa2-ir, which has correlated well with glucose disposal in clamp studies (27), was computed using the homa calculator (http://www.dtu.ox.ac.uk/homacalculator/index.php). total adiponectin was measured in edta plasma with a competitive elisa kit (biovendor laboratory medicine inc., brno, czech republic). waist circumference was measured in centimeters with a tape at the level midway between the lateral lower rib margin and the anterior superior iliac spine. smoking behavior and family history of t2 dm (first - degree relatives) were assessed by questionnaire. dietary calorie intake and mean alcohol consumption were estimated by a validated food frequency questionnaire (20). physical activity was derived from a validated short physical activity questionnaire (squash) (28). malondialdehyde (mda) was measured in edta with a reagent kit for high - performance liquid chromatography analyses (chromsystems instruments and chemicals, munich, germany ; interassay coefficient of variation, 411%), and total antioxidative status (tas) was measured in serum with an enzymatic kit (randox diagnostics, county antrim, u.k. ; interassay coefficient of variation 2.5%). serum interleukin-6, interleukin-8, tumor necrosis factor-, high - sensitivity c - reactive protein (hs - crp), serum amyloid a, and soluble intercellular adhesion molecule-1 were determined on a multiarray detection system based on electrochemiluminescence technology (sector imager 2400, meso scale discovery, gaithersburg, md) (29). creatinine levels were determined in edta plasma with a jaff diagnostic test (roche diagnostics), and estimated glomerular filtration rate (egfr) was calculated using the short modification of diet in renal disease equation (30). glucose metabolism status (i.e., normal, impaired, or t2 dm) was diagnosed according to the world health organization 1999 criteria, as previously described (1820). prior cvd was defined by self - reported history of cvd, signs of myocardial infarction or ischemia on electrocardiogram, or an ankle - arm index 45%) and elevated ferritin. excluding all subjects with elevated transferrin saturation (n = 68) did not appreciably change the associations between ferritin, transferrin, serum iron, and ntbi with metabolic outcomes, however (data not shown). to account for the possibility of markers of iron metabolism being affected by the presence of infectious or inflammatory diseases at the time of blood sampling, we also repeated all the analyses excluding 41 subjects with serum hs - crp > this did not materially change the associations of ferritin, transferrin, serum iron, and ntbi with metabolic outcomes (data not shown). in addition, similar associations were observed after stringent exclusion of 173 subjects with self - reported history of pulmonary, renal, gastrointestinal, thyroid, rheumatic disease, or cancer (data not shown). adipocyte ir increased and plasma adiponectin decreased across the spectrum of normal glucose metabolism (ngm), impaired glucose metabolism (igm), and t2 dm (both p 45%) and elevated ferritin. excluding all subjects with elevated transferrin saturation (n = 68) did not appreciably change the associations between ferritin, transferrin, serum iron, and ntbi with metabolic outcomes, however (data not shown). to account for the possibility of markers of iron metabolism being affected by the presence of infectious or inflammatory diseases at the time of blood sampling, we also repeated all the analyses excluding 41 subjects with serum hs - crp > 10 mg / l. this did not materially change the associations of ferritin, transferrin, serum iron, and ntbi with metabolic outcomes (data not shown). in addition, similar associations were observed after stringent exclusion of 173 subjects with self - reported history of pulmonary, renal, gastrointestinal, thyroid, rheumatic disease, or cancer (data not shown). ferritin, transferrin, serum iron, as well as ntbi were associated with adipocyte ir, also after taking a broad range of covariates into account. second, these findings were further corroborated by associations of these markers with plasma nefas and by inverse associations between serum ferritin and transferrin with adiponectin. third, adjustment for inflammatory markers or exclusion of subjects with elevated hs - crp did not attenuate these associations, but in some cases, even increased the magnitude of the associations. finally, tas significantly mediated associations of ferritin and transferrin with adipocyte ir and homa2-ir. taken together, these results suggest that stores of body iron and/or iron metabolism may be involved in the development of ir not only in liver or muscle but also in adipocytes. the observed associations of iron parameters with adipocyte ir and adiponectin may be important because adipocyte ir or adipocyte dysfunction is thought to be one of the first events in the pathogenesis of t2 dm (31). the results of our and other epidemiological studies are supported by several in vitro and animal studies. incubation of adipocytes with iron or transferrin resulted in increased lipolysis and decreased insulin - stimulated glucose transport (13,14). moreover in mice, an iron - enriched diet caused iron accumulation in visceral fat together with ir (15), and an iron - restricted diet led to lower free fatty acids and triglycerides (16). previous epidemiological studies have shown associations of ferritin and transferrin with homa - ir, serum triglycerides, hdl, or the triglycerides - to - hdl ratio, in agreement with these findings (1,912). however, homa - ir and these lipid variables do not necessarily reflect adipocyte ir, and these studies did not adjust for potential confounding variables such as smoking, diet, physical activity, and family history of t2 dm. the current study confirms and extends previous in vitro data and epidemiological studies by showing firstly that ferritin and transferrin were both associated with homa - ir, independently of each other and several potential metabolic confounders, and secondly, by showing that ferritin, transferrin, iron, and ntbi were independently associated with an adipocyte ir index. although adipocyte ir and homa2-ir were both derived from fasting insulin levels, ferritin, transferrin, iron, and ntbi were also independently associated with fasting nefas, even after adjustment for insulin. this suggests that, although highly correlated, the adipocyte ir and homa2-ir indices do not represent the same site of ir and that our findings indeed concern adipocyte lipolysis. in addition, ferritin and transferrin were inversely associated with plasma adiponectin, in agreement with previous studies (7,17). some authors have suggested that the association of ferritin with adiponectin may be explained by abdominal fat (7), but adjustment for obesity and related lgi did not affect the observed associations in our and one previous study (17). the potential inhibitory role of iron on adiponectin production and secretion is yet unclear, but may be interesting. low adiponectin levels are associated with the development of t2 dm and have been suggested to be a specific marker of adipose tissue dysfunction (7,32). therefore, the observed associations of ferritin and transferrin with both adipocyte ir and low adiponectin levels support the hypothesis that iron metabolism may influence adipose tissue function. in contrast to serum ferritin, published data on serum total iron and ntbi levels in obesity or t2 dm are scarce. one study showed that ntbi levels were significantly higher in patients with t2 dm than in healthy controls (33). we did not observe this difference in our study, but we note that our population as a whole had an increased metabolic risk and that median ntbi levels were relatively high, even in the ngm group. of interest, the associations of both total serum iron and ntbi with adipocyte ir emerged only after adjustment for waist circumference and the lgi score. the increases in magnitude of associations between serum iron and ntbi with adipocyte ir or homa - ir across models 15 may be attributed to negative confounding of obesity and lgi on these associations. obesity and its related lgi may increase hepcidin production (34), which in turn lowers circulating iron levels by decreased intestinal absorption and decreased release from macrophages (35). in regression analyses that are not adjusted for obesity and lgi, the true positive association between iron / ntbi levels and adipocyte ir is confounded toward the null (models 13). after these negative confounding variables had been taken into account, the true associations between iron levels and adipocyte ir became apparent. associations of adiponectin and homa2-ir with serum iron and ntbi were not significant, even after taking into account the negative confounding, as described above. still, a trend was observed for homa - ir. one explanation could be that serum iron and ntbi are characterized by more random error (due to circadian fluctuations and day - to - day variations) than ferritin and transferrin, which may decrease the magnitude of its associations. a possible mechanism through which iron may induce ir addition of a free - radical scavenger completely blocked the effect of iron or transferrin on in vitro adipocyte lipolysis (13). serum ferritin has also been associated with circulating oxidized lipoproteins and advanced oxidation protein products (1), suggesting that iron may cause ir through induction of oxidative stress. in addition, we observed significant mediation by tas in the associations of ferritin and transferrin with adipocyte ir and homa2-ir. the small magnitude of the mediated effect may be because tas is a systemic measure and does not efficiently reflect local or intracellular oxidative stress. nevertheless, the significant mediation in our study supports the hypotheses that the association between iron and ir does involve induction of oxidative stress. the association of ntbi levels with adipocyte ir also suggests the involvement of oxidative stress : ntbi is believed to be a more redox - active form of iron because it is not so tightly bound to carrier proteins such as transferrin (33,36). in the evaluation of iron metabolism in obesity and t2 dm, the concurrent lgi has regularly been implicated as an important confounder because several markers of iron metabolism (ferritin, transferrin, hepcidin) are also acute - phase proteins (21,35). remarkably, associations remained unchanged after adjustment for lgi or after exclusion of subjects with elevated hs - crp, indicating that (systemic) lgi did not have a confounding role in the associations between iron parameters and ir. finally, serum ferritin has been shown to correlate well with the amount of iron removed by phlebotomy, even in subjects with obesity - related lgi (37). therefore, we conclude that the above associations truly reflect involvement of iron metabolism and not just lgi. the current study showed consistent associations of several markers of iron metabolism with systemic markers of ir in subjects who were carefully metabolically phenotyped. the main limitation of our study is its cross - sectional design, which does not allow us to draw definite conclusions on causality. in a reverse - causation scenario, our results indeed, insulin has been shown to upregulate transferrin receptor expression and transferrin production, and therefore, iron uptake and ferritin levels (38,39). the reciprocal relation between insulin and iron metabolism is probably very complex and can not simply be dissected in epidemiological studies. however, in our study, markers of iron metabolism were also associated with nefas, which do not have a known reciprocal effect on iron metabolism. in addition, small trials in patients with t2 dm or nonalcoholic fatty liver disease have shown that iron depletion by phlebotomy reduces homa2-ir, supporting our concept (37,40). finally, our study was conducted in middle - aged and older caucasian subjects who were selected on the basis of an increased risk for metabolic and cvd, and extrapolation to other study populations or other ethnicities should be done with caution. in conclusion, we have shown that several markers of iron metabolism are associated not only with homa2-ir but also with adipocyte ir in humans. these findings suggest that body iron stores and/or iron metabolism related factors may contribute to the induction of ir early in the pathogenesis of t2 dm. of note, body iron stores can easily be influenced by low - cost interventions such as phlebotomies or dietary interventions. therefore, iron metabolism, and particularly effects of iron on adipose tissue, represents an interesting feature of the metabolic syndrome that deserves further investigation.	objectiveadipocyte insulin resistance (ir) is a key feature early in the pathogenesis of type 2 diabetes mellitus (t2 dm), and although scarce, data in the literature suggest a direct role for iron and iron metabolism related factors in adipose tissue function and metabolism. serum ferritin and transferrin were shown to be associated with muscle insulin resistance (ir) and t2 dm, but little is known about the role of iron metabolism on adipose tissue. we therefore investigated whether markers of iron metabolism were associated with adipocyte ir and plasma adiponectin.research design and methodsserum ferritin, transferrin, total iron, non transferrin - bound iron (ntbi), transferrin saturation, and plasma adiponectin were determined in 492 individuals. adipocyte ir was defined by the product of fasting insulin and nonesterified fatty acids (nefas). using linear regression analyses, we investigated the difference in adipocyte ir or adiponectin (in %) according to differences in iron metabolism markers.resultsserum ferritin (= 1.00% increase in adipocyte ir per 10 g / l [95% ci 0.661.34 ]), transferrin (4.18% per 0.1 g / l [2.885.50 ]), total iron (1.36% per mol / l [0.612.12 ]), and ntbi (5.14% per mol / l [1.888.52 ]) were associated with adipocyte ir after adjustment for several covariates, including inflammatory markers. all markers of iron metabolism were also associated with nefas (all p < 0.01). in addition, ferritin and transferrin were inversely associated with adiponectin (both p < 0.01).conclusionsthe observed associations of several markers of iron metabolism with adipocyte ir and adiponectin suggest that factors related to iron and iron metabolism may contribute to adipocyte ir early in the pathogenesis of t2 dm.
