article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
transcranial direct current stimulation (tdcs) can be utilized as a key tool because it can affect the neural plasticity of the cerebral cortex. furthermore, it can directly change the excitability of electrical potentials in a stimulated region, as well as indirectly affect the excitability of the same region at the other side of the cerebrum1. such tdcs can also cause polarity - dependent changes in the excitability of the cerebral motor cortex2. negative - polarity stimulation, on the other hand, decreases excitability due to hyperpolarization occurring at the neurons or neural networks in corresponding regions. the study conducted by fregni.4 revealed that tdcs improved working memory performance in a consecutive sequential letter - matching test, while antal.5 showed in their study that tdcs influenced visual cognitive function in the contrast sensitivity test, a visual function test tdcs - related studies have mostly used carbon rubber electrodes in applications involving scalp electrodes. carbon rubber electrodes are very inconvenient to use and are disliked by subjects because the face must be wrapped using separate straps, to keep the electrodes in place. therefore, this study was conducted to investigate the effects of electrode type on n100 and p300 when tdcs was applied to a primary motor area. this study selected 30 healthy adult females in their 20 s who had a non - dominant left hand. we obtained approval for this experiment from the research ethics committee of kwangju women s university. group i were administered tdcs with carbon rubber electrodes, while round, self - adhesive electrodes were used for group ii. the general features of the subjects are presented in table 1table 1.general characteristics of the subjectsgroup i (n=10)group ii (n=10)age (years)20.60.521.51.1height (cm)161.33.7162.11.5weight (kg)55.18.656.67.1meansd. group ii : a circular adhesive electrode tdcs was applied using an endomed 482 (enraf - nonius b.v.,, the positive electrode was placed over the primary motor cortex at c4, and the negative electrode was placed at c3. the pulse duration was set to 2 ms, and the interpulse duration to 5 ms. carbon rubber electrodes 4 6 cm (daeyang medical, wonju, south korea) were used for experimental group i with a current intensity of 0.058 ma / cm, and 1.77 cm round, self - adhesive electrodes (skintact, leonhard lang gmbh, innsbruck, australia) were used for experimental group ii with a current intensity of 0.06 ma / cm. to measure event - related brain potentials (erp), an eeg-8 electroencephalograph (lxe5208, laxtha, daejeon, south korea) was used, and the telescan software (laxtha, daejeon, south korea) program was used to conduct the latency and amplitude analyses of n100 and p300. the sampling rate was set to 256 hz, and band - pass filtered between 1~50 hz. the attachment regions were wiped clean with alcohol to reduce regional resistance to less than 5 k before the electrodes were attached. the ag - agcl electrodes were attached to the fp1 and fp2 areas ; the active electrode was placed on the right mastoid, and the earth electrode was placed on the left mastoid, in accordance with the international 1020 system placement method. the erp, which is the average of brainwaves, appears after stimulating the targets, was analyzed based on the maximum negative potential value observed between 80 and 120 ms for n100 and on the maximum positive potential value between 250 and 500 ms for p300. the subjects were requested to move a blue - colored arrows in the arrow direction by their non - dominant left hand, and the red - colored arrows in the direction away from the arrow. visual stimulation was presented a total of 50 times, among which 18 times were designated for target stimulation (red arrow) and 32 times for non - target stimulation (blue arrow). the temporal interval between each stimulation was set at 1 second, and each time duration was randomly presented between 2 to 4 seconds. repeated measures anova was used to analyze the changes in the two groups according to the duration of treatment. the results of the experiment show that the n100 latency and amplitude had statistically insignificant differences in the interactions between time and group in both the fp1 and fp2 areas. however, a statistically significant difference was found in the main effect duration (p<0.05) in both areas (table 2table 2.changes in n100eeggrouplatency (sec)amplitude (v)prepostprepostfp1i0.140.040.130.046.376.917.287.58ii0.130.030.110.047.589.408.509.88fp2i0.140.040.130.036.717.237.917.07ii0.140.030.120.037.499.138.958.16mean sd. at fp1 and fp2, there were only significant changes depending on time in the latency (p<0.05) and amplitude (p<0.05), but there was no statistically significant difference in interaction effect. thus, tdcs application reduced the n100 latency and increased its amplitude, regardless of the type of electrode. the p300 latency and amplitude had statistically insignificant differences in interactions between time and group in both the fp1 and fp2 areas. however, a statistically significant difference was found in main effect duration (p<0.05) in both areas (table 3table 3.changes in p300eeggrouplatency (sec)amplitude (v)prepostprepostfp1i0.340.060.320.0512.358.7013.5110.45ii0.330.080.320.0913.8715.0414.2714.97fp2i0.340.040.310.0413.5110.4517.5214.05ii0.330.090.310.1015.2715.1118.0518.29mean sd. at fp1 and fp2, there were only significant changes depending on time in the latency (p<0.05) and amplitude (p<0.05), but there was no statistically significant difference in interaction effect. thus, tdcs application reduced the p300 latency and increased its amplitude, regardless of the electrode type. mean sd. at fp1 and fp2, there were only significant changes depending on time in the latency (p<0.05) and amplitude (p<0.05), but there was no statistically significant difference in interaction effect. mean sd. at fp1 and fp2, there were only significant changes depending on time in the latency (p<0.05) and amplitude (p<0.05), but there was no statistically significant difference in interaction effect. utz.6 reported that generalized electrode sizes had yet to be established for tdcs ; however, some researchers have recommended using small electrodes to effectively transmit current. our present results demonstrate that tdcs shortens the latencies and increases the amplitudes of n100 and p300 at both the fp1 and fp2 areas, regardless of the electrode type. n100 reflects early attentiveness in a cerebral process7 ; therefore, it considered to be an indicator of selective attentiveness8. in addition, n100 latency represents the complexity and efficiency of synapses involved in information processing speed and responses9. therefore, we consider tdcs affected n100 latency and amplitude and to have aided the neurophysiologic processes that are related to attentiveness, information processing speed, and the responses of the subjects to external stimuli. hwang and lee10 reported that tdcs delivered by carbon rubber electrodes to stroke patients primary motor cortex resulted in shorter p300 latency at both the fp1 and 2 areas. their result is similar to the result our present study, which used healthy people as subjects. the p300 amplitude represents the amount of cognitive activity, such as memory and attentiveness, and is related to the time it takes to evaluate and classify latencies in response to stimulation11. in addition, p300 also represents the information - gathering process of perceptual decisions that identify and determine stimulation from outside influences12, 13. therefore, given that both n100 and p300 latencies were shortened, and that their amplitudes increased, regardless of the electrode type, we consider tdcs increased cognitive activities that execute tasks in response to target and non - target stimulation, regardless of the electrode type. consequently, since tdcs positively influenced cognitive activities, regardless of the electrode type, we consider self - adhesive electrodes are a better treatment choice because of their user - friendliness and convenience in clinical applications of tdcs compared with carbon rubber electrodes. | [purpose ] this study investigated the effects of types of electrode on n100 and p300 in transcranial direct current stimulation (tdcs) applications. [subjects and methods ] thirty subjects were randomly assigned to two groups with 15 subjects in each group depending on the electrode types. a positive electrode on the primary motor area (c4) and a negative electrode on the left primary motor area (c3), and stimulation was applied for 20 minutes. before and after tdcs, n100 and p300 were measured by attaching an electrode to fp1 and fp2. [results ] in tdcs applications, n100 and p300 showed no significant interaction effects between time and group for either latency or amplitude in the fp1 and fp 2 areas, but there was a statistically significant difference in the main effect duration. [conclusion ] the latencies of n100 and p300 were shortened and that their amplitudes increased in both the fp1 and fp2 areas, regardless of the type of electrode. |
choroidal neovascular membranes (cnv) can be associated with various inflammatory chorioretinal diseases, as the cytokines together with the vascular endothelial growth factor (vegf) are implicated in the pathogenetic mechanisms leading to an impaired permeability and altered angiogenesis. it is assumed that cnv may occur in up to 25% of cases with serpiginous choroiditis and may be detected at the time of active choroiditis or in between the inflammatory episodes. in a systemic immunosuppressive therapy for eye disease cohort study, 81 eyes (2%) had cnv at presentation among the 4,041 eyes of the 2,307 patients with posterior uveitis or panuveitis. of the 148 eyes with a diagnosis of serpiginous choroiditis, cnv was noted in 7 eyes (4.7%). the presence of cnv must be differentiated from the signs of active disease as the treatment options may differ. we hereby report a case of active serpiginous choroiditis with cnv and discuss our therapeutic approach. a 42-year - old otherwise healthy woman with a visual loss of 2 months ' duration in od in 2009 was examined by us. her best - corrected visual acuity was counting fingers (cf) at 1 m in od and 20/20 in os. on fundus evaluation, there were chorioretinal scars surrounding the optic disc in a serpentine - like fashion ou, together with a subfoveal grayish lesion and subretinal hemorrhage in od (fig. a single session of photodynamic therapy and 3 subsequent intravitreal ranibizumab injections were administered in a time span of 9 months without any visual improvement. four years later, at the age of 46, she was once again examined by us ; this time for metamorphopsia and mild visual loss of 2 weeks ' duration in os. visual acuity was cf at 1 m in od and 20/30 in os. while slit - lamp examination was normal in od, there were + + cells in the left vitreous. on fundus evaluation, there was a large macular scar and extensive chorioretinal scarring surrounding the optic disc in od (fig. peripapillary scarring with active - looking creamy borders and a grayish lesion with a hemorrhagic rim in the papillomacular bundle were noted (fig. 2c). with the help of fluorescein angiography and optical coherence tomography (fig. 2d - f), we reached a diagnosis of extrafoveal classic - type cnv in association with active serpiginous choroiditis in os. in order to avoid systemic steroids, the risks and benefits of the simultaneous intravitreal injection of the 2 drugs were explained to the patient, and an informed consent was obtained. at the same time, oral mycophenolic acid 2 720 mg was commenced. a week later, visual acuity was improved to 20/25, and optical coherence tomography showed that intraretinal and subfoveal fluid had almost totally disappeared. during the follow - up of 22 months, no further injection was required, and no injection - related complication occurred. oral cyclosporine 3 100 mg was added to the systemic therapy due to the persistent activity of the inflammation 2 months later. at the last visit visual acuities were cf in od and 20/25 in os, and the left fundus was relatively stabilized (fig. a thorough control of underlying inflammation with the help of systemic steroids and/or immunosuppressives should be considered in eyes with active serpiginous choroiditis associated with cnv. however, local targeted therapy is often administered to treat the coexistent cnv to obtain a better anatomical and visual outcome. in earlier days, argon laser photocoagulation was the preferred method for the treatment of extrafoveal cnv and photodynamic treatment mostly for the juxtafoveal and subfoveal cnv in serpiginous choroiditis. more recently, intravitreal anti - vegfs were evaluated in eyes with serpiginous choroiditis and cnv. patients were followed up for 36 months to assess the efficacy of intravitreal bevacizumab administration in a retrospective multicenter consecutive case series comprised of 81 patients with inflammatory ocular neovascularization refractory to standard therapy. on the other hand, eyes with multifocal choroiditis and cnv required a mean of 6.3 injections, eyes with ocular histoplasmosis a mean of 3.9, and eyes with punctate inner choroidopathy a mean of 3.4 injections. parodi. reported their results of intravitreal bevacizumab administration in 7 eyes of 7 patients with cnv and serpiginous choroiditis who were followed up for a year with monthly follow - ups. one eye required 5 bevacizumab injections, and the remaining eyes received only a single injection. song and roh described a 44-year - old woman with inactive serpiginous choroiditis and juxtafoveal cnv. two ranibizumab injections 2 months apart were sufficient to obtain a stable lesion without any concurrent systemic therapy. the patient was followed up for 6 more months after the second injection, and the visual acuity improved to 20/20 from the initial level of 20/40. in a group of 16 eyes of 15 consecutive patients with an inflammatory type of cnv, both patients received 2 ranibizumab injections. in 1 eye, visual acuity remained stable, and the other eye experienced a 15-letter improvement. reported a 55-year - old man with an already established diagnosis of inactive serpiginous choroiditis with an extrafoveal classic - type cnv. following a 3-daily intravenous infusion of prednisolone 1 g, 2 sessions of argon laser photocoagulation and then 2 photodynamic therapy treatments were performed. upon worsening, the final visual acuity was 20/20. in the present case with active serpiginous choroiditis and extrafoveal cnv the rationale for the dexamethasone implant was to suppress the active inflammation until the effect of the newly started immunosuppressive agent was commenced. there were some previous reports on the intravitreal steroid administration for the control of active inflammation in serpiginous choroiditis. injected intravitreal triamcinolone acetonide in 8 eyes of 8 patients with active unilateral serpiginous choroiditis. they reported that remission was induced rapidly, and the visual acuities were either stabilized or improved after the follow - up of 6 months. seth and gaudio placed a fluocinolone implant after the observation of a good disease control with a single intravitreal triamcinolone acetonide administration, and the visual outcome was satisfactory during a follow - up of 14 months. as there are no randomized studies for the treatment of cnv in association with inflammatory diseases, such as the ones associated with age - related macular degeneration and pathologic myopia, a tailored therapeutic approach seems to be more appropriate. it is well accepted that systemic or intravitreal steroids with or without systemic immunosuppressives should be employed in order to suppress the active inflammation. anti - vegf agents should also be administered in order to achieve a better anatomical outcome and visual acuity. the authors declare that there are no conflicts of interest regarding the publication of this article. | intravitreal anti - vascular endothelial growth factor (vegf) agents seem to be effective in choroidal neovascular membranes (cnv) in association with various entities of posterior uveitis. we herein report a 46-year - old woman who was treated with a simultaneous single intravitreal dexamethasone implant and ranibizumab administration for the treatment of unilateral extrafoveal cnv associated with an active serpiginous choroiditis. simultaneously with the intravitreal therapy, oral mycophenolic acid (2 720 mg) was started, and oral cyclosporine (3 100 mg) was then added 2 months later. on the other hand, the fellow eye had been treated for subfoveal cnv but with an inactive disease 4 years previously and ended up with a final visual acuity of counting fingers despite treatment with a single session of photodynamic therapy and 3 subsequent intravitreal ranibizumab injections. simultaneous administration of anti - vegf agents and a dexamethasone implant can be a viable approach in eyes with cnv and active serpiginous choroiditis. |
hookah which also is known as shisha, hubble - bubble, kalian, narghile and waterpipe is a traditional device for smoking tobacco in the middle east region (1). the size, shape, and tobacco used in the hookah device vary in different regions (2). hookah smoking has increased worldwide and there has been a revival of its use in general population, especially among young people (3, 4). moreover, there is a common misconception about hookah smoking that it is safer than other tobacco products (6). in some countries (like iran) such situation, as well as lack of productspecific interventions and policies have led to popular beliefs among youth and young adults that hookah smoking is neither addictive nor hazardous (5, 7). studies have reported that hookah smoking has been associated with lung cancer and other respiratory diseases (8), periodontal diseases, low birth weight (9) and some effects on cardiovascular system (7, 10, 11). several studies from different regions and countries, like eastern europe (12), united states (13), jordan (14), and syria (15) indicate an increasing and alarming trend of hookah smoking among university students. it should be noted that although hookah has been used traditionally in middle eastern countries (1), akl. in a systematic review concluded that the prevalence of hookah smoking appears to be alarmingly high among school and university students not only in middle eastern regions, but also in western countries (16). it should be noted that due to pressure of heavy workload, and in other hand higher medical knowledge, the prevalence of any substance use in medical university students may be different from the general population or other students (17). despite the importance of hookah smoking among university students, there is little information about it in this high - risk group (18). the aim of this study was to determine the status of hookah smoking and its correlates in the students of tehran university of medical sciences during 2012 - 2013. the present cross - sectional study was conducted from autumn 2012 until winter 2013 using a multistage sampling method. students were chosen as follows ; in each college (strata), a number of classes (clusters) - proportion to size - were randomly selected and all students of the selected classes were included in the study. proportion of females in the iranian universities of medical sciences in iran is about twice of males and this ratio was considered in our sample for ensuring the representativeness. the questionnaire was aimed at obtaining information on hookah and cigarette smoking, alcohol use, use of prescription - type drugs (including medications that contain opioid components, methylphenidate and sedatives or tranquilizers), and illicit drug use (including cannabis, opium and its residue, heroin, stimulants such as methamphetamine, ecstasy and cocaine), as well as demographic information. in addition, the questionnaire inquired about cigarette or hookah smoking, alcohol use, substance use and use of prescription - type drugs in the family members and close friends. more details about items and validity of the questionnaire have been presented elsewhere (17). the last year use was considered as a basis for statistical analyses of hookah, cigarette and alcohol use. for illicit substances, prescription - type drug use was defined as the use of opioid drugs and sedatives (tranquilizers) at least 3 times a week for the last month or last year use of methylphenidate. chi - square test and multiple binary logistic regression analysis (backward method) were used for univariate and multivariate analyses, respectively. a p value < 0.05 was considered as statistically significant. students were informed about the voluntary nature of the participation in the study and their right to reject participation in the study or skip any questions. the response rate was 90.5% in the present study (1992 out of the 2212 distributed questionnaires). the mean age of the participants was 21.16 3.15 years (range : 16 - 44). the majority of the sample were females (69.2%) and 7.9% were married. among 1992 students, 26.6%, 17.8% and 8.9% had used hookah in the lifetime, last year and last month, respectively. demographic and key characteristics of the sample, as well as the conditional distribution of hookah smoking at each level of the variables are also shown in table 2. according to this table, all variables had a significant association with last year hookah smoking except age, marital status and prescription - type drug use in the family. the results of these analyses showed that male gender (or = 2.8, 95% ci : 1.86 - 4.21), cigarette smoking in the past year (or = 5.6, 95% ci : 3.21 - 9.83), alcohol use in the past year (or = 7.4, 95% ci : 4.01 - 13.06), cigarette or hookah smoking in the family members (or = 1.7, 95% ci : 1.13 - 2.51), cigarette or hookah smoking among friends (or = 4.4, 95% ci : 2.69 - 7.33), alcohol use among friends in the past year (or = 1.9, 95% ci : 1.20 - 3.14), and illicit substance use among friends (or = 2.2, 95% ci : 1.22 - 4.05) were associated with hookah smoking. abbreviation : ci, confidence interval. use of opioid medications or sedatives (tranquilizers) at least 3 times a week for the last month or last year use of methylphenidate. variables entered on step 1 : gender, age, marital status, living place, cigarette smoking, alcohol use, illicit substance use, illicit substance use in family, illicit substance use in friends, prescription - type drug use in family and prescription - type drug use in friends, cigarette or hookah smoking in family, cigarette or hookah smoking in friends, alcohol use in family, alcohol use in friends and prescription - type drug use. in the present study, the lifetime, last year and past 30 day prevalence of hookah smoking were determined to be 26.6%, 17.8% and 8.9%, respectively. the prevalence of hookah smoking in the present study is similar to other studies conducted among university students in iran (20, 21). for example, the prevalence of lifetime and last year smoking of hookah were reported to be 30% and 20.7%, respectively, in one study (20) and in another study 28.7% of males and 11.5% of females reported current hookah smoking (21). in addition, the prevalence of hookah smoking among students of zanjan (occasionally and regular use) and tabriz (last use) universities, iran, were reported as 13%, 4.2% and 8.5%, respectively (22, 23). for example, the lifetime and past-30- day prevalence of hookah smoking have been reported to be 61.1% and 42.7%, respectively for university students of jordan (14). also, in a study among medical and nonmedical university students in turkey, the total prevalence rate of hookah smoking was found to be 32.7% (24). in eastern mediterranean countries the prevalence of last year hookah smoking among university students has been reported as 25.7% in monitoring the future (mtf) study in us (26). in north carolina this rate have been reported as 40% (life time prevalence) and 17% (last 30 day prevalence) (27). among students of a university in united states, the lifetime, last year and past 30 day prevalence rates of hookah smoking was reported as 40.5%, 30.6% and 9.5%, respectively (28). in a british university prevalence of hookah smoking was found to be 38% (lifetime) and 8% (regularly smoking) (29). the results of a review showed that the prevalence of last month hookah smoking range from 6% to 34% among middle eastern adolescents and from 5% to 17% among american adolescents (25). this high prevalence has been attributed to its social acceptance (30, 31). in addition, another factor that influences the spread of hookah smoking is that it is perceived to be less lethal and addicting than cigarette smoking (5, 6). our findings, like previous studies from iran and other countries (4, 29, 32, 33), showed that hookah smoking is more prevalent in men than in women. the logistic regression models demonstrated that odds of hookah smoking are 2.8 for males compared to females. it should be noted that this difference is much higher in the case of cigarette smoking, alcohol and other illegal drug use. it highlights this fact that female students show higher tendency to hookah smoking than to other substances. we found that students who had smoked cigarettes and those who had used alcohol in the last year were more likely to use hookah compared with nonsmokers. due to the cross - sectional nature of the study, we were not able to identify the temporal sequence of hookah smoking and the use of other substances. however, considering co - occurrence is one of the most effective approaches in prevention of high - risk behaviours. numerous studies have emphasized the co - occurrence of hookah smoking and other risky behaviours (34 - 36). several studies indicated that involvement in one risky behavior is related with engagement in other risky behaviours (37, 38). this may be especially important for the hookah and cigarette smoking ; because in both tobacco is used by means of smoking (39). our findings indicated that hookah smoking was strongly associated with cigarette or hookah smoking by friends. one of the most important factors that can affect the spread of hookah smoking is peers influence (3). heinz. showed that participants who were hookah users, as compared to nonusers, had a greater number of friends who had tried and approved hookah use (35). in addition, several studies indicate that if substance use is common in majority of friends, these youths probably will be pushed to consumption (40, 41). it is also found that alcohol use and illicit substance use in friends are associated with hookah use among students. hookah smoking is often a social phenomenon that occurs between friends and predominantly in cafes and bars (2, 5). ghafouri. in a study among students of health sciences, stated that hookah smoking was perceived as a social activity among friends (42). because of religious and legal prohibition of alcohol use in iran, there is no social drinking in cafes and bars. in such a case, hookah smoking has considerable importance and acts as a mean of socialization for the youth. in the present study, it was found that hookah smoking is higher in those students with hookah smoking in family. some studies have emphasized on parents substance abuse and increased chance of illicit substance use in children (43, 44). the result of a study among michigan adults found that having a father, mother, or sibling who smoke hookah at home is a significant risk factor for hookah smoking (45). due to the cross - sectional design of the study, causal inference of our results can not be identified. furthermore, findings of the study are relied on self - report data and it was assumed that the students were honest in answering the questions. for future studies, longitudinal studies are required to determine and monitor the incidence rate of hookah use and its correlates among medical university students. the results of this study indicate lifetime, last year and last month use of hookah smoking among students of tehran university of medical sciences. our findings show a relatively low prevalence of hookah smoking among iranian students in comparison to other studies. the findings of this study can be used for planning and evaluating interventions by considering co - occurrence of hookah smoking with other risky behaviours. this study has some limitations. due to the cross - sectional design of the study, causal inference of our results furthermore, findings of the study are relied on self - report data and it was assumed that the students were honest in answering the questions. for future studies, longitudinal studies are required to determine and monitor the incidence rate of hookah use and its correlates among medical university students. the results of this study indicate lifetime, last year and last month use of hookah smoking among students of tehran university of medical sciences. our findings show a relatively low prevalence of hookah smoking among iranian students in comparison to other studies. the findings of this study can be used for planning and evaluating interventions by considering co - occurrence of hookah smoking with other risky behaviours. | backgroundhookah smoking has increased worldwide, especially among young people.objectivesthe aim of the present study was to determine the prevalence of hookah use and related factors in a sample of iranian students of medical sciences.materials and methodsa cross - sectional study was conducted on 1992 randomly selected sample of students of tehran university of medical sciences during 2012 - 2013. a multistage sampling method was used and anonymous structured questionnaires were distributed to the students of each selected class. chi - square test, fisher 's exact test and multiple binary logistic regression analyses were performed and p < 0.05 was considered as a significance level.resultslifetime, last year and last month prevalence rates of hookah smoking were 26.6% (95% ci : 24.7 - 28.6), 17.8% (95% ci : 16.1 - 19.5) and 8.9% (95% ci : 7.7 - 10.2), respectively. the results of logistic regression model showed that male gender [odds ratio (or) = 2.8, 95% ci : 1.86 - 4.21 ], cigarette smoking in the past year (or = 5.6, 95% ci : 3.21 - 9.83), alcohol use in the past year (or = 7.4, 95% ci : 4.01 - 13.06), cigarette or hookah smoking in the family members (or = 1.7, 95% ci : 1.13 - 2.51), cigarette or hookah smoking among friends (or = 4.4, 95% ci : 2.69 - 7.33), alcohol use by friends in the past year (or = 1.9, 95% ci : 1.20 - 3.14), and illicit substance use among friends (or = 2.2, 95% ci : 1.22 - 4.05) were associated with hookah smoking.conclusionsthe results of our study indicate a relatively high prevalence of hookah smoking among iranian students. the findings emphasize the importance of planning preventive interventions by considering different high - risk behaviors simultaneously. |
the purpose of this document is to provide a basic understanding, to internal medicine physicians and hospitalists, as to how the functionality of cardiovascular implantable electronic devices (cieds) may be affected during noncardiovascular surgery. in the united states, every year, there are more than 100 000 implantable cardioverter defibrillators (icds) and 300 000 pacemakers implanted. due to this growing number, it is not uncommon that these patients will also undergo other types of surgeries during their lifetime. a good understanding on how these devices work will lead to safer noncardiac surgeries and diminish risk of adverse effects. this review article is mostly based on expert consensus statement that was adapted by heart rhythm society and american society of anesthesiologists, but complex concepts were simplified or broken down. this concise literature review provides internists and hospitalists with quick reference as to how to approach patients with cieds. although it may seem to be overwhelming, during residency training there is little attention paid to this topic. nevertheless, it is more common that patients with cied are being managed by general practitioners, including evaluating them prior to noncardiac surgery. knowing potential interactions between cied and electrosurgery and how to manage them will improve patients safety during surgeries. it is important to understand basic functions and differences between pacemakers, icds, and cardiac resynchronization (crt) devices. there is one more, relatively recent, group of icds subcutaneous icd that has no ability to pace the heart and only manage ventricular arrhythmias. pacemakers can have either 2 (atrial and ventricular) or 1 (mostly ventricular, but in europe atrial lead only may be implanted for patients with sick sinus syndrome) lead. if a patient is in permanent atrial fibrillation, then only a ventricular lead is implanted. the main function of pacemaker is to prevent the heart rate (hr) from falling below a certain limit (mostly below 60 beats per minute [bpm ], but sometimes slower hr may be set). however, icds are implanted for primary or secondary prevention of cardiac arrest, and their main function is to pace out ventricular arrhythmia or deliver icd shock. all icds have the ability to pace the heart similar to pacemakers. however, unless the patient is pacemaker dependent, a lower rate of pacing for icds is set at or below 40 bpm. for example, the absence of pacing spikes on an electrocardiogram (ecg), at baseline hr of 50 bpm, does not necessarily mean an abnormal pacing function of icd. there is one more group of cardiac devices called crt or sometimes referred to as biventricular device. the crt device can be just a pacemaker (crt - p) or more commonly icd (crt - d). the purpose of this device, in addition to a pacemaker or icd, is also to synchronize contraction of the left ventricle to improve symptoms of congestive heart failure (chf). it is expected that these devices provide constant pacing of the heart as appears on ecg, despite the fact that these patients, most of the time, are not pacemaker dependent. pacemaker dependence can be functional or absolute. if absolute pacemaker dependence is present, then without proper functioning of the device hr will not be stable enough to afford hemodynamic stability. as mentioned above, crt devices are forced to pace to synchronize the ventricle, but if pacing function is inhibited, there is usually an underlying rhythm that is stable enough to avoid hemodynamic instability. but another example of functional dependence is when without pacing, the hr will be less than set by lower rate pacing but will not lead to hemodynamic instability. an example of this may be a patient with sinus node dysfunction who needs acceleration of hr in the atrium to satisfy metabolic demands during exertion. without proper pacemaker function, hr may be slow, but not slow enough to cause hemodynamic instability. during most surgeries, electrical current flows from stylus that is being used to cut or coagulate, through patient body, to a dispersion patch on the skin. this electrical current, when interferes with cieds, will lead to different outcomes depending on the type of device implanted. when emi affects pacemaker sensing circuits, it may lead to the inhibition of pacing function as pacemakers will not be able to differentiate emi from intrinsic heart activity. in absolute pacemaker - dependent patients the icds react differently to emi as sensing circuits also have different functions to detect and treat ventricular arrhythmia. in addition to inhibiting pacing function in patients who are pacemaker dependent, emi can also lead to inappropriate icd therapy (deliver icd shock or antitachycardia pacing) as the device may erroneously interpret emi as ventricular tachycardia (vt) or ventricular fibrillation (vf) (figure 1). for the crt devices, there are other potential issues that may occur to cieds, but they are very rare, ie, device reset, pulse generator damage, or lead tissue interference (eg, increasing pacing threshold). if the electrosurgery current is at least 6 in away from cied, this risk can further decrease. example of electromagnetic interference (emi) on cardiac resynchronization (crt - d), with inappropriate implantable cardioverter defibrillator (icd) therapy. high - frequency artifact is noted on atrial lead (a) as well as right ventricular lead (rv) in patient with crt - d device. this leads to erroneous interpretation of emi in atrial lead as atrial fibrillation (af) and ventricular fibrillation (vf) in the right ventricular lead. eventually, it leads to inappropriate icd shock (31 j shk). a magnet is one of the tools that can be used to eliminate emi for cieds if placed over it. if one places a magnet over a pacemaker, it will make it pace asynchronously and the pacemaker will ignore any intrinsic sensing and emi. it will prevent a pacemaker - dependent patient from becoming hemodynamically unstable as hr will be at a manufacturer - determined magnet rate (table 1). placing a magnet over the icd will lead to inhibition of all of its therapies for vt or vf, but most importantly, the pacing function will not be affected. for instance, if a patient with icd is also pacemaker dependent, placing a magnet over it will prevent inappropriate icd therapy due to emi, but the patient may become bradycardic and hemodynamically unstable, as the device will not pace asynchronously. prior to most surgeries, patients are being referred to physicians for preoperative risk assessment. during this time if the patient has cied, further questioning and investigation are needed to assure safety of the patient during surgery. it is extremely important to determine what type of device the patient has : pacemaker, icd, crt - p, or crt - d. this seemingly simple task can be sometimes challenging, especially if the patient can not provide or does not know this information ; for example, the patient is unconscious prior to surgery (figure 2). all patients, after the initial implantation of cied, will be given an identification card with the description of their device. if this card is not available, reviewing patient s chest x - ray (cxr) will help in differentiating the type of device and manufacturer, as well. knowing the manufacturer can be useful as companies have different magnet response rates of pacing (table 1). if cxr does not yield conclusive information, one may call the manufacturer, which will provide all necessary information and is available 24 hours, 7 days a week (medtronic, 18005515544 ; boston scientific, 18002273422 ; st. once the presence of the device and its type are established, it is also important to know the last time it was interrogated. if the device was checked within 6 months of the planned procedure, and it was functioning normally, recommendation regarding management of cied can be given most of the time without reinterrogating it. difference between pacemaker and implantable cardioverter defibrillator (icd) on chest x - ray : (a) dual - chamber pacemaker with leads in the atrium and right ventricle and (b) single - chamber icd with radiodense coil (arrow) in the right ventricle. to provide accurate recommendations regarding management of cieds during surgery will electrosurgery be used during surgery, and what type ? if bipolar electrosurgery is used or no electrosurgery is used, then no adjustments to cieds are needed, assuming that the device functions properly based on routine device checks. if the surgery is below the umbilicus, it is highly unlikely that emi will affect device function. the position of the patient during surgery is important because if a magnet can not be safely secured over the cied, then reprogramming of device will be necessary. there are pluses and minuses for both using a magnet and reprogramming periprocedurally (table 2). the 12-lead ecg can reveal underlying rhythm and also give suggestion if a patient may be pacemaker dependent. if one sees that every beat in the ventricle is being paced, it should be assumed that the patient is pacemaker dependent, especially in emergent cases. abbreviations : cieds, cardiovascular implantable electronic devices ; icd, implantable cardioverter defibrillator ; vf, ventricular fibrillation. obviously, in an emergent situation, there may be no time for the arrhythmia team (most of the time led by electrophysiologist and supported by nurse practitioner or physician assistant) to evaluate the patient, and therefore, the emergency protocol is followed, as seen in figure 3. for all emergent and nonemergent cases, it is important that the patient be monitored by electrocardiography and plethysmography or oximetry. all patients should have defibrillator pads placed on them in an anterior - posterior fashion with the ability to pace transcutaneously, if needed. the code cart must be readily available, as well as a magnet, in case it needs to be used. for all elective cases communication between physicians caring for the patient plays a vital part in assuring an uneventful surgery. utilization of manufacturer representative should not be considered as an option to provide recommendations prior to surgery, as these representatives are not clinicians and their knowledge is limited. once the surgical and anesthesia teams receive the necessary recommendations, they will need to provide appropriate monitoring during surgery and be aware of possible changes in the device behavior. every patient should be connected to an electrocardiography monitor and pulse plethysmography or oximetry. during surgery, when electrosurgery is being used, it may affect not only the cied but also the electrocardiography monitor. having more than one lead to monitor ecg may help to distinguish artifact from real arrhythmia. a magnet should be readily available in those cases, when it was not recommended prior to procedure, for the pacemaker patient because one had stable underlying, nonpaced, rhythm. sometimes, during surgery, due to sedation, the hr may become slow and placing a magnet over the device will initiate an asynchronous pacing and prevent bradycardia. when a patient has an icd and either magnet or reprogramming was used to deactivate its therapy, it is important to keep the patient on constant ecg monitor and have an external defibrillator readily available to deliver therapy, if needed. defibrillator pads may need to be placed on the patient prior to procedure, as placing them during an emergency may compromise the sterile field (anterior - posterior placement of pads is preferred, as well as a distance of at least 8 cm from cied). alternatively, if vt or vf was detected on the monitor and a magnet was used to deactivate therapy, just removing it from icd would make it fully functional and defibrillation will be delivered, if needed. for example, if the surgical site is on the left arm, the patch should be placed on the same arm, as opposed to placing it on the right arm and directing current, via tissue, that has cied. furthermore, limiting the duration of a single application to less than 5 seconds, with a few second pauses in between deliveries, would significantly decrease adverse interferences. for example, if the patient is pacemaker dependent, even if short electrosurgery applications would lead to oversensing by pacemaker and inhibit its output, it would unlikely cause hemodynamic compromise. in view of recently published expert consensus statement for programming icds, to avoid unnecessary therapy, there is a delay between detection of tachycardia and therapy. hence, if electrosurgery application will be limited to less than 5 seconds at a time, it will unlikely lead to icd therapy, as the device will declare this event as nonsustained. once the surgery is complete, the patient is usually transported to a holding or recovery area. patients should remain in an electrocardiography monitor at least until the magnet is removed from the cied or reprogramming of the cied is performed and the original, preprocedure, settings are programmed. once this is accomplished, the length of further monitoring is decided on by the primary team. if reprogramming of the device was not done prior to procedure, most of the time it would be sufficient for the patient to be followed in the device clinic within a month. exceptions to this would be if abnormalities were noted on the monitor, it would suggest abnormal pacing or icd function, hemodynamic compromise during surgery, cardiac arrest, emergent surgery, or an appointment can not be arranged for the patient to visit device clinic within 1 month. prior to most surgeries, patients are being referred to physicians for preoperative risk assessment. during this time if the patient has cied, further questioning and investigation are needed to assure safety of the patient during surgery. it is extremely important to determine what type of device the patient has : pacemaker, icd, crt - p, or crt - d. this seemingly simple task can be sometimes challenging, especially if the patient can not provide or does not know this information ; for example, the patient is unconscious prior to surgery (figure 2). all patients, after the initial implantation of cied, will be given an identification card with the description of their device. if this card is not available, reviewing patient s chest x - ray (cxr) will help in differentiating the type of device and manufacturer, as well. knowing the manufacturer can be useful as companies have different magnet response rates of pacing (table 1). if cxr does not yield conclusive information, one may call the manufacturer, which will provide all necessary information and is available 24 hours, 7 days a week (medtronic, 18005515544 ; boston scientific, 18002273422 ; st. once the presence of the device and its type are established, it is also important to know the last time it was interrogated. if the device was checked within 6 months of the planned procedure, and it was functioning normally, recommendation regarding management of cied can be given most of the time without reinterrogating it. difference between pacemaker and implantable cardioverter defibrillator (icd) on chest x - ray : (a) dual - chamber pacemaker with leads in the atrium and right ventricle and (b) single - chamber icd with radiodense coil (arrow) in the right ventricle. to provide accurate recommendations regarding management of cieds during surgery will electrosurgery be used during surgery, and what type ? if bipolar electrosurgery is used or no electrosurgery is used, then no adjustments to cieds are needed, assuming that the device functions properly based on routine device checks. if the surgery is below the umbilicus, it is highly unlikely that emi will affect device function. the position of the patient during surgery is important because if a magnet can not be safely secured over the cied, then reprogramming of device will be necessary. there are pluses and minuses for both using a magnet and reprogramming periprocedurally (table 2). the 12-lead ecg can reveal underlying rhythm and also give suggestion if a patient may be pacemaker dependent. if one sees that every beat in the ventricle is being paced, it should be assumed that the patient is pacemaker dependent, especially in emergent cases. abbreviations : cieds, cardiovascular implantable electronic devices ; icd, implantable cardioverter defibrillator ; vf, ventricular fibrillation. obviously, in an emergent situation, there may be no time for the arrhythmia team (most of the time led by electrophysiologist and supported by nurse practitioner or physician assistant) to evaluate the patient, and therefore, the emergency protocol is followed, as seen in figure 3. for all emergent and nonemergent cases, it is important that the patient be monitored by electrocardiography and plethysmography or oximetry. all patients should have defibrillator pads placed on them in an anterior - posterior fashion with the ability to pace transcutaneously, if needed. the code cart must be readily available, as well as a magnet, in case it needs to be used. for all elective cases, it is preferred that the arrhythmia team evaluate the patient and provide recommendations. communication between physicians caring for the patient plays a vital part in assuring an uneventful surgery. utilization of manufacturer representative should not be considered as an option to provide recommendations prior to surgery, as these representatives are not clinicians and their knowledge is limited. once the surgical and anesthesia teams receive the necessary recommendations, they will need to provide appropriate monitoring during surgery and be aware of possible changes in the device behavior. every patient should be connected to an electrocardiography monitor and pulse plethysmography or oximetry. during surgery, when electrosurgery is being used, it may affect not only the cied but also the electrocardiography monitor. having more than one lead to monitor ecg may help to distinguish artifact from real arrhythmia. a magnet should be readily available in those cases, when it was not recommended prior to procedure, for the pacemaker patient because one had stable underlying, nonpaced, rhythm. sometimes, during surgery, due to sedation, the hr may become slow and placing a magnet over the device will initiate an asynchronous pacing and prevent bradycardia. when a patient has an icd and either magnet or reprogramming was used to deactivate its therapy, it is important to keep the patient on constant ecg monitor and have an external defibrillator readily available to deliver therapy, if needed. defibrillator pads may need to be placed on the patient prior to procedure, as placing them during an emergency may compromise the sterile field (anterior - posterior placement of pads is preferred, as well as a distance of at least 8 cm from cied). alternatively, if vt or vf was detected on the monitor and a magnet was used to deactivate therapy, just removing it from icd would make it fully functional and defibrillation will be delivered, if needed. for example, if the surgical site is on the left arm, the patch should be placed on the same arm, as opposed to placing it on the right arm and directing current, via tissue, that has cied. furthermore, limiting the duration of a single application to less than 5 seconds, with a few second pauses in between deliveries, would significantly decrease adverse interferences. for example, if the patient is pacemaker dependent, even if short electrosurgery applications would lead to oversensing by pacemaker and inhibit its output, it would unlikely cause hemodynamic compromise. in view of recently published expert consensus statement for programming icds, to avoid unnecessary therapy hence, if electrosurgery application will be limited to less than 5 seconds at a time, it will unlikely lead to icd therapy, as the device will declare this event as nonsustained. once the surgery is complete, the patient is usually transported to a holding or recovery area. patients should remain in an electrocardiography monitor at least until the magnet is removed from the cied or reprogramming of the cied is performed and the original, preprocedure, settings are programmed. once this is accomplished, the length of further monitoring is decided on by the primary team. if reprogramming of the device was not done prior to procedure, most of the time it would be sufficient for the patient to be followed in the device clinic within a month. exceptions to this would be if abnormalities were noted on the monitor, it would suggest abnormal pacing or icd function, hemodynamic compromise during surgery, cardiac arrest, emergent surgery, or an appointment can not be arranged for the patient to visit device clinic within 1 month. in conclusion, managing patients with cieds can be challenging, especially in emergent situations. when time is of essence, following protocol from figure 3 may guide one during emergency noncardiac surgeries. if surgical cases are nonemergent and medical facility has electrophysiology team, it makes more sense to involve them. however, understanding concepts as described above affords better teamwork and collaboration. dividing evaluation into preprocedure, intraprocedure, and postprocedure steps most of the evidence, as to interaction between cieds and electrosurgery, is based on case reports and information provided by engineers from device companies. although it is not optimal or as strong as it used to be in other cardiology fields, it is the best available at this time. nevertheless, extensive personal experiences in electrophysiology community lead to creating common sense recommendations that prepared patients with cieds to go safely through surgeries. as future technologies are knocking on our doors, we have to be ready to welcome them without compromising patient s safety. as new technology develops and new devices are coming to the market (eg, leadless pacemakers), more prospective and randomized studies are necessary to assure patients safety. | in this article, the reader will get some insights into managing patient with implantable cardiac devices while undergoing noncardiac surgery. we will review basic concepts regarding normal function of pacemakers and implantable cardioverter defibrillators, understanding how their function will be influenced during noncardiac surgeries. you will be guided through management steps from preoperative, intraoperative, and postoperative aspects. in an ever - changing world of medicine, it is important to keep up with progress as more and more patients get implantable cardiac devices. |