structural studies were carried out using an engineered hkor construct (see methods and supplementary fig. 1) and crystallized in cholesterol - doped monoolein lipidic cubic mesophase (see methods). the construct used displayed pharmacological behavior similar to that of a native receptor expressed in hek 293-t cells (supplementary tables 2 and 3). data collection and refinement statistics are shown in supplementary table 1. the structure of hkor - jdtic was determined at 2.9 in the p 212121 space group. the asymmetric unit (asu) consists of a two receptors forming a parallel dimer (fig. the dimer interface with ~1100 buried surface area is formed through contacts between helices i, ii and viii (fig. parallel receptor dimers have been identified in crystal structures of activated rhodopsin (involving helices i, ii and viii), 2 adrenergic receptor (2ar ; cholesterol mediated) and cxcr4 (involving helices iv, v and vi). consistent with these crystallographic data, recent biochemical studies have suggested the existence of two dimerization interfaces : along helices iv and v - sensitive to receptor activation, and along helix i insensitive to the state of activation. while the orientations of the two t4-lysozyme (t4l) copies in the receptor monomers in one asu differ by ~ 60 rotation, both copies of the receptor are highly similar (fig. the remaining residues of the n- and c - termini in the hkor / jdtic structure are disordered as in other class a gpcrs. the main fold of the hkor consists of a canonical 7tm bundle of helices followed by an intracellular helix viii that runs parallel to the membrane. structural comparison with other gpcrs suggests that hkor has striking similarities in the ecl region with cxcr4, another peptide binding receptor in the subfamily. in the 7tm region, however, the hkor structure is closer to aminergic receptors belonging to the subfamily (rmsdc ~2.3 for 2ar, ~1.9 for dopamine d3 receptor (d3r), and ~2.7 for cxcr4). the structure reveals distinctive features of hkor, including : (i) conformation of the extracellular end of helix i that deviates from the position observed in cxcr4, where the tip of helix i is pulled towards the tm bundle by a disulfide bond between the n - terminus and ecl3. (ii) ecl2, the largest extracellular loop of hkor, forms a -hairpin similar to that observed in cxcr4, despite the low sequence similarity in this domain between the two receptors. conservation of this feature between these peptide receptors suggests that the -hairpin could be a common motif in the ecl2 of other subfamily receptors, where interactions between ecl2 and their endogenous peptide ligands are deemed important for ligand recognition and selectivity. (iii) unlike other solved non - rhodopsin class a gpcrs which have more than one disulfide bond, hkor has only one formed between cys131 (superscripts indicate residue numbering using the ballesteros - weinstein nomenclature) and cys210, bridging ecl2 to the end of helix iii. these two cysteines are conserved in all ors and this disulfide bond is the canonical one shared by all other solved class a gpcrs. (iv) intracellular loop 2 (icl2) adopts slightly different structures in the two hkor molecules in the asu, involving a two - turn helix in molecule b, and only a one - turn helix in molecule a (supplementary fig. (v) ecl3 of hkor is disordered. of the approximately eleven residues in this loop (residues 300310), six residues in molecule a and three in molecule b do not have interpretable electron density. a common feature of the class a gpcrs is the presence of a conserved sequence motif asp / glu - arg - tyr (d / ery) located at the cytoplasmic end of helix iii. a salt bridge interaction between arg and asp / glu from the cytoplasmic end of helix vi constitutes an ionic lock, which is thought to stabilize the inactive conformation of rhodopsin and other rhodopsin - like class a gpcrs, while its absence can enhance constitutive activity. although hkor lacks either of the acidic residues asp / glu at position 6.30, arg156 forms a hydrogen bond to another helix vi residue, thr273 (supplementary fig. 3a) in this inactive hkor structure, thereby conceivably stabilizing the inactive receptor conformation. the npxxy motif located at the cytoplasmic side of helix vii, which is composed of asn326, pro327, ile328, leu329 and tyr330 in hkor, is another highly conserved functional motif that is proposed to act as one of the molecular switches responsible for class a gpcr activation. comparison of hkor with inactive 2ar and a2a adenosine receptor (a2aar) structures (supplementary fig. 3b) reveals a similar conformation of this motif in these receptors, thereby supporting the hypothesis that the observed hkor - jdtic complex structure corresponds to the inactive state. to further establish that jdtic stabilizes an inactive conformation, we evaluated its ability to modulate gi - mediated and -arrestin - mediated signaling in transfected hek293-t cells. we found that jdtic was devoid of agonist activity at both canonical and non - canonical pathways and completely blocked the effects of the prototypic agonist u69593 (supplementary fig. the hkor ligand binding pocket displays a unique combination of key characteristics both shared with and distinct from those in the chemokine and aminergic receptor families. while the hkor binding pocket is comparatively large and partially capped by the ecl2 -hairpin, as in cxcr4, it is also much narrower and deeper than in cxcr4 (fig. in addition to a different set of side chains lining the pocket, the shape differences result from an approximately 4.5 inward shift of the extracellular tip of helix vi in hkor as compared to cxcr4. 6), which reaches deep into the pocket to form ionic interactions with the asp138 side chain (fig. the asp residue is conserved in all aminergic gpcrs, thereby playing a critical role in the selectivity of aminergic receptors toward protonated amine - containing ligands. asp is conserved in all ors and for which modeling and mutagenesis studies suggest an essential role in anchoring positively charged hkor ligands. jdtic, developed as a derivative of the trans-(3r,4r)-dimethyl-4-(3-hydroxyphenyl) piperidine scaffold, has exceptionally high affinity (ki = 0.32 nm), potency (ki = 0.02 nm in gtps assays), long duration of action and a more than 1000-fold selectivity for hkor as compared to other or subtypes. extensive structure activity relationship (sar) analyses performed on jdtic analogues have yielded important insights into key determinants of jdtic activity, although reliable identification of the interaction mode(s) and contact residues of these ligands has not been feasible without a receptor crystal structure. jdtic shows a tight fit of the ligand in the bottom of the binding cleft (fig. 2a), forming ionic, polar, and extensive hydrophobic interactions with the receptor (fig. the protonated amines in both piperidine and isoquinoline moieties of the ligand form salt bridges to the asp138 side chain (3.0 and 3.1 n o distances, respectively). the piperidine amine is a part of the original trans-(3r,4r)-dimethyl-4-(3-hydroxyphenyl)piperidine scaffold, and is essential for binding. sar studies of jdtic analogues show that the isoquinoline nitrogen can be replaced by carbon, oxygen or sulfur atoms with only ~10- to 50-fold reduction in affinity. similar to the observed jdtic conformation in the hkor - jdtic complex, a v - shaped conformation was found in the crystal structure of jdtic by itself and which showed its amino groups coordinating a water molecule (supplementary fig. 7a). while several rotatable bonds within the jdtic molecule allow for the sampling of different conformations (see supplementary fig. 7b) and facilitate the ligand passage through the narrow binding pocket entrance, the anchoring - type interaction of two amino groups with asp138 likely fixes the ligand in this characteristic v - shape. sar studies have also underscored the importance of the distal hydroxyl groups on both the piperidine and isoquinoline moieties of jdtic, the removal of which did result in about a 100-fold reduction of affinity. a much smaller effect was observed upon methylation of these hydroxyls or their replacement by other polar groups. these sar results suggest the importance of water - mediated interactions between these two hydroxyl groups and the receptor. indeed, while the crystal structure does not show direct hydrogen bonding with the receptor for both hydroxyl groups, there is clear electron density for several structured water molecules that mediate their polar interactions (supplementary fig. the structure provides important clues for understanding the structural basis for the exceptional subtype selectivity of jdtic. among many extensive contacts, jdtic interacts with four residues of the binding pocket that differ in other closely related ors, which are thought to contribute to the subtype selectivity of jdtic and other kor - selective ligands (human mor (hmor) and human dor (hdor) amino acids shown in parentheses, respectively) : val108 (ala and ala), val118 (asn and lys), ile294 (val and val), and tyr312 (trp and leu) (fig. analysis of jdtic binding into hkor - based hmor and hdor homology models, as well as jdtic sar results (supplementary fig. 9), suggest that all described residues can contribute to the jdtic selectivity profile. thus, changes in the val118 side chain, where larger hydrophilic residues, asn and lys are found in hmor and hdor, respectively, are likely to introduce unfavorable contacts with jdtic. additionally, changing tyr312 to the trp and leu residues found in hmor and hdor, respectively, are likely to result in the loss of an important polar interaction with the jdtic amide. the remaining two hydrophobic side chains replacements, val to ala at position 2.53 and ile to val at position 6.55, may cause a reduction of the hydrophobic contact between jdtic and the receptor. the isopropyl group from jdtic reaches deep in the orthosteric pocket to form a hydrophobic interaction with a conserved trp287 side chain (aka the rotamer toggle switch), possibly playing a critical role in the pharmacological properties of this ligand. trp is thought to be a key part of the activation mechanism in many class a gpcrs including rhodopsin and a2aar, and similar hydrophobic contacts have been implicated in blocking activation - related conformational changes in the dark state visual rhodopsin by 11-cis retinal, and by inverse agonists in the a2aar and d3r. prior mutagenesis and modeling studies suggested that many small molecule opioid ligands can interact with kor, as well as with mor and dor, by forming a salt bridge with the highly conserved asp (ref). this is consistent with our mutagenesis studies (supplementary table 3) and flexible docking of a series of morphine analogues, including selective kor antagonists nor - bni and gnti (fig. 3 and supplementary fig. 10). to assess the compatibility of these bulky and rigid ligands with the observed hkor protein backbone conformation, we performed global energy optimizations of nor - bni and gnti in the binding cavity of hkor, keeping side chains of the binding pocket fully flexible. multiple independent runs consistently resulted in low energy conformations with essentially identical poses and receptor contacts for the common naltrexone moieties of both nor - bni and gnti (rmsd = 0.85). in addition to a highly complementary van der waals interface, both compounds formed an amino group salt bridge to the asp138 side chain and a hydrogen bond to the tyr139 side chain, both of which are important anchoring points for binding of morphine - based ligand, as supported by previous mutagenesis studies. moreover, unlike jdtic, both nor - bni and gnti compounds have a second basic moiety located more than 10 away from the first amino group (the other morphine in nor - bni and the guanidine moiety in gnti). in the predicted models of hkor- nor - bni / gnti complexes, these additional amino groups of both ligands form a salt bridge with glu297 located at the entrance to the ligand binding pocket, which was previously characterized as a residue critical for subtype selectivity of hkor - selective morphinan derivatives. this interaction is also supported by our mutagenesis results (supplementary table 3), where a glu297ala mutation induced a significant drop in both nor - bni and gnti binding, but did not affect jdtic binding. hydrophobic interactions at the kor - specific residue ile294 were also found for both nor - bni and gnti ; consistent with our mutagenesis results (supplementary table 3) and suggesting that ile294 may also be important for developing kor subtype selective morphinan derivatives. additional polar interactions with hkor - specific residues, glu209 and ser211 in ecl2, are found for nor - bni, which may further enhance hkor - selectivity of this bulky ligand. another side chain of the pocket, his291, which is involved in the highly conserved aromatic cluster around trp and thought to play a critical role in the receptor activation process, forms hydrophobic contacts with jdtic, nor - bni and gnti. his291 can be mutated to another aromatic residue, phenylalanine, without disrupting binding of these antagonists (supplementary table 3). the non - conservative his291lys mutation, however, totally abolished binding of all tested ligands, likely because of the disruption of the aromatic cluster induced by the lysine side chain. interestingly, the cyclopropyl moiety of both nor - bni and gnti in these binding poses has the same position as the isopropyl moiety of jdtic, making hydrophobic contact with the conserved residue trp287. this cyclopropyl moiety is generally implicated in conversion of opioid agonists into antagonists (e.g. agonist oxymorphone into antagonist naltrexone), and this effect may be partially explained by a direct interaction with the trp287 side chain. overall, these structure - based docking results support the message - address model in applications to morphine - based ligands nor - bni and gnti, which points to glu297 as a key side chain that controls hkor selectivity by anchoring the, however demonstrates that even in lieu of address interaction with glu297 more than 1000-fold subtype - selectivity to hkor can be achieved for jdtic and some of its derivatives. importantly, then, the message - address hypothesis does not uniformly apply to all hkor - selective antagonists. salvinorin a (sala), a naturally occurring diterpene from the widely abused hallucinogenic plant salvia divinorum, represents an exceedingly potent (ec50 = 1 nm) and selective kor agonist (> 1000-fold). sala is unique compared to other kor ligands in that it lacks a charged or polar nitrogen atom to anchor it in the binding pocket. extensive site - directed mutagenesis, scam (substituted cysteine - accessibility mutagenesis) and sar studies on sala and its analogues have been performed, indicating (among others) that the 2-acetoxy moiety interacts with cys315 (ref). possible modes of interaction between the cysteine - reactive and ultra - potent agonist and sala analog 22-thiocyanatosalvinorin a (rb-64 ; ki = 0.59 nm ; ec50 = 0.077 nm), and the hkor structure were thus evaluated. exposure of hkor to rb-64 produces irreversibly - bound, wash - resistant adducts that are tethered to cys315 (ref). as the thiocyanate group contains two electrophilic centers, two distinct adducts may be formed, increasing the mass by either 463 or 431 amu. docking studies using gold predict that the salvinorin 2-position can access cys315 while maintaining many of the interactions implicated by site - directed mutagenesis for sala, providing a possible mechanism for the formation of the kor additionally, the docking results serve as a model of the initial recognition process of sala - related agonists of the hkor in an inactive state, although additional studies will be needed to fully elucidate the nature of the sala - induced activation mechanism. the jdtic - hkor crystal structure has uncovered a combination of key features shared with chemokine and aminergic gpcrs along with unique structural details characteristic of the opioid subfamily. the hkor was crystallized as a parallel - dimer with contacts involving helices i, ii and viii. while the existence of gpcr dimers in vivo and their physiological relevance remain highly debatable, several distinct potential dimer interfaces are starting to emerge from crystallographic and biochemical studies. such multiple dimerization interfaces may serve to support different functional pathways, as well as to promote oligomeric assembly of gpcrs. analysis of the ligand - receptor interactions has revealed important molecular details responsible for the exceptionally high affinity and subtype selectivity of jdtic a small molecule antagonist with a broad therapeutic potential. the elucidation of a large binding cavity with a multitude of potential anchoring points begins to explain both the extreme structural diversity of hkor drugs and differences in their receptor interaction modes, as supported by differential effects of various site - directed mutations on the binding properties of chemically diverse prototypic ligands. the structure clearly provides a long anticipated molecular framework for understanding opioid drug action, and thereby affords valuable new opportunities for a structure - based discovery of new drugs with ideal pharmacological properties. sf9 cells were solubilized using 1% (w / v) n - dodecyl--d - maltopyranoside (ddm) and 0.2% (w / v) cholesteryl hemisuccinate (chs), and purified by immobilized metal ion affinity chromatography (imac), followed by reverse imac after cleaving n - terminal flag-10xhis tags by his - tagged tobacco etch virus (tev) protease. the purified protein was mixed with monoolein and cholesterol in a ratio of 40%:54%:6% (w / w) to form lipidic cubic phase (lcp) from which the receptor was crystallized. crystals were grown at 20 c in 45 nl protein - laden lcp boluses overlaid by 800 nl of precipitant solutions as described in methods. x - ray diffraction data were collected on the 23id - b / d beamline (gm / ca cat) at the advanced photon source, argonne, il using a 10 m minibeam at wavelength of 1.0330. modeling of jdtic analogues and hkor - selective morphine derivatives nor - bni and gnti was performed using icm - pro ; sybyl - x 1.3 and gold suite 5.1 were used to model rb-64 complexes, as described in methods. full methods and any associated references are available in the online version of the paper at www.nature.com/nature.	opioid receptors (ors) mediate the actions of endogenous and exogenous opioids for many essential physiological processes including regulation of pain, respiratory drive, mood, and, in the case of -opioid receptors (kor), dysphoria and psychotomimesis. here we report the crystal structure of the human kor (hkor) in complex with the selective antagonist jdtic, arranged in parallel - dimers, at 2.9 angstrom resolution. the structure reveals important features of the ligand binding pocket that contribute to jdtic s high affinity and subtype - selectivity for hkor. modeling of other important kor - selective ligands, including the morphinan - derived antagonists nor - bni and gnti, and the diterpene agonist salvinorin a analog rb-64, reveals both common and distinct features for binding these diverse chemotypes. analysis of site - directed mutagenesis and ligand structure - activity relationships confirms the interactions observed in the crystal structure, thereby providing a molecular explanation for hkor subtype - selectivity along with insight essential for the design of hkor compounds with new pharmacological properties.
procyanidins are the second most abundant natural phenolic after lignin, and they are widely distributed in fruits, berries, beans, nuts, cocoa, and wine. they participate in glucose homeostasis and modulate insulin synthesis, secretion, and degradation. moreover, changes in -cell insulin production may also be due to variations in the number of insulin - producing cells. -cell mass adapts to increased metabolic demands caused, for example, by obesity, pregnancy, or insulin resistance. however, when -cells are unable to compensate for increased insulin demand, there is a decrease in -cell mass characteristic of the onset of type 2 diabetes mellitus (t2 dm). moreover, they protect cells from diverse drug- or chemical - induced toxic assaults by decreasing apoptosis and inducing cell growth. however, there is little information available regarding their effects on -cells. other studies by our research group have reported that procyanidins modulate proliferation and apoptosis of the pancreatic -cell line ins-1e under altered conditions. procyanidins also alter the protein and/or gene expression of factors involved in apoptosis in zucker fatty rats. obesity has become a worldwide problem, leading to an explosion of obesity - related health issues. obese individuals develop resistance to the cellular actions of insulin, a key etiological factor for t2 dm, which is also becoming an epidemic. t2 dm is characterised by peripheral insulin resistance as well as pancreatic -cell dysfunction and decreased -cell mass. these lifestyle changes, involving high - energy diets and reduced physical activity, are linked to the pandemics of obesity and t2 dm. given the high prevalence of the disease, obtaining knowledge about natural compounds with potential beneficial effects on glucose homeostasis is of great interest. several animal models have been used to study obesity, including both genetic and diet - induced obesity models. however, the cafeteria diet is a more robust model to reproduce the diet in western society. in a previous study, we analysed the effects of procyanidins in an insulin resistance model induced by cafeteria diet administration in female wistar rats. we also considered the effects of the cafeteria diet on insulin production and apoptosis in the pancreas. the study showed that the cafeteria diet increased insulin production as well as activated apoptosis biomarkers. furthermore, procyanidin administration caused a reduction in the homeostasis model assessment for insulin resistance (homa - ir) index, suggesting improved insulin resistance. moreover, in the pancreas, procyanidins caused a decrease in insulin production and modulated pro- and antiapoptosis markers. the pharmacokinetics and pharmacodynamics in females are different from the same parameters in males because of the female 's unique anatomy and physiology [16, 17 ]. thus, the aim of the present study was to evaluate the effects of gspe in male wistar cafeteria - induced obese rats and to compare the results on insulin synthesis, apoptosis, and proliferation in the pancreas with those observed in the previous study of female rats. the procyanidin extract was derived from grape seed and contained the following : catechin (58 mol / g), epicatechin (52 mol / g), epigallocatechin (5.50 mol / g), epicatechin gallate (89 mol / g), epigallocatechin gallate (1.40 mol / g), dimeric procyanidins (250 mol / g), trimeric procyanidins (15.68 mol / g), tetrameric procyanidins (8.8 mol / g), pentameric procyanidins (0.73 mol / g), and hexameric procyanidins (0.38 mol / g). wistar male rats weighting between 250330 g were purchased from charles river laboratories (barcelona, spain) and housed in animal quarters at 22c with a 12 h light / dark cycle. after 1 week in quarantine, the animals were divided in two groups, a diet - control group (7 animals) fed a standard diet (panlab a03) and a cafeteria group (21 animals) fed a cafeteria diet (bacon, biscuits with pt, biscuits with cheese, muffins, carrots, and milk with sugar) in addition to standard chow and water. every day at 9 am, food was withdrawn, and it was replaced at 6 pm. afterwards, the diet - control group and 7 animals from the cafeteria - fed group were sacrificed, as a reference for the state of the animals before the beginning of treatment. the rest of the cafeteria - fed rats were divided in two subgroups (7 animals / group). these two groups were the (i) cafeteria group : rats treated with a vehicle (gum arabic 5% w / v) and the (ii) gspe - treated group : rats treated with 25 mg of gspe / kg of body weight (bw) per day. the treatment was administrated every evening for 21 days before the replacement of the food. three days before the end of the treatment and after 8 h of fasting, blood was collected from the tails of the rats to measure glucose and insulin levels. at the end of the treatment regimen and after 3 h of fasting, the animals were anesthetised using sodium pentobarbital (50 mg / kg of bw, sigma - aldrich, st. the pancreas was isolated from all of the animals, frozen immediately in liquid nitrogen, and stored at 80c until analysis. all of the procedures were approved by the experimental animals ethics committee of the universitat rovira i virgili. insulin plasma levels were assayed using an elisa method following the manufacturer 's instructions (mercodia, uppsala, sweden). glucose plasma levels were determined using an enzymatic colorimetric kit (qca, amposta, spain). the homa - ir and homa- were calculated using the fasting values of glucose and insulin and the following formulas : (1)homa - ir = insulin (u / ml) glucose (mm) 22.5,homa-=20insulin (u / ml) glucose (mm)3.5. triglycerides (tag) and nonesterified fatty acids (nefas) from the pancreas were extracted by homogenising the tissue with pbs containing 0.1% triton x-100 (sigma - aldrich, st. louis, mo), and their concentrations were determined using enzymatic colorimetric kits (qca, amposta, spain for tag and wako chemicals gmbh, neuss, germany for nefas). the pancreas was homogenised with six volumes of pbs containing 50 mm edta at ph 7.4 and centrifuged at 3000 g for 5 min at 4c. reactive oxygen species (ros) in the supernatants were quantified using 20 m dcfh - da (2,7-dichlorofluorescin diacetate) (sigma - aldrich, st. louis, mo), and the fluorescence was measured after 50 minutes at 37c at ex = 485 nm and em = 530 nm. the values were normalised to the protein content, which was analysed by the bradford method. total rna from the pancreas was extracted using the rneasy mini kit (qiagen, barcelona, spain). cdna was generated with the high - capacity cdna reverse transcription kit (applied biosystems, madrid, spain) and was subjected to quantitative real - time pcr amplification using the taqman master mix (applied biosystems, madrid, spain). specific taqman probes (applied biosystems, madrid, spain) were used for each gene : rn99999125_m1 for bcl2, rn01480160_g1 for bax, rn01492401_m1 for ccnd2 (cyclin d2), rn01774648_g1 for ins, and rn00565544_m1 for cpe. reactions were run on a quantitative rt - pcr 7300 system (applied biosystems, madrid, spain) according to the manufacturer 's instructions. the protein levels of bax and bcl-2 were quantified by western blot as previously described. 25 g of protein was loaded onto the gel, and the antibody dilution was 1 : 1500 for bax and bcl-2. after incubation with peroxidase - conjugated monoclonal anti - rabbit secondary antibody (sigma - aldrich, madrid, spain) at a 1 : 10000 dilution, immunoreactive proteins were visualised with the ecl plus western blotting detection system (ge healthcare, buckinghamshire, uk). chemiluminescence and densitometric analysis of the immunoblots was performed using imagej 1.44p software, and all proteins were quantified relative to the loading control. we first examined the effects of the cafeteria diet on pancreatic insulin production after 52 days of diet administration. insulin and glucose plasma levels were quantified at day 49, and the cafeteria diet - fed rats showed significantly higher plasma insulin levels and no changes in glucose levels (table 1). the homa - ir index indicated that the cafeteria - fed animals had peripheral insulin resistance, and their homa- index tended to increase (table 1). therefore, there was a tendency to increase pancreatic functionality response to glucose in order to counteract peripheral insulin resistance. the increased plasma insulin levels agree with an increase in the insulin gene expression, as well as with increased gene expression of carboxypeptidase e (cpe) (table 2). after induction of obesity via the cafeteria diet, rats were treated with 25 mg / kg of bw gspe for 21 days, concomitantly with cafeteria diet administration. the animals treated with the procyanidin extract had lower insulinemia and decreased homa - ir and homa- indexes (table 1), counteracting the effects observed in the cafeteria - fed rats. moreover, insulin gene expression tended to decrease in these rats, and decreased expression of cpe was also observed (table 3). to examine the effects of the cafeteria diet and gspe on apoptosis and proliferation in the pancreas the cafeteria - fed rats showed a decrease in the antiapoptotic marker bcl-2 at both the gene (table 2) and protein levels (figure 1(a)). for the pro - apoptotic marker bax, the mrna levels of this gene were not significantly altered (table 2), but we did observe an increase in the protein levels of bax in the cafeteria - diet - fed group (figure 1(a)). therefore, the ratio of bcl-2/bax was reduced both at the gene and protein levels, suggesting an increase in apoptosis in the pancreas (table 2 and figure 1(a)). the administration of gspe had no effect on bcl-2 and bax at gene expression compared to the cafeteria diet (table 3) and on bcl-2 at protein expression (figure 1(b)). in contrast, bax protein levels were increased by the gspe treatment, enhancing the effects observed in the cafeteria - fed rats (figure 1(b)). the ratio of bcl-2/bax was significantly reduced at protein level (figure 1(b)) compared to the cafeteria - fed animals. finally, we also analysed cyclin d2, a proliferation marker, but no changes were observed in the cafeteria - fed animals or in the gspe - treated rats (table 2). pancreas malfunction is in part due to the accrual of tag in its cells. to measure it, we examined the tag content in this tissue and found that tag triplicated its levels in the pancreas of cafeteria - fed rats compared to the standard - diet - fed rats (33.15 2.7 versus 11.42 0.3 g tag / mg tissue, p 0.01). after 21 days of treatment, the tag contents in the pancreas increased, due to cafeteria diet, but gspe avoided this (figure 2). in contrast, the content of nefas was not modified neither in the cafeteria group compared to the standard - diet - fed rats (3.37 0.9 versus 4.40 0.4 g nefa / mg tissue) nor in the gspe - treated rats compared to the vehicle - treated rats (2.43 0.3 versus 10.29 4.6 g nefa / mg tissue). ros content in the pancreas was also analysed, and no significant differences were observed in either the cafeteria - fed rats or in the gspe - treated animals (figure 3). this study was designed to examine the effects of the cafeteria diet on insulin production in male wistar rats by evaluating pancreas functionality, apoptosis, and proliferation. we have also evaluated the effects of procyanidins on these processes, since procyanidins were shown to have positive effects on glucose metabolism under conditions of slightly disrupted homeostasis. we had previously shown that 17 weeks of a cafeteria diet led to insulin resistance, high plasma insulin levels, and increased insulin synthesis and secretion in female wistar rats. it has been reported that female rats are more sensitive to cafeteria - induced obesity than males [20, 21 ]. however, with respect to insulin resistance, we now show that 52 days of cafeteria diet (nearly 7 and a half weeks) administrated to male wistar rats confirms the effects observed in the previous study of female rats. in the males, we have observed high insulin plasma levels and elevated homa - ir index, indicating peripheral insulin resistance. additionally, we have seen an elevated homa- index, which indicates an increase in pancreatic functionality in terms of glucose response to counteract peripheral insulin resistance. we have also found an increase in the expression of the insulin gene in the cafeteria - fed rats and an increase in the gene expression of cpe. cpe is the enzyme thought to be involved in the cleavage of proinsulin, which results in insulin and c - peptide molecules. therefore, the pancreas of cafeteria diet - fed rats is still functional, and it tries to counteract peripheral insulin resistance despite the increased lipid accumulation in the pancreas. increased deposits of fat are associated with obesity and lead to an increase in free fatty acids (ffas). the induction of apoptosis in in vivo high - fat diet models and in vitro models of ffa - induced apoptosis is important evidence for -cell lipotoxicity. in mice, administration of a high - fat diet for 12 weeks led to increased -cell mass, despite showing an increase in -cell apoptosis. in our study, we have found a decrease in the bcl-2/bax ratio both at the gene and protein levels in the pancreas of the cafeteria - fed rats compared to the standard chow - fed rats which also suggest an increase in apoptosis in the cafeteria - fed animals. palmitate was reported to induce -cell endoplasmic reticulum stress and death mediated by cpe degradation [26, 27 ]. we have found that