seborrheic keratosis (sk) is an extremely common benign epidermal proliferative lesion, which is prevalent in all races. most lesions are found on the trunk, face, scalp, and the extremities, although they can occur anywhere on the body except the palms and soles. the most common appearance is that of a very superficial verrucous plaque which appears to be stuck on the surface, varying from dirty yellow to black in color. giant lesions are very rare, and their location on the genital area is rarer still, with no more than 10 published cases. we report here a case of multiple giant sk lesions located on the genitals and the adjacent areas. a 59-year - old man presented with large dark coloured growths over his lower abdomen, genitalia and the adjoining areas of 10 years duration. the disease started as small elevations over the penis and left groin. over the next few years, new lesions appeared over the adjacent areas and grew in size to attain the present dimensions. the patient initially had local discomfort, occasional pain and irritation over the affected sites, but he was otherwise in good health. examination revealed multiple, brownish black to black nodules, plaques, and tumors with lobulated, irregular, greasy surface [figure 1 ]. in some areas, the lesions had erythematous moist erosions over the surface [figure 2 ]. the lesions were distributed over the pubic area, penis, scrotum, groins, upper thigh, perineum, and the perianal areas. some lesions were discrete, while the others were confluent, giving rise to large plaques. histopathological examination of multiple biopsy specimens showed similar features of hyperkeratosis, papillomatosis and acanthosis with proliferation of basaloid cells containing multiple horn cysts [figure 3 ]. large, blackish growths with verrucous, lobulated surface over the pubis, penis, scrotum, groin, and upper thigh large, warty, lobulated tumors over the perineum, groin and upper thigh. some areas are reddish, with eroded surface histopathology showing hyperkeratosis, acanthosis with basaloid cells, papillomatosis and horn cysts within the acanthotic epidermis (h and e, 100) based on the clinical and histopathological findings, a diagnosis of giant seborrhoeic keratoses was made and the patient was referred to plastic surgery department for further management. sks are common benign lesions, which usually present with multiple pigmented papules and plaques with a stuck on appearance. lesions are rarely more than 3 cm in diameter and occur most often on trunk, face, and extremities, particularly over the sun exposed areas. the lesions tend to increase in number and size with advancing age. morphologic variants of sk include the common flat type, skin tag like, stucco keratosis, dermatosis papulosa nigra, inverted follicular keratosis, and melanoacanthoma. large, often polypoidal lesions have been reported to occur on the genital / perigenital area on rare occasions. multiple giant pedunculated lesions over the penis of 20 years duration, perianal polypoidal lesions, and large perigenital lesions complicated by myiasis have been reported in the past. however, such extensive involvement as in our case with lesions over the pubic area, genitals, scrotum, perineum, thigh, and perianal areas has not been documented previously. giant sk may have to be differentiated from condyloma acuminata, melanoma, and buschke lwenstein tumor. condyloma acuminata or genital warts usually involve the glans and shaft of the penis and the perianal area, but may affect the adjoining skin. the lesions are usually skin colored to brownish, have a rough surface with filiform projections and lack the greasiness of the surface typical of sk. buschke lwenstein tumor is a locally aggressive verrucous carcinoma that typically starts on the prepuce and slowly grows into a cauliflower like mass. melanomas are darkly pigmented, show irregularity of border and color with frequent ulceration, bleeding and local lymph node involvement. several histological subtypes are generally recognized : acanthotic, hyperkeratotic, adenoid (reticulated), clonal, irritated, inverted follicular keratosis, and melanoacanthoma. of these, the acanthotic subtype is the most common variant. the acanthotic type, as in our case, demonstrates hyperkeratosis, marked acanthosis with basaloid cells, papillomatosis and presence of horn cysts or pseudocysts. the cause of genital sk is as yet unknown, but there may be a possible role of chronic friction. formation of in situ carcinoma and basal cell carcinoma has been documented rarely in acanthotic sk. the common flat type of sk may be left alone or may be treated with liquid nitrogen cryotherapy, curettage, shave excision, or light electrodessication. the large and extensive lesions as in our case, however, need surgical excision and plastic reconstruction. | seborrheic keratosis (sk) is a very common benign epidermal proliferation that is prevalent in all races. most commonly occurring on the trunk, face, scalp, and the extremities, they can occur anywhere on the body except the palms and soles. the most common appearance is that of a very superficial verrucous plaque which appears to be stuck on the surface. giant lesions are very rare, and their location on the genital area is rarer still. we report here a case of multiple giant sk lesions in a 59-year - old man. |
leiomyosarcomas (lmss) are relatively rare mesenchymal neoplasms composed of cells that exhibit smooth muscle differentiation. they account for 510% of soft tissue sarcomas. these adult soft tissue sarcomas are far out numbered by the more commonly occurring liposarcomas. majority of these tumors are located in the retroperitoneum, including the pelvis and the uterus. lms is a rare malignancy of the oral and pharyngeal region of unknown etiology. according to a review of smooth muscle tumors, only 0.06% occurred in the oral region. although no definite causative factor has yet been identified, correlation has been established between lms and exposure to radiations and chemicals and possibly trauma. association of lmss with hereditary (bilateral) retinoblastoma (rb), which appears to result directly from mutations or deletions in the rb 1 gene, suggests the role of chromosomal defects in the etiology of the tumor. these tumors arise from smooth muscle cells, especially those found in blood vessel walls and from undifferentiated mesenchymal cells. retroperitoneal and inferior vena cava lmss are more common in women. on the other hand, the oral tumors do not display any significant gender predilection. lmss present intraorally as painless, lobulated, fixed masses of the submucosal tissues in middle - aged or older individuals but are rarely found in children. oral lesions are usually less than 2 cm in diameter at diagnosis and are slow - growing, but secondary ulceration of the mucosal surface has been reported in a few cases. histological appearances differ according to the degree of differentiation but the presence of a focus of fascicles of elongated brightly eosinophilic spindle cells with vesicular, ovoid to cigar - shaped nuclei showing a strong positivity for smooth muscle actin (sma) and/or desmin is a minimum requisite. in well - differentiated lesions, there is fascicular streaming of spindled cells in a manner similar to that seen in a leiomyoma. about 10% of lmss are anaplastic, which in the extreme cases may show pleomorphic undifferentiated sarcoma (pus)/malignant fibrous histiocytoma (mfh) like pleomorphism. in these tumors, numerous pleomorphic giant cells with deeply eosinophilic cytoplasm are admixed with a set of more uniform - appearing spindle and round cells. the purpose of this compilation is to present a case report of a primary lms of maxilla in a 63-year - old male with a stress on comprehensive morphological analyses and careful interpretation of immunohistochemical markers to arrive at a correct diagnosis. a 63-year - old male patient reported to the out - patient department of the dental school with a6-month history of progressive and continuous enlargement in the anterior maxilla.the growth was painless and non - tender and had loosened the upper front teeth. on examination, the growth was bosselated and arose from the anterior maxillary alveolus extending from right canine to left lateral incisor. based on the above findings, a clinical diagnosis of malignancy of maxilla was made. computerized tomography scan showed an osteolytic lesion extending in the nasal chamber but not laterally in the maxillary sinuses. the axial section showed a diffuse soft tissue mass obliterating the anterior nasal chamber completely destroying the anatomy of the anterior palate and the nasal cartilaginous skeleton [figure 1 ]. (a) intraoral photograph showing bosselated growth in the anterior maxilla with patchy bluish discoloration extending from right canine to left lateral incisor with palatal extension in the anteroposterior direction involving the midline. (b) computed tomography (ct) axial section showing a diffuse soft tissue mass obliterating the anterior nasal chamber. the lesion is also seen extending in the anterior maxillary alveolus area completely destroying the anatomy of the anterior palate and the nasal cartilaginous skeleton because of the non - specific clinical presentation, based on the age of the patient and location of the tumor, the differential diagnoses include a salivary gland tumor, a sarcoma and squamous cell carcinoma and incisional biopsy was planned under local anesthesia. analysis of the biopsy specimen revealed a tumor mass composed of fascicles of interlacing spindle - shaped cells with abundant eosinophilic cytoplasm and moderately large nuclei exhibiting atypia. based on the above features, a provisional diagnosis of a malignant spindle cell tumor was made. the differential diagnosis of spindle - shaped lesions included malignant lesions such as pus, rhabdomyosarcoma (rms), lms, malignant peripheral nerve sheath tumor (mpnst) and fibrosarcoma. since the lesion showed aggressive clinical and radiological features suggestive of malignancy, resection of tumor with safe wide margins was planned under general anesthesia. the tumor was safely resected with approximately 1.5 cm of safe margin in the healthy tissue. a 2.4-mm titanium reconstruction plate was affixed in the residual maxilla to support a prosthesis in future. in order to rule out any primary or secondary foci of malignancy, a body scan was performed and the results were negative. the patient has been on regular follow - up for the last 2 years with no signs of recurrence. a tooth bearing obturator was delivered and the patient is presently satisfied with its appearance and function. the excised dentate hemimaxilla measuring 8 cm 7.5 cm in dimension ; reddish- brown in color and firm in consistency was received [figure 2 ]. the cut surface of the tumor mass was solid, fibrous and yellowish - white in color with foci of hemorrhage and necrosis. the tumor mass measured 8 cm 7.5 cm in dimensions and was creamish brown in color with color variegation ranging from brown to yellow and was firm in consistency histopathologically, the tumor mass was composed of elongated spindle cells arranged in interlacing bundles in interweaving fascicles of varying size. the cells showed abundant eosinophilic cytoplasm and moderately large centrally located blunt ended nuclei with mild atypia. hyperchromatism of nuclei was pronounced and numerous normal and abnormal mitotic figures were scattered throughout the lesion. mitotic figures (mf) were abundant and ranged up to 22 mf/10 hpf (high power fields). numerous pleomorphic giant cells with deeply eosinophilic cytoplasm was intimately admixed with more typical cells. pleomorphic areas imparting a pleomorphic appearance were abundant in the tumor hence a provisional diagnosis of pleomorphic sarcoma was made and the spectrum included tumors exhibiting prominent pleomorphism like pus (storiform - pleomorphic mfh), pleomorphic liposarcoma, pleomorphic leiomyosarcoma and pleomorphic rms [figure 4 ]. the tumor was graded according to the french grading system as described by coindre. with this system, the differentiation grade of tumors, the number of mf/2 mm and the amount of necrosis are scored. all tumors were divided into grade 1, grade 2 or grade 3 tumors. the mitotic index (number of mf/2 mm) was determined on hematoxylin and eosin (h and e) stained sections of the tumors ; the areas with the highest rates of mitosis were selected. photomicrographs showing a) low power view of a tumor mass with numerous engorged vascular channels (h&e stain, x40). (b) tumor mass composed of fascicles of interlacing spindle - shaped cells with abundant eosinophilic cytoplasm and moderately large nuclei exhibiting atypia (h&e stain, 40). (c) elongated cells with abundant cytoplasm exhibiting centrally placed blunt ended nuclei (h&e stain, 100). (d) bizarre tumor cells with nuclear pleomorphism interspersed among regular spindle - shaped cells (h&e stain, 100) photomicrographs showing pleomorphism in leiomyosarcoma. (a) bizarre spindle cell exhibiting deeply eosinophilic cytoplasm with pleomorphic nuclei and nuclear vacuolization (h&e stain, 400). (b) cells exhibiting extreme degree of pleomorphism and occasional multinucleation resembling pleomorphic undifferentiated sarcoma/ malignant fibrous histiocytoma (h&e stain, 400) the histopathological uncertainty prompted an immunohistochemical analysis. for immunohistochemical staining, the strept avidin biotin (sab) method was used with primary antibodies to vimentin, sma, muscle specific actin (hhf35), pancytokeratin, desmin, myogenin, h - caldesmon, cd31, cd34, s-100 protein, human melanoma black (hmb) 45 and 1 anti - chymotrypsin. the tumor cells showed a strong immunopositivity for vimentin with focal positivity for sma and muscle hhf-35 [figure 5 ]. the tumor cells were negative for pancytokeratin, epithelial membrane antigen (ema), desmin, myogenin, h - caldesmon, cd31, cd34, s-100 protein and hmb45 [table 1 ]. photomicrographs showing (a) strong positive immunohistochemical reaction to antibodies against vimentin (ihc stain, 100), (b) focal expression of smooth muscle actin (sma) in the tumour cells (ihc stain, 100), (c) focal reaction to muscle specific actin (hhf-35) by the tumor cells (ihc stain, 400) immunohistochemical expression of the lesional cells based on the above parameters, a diagnosis of pleomorphic leiomyosarcoma grade 3/3 (coindre grading system) was made. the excised dentate hemimaxilla measuring 8 cm 7.5 cm in dimension ; reddish- brown in color and firm in consistency was received [figure 2 ]. the cut surface of the tumor mass was solid, fibrous and yellowish - white in color with foci of hemorrhage and necrosis. the tumor mass measured 8 cm 7.5 cm in dimensions and was creamish brown in color with color variegation ranging from brown to yellow and was firm in consistency histopathologically, the tumor mass was composed of elongated spindle cells arranged in interlacing bundles in interweaving fascicles of varying size. the cells showed abundant eosinophilic cytoplasm and moderately large centrally located blunt ended nuclei with mild atypia. hyperchromatism of nuclei was pronounced and numerous normal and abnormal mitotic figures were scattered throughout the lesion. mitotic figures (mf) were abundant and ranged up to 22 mf/10 hpf (high power fields). numerous pleomorphic giant cells with deeply eosinophilic cytoplasm was intimately admixed with more typical cells. pleomorphic areas imparting a pleomorphic appearance were abundant in the tumor hence a provisional diagnosis of pleomorphic sarcoma was made and the spectrum included tumors exhibiting prominent pleomorphism like pus (storiform - pleomorphic mfh), pleomorphic liposarcoma, pleomorphic leiomyosarcoma and pleomorphic rms [figure 4 ]. the tumor was graded according to the french grading system as described by coindre. with this system, the differentiation grade of tumors, the number of mf/2 mm and the amount of necrosis are scored. all tumors were divided into grade 1, grade 2 or grade 3 tumors. the mitotic index (number of mf/2 mm) was determined on hematoxylin and eosin (h and e) stained sections of the tumors ; the areas with the highest rates of mitosis were selected. photomicrographs showing a) low power view of a tumor mass with numerous engorged vascular channels (h&e stain, x40). (b) tumor mass composed of fascicles of interlacing spindle - shaped cells with abundant eosinophilic cytoplasm and moderately large nuclei exhibiting atypia (h&e stain, 40). (c) elongated cells with abundant cytoplasm exhibiting centrally placed blunt ended nuclei (h&e stain, 100). (d) bizarre tumor cells with nuclear pleomorphism interspersed among regular spindle - shaped cells (h&e stain, 100) photomicrographs showing pleomorphism in leiomyosarcoma. (a) bizarre spindle cell exhibiting deeply eosinophilic cytoplasm with pleomorphic nuclei and nuclear vacuolization (h&e stain, 400). (b) cells exhibiting extreme degree of pleomorphism and occasional multinucleation resembling pleomorphic undifferentiated sarcoma/ malignant fibrous histiocytoma (h&e stain, 400) the histopathological uncertainty prompted an immunohistochemical analysis. for immunohistochemical staining, the strept avidin biotin (sab) method was used with primary antibodies to vimentin, sma, muscle specific actin (hhf35), pancytokeratin, desmin, myogenin, h - caldesmon, cd31, cd34, s-100 protein, human melanoma black (hmb) 45 and 1 anti - chymotrypsin. the tumor cells showed a strong immunopositivity for vimentin with focal positivity for sma and muscle hhf-35 [figure 5 ]. the tumor cells were negative for pancytokeratin, epithelial membrane antigen (ema), desmin, myogenin, h - caldesmon, cd31, cd34, s-100 protein and hmb45 [table 1 ]. photomicrographs showing (a) strong positive immunohistochemical reaction to antibodies against vimentin (ihc stain, 100), (b) focal expression of smooth muscle actin (sma) in the tumour cells (ihc stain, 100), (c) focal reaction to muscle specific actin (hhf-35) by the tumor cells (ihc stain, 400) immunohistochemical expression of the lesional cells based on the above parameters, a diagnosis of pleomorphic leiomyosarcoma grade 3/3 (coindre grading system) was made. they comprise a heterogeneous group of neoplasms, each with unique clinical, histological and radiographic characteristics. lms is listed as a rare disease by the office of rare diseases (ord) of the national institute of health (nih). it is rarer in the head and neck region and most commonly affects the nose and paranasal sinuses, skin, subcutaneous tissue and the cervical esophagus. in the oral cavity, the maxillary sinus, mandible and maxilla appear to be the predilection sites for lms, but other reported intraoral locations are the cheek, floor of the mouth, tongue, hard and soft palate, lips and gingiva. the rare occurrence of lms in the oral cavity has been correlated to the scarcity of smooth muscle structures in this location, as compared with their abundance in other sites. lmss occurring in the oral tissues in all probability arise from tunica media of blood vessels, arrectores pilorum, circumvallate papillae, myoepithelial cells and pluripotential undifferentiated mesenchymal cells. oral and maxillofacial lmss are rare and have no specific signs and symptoms, usually presenting as non - ulcerated painless masses. as a result, some of these lesions are occasionally mistaken for the other common lesions affecting the oral cavity and correct diagnosis is made only after a judicious histologic examination. the clinical differential diagnosis for a palatal lesion includes benign and malignant salivary gland tumors (pleomorphic adenoma, mucoepidermoid carcinoma, adenoid cystic carcinoma, polymorphous low - grade adenocarcinoma) and benign and malignant mesenchymal tumors. because of lack of a distinct radiographic presentation they can present as lytic lesions with ill - defined margins, periosteal elevation, calcification and cortical destruction. microscopic diagnosis of the smooth muscle lesions is difficult due to the small biopsy sizes and the diversity of the lesions. morphological features in favor of smooth muscle differentiation include intersecting fascicles of spindle cells, eosinophilic cytoplasm, paranuclear vacuoles and blunt - ended nuclei. para nuclear vacuole is seen at one end of the nucleus, causing a slight indentation, so the nucleus assumes a concave rather than a convex contour. size, cellularity, atypia, necrosis and mitoses per hpf are indicators that help define the difference between a benign smooth muscle tumor and lms. of these indicators, mitoses per hpf hyperchromatism of nuclei is often pronounced and numerous normal and abnormal mitotic figures are scattered throughout the lesion. the stroma is typically sparse, but cellular streaming is usually far less regular than in the low grade lesions, although the fascicles may be as uniform as those of well - differentiated lesions. hemorrhage, focal necrosis, increased vascularity and focal myxoid change are not uncommon features of poorly differentiated lesions. a score of 1 is currently assigned to sarcomas closely resembling normal adult tissue to such a degree as to be confused with benign tumors, such as a well - differentiated lms. a score of 3 is given to embryonal and poorlydifferentiated sarcomas, sarcomas of doubtful histologic type, synovial sarcoma, primitive neuro - ectodermal tumor, osteosarcoma, pleomorphic rms and pleomorphic liposarcoma. this count is taken to establish the score : score 1 for 0 to 9 mitoses ; score 2 for 10 to 19 mitoses ; and score 3 for more than 19 mitoses per 10 hpf. it is a morphologic variant rather than a distinctive subtype and is usually associated with areas of undifferentiated pleomorphic sarcoma along with fields showing morphological, immunohistochemical or ultrastructural evidence of smooth muscle differentiation. although the present case displayed features of smooth muscle differentiation to some extent, the correct light - microscopic diagnosis was difficult, mainly because the tumor was pleomorphic, resembling a pus (mfh). the differential diagnosis of lmss includes other sarcomas composed of fascicles of moderately differentiated spindle cells, such as fibrosarcoma and mpnst. although the low - power appearance of all three can be similar, there is a greater tendency to see a close juxtaposition of longitudinally and transversely cut fascicles in a lms. compared with the cells of lms, those of a fibrosarcoma tend to be tapered and those of a mpnst are wavy, buckled and distinctly asymmetric. vimentin, sma, desmin, h - caldesmon are positive in lms but fibrosarcoma is diagnosed by exclusion as it is s-100 positive [table 2 ]. thus, careful scrutiny of cytological details in multiple sections, clinico - pathological correlation and immunohistochemistry (ihc) are mandatory for a definitive diagnosis. tumor immunoreactivity reference chart in pleomorphic lms, the neoplastic cells have more bizarre features with numerous tumor giant cells, high mitotic activity and a prominent storiform pattern. the latter is sometimes so overwhelming that a diagnosis of pus (mfh) is made on h and e. we encountered a similar problem in our initial diagnosis where the diffuse and prominent storiform arrangement of neoplastic spindle cells favored a diagnosis of pus. based on the ihc results a diagnosis of lms was reached thus emphasizing its role in arriving at a final diagnosis in case of spindle cell tumors. originally the tumor was diagnosed as pus (mfh) based on the whorled structural pattern and considerable cellular pleomorphism. the distinction between pleomorphic lms and pus (mfh) is probably the most difficult and controversial. unless there are light microscopic areas that are diagnostic of smooth muscle differentiation, decision is based upon the immunoreactivity for various myogenic markers reflective of smooth muscle differentiation. significant amounts of actin or some degree of both actin and desmin immunoreactivity is required for the diagnosis of pleomorphic lms. peripheral expression of actin immunoreactivity of myofibroblasts in pus (mfh) contrasts with the diffuse actin immunoreactivity of smooth muscle cells in lmss and careful evaluation is required to differentiate the two entities. pus (mfh) are usually positive for 1-antichymotrypsin and vimentin and are negative for myoglobin and desmin. in this case, the tumors that originate from muscle stain positive for desmin, hhf35 and vimentin ; however, this case was positive for -sma and the diagnosis of rms was ruled out. immunohistochemical demonstration of muscle - specific actin and smooth - muscle - specific actin is a strong indicator for lms. also, desmin may be helpful in the diagnosis of lms, since the intermediate filament desmin is present in both smooth muscle and striated muscle. vimentin is considered a major component of the intermediate filaments of smooth muscle cells derived from vasculature. spindle - shaped cells of lms are usually negative for cks [table 2 ]. intraoral lmss are very aggressive tumors with high local recurrence and/or distant metastasis and the survival rate is very low. clinical data of the reported cases of maxilllary leiomyosarcoma (lms) generally, a complete surgical resection with tumor - free margins is recommended to control local recurrence and adjuvant radiotherapy or chemotherapy is considered to have little beneficial effect on decreasing recurrence of lms or increasing survival time. however, in some specific anatomic locations such as the vicinity of the infratemporal fossa, the maxillary sinus, the pterygoid plates and the mandibular condyle, it may be technically less feasible to achieve tumor - free margins because of difficult access, possibly resulting in residual microscopic disease leading to the local recurrence of the tumor and a poorer prognosis. distant metastases of intraoral lms appear in up to 39% of cases. in oral lms, metastasis to regional lymph nodes was relatively rare and the most common site of metastasis was the lungs. 26272829 lms is a relatively rare tumor in the oral and maxillofacial region and has a poor prognosis as a result of high local recurrence. a thorough morphological analyses and careful interpretation of immunohistochemical markers is necessary to arrive at a correct diagnosis. accurate diagnosis, classification and multi - modality treatment approach is essential for favorable outcome. | leiomyosarcoma (lms) is a malignant neoplasm composed of cells showing distinct smooth muscle features. majority of the tumors are located in the retroperitoneum, including the pelvis and the uterus but are rare in the oral and pharyngeal region. intraorally, they are present as painless, lobulated, fixed masses of the submucosal tissues in middle - aged or older individuals. lesions are usually slow growing and are less than 2 cm in diameter at the time of diagnosis. here we report the clinico - pathological findings of a case of primary lms of the maxilla in 63-year - old male patient with an emphasis on the judicious use of ancillary diagnostic modalities to arrive at a definitive diagnosis. |
advanced chronic periodontitis often coexists with poorly controlled diabetes, such that diabetes is considered to be a risk factor for periodontitis. many studies conducted among adults have reported a significant positive two - way association between diabetes (both type-1 and type-2) and periodontal disease that is, diabetes increases risk of developing periodontitis and worsens preexisting periodontitis and periodontitis may raise the risk of diabetes. periodontal infection can increase systemic inflammation, which in turn may induce a chronic state of insulin resistance, contributing to the cycle of hyperglycemia and advanced glycation end product - protein binding accumulation. therefore, it can amplify the classical pathway of connective tissue degradation, destruction and proliferation in diabetes. moreover, studies have also shown that treating periodontitis in diabetic patients has a beneficial effect on their blood glucose control. on the other hand, poorly controlled diabetes is an important risk factor for periodontitis, and gingivitis, and sometimes periodontitis is the first sign that a diabetic patient presents with. the impact of periodontitis on the diabetes - related inflammatory status has also been studied. it has been indicated that the cytokine induced inflammatory state in periodontitis can contribute to the overall low grade inflammation that occurs in diabetes. a recent study investigated the relationship between chronic periodontitis, impaired fasting glucose (ifg), and diabetes in the us population and found chronic periodontitis to be positively associated in a linear relation with ifg and diabetes in us adults. studies evaluating the relationship between impaired glucose tolerance (igt) and periodontal disease among japanese population suggest that periodontal disease is positively associated with igt, but other studies found no such association. obesity and impaired lipid profile are other strong risk factors for type-2 diabetes, which in turn is a risk factor for periodontal disease. the extent of coronary atherosclerosis is positively correlated with pro - atherogenic lipids, that is, total cholesterol, low - density lipoprotein (ldl) cholesterol and triglycerides (tg), and negatively correlated with anti - atherogenic high density lipoprotein (hdl) cholesterol. the high prevalence of cardiovascular disease and periodontitis in individuals with diabetes may be attributed to an increased inflammatory response leading to atherosclerosis as compared to those without diabetes. though there are many studies that have evaluated the interrelationship between the diabetic status of an individual with his / her periodontal status ; the authors however could not find studies / research reports that evaluated relationship between various biochemical parameters like lipid profile and oral glucose tolerance test (ogtt) with periodontal health / disease status, in both healthy and diabetic patients. hence, this study was designed to investigate the association between chronic periodontitis and diabetes by taking dental plaque index (dpi) and community periodontal index (cpi) score as periodontal health / disease dependent variables and lipid profile and ogtt as biochemical parameters in healthy, diabetic and igt subjects. this study began in 2008 in the department of biochemistry and the department of periodontics at baba jaswant singh dental college hospital and research institute, ludhiana with the subjects reporting to the opd of the department of periodontics. all patients reporting to the department of periodontics were interviewed and questioned about their diabetic / lipid profile status. any patient reporting a known self or family history of deranged lipid / diabetic profile was provisionally selected for this study. of these, a group of 120 patients who were willing to form a part of the study were finally selected and were sent for blood and periodontal examination. the subjects undertaken also fulfilled the following criteria - community periodontal index (cpi) score of 2 or more [table 1 ] and cpi loss of attachment score of 0 and above [table 2 ]. community periodontal index cpi loss of attachment score subjects with community periodontal index loss of attachment score 0 underwent a periodontal examination to determine mean periodontal pocket depth and attachment loss. for the biochemical analyses, the reports of ogtt and lipid profile tests were analyzed as per who criteria for the diagnosis of diabetes that is, normal glucose tolerance (ngt ; fasting and 2 h postchallenge plasma glucose levels < 110 mg / dl and < 140 mg / dl, respectively), diabetes (fasting or 2 h postchallenge plasma glucose levels 126 mg / dl or 200 mg / dl, respectively) and igt (igt ; all others with some glucose tolerance impairment including impaired fasting glucose (ifg), that is, with one of the two glucose tolerance levels between normal and diabetic values and the other below the diabetic level). the samples of venous blood were taken in the fasting state for ogtt and lipid profile analysis. immediately after, 75 g glucose dissolved in 300 ml water was given to be ingested in about 5 min and sample of blood was again collected at an interval of 30 min for a period of 3 h for glucose tolerance test (gtt) analysis. data obtained was tabulated, compared and statistically analyzed using z - test to know the correlation between lipid profile test values, type 2 diabetes mellitus and periodontitis. subjects with community periodontal index loss of attachment score 0 underwent a periodontal examination to determine mean periodontal pocket depth and attachment loss. for the biochemical analyses, the reports of ogtt and lipid profile tests were analyzed as per who criteria for the diagnosis of diabetes that is, normal glucose tolerance (ngt ; fasting and 2 h postchallenge plasma glucose levels < 110 mg / dl and < 140 mg / dl, respectively), diabetes (fasting or 2 h postchallenge plasma glucose levels 126 mg / dl or 200 mg / dl, respectively) and igt (igt ; all others with some glucose tolerance impairment including impaired fasting glucose (ifg), that is, with one of the two glucose tolerance levels between normal and diabetic values and the other below the diabetic level). the samples of venous blood were taken in the fasting state for ogtt and lipid profile analysis. immediately after, 75 g glucose dissolved in 300 ml water was given to be ingested in about 5 min and sample of blood was again collected at an interval of 30 min for a period of 3 h for glucose tolerance test (gtt) analysis. data obtained was tabulated, compared and statistically analyzed using z - test to know the correlation between lipid profile test values, type 2 diabetes mellitus and periodontitis. subjects with community periodontal index loss of attachment score 0 underwent a periodontal examination to determine mean periodontal pocket depth and attachment loss. for the biochemical analyses, the reports of ogtt and lipid profile tests were analyzed as per who criteria for the diagnosis of diabetes that is, normal glucose tolerance (ngt ; fasting and 2 h postchallenge plasma glucose levels < 110 mg / dl and < 140 mg / dl, respectively), diabetes (fasting or 2 h postchallenge plasma glucose levels 126 mg / dl or 200 mg / dl, respectively) and igt (igt ; all others with some glucose tolerance impairment including impaired fasting glucose (ifg), that is, with one of the two glucose tolerance levels between normal and diabetic values and the other below the diabetic level). the samples of venous blood were taken in the fasting state for ogtt and lipid profile analysis. immediately after, 75 g glucose dissolved in 300 ml water was given to be ingested in about 5 min and sample of blood was again collected at an interval of 30 min for a period of 3 h for glucose tolerance test (gtt) analysis. data obtained was tabulated, compared and statistically analyzed using z - test to know the correlation between lipid profile test values, type 2 diabetes mellitus and periodontitis. of 120 subjects undertaken for study, 35 patients were found to be periodontally healthy and 85 periodontally diseased ; 48 subjects had igt, and 17 had diabetes and the rest of the subjects that is, 55 had ngt. all subjects were assessed for their periodontal condition by taking dpi [table 3 ] and cpi scoreas parameters. when dpi score (suggesting periodontal condition of the patient) and ogtt results were compared and studied, it was observed that dpi for ngt, igt and diabetic patients were 1.05 0.5, 1.16 0.7, and 1.65 0.8, respectively [table 4 ]. when cpi score (suggesting periodontal condition of the patient) and ogtt results were studied, it was observed that cpi score for ngt, igt, and diabetics were 1.33 0.4, 1.67 0.5, and 2.33 0.8, respectively [table 4 ]. a similar correlation was found between ldl levels and ogtt results, that is, ldl levels in patients with ngt and igt were within normal range, while it was higher than normal in patients with diabetes [table 5 ]. mean total cholesterol and mean hdl values were within normal range for all ogtt patient types [table 5 ]. in a correlation table of various biochemical analyses and periodontal parameters, [table 6 ] it is evident that out of 85 periodontally diseased patients 35 showed abnormal fasting blood sugar levels and 61 showed abnormal post prandial blood sugar levels which potrays a non - significant co - relation. of the 85 periodontally diseased patients 77 patients showed abnormal total serum cholesterol level, 65 showed abnormal ldl cholesterol level and 71 showed abnormal tg levels. these findings suggest that worsening lipid profile test values can be positively correlated with increased severity of periodontal disease [highly significant p < 0.001 ]. dental plaque index (sillness and loe, 1964) periodontal condition of subjects in relation to their biochemical status association of participants diabetic status ogtt and lipid profile tests correlation between periodontal condition and various biochemical parameters the results of this study show that in patients having poor periodontal condition poor ogtt score was observed. it is also clear that as the periodontal condition and ogtt scores worsen, the tg levels and ldl levels also worsen. it has been shown that diabetes is one of the predisposing factors for the development of periodontal disease. the inter relationships between periodontitis and diabetes provide an example of systemic disease predisposing to oral infection, and once that infection is established, oral infection exacerbates the systemic disease. it has been shown that diabetic patients are prone to elevated ldl cholesterol and tgs even when blood glucose levels were well controlled. this is significant ; as our study indicated that hyperlipidemia may be one of the factors associated with periodontitis. the results of the study suggest that periodontitis itself may lead to elevated ldl / tg levels. within this context, it may be put forth that in addition to effects of diabetes, periodontitis may contribute to elevated serum lipids and potentially to systemic disease arising from chronic hyperlipidemia. in a recent study in women subjects, periodontal disease was shown to be associated with later development of impaired glucose metabolism with a prior history of gestational diabetes. therefore, treating periodontal disease may in addition to controlling and or improving the diabetic status of the patient may also improve the deranged lipid profile in a patient. when seen in this context, treating periodontal disease may also have a significant impact on improving the systemic health of the patient as both diabetes and a deranged lipid profile are known risk factors for several life - threatening diseases and conditions. as this study has demonstrated that the lipid profile can be a determinant of diabetes and periodontitis and vice versa many cases of diabetes and deranged lipid profile may remain undiagnosed, and screening of patients in dental clinics may lead to a diagnosis of these in some cases. it is evident from this study that abnormal levels of total serum cholesterol, ldl cholesterol, and tgs can be positively correlated with periodontally diseased conditions. as evidence of close link between periodontal disease, diabetes and deranged lipid profile is seen, treating and preventing recurrence of periodontal disease in patients with diabetes and deranged lipid profile values should be considered an important component of the treatment and management of patients suffering from diabetes and deranged lipid profile. | objective : a two - way relationship between diabetes and periodontal disease has been suggested ; whereas obesity and impaired lipid profile are risk factors for type-2 diabetes mellitus. this study examined the relationship between lipid profile, oral glucose tolerance test (ogtt) with periodontal health / disease dependent variables in healthy, diabetic and impaired glucose tolerance subjects.materials and methods:120 patients were selected for the study and were determined to be periodontally healthy or diseased. all these patients underwent biochemical tests for ogtt and lipid profile analysis and data was compared using z-test.results:the ogtt results deteriorated with deteriorating periodontal condition. a similar correlation was also observed between worsening lipid profile test values, ogtt score, and periodontal condition.conclusion:this study indicates that hyperlipidemia may be one of the factors associated with periodontitis and that periodontitis may itself lead to abnormal serum lipid levels. therefore, in addition to effects on diabetes, periodontitis may contribute to elevated serum lipid levels and therefore potentially to systemic disease arising from chronic hyperlipidemia. |
midfacial defects may result from congenital or developmental abnormalities, accidental trauma, or acquired disfigurements resulting from removal of tumors during maxillectomy surgery in the oral or nasal cavities. midfacial defects occur in the horizontal plane of the middle third of the face including 2 main categories : midline and lateral defects. midline defects refer to the complete or partial involvement of the nose, and/or upper lip, along with intraoral maxillary defects.1,2 a lateral defect may include complete or partial contents of the cheek and or orbit, and may include an intraoral defect of the maxilla.1 - 3 acquired midfacial defects may affect speech, mastication, quality of life, psychology, and social behavior.4 - 7 large defects that result from cancer treatment are rarely rehabilitated by surgical reconstruction alone : they usually require a facial prosthesis to restore function and appearance.8 in addition, an intraoral prosthesis such as an obturator is often needed to restore speech and deglutition. retention of the prosthesis is also a difficult problem because of its size and weight. this clinical report describes the prosthodontic rehabilitation of a dentate patient with a large midfacial (intraoral - extraoral) surgical defect. a 57-year - old man, visited to the department of ear - nose - throat in government medical college and hospital, nagpur (india) due to the extensive ulceration in right maxillary cheek mucosa and the swelling in the right maxillary buccal vestibule. clinico - pathological examination revealed t4n3m0 squamous cell carcinoma of right maxilla and cheek mucosa. the patient was then operated for right orbital exenteration and right zygomatic resection along with resection of the right maxilla to eradicate all possible cancerous tissues. the patient received a postoperative course of total dose of 7200 cgy external beam radiation within a period of 7 weeks in fractionations (a fraction of 200 cgy / day for 5 days in a week). the patient was restricted to a liquid - diet through a naso - gastric tube for initial 3 months after surgery. a surgical - obturator was fabricated and tried intraorally after surgery, but due to extensive intraoral tissue resection (also communicated extraorally) complete prosthetic - closure of the defect was not achieved well. the patient was not able to control liquids in the oral cavity and hence refused to wear the obturator at initial healing phase. after 3 months of healing period, the patient was referred to the department of prosthodontics in government dental college and hospital, nagpur (india) for prosthetic rehabilitation where he was delivered an interim obturator (without teeth incorporated). after 9 months of surgery the patient was examined in the department of ear - nose - throat for healing of the defect and was referred to the department of prosthodontics for fabrication of a definitive prosthesis. periodontal condition of mandibular teeth and remaining maxillary teeth (on left side) were examined clinically as well as radiographically (with the help of orthopantomogram) and observed to be in healthy status. examination of orthopantomogram revealed loss of floor of right orbit, right zygoma and right half of the maxilla along with the teeth. condylar processes and glenoid fossae on both sides were found to be normal in shape in orthopantomogram. temporomandibular joint and the muscles of mastication were palpated on both sides to evaluate range of mandibular movements and found to be normal. deglutition and speech intelligibility were drastically affected as the patient 's tongue could not make effective functional contacts due to lack of anatomic (palatal, alveolar, dental) boundaries during deglutition and phonetics. due to extensive size of the defect, radiation to the area, poor mucosal quality and minimal bony supporting structures ; long - term prognosis of the implant - retained prosthesis was poor. hence prosthetic rehabilitation was planned with a magnet retained intraoral - extraoral combination prosthesis (iecp) instead of an implant retained prosthesis. preliminary impressions of the normal mandibular arch as well as remaining maxillary arch along with the intraoral defect were made using high viscosity irreversible hydrocolloid (dentalgin ; prime dental products, mumbai, india). the impressions were poured in type iii gypsum material (kalstone ; kalabhai karson, mumbai, india). the tray was border molded with green stick impression compound (pinnacle ; dental products of india, mumbai, india) including the palatal defect. the impression compound was relieved and a physiologic definitive impression was made using a medium viscosity polyvinyl - siloxane impression material (reprosil ; dentsply detrey gmbh, konstanz, germany). conventional prosthodontic protocols of boxing and pouring the impression with type iii gypsum material were used to create a maxillary definitive cast. a 19 gauge hard, round, stainless steel orthodontic wire (kc smith & co, monmouth, uk) was manipulated to make a fitted labial bow from the mesial aspect of the left central incisor to the distal aspect of left second molar. though the surgical defect was completely healed chance of recurrence of the lesion was suspected hence a cast metal framework was not planned. a processed record base was fabricated from heat - polymerizing polymethyl - methacrylate (pmma) (trevalon ; dentsply, york, pa, usa) in conventional manner and adjusted with the aid of pressure indicating paste to allow complete seating.9 the definitive cast (used to fabricate the processed record base) was damaged on the lateral aspect during retrieval of the record base from the undercut areas. a sheet of baseplate wax (modelling wax ; deepti dental products, ratnagiri, maharashtra, india) was adapted and contoured over the palatal defect portion of the processed record base to restore normal palatal contour and close the palatal portion of the defect intraorally. the adapted wax sheet was removed from the record base without distortion, flasked and processed in heat - polymerizing pmma. the palatal piece was secured to the processed record base with auto - polymerizing pmma and an occlusion rim was fabricated with baseplate wax. jaw relation was recorded and transferred onto a semi - adjustable articulator with the help of face - bow. teeth arrangement and wax contouring were carried out and the waxed - up prosthesis was tried in patient 's mouth. after try - in the waxed - up obturator was processed in heat - polymerizing pmma using conventional technique.9 after finishing and polishing the obturator, the gingival portion of the prosthesis was color modified with the auto - polymerizing clear pmma (cold cure - clear, dental products of india, mumbai, india) mixed with acrylic - colors to match the normal melanin - pigmented gingiva of the contralateral side. the prosthesis was delivered to the patient and final occlusal refinement was completed (fig. 2). the patient experienced improvement in speech intelligibility and deglutition after the placement of the maxillary obturator. a pair of cobalt - samarium magnets 30 mm in diameter and 2.5 mm in thickness (jobmasters, randallstown, md, usa) was selected for mutual retention between intraoral and extraoral prostheses. one of the magnets was embedded in the superior - lateral aspect (portion which was exposed extraorally) of the obturator by using auto - polymerizing pmma thus completing the intraoral section of the iecp (fig. 3). the patient was instructed to close in maximum intercuspal position with obturator placed in the mouth. an irreversible hydrocolloid facial - moulage was made to record the facial defect along with surrounding normal extraoral structures and the extraorally exposed portion of the obturator with the second magnet placed over the obturator - magnet. a single thickness baseplate wax was adapted over the extraoral defect area of the definitive cast. the wax sheet was flasked and processed in heat polymerized clear pmma (trevalon clear ; dentsply, york, pa, usa) using conventional technique.9 the inner pmma framework was tried over the patient 's extraoral defect by placing obturator and second magnet in position. an indentation for the second magnet was formed on the tissue surface of the framework. a cellophane paper (dpi, mumbai, india) was placed in between the obturator magnet and the second magnet to act as a separating medium. auto - polymerizing clear pmma was mixed and placed in the indentation of the second magnet formed inside the tissue surface and the framework was seated over the defect area. after completion of polymerization, the second magnet was embedded in the framework (fig. an artificial stock - eye globe was selected to match size, shape and color of the normal left eye. the sclera was further color modified (from back side leaving front clear polished surface intact) with auto - polymerizing clear pmma mixed with acrylic - colors to match the normal left eye sclera. the eye globe was positioned on the framework with reference to normal left eye and fixed with auto - polymerizing clear pmma. a sheet of baseplate wax was adapted over the inner framework in such a way that it would provide uniform thickness of the silicone for future facial contour over the defect area (fig. this was carried out by completely filling the wax on the inner framework and contouring the wax according to the facial contour, which was further cut back uniformly (4 mm in depth) from all over the facial surface. petroleum jelly was applied over the cut back surface and a single thickness wax sheet was adapted to ensure uniform 3 mm of space for future overlying silicone layer. the adapted wax sheet was separated from the underlying wax surface without distortion and separately flasked for processing in heat - polymerizing pmma. the processed top layer framework was secured in position with inner framework using the auto - polymerizing pmma thus completing a hollow pmma substructure (fig. the final portion of the facial prosthesis was sculpted with baseplate wax over the completed hollow pmma substructure (fig. the wax sculpture of the prosthesis was invested in type iv gypsum material (ultrarock ; kalabhai karson, mumbai, india) to form a mold for packing the silicone. dewaxing was carried out in usual manner.9 the prosthesis was packed with a mdx4 - 4210-base silicone (dow corning corp, midland, mi, usa) and colored using intrinsic stains (kt-699, silicone coloring kit ; factor ii, lakeside, az, usa) selected according to the patient 's skin color. the silicone was heated for 2 hours at 90, deflasked, trimmed, cleaned, and bonded to the underlying framework with medical adhesive type a (factor ii) under vacuum as described by lemon.10 polyurethane lining was applied to the margins to increase the tear resistance of the marginal silicone.10,11 the prosthesis was trial fitted and extrinsically colored with trichlorethane, medical adhesive type a and oil pigments (factor ii) thus completing the fabrication of extraoral section of the iecp. the gypsum - mold was preserved for future re - packing in case of discoloration or damage of the overlying silicone layer. a spectacle frame was selected and the left glass of the spectacle was fabricated according to the specifications provided by the ophthalmologist to treat the hypermetropia of the left eye. during the prosthesis insertion appointment the maxillary obturator was placed intraorally and the facial prosthesis was positioned extraorally against the obturator magnet (fig. the obturator and facial prosthesis were thoroughly cleaned with a disinfectant (md 520 ; drr dental gmbh, bietigheim - bissingen, germany). two years after prosthesis insertion the prosthesis was still serviceable and the patient was pleased. the patient has been able to maintain 100% of his weight with a normal diet and nutritional supplements ingested orally. a cosmetic improvement, the ability to speak more intelligibly, improved deglutition and improved mastication was achieved for this patient with this iecp. preliminary impressions of the normal mandibular arch as well as remaining maxillary arch along with the intraoral defect were made using high viscosity irreversible hydrocolloid (dentalgin ; prime dental products, mumbai, india). the impressions were poured in type iii gypsum material (kalstone ; kalabhai karson, mumbai, india). the tray was border molded with green stick impression compound (pinnacle ; dental products of india, mumbai, india) including the palatal defect. the impression compound was relieved and a physiologic definitive impression was made using a medium viscosity polyvinyl - siloxane impression material (reprosil ; dentsply detrey gmbh, konstanz, germany). conventional prosthodontic protocols of boxing and pouring the impression with type iii gypsum material were used to create a maxillary definitive cast. a 19 gauge hard, round, stainless steel orthodontic wire (kc smith & co, monmouth, uk) was manipulated to make a fitted labial bow from the mesial aspect of the left central incisor to the distal aspect of left second molar. though the surgical defect was completely healed chance of recurrence of the lesion was suspected hence a cast metal framework was not planned. a processed record base was fabricated from heat - polymerizing polymethyl - methacrylate (pmma) (trevalon ; dentsply, york, pa, usa) in conventional manner and adjusted with the aid of pressure indicating paste to allow complete seating.9 the definitive cast (used to fabricate the processed record base) was damaged on the lateral aspect during retrieval of the record base from the undercut areas. a sheet of baseplate wax (modelling wax ; deepti dental products, ratnagiri, maharashtra, india) was adapted and contoured over the palatal defect portion of the processed record base to restore normal palatal contour and the adapted wax sheet was removed from the record base without distortion, flasked and processed in heat - polymerizing pmma. the palatal piece was secured to the processed record base with auto - polymerizing pmma and an occlusion rim was fabricated with baseplate wax. jaw relation was recorded and transferred onto a semi - adjustable articulator with the help of face - bow. teeth arrangement and wax contouring were carried out and the waxed - up prosthesis was tried in patient 's mouth. after try - in the waxed - up obturator was processed in heat - polymerizing pmma using conventional technique.9 after finishing and polishing the obturator, the gingival portion of the prosthesis was color modified with the auto - polymerizing clear pmma (cold cure - clear, dental products of india, mumbai, india) mixed with acrylic - colors to match the normal melanin - pigmented gingiva of the contralateral side. the prosthesis was delivered to the patient and final occlusal refinement was completed (fig. 2). the patient experienced improvement in speech intelligibility and deglutition after the placement of the maxillary obturator. a pair of cobalt - samarium magnets 30 mm in diameter and 2.5 mm in thickness (jobmasters, randallstown, md, usa) was selected for mutual retention between intraoral and extraoral prostheses. one of the magnets was embedded in the superior - lateral aspect (portion which was exposed extraorally) of the obturator by using auto - polymerizing pmma thus completing the intraoral section of the iecp (fig. the patient was instructed to close in maximum intercuspal position with obturator placed in the mouth. an irreversible hydrocolloid facial - moulage was made to record the facial defect along with surrounding normal extraoral structures and the extraorally exposed portion of the obturator with the second magnet placed over the obturator - magnet. a single thickness baseplate wax was adapted over the extraoral defect area of the definitive cast. the wax sheet was flasked and processed in heat polymerized clear pmma (trevalon clear ; dentsply, york, pa, usa) using conventional technique.9 the inner pmma framework was tried over the patient 's extraoral defect by placing obturator and second magnet in position. an indentation for the second magnet was formed on the tissue surface of the framework. a cellophane paper (dpi, mumbai, india) was placed in between the obturator magnet and the second magnet to act as a separating medium. auto - polymerizing clear pmma was mixed and placed in the indentation of the second magnet formed inside the tissue surface and the framework was seated over the defect area. after completion of polymerization, the second magnet was embedded in the framework (fig. an artificial stock - eye globe was selected to match size, shape and color of the normal left eye. the sclera was further color modified (from back side leaving front clear polished surface intact) with auto - polymerizing clear pmma mixed with acrylic - colors to match the normal left eye sclera. the eye globe was positioned on the framework with reference to normal left eye and fixed with auto - polymerizing clear pmma. a sheet of baseplate wax was adapted over the inner framework in such a way that it would provide uniform thickness of the silicone for future facial contour over the defect area (fig. this was carried out by completely filling the wax on the inner framework and contouring the wax according to the facial contour, which was further cut back uniformly (4 mm in depth) from all over the facial surface. petroleum jelly was applied over the cut back surface and a single thickness wax sheet was adapted to ensure uniform 3 mm of space for future overlying silicone layer. the adapted wax sheet was separated from the underlying wax surface without distortion and separately flasked for processing in heat - polymerizing pmma. the processed top layer framework was secured in position with inner framework using the auto - polymerizing pmma thus completing a hollow pmma substructure (fig. the final portion of the facial prosthesis was sculpted with baseplate wax over the completed hollow pmma substructure (fig. the wax sculpture of the prosthesis was invested in type iv gypsum material (ultrarock ; kalabhai karson, mumbai, india) to form a mold for packing the silicone. dewaxing was carried out in usual manner.9 the prosthesis was packed with a mdx4 - 4210-base silicone (dow corning corp, midland, mi, usa) and colored using intrinsic stains (kt-699, silicone coloring kit ; factor ii, lakeside, az, usa) selected according to the patient 's skin color. the silicone was heated for 2 hours at 90, deflasked, trimmed, cleaned, and bonded to the underlying framework with medical adhesive type a (factor ii) under vacuum as described by lemon.10 polyurethane lining was applied to the margins to increase the tear resistance of the marginal silicone.10,11 the prosthesis was trial fitted and extrinsically colored with trichlorethane, medical adhesive type a and oil pigments (factor ii) thus completing the fabrication of extraoral section of the iecp. the gypsum - mold was preserved for future re - packing in case of discoloration or damage of the overlying silicone layer. the patient was referred to an ophthalmologist for routine evaluation of the left eye. he was found to have hypermetropia. a spectacle frame was selected and the left glass of the spectacle was fabricated according to the specifications provided by the ophthalmologist to treat the hypermetropia of the left eye. during the prosthesis insertion appointment the maxillary obturator was placed intraorally and the facial prosthesis was positioned extraorally against the obturator magnet (fig. the obturator and facial prosthesis were thoroughly cleaned with a disinfectant (md 520 ; drr dental gmbh, bietigheim - bissingen, germany). two years after prosthesis insertion the prosthesis was still serviceable and the patient was pleased. the patient has been able to maintain 100% of his weight with a normal diet and nutritional supplements ingested orally. a cosmetic improvement, the ability to speak more intelligibly, improved deglutition and improved mastication was achieved for this patient with this iecp. large orofacial defects result in serious functional (impairment of speech, mastication, and deglutition) as well as cosmetic deformity. with ingenuity and an understanding of the remaining anatomic structures, intraoral and extraoral prostheses that mutually retain one another can be constructed. various methods of auxiliary retention for facial prostheses have been described in the literature ; they include eyeglasses,12 extensions from the denture that engage tissue undercuts,12,13 magnets,12,14 adhesives,12 combinations of the above,12,13 - 15 and osseointegrated implants.12,13,16,17 although osseointegrated implants may provide the most reliable prosthesis retention ; additional surgeries, expenses, inadequate bone, and prior radiation to the area may contraindicate this type of treatment.18,19 the prosthetic rehabilitation of a patient with a combined intraoral - extraoral defect has been presented in this article. a 2-piece (intraoral obturator and facial) combination prosthesis was fabricated. this was an esthetic option as there was sufficient space to utilize magnets without hindering the external appearance of the prosthesis. several authors have reported different problems that compromise the serviceability of facial prostheses made of a combination of pmma and silicone.4,20 these include degradation of the silicone properties, delamination of silicone from the pmma base, reduced marginal integrity of the facial prosthesis, resulting in open margins, and poor simulation of facial expressions due to the rigidity and heavy - weight of the pmma base.4,20 increased bulk of the pmma framework was always a worry for the prosthodontists. there has been increased interest in using a fiber - reinforced composite as a dental and medical biomaterial for the fabrication of a facial prosthesis framework which would be light - in - weight.3 this requires more sophisticated techniques and expensive materials than pmma. this article describes a technique to make a light - weight pmma substructure by making it hollow. the problems of delamination of silicone from pmma base can be easily overcome by bonding the processed silicone to an underlying substructure with medical adhesive type a under vacuum as described by lemon.10 this technique is advantageous as there is no need to fabricate the whole prosthesis again in case of discoloration or damage of the silicone layer because the outer silicone layer can be removed and re - packed with the new silicone on the pmma substructure if the mold is preserved. cast - metal framework was not planned and the orthodontic wire clasps were used for retention of the intraoral prosthesis as recurrence of the lesion was suspected for initial 2 - 3 years. the cast - metal framework was avoided initially due to complex clinical as well as laboratory procedures. though in this case report the cast metal framework was not utilized, it is mandatory to re - fabricate the intraoral prosthesis using cast metal framework once the cancer - recurrence is ruled out. the cast - metal framework improves retention, stability, support and bracing of the prosthesis and thus increases the longevity of both prosthesis as well as supporting tissues. major disadvantage of 2-piece prosthesis is that the mobility of intraoral obturator can make facial prosthesis mobile especially during functions. we did not find clinically significant vertical mobility or sinking down of the prosthesis during functional movements due to light weight of the prosthesis and good extraoral bony support of the remaining orbital roof and zygoma. durability of surface - coatings of the long - term magnets is a major concern ; hence it is advised to use the magnets with strong surface coatings. periodic recall appointments at the interval of 6 months are advisable for assessment of the prosthesis (retention, stability and support) and the supporting tissues. satisfactory functional and esthetic results are achievable in patients with a large lateral midfacial defect using a hollow pmma substructure for silicone facial prosthesis. retention of facial prosthesis can be satisfactorily achieved with the use of a pair of magnets provided the facial prosthesis is light in weight. | large oro - facial defects result from cancer treatment consequences in serious functional as well as cosmetic deformities. acceptable cosmetic results usually can be obtained with a facial prosthesis. however, retention of a large facial prosthesis can be challenging because of its size and weight. this article describes prosthetic rehabilitation of a 57-year - old man having a right lateral mid - facial defect with intraoral - extraoral combination prosthesis. a modified technique to fabricate a hollow substructure in heat - polymerizing polymethyl - methacrylate to support silicone facial prosthesis was illustrated. the resultant facial prosthesis was structurally durable and light in weight facilitating the retention with magnets satisfactorily. this technique is advantageous as there is no need to fabricate the whole prosthesis again in case of damage of the silicone layer because the outer silicone layer can be removed and re - packed on the substructure if the gypsum - mold is preserved. |
lung cancer is a common fatal disease, and 10,000/l) ; empyema (positive bacterial infection with pleural effusion) ; acute interstitial pneumonia (aggravation of dyspnea upon exertion, deterioration of arterial blood gases, and diffuse interstitial abnormalities compatible with acute interstitial pneumonia) ; mechanical ventilation 3 days ; reintubation within 48 hours ; tracheostomy ; bronchial stump dehiscence ; and persistent air leak (air leak for > 5 days or patients undergoing an intervention for a large - volume air leak prior to day 6). all patients were followed up after surgery and all complications occurring prior to discharge were recorded. data collected included demographic characteristics, operative procedure and time, pathologic diagnosis, hospital length of stay (los), in - hospital mortality, and ppcs. on the basis of the results of previous studies,16,27 we assumed that the average rate of ppcs would be 31% in the patients with copd and 14% in those without copd. a study design with a 1:2 allocation of copd group : non - copd group, with a significance level of 0.05 and using a two - sided, two - sample t - test, with a power of 90%, would require 100 patients in the copd group and 200 patients in the non - copd group. allowing for a 15% dropout rate over the study period, the total sample size required for the study is 345 individuals. unless otherwise specified, results are expressed as mean (standard deviation) or median (range) for continuous variables and as a percentage for categorical variables. student s t - test was used to compare continuous variables, and the chi - square or fisher s exact tests were used to compare categorical variables. the variables with p 10,000/l) ; empyema (positive bacterial infection with pleural effusion) ; acute interstitial pneumonia (aggravation of dyspnea upon exertion, deterioration of arterial blood gases, and diffuse interstitial abnormalities compatible with acute interstitial pneumonia) ; mechanical ventilation 3 days ; reintubation within 48 hours ; tracheostomy ; bronchial stump dehiscence ; and persistent air leak (air leak for > 5 days or patients undergoing an intervention for a large - volume air leak prior to day 6). all patients were followed up after surgery and all complications occurring prior to discharge were recorded. data collected included demographic characteristics, operative procedure and time, pathologic diagnosis, hospital length of stay (los), in - hospital mortality, and ppcs. on the basis of the results of previous studies,16,27 we assumed that the average rate of ppcs would be 31% in the patients with copd and 14% in those without copd. a study design with a 1:2 allocation of copd group : non - copd group, with a significance level of 0.05 and using a two - sided, two - sample t - test, with a power of 90%, would require 100 patients in the copd group and 200 patients in the non - copd group. allowing for a 15% dropout rate over the study period, the total sample size required for the study is 345 individuals. unless otherwise specified, results are expressed as mean (standard deviation) or median (range) for continuous variables and as a percentage for categorical variables. student s t - test was used to compare continuous variables, and the chi - square or fisher s exact tests were used to compare categorical variables. the variables with p 70%. a lower bmi was also significantly associated with higher rates of ppcs in both groups of patients. a number of studies have shown that a low bmi is associated with a poor prognosis in patients with copd.3437 however, this study revealed that low bmi was an independent risk factor for ppcs even in patients without copd. lower bmi is often associated with protein depletion, which in turn is associated with impairment of respiratory muscle strength, reduction in diaphragmatic muscular mass, and maximum voluntary ventilation, predisposing the patient to more ppcs.38,39 longer operation time was a specific risk factor for patients with copd, whereas post - tb lesions on cxr and male sex were important factors that increased the risk of ppcs in patients without copd. licker showed that prolonged surgery was independently associated with an increased risk of postoperative complications. surgery time can be influenced by the patient s status, the complexity of the surgery, and the surgeon s skill level. in addition, patients with severe adhesions would require longer operating time.41 we also found that the duration of surgery was another independent significant risk factor for complications, particularly in patients with copd. therefore, we suggest that lung resection for patients with copd should be performed by an experienced surgical team and that the surgery duration should be limited to the shortest possible time. post - tb lesions on cxr were found to be an important risk factor for ppcs in patients without copd. we attempted to restrict smoking status when defining post - tb lesions, because a smoking history could potentially have biased the estimated effect of tb on loss of lung function and on ppcs. even after adjustment for both smoking status and pack - years, post - tb lesions were still significantly associated with increased risk of ppcs (p=0.002). this is the first prospective study to show that post - tb lesions on cxr is an independent risk factor for ppcs. previously, lawrence found that abnormal cxr was associated with a three - fold increase in ppcs compared with the occurrence in the absence of this finding. however, abnormal cxr could be nonspecific, because it is affected by various cardiopulmonary diseases.12 recently, a cohort study, based on a nationwide representative sampling of korean subjects, reported that previous tb lesions on cxr comprise a risk factor for obstructive lung disease and even a minimal tb lesion was also a strong risk factor in never - smokers.42 our findings supported those of previous reports. in this study, patients with post - tb lesions showed a higher percentage of copd than patients without such findings (p<0.040). this result can be explained by considering the destructive and fibrosing properties of pulmonary tb, causing pulmonary overdistension.43 male sex was another important risk factor for ppcs in patients without copd. there were 131 (57%) male patients in the non - copd group, which was significantly lower than the number in the copd group. after adjustment for both smoking status and pack - years, male sex was still significantly associated with an increased rate of ppcs (p=0.030). some recent studies showed that male patients have a higher risk of complications in open and laparoscopic colorectal surgery,44 but no study has suggested that male sex is a specific risk factor for ppcs after thoracic surgery, especially in patients with normal lung function. genetic differences or compliance with a daily physiotherapy from the first postoperative day comprising deep breathing exercise, incentive spirometry, supported coughing, and mobilization might be plausible explanations for this, but further study is needed to confirm these findings. first, this study was conducted in only one tertiary referral hospital, and the results may have limited generalizability to other populations. a prospective multicenter study with an appropriate spectrum of patients with copd and normal patients would be necessary to validate predictors identified in our study and to define the best predictors of ppcs more rigorously. however, serious ppcs, even in patients with severe copd, are infrequent.45 this low event rate, combined with the small number of patients with severe copd undergoing lung resection surgery, would necessitate a large sample size for any prospective study. second, we followed up our patients during their hospitalization, and thus we evaluated only the short - term impact of the various factors on ppcs. longitudinal studies are needed to evaluate the long - term clinical impact of ppcs, such as the number of readmissions and all - cause mortality after ppcs. in patients with nsclc, the prevalence of ppcs is higher even in early stages of copd than in such patients with normal spirometry. symptom- or qol - based scores, such as cat or sgrq scores, are not significant risk predictors for ppcs in patients with early - stage copd. perioperative variables significantly associated with ppcs on univariate analysis note : significant differences between with and without ppcs were tested using chi - square, or fisher s exact test. data shown as number (%) patients, or abbreviations : bmi, body mass index ; cat, copd assessment test ; cxr, chest radiograph ; dlco, diffusing capacity of the lung for carbon monoxide ; % pred, percentage of the predicted value ; ppcs, postoperative pulmonary complications ; sgrq, st george respiratory questionnaire ; tb, tuberculosis. | purposethis study aimed to investigate whether the prevalence of postoperative pulmonary complications (ppcs) in patients with non - small - cell lung cancer (nsclc) is even higher in the early stages of copd than in such patients with normal lung function and to verify the usefulness of symptom- or quality of life (qol)-based scores in predicting risk for ppcs.patients and methodspatients undergoing pulmonary resection for nsclc between july 2012 and october 2014 were prospectively enrolled. preoperative measurements of lung function, dyspnea, and qol, operative characteristics, ppcs, duration of postoperative hospitalization, and in - hospital mortality were assessed.resultsamong 351 consecutive patients with nsclc, 343 patients with forced expiratory volume in 1 second (fev1) 70% of predicted value were enrolled. at least one ppc occurred in 57 (16.6%) patients. prevalence of ppc was higher in patients with copd (30.1%) than in those with normal spirometry (10.0% ; p<0.001). however, in patients with copd, the prevalence of ppc was not different in patients with fev1 70% compared to those with fev1 < 70% and between group a (low risk and less symptoms) and group b (low risk and more symptoms) patients with copd, based on the new global initiative for chronic obstructive lung disease 2011 guidelines. in patients with copd, body mass index (odds ratio [or ] : 0.80, p=0.007), carbon monoxide diffusing capacity of the lung (dlco), % predicted value (or : 0.97, p=0.024), and operation time (or : 1.01, p=0.003), but not copd assessment test or st george respiratory questionnaire scores, were significantly associated with ppcs.conclusioneven in patients with early - stage copd, the prevalence of ppcs is higher than in patients with nsclc with normal spirometry. however, this rate is not different between group a and group b patients with copd. in accordance with this, scores based on symptoms or qol are not predictors of risk of ppcs in patients with early - stage copd. |
burns are tissue lesions from thermal origin for exposure to flames, hot surfaces and liquids, extreme cold, chemicals, radiation, or friction. even with improved prognosis and progress in the use of biological skin substitutes, burns are an important cause of mortality. burns are classified depending on the lesion severity into superficial or first degree, when lesion is restricted to the epidermis or skin causing redness ; partial thickness or second degree that can be superficial when reaching the epidermis and superficial dermis, showing hypersensitivity and pain, or deep when it extends to the deepest layer of the dermis and may have reduced sensitivity with red and/or white coloration of the tissue ; full - thickness or third degree when lesion involves the subcutaneous layer, with no sensitivity and white coloring. the use of animals as experimental models in different areas of biological research was encouraged by claude bernard, who around 1865, described in his paper entitled introduction to the study of experimental medicine the use of animals as a model for study and transposition into human physiology. there are literature reports on the use of rabbits, pigs, dogs, rats, and mice as models in the study of burns. the healing of skin lesions induces the burn - injured tissue inflammation, edema, and hypertrophic and unsightly scars. thus, the choice of a topical agent or the type of coverage to be used in treating burns should be conducted based on the assessment of lesion characteristics and evidence reported in the specific literature. these products must have features such as antimicrobial or bacteriostatic activity, absence of toxicity and hypersensitivity, compliance, reduced healing time, and cost / benefit. however, many of the methods used in healing injuries caused by burns are controversial. in this context, the objective of this study was to establish an experimental protocol for induction of deep second - degree thermal lesions in wistar male rats to obtain clinical and histopathologic data that will facilitate understanding of results concerning the evolution of the healing action of topical therapeutic agents. the experiment was conducted at the department of experimental surgery, federal university of pernambuco, using albino wistar male rats (rattus norvegicus) weighing 250 50 g, kept in individual cages of polypropylene measuring 30 20 19 cm and controlled lighting conditions (12 h light / dark photoperiod), temperature (24 2c), receiving water, and food (labina) ad libitum. the experimental procedure was approved by the ethics committee on animal experimentation of the federal university of pernambuco (case no. 23076.015015/2009 - 31). initially, 12 animals were weighed and intramuscularly preanesthetized with atropine sulfate (0.04 mg / kg) and 10 minutes after subjected to anesthetic combination of 10% ketamine (90 mg / kg) and 2% xylazine (10 mg / kg) intramuscularly [15, 16 ]. with the animal properly anesthetized trichotomy of back thermal injuries were made with a solid aluminum bar 10 mm in diameter (figure 1(a)), previously heated in boiling water and so that the temperature reached 100c measured with a thermometer. the bar is maintained in contact with the animal skin on the dorsal proximal region for 15 sec (figure 1(b)). the pressure exerted on the animal skin corresponded to the mass of 51 g of aluminum bar used in the burn induction. immediately after the procedure, analgesia with dipyrone sodium (40 mg / kg) was performed intramuscularly, being maintained for three consecutive days sodium dipyrone at 200 mg / kg orally administered in the drinking water supplied to animals. the clinical course of skin lesions by burns was evaluated for 28 consecutive days based on the following aspects : blistering, swelling, redness, crust, bleeding, secretion, granulation tissue, and scar tissue. the wound retraction was evaluated using a caliper in 7, 14, 21, and 28 days after burn induction. % wound contraction on day x = [(area on day 0 open area on day x)/area on day 0 ] 100. microbiological evaluation was carried out using swabs in the injury area at the moment of surgery and respective days of biopsies. this sample was transferred to a petri dish of 20 150 mm containing nutrient agar medium in a laminar flow chamber. after 24 h incubation, plates inoculated in triplicate for each sample were evaluated. this routine evaluation was performed to evaluate the degree of contamination of injuries. at the preestablished times for biopsy (7, 14, 21, and 28 days after burn induction), three animals randomly selected underwent anesthesia combination of 10% ketamine (90 mg / kg) and 2% xylazine (10 mg / kg), intramuscularly [15, 16 ] for tissue samples collection. euthanasia was performed by excessive doses of sodium pentobarbital intraperitoneally (100 mg / kg). tissue samples were immediately fixed by immersion in 4% formaldehyde (v / v) prepared in pbs (0.01 m, ph 7.2), followed by routine histological processing paraffin embedding, microtomy with 4 m cuts, and masson 's trichrome staining. histological study was performed by comparative descriptive analysis of the experimental groups in binocular optical microscope (zeiss - axiostar model) where were evaluated the evolution of skin healing after thermal trauma. the histological analysis was performed by independent pathologist who was experienced in the examination of burn wound specimens, in the following ways : (1) inflammatory response, characterized by the presence of polymorphonuclear leukocytes (pnm), (2) granular tissue, characterized by the presence of fibroblasts, myofibroblasts, and neovascularization, (3) fibrosis, characterized by the density of collagen fibers identified by the intensity of blue color observed under optical microscopy due to staining by masson 's trichrome. a score was made for all parameters evaluated : = absent, + = mild presence, + + = moderate presence, and + + + = strong presence. all results were expressed as mean values for group standard deviation and analyzed considering p < 0.05 as statistically significant. this experimental model was established to standardize thermal burn injuries in order to obtain injuries with the same size and depth degree. the choice of wistar rats due to these animals shows a great ease of handling, accommodation and resistance to surgical aggressions, and infectious processes, with low mortality [19, 20 ]. however, the choice of male rats is due to variations in hormonal cycles in females that could intervene in the process of tissue repair. the result of clinical evaluation showed no signs of infection, secretion, bleeding, or death in both groups. infected wounds heal more slowly, reepithelisation is more prolonged, and there is also the risk of systemic infection. shaving the back of the animals was performed by manual traction of hair (figure 2(a)) thus preventing secondary skin lesions that often occurs by the use of laminated devices. the option to induce only one burning in the dorsal - proximal aimed at preventing the animal itself could reach the burn so that altering the outcome of the clinical evaluation of lesions. the use of individual aluminum bar for each animal in the experimental group is important in reducing the interval between the induction of a burn and another within the same group, thus avoiding large variations in the assessment of healing time. the size of lesions showed uniform average distribution of 10 1 mm in diameter (figure 2(b)). similar studies by heredero and colleagues and meyer and silva revealed that it is not possible to perform a perfectly uniform burn in all experimental rats. according to vale, the burn depth depends on the intensity of the thermal agent, generator or heat transmitter and time of contact with the tissue, which is the determinant of the aesthetic and functional result of the burn. caused thermal burns by using 5 cm aluminum plate heated to 130c, which were pressed into the skin of the back for 5 seconds. however, this method can generate lesions with different depths depending on the pressure during the procedure. in our study, the pressure was equivalent to the mass of the aluminum bar (51 g) there being no interference by researcher, thus ensuring the reproducibility of thermal injuries. the standardization of procedures, systematization, and organization of knowledge about the interrelationships of models is necessary to provide more reliable knowledge advance. the most common method for obtaining second - degree thermal burns uses hot water as heat transfer agent. induced second - degree thermal burns on the back of rats using submersion in hot water (90c) for 6 seconds. in this experiment, 10% body surface of the animal was injured producing lesions of variable size. according to orgaes., burns when reaching 26% to 30% of total body surface area of these mice cause mortality rates of 40% after three days, 52.5% after 7 days, 57.5% after 15 days, and 62.5% after 25 days. results of this study revealed thermal burns white in color, painful, with no bubbles, mild edema until the 3rd day after injury (figure 2(b)). similar definition is reported by [29, 30 ] that describes the deep second - degree burns and injuries that have pale color with pain in lower intensity compared to superficial second - degree burn. in our evaluation variation of the degree of hyperemia in the first three days of experiment that changed from slight to absent the formation of a thick and dry crust was observed from day 3 after burn induction. signs of the scar tissue formation at the edge of the lesion were observed from day 14 (figure 2(d)). the burn healing occurs by second intention, which is a slow process with high risk of infection, producing scar retraction, which depending on the area of injury can cause extensive scarring and consequently high cost in treatment. the contraction of skin lesions occurs centripetally fromthe injury edges being caused by the action of myofibroblasts present at the site. in turn the percentage of lesion contraction at the end of the experiment was 66.67 1.66%. values obtained in this study are similar to those published by zohdi and colleagues, who observed 72.75 1.8% of reduction in control rats treated with hydrogel without drug (placebo) at 28 days of study (figure 3). according to mandelbaum and colleagues, the mechanism of tissue repair is the integration of dynamic cellular and molecular processes involving biochemical and physiological phenomena aiming at ensuring tissue restoration. for this reason, only the clinical evaluation of a burn injury does not provide information on the evolution degree of tissue healing, being of fundamental importance of the histopathologic evaluation of these lesions. the histopathological findings confirmed the acquisition of deep second - degree burns based on the observation of total autolysis of both the dermis and epidermis, without reaching the hypodermis. these data are consistent with reports of several authors who characterize it as deep second - degree burn injuries that cause partial or total destruction of nerve endings, hair follicles, and sweat glands [25, 35, 36 ]. thermal injury was observed on the 7th day and extensive inflammatory exudate featuring an intense inflammatory reaction. describe in their study the occurrence in the control group, treated with saline solution, an acute inflammatory process on the 6th day of evaluation. by day 14 the inflammatory response was classified as moderate with presence of macrophages, progressing to discreet at day 21. by day 28 signs of inflammatory response in the animals evaluated was not observed (table 2). tissue still presented a complete destruction of the dermis and epidermis and maintenance of the hypodermis (figure 4(a)) on the 7th day after lesion induction. histopathology section of the burned skin of control animals on 5th day showed denuded epidermis, diffuse infiltration of plasma cells, lymphocytes, and polymorphs. after 14 days the histopathological evaluation revealed moderate autolysis of the tissue, with discrete neovascularization and fibroblast proliferation, with loose collagen fibers, not modeled with mild fibrosis and crust absence (figure 4(b)). yaman and colleagues confirm the presence of crust formed by remnants of necrotic tissue and infiltration of mononuclear cells on the 4th day of experimentation in the control group. the crust detachment was only observed by these authors on the 14th day of study. by day 21 we observed the absence of autolysis, discrete neovascularization and intense fibroblastic proliferation, with dense collagen, not modeled and moderate fibrosis (figure 4(c)). by the end of the experiment at 28 days, histological observations showed incomplete reepithelialization of the injured tissue with autolysis and absent neovascularization, showing moderate fibroblastic proliferation and fibrosis with the presence of modeled dense collagen fibers (figure 4(d)). wound healing includes number of stages like clotting, inflammation, granulation, fibrosis, arrangement of collagen with spasm of wound, and epithelization. the time required for complete healing of deep second - degree burns, without the application of specific therapeutic agents, can be three to six weeks or more, and these burns will leave a scar tissue that may hypertrophy and contract itself [29, 30 ]. in this new model of second - degree thermal burns, injuries are easy to create and easily reproducible. there are similarities with the human second - degree burns in clinical and pathologic aspects. thus, the animal model presented in this study is applicable in evaluating the use of therapeutic agents in the healing evolution of deep second - degree burns. | thermal lesions were produced in 12 male wistar rats, positioning a massive aluminum bar 10 mm in diameter (51 g), preheated to 99c 2c/10 min. on the back of each animal for 15 sec. after 7, 14, 21, and 28 days, animals were euthanized. the edema intensity was mild, with no bubble and formation of a thick and dry crust from the 3rd day. the percentage of tissue shrinkage at 28 days was 66.67 1.66%. there was no sign of infection, bleeding, or secretion. within 28 days reepithelialization was incomplete, with fibroblastic proliferation and moderate fibrosis and presence of modeled dense collagen fibers. it is concluded that the model established is applicable in obtaining deep second - degree thermal burns in order to evaluate the healing action of therapeutic agents of topical use. |
at least 442 denv-1 isolates from the 20042007 dengue outbreak were obtained from the diagnostic virology repository at the university of malaya medical centre. viral rna was extracted from infected cell culture supernatants, and a 1-step reverse transcription pcr amplification of the denv-1 envelope gene was performed by using amplification primers (8). genome sequences from study isolates and those obtained from genbank (table 1) were used to construct phylogenetic trees. maximum clade credibility was inferred by using the bayesian markov chain monte carlo method implemented in beast version 1.5.2 (9). for simplicity, only 10 new denv-1 sequences from the study and 47 from genbank were analyzed. phylogenetic trees showed 6 distinct denv-1 subgenotypes : 3 ancestral subgenotypes (hawaii / japan, 1940s ; thailand, 1960s ; and malaysia, 1972) and 3 major endemic subgenotypes (si, sii, and siii), which is consistent with reported findings (8). an isolate identified as d1.malaysia.36046/05 grouped with isolate p72_1244, a sylvatic denv-1 reportedly isolated from a sentinel monkey in malaysia in 1972. virus envelope gene sequence shared > 97% nt sequence similarities and > 99% aa sequence similarities. there was only 1 aa difference at position 55, from valine in p72_1244 to isoleucine in d1.malaysia.36046/05. focus - reduction neutralization tests (frnts) were performed by using the d1.malaysia.36046/05 isolate. serum samples from patients with primary dengue caused by denv-1 si and sii (figure) were pooled and used in frnts as described (10). neutralizing antibody titer was defined as the reciprocal of the highest serum dilution that reduced viral foci by 50% (frnt50). frnt results after adjustment of the titer to that of respective isolates showed that the d1.malaysia.36046/05 virus is neutralized by serum from patients with denv-1 si infections (frnt50 = 320) and samples from patients with denv-1 sii infections (frnt50 = 80) (table 2). maximum clade credibility tree of complete envelope genes of dengue virus type 1 (denv-1) isolates. coalescent times with 95% highest posterior density values (ranges in parentheses) and posterior probability values (all 1.0) of key nodes are shown. patient convalescent - phase serum samples used for neutralization assays from which virus was isolated are indicated at the end of branches according to their virus groups. sii, subgenotype ii, si, subgenotype i. mock, controls treated with serum from healthy (no dengue infection) donors ; virus, virus plus diluent ; medium, serum and diluent without virus ; si, subgenotype i ; sii, subgenotype ii. reciprocal of the highest serum dilution that reduced viral foci by 50% (50% focus - reduction neutralization test). virus was treated with serum from patients infected with primary dengue virus type 1 si or sii. laboratory and clinical records showed that d1.malaysia.36046/05 virus was isolated from a patient who had headache, body ache, chills, rigors, and abdominal pain for 3 days and sought treatment at the university of malaya medical centre. the patient did not return for subsequent follow - up, and efforts to locate the patient were unsuccessful. the most recent address of the patient was within a high population density area of kuala lumpur. additional sequencing of other denv-1 isolates from the 20042007 outbreak did not identify any additional d1.malaysia.36046/05like virus. isolation of the ancestral denv-1 after > 30 years suggests that a mosquito host transmission cycle has maintained this virus. the natural host of the virus can not be determined conclusively because the only known fact is that the virus was isolated from a patient with dengue fever. the original ancestral denv-1 isolate p72_1244 was designated as sylvatic because it was isolated from a sentinel monkey in a rural forest (3). its sylvatic origin has recently become uncertain because the virus genome is phylogenetically closer to other endemic denv-1 lineages (11). however, because no virus with high sequence similarities to that of denv-1 isolate p72_1244 has been isolated over the past 33 years, the virus may have been maintained in a sylvatic cycle through a nonhuman primate / mosquito enzootic cycle. the estimated sequence evolution rate for d1.malaysia.36046/05 is 5.20 10 substitutions / site / year. this rate is relatively slower than those for other endemic denv-1 isolates used in this study (5.67 10 to 8.05 10 substitutions / site / year). the much smaller monkey : human population ratio (700,000:28,000,000) (12) (http://en.wikipedia.org/wiki/malaysia) and the more restricted mobility of monkeys could have limited the virus genome sequence divergence, leading to conservation of the sylvatic virus genome sequence. the absence of the virus from the endemic urban cycle over the past 33 years could have been caused by its inability to overcome population herd immunity after exposure to endemic denv-1. efficient neutralization of virus by serum from patients infected with denv-1 si and sii supports this possibility (13). conversely, the virus may not be highly transmissible by peridomestic mosquitoes (14) and may be confined to the enzootic forest cycle. therefore, isolation of the ancestral virus from a person living in kuala lumpur is most likely the result of a stochastic spillover event after contact with infected forest - dwelling mosquitoes. available evidence does not support endemic presence of the virus in an urban dengue cycle. however, a sylvatic cycle needs to be considered in any future dengue vaccination initiatives. | ancestral sylvatic dengue virus type 1, which was isolated from a monkey in 1972, was isolated from a patient with dengue fever in malaysia. the virus is neutralized by serum of patients with endemic denv-1 infection. rare isolation of this virus suggests a limited spillover infection from an otherwise restricted sylvatic cycle. |
as the prevalence of obesity in children and adolescents has escalated worldwide, signs of the metabolic syndrome (mets) are increasingly observed in the pediatric age range. mets refers to a cluster of abnormal physical examination and laboratory findings, including high waist circumference, serum triglyceride, serum glucose, and blood pressure, and low - serum hdl - cholesterol. these findings synergistically relate to risk for developing type 2 diabetes and cardiovascular diseases (cvds), including coronary artery disease and stroke [24 ]. in a study of a representative sample of us 12- to 19-year - old, 8.6% met criteria for mets ; hispanic youth had a higher prevalence (11.2%) than white (8.9%) or black adolescents (4.0%). children who meet the criteria are at increased risk for cvd in adulthood. focusing on the mets during the pediatric period is expected to lead to early - prevention strategies for diabetes and cvd. a large body of evidence suggests that metabolic programming can occur early in life [68 ]. early - life risk factors include low birth weight and rapid postnatal weight gain. breastfeeding including duration and dose appears to offer protection for obesity, type 2 diabetes, the mets, and cvd [912 ]. in fact, the time immediately before and after birth may be a sensitive period related to metabolic and cardiovascular risk. rapid post - natal weight gain is associated with increased risk for obesity, type 2 diabetes and hypertension in young adulthood [1318 ]. infant weight gain, especially in the first 3 months, may be more important than birth weight as a predictor of later health outcomes. adolescent mets has previously been found to be associated with infancy growth in the setting of a developed country. much of the work on fetal origins of disease has been done in developed countries beginning with barker 's work in england. research in low- to middle - income countries is needed to further delineate the roles of biology and environment related to early - life risk for cardiovascular disease and related conditions. our cohort of low- to middle - income chilean adolescents, studied since infancy, provides a special opportunity to address these research questions, especially because the participants were born during a period of rapid nutritional and economic transition in chile. this transition was characterized by economic progress that led to increased consumption of calories, fat, animal protein, and processed foods, and increased mortality from noncommunicable chronic diseases. the aims of this study were to examine the association between infant weight gain from birth to 3 months and risk for the mets in mid - adolescence, accounting for the extent of exclusive breastfeeding in infancy and covariates known to be associated with infant growth and the mets, gender, birth weight, and socioeconomic status (ses). this is an observational cohort study involving adolescents who were enrolled as infants in a randomized controlled trial of iron supplementation to prevent iron deficiency anemia. infants were enrolled from 19911996 in santiago, chile ; 1657 infants completed the preventive trial at 1 year. the inclusion criteria for the preventive trial were infant birth weight of 3 kg or more, with no birth complications, major congenital abnormalities, or prior iron therapy. due to a highly successful national breastfeeding campaign, all but 8 infants in the cohort were initially breastfed. infants were randomly assigned to low or high iron supplementation, or usual nutrition (no added iron). a more detailed description of randomization techniques, sampling, and entrance and exclusion criteria is published elsewhere. the participants have been involved in follow - up studies at 5, 10, and 16 years. at 16 years, the participants from the longitudinal cohort were invited to enroll in a study of adolescent obesity and cardiovascular risk. we report on the first 384 studied from a randomly selected sample of the original cohort evaluated at 16 years between may 2009 and january 2011. complete data from the infancy and adolescent waves were available for 357 of the 384 adolescents. infancy variables (birth weight, weight at 3 months, and gestational age) did not differ between the 357 studied and the original 1657 infant participants. our analytic sample was more likely to receive bottle supplementation before 90 days, compared to the larger cohort (52% versus 45%, p < 0.05). the longitudinal study has been approved by the institutional review boards of the university of michigan, ann arbor usa ; institute of nutrition and food technology, university of chile, santiago, chile for each wave of study ; by the university of california, san diego, for the 16-year study of obesity and cardiovascular risk. we included the following infancy measures : gender, weight measured at birth and at 3 months, and date of the first supplemental bottle. mother 's prepregnancy bmi was calculated from measured height and self - report of prepregnancy weight. data on pre - pregnancy weight was not collected for the infancy study. during the 10-year wave of data collection, mothers reported their pre - pregnancy weight ; it was highly correlated with their actual weight 10 years later. adolescents were assessed between 16 and 17 years during the fourth wave of the longitudinal research study (infancy, 5 years, 10 years, and 16 - 17 years). height (cm), weight (kg), waist and hip circumference (cm), and blood pressure (mm hg) were measured by a physician - investigator at the nutrition research center. standardized procedures were used to measure weight to the closest 0.1 kg, using a seca scale, and height to the closest 0.1 cm, using a holtain stadiometer. measurements were taken twice, with a third measurement if the difference between the first two exceeded 0.3 kg for weight and 0.5 cm for height. serum glucose concentration (mg / dl), triglycerides (mg / dl), and cholesterol (mg / dl) levels were determined using an enzymatic - colorimetric test (qca s.a., amposta, spain). using a standardized questionnaire, parents reported family history of type 2 diabetes, hypertension, dyslipidemia, and heart attack before the age of 60, in first - degree relatives. infant weight gain in the first 3 months was calculated as weight gain velocity over the first 3 months (91.3 days) : (weight [kg ] at 3-month birth weight [kg])/(age at 3-month measurement 91.3 days). extent of breastfeeding was assessed as a dichotomous variable representing breastfeeding without bottle supplementation for less than 90 days, compared to 90 days or more. maternal education was assessed as a continuous measure (median for sample = 10 years). we constructed a metabolic syndrome risk z - score according to the work of brage and colleagues. the following variables were converted to z - scores : the reciprocal of the hdl value, the mean of the systolic and diastolic blood pressure measurements, waist circumference, fasting serum triglyceride, and glucose. we obtained a continuous, normally distributed metabolic risk z - score by averaging these 5 values. for descriptive statistics, continuous variables were expressed as median and interquartile ranges and categorical variables as frequencies. we evaluated cardio / metabolic risk factors and overall prevalence of the mets according to international diabetes federation definition : waist circumference 94 cm for boys and 80 cm for girls, plus any two of the following four factors : triglycerides 1.7 mmol / l, hdl - cholesterol < 40 mg / dl in males and < 50 mg / dl in females, systolic bp 130 or diastolic bp 85 mm hg, fasting plasma glucose 100 mg / dl. we used spss for windows version 18.0 (chicago, il, usa), a p value of < 0.05 denoted statistical significance. multiple linear regression models were used to determine the relationship between change in weight (kg) in the first 3 months and metabolic syndrome risk z - score, adjusting for extent of breastfeeding and the following covariates : birth weight, gender, ses, age, mother 's age at birth of infant, mother 's pre - pregnancy bmi, and family history of type 2 diabetes, dyslipidemia, and heart attack. we tested the full model and then, using backward elimination, removed each variable that was not significantly related to the outcome in the model based on a significant p value of < 0.05. as the sample came from an iron - deficient anemia prevention trial, we tested whether iron - deficient anemia during the first year of life or iron supplementation were significant covariates in our models. neither variable showed significant relationship in the models and were thus removed from the final models. participants had been born at 40 weeks of gestation weighing 3.5 kg, on average, and 48% were exclusively breastfed for 90 days. the median bmi percentile was 68.7 with 15.2% in the obese range and 10.4% met criteria for mets. table 1 describes infant and family background characteristics by gender of the 357 participants in infancy and adolescence. males had higher birth length, weight at three months, and higher weight gain between birth and 3 months compared to females. males also had significantly lower hdl cholesterol and higher blood pressure values (systolic and diastolic), glucose and mets risk z - scores than females. there were no significant differences between males and females in gestational age, birth weight, maternal education, exclusive breastfeeding for 90 days, and prevalence of the mets. the multiple variable linear regression models (full and final) are shown in table 2. the final model revealed that weight gain over the first three months was associated with an increased mets risk score at 16 - 17 years, taking into account extent of breastfeeding and gender (b = 0.16, 95% ci = 0.04, 0.27, p < 0.05). introduction of the first bottle at 90 days or after was related to a lower mets risk score in adolescence (b = 0.16, 95% ci = 0.29, 0.04, p < 0.05), taking into account other covariates. additionally, being male was associated with an increased mets risk score in the model (b = 0.24, 95% ci = 0.11, 0.37, p < 0.05). we examined weight gain in the first 3 months of life and timing of bottle supplementation related to mets risk at 16 years. in both sexes, adolescents who had more rapid weight gain during the first 3 months of infancy had higher adolescent mets risk scores compared to those who gained less weight in early infancy. the association of weight gain with mets risk is consistent with findings from a study addressing the same question, in a scandinavian country. infancy weight gain has previously been associated with later obesity in childhood and adulthood [15, 18, 25, 26 ]. in addition, especially for low - birth - weight infants, more rapid early weight gain, sometimes called catch - up growth, has been related to higher risk of developing type 2 diabetes and/or cardiovascular disease. contrary to our findings, a finnish study found that infants who had low weight gain in the first 6 months had higher risk for development of glucose intolerance, an effect that was greater for those with low birth weight. since our cohort excluded infants with birth weights below 3 kg, it is clear that the association we find between infant weight gain and adolescent mets risk is independent of low birth weight furthermore, this association did not depend on family history of conditions related to the mets such as type 2 diabetes, dyslipidemia, or myocardial infarction. there is accumulating evidence that breastfeeding offers some protection related to the development of obesity, and that the effect may be dose - dependent [28, 29 ]. because breastfed infants gain weight more slowly over the first year compared to formula - fed infants [30, 31 ], infant weight gain may pertain to the mechanism that decreases obesity risk in those who were breastfed. having been breastfed has also been associated with lower risk for hypercholesterolemia, hypertension, diabetes, glucose intolerance, and insulin resistance [912 ]. to our knowledge, no other study has shown an association between breastfeeding and mets risk in adolescence. importantly, the significant effects of weight gain and breastfeeding were independent, suggesting that the effect of breastfeeding on mets risk was not mediated by early infancy weight gain. we do not know why males had higher mets risk scores compared to females, but they had marginally significant higher birth weights and gained more weight in the first 3 months. nonetheless, the effect of gender on mets was independent of birth weight and infancy weight gain. this finding is consistent with higher prevalence rates of mets in men compared to women in chile. in us adolescents, males are also more likely to have clustering of metabolic syndrome risk factors compared to girls. however, in the scandinavian study of infant weight gain and the mets, male gender was not related to higher mets risk, even though boys were similarly heavier at birth and gained more in infancy than girls. the cohort was enrolled from a low- to middle - income community in santiago, chile, during a period of economic and nutritional transition. the setting and the fact that children with birth weights under 3 kg were not included limits generalizability. the context of economic growth, high rates of breastfeeding, and nutritional support for infants allowed us to assess a sample where malnutrition was not a confounding factor. the longitudinal study took place at a nutrition research center allowing for detailed anthropometric measurement during infancy and the adolescent wave of data collection. other strengths of the study include prospective data collection including monthly anthropometry in infancy and breastfeeding data collected from 4 to 12 months. in addition, the adolescent data collection included family history of diabetes, hypertension, elevated cholesterol, and heart attack. in conclusion, this study adds to the current knowledge about early infant growth and breastfeeding and their long - term health effects. higher infant weight gain was associated with increased mets risk, whereas longer duration of exclusive breastfeeding was protective in healthy adolescents living in a rapidly developing country. considering the increasing prevalence of the mets in younger age groups and associations between the mets and later disease, | background. prevalence of the metabolic syndrome is increasing in pediatric age groups worldwide. meeting the criteria for the metabolic syndrome puts children at risk for later cardiovascular and metabolic disease. methods. using linear regression, we examined the association between infant weight gain from birth to 3 months and risk for the metabolic syndrome among 16- to 17-year - old chilean adolescents (n = 357), accounting for the extent of breastfeeding in infancy and known covariates including gender, birth weight, and socioeconomic status. results. participants were approximately half male (51%), born at 40 weeks of gestation weighing 3.5 kg, and 48% were exclusively breastfed for 90 days. factors independently associated with increased risk of metabolic syndrome in adolescence were faster weight gain in the first 3 months of life (b = 0.16, p < 0.05) and male gender (b = 0.24, p < 0.05). breastfeeding as the sole source of milk for 90 days was associated with significantly decreased risk of metabolic syndrome (b = 0.16). conclusion. this study adds to current knowledge about early infant growth and breastfeeding and their long - term health effects. |