cpe is not decreased but increased by the cafeteria diet, suggesting that the apoptosis observed in the cafeteria - fed rats is not mediated by lipotoxicity. in fact, the levels of nefa in the pancreas are not altered in the cafeteria - fed rats when compared to the standard - diet - fed rats. the results from the apoptosis markers are in accordance with the data obtained in the previous study which evaluated the cafeteria diet in wistar female rats. we have also analyzed the expression of the proliferation marker cyclin d2 and found no changes due to the cafeteria treatment suggesting that at the time of the analysis, -cell mass had likely already increased. this also agrees with the pervious results in females, as well as with those found in rats fed high fat diets, in which no changes in ki67 (a proliferation marker) expression were observed. taken together, the data suggests that the effects of the cafeteria diet on insulin synthesis, secretion, and apoptosis are not influenced by gender or treatment duration. once the effects of the cafeteria have been established, we have analyzed the effects of a gspe treatment on the cafeteria - fed animals. after 52 days of cafeteria diet administration, male wistar rats have been treated with 25 mg / kg of gspe for 21 days concomitant with the cafeteria diet. the gspe treatment has decreased insulin production, plasma insulin levels, and pancreatic insulin cpe gene expression compared to the cafeteria - vehicle - fed rats. moreover, the decreased insulin production could be at least in part explained through gspe 's lipid - lowering effect, since the triglyceride content has also been reduced in the pancreas of gspe - treated rats. previously, we showed that 25 mg of gspe / kg of bw administered to female wistar rats for 30 days resulted in decreased insulin production and reduced triglyceride content in the pancreas, likely via decreased fatty acid synthesis and increased -oxidation. despite this lower insulinemia, gspe improved glycemia in female wistar cafeteria - fed rats acting peripherally on adipose tissue. present results reinforce the effects of gspe decreasing insulin production and ameliorating lipid accumulation in cafeteria - fed rats and support that these effects are not gender dependent. gspe has counteracted the effects of the cafeteria diet reducing the accumulation of triglycerides in the pancreas but has not counteracted the cafeteria - diet effects on the apoptosis markers. instead, gspe - treated rats have shown an increase in bax protein levels and a decreased ratio of bcl-2/bax, suggesting an enhancement in the apoptosis. therefore, the lipid - lowering effects of gspe do not involve a reduction in apoptosis in the pancreas of cafeteria - fed male rats. in fact, gspe increases glucose uptake in -cells under high - glucose conditions and impairs mitochondrial and cellular membrane potentials. moreover, gspe is reported to enhance the pro - apoptotic effects of high glucose in vitro. therefore, the enhanced apoptosis observed in the gspe - treated rats could be due to increased glucose uptake in the -cells that potentiate glucotoxicity. ros is one of the players in glucose - induced apoptosis in -cells ; ros is increased as a consequence of chronically increased glucose metabolism. -cells have relatively low expression of antioxidant enzymes and are more sensitive to ros attack when they are exposed to oxidative stress. however, the levels of ros in the pancreas have not been modified by the cafeteria diet or by gspe treatment, suggesting that glucose toxicity could be mediated by another mechanism. the apoptosis marker results conflict with those in the previous study of female wistar rats, which showed that 25 and 50 mg / kg of gspe seemed to counteract the deleterious effects of the cafeteria diet by inhibiting the down - regulation of bcl-2 protein expression after 10 and 30 days of treatment. in addition, 50 mg / kg bw of gspe also counteracted the decrease in the bcl-2/bax ratio at the protein level after 10 days of administration. however, no gspe effects were observed with respect to the ratio of bcl-2/bax gene expression at any dose or treatment duration. therefore, the modulation of apoptosis biomarkers by gspe in cafeteria - fed rats is clearly dependent on the dose and treatment period ; these effects may also be dependent on gender. in conclusion, the present study has confirmed that the cafeteria model is a suitable reproduction of the prediabetic state. this model induces an insulin resistance state, shows increased insulin synthesis and secretion, and exhibits increased apoptosis in the pancreas. moreover, gspe treatment in male rats treated with 25 mg / kg of gspe for 21 days improves the insulin resistance state and counteracts the cafeteria - induced effects on insulin synthesis. however, procyanidins enhance the elevated levels of bax, a pro - apoptotic protein observed in the cafeteria - fed rats, potentially suggesting an increase in apoptosis. this result indicates that the effects of gspe on apoptosis markers are dose, time, and/or gender dependent.	in a previous study, the administration of a grape seed procyanidin extract (gspe) in female wistar rats improved insulin resistance, reduced insulin production, and modulated apoptosis biomarkers in the pancreas. considering that pharmacokinetic and pharmacodynamic parameters in females are different from these parameters in males, the aim of the present study was to evaluate the effects of gspe on male wistar cafeteria - induced obese rats. the results have confirmed that the cafeteria model is a robust model mimicking a prediabetic state, as these rats display insulin resistance, increased insulin synthesis and secretion, and increased apoptosis in the pancreas. in addition, gspe treatment (25 mg / kg of gspe for 21 days) in male rats improves insulin resistance and counteracts the cafeteria - induced effects on insulin synthesis. however, the administration of the extract enhances the cafeteria - induced increase in bax protein levels, suggesting increased apoptosis. this result contradicts previous results from cafeteria - fed female rats, in which gspe seemed to counteract the increased apoptosis induced by the cafeteria diet.
primary nasopharyngeal adenocarcinomas (npacs) are extremely rare malignant tumors accounting for 0.38% to 0.48% of all malignant nasopharyngeal neoplasms and 0.70% of all nasopharyngeal carcinomas. these properties mean that the treatment of choice for these tumours is total surgical resection of the primary tumor, and this has an excellent prognosis. traditionally, because of the anatomic complexity of the nasopharynx, resection of nasopharyngeal tumors has used an external approach. however, here we suggest that an alternative exclusively endoscopic surgical strategy should be considered. this is because this tumor type is pedunculated, histologically relatively non - aggressive and, further, we have now refined our existing published endoscopic technique and successfully used it to resect different types of tumour [2 - 9 ]. here we describe our exclusively endoscopic approach for the resection of primary nasopharyngeal adenocarcinoma. to the best of our knowledge, this is the first time to excise the nasopharyngeal adenocarcinoma via the strictly endoscopic approach. the first case is a 28-year - old female with the symptoms of nasal bleeding for about 3 weeks. was noted by nasopharyngoscopic exam and biopsy with magnetic resonance imaging (mri) was performed. mri showed an approximate 1.5 cm pedunculated nodule attaching on the left lateral wall (fig. 1). the second case is a 58-year - old male with the symptoms of blood tinged sputum for about 1 month. mri showed an approximate 2.2 cm pedunculated nodule occupying the nasopharyngeal airway, from the nasopharyngeal roof. the pathologic biopsy report of both patients showed low - grade papillary adenocarcinoma composed of papillary fronds lined by pseudostratified columnar cells with bland unclei. according to the preoperative pathologic biopsy the operations were performed under general anesthesia with our patient placed in a semi - sitting position. prior to surgery, the nasal turbinates were decongested using cotton packs saturated with 1:100,000 bosmin for 15 minutes. the posterior half of the nasal septum, vomer, and inferior turbinate of the lesion site were excised to create a working space for the endoscope and to expose the tunour. endoscope versatility has improved considerably in recent years, and by using a 4 mm diameter, 0 degree, 30 degree, and 70 degree angle endoscope (karl - storz, tuttlingen, germany), it was possible to remove the exposed tumor completely leaving an adequate mucosal surgical margin. the lateral wall of the nasal cavity (including part of the eustachian tube), the roof (deep to the periosteum of skull base), and the posterior wall (deep to prevertebral fascia) were totally resected by a continued - wave, contact type of diomed 25 diode laser (diomed co., cambridge, uk). frozen sections prepared from the surgical margin tissue were assessed during the nasopharyngectomy to assess whether all the tumor had been removed. the wound surface was covered with a free mucosal flap harvested from the inferior nasal turbinate and held in place by absorbable gelform. the nasal cavity was packed with nasal packing and a balloon - inflated foley catheter for 72 hours after the operation. the 2 operations were performed successfully and all surgical resection margins were free of tumor. total operation times were 100 and 90 minutes respectively, and the patients were discharged from hospital only 4 to 5 days after surgery. as the resection margins were clear there was no need to perform postoperative radiotherapy or chemotherapy. one of the patients ' mri pre- and postsurgery is shown in fig. 1. low - grade papillary adenocarcinoma is one histologic pattern of the polymorphous low - grade adenocarcinoma. with a very low tendency for aggressive behaviour of this carcinoma, the recommended treatment of low - grade papillary adenocarcinomas is currently surgical excision, and the results are excellent. lymphatic spread been not been described in any case, so neck dissection is not normally necessary unless there is clinical evidence that suggests lymph node involvement has occurred. if it has not been possible to surgically resect all the tumor then adjuvant radiotherapy should be carried out to prevent tumor recurrence. in this study, the 2 tumors were excised radically with adequate margins, thus the postoperative radiotherapy was not performed. nasopharynx anatomical structure is extremely complex and so existing surgical techniques use a variety of open procedures including facial translocation, midfacial degloving, maxillary swing, lateral rhinotomy, or a transpalatal approach. the surgical approach that is used depends upon both the tumor extension and the surgeon 's experience and preference. in 2007, we have reported the minimally invasive endoscopic nasopharyngectomy in the treatment of recurrent t1 - 2a nasopharyngeal carcinoma. because of the pedunculated shape of nasopharyngeal adenocarcinomas, the relatively benign histological features of this type of tumour and also given the recent improvements in endoscopic technique and instruments [2 - 9 ], we think the exclusively endoscopic approach is feasible for selected nasopharyngeal adenocarcinoma. however, it is not the intent of this report to suggest that the exclusively endoscopic approach is superior to the conventional open approaches. instead, the goal of this study is to highlight the experience with the minimally invasive endoscopic approach at the early juncture. with respect to the anatomic limitations of exclusively endoscopic excision of nasopharyngeal adenocarcinoma, these would include tumor invasion to the central skull base bone superiorly, the pharyngobasilar fascia laterally, the prevertebral fascia posteriorly, and oropharynx inferiorly. if the extent of the tumor is found to be far beyond the nasopharynx during operation, we believe endosopic nasopharyngectomy can be changed to conventional open surgery without difficulty. first, primary nasopharyngeal adenocarcinomas are extremely rare ; we can not analyze the quality of life between our 2 cases and similar cases operated with a conventional open procedure. second, to gain a conclusive result, we need a larger series of patients with longer follow - up. however, the early results appear encouraging. not only for the early recurrent nasopharyngeal carcinoma we find that the procedure is curative, cuts down the length of the operation, decreases wound - related complications, shortens hospital stay, and moreover gives a better cosmetic outcome.	we reported two patients with nasopharyngeal adenocarcinoma resected by using the exclusively endoscopic approach. case reports and a review of the world literature concerning nasopharyngeal adenocarcinoma. the tumors were resected successfully via the exclusively endoscopic approach and no conversions to the conventional approach were necessary. the two patients were followed up for 26 and 18 months respectively, and no recurrence was noted without postoperative chemotherapy or radiotherapy. to the best of our knowledge, this is the first report of endoscopic resection of nasopharyngeal adenocarcinoma. our experience revealed that not only for the early recurrent nasopharyngeal carcinoma, the exclusively endoscopic nasopharyngectomy can be expanded for the resection of selected nasopharyngeal adenocarcinoma.