type 2 diabetes mellitus (t2 dm) is a major risk factor for cardiovascular disease and is associated with significant cardiovascular morbidity and mortality. patients with t2 dm have increased risk of major adverse cardiac events (mace). acute coronary events are often caused by the rupture of unstable coronary atherosclerotic plaques and coronary stenosis [2, 3 ]. therefore, assessment of atherosclerotic plaque morphology and pathological features has become an important part of clinical investigation of coronary artery disease. multidetector coronary computed tomography angiography (ccta) has been increasingly used in the evaluation of the coronary arteries. in an acute setting, ccta is associated with 95% sensitivity and 90% specificity in diagnosing non - st - elevation myocardial infarction (nstemi) and unstable angina pectoris. the ability to detect not only coronary stenosis but also the nonobstructive coronary atherosclerotic plaques in a noninvasive fashion makes ccta imaging a potentially valuable tool for risk stratification. in recent years, ccta has been used to predict the prognosis or cardiac events in patients with suspected coronary artery disease [714 ]. however, there has been limited information on the predictive value of ccta on the acute coronary events in patients with t2 dm. the purpose of this study is to investigate the ccta characteristics of the coronary plaques in patients with t2 dm. the sensitivity and specificity of ccta in predicting the acute coronary events in these patients are also evaluated. the study was approved by the institutional ethics committee of our hospitals, and written informed consent was obtained from all participants. from february 2007 to november 2008, 318 consecutive patients with t2 dm were referred to our department for coronary cta because of nonspecific chest pain, exertional dyspnea, or st - t depression or flattening on electrocardiogram (ecg). patients who had a previous coronary balloon angioplasty, stenting, or coronary artery bypass grafting were excluded. other exclusion criteria were (a) heart rate above 90 beats / min or with atrial fibrillation or other arrhythmias ; (b) renal dysfunction (serum creatinine 120 mmol / l) ; (c) other chronic illnesses, such as severe respiratory insufficiency, hyperthyroidism ; (d) inability to give a written consent. in the end the first 85 patients were scanned by philips brilliance 64-detector ct (philips medical systems, eindhoven, the netherlands). prior to the scans, beta - blocker was administered in patients whose heart beat was 70/min, and nitroglycerine (0.3 mg sublingually) was used in all patients 15 minutes before the scans. the scan parameters were 64 0.625 mm collimation, 120 kv tube voltage, 400600 mas tube current, 0.42 s rotation time, and 0.2 pitch. data acquisition was completed within 4.15.9 sec with radiation dose of 13.916.8 msv (median, 15.1 msv). in the remaining 65 patients, prospective ecg - gated scan was performed in 128-detector ct and heart rate was restricted within 6070 beats / min. the scan parameters were 120 kv tube voltage, 200 mas tube current, collimation 128 0.625, 0.180.27 sec rotation time, and 0.2 pitch. scanning was completed within 3.96.8 sec with radiation dose of 3.164.14 msv (median, 3.6 msv). a 5060 ml (dependent on body mass index) bolus of iodinated contrast agent (iopamidol, 370 mg of iodine / ml ; bracco sine pharmaceutical corp. ltd., shanghai, china) was injected into the antecubital vein at a flow rate of 4 - 5 ml / sec. the scanning range was from the tracheal bifurcation to 10 mm below the inferior cardiac apex. the best quality images were chosen for evaluation and other phases or ecg - editing was performed if needed. all initial data sets were transferred to a postprocessing workstation (brilliance - workshop, philips medical systems, eindhoven, the netherlands) for image analysis. alternative image reconstruction methods for evaluation of coronary artery and plaques included maximum intensity projection, multiplanar reconstruction, curvature plane reconstruction, and volume rendering. both observers were blinded to the medical histories, clinical diagnoses, and results of other investigations for all patients. in case of disagreement, noncalcified plaques are plaques with a lower density compared with the contrast - enhanced lumen ; calcified plaques are plaques with a higher density ; and mixed plaques are plaques with soft and calcified elements within a single plaque. the measure was performed in axial and mpr images and 4 points were chosen randomly. roi > 1.0 mm (at least 3 contiguous pixels, area 1.03 mm) and the smallest ct value were defined as the value of plaques (figures 2 and 3). the coronary artery plaques were classified into 4 types [16, 17 ] : type i, concentric lesions ; type ii, eccentric lesions with a wide base but smooth margin ; type iii eccentric lesions with a narrow base and rough surface ; type iv, long segment of irregular lesions. number of diseased coronary vessels and segments, number and types of plaques, and grading of stenosis caused by plaques were evaluated. the degree of stenosis was defined as the percentage of stenosis and adjacent normal vessel lumen : normal or mild (0.05). however, the proportion of type iii plaques in the study group was higher than in the control group, whereas the proportion of type ii and iv plaques was lower (p < 0.01). using type iii plaques to predict acute coronary events, the sensitivity and specificity were 76.2% and 63.8%, respectively. the main findings of the present study are as follows : (a) the proportion of noncalcified and type iii plaques in patients with acute coronary events was higher than in patients with stable angina ; (b) the proportion of calcified plaques in patients with stable angina was higher than in patients with acute coronary events ; (c) the sensitivity and specificity of type iii plaques in predicting acute coronary events were 63.8% and 76.2%, respectively. the sensitivity and specificity of type ii and iv plaques in predicting chronic coronary events were 91.5% and 79%, respectively. these findings indicated that noninvasive ccta may be used to evaluate the unstable plaques that are prone to cause acs in patients with t2 dm. previous studies have found that many coronary lesions in patients with coronary heart disease were nonobstructive, and the vessel with mild - to - moderate stenosis was responsible for cardiac events [20, 21 ]. the vulnerability of the intracoronary lesions is a key factor for acs in these patients with mild - to - moderate stenosis [20, 21 ]. acute coronary syndrome was often caused by rupture of coronary artery atherosclerosis plaques rather than lumen stenosis. therefore, early detection of vulnerable or unsteady plaques is important in guiding prevention and treatment of acute cardiac events. noncalcified plaques were unsteady and were commonly seen in patients with acute coronary syndromes [23, 24 ]. inconsistent with the previous reports, our study showed that there was little difference in the stenosis severity between patients with acute and chronic coronary events. on the other hand, the types of the coronary plaques on ccta seem to be related to the coronary events. we also found that, in patients with acute coronary syndromes, there were more noncalcified plaques and fewer calcified plaques than in patients with stable angina. these results suggest that, in patients with t2 dm, analysis of the stenosis severity alone on ccta is probably insufficient. evaluation of the plaque morphology and vulnerability on ccta seems to offer additional information on the future risk of acute coronary events. the reliability of ccta in assessing coronary plaque stability has been under investigation in recent years [2528 ]. the study of otaki. showed the prognostic information of ccta enhances risk stratification and may improve medical therapy and/or behavioral changes that may enhance event - free survival. an earlier study by motoyama. demonstrated that ccta can be used to accurately assess plaque composition by measuring the ct value of the plaque on thin - ct images. the lipid core was in the inner lining of the coronary lumen and was prone to rupture under the impact of blood flow. the ruptured plaques will absorb platelets, leading to new clots formation and obstruction of coronary flow and causing acute coronary syndrome or sudden death. in the present study, we have divided the coronary plaques into 4 types [16, 17 ]. the type iii plaques, those with an eccentric centre and rough surfaces, appear to be related to acute coronary events. the predictive sensitivity and specificity of type iii plaques were 63.8% and 76.2%, respectively, for acute coronary events. on the other hand, eccentric lesions with a wide base but smooth margin (type ii plaques) and long segment of irregular lesions (type iv plaques) represent relatively stable plaques and have 91.5% sensitivity and 79% specificity in predicting chronic coronary events. achenbach and raggi thought that the actual clinical utility of coronary cta for risk stratification purposes is very uncertain, especially when considering extending the currently available findings to a many trials [3336 ] which demonstrated a prognostic value of coronary cta were all retrospective analyses of individuals in whom ct was performed for a clinical reason, so most likely the populations mainly consisted of symptomatic patients. because of the low overall event rate, predicting acute coronary syndromes in asymptomatic individuals is substantially more difficult. so ada 2013 guideline pointed that, for asymptomatic patients, it is not recommended for routine screening for cad, because this screening does not make sense to improve the outcomes as long as appropriate treatment for cad risks can be achieved. but similar to the detection and quantification of coronary calcium, one would expect that the detection and further characterization of noncalcified plaque should provide prognostic information concerning the occurrence of future acute coronary syndromes. ostrom. demonstrated that the presence of nonobstructive plaque in all three coronary arteries was associated with increased mortality (risk ratio 1.77 when compared with individuals without any detectable plaque). proposed that the burden of angiographic disease detected by cta provides both independent and incremental value in predicting all - cause mortality in symptomatic patients independent of age, gender, conventional risk factors, and cac. so we should do more research to find unstable plaque or criminal vessels. a further concern is the fact that ccta, as opposed to coronary calcium, requires the injection of contrast agent and is usually associated with substantially higher radiation exposure than calcium scans. average effective doses for ccta are 12 msv, but they can easily reach 20 msv or more unless special measures to minimize the dose are implemented [33, 39 ]. recently, numerous approaches to reduce the dose of ccta have been proposed and evaluated, and estimated effective doses, 3 msv [4043 ] in selected cases even 1 msv, can be achieved. a potential limitation of the present study on the first 85 patients is that, in the earlier part of our study, retrospective ecg - gated helical ccta was performed using 64-detector ct. in the remaining 65 patients, prospective ecg - gated scan was performed using 128-detector ct. the imaging quality of 128-detector ccta is generally superior to 64-detector ccta and the dose of radiation is also lower [5, 31 ]. so we need do more research to discover how predictive the ccta is versus traditional risk assessment. ccta is a noninvasive modality to measure the severity of coronary stenosis and to assess the morphology of coronary plaques and provides potential prognostic information in t2 dm patients with suspected cad. these data suggest morphology analysis on ccta may add value to coronary risk stratification in patients with t2 dm although more studies are needed. these results may improve the risk stratification in patients evaluated by ccta and provide strategies for the individualized prevention programs. | objectives. to analyze the predictive value of coronary computed tomography angiography on acute coronary artery events in patients with type 2 diabetes. methods. coronary computed tomography angiography was performed in 250 type 2 diabetic patients. after a follow - up for 5 years, 145 patients were excluded as they did not have any coronary events. the remaining 95 patients were divided into study group and control group. according to their density and shape, the coronary artery plaques were classified into 3 types and 4 types, respectively. results. there is no statistically significant difference in the degree of stenosis between two groups. the proportion of calcified plaques in the study group was lower than in the control group. the proportion of mixed - calcified plaques in the study group was higher than in the other. type iii plaques have a 76.2% sensitivity and negative predictive value was 64.5% for acute coronary events ; type iv plaques have a sensitivity of 52.6% and positive predictive value of 63% for chronic coronary events. conclusions. ccta may be used as a non - invasive modality for evaluating and predicting vulnerable coronary atherosclerosis plaques in patients with type 2 diabetes. |
the real frequency of supernumerary kidney could not be computed due to its unusual appearance. there are five cases presented in the literature (1 - 5). in embryogenesis, the atypical section of nephrogenic cord into two metanephric blastemas with bifurcation of one bud shapes supernumerary kidneys. genuinely, supernumerary kidney that is an accessory organ has its own collecting system, blood supply, and separate encapsulated tissue. the supernumerary kidney may be completely distinct from the usual renal tissue or linked to it by loose connective tissue (6, 7). in our case, we demonstrate radiological findings in a young man with bilateral supernumerary kidney on computed tomography. a 23-year - old man was admitted to the endocrinology clinic with a one - year history of hypertension. the color doppler study was performed, but the renal arteries were not shown because of gas artifact. then, abdominopelvic computed tomography (ct) examination (somatom emotion duo ct, siemens, berlin, germany) with 100 ml of nonionic intravenous contrast material (ultravist 300 ; schering, germany) was performed for differential diagnosis with the following scanning parameters : 0.6 mm collimation, 5 mm slice thickness, 1.4 mm increment, 100 kv, 135 mas, and a pitch of 0.9. it was injected at a flow rate of 5 mm / second applying an automatic injector. bilateral supernumerary kidneys were demonstrated on ct (figure 1 a - c). on each side a significant rotation anomaly was found at the inferiorly located kidneys that were smaller than the superiorly located kidneys on each side. the collecting system of all four kidneys was expanded (figure 2). on each side, there were two renal arteries that originated from the aorta (figure 3 and 4). a conservative approach was decided with regular follow - up including urine and blood analysis and us. a, coronal b, right sagittal and c, left sagittal mpr reconstruction of contrast enhanced ct images demonstrates bilateral supernumerary kidneys. bilateral supernumerary kidney is an uncommon renal abnormality, which influences both genders evenly (8). it is commonly smaller, situated usually in the left quadrant and it may be placed in a caudal situation. the supernumerary kidneys may be established in the iliac or sacral region (9). a narrow stratum of fibrous structure may closely separate supernumerary kidneys or it is entirely discrete from the opposite side. embryologically, the fundamental difference must discriminate the rare supernumerary kidney from the usual combined duplex systems. a sprout diverges and every division permeates a freely mixed metanephric mesenchymal mass and bifid ureters in combined duplex bifid kidneys. once two sprouts originate disparately from the wolffian duct and permeate the similar metanephric mass, two free nephritic collecting structures shape, but the parenchymas abide blended. a sprout divides into two and every division permeates separately a metanephric mass, which improves into unrelated simple kidneys in supernumerary kidneys with bifid ureters (6, 10). the supernumerary kidney disagrees from the duplex kidney and megapolycalycosis in that its own divided parenchyma crowns each pelvicaliceal system (4). in most of the patients with supernumerary kidneys, the ureter of the supernumerary kidney may have calculus disorder and hydronephrosis (11). supernumerary kidney may be cranial or caudal to the normal kidney. in our case, coarctation of the aorta, ectopic ureteral opening, duplication of the penis or female urethra, vaginal atresia and horseshoe kidneys are congenital anomalies associated with the supernumerary kidney (12). bilateral supernumerary kidney in conjunction with horseshoe anomaly was described by mustafa (5). oto. described bilateral supernumerary kidney with bifid ureters bilaterally in intravenous pyelography (ivp) (3). in our case a palpable abdominal mass, pain and fever are commonly the demonstrating symptoms (6, 9). if there is no symptom in the patient with supernumerary kidneys, medical care is not needed and regular follow - up is suggested. if renal disease is found, nephrectomy is advised (11). associated with supernumerary kidneys, many complications such as pyelonephritis, stones, pyonephrosis, hydronephrosis, and malignant changes (clear cell carcinoma, wilms tumor) have been reported (11, 13). in our case, bilateral supernumerary kidney associated with hypertension was observed. excretory urography, usg, ct, nuclear scintigraphy, and magnetic resonance imaging (mri) can be used for the diagnosis of supernumerary kidney. in addition, they reported that mri can show the presence of individual ureters (14). it is hard to diagnose supernumerary kidney before operation and clinicians have not observed most cases preoperatively. on excretory urograms, it is difficult to identify supernumerary kidney since they are commonly smaller and have a decreased function (9, 11). on each side, in our case, ct had characteristic findings and obviously presented the combination of kidneys. we think that ct commonly appears to be enough for the diagnosis of supernumerary kidneys. ct angiography may be a useful radiological method to discover the compound anatomy of arteries in kidneys and to discern the origin of renal arteries non - invasively. the use of mr angiography to detect the origin of renal arteries could be an alternative. | to our knowledge, bilateral supernumerary kidney is a very rare renal abnormality and there are five cases presented in the literature. it is difficult to diagnose supernumerary kidney and clinicians have not detected most cases preoperatively. laboratory and imaging studies were acquired and carefully examined. the normal laboratory tests were found. emergency ultrasonography was performed and they revealed no signs of parenchymal abnormality in both kidneys. serial imaging study including enhanced computed tomography (ct) was performed. an imaging study identified bilateral supernumerary kidney with expanded collecting systems. on each side, significant rotation anomaly was found. in addition, there were two different renal arteries originating from the aorta. this report presents radiological determinations of supernumerary kidney bilaterally in a young man. we think that ct commonly appears to be enough for the diagnosis of supernumerary kidneys. |
sepsis is a leading cause of hospital mortality in adult patients, and the incidence is increasing. there is considerable variation between countries, with a strong correlation between the frequency of sepsis and intensive care unit (icu) mortality rates. in a prospective study of 3877 patients in 454 german icus, the prevalence of severe sepsis, defined as sepsis associated with organ dysfunction, was 11.0%. of those with severe sepsis, nearly half had septic shock, defined as sepsis with hypotension despite adequate fluid replacement. the incidence of severe sepsis was estimated to be 76 - 110 cases / year per 100,000 inhabitants. patients surviving sepsis have a lower quality of life than the age- and sex - adjusted population as much as 1.5 years later. the daily cost is estimated to be 1090 euros (approximately usd $ 1600), and the overall costs per hospital stay are estimated to be 2-fold to 11-fold higher than the general cost per patient. currently available strategies for the management of sepsis patients include timely patient identification and diagnosis, rapid identification of causative organisms, appropriate and early antimicrobial therapy, improved ventilatory techniques, goal - directed hemodynamic support, targeted immunological therapy, glycemic control, appropriate nutrition, effective supportive therapies, and patient management by highly qualified clinicians and nursing staff. these multifaceted approaches to patient management, the use of evidence - based methods, and the adoption of incremental, goal - oriented strategies are vital to combat this complex, aggressive, and increasingly prevalent condition. infectious pathogens possess unique structural components called pathogen - associated molecular patterns ; examples include lipopolysaccharide in gram - negative bacteria and peptidoglycan in gram - positive bacteria. pattern recognition receptors, which include the cell - surface toll - like receptors and several types of cytoplasmic receptors. receptor binding results in the activation of intracellular signaling pathways that lead to a variety of responses, including increased transcription of inflammatory cytokines, upregulation of adhesion molecule expression, stimulation of humoral and cell - mediated immune responses, and activation of vascular endothelial cells. a detailed discussion of the pathogenesis of sepsis is beyond the scope of this article, but the subject has been addressed in a number of recent reviews [8 - 11 ]. an important feature of the pathophysiology of sepsis is the development of a procoagulant state. disseminated intravascular coagulation, one of the most feared complications of sepsis, is a manifestation of the dysregulation of coagulation seen in this disorder. in severe sepsis, treatment of the underlying cause of infection requires early and meticulous attention to source control, including the use of antimicrobial agents and, where appropriate, surgical drainage. physiological support of organ dysfunction with inotropes, mechanical ventilation, and renal replacement therapy specific drugs such as corticosteroids are broadly used, although the benefit of such therapy remains uncertain. protein c is a soluble, vitamin k - dependent, plasma serine protease that plays a central role in endogenous anticoagulation. the activated form is generated when thrombin, bound to the cofactor thrombomodulin, interacts with and cleaves the zymogen protein c. activated protein c (apc) is a potent anticoagulant and profibrinolytic enzyme capable of inactivating clotting factors va and viiia and plasminogen activator inhibitor 1. the exact role of apc in the treatment of septic shock is eagerly debated, and a recent review from our group gives an overview. the 23 patients included in this observational study had a 100% risk of death, according to a score based on the response to early continuous veno - venous hemodiafiltration. the actual 28-day mortality rate of the 23 patients who received apc was only 39% and was associated with a decrease in the magnitude of lactic acidosis and the dose of norepinephrine required. in a double - blind randomized placebo - controlled trial, the safety and efficacy of extended apc treatment were evaluated in 64 icus in nine countries. however, extended apc treatment was not associated with reductions in day-28 all - cause mortality or in - hospital mortality or with an increase in serious adverse events. heparin used concomitantly with apc was explored in a large randomized study, and no heparin effect on mortality was observed. further analyses revealed that the coadministration of apc with low - dose heparin in patients with severe sepsis did not increase the incidence of serious bleeding. fewer ischemic strokes in the heparin group suggest that heparin cessation should be avoided during apc infusion. finally, recent observational data from a large international sepsis registry demonstrated a beneficial effect of the treatment with apc. in 2002, this international group of investigators developed evidence - based guidelines through a formal and transparent process. the initial guidelines were published in 2004, and an updated version was published in 2008. the development and publication of guidelines often do not lead to changes in clinical behavior, and guidelines are rarely, if ever, integrated into bedside practice in a timely fashion. recognizing that implementing guidelines presents a significant challenge, the ssc set out to develop and evaluate a multifaceted model to change bedside practice for patients with severe sepsis and septic shock by the definition of sepsis resuscitation bundles as well as. a central part of that program was an international registry that providers could use to monitor the performance of their institution and to recruit and enter patients. a spanish cohort study demonstrated significant benefit after implementing these bundles. in january 2010, the first analysis of the worldwide registry data described the global initiative and its implementation and reported its impact on process improvement and patient outcomes. data from 15,022 subjects at 165 sites were analyzed to determine the compliance with bundle targets and association with hospital mortality. compliance with the entire resuscitation bundle increased linearly from 10.9% in the first site quarter to 31.3% by the end of 2 years (p < 0.0001). the adjusted odds ratio for mortality improved the longer a site was in the ssc, resulting in adjusted absolute decreases of 0.8% per quarter and 5.4% over 2 years (95% confidence interval 2.5 - 8.4%). infectious pathogens possess unique structural components called pathogen - associated molecular patterns ; examples include lipopolysaccharide in gram - negative bacteria and peptidoglycan in gram - positive bacteria. pattern recognition receptors, which include the cell - surface toll - like receptors and several types of cytoplasmic receptors. receptor binding results in the activation of intracellular signaling pathways that lead to a variety of responses, including increased transcription of inflammatory cytokines, upregulation of adhesion molecule expression, stimulation of humoral and cell - mediated immune responses, and activation of vascular endothelial cells. a detailed discussion of the pathogenesis of sepsis is beyond the scope of this article, but the subject has been addressed in a number of recent reviews [8 - 11 ]. an important feature of the pathophysiology of sepsis is the development of a procoagulant state. disseminated intravascular coagulation, one of the most feared complications of sepsis, is a manifestation of the dysregulation of coagulation seen in this disorder. in severe sepsis, treatment of the underlying cause of infection requires early and meticulous attention to source control, including the use of antimicrobial agents and, where appropriate, surgical drainage. physiological support of organ dysfunction with inotropes, mechanical ventilation, and renal replacement therapy specific drugs such as corticosteroids are broadly used, although the benefit of such therapy remains uncertain. protein c is a soluble, vitamin k - dependent, plasma serine protease that plays a central role in endogenous anticoagulation. the activated form is generated when thrombin, bound to the cofactor thrombomodulin, interacts with and cleaves the zymogen protein c. activated protein c (apc) is a potent anticoagulant and profibrinolytic enzyme capable of inactivating clotting factors va and viiia and plasminogen activator inhibitor 1. the exact role of apc in the treatment of septic shock is eagerly debated, and a recent review from our group gives an overview. the 23 patients included in this observational study had a 100% risk of death, according to a score based on the response to early continuous veno - venous hemodiafiltration. the actual 28-day mortality rate of the 23 patients who received apc was only 39% and was associated with a decrease in the magnitude of lactic acidosis and the dose of norepinephrine required. in a double - blind randomized placebo - controlled trial, the safety and efficacy of extended apc treatment were evaluated in 64 icus in nine countries. however, extended apc treatment was not associated with reductions in day-28 all - cause mortality or in - hospital mortality or with an increase in serious adverse events. heparin used concomitantly with apc was explored in a large randomized study, and no heparin effect on mortality was observed. further analyses revealed that the coadministration of apc with low - dose heparin in patients with severe sepsis did not increase the incidence of serious bleeding. fewer ischemic strokes in the heparin group suggest that heparin cessation should be avoided during apc infusion. finally, recent observational data from a large international sepsis registry demonstrated a beneficial effect of the treatment with apc. this international group of investigators developed evidence - based guidelines through a formal and transparent process. the initial guidelines were published in 2004, and an updated version was published in 2008. the development and publication of guidelines often do not lead to changes in clinical behavior, and guidelines are rarely, if ever, integrated into bedside practice in a timely fashion. recognizing that implementing guidelines presents a significant challenge, the ssc set out to develop and evaluate a multifaceted model to change bedside practice for patients with severe sepsis and septic shock by the definition of sepsis resuscitation bundles as well as. a central part of that program was an international registry that providers could use to monitor the performance of their institution and to recruit and enter patients. a spanish cohort study demonstrated significant benefit after implementing these bundles. in january 2010, the first analysis of the worldwide registry data described the global initiative and its implementation and reported its impact on process improvement and patient outcomes. data from 15,022 subjects at 165 sites were analyzed to determine the compliance with bundle targets and association with hospital mortality. compliance with the entire resuscitation bundle increased linearly from 10.9% in the first site quarter to 31.3% by the end of 2 years (p < 0.0001). (p = 0.001). the adjusted odds ratio for mortality improved the longer a site was in the ssc, resulting in adjusted absolute decreases of 0.8% per quarter and 5.4% over 2 years (95% confidence interval 2.5 - 8.4%). the management of sepsis in hospitals is significantly better today than it was 10 years ago. however, sepsis - associated mortality rates remain unacceptably high, and new strategies to improve patient outcomes will have to be embraced further still. the recent improvement in outcomes of patients with severe sepsis and septic shock has been characterized by the successive introduction of multiple interventions and therapies, which is an ongoing process. the results of the aforementioned studies demonstrate that the use of a multifaceted performance improvement initiative was successful in changing sepsis treatment behavior as evidenced by a significant increase in compliance with sepsis performance measures. this compliance was associated with a significant reduction in hospital mortality in patients with severe sepsis and septic shock over the duration of the 2-year study, but the study design does not allow us to say, with certainty, whether this was due to some or all bundle elements, increased awareness of severe sepsis, or other unrelated factors. there are still many unanswered questions - including the mortality trend in hospitals that have not implemented the bundles and confirmation of which components of the bundles reduce mortality - that could provide direction for future research. the results of this study should encourage similar efforts to implement guidelines and treatment protocols as a means to improve outcomes. finally, the importance of the wholehearted involvement of the entire health care team and the provision of strong public and political support in achieving these objectives can not be stressed enough. | although several successful clinical trials in the last 2 - 3 years have been greeted with enthusiasm by intensivists, severe sepsis and septic shock still have increasing incidence and more or less unchanged mortality. within the last few years, the progress in sepsis research covering definitions, epidemiology, pathophysiology, diagnosis, and standard and adjunctive therapy as well as general measures such as treatment bundles is encouraging. in this report, a small selection of recent publications, focusing on the current discussion of activated protein c as well as the relevance of the surviving sepsis campaign bundle therapy, is presented and the possible impact on clinical routine is discussed. |
we use density functional theory (dft) to compute the effects of substitutional al, b, cu, mn, and si solutes, and octahedral interstitial c and n solutes on the lattice parameters and elastic stiffness coefficients cij of bcc fe. the purefe.csv file contains the computed lattice parameter, magnetic moment, cij, and the derivatives of the cij with respect to lattice parameter for pure fe. the computational methodology we developed in ref. calculates a strain - misfit tensor for each solute which determines changes in the lattice parameter and volumetric contributions to the derivatives of the cij with respect to solute concentration. we also compute chemical contributions from each solute to the derivatives of the cij with respect to solute concentration. the sum of the volumetric and the chemical contributions gives the total derivatives of the cij with respect to solute concentration. the soluteeffects.csv file contains the diagonal components of the solute strain - misfit tensors and their average values, the volumetric and chemical contributions to the cij derivatives, the sum of the two contributions, and direct calculations of the total derivatives that encompass both contributions. we compute the solute data using 222 (16 atoms), 333 (54 atoms), and 444 (128-atom) supercells. the calculation details, including the exchange - correlation functional, pseudopotentials, and all numerical convergence parameters used in generating the data, are given in ref.. the vasp input files incar and kpoints, and output files contcar, outcar, and oszicar for all the calculations are stored in the nist dspace repository (http://hdl.handle.net/11256/67), along with the analyzed data stored in the purefe.csv and soluteeffects.csv files. the repository also stores unix shell scripts we developed for calculating the data in the csv files from the raw vasp output files. the fundamental quantities necessary for computing strain misfit tensors and elastic stiffness coefficients are the numbers of atoms in the computational supercells, lattice parameters, applied strain magnitudes, and stresses. the scripts compute the elastic stiffness coefficients from derivatives of stress with respect to strain, approximated using a standard four - point central finite - difference formula. table 1, table 2 list the properties contained in the purefe.csv and soluteeffects.csv files, respectively, along with identifying tags that label the properties in the files and their units. | we present computed datasets on changes in the lattice parameter and elastic stiffness coefficients of bcc fe due to substitutional al, b, cu, mn, and si solutes, and octahedral interstitial c and n solutes. the data is calculated using the methodology based on density functional theory (dft) presented in ref. (m.r. fellinger, l.g. hector jr., d.r. trinkle, 2017) [1 ]. all the dft calculations were performed using the vienna ab initio simulations package (vasp) (g. kresse, j. furthmller, 1996) [2 ]. the data is stored in the nist dspace repository (http://hdl.handle.net/11256/671). |
to compare the effects of weight loss by an energy - restricted low - fat diet versus low - carbohydrate diet on serum peptide yy (pyy) levels. 8-week prospective study of 30 obese adults (mean age : 42.8 2.0 years, mean bmi 35.5 0.6 kg / m). after 8 weeks, subjects on the low - carbohydrate diet lost substantially more weight than those on the low - fat diet (5.8 kg vs. 0.99 kg, p 170/100 mmhg ; diabetes mellitus with hba1c7.9% ; and pregnancy or lactation. subjects provided informed, signed consent. procedures took place at the general clinical research center (gcrc), and the protocol was approved by the institutional review board of virginia commonwealth university. after enrollment, subjects presented for a screening visit and instruction on maintenance of a 3-day food diary. the subjects energy requirements were estimated with the equation : total energy expenditure = fasting metabolic rate (calculated with the harris - benedict equation) activity factor (sedentary = 1.3, some regular exercise = 1.5, and regular exercise = 1.7). from these estimates, daily caloric intake needed to achieve an energy deficit of 500 kcal / day was estimated for each individual. after randomization to an energy - restricted low - fat or low carbohydrate diet, subjects presented to the gcrc at 0800 after a 10-hour overnight fast. baseline serum pyy, glucose, insulin, leptin, and adiponectin levels were drawn at 15 min and 0 min. subjects consumed a low - fat or low - carbohydrate test meal (mean 540 kcal), and serum samples were subsequently drawn at 30-minute intervals over the next 2.5 hours. subjects received counseling from a study dietitian on maintenance of an energy - restricted low - fat diet or low - carbohydrate diet and were instructed to avoid modifying physical activity. compliance was assessed by interview and degree of weight loss, with less than 1 kg loss over a 3-week defined as noncompliance. after 8 weeks, subjects presented again to the gcrc and underwent similar procedures to those performed at baseline. serum glucose concentrations were measured on a glucose analyzer using oxidative methodology, and serum insulin using a double - antibody ria. for pyy determinations, aprotinin (sigma - aldrich, inc., st. louis, mo) at a concentration of 1 g / ml and dipeptidyl peptidase iv (dpp - iv) inhibitor (linco, research, inc., st. louis, mo) at a final concentration of 100 m were added to the serum, and the samples were stored at 70 c until assays were performed. total pyy was measured using a sensitive and specific ria (linco research, inc., st. louis, mo). the lower limit of detection was 10 pg / ml, and the coefficients of variation were 9.4% within and 8.5% between assays. serum leptin and adiponectin were measured with elisa kits (diagnostic system laboratories, inc., areas under the curve (auc) for insulin, glucose, and pyy were calculated with the trapezoidal method. the primary variable of interest was postprandial auc pyy. in order to detect a 35% difference between the groups with a standard deviation of 154.5, based on a published study (7), 10 subjects per group were needed to achieve a power of 80% with =0.05. estimating a potential 20% noncompliance rate, the sample size increased to 16 subjects per group. baseline measurements were assessed with unpaired t - tests, and comparisons between groups analyzed using repeated - measures anova with time and diet as main effects. the macronutrient composition of the diets was calculated using the nutrition data system for research (version 4.04, nutrition coordinating center, university of minnesota). all statistical analysis were made using jmp version 8.0 (sas institute inc., cary, nc), with p<0.05 statistically significant. the mean age was 42.8 2.0 years, and the mean bmi 35.5 0.6 kg / m. furthermore, analysis with inclusion of the 2 eliminated subjects demonstrated no differences in any baseline variables between groups. after 8 weeks, weight loss for the entire study group (n=30) was 3.7 0.7 kg (95% ci [5.2, 2.3 ]). subjects on the low - carbohydrate diet lost significantly more weight than those on the low - fat diet (5.8 0.75 kg, 95% ci [7.3, 4.3 ] vs. 0.99 0.86, 95% ci [2.8, 0.8 ] respectively, p<0.001). no difference in weight loss was observed by gender or race, and there were no significant associations between weight loss and baseline weight, bmi, or levels of fasting insulin, glucose, leptin, or adiponectin. fasting serum pyy levels (figure 1a) decreased by 9% over 8 weeks (103.5 8.8 pg / ml, 95% ci [85.4, 121.5 ] vs. 94.1 6.5 pg / ml, 95% ci [80.8, 107.4 ], p<0.01). similarly, postprandial serum pyy levels (figure 1b) decreased by 9% [(20.5 1.5) 10 pghrml, 95% ci (17.5, 23.5) ] and [(18.8 1.4) 10 pghrml, 95% ci (15.9, 21.7), p<0.001) ]. there was a trend towards an inverse relationship between weight loss and fasting pyy level such that greater extent of weight loss correlated with lower fasting pyy levels (r=0.32, p=0.09). no significant correlations were observed between pyy and glucose, insulin, leptin, or adiponectin. contrary to our hypothesis that weight loss with a low - carbohydrate diet would increase pyy levels, serum fasting and postprandial auc pyy decreased by nearly 10% after weight loss by either diet. subjects randomized to the low - carbohydrate diet lost 6-fold more weight than those randomized to the low fat - diet. however, change in auc pyy occurred independently of dietary intervention and degree of weight loss. few studies to date have evaluated the effects of dietary composition on pyy expression in humans. unlike our previous study (6), this study showed no difference in postprandial pyy levels between low - fat and low - carbohydrate diets, likely because subjects prepared their own meals and were not as adherent to their assigned diets as subjects in the previous study. the fact that some subjects did not achieve weight loss as expected with a 500 kcal / day deficit suggests noncompliance. (8) reported no difference in pyy levels with a high monounsaturated fat, low glycemic index diet versus a low - fat diet. likewise, brownley. (9) reported that postprandial pyy levels were not affected by glycemic load in obese women. an interesting finding of this study is that postprandial pyy decreased significantly after weight loss regardless of low - fat or low - carbohydrate diet. (8) reported that 8 weeks of a low energy diet resulted in lower pyy levels and increased appetite scores. 10) reported that short - term fasting over 4872 hours reduced fasting pyy levels. since lower pyy levels are associated with increased appetite (5,7), we speculate that reduced pyy levels following diet - induced weight loss represents a physiological homeostatic mechanism to preserve baseline body weight. reduced pyy levels would indirectly stimulate hypothalamic neurons containing neuropeptide y and agouti - related protein, which in turn would stimulate appetite and food intake lastly, measures of hunger, appetite, and satiety were not evaluated. in summary, this study demonstrates that weight loss by either a low - fat or low - carbohydrate diet reduces postprandial serum pyy levels. this finding suggests that low pyy levels may contribute to the high recidivism and weight regain with energy - restricted diets. further investigation is needed to determine whether diets comprised of various macronutrient compositions may increase pyy levels and promote weight loss in obese individuals. | objectiveto compare the effects of weight loss by an energy - restricted low - fat diet versus low - carbohydrate diet on serum peptide yy (pyy) levels.design8-week prospective study of 30 obese adults (mean age : 42.8 2.0 years, mean bmi 35.5 0.6 kg / m2).resultsafter 8 weeks, subjects on the low - carbohydrate diet lost substantially more weight than those on the low - fat diet (5.8 kg vs. 0.99 kg, p<0.001). weight loss by either diet resulted in a 9% reduction in both mean fasting serum pyy levels (baseline : 103.5 8.8 pg / ml, after weight loss : 94.1 6.5 pg / ml, p<0.01) and postprandial auc pyy (baseline : (20.5 1.5) 103 pghr1ml1, after weight loss : mean auc pyy (18.8 1.4) 103 pghr1ml1 p<0.001). there was a trend towards lower levels of pyy with greater degrees of weight loss.conclusionsreduced pyy levels after weight loss by an energy - restricted low - fat or low - carbohydrate diet likely represents a compensatory response to maintain energy homeostasis and contributes to difficulty in weight loss during energy - restricted diets. |
in india, the national aids control organization (naco) has initiated the introduction of inexpensive and generic highly active anti - retroviral therapy (haart). current recommendations in western countries for initiation and monitoring of haart are based on cd4 t - cell counts and plasma human immunodeficiency virus (hiv) rna levels. however, these methods are expensive. due to this, the world health organization (who) stipulates that cd4 count testing is desirable but not essential for haart use in resource - limited settings. several studies have demonstrated the usefulness of absolute lymphocyte count (alc) or total lymphocyte count (tlc), (i.e. alc plus all large lymphocytes such as lymphoblasts or reactive lymphocytes) in identifying patients who would benefit from initiating prophylaxis for acquired immunodeficiency syndrome (aids)-related opportunistic infections.[47 ] we conducted this study to evaluate the correlation of tlc and alc to cd4 count and to determine a range of tlc and alc cut - offs for initiating haart in hiv - infected patients, as there are fewer published studies on this subject, from resource - limited settings. a prospective observational cohort study involving 108 hiv - positive patients, attending our art centre, from august 20 2006 onwards were selected. the duration of study period was 1 year from august 20, 2006 to august 19, 2007. after taking an informed consent (for hiv testing), these individuals, voluntarily attending our ictc at the department of microbiology (or any of the government designated ictcs), underwent pre - test counseling by male or female ictc counselors, followed by hiv testing as per the strategy iii of the naco guidelines (for hiv testing). after post - test counseling, those found hiv positive were referred to the art centre, k.r. hospital, mysore medical college and research institute, mysore, where they underwent pre - art counseling. after clinical evaluation, informed consent was taken from these patients and they were enrolled into the study if they satisfied the inclusion criteria. those found eligible for art as per the who guidelines were started on anti - retroviral therapy. the individuals should be above 18 years of age, they should be proven to be hiv - positive and they should not be on prior anti - retroviral therapy (art). using standard precautions, 4 ml of venous blood was collected between 9 am to 12 noon using two 2 ml k3-edta vacutainers (bd), one for cd4 testing and the other for complete blood counts (cbcs). the cd4/cd3 enumeration was done using the single platform bd facs calibur machine (becton, dickinson and company, san jose, united states of america), by strictly following the manufacturer 's instructions. internal quality control was performed with process controls using the manufacturer 's recommendations. external quality control was performed through an external quality assurance program with nari (national aids research institute), pune, india. cbcs with differential were performed by using a sysmex k21 hematology analyzer (sysmex corporation, kobe, japan). tlc was derived from the cbc by multiplying lymphocyte percentage by the white blood cell count. spearman correlations between alc and cd4 cell count and tlc and cd4 cell count were assessed. sensitivity, specificity, positive predictive value, and negative predictive values of various alc and tlc cut - offs were computed for cd4 count < 200 cells / cu.mm. all statistical analyses were performed using spss software (version 16.0, spss, chicago, usa). a prospective observational cohort study involving 108 hiv - positive patients, attending our art centre, from august 20 2006 onwards were selected. the duration of study period was 1 year from august 20, 2006 to august 19, 2007. after taking an informed consent (for hiv testing), these individuals, voluntarily attending our ictc at the department of microbiology (or any of the government designated ictcs), underwent pre - test counseling by male or female ictc counselors, followed by hiv testing as per the strategy iii of the naco guidelines (for hiv testing). after post - test counseling, those found hiv positive were referred to the art centre, k.r. hospital, mysore medical college and research institute, mysore, where they underwent pre - art counseling. after clinical evaluation, informed consent was taken from these patients and they were enrolled into the study if they satisfied the inclusion criteria. those found eligible for art as per the who guidelines were started on anti - retroviral therapy. the individuals should be above 18 years of age, they should be proven to be hiv - positive and they should not be on prior anti - retroviral therapy (art). the individuals should be above 18 years of age, they should be proven to be hiv - positive and they should not be on prior anti - retroviral therapy (art). using standard precautions, 4 ml of venous blood was collected between 9 am to 12 noon using two 2 ml k3-edta vacutainers (bd), one for cd4 testing and the other for complete blood counts (cbcs). the cd4/cd3 enumeration was done using the single platform bd facs calibur machine (becton, dickinson and company, san jose, united states of america), by strictly following the manufacturer 's instructions. external quality control was performed through an external quality assurance program with nari (national aids research institute), pune, india. cbcs with differential were performed by using a sysmex k21 hematology analyzer (sysmex corporation, kobe, japan). tlc was derived from the cbc by multiplying lymphocyte percentage by the white blood cell count. spearman correlations between alc and cd4 cell count and tlc and cd4 cell count were assessed. sensitivity, specificity, positive predictive value, and negative predictive values of various alc and tlc cut - offs were computed for cd4 count < 200 cells / cu.mm. all statistical analyses were performed using spss software (version 16.0, spss, chicago, usa). the mean age of this cohort was 34.69 years. of the 108 patients, 71 (65.74%) were males and 37 (34.26%) were females. 90 (83.4%) of the patients stated that they acquired hiv through heterosexual intercourse. during the study period, the mean cd4 count and mean tlc at baseline were 129.6576.84 cells / cu.mm and 1262.96738.98 cells / cu.mm, respectively. the correlations between alc and a cd4 cell count, and between tlc and a cd4 cell count were highly significant (spearman correlation coefficients of r=0.5604, p<0.0001 and 0.3497, p<0.001 respectively). the positive predictive value (ppv), negative predictive value (npv), sensitivity, specificity, and likelihood ratio of alc and tlc for cd4 count < 200 cells / mm in all paired counts are given in tables 1a and 1b, respectively. positive predictive value, negative predictive value, sensitivity and specificity of absolute lymphocyte count for cd4 count < 200 cells / cu.mm in all paired counts (n=108) positive predictive value, negative predictive value, sensitivity, and specificity of total lymphocyte count for cd4 count < 200 cells/ cu.mm in all paired counts (n=108) an alc of 1400 cells / cu.mm or less had maximal combined sensitivity, 71.08% (95% ci : 60.11 - 80.51%), and specificity, 78.26% (95% ci : 56.26 - 92.53%), for a cd4 cell count of less than 200 cells / cu.mm. however, a tlc cut - off value of 1200 cells / cu.mm l had a sensitivity of 63.41% [(95% ci : 52.09 to 73.74%) and a specificity of 69.57% (95% ci : 47.10 to 86.80%), with p=0.0081, considered very significant ]. notably, alc and tlc of less than 800 cells / cu.mm had a positive predictive value of 100.00% and 96.15%, respectively, for a cd4 cell count < 200 cells / cu.mm. similarly, the (ppv, npv, sensitivity, specificity, and likelihood ratio of alc and tlc for cd4 count 200 - 350 cells / cu.mm in all paired counts are given in tables 2a and 2b, respectively. positive predictive value, negative predictive value, sensitivity and specificity of absolute lymphocyte count for cd4 count 200 to 350 cells / cu.mm in all paired counts positive predictive value, negative predictive value, sensitivity and specificity of total lymphocyte count for cd4 count 200 to 350 cells / cu.mm in all paired counts in this study, we have demonstrated that both tlc and alc can be used in the place of cd4 count as a routine marker of immune status. in this cohort of indian patients, there was a good correlation between tlc and cd4 count by spearman rank order correlation (r=0.3497), indicating a moderately positive association between tlc and cd4 counts. however, spearman correlations between tlc and cd4 count reported in north america (r=0.77), england (r=0.76), and india (r=0.744) were higher, when compared with this study. this difference could be due to the small size of the study sample. however, the correlation between alc and cd4 counts in this study was higher (r=0.5604, p<0.0001), indicating that alc was a better marker when compared with tlc as a surrogate for cd4 counts. we found that an alc of 1400 cells / cu.mm was 71.08% sensitive and 78.26% specific for a cd4 cell count < 200 cells / cu.mm. however, jacobson. reported similar findings at a slightly higher alc cut - off of 1500 cells / cu.mm. but, we found that all the four statistical indices (ppv, npv, sensitivity, and specificity) maximally aggregated at tlc < 1200 cells / cu.mm for cd4 < 200 cells / cu.mm, thus proving that the who recommended cut - off (of 1200 cells / cu.mm) was adequate though the sensitivity was less. a critical issue in taking an alc cut - off of 1400 cells / cu.mm is that a proportion of patients with a cd4 cell count < 200 cells / cu.mm who would be misclassified by alc as having a cd4 cell count greater than 350 cells / cu.mm, and who would thus mistakenly have antiretroviral treatment deferred. using an alc of 1400 cells / cu.mm or less as the threshold to initiate haart, 24 of the 108 patients (25.92%) with a cd4 cell count < 200 cells / cu.mm would have been misclassified as not being in need of antiretroviral treatment, by having a simultaneous alc greater than 1400 cells / cu.mm. of note is the fact that 7 of these 108 (7.56%) patients had a cd4 cell count < 100 cells / cu.mm and although at very high risk of opportunistic infection, would have been misclassified as not needing antiretroviral treatment, by an alc greater than 1400 cells / cu.mm. alc and tlc cut - off values could be defined in such a way that ppv is very high, so that cd4 cell enumeration might not be needed to initiate haart. however, lower alc and tlc values of < 800 cells / cu.mm can not be taken as cut - offs [in spite of high ppv (100% for alc and 96.15% for tlc respectively) ] because of the low sensitivity. the latest who guidelines on anti - retroviral therapy recommend that all adolescents and adults including pregnant women with hiv infection and cd4 counts of 350 cells / cu.mm should start art, regardless of the presence or absence of clinical symptoms. we therefore analysed the data from those patients with cd4 counts of 200 - 350 cells / cu.mm to evaluate the performance of alc and tlc. the positive predictive values (ppv) for alc and tlc at this higher cd4 count of 200 - 350 cells / cu.mm were poor [tables 2a and 2b ]. we were also not able to draw any further conclusions as the results obtained were not statistically significant though the sensitivity and npv maximally aggregated at alc of < 1600 cells / cu.mm and tlc of < 1400 cells / cu.mm, respectively. we believe that this discrepancy was mainly due to the small size of the study sample. hence, more studies with larger sample sizes need to be done to analyse this aspect. the main limitations of this study were the small size of the study sample, which has an implication on determining the cut - offs for both alc and tlc. the second limitation was that we could not rule out the latent cases of intercurrent infections like tuberculosis (tb) and malaria, which might affect the interpretation of the alc / tlc. tb - related immune activation and anti - tb therapy may lead to fluctuations in cd4 cell count. malaria is another prevalent endemic disease known to have specific interactions with hiv infection. though its effect on cd4 cell count is less well documented, patients with hiv infection are known to have an increased likelihood of developing malaria, as well as a decreased response to prophylaxis. thus, further studies are needed to examine this aspect of impact of tb and malaria based on the correlation between tlc / alc and cd4 cell counts. our findings suggest that both alc and tlc could have clinical utility in determining when hiv - infected patients in resource - poor settings should initiate haart although alc is a better marker than tlc. however, more studies are required in resource - limited settings with larger study groups to ascertain the usefulness of alc / tlc as a surrogate for cd4 counts both before and after haart initiation. | background : the high cost of cd4 count estimation in resource - limited settings is a major obstacle in initiating patients on highly active antiretroviral therapy (haart). thus, there is a need to evaluate other less expensive surrogate markers like total lymphocyte count (tlc) and absolute lymphocyte count (alc).objectivesto evaluate the correlation of tlc and alc to cd4 count. to determine a range of tlc and alc cut - offs for initiating haart in hiv - infected patients in resource - limited settings.materials and methods : in a prospective observational cohort study of 108 art - naive hiv - positive patients, spearman correlation between alc and cd4 cell count, and tlc and cd4 cell count were assessed. sensitivity, specificity, positive and negative predictive values of various alc and tlc cut - offs were computed for cd4 count < 200 cells / cu.mm.results : good correlation was noted between alc and cd4 (r=0.5604) and tlc and cd4 (r=0.3497). alc of 1400 cells / cu.mm had a sensitivity of 71.08% and specificity of 78.26% for predicting cd4 cell counts less than 200 cells / cu.mm. similarly, tlc of 1200 cells / cu.mm had a sensitivity of 63.41% and specificity of 69.57%.conclusion : either alc or tlc may be helpful in deciding when to initiate antiretroviral therapy in resource - poor settings, though alc is better than tlc as a surrogate for cd4 counts. |
during an 18-year period (1995 - 2012), a total of 66 patients with pleural mesothelioma were diagnosed at the samsung medical center in seoul, south korea. only patients with a definite histological diagnoses were included in the present study. thirty - nine patients were diagnosed by needle biopsy ; followed 23 patients by video - assisted thoracotomy biopsy, 3 patients by excisional biopsy, and one patient by pleural fluid cytology. for twenty - two patients, clinical information included sex, age, history of exposure to asbestos, occupation, residential area, treatment, and follow - up visit dates. the antibodies used in this study are as follows : thyroid transcription factor-1 (ttf-1 ; 1:100, dako, glostrup, denmark), hbme-1 (1:400, dako), calretinin (1:80, novocastra, newcastle upon tyne, uk), vimentin (1:2,000, dako), wilms tumor 1 (wt-1 ; 1:50, dako), carcinoembryonic antigen (cea ; 1:200, dako), p53 (1:1,000, invitrogen, grand island, ny, usa), and cytokeratin (ck [ae1/ae3 ]) (1:500, dako). this study was approved by the institutional review board of the samsung medical center (smc 2013 - 11 - 027 - 001). the male - to - female ratio was 1.75:1, and patient ages ranged from 28 to 80 years with an average age of 56.84 years. the most common symptom was chest discomfort (16/35), followed by dyspnea (15/35) and cough (3/35). one patient had an incidentally found lesion on imaging work - up for another condition. radiologic impressions were as follows : mesothelioma (42/66), advanced lung cancer (7/66), lymphoma (1/66), pneumonia (2/66), tuberculoid pleurisy (1/66), malignant effusion (11/66), and pleural effusion with undetermined character (2/66). one patient underwent neoadjuvant chemotherapy before pleuropneumonectomy. among the 44 patients without surgical intervention, 16 patients underwent chemotherapy and one patient underwent radiation therapy. follow - up data was available in 60 patients (90.9%), and 50 (83.3%) patients died from the disease. with regard to the treatment method, the average overall survival of surgically treated patients and non - surgically treated patients was 18.2 and 10.8 months, respectively. surgery had no mortality benefit in patients with malignant mesothelioma, and it was statistically confirmed (p=.625). the tumor was more common on the right side (15/22) than the left side (7/22). grossly, there was diffuse pleural thickening of the tumor (11/22), diffuse and nodular growth (8/22), or nodular growth (3/22). regarding lymph nodal status, 54.5% (12/22) of patients had metastatic lymph nodes, and 40.9% (9/22) had no nodal metastasis. total 54 cases were availalbe for slide review. fifty cases (92.6%) were epithelioid subtype with followed 3 cases of sarcomatoid subtype (5.6%) and one case of byphasic subtype (1.9%) (fig. one epithelioid mesothelioma case exhibited a focal deciduoid feature, which showed diffuse proliferation of large neoplastic cells with well - defined borders and dense eosinophilic cytoplasm (fig. histological subtype is a statistically significant prognostic factor in malignant mesothelioma of pleura by univariate analysis (p=.035). there were poorer outcomes in patients with sarcomatoid subtype (hazard ratio [hr ], 3.973 ; confidence interval [ci ], 0.854 to 18.451) and patients with biphasic subtype (hr, 10.777 ; ci, 1.182 to 98.216) compared to those with epithelioid subtype. available small biopsy cases were histologically reviewed in order to evaluate the diagnostic features distinguishing mesothelioma from reactive mesothelial proliferation (table 1, fig. stromal components were identified in 26 out of 33 cases (78.8%), and stromal invasion was demonstrated in all stroma - included cases (fig. tumor cells displayed various growth patterns including complex papillary architecture (9/33), simple papillary architecture (1/33), and diffuse growth pattern (23/33) with or without desmoplastic reaction (fig. necrotic foci were identified in 11 out of 33 specimens (33.3%) (fig. the degree of cellular atypia varied : mild (8/33), moderate (22/33), and severe (3/33). with regard to immunohistochemistry, various markers including ttf-1, calretinin, wt-1, hmbe-1, vimentin, and ck (ae1/ae3) had been analyzed. two or three immunohistochemical markers were used for diagnosis. the choice of immunohistochemical markers varied according to the time and the pathologist. hbme-1, calretinin, and wt-1 were positive in 84.9%, 72.3%, and 80.9% of the cases studied, respectively (fig. ttf-1 was negative in 96.9% of the cases, except one case that had an unsatisfactory result. ck (ae1/ae3) was diffusely positive in 90% (9/10) of the cases and focally positive in 10% (1/10). epidemiologic information was not available in most cases, and only four patients had recorded information about asbestos exposure. only one patient was confirmed to have a history of definite asbestos exposure. the occupations of the remaining patients were as follows : housewife (8/66), office worker (5/66), businessman (4/66), teacher (2/66), paint factory worker (1/66), electrical technician (1/66), sewage worker (1/66), automobile repair worker (1/66), fabric factory worker (1/66), brewery worker (1/66), farmer (1/66), law clerk (1/66), and stage director (1/66). the current residential areas of the remaining patients were as follows : gyeonggi - do (12/66), seoul (14/66), gangwon - do (2/66), gyeongsang - do (18/66), incheon (1/66), jeolla - do (8/66), chungcheong - do (5/66), jeju - do (1/66) of korea, and russia (1/66). the male - to - female ratio was 1.75:1, and patient ages ranged from 28 to 80 years with an average age of 56.84 years. the most common symptom was chest discomfort (16/35), followed by dyspnea (15/35) and cough (3/35). one patient had an incidentally found lesion on imaging work - up for another condition. radiologic impressions were as follows : mesothelioma (42/66), advanced lung cancer (7/66), lymphoma (1/66), pneumonia (2/66), tuberculoid pleurisy (1/66), malignant effusion (11/66), and pleural effusion with undetermined character (2/66). one patient underwent neoadjuvant chemotherapy before pleuropneumonectomy. among the 44 patients without surgical intervention, 16 patients underwent chemotherapy and one patient underwent radiation therapy. follow - up data was available in 60 patients (90.9%), and 50 (83.3%) patients died from the disease. with regard to the treatment method, the average overall survival of surgically treated patients and non - surgically treated patients was 18.2 and 10.8 months, respectively. surgery had no mortality benefit in patients with malignant mesothelioma, and it was statistically confirmed (p=.625). the tumor was more common on the right side (15/22) than the left side (7/22). grossly, there was diffuse pleural thickening of the tumor (11/22), diffuse and nodular growth (8/22), or nodular growth (3/22). regarding lymph nodal status, 54.5% (12/22) of patients had metastatic lymph nodes, and 40.9% (9/22) had no nodal metastasis. fifty cases (92.6%) were epithelioid subtype with followed 3 cases of sarcomatoid subtype (5.6%) and one case of byphasic subtype (1.9%) (fig. one epithelioid mesothelioma case exhibited a focal deciduoid feature, which showed diffuse proliferation of large neoplastic cells with well - defined borders and dense eosinophilic cytoplasm (fig. histological subtype is a statistically significant prognostic factor in malignant mesothelioma of pleura by univariate analysis (p=.035). there were poorer outcomes in patients with sarcomatoid subtype (hazard ratio [hr ], 3.973 ; confidence interval [ci ], 0.854 to 18.451) and patients with biphasic subtype (hr, 10.777 ; ci, 1.182 to 98.216) compared to those with epithelioid subtype. available small biopsy cases were histologically reviewed in order to evaluate the diagnostic features distinguishing mesothelioma from reactive mesothelial proliferation (table 1, fig. stromal components were identified in 26 out of 33 cases (78.8%), and stromal invasion was demonstrated in all stroma - included cases (fig. tumor cells displayed various growth patterns including complex papillary architecture (9/33), simple papillary architecture (1/33), and diffuse growth pattern (23/33) with or without desmoplastic reaction (fig. necrotic foci were identified in 11 out of 33 specimens (33.3%) (fig. the degree of cellular atypia varied : mild (8/33), moderate (22/33), and severe (3/33). with regard to immunohistochemistry, various markers including ttf-1, calretinin, wt-1, hmbe-1, vimentin, and ck (ae1/ae3) had been analyzed. two or three immunohistochemical markers were used for diagnosis. the choice of immunohistochemical markers varied according to the time and the pathologist. hbme-1, calretinin, and wt-1 were positive in 84.9%, 72.3%, and 80.9% of the cases studied, respectively (fig. ttf-1 was negative in 96.9% of the cases, except one case that had an unsatisfactory result. ck (ae1/ae3) was diffusely positive in 90% (9/10) of the cases and focally positive in 10% (1/10). epidemiologic information was not available in most cases, and only four patients had recorded information about asbestos exposure. only one patient was confirmed to have a history of definite asbestos exposure. the occupations of the remaining patients were as follows : housewife (8/66), office worker (5/66), businessman (4/66), teacher (2/66), paint factory worker (1/66), electrical technician (1/66), sewage worker (1/66), automobile repair worker (1/66), fabric factory worker (1/66), brewery worker (1/66), farmer (1/66), law clerk (1/66), and stage director (1/66). the current residential areas of the remaining patients were as follows : gyeonggi - do (12/66), seoul (14/66), gangwon - do (2/66), gyeongsang - do (18/66), incheon (1/66), jeolla - do (8/66), chungcheong - do (5/66), jeju - do (1/66) of korea, and russia (1/66). malignant mesothelioma is a rare malignant neoplasm arising from the serosal surfaces of the pleura, peritoneum, pericardium, and other body cavities.11 it is highly aggressive, with a mortality of nearly 100%.11 in the present study, we evaluated clinicopathologic and etiologic information of the patients with malignant mesothelioma at single institution over 18 years. the diagnosis is challenging due to many tumors with similar histology.7 therefore, the diagnosis is usually made with the aid of immunohistochemistry.6,8,9 to date, there is no single immunohistochemical marker that provides high sensitivity and specificity for the diagnosis of malignant mesothelioma.7,9,10 we reviewed the immunohistochemical panel used from 1995 to 2012 and discovered that there has been a shift in the combination of markers used for the diagnosis of malignant mesothelioma. before introduction of calretinin and wt-1, various combinations of markers including ck (ae1/ae3), vimentin, bcl-2, and cd15 were used. electron microscopy was performed in four cases and the final diagnosis was made with the aid of the characteristic long microvilli feature by electron microscopy. in general, a combination of two or more positive mesothelial markers with two or more negative epithelial markers is recommended under considerable findings of histology.6,8,10,11 among positive mesothelioma markers, calretinin and wt-1 are usually recommended.6 it is known that virtually all mesothelioma are positive for calretinin with nuclear and cytoplasmic staining, and approximately 70% to 95% of mesotheliomas show nuclear positivity for wt-1.6 ck 5/6 and d2 - 40 are also useful.6 on the other hand, the value of hbme-1 in the diagnosis of malignant mesothelioma is still controversial due to low specificity.12,13 however, hbme-1 is commonly used in our institution because the thick membranous staining pattern of hbme-1 in malignant mesothelioma is helpful, in contrast to metastatic adenocarcinoma and reactive mesothelial cells which have a thin membrane and cytoplasmic pattern.12,13 regarding epithelial markers, at least two epithelial markers are recommended to rule out metastatic carcinoma.6 markers useful in differentiating mesothelioma from metastatic pulmonary adenocarcinoma are moc-31, bg8, cea, b72.3, ber - ep4, ttf-1, and napsin a.6 in our institution, we usually used single marker, ttf-1, because ttf-1 shows high sensitivity and specificity for pulmonary adenocarcinoma.6 since 2002, the combination of hbme-1, calretinin, wt-1, and ttf-1 has been mainly used for the distinction between mesothelioma and metastatic adenocarcinoma in our institution. it seems that the combination of hbme-1, calretinin, wt-1, and ttf-1 enables a highly accurate and consistent diagnosis in the proper clinical context and hematoxylin and eosin morphology. in the present study, we could not compare sensitivity and specificity of individual markers because they were used in various combinations in different studies. the diagnostic distinction between reactive and neoplastic mesothelial proliferation is also challenging, particularly in small biopsied samples.6,8 frank stromal invasion is considered the most significant discriminating diagnostic feature.6,14 we also concluded that histologic features including stromal invasion, the presence of necrosis, and cellular atypia are determining factors in the proper clinical context. in some difficult cases immunohistochemical markers could be helpful.6,14 in our institution, p53 immunostaining was performed in five of the small biopsied cases to rule out reactive conditions, and the results were positive in four out of the five cases. according to one study conducted by attanoos.,14 malignant mesothelioma was reactive to p53 in 45% of mesothelioma cells in contrast to no reactivity of reactive mesothelial cells. we are in close agreement that p53 antibody may be of use as a second - line marker of neoplastic mesothelium within a standard immunohistochemical panel of antibodies and clinical settings.6,14 other useful markers include desmin, epithelial membrane antigen, glucose transporter 1, and insulin - like growth factor - ii mrna - binding protein 3.6 in terms of histological classification, there are various types of mesothelioma : epithelioid, sarcomatoid, desmoplastic, and biphasic types. while the subtype " desmoplastic mesothelioma " is generally accepted for a particular subtype of highly aggressive sarcomatoid mesothelioma, there is no agreement on the nomenclature of other subtypes.11 while several reports have suggested that patients with epithelioid subtype have a better prognosis than those with the sarcomatoid subtype, the other studies did not reveal prognostic differences among the different histologic subtypes.3,5,15 according to one study, patients with epithelioid histology had a more favorable survival than patients with non - epithelial histology. in the current study,, high - grade deciduoid mesothelioma among epithelioid type is known to harbor a worse prognosis, and one patient showing deciduoid features also died shortly after the diagnosis.16 there has been an ongoing debate regarding the optimal approach to malignant mesothelioma. the consensus among centers is that surgery, whether debulking surgery or radical resection, is best performed in combination with adjuvant chemotherapy, radiotherapy, immunotherapy, or other treatment.1,17,18,19 it is possible that some very early stage tumors have been cured by the so - called triple modality therapy, which includes extrapleural pneumonectomy followed by chemotherapy and radiation therapy ; however, this finding remains inconclusive.11 there have been several studies supporting curative therapy including surgery rather than palliative treatment. sugarbaker.4 reported that patients receiving any therapy survived longer than patients treated with supportive care only. in one recent trial, patients who underwent neo - adjuvant chemotherapy combined with pleuropneumonectomy and followed by radiotherapy showed an average three - year survival gain compared to patients with unimodal treatment.4 on the other hand, takagi.5 reported that the survival and perioperative mortality rates of patients who had undergone pleuropneumonectomy or limited resection did not significantly differ. in our study, the overall survival of this patient was 24.9 months, approximately nine months longer than the average survival of 15.39 months. however, we could not statistically compare the therapeutic benefit of neoadjuvant therapy because of the limited sample size. in the present study, overall survival was 83.3%, which is a favorable result compared to the known survival rate. most of alive patients in this study were recently diagnosed, possibly explaining this higher survival rate. regarding tumor etiology, it is well established that mesothelioma is associated with asbestos exposure. in most industrialized countries, more than 90% of pleural mesotheliomas in men are related to prior asbestos exposure.11 on the other hand, only 25% of patients with malignant mesothelioma had a history of asbestos exposure in one study from iran.20 in korea, an average of 34 cases have been reported annually in the mesothelioma surveillance system data since 2001.21 it has been reported that about 60% of malignant mesothelioma patients in korea have a history of asbestos exposure.22,23 asbestos was commonly used among manufacturers and builders in the late 19th century because of its sound absorption, average tensile strength, and its resistance to fire and heat.24 asbestos factories were mainly located in gyeonggi - do and gyeongsang - do, and many asbestos mines were located in chungcheong - do of korea.24 in our study, exposure history was not available in most cases. in addition, occupational and residential information included only current profession and geographic living area. regarding other etiologies, there has been a recent study investigating the relationship between simian virus 40 (sv40) and malignant mesothelioma in korea. sv40 is a known cofactor in the carcinogenic effects of asbestos in malignant mesothelioma ; however, its actual role is still controversial.25 according to one recent study, there was no association between sv40 and the development of malignant mesothelioma in korea.25 as the epidemiologic background of malignant mesothelioma has not yet been determined, a more active epidemiologic study is warranted. there is a lack of specialized facilities and experts to diagnose and treat asbestos - related illnesses in korea ; therefore, nation - wide awareness and evaluation are needed.21 | backgroundmalignant mesothelioma of the pleura is an aggressive tumor known to be associated with asbestos. histological diagnosis of mesothelioma is challenging and is usually aided by immunohistochemical markers.methodsduring an 18-year period (1995 - 2012), 66 patients with pleural mesothelioma were diagnosed at the samsung medical center in seoul. we reviewed hematoxylin and eosin and immunohistochemical slides of pleural mesothelioma and evaluated their pathological and clinical features.resultsthe male - to - female ratio was 1.75:1, and age of patients ranged from 28 to 80 years with an average age of 56.84 years. twenty - two out of 66 patients underwent curative pneumonectomy. follow - up data was available in 60 patients (90.9%), and 50 of them (83.3%) died from the disease. the average overall survival was 15.39 months. histologically, the epithelioid type was the most common, followed by the sarcomatoid and the biphasic types. epidemiologic information was not available in most cases, and only one patient was confirmed to have a history of asbestos exposure.conclusionsmalignant mesothelioma of the pleura is a fatal tumor, and the therapeutic benefit of pneumonectomy remains unproven. the combination of calretinin, wilms tumor 1, hmbe-1, and thyroid transcription factor-1 may provide high diagnostic accuracy in diagnosing mesothelioma. |
meningiomas are one of the most common neoplasms arising from cellular elements of the meninges, in particular, from arachnoid villi structures. commonly, meningiomas are attached to the dura and grow in the cranial cavity or intraspinal region. however, ectopic locations of meningiomas can not be excluded. in this report, we present a rare case of this special tumor entity in the mandibular bone of a young woman. a 20-year - old woman was referred to our department with the suspicion of a radicular cyst resulting from a periapical infection of tooth 36 in the mandibular bone. on radiographic examination, panoramic x - ray and computed tomography (ct) imaging showed a 2 1.8-cm radiolucent lesion of the left posterior mandible. the lesion involved both apical roots of the first molar and the mesial apical root of the second molar. it showed an expansive character and penetrated the medial corticalis of the mandibular bone (figs 1 and 2). the lesion involved both apices of the first molar and the mesial apex of the second molar and extended to the caudal border of the mandibular bone. figure 2:axial, sagittal and coronar ct showing a 2 1 x 1.8-cm lesion in the left posterior mandible, its expansive and destructive character, and its penetration of the medial corticalis. the lesion involved both apices of the first molar and the mesial apex of the second molar and extended to the caudal border of the mandibular bone. axial, sagittal and coronar ct showing a 2 1 x 1.8-cm lesion in the left posterior mandible, its expansive and destructive character, and its penetration of the medial corticalis. after completion of a discussion of the results, the patient was treated under general anesthesia by intraoral subtotal incisional biopsy by using piezosurgery (mectron, cologne, germany). the tumor had a high cell density including fascicular, storifom and spindle - shaped patterns. the cells were ordered into cell cords, but also into whorls. additionally, collagenous and hard matter areas were present evoking psammom bodies, and the cells clearly formed reticulin fibers. biotin complex immunostaining, we found a strong positive reaction with antibodies for vimentin, epithelial membrane antigen (ema) and somatostatin and also a positive reaction for desmoplakin in a smaller amount of tumor cells (< 20%) (fig. the final histopathological results of the biopsy revealed a mesenchymal tumor classified as an ectopic meningioma who grade i. figure 3:(a) spindle - shaped cells arranged in cell cord and in whorls with no mitotic figures (hematoxylin eosin, original magnification 400). immunhistochemical stains with immunopositive reaction for (b) vimentin (100), (c) ema (400) and (d) somatostatin (400). (a) spindle - shaped cells arranged in cell cord and in whorls with no mitotic figures (hematoxylin eosin, original magnification 400). immunhistochemical stains with immunopositive reaction for (b) vimentin (100), (c) ema (400) and (d) somatostatin (400). meningiomas are one of the most common tumor entities in the central nervous system, are generally benign and have their origin in the arachnoid villoid structures of the meningocytes. however, in rare cases, ectopic forms of this tumor entity can appear extracranially and extraosseously in the head and neck region. with respect to the jaws, we have found only eight cases including two meningiomas of the maxilla [1, 2 ] and six meningiomas of the mandible [37 ] in the current literature. we have found the seventh case of an extracranial meningioma of the mandible in a young woman who presented with a cystoid - like lesion in the left mandibular bone and no specific clinical symptoms. because of the absence of typical radiographic features, no clear diagnosis was possible either with a panoramic x - ray or 3d imaging. however, the role of ct is seen significantly to assess the relationship between the tumor and the bony surfaces and to exclude potential malignancy. several hypotheses have been proposed for the occurrence of extracranial meningiomas, including extradural enclosing of arachnoid cell nests during embryogenesis, ectopic migration, and the development of arachnoid cells in combination with the peripheral nerves, or metaplasia of the mature peripheral nerve sheath cells or progenitor cells. however, ectopic meningiomas have also been postulated to be mesenchymal tumors that arise from multipotential mesenchymal cells, particularly if no associations to the cranial nerves are apparent. in the head and neck region, this tumor entity is often associated with cranial nerves and, therefore, is considered to be derived from ectopic arachnoid tissue present around these nerves. therefore, the origin of the tumor arising in our patient seems to be the perineural cells of the mandibular nerve. however, ectopic arachnoid cells within the mandibular bone as a source of tumor growth can not be excluded. the histopathologic and immunhistochemical features of ectopic meningiomas are seen similar to those of their more frequent intracranial counterparts [4, 8 ]. the general histologic diagnosis of meningiomas describes spindle - shaped cells that can be arranged in whorls, rosettes and interconnecting fascicles. mitotic figures or atypia is generally rare, and psammom bodies might be present. because of the differential diagnosis from other tumor entities of peripheral nerve origin, an immunhistochemical analysis is useful or even necessary. in meningiomas, the positive expression of ema, desmoplakin, somatostatin and vimentin is a characteristic feature [3, 4, 10 ] and demonstrates the epithelial and mesenchymal patterns of cells within this tumor. epidemiologically, ectopic meningiomas are slightly more frequent in females with a ratio of 1:1.2, i.e. ~55%. the average age of patients is 43.4 years, whereby females are older (48.7 years) than males (36.9 years). on closer consideration of extracranial meningiomas of the mandibular bone, all previously described cases in the current literature were women with an average age of 45.7 years. in our case, the gender was the same, but the age of the patient was, at 20 years, considerably younger than the average. the therapy of choice for extracranial meningiomas in the jaw bones is surgical excision [3, 4, 8 ]. the prognosis of extracranial meningiomas after complete surgical tumor resection is good with disease - free rates of 82 and 78% at 5 and 10 years, respectively. in cases of subtotal resection or aggressive histopathologic features such as mitotic figures or foci of necrosis, close follow - up is necessary. despite the strong recommendation for surgical treatment in the current literature, we decided on close follow - up examinations without any therapeutic interventions at the time of diagnosis, considering potential tooth loss or surgical damage of the inferior alveolar nerve as a potential complication of surgery. the follow - up examinations at 12 months including panoramic x - ray (fig. 5) showed no significant progression of the tumor lesion and no new clinical symptoms were apparent. this case remains under review and is the first case of an ectopic mandibular meningioma that has not initially been surgically removed after diagnosis. figure 4:follow - up panoramic x - ray imaging at 12 months after initial diagnosis showing no significant progression of the tumor lesion. figure 5:likewise to panoramic x - ray, follow - up ct after 12 months showing no significant progression of the lesion. follow - up panoramic x - ray imaging at 12 months after initial diagnosis showing no significant progression of the tumor lesion. likewise to panoramic x - ray, the conclusion of this case is that unclear lesions of the jaws, even if they seem to be clear following diagnostics, should be evaluated by incisional biopsy and histopathological evaluation. | abstractectopic meningiomas are a very rare tumor entity. we present a case of a meningioma arising in the mandible of a young woman and initially supposed to be a radicular cyst. histopathological and immunhistochemical evaluation showed typical cell characteristics of a meningioma. only six cases of ectopic meningiomas in the mandible have been described in the literature until now, mainly in women at an advanced age and with surgical removal of all tumors. for the first time, no surgical excision has been performed in this case and follow - up control after 12 months showed no significant progression or increasing clinical complaints. hence, surgical removal seems non - urgent. in conclusion, unclear lesions of the jaws, even if they seem to be clear following diagnostics, should be evaluated by incisional biopsy and histopathological evaluation. |
the primary aim of cleft palate surgery is not only to close the cleft palate but to push back the palate by repositioning the levator muscle to ensure that normal speech is obtained. using a buccal myomucosal flap is a readily effective method for velopharyngeal closure when the cleft palate is wide. buccal musculomucosal flap is commonly used in cleft palate surgery for providing additional lining when nasal mucosa is inadequate. it is an axial pattern flap which can be based either on the buccal or facial arteries. it is flexible and versatile and unlike most free flaps, provides mucosal, as opposed to skin, cover. the flap is about 5 mm thick and comprises buccal mucosa, submucosa, and buccinator muscle, with the feeding vessels and vascular plexus. the technique presented has been effective, with the advantages of palatal closure without tension, good muscular reconstruction, lengthening of the nasal layer, and palatal closure without raw areas. the aim of this study is to review the experience with the buccinator myomucosal flap, for clinical application in the secondary cleft cases with velopharyngeal insufficiency [figure 1 ] and nasal regurgitation along with palatal fistula [figure 2 ]. palatal lengthening using buccal myo mucosal flap anterior palatal fistula closure using buccal myo mucosal flap it includes patient 's general information such as family history, genetic study, and primary cleft diagnosis, surgeries performed, and follow - up. after infiltration with local anesthesia (lidocaine 0.05% plus 1:100.000 epinephrine), the veau flaps are raised and extensively dissected from the nasal layer in the area of the soft palate. the levator mechanism is then dissected completely from its anteromedial insertion onto the palate shelves. division of the tendinous insertion of the palatopharyngeus and the fascia of von troltz is carried out. the levator musculature is gently dissected off the nasal layer, which is then devoid of any other structure. the muscles come to lie at right angles to the long axis of the palate at the base of the uvula. the greater palatine neurovascular bundle to these muscles enters from a later position ; it is clearly seen and carefully preserved during the dissection. the levator musculature is reconstructed by being sutured together and to the nasal layer with 40 vicryl sutures in the midline at the base of the uvula. after that, the nasal layer of the palate is divided transversely at approximately 0.5 cm behind the palatal shelves. the oral mucosa area over the cheek is then exposed and a buccal myomucosal flap measuring between 1.5 and 2 cm wide by 2.5 cm long is then raised. the flap is elevated together with a thin layer of the buccinator muscle, which improves its blood supply. it is important to avoid opening the buccal fat fascia ; this prevents the herniation of fat into the oral cavity. if this occurs, repositioning of the fat pad and suture of the flap donor site is enough to solve the problem. the parotid duct should be carefully preserved, but if injured, it is of no consequence ; the parotid secretion always finds a way out. a generous tunnel is created posterior to greater palatine vessels, and the buccal flap is passed through it to fill the nasal layer defect. the flap must be placed with the mucosal surface facing the nasal cavity, taking care not to twist the pedicle. subperiosteal dissection is never performed on the posterior tuberosity on the left side even if closure is difficult. to prevent growth problems, submucosal dissection only should be performed. this is a composite closure that includes the oral and nasal layers and posteriorly the reconstructed muscles [figure 1 ]. the lateral raw areas on the hard palate can always be closed directly in all clefts and also with 4.0 vicryl sutures. the patients are discharged 1-day after the surgery with examination of the palate and are seen 1-month later at the clinic unless something unforeseen occurs. postoperatively, there is slight edema on the side from which buccal myo mucosal flap (bmmf) is taken, which subsides eventually after proper administration of antiinflammatory drugs and positioning [figure 3 ]. healed flap for palatal fistula the surgery was performed on all patients under general anesthesia using a standard protocol. after infiltration with local anesthesia (lidocaine 0.05% plus 1:100.000 epinephrine), the veau flaps are raised and extensively dissected from the nasal layer in the area of the soft palate. the levator mechanism is then dissected completely from its anteromedial insertion onto the palate shelves. division of the tendinous insertion of the palatopharyngeus and the fascia of von troltz is carried out. the levator musculature is gently dissected off the nasal layer, which is then devoid of any other structure. the muscles come to lie at right angles to the long axis of the palate at the base of the uvula. the greater palatine neurovascular bundle to these muscles enters from a later position ; it is clearly seen and carefully preserved during the dissection. the levator musculature is reconstructed by being sutured together and to the nasal layer with 40 vicryl sutures in the midline at the base of the uvula. after that, the nasal layer of the palate is divided transversely at approximately 0.5 cm behind the palatal shelves. the oral mucosa area over the cheek is then exposed and a buccal myomucosal flap measuring between 1.5 and 2 cm wide by 2.5 cm long is then raised. the flap is elevated together with a thin layer of the buccinator muscle, which improves its blood supply. it is important to avoid opening the buccal fat fascia ; this prevents the herniation of fat into the oral cavity. if this occurs, repositioning of the fat pad and suture of the flap donor site is enough to solve the problem. the parotid duct should be carefully preserved, but if injured, it is of no consequence ; the parotid secretion always finds a way out. a generous tunnel is created posterior to greater palatine vessels, and the buccal flap is passed through it to fill the nasal layer defect. the flap must be placed with the mucosal surface facing the nasal cavity, taking care not to twist the pedicle. subperiosteal dissection is never performed on the posterior tuberosity on the left side even if closure is difficult. to prevent growth problems, submucosal dissection only should be performed. this is a composite closure that includes the oral and nasal layers and posteriorly the reconstructed muscles [figure 1 ]. the lateral raw areas on the hard palate can always be closed directly in all clefts and also with 4.0 vicryl sutures. the patients are discharged 1-day after the surgery with examination of the palate and are seen 1-month later at the clinic unless something unforeseen occurs. postoperatively, there is slight edema on the side from which buccal myo mucosal flap (bmmf) is taken, which subsides eventually after proper administration of antiinflammatory drugs and positioning [figure 3 ]. of all the 20 cases operated, nasal regurgitation that was marked preoperatively was reduced significantly. in four patients who had velopharyngeal insufficiency along with glottal sounds the bmmf had little or no effect. three patients had palatal fistula (mid palatine and anterior in one patient [figure 2 ]) the results were marked as the regurgitation along with nasality in sounds also reduced. buccal mucosal flaps have been utilized to repair a variety of defects of the nasal septum, palate, midface, orbit and conjunctiva. modifications to improve the vascularity of the mucosal flaps were reported by maeda., who also described buccal various techniques have been described for the creation of the buccinators musculomucosal flap, mainly based on arterial supply. once the doppler ultrasound used for identification of buccal artery, at the level of the buccopharyngeal facia buccal mucosa and the buccinators muscle are incised in the loose areolar plane, flap elevated in an anterior to posterior direction between the buccinator muscle and the buccopharyngeal fascia. to prevent the herniation of the buccal fat pad and avoids injury to branches of the facial nerve, the buccopharyngeal fascia is preserved. small branches of the facial artery are ligated, as are anterior venous tributaries from the pterygoid plexus. the dissection proceeds posteriorly until just anterior to the pterygomandibular raphe, where the main neurovascular bundle enters the flap. care is taken that the pedicle does not interpose between the molar teeth as this may interfere with mastication. relevant molars might need to be extracted or an island flap created ; alternatively, the vascular pedicle may be divided after a delay of a few weeks. modifications of this procedure include isolation of the pedicle to create an island flap, in order to facilitate rotation, and creation of a buccinator myomucosal neurovascular island pedicle flap based on the buccal artery, the buccal venous plexus and nerves innervating the muscle. the mucosa at the posterior end of the flap is divided from the underlying muscle and freed of its insertion from the pterygomandibular raphe. based anteroinferiorly on the inferior buccal branches of the facial artery the main trunk identified with a doppler probe to establish its position. the mucosa and the buccinator muscle are incised superiorly, and the facial artery and vein ligated. the dissection continues in a plane lateral to the vessels, as the flap is raised from the front to back while branches of the facial artery are ligated. buccinator myomucosal reversed - flow arterial island flap based on the distal end of the facial artery and its anterior buccal branches. course of the artery is outlined by doppler ultrasound, and dissection starts at the inferior margin of the flap with incision of the mucosa and buccinators muscle. the facial artery is ligated inferiorly and the flap is elevated in a superior direction. buccal flap used in palatal repairs to provide the following advantage : nasal layer lengtheningreconstruction of poor nasal layer repairlevator muscle sling reattachment on the hard palate. nasal layer lengthening reconstruction of poor nasal layer repair levator muscle sling reattachment on the hard palate. buccal flaps have been used in palatal surgery for lengthening of the nasal layer, reconstruction of the poor nasal layer repair and to prevent reattachment of the levator sling on the hard palate. this flap can be raised either as a mucosal or a myomucosal flap and is usually based near the anterior pillar of the fauces. the main reason for techniques using hard palate mucoperiosteal flaps to achieve the anatomical union of the palate shelves has been to improve speech (von langenbeck, 1861 ; wardill, 1937 ; dorrance and bransfield, 1943 ; furlow, 1986 ; brothers., 1995). however, a large number of patients who undergo these surgical techniques still develop velopharyngeal insufficiency (vpi) because of the inability to reconstruct the palatal mechanism adequately to allow for normal speech. it should lengthen the palate and reconstruct the muscular sling to allow an efficient velopharyngeal valving action during speech, thus establishing conditions for good velopharyngeal closure. the modified palatoplasty with the buccal myomucosal flap meets all of these the buccal myomucosal flap meets all of these criteria. the muscular sling reconstruction maximizes the velar elevation and posterior closure by establishing normal levator muscle relationships. it is important to note that the musculature is completely released from its atypical insertions on the posterior edges of the palatine bones and to the nasal and oral attachments. the muscular sling and sphincteric mechanism can be easily reconstructed without any tension if the muscles are properly and completely detached from these structures. the innervation to the muscles is maintained because this is essential for good postoperative muscular action. in addition, the muscles are fixed securely to the nasal and oral layers when correctly repositioned. the palatal and oral layers are sutured to one another throughout the length of the cleft repair. although the muscular reconstruction can be very effective in achieving velopharyngeal closure, it is not enough to merely lengthen the nasal mucosa. thus, insertion of the buccal myomucosal flap complements the palate repair and prevents any possible anterior movement of the muscle sling. in the first description of the buccal mucosal flap, mukherji (1969) stated that short soft palate is a relative term because its length is dependent on the depth of the nasopharynx. he noticed that children with distances > 5 mm between the soft palate and the posterior pharyngeal wall (57.1% of children with cleft in his study) were more likely to have speech problems that needed to be corrected further. his rationale for the use of the buccal flap was the possibility of lengthening the palate and to avoid surgeries such as the pharyngeal flap in small children. ganguli (1971) reported the use of submucous cheek pedicle to lengthen the short palate. kaplan (1975) described the technique in primary palatal repair as a unilateral buccal mucosal flap to be turned in for nasal lining after the nasal mucosa division following the pushback. maeda. (1987) modified the initial buccal mucosal flap to a buccal myomucosal flap, including a thin layer of the buccinator muscle, in an attempt to improve the blood supply. they also used bilateral buccal flaps to lengthen the nasal layer and to cover the oral surface of the palate, as nakikita. placed in a transverse cut made in the nasal layer, the buccal myomucosal flap can add an additional 1.52 cm to the nasal surface. that maneuver will allow an adequate contact between the soft palate and the nasopharynx (mukherji, 1969). it is possible to completely close even the widest clefts with this technique without the need of further procedures. because of the extensive release of the nasal and oral layers from the palatal shelves, insertion of the buccal flap and mattress sutures that include the nasal, oral, and levator muscles, the repaired palate is anatomically correct and stable. freedlander and jackson (1989) studied the reliability of the buccal flap over time. they showed by endoscopic examination that the buccal flap remained viable and kept its initial dimensions, lengthening the nasal layer. they hypothesized that the flap would prevent reattachment of the reconstructed levator muscle in its preoperative position because of its in terposition between the hard palate and the velar muscles (kaplan, 1975 ; freedlander and jackson, 1989). the buccal mucosa is available in an adequate amount, and there is no significant danger of airway obstruction or hemorrhage. none of the complications described in the literature, such as swelling of the face, impossibility of hard palate donor site closure, infection, or stenosis of the parotid duct (kaplan, 1975 ; maeda., 1987 ; freedlander and jackson, 1989) were observed in our series. in our experience, the primary palatoplasty with the buccal myomucosal flap has been an extremely safe and easy operation. occasionally, on the advice of an orthodontist, the buccal flap pedicle had to be divided at the time of eruption of the third molar. it is important to differentiate the use of the buccal mucosal flap from other flaps used to lengthen the palate, such as the millard island flap (millard, 1963) and the edgerton technique for palate elongation (edgerton, 1962). the millard island flap consisted of the division of the nasal mucosa and placement of a palatal mucosa island flap based on the great palatine vessels. a plethora of techniques has been used in palatal repair. it is still difficult to determine how much these have really improved speech because of the variety of methods used to analyze speech and different interpretations by the evaluators. the presence of a speech - language pathologist has been extremely important in the evaluation and improvement of the speech quality. there is a common belief that this can enhance the speech outcome and prevent the development of compensatory articulation patterns that are difficult to correct the longer they are left untreated. the optimal age for palatal repair has been the subject of a number of studies (cosman and falk, 1980 ; dorf and curtin, 1982 ; freedlander and jackson, 1989 ; ysunza., 1997 ; the palate needs be closed prior to the onset of the phonemic development to minimize abnormal speech patterns (dorf and curtin, 1982). the dilemma about early repair has been how to obtain an early communicative adequacy without sacrificing orofacial growth components. once the doppler ultrasound used for identification of buccal artery, at the level of the buccopharyngeal facia buccal mucosa and the buccinators muscle are incised in the loose areolar plane, flap elevated in an anterior to posterior direction between the buccinator muscle and the buccopharyngeal fascia. to prevent the herniation of the buccal fat pad and avoids injury to branches of the facial nerve, the buccopharyngeal fascia is preserved. small branches of the facial artery are ligated, as are anterior venous tributaries from the pterygoid plexus. the dissection proceeds posteriorly until just anterior to the pterygomandibular raphe, where the main neurovascular bundle enters the flap. care is taken that the pedicle does not interpose between the molar teeth as this may interfere with mastication. relevant molars might need to be extracted or an island flap created ; alternatively, the vascular pedicle may be divided after a delay of a few weeks. modifications of this procedure include isolation of the pedicle to create an island flap, in order to facilitate rotation, and creation of a buccinator myomucosal neurovascular island pedicle flap based on the buccal artery, the buccal venous plexus and nerves innervating the muscle. the mucosa at the posterior end of the flap is divided from the underlying muscle and freed of its insertion from the pterygomandibular raphe. based anteroinferiorly on the inferior buccal branches of the facial artery the main trunk identified with a doppler probe to establish its position. the mucosa and the buccinator muscle are incised superiorly, and the facial artery and vein ligated. the dissection continues in a plane lateral to the vessels, as the flap is raised from the front to back while branches of the facial artery are ligated. zhao. described the superiorly based buccinator myomucosal reversed - flow arterial island flap based on the distal end of the facial artery and its anterior buccal branches. course of the artery is outlined by doppler ultrasound, and dissection starts at the inferior margin of the flap with incision of the mucosa and buccinators muscle. the facial artery is ligated inferiorly and the flap is elevated in a superior direction. buccal flap used in palatal repairs to provide the following advantage : nasal layer lengtheningreconstruction of poor nasal layer repairlevator muscle sling reattachment on the hard palate. nasal layer lengthening reconstruction of poor nasal layer repair levator muscle sling reattachment on the hard palate. buccal flaps have been used in palatal surgery for lengthening of the nasal layer, reconstruction of the poor nasal layer repair and to prevent reattachment of the levator sling on the hard palate. this flap can be raised either as a mucosal or a myomucosal flap and is usually based near the anterior pillar of the fauces. the main reason for techniques using hard palate mucoperiosteal flaps to achieve the anatomical union of the palate shelves has been to improve speech (von langenbeck, 1861 ; wardill, 1937 ; dorrance and bransfield, 1943 ; furlow, 1986 ; brothers., 1995). however, a large number of patients who undergo these surgical techniques still develop velopharyngeal insufficiency (vpi) because of the inability to reconstruct the palatal mechanism adequately to allow for normal speech. it should lengthen the palate and reconstruct the muscular sling to allow an efficient velopharyngeal valving action during speech, thus establishing conditions for good velopharyngeal closure. the modified palatoplasty with the buccal myomucosal flap meets all of these the buccal myomucosal flap meets all of these criteria. the muscular sling reconstruction maximizes the velar elevation and posterior closure by establishing normal levator muscle relationships. it is important to note that the musculature is completely released from its atypical insertions on the posterior edges of the palatine bones and to the nasal and oral attachments. the muscular sling and sphincteric mechanism can be easily reconstructed without any tension if the muscles are properly and completely detached from these structures. the innervation to the muscles is maintained because this is essential for good postoperative muscular action. in addition, the muscles are fixed securely to the nasal and oral layers when correctly repositioned. the palatal and oral layers are sutured to one another throughout the length of the cleft repair. although the muscular reconstruction can be very effective in achieving velopharyngeal closure, it is not enough to merely lengthen the nasal mucosa. thus, insertion of the buccal myomucosal flap complements the palate repair and prevents any possible anterior movement of the muscle sling. in the first description of the buccal mucosal flap, mukherji (1969) stated that short soft palate is a relative term because its length is dependent on the depth of the nasopharynx. he noticed that children with distances > 5 mm between the soft palate and the posterior pharyngeal wall (57.1% of children with cleft in his study) were more likely to have speech problems that needed to be corrected further. his rationale for the use of the buccal flap was the possibility of lengthening the palate and to avoid surgeries such as the pharyngeal flap in small children. ganguli (1971) reported the use of submucous cheek pedicle to lengthen the short palate. kaplan (1975) described the technique in primary palatal repair as a unilateral buccal mucosal flap to be turned in for nasal lining after the nasal mucosa division following the pushback. (1987) modified the initial buccal mucosal flap to a buccal myomucosal flap, including a thin layer of the buccinator muscle, in an attempt to improve the blood supply. they also used bilateral buccal flaps to lengthen the nasal layer and to cover the oral surface of the palate, as nakikita. placed in a transverse cut made in the nasal layer, the buccal myomucosal flap can add an additional 1.52 cm to the nasal surface. that maneuver will allow an adequate contact between the soft palate and the nasopharynx (mukherji, 1969). it is possible to completely close even the widest clefts with this technique without the need of further procedures. because of the extensive release of the nasal and oral layers from the palatal shelves, insertion of the buccal flap and mattress sutures that include the nasal, oral, and levator muscles, the repaired palate is anatomically correct and stable. freedlander and jackson (1989) studied the reliability of the buccal flap over time. they showed by endoscopic examination that the buccal flap remained viable and kept its initial dimensions, lengthening the nasal layer. they hypothesized that the flap would prevent reattachment of the reconstructed levator muscle in its preoperative position because of its in terposition between the hard palate and the velar muscles (kaplan, 1975 ; freedlander and jackson, 1989). the buccal mucosa is available in an adequate amount, and there is no significant danger of airway obstruction or hemorrhage. none of the complications described in the literature, such as swelling of the face, impossibility of hard palate donor site closure, infection, or stenosis of the parotid duct (kaplan, 1975 ; maeda., 1987 ; freedlander and jackson, 1989) were observed in our series. in our experience, the primary palatoplasty with the buccal myomucosal flap has been an extremely safe and easy operation. occasionally, on the advice of an orthodontist, the buccal flap pedicle had to be divided at the time of eruption of the third molar. it is important to differentiate the use of the buccal mucosal flap from other flaps used to lengthen the palate, such as the millard island flap (millard, 1963) and the edgerton technique for palate elongation (edgerton, 1962). the millard island flap consisted of the division of the nasal mucosa and placement of a palatal mucosa island flap based on the great palatine vessels. it is still difficult to determine how much these have really improved speech because of the variety of methods used to analyze speech and different interpretations by the evaluators. the presence of a speech - language pathologist has been extremely important in the evaluation and improvement of the speech quality. there is a common belief that this can enhance the speech outcome and prevent the development of compensatory articulation patterns that are difficult to correct the longer they are left untreated. the optimal age for palatal repair has been the subject of a number of studies (cosman and falk, 1980 ; dorf and curtin, 1982 ; freedlander and jackson, 1989 ; ysunza., 1997 ; marrinan., the palate needs be closed prior to the onset of the phonemic development to minimize abnormal speech patterns (dorf and curtin, 1982). the dilemma about early repair has been how to obtain an early communicative adequacy without sacrificing orofacial growth components. the buccal myomucosal flap is a dependable local sensate flap with a well - defined neurovascular pedicle that can be used in a variety of intraoral reconstruction obviating the need for distal tissue harvest. secondary palate repair with the buccal myomucosal flap has been an effective technique in terms of speech outcome, vpi, and fistula occurrence. it allows palatal closure without tension ; good levator muscular sling reconstruction and retropositioning ; lengthening of the nasal layer ; and the absence of raw areas, which may compromise facial growth. the technique, the early repair, and the surgeon 's experience are the most important variables for the good outcome that has been achieved. | background : the purpose of this review was to assess the effectiveness of the buccal myomucosal flap in secondary repairs of cleft palate in 20 patients.patients and methods : totally, 20 patients, who underwent secondary palatoplasty between 5 years and 8 years in which a buccal myomucosal flap was used, were reviewed retrospectively. all patients had undergone at least one previous attempted repair at other institutions. indications for the secondary repair included velopharyngeal incompetence and/or oronasal fistula. patients were evaluated preoperatively for oronasal fistula status, velopharyngeal competence, nasal resonance, speech quality, and nasal escape.results:the buccal myomucosal flap was used in all 20 patients, and there was marked increase in the quality of speech as well as nasal regurgitation decreased. in patients with levator dysfunction due to poor primary surgery and glottal speech the results were inconclusiveconclusion : palate re - repair combined with a buccal myomucosal flap, occasionally in conjunction with other techniques, is an effective method for correcting failed cleft palate repairs. minimum donor site morbidity and complication makes the buccal flap a useful armamentarium of a cleft surgeon. |