it has long been accepted that bipolar disorder has its peak onset in late adolescence to young adulthood. however, biederman and colleagues (wozniak., 1995) proposed that most cases of bipolar disorder have a preschool age onset and that irritability, not elevated mood, is the core feature. affective storms or prolonged and aggressive temper outbursts and with chronic and continuous rather than episodic and acute clinical course (biederman., 1996, in the same year, geller and colleagues (1995), in another departure from traditional concepts of manic depressive illness, proposed that most cases of bipolar disorder in children still exhibited elevated mood but also featured ultradian mood cycles several cycles of mania and depression per day. geller and luby (1997), in a review article in the journal of the american academy of child and adolescent psychiatry (jaacap), stated, pre - pubertal onset manic depressive disorder may present with continuous, mixed manic, rapid - cycling of multiple brief episodes. thus, children may be having a laughing fit and happily doing arts and craft when, without any environmental prompt, they suddenly become miserable and acutely suicidal (p. 1172) over the next decade these pediatric bipolar disorder (pbd) constructs gained acceptance in the united states. another review article in jaacap (pavuluri, birmaher, & naylor, 2005) noted that the national institute for mental health roundtable on pre - pubertal pbd, convened in april 2000, had termed the chronic irritable mood group broad phenotype pbd and the elevated mood group narrow phenotype pbd. when jaacap published (kowatch., 2005), a commentary (mcclellan, 2005) raised doubts about the diagnostic validity of pbd, but skeptical articles in the literature were few. biederman (2006), although acknowledging the debate over the validity of pbd, asserted that the literature supported the diagnosis and that up to 20% of psychiatrically referred children satisfy criteria for bipolar spectrum disorders (p. 901). however, follow - up studies have shown that non - episodic irritable broad phenotype pbd does not progress to adult bipolar disorder, and thus it has been relabeled severe mood dysregulation (stringaris., 2010). this may have tempered the spread of pbd diagnoses ; nonetheless, publications like the recent book is your child bipolar ? (wozniak & mcdonnell, 2008), reviewed by levin (2010), still propound the broad as well as narrow versions of pbd. pbd was popularized to the public in the bestselling book the bipolar child : the definitive and reassuring guide to childhood 's most misunderstood disorder (papolos & papolos, 2000) and as the cover story of time magazine (kluger & song, 2002). both the book and the article suggested that bipolar disorder could begin in utero. advocacy groups like the child and adolescent bipolar foundation (www.bpchildren.com) and the juvenile bipolar research foundation (www.jbrf.org) provided parent education and an online diagnostic questionnaire. upon this background, diagnoses of bipolar disorder in children and youth increased 4,000% from 19941995 to 20022003 (moreno., 2007), and by 2004 pbd had become the most common diagnosis in u.s. its validity is questioned both academically (frances, 2010 ; parens & johnson, 2010) and increasingly in the public media through stories of heavily medicated children and conflicts of interest involving researchers and the pharmaceutical industry. psychiatry is as much social science as a biomedical discipline, and its tenets are subject to influence by the prevailing paradigm. we believe the phenomenon of pbd as a new, commonly used diagnostic entity confined mainly to the united states is best comprehended from a broad systemic perspective. such a perspective needs to explore beyond the pbd academic literature with its focus on symptom cluster analyses, neuroimaging, and medication responses to consider overarching paradigmatic shifts in psychiatry, particularly shifts in nosology and research methodology, individual and societal repression of trauma, the vagaries of managed care in the u.s. we acknowledge our skepticism, which is based on our clinical experience, reading of the literature and wider media, and communication with colleagues. differences in practice and training between the united states and other countries are factored in, with a focus on differences where we work australia (peter ignatius parry) and the united states (edmund c. levin). the media have reported several cases of the overmedication of very young children featuring the pbd diagnosis. the story of rebecca riley, diagnosed at age 2 and deceased from a medication overdose at age 4, is widely known (cbs 60 minutes, 2007). although rebecca died after her parents allegedly gave extra clonidine plus a cough medicine, the autopsy report indicated that her regime of clonidine, quetiapine, and divalproex had caused damage to her heart and lungs from prolonged abuse of these prescription drugs, rather than one incident another case involved destiny hager, diagnosed with pbd at age 3 and prescribed two antipsychotics concurrently : quetiapine, 600 mg / day ; and ziprasidone, unspecified dose. a 2008 cover story of newsweek was of max, a 10-year - old diagnosed and medicated around his second birthday. he was treated with 38 psychiatric drugs over the next 8 years (carmichael, 2008). the new york times recently highlighted the case of kyle warren, misdiagnosed with autism and pbd and treated with polypharmacy that commenced with an antipsychotic at 18 months of age. these cases signal a profound shift in the conceptualization and management of childhood emotional and behavioral problems. such changes in practice imply a shift in the paradigm under which psychiatry is practiced. kuhn (1962) proposed that science always proceeds in a social and historical context. the prevailing paradigm governs what is considered for study and treatment and what is not. under the influence of a paradigm, even research of high intellect, internal consistency, and technical quality can lead to false conclusions. eisenberg (1986), head of the american psychiatric association 's section on child and adolescent psychiatry, coined the terms brainless psychiatry and mindless psychiatry. these describe the poles of the pendulum swing from the pre - dsm - iii (diagnostic and statistical manual of mental disorders, 3rd ed.) excesses of speculative psychoanalysis, overly zealous family therapy, and the anti - psychiatry movement to the excessive biological reductionism of the past two decades. the dsm - iii, published in 1980, was a key turning point, and the paradigm shift was under way by january 1990 when president george h. bush declared the decade of the brain. since then there have been significant advances in neuroimaging, neurochemistry, and genomics. however, homo sapiens evolved as a social species, and the biopsychosocial model remains a more philosophically robust basis for the health sciences (borrell - carrio, suchman, & epstein, 2004). silove (1990), in the australian and new zealand journal of psychiatry, quoted eisenberg with his reference to mindless psychiatry and stated, australian psychiatry should consider the recent ideological shift in the usa to an extreme biological model of mental disorders the field is at risk of being overwhelmed by a reductionist (p. 461) in 1989, lipowski stated, after a period marked by one - sided emphasis on psychodynamic and social issues, or what could be called tasman (1999) noted that economic forces have diminished psychodynamic training in the united states to the extent that many fear we are in danger of training a generation of psychiatrists and physicians who lack a framework for understanding mental functioning from a psychodynamic perspective boyce (2006), in an address to the royal australian and new zealand college of psychiatrists, blamed the dumbing down of psychiatry on increased service demand, the deification of dsm, the influence of the pharmaceutical industry, a misunderstanding of evidence - based medicine (ebm), managerialism and the influence of consumerism commenting further on this paradigm shift, scull (2010) noted, a simplistic biological reductionism (has) increasingly ruled the psychiatric roost. it was biobabble as deeply misleading and unscientific as the psychobabble it replaced (p. 1247). it appears to us that the common application of the pbd diagnosis reflects research and clinical practice that, consistent with the prevailing paradigm, underutilizes psychodynamics, family dynamics, attachment, trauma, and context. frances (2010), the former dsm - iv task force chair, has gone so far as to critique pbd as a fad diagnosis of epidemic proportions. nonetheless, anecdotally it has been difficult for critics of pbd to publish in the psychiatric literature. in an era in which quantitative research is held in higher regard than qualitative research, it may be that contrary views about pbd are seen as opinion based and lacking data, reflecting a catch 22 : those who dispute the construct validity of pbd are unlikely to have generated data on something they do n't see. one published exception in jaacap was a commentary by mcclellan (2005) to the treatment guidelines. mcclellan bluntly stated, labelling tantrums as a major mental illness lacks face validity and undermines credibility in our profession (p. 238). he also stressed the traditional basics of child psychiatry : the developmental and family systemic context of children 's moods and behavior reflect complex problems interwoven with temperament, attachment, parent - child relationships, cognition and other moderating / mediating factors including trauma (p. 237). one aspect of this paradigm shift has been an emphasis on structured interviews and rating scales, which are necessary in research. however, this comes at the expense of introspection and reflection about the presenting phenomenology of patients in their life narrative and context. carlson (1998), despite being among the first to raise the issue of pre - pubertal mania, critiqued the checklist approach to diagnosis in pbd research. carlson and meyer (2006) noted, the diagnosis of bipolar disorder is often made by mindlessly applying criteria without understanding developmental history and context (p. 963) and went on to propose that bipolar research could benefit from a developmental psychopathology approach it can be argued that the extensive pbd research literature reflects a current biomedical reductionist and taxonomic approach to the phenomenology of children 's and teenagers behavior. einstein, whose ideas came more from intuition than calculation, hung a plaque in his office at princeton university that stated not everything that counts can be counted, and not everything that can be counted, counts 1995) have used subscales of the child behavior checklist (cbcl) to define broad phenotype pbd or juvenile bipolar disorder (jbd)hence cbcl - jbd. however, a 10-year follow - up of prepubertal children diagnosed by the cbcl - jbd was found to lack predictive validity into adolescence for bipolar disorder (halperin, rucklidge, powers, miller, & newcorn, 2011). a diagnostic checklist from the bipolar child and accessible online at www.jbrf.org also was found to lack predictive capacity for bipolar disorder in a study that used it retrospectively (rucklidge, 2008). blader and carlson (2007) found that a disproportionate number of afro - american children received the pbd diagnosis. j. harris (2005), a child psychiatrist working on a preteen inpatient unit in boston, noted that many children diagnosed with pbd were in foster care and had attachment trauma histories. edmund c. levin, dealing with children in a residential program on polypharmacy cocktails typical for treating pbd, found over a 2-year period that milligrams of psychotropic medications could be reduced by 80% while aggressive incident reports fell by 100%. the reductions became possible by tapering medications while addressing trauma, attachment, milieu, and other factors. most of the children at admission had a diagnosis of mood disorder not otherwise specified with comorbid attention - deficit / hyperactivity disorder. developmental trauma disorder (dtd ; van der kolk & courtois, 2005) was felt to better describe their presentations (levin, 2009). developmental trauma can predispose or precipitate those constitutionally vulnerable to major psychiatric disorders like schizophrenia and bipolar disorder into manifesting the illnesses, but the effects of trauma can also present as affective instability and other ego defenses that may superficially resemble psychotic or severe mood disorders. dissociation as a defense against trauma can particularly lead to symptoms easily confused with hypomanic and psychotic states (silberg & dallam, 2009). biomedical research is leading to significant advances in understanding brain development in the context of a child 's attachment relationships and the effects of attachment disruption and trauma (schore, 2002). attachment theory is a bedrock concept of child psychiatry and the wider field of developmental psychology. however, a search of the pbd literature for reference to attachment theory finds almost no mention of it (parry, 2010). louis group, who proposed what has since been termed narrow phenotype pbd, found no cases of posttraumatic stress disorder (ptsd) and only mentioned sexual abuse as a differential diagnostic consideration to manic hypersexuality. only 1% of their pbd cohort had a history of sexual abuse. this very low rate is at odds with the literature on child sexual abuse and is also low compared to a study (rucklidge, 2006) of narrow phenotype pbd that used the same diagnostic methodology. this study found that more than 50% had a history of trauma and 21% met criteria for lifetime ptsd (10% trauma exposure, 0% ptsd among controls). the harvard / massachusetts general hospital group, who proposed what has since been termed broad phenotype pbd, referenced wozniak. (1999) to hypothesize that ptsd occurs secondary to pbd (i.e., a child who develops pbd early in childhood may create stressful situations by misbehaving). that may then lead to the child 's being traumatized. herman (1992) posited that society is biased against the acknowledgement of trauma : all the perpetrator asks is that the bystander do nothing. he appeals to the universal desire to see, hear, and speak no evil. the victim, on the contrary, asks the bystander to share the burden of pain. the victim demands action, engagement, and remembering. (p. 7) thus, nuclear families and sole parents, struggling in a modern world of complex stressors that offers minimal extended family, tribe, or village - like support, are likely to be attracted to simple biomedical explanations for disturbed childhood emotions and behaviors particularly as such diagnoses imply no blame or need for difficult changes to the modern family. there is also the allure of a quick biomedical fix for both families and health providers, particularly pediatricians and psychiatrists, for whom writing a prescription may bestow a sense of action and assistance. although we find little coverage of these issues in the pbd research literature, academics have debated in the public media. pavuluri (carey, 2007b) enunciated the benefits of the diagnosis : these