human, rat, and guinea pig packed erythrocytes exposed to 100, 500, or 1000 ppm of methyl isocyanate (mic) vapor in vitro showed a concentration - related inhibition of cholinesterase (che) activity. rat and guinea pig packed erythrocytes showed an almost complete inhibition of che activity at 2000 ppm. in vitro exposures of human and guinea pig blood to 1000 or 2000 ppm of mic vapor resulted in qualitative alterations in the electrophoretic mobility of hemoglobin (hb) as measured by citrated agar electrophoresis. in rats and guinea pigs, neither iv injection of liquid mic nor in vivo exposure to 1000 ppm of mic by inhalation resulted in any inhibition of erythrocyte che activity or alteration in hb electrophoretic mobility. as a result of these observations, it was concluded that neither che inhibition nor structural alteration of hb were major contributing factors to death resulting from mic exposure. rats and guinea pigs receiving iv injections of liquid mic showed an increase in creatine kinase (ck) levels. this increase could not be attributed to a specific isoenzyme of ck by ion exchange chromatography. rats exposed to 100, 600, or 1000 ppm of mic and guinea pigs exposed to 25, 125, or 225 ppm of mic and bled immediately following a 15-min exposure or at 1, 2, 4, or 16 hr postexposure had the following alterations in blood parameters : an increase in ck, increases in hemoglobin concentration and hematocrit, reticulocytosis (rats only), neutrophilia, a decrease in blood ph and po2, and an increase in blood pco2.(abstract truncated at 250 words)imagesfigure 6. |
|
health financing has been considered by all health system stakeholders in vietnam as an important building block of a health system and has a key role in promoting universal health coverage in the country. like other developing countries, vietnam is now using both public financial sources (state budget, social health insurance fund and international aids) and private contributions (direct out - of - pocket payments by households and other private health expenditure) to finance health care service provision. since doi moi (renovation) in 1986, central among these were the introduction of user fees and legalization of private medical practices in 1989, the initiation of health insurance schemes at the national level in 1992 and the take - over by the central government of the responsibility for paying salaries to the public health staff at the commune level in 1994. to support health care for disadvantaged populations in vietnam, the government has launched decision 139/2002/qd - ttg on health care financing for the poor and decree 36/2005/nd - cp on free health services for children under 6 yr of age. in 2006, the government issued decree 43/2006/nd - cp on financial autonomy, ownership, and accountability of public administrative organizations. the law on health insurance was passed in 2009 which stipulates that all children under 6 yr of age, the elderly, the poor and the near - poor would be compulsorily enrolled. under the law, the government is responsible for fully subsidizing the health insurance premiums for children under six, the elderly, the poor and ethnic minorities, and for partially subsidizing premiums for the near - poor and students. the law also provides a roadmap for enrolling all other groups in the population. in 2012 85/2012/nd - cp on the operational and financial mechanism and medical service prices for application in state health service facilities. 5380/qd - byt approving the project to pilot capitation payments for medical services paid by health insurance, etc. as a number of health financing reforms are well underway in vietnam, it is crucial for health policy makers to understand the achievement and challenges of the interventions they have introduced so that they can make timely and appropriate decisions on needed changes or adjustments. as an attempt of providing evidence for health policy making process, built from previous studies on vietnam 's health financing situation (123), this paper aims to describe the pattern of health care expenditures and financial protections over the period 1992 - 2012 in vietnam. data reported in this paper were obtained from 2 main data sources, including 1) national health account ; and 2) vietnam living standard survey. in addition, we extracted data from other relevant published literature, reports and statistics about health care expenditure in vietnam. the sources of online data included international and national journal articles and studies from multiple electronic bibliographic databases. the key search terms were " universal health coverage ", " health financing ", " health insurance ", " health payment ", " health expenditure ", and " health expenses ". the research team members also conducted manual searches to collate government documents, reports, publications related to health financing in vietnam. the total health expenditure in vietnam has increased over the period 1995 - 2012. in nominal term, the per capita health expenditure at exchange rate in vietnam increased from us$ 14 in 1995 to us$ 86 in 2012 (the increase of 6 times). the total health expenditure as a share of gdp also rose from 5.2% in 1995 to 6.9% in 2012 (table 1). the public funding for health in vietnam had also increased (from 33.9% in 1995 to 42.6% in 2012). public health expenditure as percentage of government expenditure rose from 7.4% in 1995 to nearly 10% in 2012 (table 2). coverage of health insurance as measured by enrollment rates has also increased significantly over years. the coverage went up from 10% in 1995 to 68.5% in 2012. as a result, health expenditure from social security funds as percentage of government expenditure increased from 7% in 1995 to 36% in 2010 (table 3). 1 shows the private health expenditure as share of total health expenditure during 1995 - 2012. the figure indicates that health financing in vietnam was heavily depending on private expenditures (57.4% in 2012), especially the household out - of - pocket health payments (48.8% in 2012). as a result table 4 shows that the proportion of households with catastrophic expenditure in 2012 was 4.2%. health financing system is one of six health system building blocks that constitute a health system. the health financing system clearly affects almost all the goals of the health care and plays a central role in improving equity, risk protection and efficiency (4). the level of total health expenditure as a share of gdp of 6.9% in vietnam is higher than that of other countries of similar or higher income in the region such as laos, cambodia, the philippines, thailand, indonesia, and china (5). who 's health financing strategy for the asia pacific region 2010 - 2015 emphasized the importance to monitor progress towards universal health coverage through health financing indicators such as total health expenditure as a share of gdp (5). in vietnam, state budget plays a critical role in protecting public health and ensuring equity in health care. the level of state budget for health as percentage of total state budget in vietnam has nearly doubled since 2005 (5). the increase in the state budget for health care can lead to better funding for health care for among the poor, the children under 6 yr, implementation of national health target programs, epidemic control, and district health system upgrades. the growth in state budget for health can be explained in part by the increases in the allocation norms for financial support to the poor in accordance with prime ministerial decision no.139/2002/qd - ttg and changes in the mechanism to use this funding through purchase of compulsory health insurance for the poor under decree no.63/2005/nd - cp. in addition to the finance sourced from government budget, the health sector also received finance that was sourced from the government bonds for investing in premises of the health facilities at the grassroots level and provincial general hospitals (6). social health insurance (shi) is the key mechanism for achieving universal health coverage in vietnam. the law on health insurance is an important step on the path to universal health coverage because it integrated the existing health insurance program with the program for the poor, thus bringing together all groups into one program. the recent expansion of coverage of health insurance has been financed largely through tax subsidies to cover insurance premiums for the poor, near - poor and other vulnerable groups. as shi expanded rapidly during 2006 - 2010, government health spending increased at a faster rate than economic growth from 2006 to 2010. meanwhile, contributions from employers, employees, and individuals have declined as a share of total revenues. vietnam, like other countries in the region, has recognized that expanding coverage based on contributory mechanisms alone is not feasible in a context where a large share of the population is still poor, in the informal sector, or both (7). even though the number of people with health insurance in vietnam has increased sharply (43.7% in 2008) the contribution of the health insurance fund as a portion of total health expenditure was only 17.6% in 2008 (8). policies to expand coverage of health insurance in vietnam and, more importantly, to enhance impacts on financial protection should be emphasized. in addition to the task of increasing 3 dimensions of insurance coverage (breath, depth, and height), vietnam 's health insurance program faces a further challenge regarding the financial sustainability of the scheme. since 2003, outlays have risen faster than revenues in both the compulsory and voluntary programs (9). by 2007, overall health outlays exceeded its revenues (1). even though health spending in vietnam is not low, the structure was not yet optimal (e.g. public spending on health share of total health spending including state budget, health insurance and external grants are always lower than private spending (oop and other private spending) on health share of total health spending). over the years, private spending on health with majority of oop always stood at more than 50% as a share of total health spending and with the current health financing mechanism (oop spending higher than the suggested level by who), financial risk was quite obvious to the patients and their families when using healthcare services. high oop payment easily leads to catastrophic health expenditure and becomes impoverished due to health expenditure in vietnam. household direct oop payment is an important indicator for assessing equity in a health system in general and in a health financing system in particular. according to the who, the level of oop as a share of the total health expenditure greater than 40% can result in inequity in health care in a variety of ways (5). the share of private health expenditure (mainly from the oop) in vietnam was higher than that of other countries in the asia pacific region such as thailand, laos, cambodia, china, etc. our study revealed that many households in vietnam incurred catastrophic level of health expenditure and/or were pushed into poverty (impoverishment) because of health care payments. the prevalence of the catastrophic health expenditure and impoverishment of vietnam were lower than the corresponding figures for china in 2008 (catastrophic health expenditure : 14% ; impoverishment : 6.8%) but higher than that for cambodia in 2007, for laos in 2008 and for the philippines in 2009 (2). (3) showed that the proportion of households facing catastrophic payments from out - of - pocket health expenses in vietnam in 1998 was 10.5%, which was the highest level among 59 countries included in the study. another study by van doorslaer., using various cut - off points to define catastrophic levels, confirmed the fact that the rates of catastrophic payments in vietnam were very high compared to other countries in asia (1011). the oop is still high partly because fee - for - service mechanism is the most common provider payment method in vietnam. the ministry of health and ministry of finance jointly set the medical service fee schedule, with maximum fees that are applied to services in the public sector. the fee schedule covers services such as hospital examination and inpatient stays, laboratory and diagnostic imaging services, and surgeries or procedures. fees are paid either by patients as out - of - pocket payments, or by the insurance scheme through provider reimbursement. fees do not yet cover all cost components, and public facilities continue to receive state budget subsidies. in addition, medical technologies become more and more high - tech that lead to increase the cost of care, etc. as a short review, this paper just provides a snapshot of pattern of health expenditure and financial protection in vietnam over the last two decades. further research works based on more detailed and sophisticated analyses are needed to give more insights into health financing situation in vietnam. vietnam has made marked improvements via health financing reform over the past few decades and that has helped in improving the coverage of health care in the country. these achievements have been reflected in total national health expenditure ; total national health expenditure as % of gdp ; state budget for health as percentage of total state budget ; the coverage of health insurance and other health financing related indicators. however, there are still several equity - related issues in health financing system in vietnam that need to be addressed in the coming time : dependence on private expenditures, especially out - of - pocket household payment. to ensure equity and efficient goal of health system, policy actions for containing the health care out - of - pocket payments and their poverty impacts are urgently needed in vietnam. | health financing has been considered as an important building block of a health system and has a key role in promoting universal health coverage in the vietnam. this paper aims to describe the pattern of health expenditure, including total health expenditure and composition of health expenditure, over the last two decades in vietnam. the paper mainly uses the data from vietnam national health account and vietnam living standards survey. we also included data from other relevant published literature, reports and statistics about health care expenditure in vietnam. the per capita health expenditure in vietnam increased from us$ 14 in 1995 to us$ 86 in 2012. the total health expenditure as a share of gdp also rose from 5.2% in 1995 to 6.9% in 2012. public health expenditure as percentage of government expenditure rose from 7.4% in 1995 to nearly 10% in 2012. the coverage of health insurance went up from 10% in 1995 to 68.5% in 2012. however, health financing in vietnam was depending on private expenditures (57.4% in 2012). as a result, the proportion of households with catastrophic expenditure in 2012 was 4.2%. the rate of impoverishment in 2012 was 2.5%. to ensure equity and efficient goal of health system, policy actions for containing the health care out - of - pocket payments and their poverty impacts are urgently needed in vietnam. |
although the indications for cholecystectomy in the presence of polypoid lesions in adults have been established, they remain to be clearly defined in children because of the limited experience. we report an unusual case of a polypoid lesion of the gallbladder in an adolescent boy, which was successfully treated by laparoscopic cholecystectomy. a 14-year - old male presented with a four - month history of recurrent right upper quadrant abdominal pain. the initial episode, which began suddenly and persisted for three days, had been severe enough to warrant admission to the hospital. after his discharge from the hospital, the pain recurred once a week, and sometimes lasted for several days. physical examination at our institution (westchester county medical center) revealed inconsistent right upper quadrant tenderness with an occasional positive murphy 's sign. all laboratory results were normal, including complete blood cell count, liver function tests and serum amylase. initial ultrasound of the gallbladder done at a community hospital had revealed the presence of multiple small gallstones. a repeat ultrasound examination demonstrated a 3 mm polypoid lesion in the body of the gallbladder, close to hartmann 's pouch (figure 1). computerized tomography of the abdomen was normal, and failed to demonstrate the polypoid lesion in the gallbladder. histological examination revealed a benign 2 mm adenomatous polyp in the body of the gallbladder, close to the hartmann 's pouch (figure 2). after cholecystectomy the patient 's symptoms completely disappeared. he has remained well and pain - free after two years of follow - up. polypoid lesions of the gallbladder have been the subject of controversy in the medical literature. the most accepted classification was proposed by christensen and ishak, who classify the lesions as benign tumors, pseudotumors, and malignant neoplasms. over 90% of the polyps adenomas of the gallbladder account for only 1% of all lesions, but they are important because of their potential transformation to invasive carcinoma. it is characterized by late diagnosis and extremely poor prognosis with five - year survival of less than 5%. the importance of early diagnosis is paramount in these cases, since the only survivors have been reported following early cholecystectomy. polypoid lesions are mainly composed of heterotopic tissues, the most common one being ectopic gastric mucosa, followed by ectopic pancreatic and thyroid tissue. in our search of the literature we did not find any reports of adenomas of the gallbladder in children. for diagnostic purposes, ultrasound seems to have the best sensitivity and specificity. computerized tomography with oral cholecystographic enhancement has been reported to be successful in equivocal cases. in the present case computerized tomography failed to demonstrate the polyp. in the adult population, accepted indications for cholecystectomy in the presence of polypoid lesions of the gallbladder include polyps over 10 mm in diameter, patient age over 50 years, sessile polyps, associated gallstones, possibility of malignancy and the presence of symptoms regardless of the size of the polyp. the experience with polypoid lesions of the gallbladder in children however, because the presence of these lesions in the gallbladder of children has been associated with acalculous cholecystitis and because the long - term effects of their presence in the gallbladder are unknown, we currently recommend cholecystectomy in all children with such lesions. laparoscopic cholecystectomy, which is now well accepted as a safe procedure in the pediatric population, even in small children, should be the procedure of choice unless there are specific contraindications for its use. | polypoid lesions of the gallbladder in children are rare. we report a case of a gallbladder polyp in a 14-year - old boy who presented with recurrent right upper quadrant abdominal pain. ultrasound examination of the abdomen revealed a polypoid lesion of the gallbladder. his symptoms resolved after laparoscopic cholecystectomy. histological examination of the gallbladder demonstrated a benign adenomatous polyp. although the experience with polypoid lesions of the gallbladder in children is limited, we currently recommend cholecystectomy because these lesions are associated with acalculous cholecystitis, and because their long - term effects are unknown. |
cigarette smoking is a leading cause of preventable mortality. each day, at least 3800 adolescents in the usa try their first cigarette and 33% of teenagers that are daily smokers will die of a smoking - related condition. tobacco dependence is also the single most prevalent substance abuse disorder. in 2000, 18.1% of total deaths in the usa were attributed to tobacco use, making it one of the leading causes of death, followed by poor diet and physical inactivity, which together are responsible for 15.2% of totals deaths, and 3% of total deaths were alcohol - related. some countries, such as england, have a decreasing tobacco - use trend, but even there, 27% of males and 24% of females reported smoking more than 20 cigarettes (1 pack) a day. smoking is a risk factor for many health - related diseases, including cardiovascular disease, and it also affects brain function. it is a well - recognized risk factor for alzheimer disease (ad) ; research found that smokers are twice as likely to develop ad compared to those who never smoked. adverse effects of smoking on cognition are also known, including a decrease in visual search speed. smoking is related to preclinical changes in the brain, higher risk of cognitive decline, and increased risk of dementia [810 ]. even after the cessation of smoking, certain problems remain, such as impaired working memory. these problems are probably caused by the toxins inhaled in tobacco smoke, including vinyl chloride (a risk factor for brain cancer), hydrogen cyanide, and arsenic. long - term, daily exposure to these toxins may result in altered vascular and neural processes, which probably result from tissue accumulation and/or assault. additionally, these changes express themselves by changes in grey matter (gm) and white matter (wm) volume and brain density. although gmv decreases linearly with age, global white matter does not decline with age ; however, local areas of relatively accelerated loss and preservation occur. as the world population ages, it is important to determine which brain changes are attributable to normal / healthy aging and which are caused by preventable behaviors such as smoking. a growing number of studies using the voxel - based morphometry technique have compared smokers to non - smokers in terms of the volume of white and grey matter [1519 ]. (2012) reported no differences in wm volume between smokers and non - smokers, whereas yu, zhao, and lu (2011) reported a regional wm volume increase. as with gmv, some studies reported smokers have smaller gmv in the dorsolateral prefrontal cortex (dlpfc), while others found a smaller volume in the anterior cingulated cortex (acc) and thalamus. a recent meta - regression analysis showed that a higher number of smoking years was correlated with more gm atrophy in the right superior frontal gyrus, and more cigarettes smoked per day was correlated with more gm atrophy in the right superior frontal gyrus and acc, extending to the paracingulate gyrus. the following databases were searched in march / april 2015 : medline, embase, and psycinfo. the following string search was used : grey matter and voxel - based and smoking and cigarette. records were obtained when grey matter was found in the title of the article and the remaining terms were found in the abstract or in the title. male and female sample. studies that measured differences in grey matter. studies comparing smokers with non - smokers. studies that used voxel - based morphometry. articles that did not have full text or that could not be retrieved through our university libraries. we evaluated the quality of included articles by use of a modified version of the effective public health practice project (ephpp) quality assessment tool for quantitative studies. it is important to note that only 1 study was conducted in europe and the remaining ones were in the usa. all studies used cross - sectional design and only 1 study was not conducted in 2014. there were large differences in the sample sizes : brody (2004) only included 36 participants, whereas fritz (2014) had 974. none of the studies used power calculation ; therefore, the results need to be interpreted with caution. additionally, all of studies compared smokers to non - smokers, with some adding further groups for comparison. for example, franklin (2014) compared across sexes and hanlon (2014) compared the differences between young and long - term smokers. three of the studies had approximately the same number of smokers as non - smokers, but fritz (2014) had significantly more non - smokers and significant differences in demographics of the studied population. all 4 studies used voxel - based morphometry (vbm), which is a neuro - imaging analysis technique that investigates focal differences in brain anatomy [1719,24 ]. brody (2004) also included hand - drawn regions of interest (roi), which allows extraction of data for a specific structure. all images were produced by a tesla siemens scanner, and all studies used statistical parametric mapping (spm), which increases the validity of conclusions because the same methodology is applied in each study and the results can not be attributed to the technology or methodology used. studies by fritz (2014), franklin (2014), and hanlon (2014) were scored as strong quality with moderate quality in terms of representativeness of the sample. brody (2004) was graded as moderate quality after scoring weak quality in the population component of the questionnaire. importantly, 3 studies reported significant (p<0.001) differences between smokers and non - smokers in gmv, and fritz (2014) also found a significance difference (p<0.05). all studies corrected for family - wise error [1719,24 ]. decreased gmv in smokers compared to non - smokers was reported, but franklin (2014) and hanlon (2014) also noted increased gmv in some brain areas (table 4). overall, it is clear that smoking causes decreased gmv, but variations in the specific region affected were found as well. all 4 studies found decreased gmv in the ventrolateral prefrontal cortex of smokers [1719,24 ], as well as loss of gmv in the dorsal - lateral prefrontal cortex. two studies found gm loss in the cerebellum of smokers. the only study to find differences in gmv in the olfactory gyrus was by fritz (2014). hanlon (2014) found a decrease in gmv in the amygdala region in smokers. a decrease of thalamic gmv in smokers was found by franklin (2014) and hanlon (2014), who also reported differences in the parahippocampal gyrus region. interestingly, hanlon (2014) also found decreased gmv in smokers, whereas franklin (2014) found greater gmv in the parahippocampus in smokers. although contradictory results in specific areas were found, these may be attributed to the differences in samples studied. future studies should consider differences between sexes and age groups as well as between smokers and non - smokers. two studies compared female and male smokers to non - smokers and found certain sex - specific differences. one found a decrease in smokers in both sexes in the ventromedial prefrontal cortex, while the other found reduced gmv in the thalamus and cerebellum in smokers of both sexes. fritz (2014) found gmv loss in the olfactory gyrus in male smokers, and did not find any area of increased gmv, which is a unique finding. franklin (2014), on the other hand, found increased gmv in the bilateral hippocampus and the left putamen in male smokers. hanlon (2014) reported decreased gmv in younger smokers compared with a matched control group of non - smokers. compared with a matched control group of non - smokers, long - term smokers had changes in the amygdala (t=6.03, cluster size=601, p=0.002) and left thalamus (t=5.75, cluster size=234, p<0.000). decreased gmv in the amygdala was not reported by other investigators. decreased gmv was found in long - term smokers in the insula, parahippocampus, and thalamus. interestingly, when they compared long - term smokers with their non - smoking matched control group, they found decreased gmv in the same areas : the insula and parahippocampus. in this group comparison, they also found that smokers had decreased gmv in the left occipital cortex. these results suggest either that nicotine rapidly affects brain regions or that there may be pre - existing abnormalities that lead to nicotine dependence in younger individuals. lastly, we explored a possible correlation between gmv and age of onset of smoking, cigarettes per day, the length of time smoking, and the pack - years smoked. hanlon (2014) reported a negative correlation in long - term smokers between number of pack - years and gmv in the medial prefrontal cortex. brody (2004) reported similar correlations between gmv in the prefrontal cortex and pack - years. fritz (2014) found that small clusters of reduced gmv in the middle occipital gyrus and anterior and middle cingulate cortex were correlated with number of pack - years (r=0.192, t=3, 45, p<.001). lastly, franklin (2014) reported a positive correlation between gmv in the left putamen and number of pack - years in males (r=.38, p=.018). overall, these studies reported similar results and all found lower gmv in certain brain areas in smokers compared to non - smokers. two studies also found brain areas where the gmv was actually higher in smokers than in non - smokers. lastly, 2 studies reported a negative correlation between pack - years and gmv. only 1 study found a positive correlation between number of pack - years and gmv. these studies found that smokers have lower gmv in multiple cortical and sub - cortical regions compared with non - smokers. regard, nicotine and cue - induced prefrontal activation might partially explain the atrophies observed via repeated stimulation during smoking, and this is thought to be associated with lower gmv. a decrease in gmv in the dlpfc may be associated with cognitive deficits in smokers. in the abstinent state, smokers are not able to compensate higher task loads. the prefrontal cortex also has a role in emotional processing (e.g., regulation). personality - wise, smokers with lower gmv in the pfc are more likely to be impulsive and neurotic than their non - smoking counterparts. the mpfc and vpfc are associated with reward and development, as well as maintenance of addiction. the insula also plays a role in dysfunction of emotional regulation, as well as a general role in nicotine addiction and craving. mofc is correlated with inhibition of behavior ; this effect is enhanced in females, explaining why they find it harder to stop smoking. importantly, 2 studies found lower gmv in the thalamus, which has the highest density of nicotine receptors of any brain region and is the prime target in long - term smoking. cigarette smoking also correlates with increased nicotine binding in the thalamus. however, controversy exists in that fritz (2014) and brody (2004) did not report any areas of decreased gmv in the thalamus, suggesting a role of functional abnormalities in signalling. the thalamus is associated with memory, attention, and planning, explaining why smokers tend to have worse results on cognitive tasks, including memory. the severity of compulsivity was also positively correlated with increased gmv in the putamen. in 1 study, this increase was only found in males. there were also differences found in the hippocampus and amygdala ; these areas also are linked with emotional and drug memories. however, hanlon (2014) found differences in the amygdala only when comparing young smokers with non - smokers. interestingly, this difference was lost in long - term smokers. despite these inconsistencies, although all 4 studies used the same technique, certain differences may have arisen because the technique was not used at the same place and time. also, all 4 studies were cross - sectional, so we can not know if there were any pre - existing structural differences in the brains of subjects. in younger smokers, nicotine either affects neural tissue volume very quickly or there are pre - existing abnormalities that predispose some individuals to smoking. lastly, smoking is highly prevalent in people with psychiatric disorders, and smoking can be a strong confounder in brain studies of these patients. overall, smoking causes differences in gmv in various brain areas, and these differences help explain the cognitive impairment and emotional dysregulation in smokers compared with non - smokers. there are considerable differences, not only between males and females, but also between younger and older smokers, and any therapeutic treatment must take this into account. to summarize, smoking decreases gmv in most brain areas, and this decrease is believed to be responsible for the cognitive impairment and difficulties with emotional regulation in smokers. future studies should separate physical changes of the brain from those associated with cognition, which would be useful in determining a therapeutic strategy for treating the associated pathologies of tobacco smoking. importantly, it can not be ignored that tobacco smoking may be a self - medicating phenomenon, which seeks to relieve a pre - existing pathology ; therefore, an individualized approach to treatment is advised. | although cigarette smoking is a leading cause of preventable mortality, tobacco is consumed by approximately 22% of the adult population worldwide. smoking is also a risk factor for cardiovascular disease, affects brain processing, and is a recognized risk factor for alzheimer disease (ad). tobacco toxins (e.g., nicotine at high levels) inhaled in smoke may cause disorders resulting in preclinical brain changes. researchers suggest that there are differences in brain volume between smokers and non - smokers. this review examines these differences in brain grey matter volume (gmv).in march / april 2015, medline, embase, and psycinfo were searched using the terms : grey matter and voxel - based and smoking and cigarette.the 4 studies analyzed found brain gmv decreases in smokers compared to non - smokers. furthermore, sex - specific differences were found ; while the thalamus and cerebellum were affected in both sexes, decreased gmv in the olfactory gyrus was found only in male smokers. age - group differences were also found, and these may suggest pre - existing abnormalities that lead to nicotine dependence in younger individuals. only 1 study found a positive correlation between number of pack - years smoked and gmv.smoking decreases gmv in most brain areas. this decrease may be responsible for the cognitive impairment and difficulties with emotional regulation found in smokers compared with non - smokers. |
the american cancer society estimates that in 2010, 207,090 women were diagnosed with invasive breast cancer, and approximately 40,000 women died from the disease in the united states alone. despite the advances in treatment, earlier detection through screening, and increased awareness, randomized trials and large meta - analyses clearly indicate that all breast cancer patients derive a statistically significant survival benefit from endocrine therapy and chemotherapy, with the antiestrogen (ae) tamoxifen (tam) being among the most effective single agents. this survival benefit reflects the ability of these agents to drive cells down an irreversible cell death pathway. yet, advanced er+ breast cancer remains an incurable disease, and improvements in overall survival rates for these women have been relatively modest during this timeframe. endocrine therapy is generally administered as an antiestrogen, such as tam or fulvestrant (fas ; faslodex ; ici 182,780), or as an aromatase inhibitor (ai) including letrozole or exemestane. tam is the most frequently used ae and significantly reduces the risk of recurrence and death in patients with er+ disease. five years of tam is a standard treatment for both premenopausal and postmenopausal women with er+ breast cancer. mechanistically, tam is a selective estrogen receptor modulator (serm) that competes with the endogenous er substrate (17-estradiol) for binding to the receptor protein. tam induces a conformational change in the receptor that, in turn, represses er transcriptional activity. while tam has been the treatment of choice for over three decades, third - generation ais have demonstrated a greater disease - free benefit than tam and are often now the first line endocrine therapy of choice for postmenopausal women with er+ breast cancer. newer antiestrogens, such as the selective estrogen receptor down regulator fulvestrant, do not exhibit the partial agonist activities of serms and are effective treatment options after relapse on tam. fas has been shown to be as effective as the ai anastrozole in postmenopausal women with advanced breast cancer resistant to tam. despite ais and aes being key modalities in the treatment of er+ breast cancers, the inability of these therapies to cure all women with er+ disease remains a major challenge to the clinical and research communities. in the case of tam, de novo (intrinsic) or acquired resistance limits the efficacy of treatment in many patients with er+ disease. moreover, some tumors may become resistant to endocrine therapies despite the continued presence of er ; a small proportion may also become er - negative (er). consequently, we fail to predict responsiveness to endocrine therapy in 66% of er+/progesterone receptor (pgr) negative, 55% of er/pgr+, and 25% of er+/pgr+ tumors. most tam - resistant tumors retain detectable levels of er expression, and many of these will respond to second or third line hormonal therapies. for patients with advanced breast cancer, currently, fas is the only fda approved drug to treat advanced breast cancer in postmenopausal women who previously progressed on other antiestrogens. however, a significant number of patients will also develop resistance to fas. the inability to fully modify these negative outcomes reflects an incomplete understanding of the signaling events effecting cell proliferation, survival, and hormonal regulation. estrogen independence and ae resistance are complex phenotypes, and it is unlikely that a single gene / signaling pathway drives endocrine resistance in er+ tumors. drug resistance arises from a cell 's inability to induce signaling down an irreversible cell death pathway. therefore, understanding the key signaling aspects of resistance and how they are balanced, ultimately leading to cell death / survival, is an important research goal. several genes associated with survival despite antiestrogen treatment have been identified from gene expression microarrays between antiestrogen - responsive (mcf7/lcc1) and resistant variants (mcf7/lcc9) of the mcf7 human breast cancer cell line. one transcription factor that is vital in the cell death / survival regulatory network is interferon regulatory factor-1 (irf1), which is downregulated in the resistant cell line. these data and others suggest that the downregulation of irf1 protects breast cancer cells from irf1-induced inhibition of cell proliferation and/or induction of apoptosis [16, 17 ]. in the present review paper, we summarize the role of irf1 in endocrine responsiveness and how irf1 affects the molecular signaling that regulates cell fate. by understanding the contribution of irf1 to cellular growth and tumor suppression, we will further our knowledge on the signaling pathways of malignant diseases, which could lead to the development of novel and more effective therapeutic strategies for er+ breast cancers. irf1 was initially characterized for its role in the transcriptional activation of type i interferon (ifn) genes. during a study on the regulation of the ifn- gene by a virus, a factor that was called irf1 ten splice variants of irf1 have been identified and are labeled as splice patterns 110. irf1 is now recognized as an essential player in many facets of the immune response and oncogenesis. since the discovery of irf1 in 1988, there are now nine known irf family members in humans and mice : irf1, irf2, irf3, irf4 (also known as pip, lsirf, or icsat), irf5, irf6, irf7, irf8 (icsbp), and irf9 (isgf3). each irf contains a well - conserved n - terminal dna - binding domain (dbd) of approximately 120 amino acids and five conserved tryptophan repeats. the irf dbd has a helix - turn - helix architecture that recognizes a specific dna sequence corresponding to the ifn - stimulated response element (isre ; g(a)aaag / ct / cgaaag / ct / c). a single point mutation (p325a) in the c - terminal region of irf1 (multifunctional-1 ; mf1 ; residues 301325) increases both irf1 's ability to regulate its own transcription and rate of degradation. we have also reported a novel single nucleotide polymorphism in the irf1 gene (a4396 g). irf1-a4396 g is more frequent in human breast cancer cell lines than in the general population and is more frequently expressed in african american than caucasian women. subsequent to the identification of irf1, a structurally similar molecule, irf2, was isolated by its ability to cross - hybridize with the irf1 cdna (figure 1). the two factors show 62% homology in their n - terminal regions (spanning the first 154 residues), whereas the rest of the family members exhibit only 25% similarity. while irf1 is characterized by an abundance of acidic amino acids and serine - threonine residues in its carboxy - terminal region (transcriptional activation domain), irf2 is relatively rich in basic residues. when activated by ifn signaling, both irf1 and irf2 bind to the same dna element, known as irf - e, which is almost identical to the isre. despite their similar dbds, irf1 mrna is dramatically upregulated upon viral infection or ifn stimulation. a high level of irf1, in turn, results in the induction of endogenous ifn- and ifn- in a variety of cell types, while irf2 represses irf1 transcriptional activation. the irf1 protein is also very unstable (half life 30 min) compared with irf2 (half - life 8 hrs). these findings suggest respective functional activator and repressor roles for irf1 and irf2 for the regulation of the ifn-/ genes. further studies demonstrated markedly diverse roles for irf family members including how they contribute to the regulation of key functions in the development of immune cells and in the control of oncogenesis. irf1 is expressed at low levels in unstimulated cells and is activated by many cytokines including type i (ifn, ifn, and others) and ii (ifn) interferons, tumor necrosis factor- (tnf-), retinoic acid, interleukin-1 (il-1), il-6, and viral infection. initial signaling is mediated through the janus - activated kinase - signal transducer and activator of transcription (jak / stat1) pathway, leading to the activation of the irf1 promoter by the stat and nf-b transcription factors [20, 27 ]. when a signal is transduced through the ifn receptor, phosphorylated stat1 translocates to the nucleus where it induces the transcription of primary ifn response genes. as irf1 is a short - lived protein, rapid changes in steady - state levels occur in response to stimuli such as dna damage or viral infection [26, 29 ]. the precise mechanism that regulates irf1 stability is unknown, but irf1 is polyubiquitinated by the e3 ubiquitin ligase and then degraded by the 26s proteasome. in unstressed cells, irf1 is chaperoned by the e3 ligase and the c - terminus of heat - shock cognate (hsc70)-interacting protein (chip). in stressed cells, a complex forms between chip and irf1, leading to an increase in ubiquitination of irf1 and a decrease in its steady - state levels. additionally, the c - terminal region of irf1 (mf1) was identified as the regulatory domain that modulates target gene expression and determines the rate of irf1 protein degradation. without this enhancer region, irf1 is also serine phosphorylated by casein kinase ii (ckii), protein kinase a (pka), and protein kinase c (pkc) at two clustered regions (between amino acids 138150 and 219231), which may also have an effect on irf1 regulation. irf1 recruitment of heat - shock protein (hsp70) to the mf1 domain leads to the further recruitment of hsp90, which results in an increase in endogenous irf1 protein. irf1 is a member of a class of proteins considered to be unstructured, which allows it to interact with multiple proteins. in addition to nucleophosmin (npm1), which can inhibit irf1 function, the interaction between irf1 repressors, yb-1 (y - box protein) and trim28 (tripartite motif - containing 28), which are both overexpressed in various cancer types, has also been reported. the presence of multiple irf1 regulating proteins and its short protein half life suggest the presence of several redundant regulatory interactions, often the mark of a central functional activity for the control of critical cellular functions. perhaps this is not surprising, given irf1 's ability to affect cell fate decisions. irf1 has remarkable functional diversity and controls the transcription of genes involved in mediating antiviral, immunomodulatory, and antiproliferative effects. events downstream of irf1 activation include changes in major histocompatibility complex (mhc) class i and interferon expression, inducible nitric oxide synthase (inos) expression, the development of cd8 t cells, induction of il-12 and t helper differentiation, and natural killer (nk) development. in addition to having critical functions in the development and activation of immune cells, irf1 is also involved in cell cycle regulation and apoptosis in response to a variety of stressors. for instance, irf1 coordinates expression of the immunoproteasome, regulates human telomerase activity [38, 39 ], and controls vital aspects of dna damage repair [40, 41 ]. irf1 can regulate signaling that leads to the induction of apoptosis, which it can achieve with or without the induction of the cell cycle inhibitors, p21 or p27, and through the activation of caspases (casp)-1, casp-3, casp-7 [45, 46 ], casp-8 [44, 46 ], and/or fas ligand. irf1 also induces apoptosis in a p53-dependent or - independent manner [40, 42 ]. for example, p53 is frequently mutated in many cancers including 30% of breast cancers, but this loss of p53 function does not necessarily abrogate irf1 's capacity to regulate cell fate decisions. a critical facet of irf1 's function in host defense is the regulation of oncogenesis. the first studies to highlight irf1 's role in tumor suppression and cell cycle control were established using irf1 / mouse embryonic fibroblasts (mefs). irf1 / mefs are deficient in their ability to undergo dna - damage cell cycle arrest, a phenotype similar to that observed in mefs lacking the tumor suppressor p53. furthermore, transcriptional induction of p21 following gamma irradiation is dependent on both irf1 and p53. several other reports have also elucidated the involvement of irf1 in cell growth effects [49, 50 ]. for instance, wild - type mefs require two or more oncogenic mutations for transformation, whereas a single hit with c - ha - ras induces transformation in irf1 / mefs. in this situation, in contrast, dna damage - induced apoptosis in mitogenically activated mature t lymphocytes is dependent on irf1 but independent of p53. these studies demonstrate that irf1 can mediate two crucial compounds of neoplastic progression : apoptosis and cell cycle arrest [44, 51 ]. the irf1 locus at chromosome 5q31.1 was initially reported to be lost in a substantial proportion of leukemia and preleukemic myelodysplasia cells. irf1 is also frequently deleted (loss of heterozygosity) in esophageal and gastric carcinoma (point mutation). approximately 11% of sporadic breast cancers exhibit the loss of chromosome 5q1231, the most frequent chromosome loss detected by comparative genomic hybridization (cgh). other studies report that approximately 30% of neoplastic breast tissues have loss of irf1 by immunohistochemical staining when compared with normal breast epithelium. furthermore, high - grade ductal carcinoma in situ (dcis) or node - positive invasive ductal cancers were less likely to express irf1 and were much more likely to have higher oncogenic irf2 protein than normal. cgh also implicates irf1 loss of heterozygosity (loh) in 50% of brca1 mutated breast cancer tumors [57, 58 ]. these results are consistent with the hypothesis that loss of irf1 expression in some breast cancers contributes to the loss of appropriate growth control. allelic loss of irf1 is detected in 32% of women with breast cancer (12/37 breast tissue specimens). this loss of heterozygosity is associated with an increased risk