are kids that have rage, anger, bubbling emotions that are just intolerable for them, and it is good that this is finally being recognized as part of a single disorder (i.e., pbd). however, van der kolk, a psychiatrist prominent in ptsd research, said, the (pbd) diagnosis is made with no understanding of the context of their life. bipolar is being over diagnosed in children, and the major downside is that people then think they have a solution and are not amenable to listening to alternatives (which may not include drugs) (carey, 2007a). williams (2008) critiqued pbd from a systemic perspective and described a 10-year - old boy erroneously diagnosed with pbd who was concurrently on eight psychotropics. thus far, pbd has been a diagnosis mainly confined to the united states. illustrating this are differences at various child and adolescent psychiatry conferences. in 2009 at the american academy of child and adolescent psychiatry (aacap) conference in hawaii there were at least 40 presentations on pbd and a further half dozen in a session chaired by carlson about severe mood dysregulation as an alternative description for broad phenotype pbd. in contrast, there were zero presentations on pbd at both the 2009 australian and new zealand child and adolescent psychiatry (cap) conference in new zealand and the larger european society of cap conference in hungary. furthermore, the british national institute for health and clinical excellence (2006) guidelines on bipolar disorder specifically recommend against using the pbd diagnosis in clinical practice. a german survey of child psychiatrists (meyer, komann - bhm, & schlottke, 2004) found that only 8% had ever seen a pre - pubertal bipolar disorder case. why is this so ? one reason may be that the united states is one of the few nations to allow direct - to - consumer advertising. psychotropics and bipolar disorder have featured prominently in such advertising (healy, 2006). although the global media and practitioners and parents to hear of pbd, still the diagnosis has not erupted as in the united states. health system appear to induce diagnostic upcoding pressures that drive a higher rate of bipolar disorder diagnoses. diagnosis upcoding occurs wherever medical practitioners are under pressure to give a diagnostic label in order to provide treatment and be reimbursed. parry, furber, and allison (2009) surveyed australian and new zealand child psychiatrists about pbd. the survey noted that 90% thought pbd was over - diagnosed in the united states, 6% were unsure, and only 3.5% thought it was under - diagnosed or appropriately diagnosed by american colleagues. in discussion, u.s. blader and carlson (2007) postulated diagnosis upcoding as a reason for the increase in pbd. in light of such pressures, eist (1999), former president of the american psychiatric association, called the u.s. managed care health system corpricare, as the system primarily serves the profit interests of private insurers. in particular, corpricare has tended to disadvantage the provision of psychotherapies more so than pharmacotherapy. in australia, diagnosis upcoding has emerged with asperger 's disorder with children inappropriately labeled because the diagnosis confers educational and family financial welfare assistance (basu, 2010). but because it is based on clinical need, australia 's universal single payer health system does not require diagnoses for reimbursement for therapy and thus does not encourage a pbd epidemic. carlson alluded to causes other than upcoding for the pbd epidemic (carey, 2007b) : we are just inundated with stuff from drug companies, publications, throwaways, that tell us six ways from sunday that, oh my god, we 're missing bipolar. scull (2010) noted that the rise of biobabble makes priceless marketing copy and that drug money has come to dominate psychiatry. it underwrites psychiatric journals and psychiatric conferences (where the omnipresence of pharmaceutical loot startles the naive outsider) investigations by senator charles grassley, chair of the senate finance committee, question the relationships between the pharmaceutical industry and some academic psychiatry departments (grassley, 2008). internal industry documents indicate that companies seek a wider bipolar diagnosis to boost sales of antipsychotics. analysis of these documents (spielmans & parry, 2010) leads to the view that much psychiatric literature and continuing medical education would be better described as promoting marketing - based medicine rather than evidence - based medicine. this problem has been described by former chief - editors of the new england journal of medicine in industry - sponsored clinical research : a broken system some pharmaceutical company documents (spielmans & parry, 2010) detail how, with the expiration of patents for many antidepressants in the past decade, new markets have been required to meet commercial needs. with most so - called second - generation antipsychotics (sgas) still on patent, there has been interest in a wider bipolar diagnosis and a rebranding of sgas as mood stabilizers. researchers with theories that converged with industry goals were more likely to get financial support. there is nothing intrinsically wrong with this if evidence - based medicine is truly adhered to. the grassley committee, the new york times, and the wall street journal in their investigations focused upon some academic departments of child psychiatry. documents of interest included the 2002 annual report the johnson and johnson (j&j) center for pediatric psychopathology at the massachusetts general hospital (g. harris & carey, 2008), which stated, an essential feature of the center is its ability to conduct research satisfying three criteria : a) it will lead to findings that improve the psychiatric care of children ; b) it will meet high levels of scientific quality and c) it will move forward the commercial goals of j&j. no one would fault the first two criteria ; however, the third criterion is scientifically and ethically problematic. the report outlined the aims of the research : because parents, patients and clinicians are exposed to a media that frequently questions the validity of childhood disorders, genetic and brain imaging studies are needed to show the validity of these disorders as brain disorders that respond to medication. without such data, many clinicians question the wisdom of aggressively treating children with medications, especially those like neuroleptics. but it is not just the biopsychosocial factors acting upon the child and his or her family that need to be considered ; indeed, the societal pressures that act upon psychiatry and mental health services also need to be considered. the pharmaceutical industry spends vast sums of money on marketing, research, and continuing medical education, and furthermore economic pressures place pharmaceutical companies in fierce competition. in this context, the words of the chief executive officer of eli lilly, the manufacturer of zyprexa, as written in an internal e - mail, reveal pressures to find markets in the pediatric age group : the fact we are now talking to child psychs and peds and others about strattera means that we must seize the opportunity to expand our work with zyprexa in this same child - adolescent population (berenson, 2008). there has been growing awareness within the medical profession that liaisons with the pharmaceutical industry can be fraught with ethical dilemmas. as an editorial in the american journal of psychiatry with 26 signatories put it, the interacting system of industry - supported clinical trials, advisory boards, and speakers bureaus not always, but nonetheless too often, has resulted in conflicts of interest that have demeaned both psychiatry and the pharmaceutical industry healy and lenoury (2007) considered that as industry and others gain from the diagnosis, pbd can even be likened to a case of munchausen 's by proxy. wittgenstein proposed that language and concepts affect perception (i.e., what is in our vocabulary we see ; what is not can easily remain invisible). in psychiatric nosology, scull (2010) pointed to the dsm - iii, saying the revolution came in the form of an anti - intellectual system published in book form : a checklist approach to psychiatric diagnosis and treatment with scant regard for whether the new labels lane (2007) interviewed several on the dsm - iii task force to conclude that a political agenda to depose psychoanalysis from its perch atop psychiatry 's power structure drove the despite significant advances in the attachment theory and traumatology research literature, both the dsm - iii and dsm - iv have generally not incorporated this work. silberg and dallam (2009), focusing on dissociation in children and its association with disorganized attachment, relational stress, and trauma, noted that children with dissociative disorders are frequently misdiagnosed because of their comorbid symptomatology, and one factor is because child - specific categories of dissociation do not exist in dsm - iv (p. 70). the problem for psychiatric nosology is that diagnoses, including pbd within the bipolar disorder not otherwise specified rubric, lack relational context and suffer from reification and oversimplification (dignam, parry, & berk, 2010 ; parry, 2009). neuroimaging of children with disorganized attachment and trauma histories has revealed impaired right prefrontal cortex control over a hyperactive right amygdala. this can be explained in terms of the function of these structures in attachment relationships and for survival in the face of threat (schore, 2002). neuroimaging of children diagnosed with pbd (delbello, 2009 ; pavuluri, 2009 ; pavuluri, passarotti, harral, & sweeney, 2009) found essentially the same findings but made no reference to attachment and trauma factors. as it specifically deals with attachment issues, dtd can be proposed as a more accurate descriptor for many children diagnosed with pbd (levin, 2009). however, dtd is not officially within the dsm - iv. thus, in the pbd neuroimaging research attention - deficit / hyperactivity disorder and pbd receive consideration, but dtd and attachment and contextual factors do not appear to. hyman, former director of the national institute of mental health, has said, the (pbd) diagnosis has spread too broadly, so that powerful drugs are prescribed too widely we are going to have hell to pay in terms of side effects (groopman, 2007, p. 31). primary suspect was an atypical (antipsychotic) and more than 1,300 reports of other serious side effects. g. harris, carey, and roberts (2007) reported, in 2006 alone the [food and drug administration ] received reports of at least 29 children dying and at least 165 more reports of other serious side effects in children where an antipsychotic was listed as the primary suspect. harris (2008) also reported that from 1993 through the first three months of 2008, 1,207 children given risperdal suffered serious problems, including 31 who died. this investigative journalism used similar research methodology (personal communication, g. harris with p. i. parry, 2008) as academic research by moore, cohen, and furberg (2007 ; personal communication, moore with p. i. parry, 2008), which found that atypical antipsychotics figure highly as a primary cause of death in all age groups on the food and drug administration database. in addition, although sgas are supposedly low in extrapyramidal side effects, 430 children in foster care in the state of texas in 2004 were prescribed antidyskinetics drugs to control side effects from antipsychotics the academic literature (wonodi., 2007) adds concern with a finding of a 6% rate of tardive dyskinesia in a cohort of 5- to 18-year - olds on sgas for over 6 months. (2008) have drawn further academic attention to the harms of polypharmacy for texas foster children. in addition to physical morbidity and mortality, there can be adverse effects on a young person 's self - concept and psychosocial development from an erroneous label of pbd (purcell, 2007). it can also be argued that parent - child communication is constricted in meaning if reduced to, or overly focused upon, the vocabulary of mental symptoms and medication. there are signs that psychiatry 's paradigmatic pendulum may be swinging back from the mindless extremity of its arc. a 2-day workshop (parens & johnson, 2010) on controversies in pbd attended by some leading figures in child psychiatry concluded that the bipolar label may fit poorly many of the children who have received it over the last decade (p. 20) and highlighted the importance of a child 's social context. the workshop also pointed to problems of diagnostic upcoding : it is a deeply regrettable feature of our current mental health and educational systems that some dsm diagnoses are better than others at getting children and families access to the care and services they so desperately need. the 2010 aacap meeting included two symposia on pbd (aacap, 2010a, 2010b), both questioning the diagnosis in many cases and highlighting research on contextual factors in affect regulation. finally, one sign of change coming from the highest levels of the aacap is that a september 2, 2010, new york times article on kyle warren (wilson, 2010) was e - mailed to all members of the aacap by the president, larry greenhill. professor greenhill requested that aacap members please take a moment to read the article and watch the (associated) video.	objectivepediatric bipolar disorder (pbd) reflects shifts in conceptualizing bipolar disorder among children and adolescents since the mid-1990s. since then, pbd diagnoses, predominantly in the united states, have increased dramatically, and the diagnosis has attracted significant controversy. during the same period, psychiatric theory and practice has become increasingly biological. the aim of this paper is to examine the rise of pbd in terms of wider systemic influences.methodin the context of literature referring to paradigm shifts in psychiatry, we reviewed the psychiatric literature, media cases, and information made available by investigative committees and journalists.resultssocial historians and prominent psychiatrists describe a paradigm shift in psychiatry over recent decades : from an era of brainless psychiatry, when an emphasis on psychodynamic and family factors predominated to the exclusion of biological factors, to a current era of mindless psychiatry that emphasizes neurobiological explanations for emotional and behavioral problems with limited regard for contextual meaning. associated with this has been a tendency within psychiatry and society to neglect trauma and attachment insecurity as etiological factors ; the atheoretical (but by default biomedical) premise of the diagnostic and statistical manual of mental disorders (3rd and 4th eds.) ; the influence of the pharmaceutical industry in research, continuing medical education, and direct - to - consumer advertising ; and inequality in the u.s. health system that favors diagnostic upcoding. harm from overmedicating children is now a cause of public concern.conclusionit can be argued that pbd as a widespread diagnosis, particularly in the united states, reflects multiple factors associated with a paradigm shift within psychiatry rather than recognition of a previously overlooked common disorder.
both prospective and retrospective studies have shown that hemiplegic stroke patients are at a high risk of fall throughout their post - stroke lifespan1. although previous studies have reported varying fall rates among hemiplegic stroke patients, there is a general consensus regarding the higher fall rate in stroke patients compared to the general population of the same age2, 3. falls are a common and serious complication after stroke4, and approximately one - third of hospital - related falls lead to potentially serious injuries, such as a fracture5. given that falls in stroke patients are associated with lower rehabilitation potential and functional recovery6, prevention of falls is a major rehabilitation goal. although the physical consequences of a fall receive the most attention, the psychosocial effects are also important. one of these psychosocial effects is the fear of falling. falling and fear of falling form a vicious circle. the experience of falling increases the fear of falling, and the fear of falling decreases physical activity, resulting in deconditioning. deconditioning leads to decreased physical activity, resulting in lower functioning that increases the incidence of falls in stroke patients7,8,9. the negative effect that the fear of falling has on rehabilitation emphasizes the need for physical therapists to be aware of this fear in hemiplegic stroke patients. assessment is the first step in developing a targeted rehabilitation intervention. choosing an appropriate tool that measures the fear of falling is the foundation for planning an appropriate course of therapy for post - stroke intervention and assessing the effects of an intervention10. despite a shift that places emphasis on task - oriented evaluation and self - efficacy in rehabilitation assessment and management of chronic disease11, use of a self - reported scale is insufficient in most environmental contexts. the falls efficacy scale (fes) developed by tinetti.12 is an instrument based on the theory of self - efficacy. the fes is designed to measure self - perceived fear of falling during the performance of 10 common activities, including dressing, toileting, and preparing meals. the authors investigated its reliability in ambulatory individuals aged over 65 years and reported a test - retest reliability of 0.7112. understanding individual factors such as the level of confidence and the emotional responses of a patient working toward a particular post - stroke goal could help health professionals appreciate the different responses to rehabilitation13 ; therefore the fes, which measures balance confidence, is useful for the physical therapist. although the fes is used for measuring the fear of falling in hemiplegic stroke patients14, its psychometric properties have not been fully investigated. hellstrm.15 reported the scaling properties and the test - retest reliability of an extended version of the fes. responsiveness of the fes was investigated through comparison with the berg balance scale and the fugl - meyer balance subscale. the results of a previous study suggested that the fes is responsive and useful for measurement of perceived confidence in task performance16. after development of the fes, several studies have investigated its use in the general elderly population. studies that examined the psychometric properties of the fes were conducted on the basis of the classical test theory. when investigating the psychometric properties of the fes in a clinical population, such as in patients with hemiplegic stroke, rasch analysis, which is a specific application of the item response theory that is based on the application of a related mathematical model, is appropriate17, 18. rasch analysis is less sample - dependent and more broadly useful than the classical test theory because it provides a more comprehensive understanding of the latent structure of the test19. the purpose of this study was to investigate the psychometric properties of the fes using rasch analysis in patients with hemiplegic stroke. through this investigation the study sample was chosen from a group of community - dwelling hemiplegic stroke patients visiting a convalescent or rehabilitation center for disabled individuals in south korea. inclusion criteria were as follows : (1) presence of hemiplegia, (2) score on the korean version of the mini - mental state examination (mmse - k) > 21, and (3) age > 65 years. study approval was received from the ethics review board of our affiliated university, and written informed consent was obtained from all participants. participants responses to the questionnaire and their measurements were analyzed ; none had missing data. participants ages ranged from 65 to 89 years, with an average of 70.73 3.06 years. stroke duration since diagnosis ranged from 6 to 480 months, with an average of 103.87 38.69 months. participants scores on the mmse - k ranged from 21 to 30, with a mean of 27.71. there were 10 items using a 10-point ordinal scale included in the fes, with a total possible score of 100 points. the korean fes items were as follows : (1) take a bath or shower, (2) reach into the closet, (3) do light housekeeping (e.g., clean up your nightstand or dresser), (4) walk around the nursing home, (5) get in and out of bed, (6) get up at night to go to the bathroom, (7) get in and out of a chair, (8) get dressed and undressed, (9) do personal grooming (e.g., wash your face, comb your hair), and (10) get on and off the toilet. the rasch model assumes that an item response is the result of an interaction between the scale item and the respondent s ability. the strength of rasch analysis lies in its investigation of the construction and validation of health status questionnaires for various patient groups, including stroke patients21,22,23. in this study infit and outfit mean square (mnsq) statistics were used to confirm unidimensionality. unidimensionality examines whether all items contribute adequately to the scale s domain and identifies any misfit items. in this study, if the item or subject was in the range of 0.60 to 1.40 or had a z - value between 2.0 and 2.0 for the infit, it was considered to have an appropriate model fit24. in rasch analysis, each item is explained by a chain of threshold parameters that describe the difficulty or probability of the response categories. rating scale analysis includes average measures, threshold estimates, and category fit. in this study, the item rating scale was considered to have an appropriate rating scale if the threshold increased by at least 1.4 logits between categories25. reliability was verified using the person separation reliability statistic ; the separation index (si) must exceed 2 to attain the desired level of separation reliability (i.e., a value of 0.80), and exceed 3 to achieve a value of 0.9026. there were no misfit persons or items (table 1table 1.item fit statistics : entry orderitemmeasureseinfitoutfitmnsqz - valuemnsqz - value152.941.151.241.01.100.5256.471.191.351.31.110.5354.541.160.780.090.731.1451.381.131.301.21.030.2549.211.130.631.70.641.6649.721.130.661.50.522.3747.791.140.890.41.090.4847.391.150.800.80.780.8944.931.201.090.40.920.21045.641.180.920.20.850.6mnsq : mean square statistic, se : standard error). a summary of the rating scale analysis is presented in table 2table 2.rating scale analysis of the original 10-point scalecategorylevelobservedaverageinfitmnsqoutfitmnsqstructurecalibration127.713.641.21none222.280.740.8536.7037.080.740.593.4042.270.941.085.3751.240.800.630.8062.770.940.821.5574.290.390.260.1988.241.341.294.38915.910.450.5911.451018.511.911.1331.54mnsq : mean square statistic. the average measures, which indicate the average of the modeled fes for all patients who chose that particular response category, followed the low - to - high expected order and increased with the category value. however, structure calibrations were disordered. based on the structure calibration and fit statistics, ratings 1, 2, 5, 6, 7, 9, and 10 were combined in a new scale. a summary of the new 6-point rating scale analysis is presented in table 3table 3.rating scale analysis of the revised 6-point scalecategorylevelobservedaverageinfitmnsqoutfitmnsqstructurecalibration116.201.181.23none210.730.750.8710.8332.991.001.195.9843.120.760.6510.14511.871.301.2410.12624.800.890.9316.83mnsq : mean square statistic. mnsq : mean square statistic, se : standard error mnsq : mean square statistic mnsq : mean square statistic with this new scale, the threshold increased by more than 1.4 logits between categories. thus, the rating scale from 1 to 6 was determined to be appropriate for stroke patients. the reliability of all items was at an acceptable level for patients with hemiplegic stroke. the purpose of this study was to use rasch analysis to investigate the psychometric properties of the fes for measuring balance confidence in patients with hemiplegic stroke. we investigated its unidimensionality through item fit, reliability, and appropriateness of the rating scale. the fes was found to be reliable, there were no misfit persons or items, and it showed unidimensionality. however, the rating scale required modification for application in patients with hemiplegic stroke. item fit is a tool for determining unidimensionality of a psychometric measure, specifically for showing how each item fits in a single dimension27. the fit statistics of the 10 items support the proposed unidimensionality of the fes. a high mnsq value for an item indicates that the item is not homogenous with the other items, whereas a low mnsq value indicates that the item is a duplicate of another. the ideal mnsq value is 124. in this study, we selected a range of 0.601.40 for the infit mnsq values and a z - value of > 2.0 to determine whether the scale items were a misfit. infit value is more sensitive to the pattern of responses to items targeted on the person, whereas outfit value is more sensitive to the responses to items with difficulty far from the person. the infit mnsq value is a residual that is sensitive to the estimated person s abilities, whereas the outfit mnsq value is sensitive to unexpected outliers for either person or item parameters. outfit mnsq values are influenced by outliers and are easy to diagnose and remedy ; therefore, they pose a lesser threat to measurement. however, infit mnsq values are influenced by response patterns and are usually hard to diagnose and remedy, and therefore they are a greater threat to measurement24. two items, namely, reach into the closet and walk around the nursing home were the closest to being misfits, having an inordinately high infit mnsq value. the possibility of the different dimensions of reach into a closet and walk around the nursing home were reported in a previous study investigating the validity of the fes20. the value for reach into a closet in this study was reported to be 0.56, while that for walk around the nursing home was 0.62. a low item - total correlation value indicates the possibility of a different construct. get in and out of bed and get up at night to go to the bathroom showed a low infit mnsq value ; a low infit mnsq value indicates the possibility of duplication with other items. although 4 items of the fes had a close misfit value, they did not exceed the border. in addition, although the fit indices of these 4 items were acceptable, further investigation is needed. psychometric properties of the fes in stroke patients have been examined using the classical test theory. hellstrm.15 reported the reliability of the extended fes in 30 stroke patients. a 13-activity questionnaire was used, and the overall test - retest reliability was high (intraclass correlation coefficient [icc ] = 0.97). the iccs for personal activities of daily living and instrumental activities of daily living were also high. the authors suggested that the fes was a useful instrument for assessing balance confidence in those patients with hemiplegic stroke who are at risk for falls. the results of the rating scale analysis in this study showed the need for modifying the original 10-point scale. the adequacy of the rating scale was judged based on the order and the differences between the items. on the basis of the judgment criteria, ratings of 1, 2, 5, 6, 7, 9, and 10 after rescoring, the fit statistics of the rating scale were improved and appropriate. the order was increased in structure calibration, and the threshold of the differences between items was at least 1.4 logits25. these criteria include at least 10 cases per category and monotonically increase the average measures across a category ; a category outfit is indicated by a square value of < 228. the modified 6-point ordinal scale was appropriate based on the guidelines for scale adequacy. person separation in the rasch model is equivalent to cronbach s. in this study, the person separation value indicated how well the measure could differentiate patients in terms of their balance confidence. the present study had a person separation value of 0.90. despite the clinical significance of falls in stroke patients, studies on falls and fall self - efficacy are insufficient1. the psychosocial aspect of falls, in particular, should be emphasized because fear of falling is related to balance and gait deficits. new studies have been initiated to identify a validated tool for assessing fall self - efficacy in stroke patients. validation of this measure of balance confidence in stroke patients is needed to achieve the goals of reducing the fear of falling, developing an appropriate intervention, and assessing the effect of the intervention. this was the first study to investigate the psychometric properties of the fes using rasch analysis. the results of this study suggest that the 6-point fes is an appropriate tool for measuring self - perceived fear of falling in patients with hemiplegic stroke.	[purpose ] the purpose of this study was to investigate the psychometric properties of the falls efficacy scale using rasch analysis in patients with hemiplegic stroke. [subjects ] fifty - five community - dwelling hemiplegic stroke patients were selected as participants. [methods ] data were analyzed using the winsteps program (version 3.62) with the rasch model to confirm the unidimensionality through item fit, reliability, and appropriateness of the rating scale. [results ] there were no misfit persons or items. furthermore, infit and outfit statistics appeared adjacent. the person separation value was 3.07, and the reliability coefficient was 0.90. the reliability of all items was at an acceptable level for patients with hemiplegic stroke. [conclusion ] this was the first study to investigate the psychometric properties of the falls efficacy scale using rasch analysis. the results of this study suggest that the 6-point falls efficacy scale is an appropriate tool for measuring the self - perceived fear of falling in patients with hemiplegic stroke.