of recurrence and risk of death in the cases studied, strongly implicating a tumor suppressive role for the irf1 gene in breast cancer. analyses of two publically available oncomine cancer gene microarray datasets also imply an important tumor suppressive role for irf1 in many sporadic breast cancers. protein expression studies show that in breast tumors the most prevalent location of irf1 is within the cytosol (90%) ; this location suggests a transcriptionally inactive form of irf1. in contrast, 51% of the reported tumors expressed irf1 in the nucleus (in more than 50% of the tumor cells), consistent with a potential to represent a transcriptionally active form. thus, some breast tumors may differentially regulate the activation of irf1 by controlling its subcellular localization. these observations are consistent with a study reporting higher levels of irf1 protein in adjacent normal breast epithelium when compared with high - grade dcis or lymph node - positive invasive ductal carcinoma of the breast. collectively, these studies imply that some cells may bypass the growth inhibitory mechanisms of irf1 by down - regulating its expression [60, 61 ]. this observation is supported by the evidence that reduced irf1 expression in breast cancer cells is associated with low caspase activity, low apoptosis, and ultimately, increased cell survival [16, 44, 62 ]. irf1 is a key mediator of cell death for the antiestrogens fulvestrant and tamoxifen. mcf7 and t47d breast cancer cells expressing a dominant negative irf1 (dnirf1), which lacks the carboxyl - terminal transcriptional activation domain, do not undergo fas - induced cell death and are, in turn, less sensitive to aes. moreover, dnirf1 expressing cells result in the inhibition of casp3/7 and casp8, indicating the primary antitumorigenic role of irf1 is through the promotion of apoptosis. furthermore, breast cancer cells that have acquired resistance to fas show significant upregulation of microrna (mirna)-221 and -222 expression. overexpression of these two mirnas affects several oncogenic signaling pathways, including the jak / stat and p53 pathway, supports er-independent proliferation, and promotes tumor progression. thus, mirna-221/222 may serve to down - regulate the tumor suppressing effects of irf1 in breast cancer cells following antiestrogen therapy. an acquired resistance model involving aromatase inhibitors shows that irf1 expression is reduced in long - term estrogen deprived mcf7 cells, indicating irf1 is a key gene that is consistently reduced in ae resistant breast tumors. in er+ breast cancer cells, have shown that irf1 signaling reduces the rate of cell proliferation and the incidence of human breast cancer xenografts in athymic nude mice. a dnirf1 blocks the effect of parthenolide, a small molecule inhibitor of nf-b, and synergistically interacts with antiestrogens in vitro to reverse the antiestrogen - resistance phenotype. moreover, antiestrogen resistant breast cancer cells mcf7/lcc9 have greater bcl2 protein expression compared to antiestrogen sensitive breast cancer cells (mcf7/lcc1). lcc9 cells are more dependent on bcl2 for their survival, since they exhibit a significantly greater growth inhibition by the small molecule bcl2 inhibitor ha 14 - 1 when compared with their lcc1 controls, and the lcc9 antiestrogen - resistant cells also express lower irf1, indicating that a clear functional link exists between irf1, nf-b activation, bcl2 expression, and er+ breast cancer cell fate [62, 68 ]. functionally relevant interactions between irf1 and at least two different members of the epidermal growth factor receptors (egfr) superfamily have been reported. egfr induces expression of irf1, and irf1 also can regulate egfr expression, suggesting a possible role of irf1 in egfr overexpressing breast cancers. the coexpression of egfr and irf1 appears key for the induction of apoptosis, and blocking stat5 with a dominant negative eliminates the transcriptional synergy and ability of irf1 and egfr to induce apoptosis. overexpression of egfr (her1) is common in the subgroup generally referred to as triple negative breast cancer (tnbc) ; these tumors lack the er, the pgr, and have normal human epidermal growth factor 2 receptor (her2/neu) levels. thus, expression of irf1 and the ability of egfr : irf1 to affect cell death may be important in tnbc. irf1 may play an important role in another breast cancer subgroup, the her2-amplified breast cancers. overexpressing breast cancer has a generally poor prognosis, with approximately 35% of cases responding to the her2-targeted therapy, herceptin. several observations have led to the hypothesis that breast cancer patients with her2/neu overexpression may benefit less from tam than those whose tumors with low expression of this oncogene. for example, tam acts similarly to estrogen withdrawal in mcf7 cells transfected with the her2/neu oncogene. however, the true relationship remains controversial, since a recent meta - analysis found no association between tam responsiveness and her2/neu expression. in contrast, a benefit for both anthracycline and taxane - based polychemotherapies shows a clear association with her2/neu status. given the close relationship between irf1 and egfr family members, studies of the role of irf1 in modifying responsiveness to taxanes and anthracyclines in the context of triple negative and her2/neu breast cancers seem warranted. cell signaling to affect an irreversible cell death results in one or more forms of cell death including apoptosis (programmed cell death 1 ; pcd1), autophagy (pcd2), and necrosis (pcd3) [76, 77 ]. in the context of endocrine responsive breast cancers, it is important to understand the underlying mechanism that irf1 uses to mediate tumor suppressive activity. a recent study by ning. shows how combined ifn and fas treatment increases the expression and nuclear translocation of irf1. ae sensitivity is restored in ae - resistant breast cancer cells through an irf1-dependent increase in mitochondrial outer membrane permeability and activation of the intrinsic apoptotic pathway. apoptosis is then executed by selected caspases including casp7, casp8, and casp9 [62, 78 ]. moreover, irf1-induced apoptosis is ligand independent but requires a fas - associated death domain (fadd)/casp8 complex that forms intracellularly. members of the tgf family, which have long been implicated in endocrine resistance, also induce irf1 expression that can lead to apoptosis in breast cancer cells. overexpression of irf1 in breast cancer cells can induce apoptosis, which is consistent with its tumor suppressive activity. bcl2 family proteins have either pro- (including bad, bak, bid, bax, bid), or antiapoptotic activities (such as bcl2, bclw, and bclxl) and are functionally involved in the regulation of cell fate. irf1 mediates cell death, specifically apoptosis, by signaling through several bcl2 family members and caspases [62, 78 ]. irf1 can increase expression of proapoptotic bak, bax, bik, while decreasing expression of the antiapoptotic bcl2 and bclw. moreover, enhanced irf1 expression in breast cancer cells down - regulates the inhibitor of apoptosis protein, survivin (birc5). reduced expression of antiapoptotic bcl2 members and survivin, with an increase in proapoptotic bcl2 protein expression, leads to an alteration in mitochondrial membrane permeability, release of cytochrome c, and ultimately apoptosis executed by selected caspases. we propose a novel signal transduction pathway operating in breast cancer (figure 2). in this pathway, irf1 plays a central role in regulating expression of bcl2 members, survivin, and caspases, thus, determining the cell fate decision to live or to undergo apoptosis. the regulation of several bcl2 family members is also dependent on nf-b, a transcription factor critical in the regulation of cell proliferation and in resistance to cytotoxic drugs. for example, nf-b expression and activation is significantly increased in mcf7/lcc9 cells when compared to the parental, antiestrogen sensitive mcf7/lcc1 breast cancer cells ; nf-b can form functional heterodimers with irf1 that regulate the expression of genes through an ifn activation site (gas)/kappab promoter element. increased nf-b activation is functionally associated with conferring an antiestrogen resistant phenotype, which it does in part by modulating casp8 activity, mitochondrial function, and apoptosis. interestingly, the activities of nf-b appear to act by increasing bcl2 expression [85, 86 ], whereas this expression is inhibited by irf1 ; endogenous irf1 expression is reduced in these cells indicating that the balance between irf1 and nf-b may be critical in determining cell fate. these activities are likely independent of irf1:nf-b heterodimer formation, unless the primary role of these in the endocrine resistant phenotype is to sequester irf1. the upregulation of nf-b expression in resistant cells would likely leave sufficient nf-b, in excess of that bound to irf1, free to regulate its prosurvival signaling. the combination of ifn and fas reduces nf-b protein expression and transcriptional activation through the induction of irf1. in addition to nf-b, npm1 is also significantly overexpressed in mcf7/lcc9 cells, and npm1 binds and inhibits irf1 function. thus, npm1 may act by blocking / eliminating a caspase cascade in breast cancer cells through its ability to reduce irf1 and signaling to apoptosis. stat1, a transcription factor upstream of irf1 and mediator of ifn signaling, is also considered a tumor suppressor gene. protein levels of stat1 and phosphorylated stat1 are substantially increased with ifn treatment, leading to an increase in irf1 [62, 90 ]. moreover, stat1 and ifn receptor null mice show spontaneous tumor growth when either exposed to methylcholanthrene, or are bred into a p53-deficient background. stat1 also has a tumor suppressive role in mammary epithelium in erbb2/neu - induced breast cancer. these studies provide greater insight into the cell - specific roles of ifn and stat1 signaling, ultimately effecting irf1 induction. the ability of interferons to sensitize breast cancer cells to tam was shown over 20 years ago. van den berg. showed that the combination of ifn and tam had a greater antiproliferative effect on zr-75 - 1 breast cancer cells than either drug alone. ifn, ifn, and ifn have each been used in the treatment of breast cancer either to induce antiestrogen sensitivity and/or stimulate cellular immunity. pilot studies suggest that ifn can improve clinical benefit and/or overall survival in patients with metastatic breast cancer and will be tested in phase iii clinical trial. although mixed results have been shown with ifn as an antitumor agent, ifn and ifn, alone or combined with an antiestrogen, have shown to be effective in increasing hormonal dependency and overcome tam resistance. the pegylation (covalent attachment of polyethylene glycol molecule to a protein) of ifn also induces irf1-mediated signaling and sensitizes melanoma cells to chemotherapy. pegylated ifn is currently being used in monotherapy and in combination with chemotherapy for several different types of cancers [97, 98 ]. restoring irf1 expression or controlling its modulation may be useful for the treatment of er - positive breast tumors that have acquired resistance to endocrine therapy. therefore, a clear understanding of irf1 signaling and how it contributes to cell death is necessary for the discovery of new drug candidates and better predictors of how tumors will respond to endocrine therapy. | resistance to endocrine therapy is common among breast cancer patients with estrogen receptor alpha - positive (er+) tumors and limits the success of this therapeutic strategy. while the mechanisms that regulate endocrine responsiveness and cell fate are not fully understood, interferon regulatory factor-1 (irf1) is strongly implicated as a key regulatory node in the underlying signaling network. irf1 is a tumor suppressor that mediates cell fate by facilitating apoptosis and can do so with or without functional p53. expression of irf1 is downregulated in endocrine - resistant breast cancer cells, protecting these cells from irf1-induced inhibition of proliferation and/or induction of cell death. nonetheless, when irf1 expression is induced following ifn treatment, antiestrogen sensitivity is restored by a process that includes the inhibition of prosurvival bcl2 family members and caspase activation. these data suggest that a combination of endocrine therapy and compounds that effectively induce irf1 expression may be useful for the treatment of many er+ breast cancers. by understanding irf1 signaling in the context of endocrine responsiveness, we may be able to develop novel therapeutic strategies and better predict how patients will respond to endocrine therapy. |
the retroviral plasmid mscv-(sd-)-il-4-neo (11) contains the poliovirus type 2 internal ribosome entry site sequence (12) between the bacterial neomycin phosphotransferase gene (neo), conferring neomycin resistance to eukaryotic cells, and the mouse il-4 gene. the internal ribosome entry site sequence allows for subsequent translation of the two proteins. nolan, manuscript in preparation). in brief, pheonix cells were plated at 2 10 cells / well in 6-cm plates and allowed to adhere overnight. the cells were transfected with the il-4-neo plasmid (10 g / plate) by cacl2 transfection. replication - defective retrovirus was harvested 48 hr after transfection, sterile filtered to remove nonadherent producer cells, and used to infect t cell hybrids. cells were grown to log phase, harvested, and washed two times with pbs. cells were resuspended to 2 10 cells / ml using retrovirus containing supernatant stocks. polybrene was added to a final concentration of 8 g / ml. the cells were placed in 6-well tissue culture plates (2 ml / plate) and centrifuged at 2,500 rpm for 90 min at 32c in a tabletop centrifuge. the cells were then incubated for a further 8 h at 37c in a co2 incubator before the cells were washed and replated in fresh media without polybrene. after 48 h of culture to allow gene expression, transduced cells were selected by growth in the presence of the neomycin analogue g418 (2 g / ml) for 57 d. eae was induced by active immunization with mylein basic protein (mbp). in brief, mbp (200 g / mouse final concentration) in pbs was emulsified in an equal volume of cfa. sjl/ j)f1 mice (5 mice / group) were immunized subcutaneously at four sites in the flanks, draining the axial and inguinal lymph nodes (50 l / site). animals were also given an injection of the coadjuvant pertussis toxin (200 ng / mouse) intravenously on the day of immunization and 48 h later. mice were scored daily for clinical signs of eae according to the following scale : 0, no clinical disease ; 1, flaccid tail ; 2, single hind leg paralysis ; 3, dual hind leg paralysis ; 4, fore limb paralysis ; 5, moribund ; 6, death. on day 9 or 10, mice were transferred 10 of each cell type intravenously, and were observed daily for clinical signs of eae. mice were housed in the stanford department of laboratory animal medicine (stanford, ca) under national institutes of health (nih) approved conditions. il-4 and, microtiter plates were coated with primary antiinterleukin antibody overnight, washed with pbs after a 2-h incubation, plates were washed and a biotin - conjugated secondary antiinterleukin antibody was added. a standard colormetric assay was then performed by the addition of the peroxidase substrate 2,2-azinobis (3ethylbenzthiazoline-6-sulfonic acid). the retroviral plasmid mscv-(sd-)-il-4-neo (11) contains the poliovirus type 2 internal ribosome entry site sequence (12) between the bacterial neomycin phosphotransferase gene (neo), conferring neomycin resistance to eukaryotic cells, and the mouse il-4 gene. the internal ribosome entry site sequence allows for subsequent translation of the two proteins. nolan, manuscript in preparation). in brief, pheonix cells were plated at 2 10 cells / well in 6-cm plates and allowed to adhere overnight. the cells were transfected with the il-4-neo plasmid (10 g / plate) by cacl2 transfection. replication - defective retrovirus was harvested 48 hr after transfection, sterile filtered to remove nonadherent producer cells, and used to infect t cell hybrids. cells were grown to log phase, harvested, and washed two times with pbs. cells were resuspended to 2 10 cells / ml using retrovirus containing supernatant stocks. polybrene was added to a final concentration of 8 g / ml. the cells were placed in 6-well tissue culture plates (2 ml / plate) and centrifuged at 2,500 rpm for 90 min at 32c in a tabletop centrifuge. the cells were then incubated for a further 8 h at 37c in a co2 incubator before the cells were washed and replated in fresh media without polybrene. after 48 h of culture to allow gene expression, transduced cells were selected by growth in the presence of the neomycin analogue g418 (2 g / ml) for 57 d. eae was induced by active immunization with mylein basic protein (mbp). in brief, mbp (200 g / mouse final concentration) in pbs was emulsified in an equal volume of cfa. sjl/ j)f1 mice (5 mice / group) were immunized subcutaneously at four sites in the flanks, draining the axial and inguinal lymph nodes (50 l / site). animals were also given an injection of the coadjuvant pertussis toxin (200 ng / mouse) intravenously on the day of immunization and 48 h later. mice were scored daily for clinical signs of eae according to the following scale : 0, no clinical disease ; 1, flaccid tail ; 2, single hind leg paralysis ; 3, dual hind leg paralysis ; 4, fore limb paralysis ; 5, moribund ; 6, death. on day 9 or 10, mice were transferred 10 of each cell type intravenously, and were observed daily for clinical signs of eae. mice were housed in the stanford department of laboratory animal medicine (stanford, ca) under national institutes of health (nih) approved conditions., microtiter plates were coated with primary antiinterleukin antibody overnight, washed with pbs an il-4 or il-10 standard was included in each assay for quantification purposes. after a 2-h incubation, plates were washed and a biotin - conjugated secondary antiinterleukin antibody was added. a standard colormetric assay was then performed by the addition of the peroxidase substrate 2,2-azinobis (3ethylbenzthiazoline-6-sulfonic acid). to test the concept of site - specific delivery of cytokines by transduced t cells, the murine model of eae was used. an encephalitogenic, mbp - specific t cell hybridoma, g1.15h, was used in these preliminary studies due to its transduction efficiency. pl / j)f1 mice verified its eae - inducing, and thus cns - homing, capability (fig. it was decided to transduce this t cell line for expression of the il-4 gene since this cytokine has been demonstrated to be a mediator in eae regulation as evidenced by its role in the natural recovery from disease (13), experimental protection from disease after oral tolerance induction (14), and after immunization with altered peptide ligands of mbp (15). after transduction of g1.15h with an il-4encoding retrovirus and drug selection, the line was confirmed to secrete il-4 by elisa (table 1). subsequent limiting dilution cloning of these transduced hybrids yielded individual lines secreting between 1 and 8 pg / ml il-4/10 cells (table 1). 10 d after mbp immunization to induce eae, (sjl / j pl / j)f1 mice were given transduced or control cells. clinical eae was ameliorated by adoptive transfer of 10 transduced t cells secreting high levels of il-4 (line n5). disease onset for the il-4 treatment group was delayed by 2 d (p < 0.01 student 's t test) and the average disease score was significantly lower (p < 0.05) than an experimental group receiving cells transduced to express il-10, or control mice receiving untransduced cells or pbs (fig. that amelioration of disease was due to local delivery of il-4 was supported by several experimental approaches. in the first, mice that received t cells transduced to express il-4 were bled at various time points after cell transfer, and serum il-4 was determined by elisa. no cytokine was detected in the serum until day 24 after transfer, well after initial recovery from disease. serum il-4 levels at this time were low, ranging from 1.19 pg / ml to 2.53 pg / ml (table 2). this finding indicates that disease remission was not due to high systemic levels of il-4. in a second experimental approach, we verified the presence of transduced t cells in the cns at the time of disease amelioration by testing spinal cord tissue from treated animals for retroviral - specific il-4 expression by reverse transcriptase pcr analysis. retroviral il-4 transcription could be detected in the cns of treated animals 15 d after transfer of transduced t cells (data not shown). the third experimental approach demonstrated that amelioration of disease was dependent on t cell homing to the cns. we reasoned that t cells transduced to express il-4 that could not recognize cns antigens would be ineffective at delivering il-4 to the cns. to test this hypothesis, additional transfer experiments were performed, using as controls, transduced t cells expressing il-4 but lacking antigen specific tcr expression. in the first experiment, an il-4 expressing transductant of the hybridoma fusion partner bw5147 was used as a control. transfer of this cell line to mbp - immunized mice had no effect on the disease course, whereas transfer of an mbp - specific line, clone 4.9, secreting low levels of il-4 (matched to the fusion partner control) had a significant therapeutic effect (p < 0.05 ; data not presented). in the second experimental approach, a tcr negative variant of the il-4secreting disease ameliorating n5 clone was used as a control. this line had significantly less effect on the disease course (p < 0.05) when compared to its tcr - expressing counterpart (fig. 3). the majority of approaches taken to control autoimmune disease result in deleterious side effects due to the systemic administration of antiinflammatory agents. our findings indicate that the disease processes can be modulated by the transfer of mbp - specific t cells which have been retrovirally modified to express the antiinflammatory cytokine il-4. disease amelioration was due to local, rather than systemic, delivery of il-4 as evidenced by the following points. (a) serum levels of il-4 were undetectable at the time of disease remission. (b) retroviral - encoded il-4 expression could be detected in the cns of treated mice. (c) disease amelioration was dependent upon antigen - specific t cell receptor expression on transduced t cells, indicating that t cell antigen recognition and presumably trafficking were necessary for delivery of cytokines. the use of antigen - specific t cells, transduced to express regulatory cytokines, selectively target antiinflammatory molecules to the site of pathology represents a unique therapeutic approach to the treatment of autoimmune disease. t cells are advantageous since they are easily manipulated and expanded in tissue culture before reintroduction into the host. more importantly, the antigen specificity of t cells allows them to home to depots of antigen in the body, such as at inflammatory sites of autoimmune disease. this has been demonstrated in the murine model of eae where mbp - specific t cells have been shown to traffic to the cns, both during the induction phase of disease as well as during relapses in a relapsing - remitting model of eae (16, 17). results presented here demonstrate that a statistically significant benefit can be observed when mice, immunized to develop eae, are given mbp - specific t cells retrovirally transduced to express il-4. three naive (pl / j sjl / j)f1 mice were given 10 g1.15h cells intravenously on day 0. each mouse (circles, squares, or triangles, respectively) was scored daily for clinical signs of eae as described in materials and methods. il-4 and il-10 secreted by cell lines used in this study control il-4 and il-10transduced cell lines were incubated overnight, and il-4 and il-10 in culture supernatants quantitated by elisa as described in materials and methods. adoptive transfer of t cells transduced to express il-4 ameliorates mbp - induced eae. mice immunized to induce eae were treated with t cells transduced to express il-4 (circles) or il-10 (triangles), untransduced t cells (diamonds), or pbs (squares), and observed for clinical signs of eae. data are given as mean disease scores, and are representative of the results of at least two independent experiments. the mean disease score was statistically different from all other groups, student 's t test, p < 0.05. serum levels of il-4 at various times after transfer of t cell hybrids transduced to express il-4 n5-transferred mice were bled from the tail vein on the indicated days into heparinized tubes. serum was obtained by centrifugation and tested for il-4 by elisa as described in materials and methods. none detected (lower limit of detection of elisa = 0.875 pg / ml). mbp - immunized (pl / j sjl / j)f1 mice (10 mice / group) were given 10 transduced tcr - positive, il-4secreting n5 cells (circles) or tcr - negative, il-4secreting n5 cells (squares). data are given as the mean disease scores of those mice developing disease, and are representative of the results of at least two independent experiments. the mean disease score was statistically different from all other groups, student 's t test, p < 0.05. | experimental autoimmune encephalomyelitis (eae) is an inflammatory autoimmune disease of the central nervous system which serves as a model for the human disease multiple sclerosis. we demonstrate here that encephalitogenic t cells, transduced with a retroviral gene, construct to express interleukin 4, and can delay the onset and reduce the severity of eae when adoptively transferred to myelin basic protein immunized mice. thus, t lymphocytes transduced with retroviral vectors can deliver regulatory cytokines in a site - specific manner and may represent a viable therapeutic strategy for the treatment of autoimmune disease. |
torque control is the primary method used in implant dentistry for tightening abutment screws. tightening torque and the coefficient of friction at the abutment screw - implant thread interface are the most important factors in determining the preload developed in the implant complex. studies have demonstrated that a lower joint preload causes significantly greater micromotion in the joint, resulting in joint failure and loss of function. manufacturers of mechanical torque devices specify the torque to which the screws need to be tightened to achieve the intended preload, as a target torque. these two types are toggle type or friction - style and beam type or spring - style. accuracy of mechanical torque limiting devices (mtlds) is essential to prevent connection related complications. the literature offers little information on the possible influence of steam sterilization on the accuracy of friction - style mechanical torque limiting devices (f - s mtlds). it is stated that except for the effect of autoclaving on the 10ncm friction - style torque wrench, sterilization procedures did not adversely affect the accuracy of the new f - s mtlds. but high variability in delivered peak torque have been reported in clinical service of these devices. gutierrez., tested 35 f - s mtlds following 3 years of clinical services for torque delivery accuracy. their results showed that many of the tested devices were not accurate in delivering the target torque and maximum torque difference was higher than the manufacturer 's designated torque value for 10 ncm devices. mccracken., reported that the mean applied torque of f - s mtlds was not significantly different from spring - style devices, but greater range of values and variability were seen in f - s mtlds after clinical use. in general, manufacturers recommend sterilizing the f - s mtlds in the broken or toggled position or dismantling of devices following the use of an approved lubricant before sterilization. the effect of such pre - sterilization process has not yet been clarified on the accuracy of f - s mtlds. due to high inaccuracy reported in f - s mtld and unknown effect of sterilization procedures (considering the broken position or dismantling of devices, with the use of an approved lubricant) and number of use on their accuracy, this study aimed to investigate the effect of sterilization procedures and number of use on the accuracy of f - s mtlds. the null hypothesis was that there would be no significant difference in the accuracy of f - s mtlds considering sterilization procedures and number of use. 15 new f - s mtlds from three different implant manufactures were evaluated [figure 1 ] to determine the effect of pre - sterilization procedures before steam sterilization on their accuracy (within % 10 of the target value). five samples from each of the three types of selected f - s mtlds were tested : friction - style mechanical torque limiting devices tested. x, astra tech y, biohorizons z, dr idhe mechanical torque limiting devices astra tech (25 ncm, hader sa, la chaux - de - fonds, switzerland)biohorizons (30 ncm, dynatorq itl, irvine, california, usa)dr. idhe (15 - 60 ncm, dr. idhe dental, eching / munich, germany). astra tech (25 ncm, hader sa, la chaux - de - fonds, switzerland) biohorizons (30 ncm, dynatorq itl, irvine, california, usa) dr. idhe (15 - 60 ncm, dr. idhe dental, eching / munich, germany). target torque was 25 ncm for astra tech devices and 30 ncm for biohorizons and dr. total specimen size of fifteen devices was selected according to other studies and considering the effect size of 0.37 ncm, sd = 0.13 and using 2-level factorial design. the peak torque measurement was tested ten times before and after 1, 5, 10, 20, 50, 75, and 100 steam sterilization cycles(134c, 0.9 bar vacuum pressure and 18 min) using the digital torque gauge (tohnichi torque gauge, tohnichi co., tokyo, japan) [figure 2 ]. the torque gauge was calibrated by the manufacturer to be accurate within 2% of the full scale. after connection of the torque device to the driver, torque indicator on the gauge was set to zero. each device was tested by applying the torque slowly ; over 4 s. force was applied to the f - s mtlds until the release at a pre - calibrated target torque value. the torque was applied by one operator that was blind of measured values and the other operator registered the peak torque values. devices of each group were prepared before each sterilization cycle, as recommended by manufacturers. idhe devices were dismantled, cleaned, dried and lubricated at the proposed site, and then the parts were assembled before sterilization [figures 3 and 4 ]. for biohorizons, devices were lubricated with the bended handle [figure 5 ]. the digital torque gauge (tohnichi, japan) dismantling of the components in dr. idhe devices dismantling of the components astra tech devices for biohorizons devices lubrication and bending of the handle could be considered to simulate the clinical situation of aging, the procedure of target torque application was repeated 10 times after each sterilization cycle and the peak torque values were registered. before each autoclaving cycle, to simulate the contamination of these devices with saliva during surgical and prosthetic procedures, devices were immersed in artificial saliva (bioxtra, solarfarma, knokke, belgium) and then disinfected, for 15 min with the 2% phenols and aldehyde - free, non - fixing disinfectant (deconex 53 plus, borer chemie ag, zuchwil, switzerland). devices were packed and then were put through the steam autoclave (techno- gaz/, europa bxp / parma, italy). mean and range of difference between the measured torque and the targeted torque values were evaluated, considering sterilization cycles and number of use. absolute difference is the difference in ncm taken without regard to the sign between the measured torque value and the targeted torque value. descriptive statistical analysis was used and a comparison of mean of difference with target torque in each cycle was performed with one sample t test. one - way repeated measure anova, considering the type of mtlds as a between subject comparison, was used to evaluate the absolute values of difference between devices of each manufacturer in each studied group (= 0.05). descriptive values of mean, standard deviation, minimum, and maximum difference between the measured torque and the targeted torque values for each group of friction - style mechanical torque devices are summarized in tables 13. differences between peak torque and target values (absolute, mean, and range in ncm) before (x0) and during 100 times of steam sterilization cycles (x1-x100) for astra tech devices mean differences between peak torque and target values (absolute, mean, and range in ncm) before (x0) and during 100 times of steam sterilization cycles (x1-x100) for biohorizons devices differences between peak torque and target values (absolute, mean, and range in ncm) before (x0) and during 100 times of steam sterilization cycles (x1-x100) for dr idhe devices in astra tech group [table 1 ] mean of difference values significantly differed from the target torque (p = 0.04) until 75 cycles, usually with under estimation trend. under estimation increased until the 100 cycle that achieved to maximum difference values and showed a significant difference with the target torque (p < 0.001). maximum absolute values of difference were 3.35 ncm (13.4% difference from the target torque) in astra tech devices and they showed more than 10% difference from the target torque on 16% of measured peak torque in one device (figure 6). error bar and 95% confidence interval of mean raw error compared to target torque for 3 groups of friction - style torque limiting devices, zero level showing target torque for each group (astra tech, biohorizon, dr. idhe) considering steam sterilization and number of use, the results of this study in biohorizons group [table 2 ] showed that, mean of error values significantly differed from the target torque with under estimation trend during all the 100 cycles (p < 0.05). maximum absolute value of difference was 7.75 ncm (25.83% difference from the target torque) in this group. biohorizons devices showed more than 10% difference from the target torque on 76% of measured peak torque in all of the five devices. considering sterilization and number of use, the results of this study in dr. idhe group [table 3 ] showed that, mean of difference values significantly differed from the target torque (p = 0.002) until 75 cycles and then, despite the increase of difference, values with both under and over estimation trend of target torque value evaluation, significant difference of mean values was not seen. maximum absolute values of difference was 3.75 ncm (12.5% difference from the target torque) in dr. after 100 cycles, more than 10% difference from the target torque was seen on 10% of measured peak torque in one device. the data support rejection of the first null hypothesis as there was a statistically significant difference of torque values (p < 0.05 for biohorizons and dr. ideh and connection related complications have been reported among the most frequent technical complications that affects the survival rates of fixed implant supported prosthesis. peak torque values within 10% of the target torque was proposed as a clinically suitable torque. after 100 autoclave cycles the maximum torque value measured in the current study showed 12.5% and13.4% and 25.83% difference from the target torque in dr. sterilization in saturated steam under pressure is considered to be the most certain method for destroying all forms of microbial life. dellinges and curtis demonstrated that sterilization procedures did not adversely affect the accuracy of the new dynatorq wrench system for target torque value of 20 and 30ncm. however, the results of the current study demonstrated higher variability of dynatorq itl devices in biohorizons group. the maximum torque value measured in biohorizons group showed 25.83% difference from the target torque. this can be related to the effect of lubrication and simulated clinical use in the current study. gutierrez., evaluated the torque delivery accuracy of 35 f - s mtlds. all of the devices had been in clinical service for a minimum of 1 month or a maximum of 3 years. corrosion of the spring in the handle of the torque wrench was found to be the reason for the largest value seen for 10 ncm torque wrench (455% higher than the manufacturer 's designated torque value). they presented spring corrosion as a leading factor to excessively high torque delivery resulting from lack of spring flexibility. their results showed largest values of 17% for the 30 ncm torque wrench and 58.6% for the 35 ncm devices. sterilization procedures were not clearly pointed in this study. in the current study, maximum difference values, considering sterilization procedures and number of use, were higher for biohorizons group (7.75 ncm25.83% differences for the target torque of 30 ncm). aging as an independent factor affects the accuracy of f - s mtlds. it is stated that the number of uses producing wear, is probably not the major factor of inaccurate torque delivery. evaluating the peak torque delivery of frictional style torque wrenches used routinely in dental practice, any correlation between age of the torque wrenches and peak torque delivery have been rejected. this finding support our results that demonstrated low variability of peak torque values in some of the tested devices considering 100 cycles of sterilization and number of use. vallee., demonstrated the accuracy of mtlds were dependent not only on the wrench style, but also on the manufacturer. this finding supports our results that demonstrated higher variability in biohorizons devices. under estimation of target torque on peak torque delivery dental implant screw joints tightened to lower preload values, can not achieve the mechanical integration in implant abutment interface. mccracken., assessing the accuracy of mechanical torque devices at clinical service for 18 months to 7 years and with maximum 700 times of clinical use in an institutional environment, showed their capability of producing accurate torque values within 10% of their target torque. however, higher standard deviation (16.1 ncm) and range of values (55.9%) were seen among the friction - style devices comparing with spring - style devices. heating process that congeals the lubricant inside the friction - style wrench, jamming the action and increasing the applied torque, was stated as a probable cause of creating inaccuracy of f - s mtlds in an institutional environment with proposed frequent calibration of these devices. current results showed that mean absolute values of difference did not differed significantly between astra tech and dr. idhe group, but they were significantly lower than biohorizons group p < 0.05. in the analysis of data, absolute values of difference (extremes) are more reliable than the mean difference values to show probable clinical complications. some studies have used new devices to evaluate the effect of sterilization on the accuracy of these devices. f - s mtlds of current in vitro study were also new and had not been exposed to clinical procedures (aging). other studies use torque wrenches in clinical services to investigate their accuracy but, due to the lack of data on the exact age and the actual number of sterilization cycles and maintenance of mechanical torque devices, their results will not apply to every clinical situation. continuous education and regular studies on the efficacy of different sterilizing techniques to overcome the infectious hazards are strongly emphasized. considering the combined effect of sterilization methods and number of use, will help to determine a clinical guideline to determine the maintenance requirement of this devices for accurate torque delivery (within 10% of their preset target values). the torque output of each individual device stayed in 10% difference from target torque values before 100 sterilization cycles.mean difference values differed significantly from the target torque in astra tech group (p < 0.01) and biohorizons group (p < 0.05). idhe devices, mean difference showed a significant difference only until 75 cycles (p = 0.002) and then, despite the increase of difference, significant difference of mean values was not seen.absolute values of difference did not differed significantly between astra tech and dr. idhe group but they were significantly lower than biohorizons group (p < 0.05).low range of variability was seen in all of the tested devices in dr. the torque output of each individual device stayed in 10% difference from target torque values before 100 sterilization cycles. mean difference values differed significantly from the target torque in astra tech group (p < 0.01) and biohorizons group (p < 0.05). however, in dr. idhe devices, mean difference showed a significant difference only until 75 cycles (p = 0.002) and then, despite the increase of difference, significant difference of mean values was not seen. low range of variability was seen in all of the tested devices in dr. idhe group. | background : mechanical torque limiting devices (mtlds) are necessary tools to control a peak torque and achieving target values of screw component of dental implants. due to probable effect of autoclaving and number of use on the accuracy of these devices, this study aimed to evaluate the effect of sterilization and number of use on the accuracy of friction - style mechanical torque limiting devices (f - s mtlds) in achieving their target torque values.materials and methods : peak torque measurements of 15 new f - s mtlds from three different manufacturers (astra tech, biohorizons, dr. idhe) were measured ten times before and after 100 steam sterilization using a digital torque gauge. to simulate the clinical situation of aging (number of use) target torque application process was repeated 10 times after each sterilization cycle and the peak torque values were registered. comparison of the mean differences with target torque in each cycle was performed using one sample t test. considering the type of mtlds as inter subject comparison, one - way repeated measure anova was used to evaluate the absolute values of differences between devices of each manufacturer in each group (= 0.05).results : the results of this study in dr. idhe group showed that, mean of difference values significantly differed from the target torque (p = 0.002) until 75 cycles. in astra tech group, also mean of difference values with under estimation trend, showed a significant difference with the target torque (p < 0.001). mean of difference values significantly differed from the target torque with under estimation trend during all the 100 cycles in biohorizons group (p < 0.05).conclusion : the torque output of each individual device stayed in 10% difference from target torque values before 100 sterilization cycles, but more than 10% difference from the target torque was seen in varying degrees during these consequent cycles. |
a previously healthy 33-year - old male was referred to our retina service for sudden onset of intermittent floaters and flashing lights in his right eye which developed 3 weeks following inactivated hepatitis a, yellow fever, and typhoid vaccinations. these vaccines were given prophylactically in preparation for a 2-week trip to panama at the ohio state university wexner medical center travel and immunization clinic. the patient had previously received one dose of the hepatitis a vaccine 12 years prior (he did not complete the series) and had never before been exposed to typhoid or yellow fever immunizations. on examination, pupil responses, visual fields to confrontation, and intraocular pressures (14 mmhg) were normal bilaterally. fluorescein angiography of the right eye demonstrated scattered peripheral hyperfluorescent lesions correlating with those seen in the fundus, and there was no evidence of disc leakage (figure 1). a comprehensive review of systems was negative for fever, rash, oral ulcers, arthralgias, headache, or vertigo. his ocular examination revealed continued low grade anterior vitreous inflammation and the peripheral retinal lesions began to demonstrate early hyperpigmentation (figure 2). because of the nonprogressive examination findings and given the excellent visual acuity, it was decided to continue close observation. at 8 weeks, the patient s symptoms had resolved, the vitreous was clear of cellular inflammation, and the fundus revealed punched out areas of retinal pigment epithelium atrophy. vaccines potentiate both humoral and cellular immune responses by exposing lymphocytes to pathogen - specific antigens which triggers an inflammatory t cell - mediated reaction and initiates the steps of adaptive immunity and development of cellular memory. autoimmune phenomena have been infrequently observed following vaccination, and possible mechanisms proposed to explain some of these occurrences include the roles of excessive lymphocyte activation, cytokine expression, and molecular mimicry.1 cross - reactivity of an activated immune response against uveal antigens may occur when peptide fragments presented to t cells show close conformational resemblance to uveal self - peptides. melanin - associated molecules present in choroid have been shown experimentally to be capable of inducing ocular inflammation.2 another possible method of immune system activation following vaccination relates to the use of vaccine adjuvants. adjuvants are routinely combined with vaccines to potentiate their immunogenic activity and these have been used in animal models to create uveitis.2 aluminum - containing adjuvants are used widely in vaccine formulations licensed for use in the us, including hepatitis a. crucial to the adjuvant activity of aluminum is the influx of inflammatory factors, including dendritic cells, to the site of injection. these cells can recognize and process foreign antigens, as well as provide the costimulatory molecules necessary for activating plasma cell production of target antibodies.3 rarely, erythema, subcutaneous nodules, contact hypersensitivity, and granulomatous inflammation have been observed with the use of aluminum adjuvants.4 the currently used preparation of typhoid and yellow fever vaccines are free of adjuvants. there are a few case reports in the literature describing posterior uveitis syndromes occurring shortly after vaccination. specifically, multiple evanescent white dot syndrome was reported 10 days following simultaneous hepatitis a and yellow fever vaccines, and acute posterior multifocal placoid pigment epitheliopathy was described in association with hepatitis b and varicella vaccinations.57 a review of 32 cases of uveitis following hepatitis b vaccination included a few reports of positive rechallenge response in patients who developed recurrent uveitis following separate doses of the hepatitis b vaccine.8 most of the reported cases of uveitis demonstrated self - resolution, although recently a case of ampiginous choroiditis was described following human papilloma virus vaccination which required treatment with oral prednisone and resulted in macular scarring.9 multifocal choroiditis is an inflammatory disease characterized by multiple, small, yellow fundus lesions, and vitreous inflammation. presenting symptoms include blurry vision, floaters, and photopsias. although the etiology of multifocal choroiditis remains unknown, there have been suggestions of autoimmune and viral associations. the choriocapillaris and choroid are richly invested with certain potential antigen - presenting cells and the retinal pigment epithelium can be induced to express major histocompatibility complex class ii molecules, suggesting it may be able to interact with t lymphocytes. there is experimental evidence that high densities of t lymphocytes, b lymphocytes, and macrophages can infiltrate the choroid and stimulate synthesis of cytokines capable of altering the subsequent immune response.10 during the late stage of the disease, the spots adopt a rim of hyperpigmentation and often assume the classic punched - out appearance of retinal pigment epithelium atrophy with bands of subretinal fibrosis at their margins. to our knowledge, this is the first reported case of multifocal choroiditis following vaccination. although this case does not prove causation and the relationship remains presumptive, it does suggest that some vaccinations can act as a trigger for immunologic initiation that could subsequently lead to the development of noninfectious uveitis. | the paper describes the first reported case of multifocal choroiditis following simultaneous hepatitis - a, typhoid, and yellow fever vaccinations. a 33-year - old male developed sudden onset of flashing lights and floaters in his right eye 3 weeks following hepatitis a, typhoid, and yellow fever vaccinations. fundus examination and angiography confirmed the presence of multiple peripheral chorioretinal lesions. these lesions demonstrated characteristic morphologic changes over a period of 8 weeks which were consistent with a diagnosis of self - resolving multifocal choroiditis. vaccine - induced intraocular inflammation has been described infrequently. we demonstrate the first case of self - resolving multifocal choroiditis following simultaneous administration of hepatitis a, yellow fever, and typhoid immunizations. |