although the vocalizations of most animal species constitute their innate behavior, some animal groups, such as mammals (humans, cetaceans, bats, elephants, and pinnipeds) and birds (oscine songbirds, parrots, and hummingbirds) develop a complex vocal pattern through vocal learning [23, 24 ]. the songbird is an attractive animal model for understanding the mechanisms underlying vocal learning because non - human primates and rodents have a limited ability to modify their vocalization. there are approximately 3,500 songbird species all over the world, and their birdsong shows a readily quantifiable species - specific variation, ideal to investigate the developmental changes of acoustic and sequential song structure (fig. the zebra finch is known as a closed - ended learner, meaning that once a stable species - specific song pattern motif is developed, the song structure remains unchanged throughout life [8, 22, 74 ]. this stereotypy of crystallized song enables precise quantification of the similarities and differences in vocal development and song patterns between experiments, allowing for examination of genetic and epigenetic factors that contribute to the acquisition and maintenance of complex vocal patterns. (b, c) examples of adult song patterns of two bengalese finches (b) and two java sparrows (c).). some species of birds such as the zebra finch and canary are easily bred under laboratory conditions. these features mean that studies of songbirds can provide excellent insights into the evolution, function, development, and mechanisms of vocal learning. here we review vocal learning in songbirds, with particular focus on auditory input as a developmental epigenetic factor of vocal development. first, we highlight the parallels between human speech and birdsong and introduce the neural mechanisms involved in vocal production and learning. we then provide an overview of the contribution of auditory input during vocal development and maintenance. the zebra finch is known as a closed - ended learner, meaning that once a stable species - specific song pattern motif is developed, the song structure remains unchanged throughout life [8, 22, 74 ]. this stereotypy of crystallized song enables precise quantification of the similarities and differences in vocal development and song patterns between experiments, allowing for examination of genetic and epigenetic factors that contribute to the acquisition and maintenance of complex vocal patterns. (b, c) examples of adult song patterns of two bengalese finches (b) and two java sparrows (c). although birds and mammals diverged from a common ancestor approximately three hundred million years ago, birdsong broadly possesses three behavioral traits similar to that of human speech. first, sensory and sensorimotor learning is crucial for the development of both the birdsong and human speech. the sensorimotor learning follows, and animals start vocalizing, gradually matching their vocalization to the memorized template (fig. at the early stage of sensorimotor learning, fledgling juvenile songbirds produce unstructured sounds. juveniles compare these sounds with the memorized template and achieve vocal imitation through a process of trial - and - error vocalizations using auditory feedback (fig. thus, this reliance on tutor experience and auditory feedback means that birds raised in complete social and acoustic isolation will develop abnormal song (figs. 2.examples of song development and syllable scatter plots [duration versus mean frequency modulation (fm) ] in an intact, a socially isolated, an early - deafened, and an adult - deafened bird. (a, b) colored portions (blue and green) highlight stable song motifs. the intact and socially isolated birds exhibited song stability around dph 110. the crystallized song pattern of the socially isolated bird is similar to that of the intact (normal) bird, except for a prolonged and variable syllable (green bracket). [33, 40 ]. examples of song development and syllable scatter plots [duration versus mean frequency modulation (fm) ] in an intact, a socially isolated, an early - deafened, and an adult - deafened bird. (a, b) colored portions (blue and green) highlight stable song motifs. the crystallized song pattern of the socially isolated bird is similar to that of the intact (normal) bird, except for a prolonged and variable syllable (green bracket). second, learned vocalizations consist of a complex motor sequence, quantifiable at the phonological and syntactical levels in both songbirds and humans. although the human speech and birdsong share common features and their vocal patterns are defined as ordered strings of sounds, they are different in a critical character. human speech has the flexible capacity to convey meaning associated with distinct sound (phonology) and word (syntax) order, while songbirds use their songs for territorial advertisement and for mate attraction, just conveying the information about the individual identity of the bird to receivers. third, vocal learning occurs within a critical period, usually at the early developmental stage before adulthood. both songbirds and humans are unable to learn vocalization equally well throughout their life. although it is critical that humans and birds are provided with appropriate auditory and social conditions during the critical period to achieve vocal learning, they are different with regard to the following point : humans are able to learn new words and languages throughout their life. some species of songbirds categorized as closed - ended vocal learners, e.g., the zebra finch and bengalese finch, which are commonly used in research, are unable to learn new songs at the adult stage, while others categorized as open - ended vocal learners, e.g., the canary, have the ability to imitate new sounds to some extent as adults. this neurogenesis allows for replacement of old neurons with new ones and results in a seasonal fluctuation in the neuron number that correlates with the capacity of song plasticity. as outlined above, birdsong shares numerous behavioral traits with human speech. in contrast, with regard to their vocal organs and respiratory systems, there are subtle differences in the functional morphology. birds generate sound using an organ named the syrinx, which is part of the respiratory system, whereas humans generate sound using the larynx, which contains the vocal folds. however, the basic mechanism underlying sound generation in birds shows strong analogies to the human source - filter mechanism. in both the cases, vocalizations are generated by airflow - induced oscillation of the vocal folds in the human larynx and elements in the wall of the syrinx, followed by filtering and tuning of sound by the upper airway. to generate vocal sounds, the components of the peripheral vocal system, such as respiration organs, vocal organs and vocal tract structures require to be precisely coordinated through the neural control of a number of different muscles. the following text elaborates on the neural substrates involved in vocal development and how they contribute to this process. in vertebrates such as mammals and birds, the central nervous system is divided into five basic regions : the hindbrain, the midbrain, the thalamus, the cerebellum, and the cerebrum. across vertebrate species, there is similar structural organization throughout most of these five brain regions, except the cerebrum. in birds, the cerebrum is organized into large cell clusters ; on the other hand, in mammals, the cerebrum is divided into subcortical nuclei, such as the basal ganglia, and the cerebral cortex, which consists of six main layers. however, recent studies have indicated that the avian striatal and pallidal domains are well conserved in relation to their counterparts in the cerebrum of mammals (fig. 3fig. (modified from horita and wada, 2011, and pfenning., 2014). (a, b) upper drawings illustrate a brain section from a male zebra finch (a) and a human (b). solid black arrows denote connections within the posterior vocal motor circuit (from hvc to ra to brainstem motor nuclei). white arrows denote connections within the basal ganglia forebrain circuit. dashed black arrows denote connections between the two circuits. red arrows show the direct connections found only in vocal learners, which project from vocal motor cortex regions to brain stem vocal motor neurons. (c, d) lower drawings illustrate comparative and simplified connectivity of anterior and posterior vocal circuits in a songbird (c) and a human (d). dlm : dorsal lateral medial nucleus of the thalamus, dm : dorsal medial nucleus of the midbrain, hvc : a vocal nucleus (no acronym), lman : lateral man, man : magnocellular nucleus of the anterior nidopallium, nxiits : twelfth nucleus, tracheosyringeal part, ra : robust nucleus of the arcopallium, ram / pam : nucleus retroambiguus / parambiguus.) [25, 26 ]. both humans and songbirds have specific brain regions involved in vocal learning and production. humans have a specialized circuit that forms a network of brain areas (including broca s area and temporal areas) devoted to speech perception and production. syntax - related networks are reported to exist in the opercular / triangular parts of left inferior frontal gyrus and the left lateral premotor cortex. in addition, the basal ganglia are considered to be involved in prosodic modulation and language acquisition [1, 12 ]. several studies have indicated that compared with the native language the basal ganglia showed different activity during speech production and syntactic processing of a second language [11, 31 ]. the identity and function of the neural networks contributing to vocalization have been particularly well studied in songbirds through a variety of neurophysiological and molecular biology methods. (modified from horita and wada, 2011, and pfenning., 2014). (a, b) upper drawings illustrate a brain section from a male zebra finch (a) and a human (b). solid black arrows denote connections within the posterior vocal motor circuit (from hvc to ra to brainstem motor nuclei). red arrows show the direct connections found only in vocal learners, which project from vocal motor cortex regions to brain stem vocal motor neurons. (c, d) lower drawings illustrate comparative and simplified connectivity of anterior and posterior vocal circuits in a songbird (c) and a human (d). dlm : dorsal lateral medial nucleus of the thalamus, dm : dorsal medial nucleus of the midbrain, hvc : a vocal nucleus (no acronym), lman : lateral man, man : magnocellular nucleus of the anterior nidopallium, nxiits : twelfth nucleus, tracheosyringeal part, ra : robust nucleus of the arcopallium, ram / pam : nucleus retroambiguus / parambiguus. the brain areas associated with song learning and production, the song nuclei, are organized into two major circuits : the posterior vocal motor circuit and the anterior basal ganglia forebrain circuit (figs. 3a and c). the vocal motor circuit is involved in the generation of vocal patterns through a hierarchical process of regulation of syllable sequence and acoustic features [17, 73 ]. furthermore, the premotor hvc nucleus is the only song system nucleus that receives direct projections from auditory areas, and it has a crucial role in encoding the experience of the tutor song. mirror neurons have been reported in hvc of some songbirds [13, 53 ] such as the swamp sparrow and bengalese finches. auditory mirroring in analogy to the motor visual ones found in human and nonhuman primate cortical motor areas. this form of sensorimotor correspondence is considered to be important for vocal learning and communication. in contrast, the basal ganglia forebrain circuit in both humans and songbirds is involved in motor and cognitive processes, such as control of vocal movements and reinforcement - based learning. in songbirds, this circuit plays a crucial role in song learning by supporting vocal exploration with direct premotor bias in response to the vocal experience [3, 6, 27, 61 ], and it also maintains learned vocalizations using auditory feedback. variability in the sequence and structure of syllables is reduced by the presence of a female. physiological studies have indicated that this context - dependent change in song variability is accompanied by changes in singing - related neural activity within cortical nucleus lman [27, 60 ]. a recent study also revealed that the basal ganglia nucleus area x is essential for singing - related patterned burst firing of lman, which is critical for vocal plasticity and adjustment in response to auditory feedback. together, these two premotor circuits are believed to produce vocalizations at different stages of song development. the poorly structured subsong, akin to human babbling, is driven primarily by the basal ganglia forebrain circuit, whereas the adult song is highly stereotyped and is driven primarily by the motor circuit. transferring control of song from the basal ganglia forebrain circuit to the motor circuit is crucial for regulating vocal plasticity and stabilization. human speech and birdsong result from the development of specialized brain regions for vocal learning and production, which develop through interaction between genetic and environmental factors. overcoming this problem requires an appropriate model system whose genomic information has been well understood and in which genetic manipulation can be performed. for example, foxp2, a forkhead box family gene that encodes a transcription factor, has been reported as the gene underlying a human developmental language impairment caused by structural abnormalities in the striatum, cerebellum, and cortex [35, 69 ]. similarly, in songbirds, foxp2 is expressed strongly in the striatum and is regulated during vocal development [15, 66 ]. knockdown of foxp2 in the songbird striatum impairs song learning, decreases spine density of striatal spiny neurons, and disrupts the control of vocal variability by interfering with dopamine - dependent modulation [16, 62 ]. other genes relevant to speech and other human language disorders have been reported to be differentially expressed in the song nuclei of songbirds, and investigation and manipulation of these genes has become possible following the sequencing of the zebra finch genome and through use of transgenesis and viral transfection [2, 16, 43 ]. in addition, targeting of viral vectors to specific brain regions using microinjections can be used to regulate gene expression with temporal and spatial precision in order to analyze the function of genes, cells, and circuits [57, 58, 68 ]. in addition to these genetic contributors, developmental factors that influence epigenetics, such as social interaction and nutrition, are also important in the development of vocalization and the brain regions that support it. dysfunction of motor and auditory ability causes speech disorders, such as aphasia and stuttering. studies of vocal deficits by lesions to song nuclei provide us with an animal model of aphasia. for instance, an adult zebra finch becomes unable to produce a learned vocal pattern after hvc lesions [4, 63, 67 ]. stuttering is the most common disorder of speech motor control in young children who are developing speech. twin studies have reported substantial genetic and epigenetic effects on stuttering [10, 55 ]. however, the neurobiological basis of this disorder is poorly understood despite recent progress in uncovering its genetic roots. from a comparative point of view, song syllable repetitions of the zebra finch resemble part - word repetitions, a common feature of stuttering. song syllable repetitions can be induced by delays or disruptions in auditory feedback during vocalization [19, 36 ], similar to those that can occur in humans. furthermore, auditory input is crucial for the acquisition of birdsong and human speech and can influence epigenetic factors contributing to sensorimotor learning [33, 59 ]. audition provides important information for vocal learning, both for learning templates and for evaluation of one s own vocal output. auditory feedback also plays an important role in maintaining stable vocal output in adulthood [19, 36, 38, 46 ]. when songbirds are deprived of auditory input before the sensory learning phase of song, they do not develop normal songs (fig. 2c), similar to individuals with hearing loss that have difficulty developing normal speech patterns. however, audition - deprived songbirds can still develop a certain degree of species - specific song [41, 54 ] and crystallize vocal patterns, though they are noisy and amorphous (fig. developmental gene expression is found to be conserved in an age - dependent manner even in deafened birds, indicating audition - independent robustness of gene expression dynamics during vocal development in the song system. although auditory information is crucial for song development, auditory input is not the main driver of developmental gene expression dynamics in motor circuit nuclei. in adult humans and songbirds, disruption of auditory feedback 2d) [19, 46, 71 ], and the rate of deterioration depends on age. when deprived of auditory feedback, deterioration of vocal patterns is much more severe at a younger age, and deterioration takes longer at an older age. delays or disruptions in auditory feedback during vocalization result in stuttering, deletions, and distortion of syllables [19, 36 ]. furthermore, birds exhibit the capacity to adjust pitch according to perceived errors in vocal production, and the speed and extent of vocal error correction decreases markedly with age. the vocal variability necessary for audition - dependent song plasticity is generated by the basal ganglia forebrain circuit [3, 27, 49 ]. however, expression of the molecular markers of neural activity - dependent gene induction [dual specificity phosphatase 1 (dusp1), c - fos, and arc ] is similar throughout development in the nuclei of the basal ganglia forebrain circuit. this suggests that molecular signaling cascades are consistently regulated regardless of age in the basal ganglia therefore, during vocal learning, inherited genetic programs contribute to vocal development and auditory - dependent vocal plasticity, which are directly or indirectly regulated by age or activation of vocalization (motor)-dependent epigenetic factors. it is a complex form of sensorimotor learning that requires coordination of sensory input and motor output to guide one s own vocalization. hearing impairment and developmental disabilities lead to deficits in acquired vocal patterns and maintenance during vocal development, including speech disorders, such as aphasias, and stuttering. songbirds that have had auditory input disrupted are useful animal models for understanding how hearing impairment affects the development of brain regions for vocal learning and production (fig. 4.a schematic highlighting the use of songbirds as a research model for disorders of vocal development and communication.). a schematic highlighting the use of songbirds as a research model for disorders of vocal development and communication. as we have described, audition - independent robustness of gene expression is present in the songbird motor circuit, which indicates that volitional vocalization itself may have a crucial influence on epigenetic factors that activate the genetic programs necessary for regulating vocal plasticity and development of vocal patterns. in fact, a large set of neural plasticity - related genes are regulated by singing in song nuclei [37, 51, 70 ]. although variability in the accuracy of syllable / word structures in human children and adults with hearing impairments has been observed, language outcomes may vary by the overall hearing level, age of onset of hearing loss, and therapeutic interventions, such as hearing aids or cochlear implants. in addition, vocal development may rely not only on how good one s hearing is but also how much vocalization they produce. this suggests that interventions, such as hearing aids or cochlear implant, performed at an early stage of word production may have a more positive effect on language development in children with congenital hearing impairment. studies on birdsong using behavioral manipulation and genetic and neurophysiological tools have shed light on the specialized neural networks that underlie vocal learning. further research is needed to understand how auditory input, motor activity, and aging affect the development of brain areas involved in vocal learning and production.	like humans, songbirds are one of the few animal groups that learn vocalization. vocal learning requires coordination of auditory input and vocal output using auditory feedback to guide one s own vocalizations during a specific developmental stage known as the critical period. songbirds are good animal models for understand the neural basis of vocal learning, a complex form of imitation, because they have many parallels to humans with regard to the features of vocal behavior and neural circuits dedicated to vocal learning. in this review, we will summarize the behavioral, neural, and genetic traits of birdsong. we will also discuss how studies of birdsong can help us understand how the development of neural circuits for vocal learning and production is driven by sensory input (auditory information) and motor output (vocalization).

Subsets and Splits

No saved queries yet

Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.