although ecologists have long regarded biological diversity as one of the main factors leading to gains in ecosystem stability and productivity, the mechanisms by which these gains arise have been the subject of a decades - long debate (hooper., we here consider ecosystem stability to be a composite of multiple stability - related properties, such as resilience, that together broadly refer to insensitivity to perturbation in ecosystem functioning (song., 2015). historically, two major overarching explanations for gains in ecosystem stability have been proffered, although these mechanisms are not mutually exclusive. the first explanation, frequently termed the sampling hypothesis, ' is that more diverse communities are statistically more likely to contain members with varying tolerance to environmental stressors, so that, as conditions change, organisms displaying a higher degree of fitness under given conditions fill the functional void left by intolerant members (loreau., 2001). in contrast, niche differentiation, and more specifically, functional complementarity, leads to gains in productivity- that is, overyielding'- through more efficient resource utilization and elevated resistance to environmental perturbation (savage., 2007). more recently, a view of communities as functionally degenerate networks has asserted that rewiring of individual member functions and interactions between members may buffer overall community function against environmental perturbation (hastings, 2010 ; shade., 2012). clearly, major strides are being made toward quantitative description of the effects of diversity upon microbial community higher - order properties, yet significant gaps remain in our understanding of mechanisms by which these properties emerge. we argue that the paucity in mechanistic knowledge must not discourage biodesign efforts but rather leverage the available engineering strategies to test specific hypotheses. for example, if the sampling hypothesis is the most dominant explanation for biodiversity effects on productivity and stability, we should expect that organisms engineered for optimal properties and maintained under their optimal growth conditions in monoculture should outperform consortia. but if niche differentiation and/or networked buffering are causal contributors to community productivity or stability, we anticipate that multispecies consortia will outperform even the best - optimized species in monoculture. our view is that recent technical advances now permit elucidation of the mechanisms driving diversity effects upon higher - order properties in microbial communities. we submit that research directed at uncovering such principles (konopka., 2014) will be useful for the engineering of synthetic ' consortia to stably and efficiently perform desired functions, and even to the point of designing robust, self - regulating interactions between member species. since the first published report of a sequenced genome in 1995 (fleischmann., 1995), there has been an explosion in microbial genomic data, which has greatly impacted the study of microbial populations and communities. emergence of small subunit ribosomal rna phylogeny - based approaches led to the first insights into the vastness of uncultivated microbial diversity. since then, these studies have yielded to metagenomics as standard methods for studying the community functional and compositional dynamics. new tools begat new understandings that have led to new disciplines ; in this case, the rising technological frontier of microbial community design and control. although it is not our intent to provide an exhaustive treatment of new systems - level approaches pertinent to microbial community engineering, there are a few developments we deem most impactful upon the emergence of this discipline : advances in genome and transcriptome sequencing (beliaev., 2014 ; shakya., 2013), mass spectrometry - based metabolomic and proteomic approaches (louie and northen, 2014 ; kurczy., 2015), cell isolation and printing (louie., 2013), and a movement towards high - throughput cultivation (knepper., 2014 ; long., nonetheless, the challenges of predictable systems - level understanding of complex microbiological systems, by and large, are not fully attributable to the lack of data or omics - level resolution. in fact, many microbial ecology questions do not require deeper sequence analysis and increased phylogenetic resolution, but rather studies that use the current technologies to explore the spatial scales, phenotypic diversity and temporality important to microbial communities (prosser, 2012) that exert major influence upon the energy flux and nutrient cycling within even the simplest microbial consortia (konopka., 2014). mechanistic understanding of interactive behaviors occurring within diverse, spatially organized communities is limited by methodological and theoretical issues related to predicting protein function from its sequence, inherent community dynamics, sampling at multiscale boundaries and our general inability to define a microbial species, ' all of which hinder inter - community comparisons. our perspective is aligned with prosser (2012) in that improvements in our understanding of temporal and spatial dynamics will ultimately aid the ability to engineer microbial communities with outputs that can be predicted and, ultimately, controlled. furthermore, advancements of knowledge - based design and control of microbial consortia will increasingly rely on mathematical modeling, which can provide a better predictive understanding of microbial community dynamics and higher - order properties (henson and hanly, 2014). any successful outcomes of in silico hypothesis testing, however, are contingent both upon our understanding of microbial metabolism and the accuracy of models, which describe community state in space and time as a function of metabolic adaptation of individual species as well as interactions among species. in this regard, the focus of microbial community modeling has bifurcated into two directions : first, population - based modeling for the prediction of the interspecies dynamics without detailed description of intracellular metabolism (bouskill., 2012) and, second, metabolic network modeling to analyze energy and material flows, and their partitioning in a community (stolyar., 2007 ; taffs., 2009). integration of both approaches to understand the guiding role of interspecies interactions in governing community dynamics is becoming increasingly important (song., 2014). the true asset of modeling, we believe, lies in its ability to predict community - level properties from individual variables through a rational description of nonlinearities arising from interactions between members. accordingly, the prospect of in silico design of synthetic consortia will greatly benefit from expanding the knowledge of microbial metabolism and functional gene annotation, which, in turn, will facilitate the integration of heterologous data sets including omic, kinetic, and physiological data for improved prediction. this effort will lead to more accurate and realistic simulations of community functions that account for spatial heterogeneity (zhuang., 2012), single cell - level interactions (lardon., 2011) and/or population - controlling mechanisms (klapper and dockery, 2010). in sum, integrated, predictive modeling approaches will be required to describe the behavior of microbial communities and to discern the mechanisms by which higher - order properties arise. we also expect model accuracy to increase with our improved ability to test and validate model predictions through species - resolved measurements. it has been recognized for some time that engineered microbial consortia have the potential to be more productive and robust than monocultures (brenner., 2008). the question that remains, however, is how microbial communities can be designed and, more importantly, controlled. to date, successful examples of improvements by employing consortia rather than monocultures have not been based upon a mechanistic understanding of community function but have arisen either serendipitously or by adopting some of the most intuitive ecological principles. chief among these is the division of labor concept based on rational assembly of functional specialists, which can be observed in cellular biology (kirk, 2005), social economics (becker and murphy, 1994) and ecosystems (shapiro, 1998). division of labor among members mitigates constraints imposed by tradeoffs, whereby a population 's pursuit of one objective is realized only at the cost of an alternative objective (carlson and taffs, 2010). such inherent tradeoffs fundamentally prevent the existence of monoculture super - species that are simultaneously optimized for all niches (law, 1979). hence, when the first demonstrations of engineered division of labor in synthetic microbial consortia were reported (shou., 2007), it was not surprising that carefully assembled specialists exhibited emergent properties, such as increased robustness and productivity, compared with their respective monoculture controls. these initial studies beg the question of whether there are overarching engineering design principles that could predict how best to distribute metabolic labor across different microbial members to optimize a process objective. more specifically, how should metabolic processes be compartmentalized within different cells to optimize the performance of a desired metabolic transformation ? previous theoretical studies (pfeiffer and bonhoeffer, 2004) suggest that comprehending competition and conflict between metabolic processes could serve as a foundation for establishing such engineering design principles (johnson., 2012). for example, consider a linear metabolic pathway where a primary substrate is consumed via an intermediate to an end product by two different enzymes, and that each of these different enzymes competes for the same finite pool of intracellular resources such as atp or biomolecule precursors (weisse., 2015) or for occupancy space within a cell (beg., 2007). if the two competitive enzymes are contained within the same cell, then competition between the different enzymes could result in the accumulation of the intermediate within the cell. this would occur, for example, if the enzyme for the first metabolic transformation has preferential access to the finite supply of resources than the enzyme for the second metabolic transformation (almeida., 1995). conversely, if the two enzymes are segregated into different cells, then competition between the enzymes is eliminated, which in turn may reduce accumulation of the intermediate. this would occur, for example, if the enzyme for the first metabolic transformation no longer has preferential access to the finite supply of resources (figure 1). the main outcome is that dividing metabolic labor should minimize the accumulation of intermediates, thus reducing the negative feedback effects that those intermediates might have on the cell and facilitating the consumption of the primary substrate. indeed, the arguments above are analogous to those used for industrial assembly lines, where an important objective is to minimize the accumulation of manufacturing intermediates, thereby reducing any negative effects of accumulating those intermediates on the production of the final product. a proven design principle that has emerged from the arguments above is that the division of metabolic labor among pre - assigned specialist cells enhances the substrate conversion efficiency, often leading to gains in biomass (eiteman., 2008). this effect has special implications upon metabolite cross - feeding systems where the primary substrate is converted by one population to an inhibitory intermediate that can be concurrently consumed by a complementary specialist (bernstein., 2012). if dividing metabolic labor reduces the accumulation of toxic intermediates, enhanced mechanistic knowledge about inhibition may soon guide design of new communities with optimal reaction compartmentalization assigned to distinct members. there is some empirical evidence to support this expectation as different steps of pollutant biotransformation pathways, which produce inhibitory intermediates, are often compartmentalized within different cells across the population (de souza., 1998 ; moller., 1998 ; pelz., 1999). however, there is only limited evidence to date that dividing metabolic labor enables or promotes the consumption of inhibitory compounds. such a generalization will require cross - system comparisons where the performance of communities, in which the metabolic labor is differentially compartmentalized, can be compared. in nature, incorporation of incompatible members or processes is fostered through the development of spatial and/or temporal segregation. for example, aerobic and anaerobic microbial populations may be co - cultured within a single system containing spatially defined oxic / anoxic habitats collocated within micrometer proximities ; this can arise spontaneously (field., 1995) or by design (kim., 2008). controlling spatial partitioning of populations in artificial habitats (for example, microfluidic and biofilm reactors) is also a promising technique for rationally engineering system robustness by simultaneously mitigating competition (or other antagonisms) and promoting beneficial interactions (brenner and arnold, 2011). it has been shown that in a spatially structured environment, strongly cooperating species will intermix, whereas two species engaging in competition or commensalism will spatially segregate resulting in a laminated consortium (figure 2a ; estrela and brown, 2013 ; momeni., 2013 ; muller., 2014). another example of manipulating community spatial organization through interaction strength is based on a co - culture of sphingobium chlorophenolicum and ralstonia metallidurans engineered to perform environmental remediation (kim. s. chlorophenolicum can degrade the highly toxic environmental pollutant pentachlorophenol (pcp) but is sensitive to hg, which is often present with pcp in contaminated sites. microfluidic laminar flow techniques have been used to spatially position the pcp degrader s. chlorophenolicum in a core layer protected by an outer shell of r. metallidurans, which is a reducer of hg (figure 2b). this spatially structured community can simultaneously remove pcp and hg ; a capability not possessed by a well - mixed consortium containing the same members. physiological or metabolic incompatibilities among community members can also be resolved via temporal separation, which involves sequential activities or operation in distinct phases (bond., 1995). a well - known and ecologically critical example is diel separation of nitrogen fixation and energy acquisition via oxygenic photosynthesis in diazotrophic cyanobacteria and their associated communities (bebout., 1987). however, to our knowledge, synthetic consortia have yet to be designed specifically around a temporal separation concept, although temporal mechanisms have been specifically designed in quorum - sensing - based synthetic biology framework (garcia - ojalvo., 2004). new design principles based on concepts such as analog memory (farzadfard and lu, 2014), time - lag and temporal shifts are likely to be realized in future generations of synthetic microbial consortia platforms. the collective action of individual physiologies and resulting interactions at various scales of time and space yield systems - level community behavior that is more than sum of all parts (levin, 1992). for example, in a community comprised of two species cooperating through metabolite exchange, exogenous addition of one or both metabolites will change their relationship from cooperation to competition or commensalism, respectively, with the potential to markedly change community behaviors. in commensalism and cooperation, but not in competition, disparate species ratios can potentially converge to a steady - state value yielding non - linear response which is basis for the emergence of higher - order properties (momeni. further examples of modifying community properties through the modulation of individual behaviors have been demonstrated both in clonal populations (hu., 2010 ; 2011) and synthetic multispecies communities design based on metabolic cross - feeding (harcombe, 2010) or obligate syntrophy (zhou., 2015). it has been recognized for some time that engineered microbial consortia have the potential to be more productive and robust than monocultures (brenner., 2008). the question that remains, however, is how microbial communities can be designed and, more importantly, controlled. to date, successful examples of improvements by employing consortia rather than monocultures have not been based upon a mechanistic understanding of community function but have arisen either serendipitously or by adopting some of the most intuitive ecological principles. chief among these is the division of labor concept based on rational assembly of functional specialists, which can be observed in cellular biology (kirk, 2005), social economics (becker and murphy, 1994) and ecosystems (shapiro, 1998). division of labor among members mitigates constraints imposed by tradeoffs, whereby a population 's pursuit of one objective is realized only at the cost of an alternative objective (carlson and taffs, 2010). such inherent tradeoffs fundamentally prevent the existence of monoculture super - species that are simultaneously optimized for all niches (law, 1979). hence, when the first demonstrations of engineered division of labor in synthetic microbial consortia were reported (shou., 2007), it was not surprising that carefully assembled specialists exhibited emergent properties, such as increased robustness and productivity, compared with their respective monoculture controls. these initial studies beg the question of whether there are overarching engineering design principles that could predict how best to distribute metabolic labor across different microbial members to optimize a process objective. more specifically, how should metabolic processes be compartmentalized within different cells to optimize the performance of a desired metabolic transformation ? previous theoretical studies (pfeiffer and bonhoeffer, 2004) suggest that comprehending competition and conflict between metabolic processes could serve as a foundation for establishing such engineering design principles (johnson., 2012). for example, consider a linear metabolic pathway where a primary substrate is consumed via an intermediate to an end product by two different enzymes, and that each of these different enzymes competes for the same finite pool of intracellular resources such as atp or biomolecule precursors (weisse., 2015) or for occupancy space within a cell (beg., 2007). if the two competitive enzymes are contained within the same cell, then competition between the different enzymes could result in the accumulation of the intermediate within the cell. this would occur, for example, if the enzyme for the first metabolic transformation has preferential access to the finite supply of resources than the enzyme for the second metabolic transformation (almeida., 1995). conversely, if the two enzymes are segregated into different cells, then competition between the enzymes is eliminated, which in turn may reduce accumulation of the intermediate. this would occur, for example, if the enzyme for the first metabolic transformation no longer has preferential access to the finite supply of resources (figure 1). the main outcome is that dividing metabolic labor should minimize the accumulation of intermediates, thus reducing the negative feedback effects that those intermediates might have on the cell and facilitating the consumption of the primary substrate. indeed, the arguments above are analogous to those used for industrial assembly lines, where an important objective is to minimize the accumulation of manufacturing intermediates, thereby reducing any negative effects of accumulating those intermediates on the production of the final product. a proven design principle that has emerged from the arguments above is that the division of metabolic labor among pre - assigned specialist cells enhances the substrate conversion efficiency, often leading to gains in biomass (eiteman., 2008). this effect has special implications upon metabolite cross - feeding systems where the primary substrate is converted by one population to an inhibitory intermediate that can be concurrently consumed by a complementary specialist (bernstein., 2012). if dividing metabolic labor reduces the accumulation of toxic intermediates, enhanced mechanistic knowledge about inhibition may soon guide design of new communities with optimal reaction compartmentalization assigned to distinct members. there is some empirical evidence to support this expectation as different steps of pollutant biotransformation pathways, which produce inhibitory intermediates, are often compartmentalized within different cells across the population (de souza., 1998 ; moller., 1998 ; pelz., 1999). however, there is only limited evidence to date that dividing metabolic labor enables or promotes the consumption of inhibitory compounds. such a generalization will require cross - system comparisons where the performance of communities, in which the metabolic labor is differentially compartmentalized, can be compared. in nature, incorporation of incompatible members or processes is fostered through the development of spatial and/or temporal segregation. for example, aerobic and anaerobic microbial populations may be co - cultured within a single system containing spatially defined oxic / anoxic habitats collocated within micrometer proximities ; this can arise spontaneously (field., 1995) or by design (kim., 2008 controlling spatial partitioning of populations in artificial habitats (for example, microfluidic and biofilm reactors) is also a promising technique for rationally engineering system robustness by simultaneously mitigating competition (or other antagonisms) and promoting beneficial interactions (brenner and arnold, 2011). it has been shown that in a spatially structured environment, strongly cooperating species will intermix, whereas two species engaging in competition or commensalism will spatially segregate resulting in a laminated consortium (figure 2a ; estrela and brown, 2013 ; momeni., 2013 ; muller., 2014). another example of manipulating community spatial organization through interaction strength is based on a co - culture of sphingobium chlorophenolicum and ralstonia metallidurans engineered to perform environmental remediation (kim., 2011). s. chlorophenolicum can degrade the highly toxic environmental pollutant pentachlorophenol (pcp) but is sensitive to hg, which is often present with pcp in contaminated sites. microfluidic laminar flow techniques have been used to spatially position the pcp degrader s. chlorophenolicum in a core layer protected by an outer shell of r. metallidurans, which is a reducer of hg (figure 2b). this spatially structured community can simultaneously remove pcp and hg ; a capability not possessed by a well - mixed consortium containing the same members. physiological or metabolic incompatibilities among community members can also be resolved via temporal separation, which involves sequential activities or operation in distinct phases (bond., 1995). a well - known and ecologically critical example is diel separation of nitrogen fixation and energy acquisition via oxygenic photosynthesis in diazotrophic cyanobacteria and their associated communities (bebout., 1987). however, to our knowledge, synthetic consortia have yet to be designed specifically around a temporal separation concept, although temporal mechanisms have been specifically designed in quorum - sensing - based synthetic biology framework (garcia - ojalvo., 2004). new design principles based on concepts such as analog memory (farzadfard and lu, 2014), time - lag and temporal shifts are likely to be realized in future generations of synthetic microbial consortia platforms. the collective action of individual physiologies and resulting interactions at various scales of time and space yield systems - level community behavior that is more than sum of all parts (levin, 1992). for example, in a community comprised of two species cooperating through metabolite exchange, exogenous addition of one or both metabolites will change their relationship from cooperation to competition or commensalism, respectively, with the potential to markedly change community behaviors. in commensalism and cooperation, but not in competition, disparate species ratios can potentially converge to a steady - state value yielding non - linear response which is basis for the emergence of higher - order properties (momeni. further examples of modifying community properties through the modulation of individual behaviors have been demonstrated both in clonal populations (hu., 2010 ; moon., 2011) and synthetic multispecies communities design based on metabolic cross - feeding (harcombe, 2010) or obligate syntrophy (zhou., as generalizable biological principles governing the functioning of microbial communities continue to emerge, they will expand the foundation of biological systems design. in our view, one of the primary objectives of microbial community engineering is enhanced control over composition and behavior. ideally, advances in this field will bring to bear ability to control safety, productivity and stability of both natural and synthetic microbial ecosystems. the two fundamental approaches for managing the structure and the function of consortia may include extrinsic and intrinsic mechanisms. although extrinsic methodologies have already been established and successfully demonstrated through environmental control and introduction of selective pressure, or substrate availability (shou., 2007 ; bayer. 2014), intrinsic control through programmable regulatory circuits is a relatively new concept that has been largely applied to isogenic populations of microorganisms (elowitz and leibler, 2000 ; gardner., 2000). recent demonstrations have proven that population - level behaviors can be engineered into synthetic systems that through quorum - sensing and metabolite - sensing intrinsic devices (brenner., 2007 ; marchand and collins, 2013 ; chen., 2015). with further development of intrinsic devices that render cells capable of decision - making, the ability to control cellular behavior through logic - based operations will provide means for tighter control and a higher level of communication between members of the consortia (brophy and voigt, 2014 ; church., 2014). we envision new design concepts to take advantage of consortial modularity (figure 3) and create new opportunities for metabolic engineering by offering robust, multicellular engineering platforms that can be stabilized by metabolic coupling and forced interdependency. in fact, the state of the science is ready to conceive designs in which output(s) can be controlled and customized simply by interchanging specialist members or plug - and - play ' concept will be particularly effective for implementation of automated, intrinsic control processes designed after established feedback motifs constituting of sensor, controller and actuator system components. our perspective is that these expansions will continue to move away from the traditional monocultures which rely heavily upon cultivation of domesticated and often highly engineered strains, and move more towards multi - organism designs. traditional monoculture microbial technology is limited by poor resistance and resilience to fluctuating environmental conditions and competition from indigenous microorganisms ; designed microbial consortia may greatly increase robustness against such insults, especially in open systems (for example, raceway ponds). reconciliation of fundamental ecology with new biodesign framework is poised to overcome these barriers, drawing inspiration from the modular design of natural systems, which is a common paradigm in synthetic biology and standard for genetic recombination, device synthesis and protein engineering (purnick and weiss, 2009). the promise that this field has to offer is great not only because transformative biotechnologies will help overcome the energy, health and environmental problems of the future but also because the process of learning to design and control ecological phenomenon has and will undoubtedly continue to yield new insights on the fundamentals of life. | much research has been invested into engineering microorganisms to perform desired biotransformations ; nonetheless, these efforts frequently fall short of expected results due to the unforeseen effects of biofeedback regulation and functional incompatibility. in nature, metabolic function is compartmentalized into diverse organisms assembled into robust consortia, in which the division of labor is thought to lead to increased community efficiency and productivity. here we consider whether and how consortia can be designed to perform bioprocesses of interest beyond the metabolic flexibility limitations of a single organism. advances in post - genomic analysis of microbial consortia and application of high - resolution global measurements now offer the promise of systems - level understanding of how microbial consortia adapt to changes in environmental variables and inputs of carbon and energy. we argue that, when combined with appropriate modeling frameworks, systems - level knowledge can markedly improve our ability to predict the fate and functioning of consortia. here we articulate our collective perspective on the current and future state of microbial community engineering and control while placing specific emphasis on ecological principles that promote control over community function and emergent properties. |
amyotrophic lateral sclerosis (als) is an intractable neurodegenerative disease, characterized by rapid and progressive degeneration of motor neurons in the cerebral cortex and the spinal cord. approximately 10% of als is of familial origin caused by genetic mutations of superoxide dismutase 1 (sod1), tar dna binding protein (tardbp, tdp-43), fused in sarcoma (fus), optineurin (optn), ubiquilin 2 (ubqln2), and chromosome 9 open reading frame 72 (c9orf72).1 at present, the precise molecular mechanism underlying motor neuron degeneration in sporadic als remains unknown. increasing evidence indicates that dysfunction of oligodendrocytes plays a key role in pathological processes of als. the levels of expression of oligodendrocyte - specific monocarboxylate transporter 1, which transports lactate, an essential energy metabolite to motor neurons, are greatly reduced in the motor cortex of als patients and the spinal cord of sod1 mutant mice.2 in the spinal cord of als patients, tdp-43-positive inclusions accumulate not only in motor neurons but also in oligodendrocytes.3 extensive degeneration of gray matter oligodendrocytes is found in the motor cortex and the spinal cord of als patients.4 furthermore, genetic deletion of mutant sod1 selectively from oligodendrocytes markedly ameliorates the disease course in sod1 mutant mice.4 the basic helix loop helix (bhlh) transcription factor olig2, a downstream target of a ventralizing factor sonic hedgehog (shh) that is secreted from the notochord and floor plate, plays a pivotal role in the development and differentiation of both motor neurons and oligodendrocytes in the spinal cord.5 olig2 is expressed in a restricted domain of the spinal cord ventricular zone named progenitor of motor neuron (pmn), which is composed of a pool of progenitor cells that sequentially generate motor neurons and oligodendrocytes, supporting evidence for the shared motor neuron / oligodendrocyte lineage.6,7 in contrast, v0, v1, v2, and v3 interneurons are separately generated from the p0, p1, p2, and p3 domains, respectively.8 the pmn domain is bounded ventrally by the p3 domain defined by the expression of nk2 homeobox 2 (nkx2.2, nkx22), a homeodomain transcription factor, and dorsally by the p2 domain, whose ventral boundary is defined by the expression of iroquois related homeobox 3 (irx3), another homeodomain protein.6 both motor neurons and oligodendrocytes are almost completely lost in mice with a homozygous inactivation of olig2.9 olig2 specifies the pmn identity by direct repression of interneuron transcription programs.10 notably, in oligo1/2 double - mutant mice, pmn progenitors generate v2 interneurons and astrocytes.11 a microrna mir-173p silences the expression of olig2 in the p2 domain to generate v2 interneurons.12 olig2 plays a decisive role in the specification of the pmn domain and initiates motor neuron differentiation by inducing expression of a proneural bhlh factor neurogenin 2 (neurog2, ngn2), which drives pmn progenitors to leave the cell cycle and express differentiation markers characteristic of post - mitotic neurons.13 ngn2 expression is extinguished from the progeny destined to become oligodendrocytes, whereas the expression of olig2 is downregulated in the progeny destined to become motor neurons.14 in contrast, the expression of nkx2.2 is upregulated in pmn progenitors as they switch from producing motor neurons to generating oligodendrocytes.15 structurally, olig2 is characterized by the presence of the bhlh domain that mediates dimerization and binding to target dna sequences, often containing the core hexanucleotide motif composed of canntg named the e - box.5 the bhlh domains of olig1 and olig2 exhibit more than 80% amino acid identities. however, olig1 and olig2 exert non - overlapping biological functions attributable to differential interactions with dimeric partners and co - regulator proteins.5 olig2 favors forming a homodimer, while ser147 phosphorylation of olig2 by protein kinase a induces motor neuron differentiation by switching of dimerization partner from olig2 to ngn2.16 the levels of olig2 expression in the developing spinal cord are much higher than those of olig1, and olig2 has a broader expression pattern in the embryonic forebrain.9 furthermore, deletion of olig1 has no visible impact on the generation of motor neurons and early oligodendrocyte progenitors.5,17 olig2 generally acts as a transcriptional repressor of direct target genes.5,13 however, at present, the complete profile of olig2 target genes in both pmns and oligodendrocyte progenitor cells (opcs) remains to be intensively characterized, particularly with relevance to the pathogenesis of als. recently, an advanced next - generation sequencing (ngs) technology termed chromatin immunoprecipitation, followed by deep sequencing (chip - seq), encouraged us to characterize genome - wide profiles of dna - binding proteins and histone modifications.18 chip - seq, with the advantages of higher resolution, less noise, and greater coverage of the genome compared with microarray - based chip - chip, serves as an innovative tool for studying gene regulatory networks on the whole - genome scale. to investigate a role of olig2 in the pathogenesis of als, we attempted to characterize the comprehensive set of chip - seq - based olig2 direct target genes in pmns and opcs and their molecular networks by analyzing datasets retrieved from the public database. we retrieved an olig2 chip - seq dataset of embryonic stem cells (escs) during motor neuron differentiation from the ddbj sequence read archive (dra) (trace.ddbj.nig.ac.jp/drasearch) under the accession number of srp007566. hynek wichterle s laboratory, columbia university medical center.10 the relevant dataset numbered gse30882 is open to public since november 12, 2011. they generated a mouse esc line incorporated with a transgene composed of doxycycline (dox)-inducible olig2 tagged with the v5 epitope in the carboxyl terminal, named iolig2-v5. then, motor neuron differentiation was induced by exposure of embryoid bodies derived from escs to 1 m all - trans retinoic acid (ra, sigma) and 0.5 m smoothened agonist (sag, merck / calbiochem), an agonist of hedgehog signaling. this was followed by a 24-hour treatment with 1 g / ml dox starting on day 3, resulting in differentiation of motor neurons progenitors (pmns) expressing an olig2-v5 fusion protein, along with endogenous olig2 (olig2-v5pmns). in some experiments, pmn cells untreated with dox (olig2-v5 pmns) were utilized to detect binding sites for an endogenous olig2 protein. sonicated nuclear extracts were immunoprecipitated with a rabbit polyclonal anti - olig2 antibody (ab15328, mil - lipore) for chip of olig2-v5 pmns (srr315585), a rabbit polyclonal anti - v5 antibody (ab15828, abcam) for chip of olig2-v5 pmns (srr315586), or with ab15828 for chip of olig2-v5 pmns serving as a negative control (srr315590). ngs libraries constructed from adapter - ligated chip dna fragments were processed for deep sequencing on genome analyzer iix (illumina). to compare olig2 target genes in pmns with those in opcs, we retrieved another olig2 chip - seq dataset from dra under the accession number of srp015333. qing richard lu s laboratory, university of texas southwestern medical center.19 the relevant dataset numbered gse40506 is open to public since august 31, 2012. in their experiment, purified opcs isolated from newborn rat cerebral cortices at p2 were grown in the opc growth medium containing 10 ng / ml platelet - derived growth factor (pdgf)-aa and 20 ng / ml basic fibroblast growth factor (bfgf). then, they were incubated for 3 days in the oligodendrocyte differentiation medium containing 15 nm triiodothyronine (t3) and 10 ng / ml ciliary neurotrophic factor (cntf). sonicated nuclear extracts were immunoprecipitated with a rabbit polyclonal anti - olig2 antibody (ab136253, abcam) for chip of the endogenous olig2 protein expressed in differentiating oligodendrocytes (srr548313), or with rabbit anti - human igg (ab2410, abcam) serving as a negative control (srr548314). ngs libraries constructed from adapter - ligated chip dna fragments were processed for deep sequencing on genome analyzer iix. to study the involvement of olig2 target genes in motor neuron degeneration in vivo in an animal model of als, we first retrieved a rna - seq dataset from dra under the accession number of srp013849. s laboratory, yale university school of medicine.20 the relevant dataset numbered gse38820 is open to public since december 4, 2012. in their experiment, motor neuron cell bodies were isolated by laser - captured microdissection (lcm) from spinal cords of transgenic mouse strains at 3 months of age in the presymptomatic stage, including wild - type sod1-yfp (strain 592 ; srr515121 and srr515122) and mutant g85r sod1-yfp (strain 737 ; srr515123 and srr515124). total rna extracted from pooled motor neuron cell bodies was subjected to polya selection, fragmentation, cdna synthesis, adaptor ligation, and library amplification. ngs libraries were processed for single - end sequencing on genome analyzer iix. to verify a pivotal role of olig2 target genes in vivo in als patients, next we retrieved another oleg butovsky s laboratory, brigham and women s hospital, harvard medical school.21 the relevant dataset numbered gse52946 is open to public since november 24, 2014. in their experiment, whole lumbar spinal cord tissues were isolated from eight sporadic and two familial als (sod1 a4v) patients and 10 healthy control subjects according to the guideline approved by the institutional review boards at massachusetts general hospital and brigham and women s hospital. total rna was extracted by using mirvana mirna isolation kit (ambion) according to the manufacturer s protocol. paired - end rna - seq analysis was performed on hiseq 2000 (illumina) in the harvard genetic facility. first, we evaluated the quality of ngs short reads by searching on the fastqc program (www.bioinformatics.babraham.ac.uk/projects/fastqc). then, we removed the reads of insufficient quality by filtering them out by the fastx toolkit (hannonlab.cshl.edu/fastx_toolkit). for chip - seq analysis, we mapped the cleaned data on the mouse genome reference sequence version mm9 or the rat genome reference sequence version rn4 by a mapping tool named cobweb of the strand ngs2.0 program, formerly named avadis ngs (strand genomics) or by bowtie version 1.0.0 or 2.1.0 (bowtie-bio.sourceforge.net). then, we identified the peaks of the binding sites by using the model - based analysis of chip - seq (macs) program, as described previously.22 we determined the genes corresponding to the peaks by a neighboring gene analysis tool of strand ngs in the setting within a distance of 5000 bp from peaks to genes. we identified the consensus motif sequences surrounding the peaks by using the gadem program23 and the genomic location of binding peaks by a peak - finding tool of strand ngs. we imported the processed data into a genome viewer named genomejack v1.4 (mitsubishi space software).22 for rna - seq analysis, after removing poly - a tails and low - quality reads from ngs short - read data, we mapped them on mm9 or hg19 by tophat version 2.0.9 (ccb.jhu.edu/software/tophat/index.shtml), and identified differentially expressed genes that satisfied the significance expressed as q - value (fdr - adjusted p - value) 0.01 by cufflinks version 2.1.1 (cufflinks.cbcb.umd.edu). to identify molecular networks biologically relevant to chip - seq - based olig2 target genes, we imported the corresponding entrez gene ids into the functional annotation tool of database for annotation, visualization and integrated discovery (david) v6.7 (david.abcc.ncifcrf.gov).24 david identifies relevant pathways constructed by the kyoto encyclopedia of genes and genomes (kegg), composed of the genes enriched in the given set, followed by statistical evaluation by a modified fisher s exact test after correction by bonferroni multiple comparison test. kegg (www.kegg.jp) is a publicly accessible knowledge base that covers a wide range of pathway maps on metabolic, genetic, environmental, and cellular processes, as well as human diseases, and is currently composed of 381,274 pathways generated from 473 reference pathways.25 we also imported entrez gene ids into ingenuity pathways analysis (ipa) (ingenuity systems ; www.ingenuity.com). ipa is a commercial knowledge base that contains approximately 3,000,000 biological and chemical interactions and functional annotations with definite scientific evidence. by uploading the list of gene ids, the network - generation algorithm identifies focused genes integrated in global molecular pathways and networks in the setting of 70 molecules per network. ipa calculates the score p - value that reflects the statistical significance of association between the genes and the pathways or networks by the fisher s exact test. keymolnet (km data ; www.km-data.jp), another commercial knowledge base, contains manually curated contents on 164,000 relationships among human genes and proteins, small molecules, diseases, pathways, and drugs.26 they include the core contents collected from selected review articles with the highest reliability. by importing the list of gene i d, keymolnet automatically provides the corresponding molecules as nodes on the network. the neighboring network - search algorithm selected one or more molecules as starting points to generate the network of all kinds of molecular interactions around starting molecules, including direct activation / inactivation, transcriptional activation / repression, and the complex formation within one path from the starting points. the generated network was compared side by side with 501 human canonical pathways of the keymolnet library. the algorithm, which counts the number of overlapping molecular relations between the extracted network and the canonical pathway, makes it possible to identify the canonical pathway showing the most significant contribution to the extracted network. we retrieved an olig2 chip - seq dataset of embryonic stem cells (escs) during motor neuron differentiation from the ddbj sequence read archive (dra) (trace.ddbj.nig.ac.jp/drasearch) under the accession number of srp007566. hynek wichterle s laboratory, columbia university medical center.10 the relevant dataset numbered gse30882 is open to public since november 12, 2011. they generated a mouse esc line incorporated with a transgene composed of doxycycline (dox)-inducible olig2 tagged with the v5 epitope in the carboxyl terminal, named iolig2-v5. then, motor neuron differentiation was induced by exposure of embryoid bodies derived from escs to 1 m all - trans retinoic acid (ra, sigma) and 0.5 m smoothened agonist (sag, merck / calbiochem), an agonist of hedgehog signaling. this was followed by a 24-hour treatment with 1 g / ml dox starting on day 3, resulting in differentiation of motor neurons progenitors (pmns) expressing an olig2-v5 fusion protein, along with endogenous olig2 (olig2-v5pmns). in some experiments, pmn cells untreated with dox (olig2-v5 pmns) were utilized to detect binding sites for an endogenous olig2 protein. sonicated nuclear extracts were immunoprecipitated with a rabbit polyclonal anti - olig2 antibody (ab15328, mil - lipore) for chip of olig2-v5 pmns (srr315585), a rabbit polyclonal anti - v5 antibody (ab15828, abcam) for chip of olig2-v5 pmns (srr315586), or with ab15828 for chip of olig2-v5 pmns serving as a negative control (srr315590). ngs libraries constructed from adapter - ligated chip dna fragments were processed for deep sequencing on genome analyzer iix (illumina). to compare olig2 target genes in pmns with those in opcs, we retrieved another olig2 chip - seq dataset from dra under the accession number of srp015333. qing richard lu s laboratory, university of texas southwestern medical center.19 the relevant dataset numbered gse40506 is open to public since august 31, 2012. in their experiment, purified opcs isolated from newborn rat cerebral cortices at p2 were grown in the opc growth medium containing 10 ng / ml platelet - derived growth factor (pdgf)-aa and 20 ng / ml basic fibroblast growth factor (bfgf). then, they were incubated for 3 days in the oligodendrocyte differentiation medium containing 15 nm triiodothyronine (t3) and 10 ng / ml ciliary neurotrophic factor (cntf). sonicated nuclear extracts were immunoprecipitated with a rabbit polyclonal anti - olig2 antibody (ab136253, abcam) for chip of the endogenous olig2 protein expressed in differentiating oligodendrocytes (srr548313), or with rabbit anti - human igg (ab2410, abcam) serving as a negative control (srr548314). ngs libraries constructed from adapter - ligated chip dna fragments were processed for deep sequencing on genome analyzer iix. to study the involvement of olig2 target genes in motor neuron degeneration in vivo in an animal model of als, we first retrieved a rna - seq dataset from dra under the accession number of srp013849. arthur l. horwich s laboratory, yale university school of medicine.20 the relevant dataset numbered gse38820 is open to public since december 4, 2012. in their experiment, motor neuron cell bodies were isolated by laser - captured microdissection (lcm) from spinal cords of transgenic mouse strains at 3 months of age in the presymptomatic stage, including wild - type sod1-yfp (strain 592 ; srr515121 and srr515122) and mutant g85r sod1-yfp (strain 737 ; srr515123 and srr515124). total rna extracted from pooled motor neuron cell bodies was subjected to polya selection, fragmentation, cdna synthesis, adaptor ligation, and library amplification. ngs libraries were processed for single - end sequencing on genome analyzer iix. to verify a pivotal role of olig2 target genes in vivo in als patients, next we retrieved another oleg butovsky s laboratory, brigham and women s hospital, harvard medical school.21 the relevant dataset numbered gse52946 is open to public since november 24, 2014. in their experiment, whole lumbar spinal cord tissues were isolated from eight sporadic and two familial als (sod1 a4v) patients and 10 healthy control subjects according to the guideline approved by the institutional review boards at massachusetts general hospital and brigham and women s hospital. total rna was extracted by using mirvana mirna isolation kit (ambion) according to the manufacturer s protocol. paired - end rna - seq analysis was performed on hiseq 2000 (illumina) in the harvard genetic facility. first, we evaluated the quality of ngs short reads by searching on the fastqc program (www.bioinformatics.babraham.ac.uk/projects/fastqc). then, we removed the reads of insufficient quality by filtering them out by the fastx toolkit (hannonlab.cshl.edu/fastx_toolkit). for chip - seq analysis, we mapped the cleaned data on the mouse genome reference sequence version mm9 or the rat genome reference sequence version rn4 by a mapping tool named cobweb of the strand ngs2.0 program, formerly named avadis ngs (strand genomics) or by bowtie version 1.0.0 or 2.1.0 (bowtie-bio.sourceforge.net). then, we identified the peaks of the binding sites by using the model - based analysis of chip - seq (macs) program, as described previously.22 we determined the genes corresponding to the peaks by a neighboring gene analysis tool of strand ngs in the setting within a distance of 5000 bp from peaks to genes. we identified the consensus motif sequences surrounding the peaks by using the gadem program23 and the genomic location of binding peaks by a peak - finding tool of strand ngs. we imported the processed data into a genome viewer named genomejack v1.4 (mitsubishi space software).22 for rna - seq analysis, after removing poly - a tails and low - quality reads from ngs short - read data, we mapped them on mm9 or hg19 by tophat version 2.0.9 (ccb.jhu.edu/software/tophat/index.shtml), and identified differentially expressed genes that satisfied the significance expressed as q - value (fdr - adjusted p - value) 0.01 by cufflinks version 2.1.1 (cufflinks.cbcb.umd.edu). to identify molecular networks biologically relevant to chip - seq - based olig2 target genes, we imported the corresponding entrez gene ids into the functional annotation tool of database for annotation, visualization and integrated discovery (david) v6.7 (david.abcc.ncifcrf.gov).24 david identifies relevant pathways constructed by the kyoto encyclopedia of genes and genomes (kegg), composed of the genes enriched in the given set, followed by statistical evaluation by a modified fisher s exact test after correction by bonferroni multiple comparison test. kegg (www.kegg.jp) is a publicly accessible knowledge base that covers a wide range of pathway maps on metabolic, genetic, environmental, and cellular processes, as well as human diseases, and is currently composed of 381,274 pathways generated from 473 reference pathways.25 we also imported entrez gene ids into ingenuity pathways analysis (ipa) (ingenuity systems ; www.ingenuity.com). ipa is a commercial knowledge base that contains approximately 3,000,000 biological and chemical interactions and functional annotations with definite scientific evidence. by uploading the list of gene ids, the network - generation algorithm identifies focused genes integrated in global molecular pathways and networks in the setting of 70 molecules per network. ipa calculates the score p - value that reflects the statistical significance of association between the genes and the pathways or networks by the fisher s exact test. keymolnet (km data ; www.km-data.jp), another commercial knowledge base, contains manually curated contents on 164,000 relationships among human genes and proteins, small molecules, diseases, pathways, and drugs.26 they include the core contents collected from selected review articles with the highest reliability. by importing the list of gene i d, keymolnet automatically provides the corresponding molecules as nodes on the network. the neighboring network - search algorithm selected one or more molecules as starting points to generate the network of all kinds of molecular interactions around starting molecules, including direct activation / inactivation, transcriptional activation / repression, and the complex formation within one path from the starting points. the generated network was compared side by side with 501 human canonical pathways of the keymolnet library. the algorithm, which counts the number of overlapping molecular relations between the extracted network and the canonical pathway, makes it possible to identify the canonical pathway showing the most significant contribution to the extracted network. first, we evaluated the quality of chip - seq data reanalyzed in the present study. after cleaning short - read data, the quality scores exceeded 20 across the bases on fastqc, indicating an acceptable quality of the data for downstream analysis (supplementary fig. after mapping cleaned data on mm9 by cobweb, we identified 43,419 chip - seq peaks for the binding sites of the endogenous olig2 protein and 24,112 chip - seq peaks for binding sites of the olig2-v5 fusion protein in mouse esc - derived pmns progenitors. we extracted the set of 20,043 peaks shared between both as the most reliable set of olig2 chip - seq peaks. from these, we collected the peaks located within a distance of 5000 bp from protein coding genes. finally, we identified a set of 5966 olig2 target genes that satisfied fold enrichment (fe) 10 and false discovery rate (fdr) 0.1 (supplementary table 1). importantly, the list contained previously reported olig2 direct targets,10,19 such as nkx2.2 (fe = 353.7) (fig. 1), zeb2 (sip1, fe = 88.5), pax6 (fe = 87.4), and irx3 (fe = 24.8). furthermore, we identified trp53 (fe = 108.4) and ngn2 (ef = 28.6) as a category of unreported olig2 targets (supplementary table 1). the peaks were distributed in the upstream (12.9%), 5utr (11.8%), 3utr (2.0%), coding exonic (13.1%), and intronic (54.3%) regions. the motif analysis by gadem revealed a relative enrichment of the e - box consensus sequence defined as 5-cagctg-3 located within genomic regions surrounding chip - seq peaks (fig. 1 and supplementary fig. next, we studied olig2 target genes in rat opcs by mapping chip - seq data on rn4 by cobweb. we identified 10,756 chip - seq peaks in opcs upon differentiation into oligodendrocytes. from these, we extracted the peaks located within a distance of 5000 bp from protein coding genes. finally, we identified a set of 1553 olig2 target genes that satisfied fe 10 and fdr 0.1 (supplementary table 2). the peaks were distributed in the upstream (9.2%), 5utr (11.8%), 3utr (1.3%), coding exonic (10.4%), and intronic (59.5%) regions. importantly, the set of 740 genes among them were overlapped between pmns and opcs (supplementary table 3, underlined in supplementary tables 1 and 2). importantly, functional annotation analysis by david showed that 320 genes (43.2%) out of the set of 740 olig2 target genes overlapping between pmns and opcs were significantly related to alternative splicing in the swiss - prot (sp)/protein information resource (pir) keyword (p = 3.73e31 corrected by bonferonni ; underlined in supplementary table 3). next, we studied molecular networks of olig2 target genes by using three distinct pathway analysis tools of bioinformatics. by using david, we identified functionally associated gene ontology (go) terms. for 5966 olig2 targets in pmns, (go:0005886 ; p = 5.54e18) for cellular component, and metal ion binding (go:0046872 ; p = 6.46e20) for molecular function. for 1533 olig2 targets in opcs, (go:0007242 ; p = 2.53e05) for biological process, plasma membrane (go:0005886 ; (go:0043167 ; p = 3.07e04) for molecular function. by kegg pathway analysis, the set of 5966 olig2 targets in pmns showed a significant relationship with top three pathways defined as (mmu04340 ; rank 18, p = 0.033), where patched homolog 1 (ptch1), the receptor for shh, corresponded to one of olig2 targets (table 1). from the 5966 genes described above, we extracted the set of 4717 olig2 target genes that satisfied 10 times more stringent fdr (fdr 0.01) (supplementary table 4). we imported them into the functional annotation tool of david to identify relevant kegg pathways. again, we found that the set of 4717 olig2 target genes in pmn showed the most significant relationship with (mmu04360 ; p = 1.76e09 corrected by bonferroni), pathways in cancer (mmu05200 ; (mmu04510 ; p = 2.7304), validating the reliability of initial results. for the 1533 olig2 targets in opcs, mapk signaling pathway (rno04010 ; p = 1.49e05 corrected by bonferroni), long - term depression next, we studied molecular networks of 5966 olig2 targets in pmns by using the core analysis tool of ipa. (p = 3.64e15), well consistent with the results of kegg. for the 1533 olig2 targets in opcs ipa also identified functional networks highly relevant to the 5966 olig2 targets in pmns, defined as cancer, cell - to - cell signaling and interaction, cellular assembly and organization (p = 1.00e54), auditory disease, connective tissue disorders, dermatological diseases and conditions (p = 1.00e54), cancer, gastrointestinal disease, organismal injury and abnormalities (p = 1.00e52), and rna post - transcriptional modification, embryonic development, hair and skin development and function (p = 1.00e52), where both cul1 (cullin 1) and cul3 (cullin 3), which constitute the cullin - ring ubiquitin ligase (crl) complex, play a central role in the olig2 target gene network (fig. ipa identified a functional network defined as cell death and survival, cellular compromise, neurological disease next, we studied molecular networks of the 5966 olig2 targets in pmns by using keymolnet. the neighboring network - search algorithm extracted the extremely complex network composed of 5839 molecules and 13,818 molecular relations (supplementary fig. (p = 1.68e237). for the 1533 olig2 targets in opcs, keymolnet identified the highly complex network showing the most significant relationship with finally, we studied a possible role of olig2 target genes in the process of motor neuron degeneration in a mouse model of als and lumbar spinal cord tissues of als patients. we identified the set of 277 genes downregulated in lcm - purified spinal cord motor neurons derived from presymptomatic sod1 g85r transgenic mice, which satisfied a q - value 0.01 and log2 fold change 1.0 (supplementary table 5). among them, the set of 77 genes (27.8%) corresponded to olig2 target genes in pmns (table 2, underlined in supplementary table 5). we also identified the set of 1583 genes downregulated in lumbar spinal cord tissues of als patients, which satisfied a q - value 0.01 and log2 fold change 1.0 (supplementary table 6). among them, the set of 473 genes (29.9%) corresponded to olig2 target genes in pmns (underlined in supplementary table 6). since olig2 generally acts as a transcriptional repressor of direct target genes,5,13 these results suggest that downregulation of olig2 target genes possibly due to overactivation of olig2 plays a key role in progression of motor neuron degeneration both in mutant sod mice and in als patients. first, we evaluated the quality of chip - seq data reanalyzed in the present study. after cleaning short - read data, the quality scores exceeded 20 across the bases on fastqc, indicating an acceptable quality of the data for downstream analysis (supplementary fig. after mapping cleaned data on mm9 by cobweb, we identified 43,419 chip - seq peaks for the binding sites of the endogenous olig2 protein and 24,112 chip - seq peaks for binding sites of the olig2-v5 fusion protein in mouse esc - derived pmns progenitors. we extracted the set of 20,043 peaks shared between both as the most reliable set of olig2 chip - seq peaks. from these, we collected the peaks located within a distance of 5000 bp from protein coding genes. finally, we identified a set of 5966 olig2 target genes that satisfied fold enrichment (fe) 10 and false discovery rate (fdr) 0.1 (supplementary table 1). importantly, the list contained previously reported olig2 direct targets,10,19 such as nkx2.2 (fe = 353.7) (fig. 1), zeb2 (sip1, fe = 88.5), pax6 (fe = 87.4), and irx3 (fe = 24.8). furthermore, we identified trp53 (fe = 108.4) and ngn2 (ef = 28.6) as a category of unreported olig2 targets (supplementary table 1). the peaks were distributed in the upstream (12.9%), 5utr (11.8%), 3utr (2.0%), coding exonic (13.1%), and intronic (54.3%) regions. the motif analysis by gadem revealed a relative enrichment of the e - box consensus sequence defined as 5-cagctg-3 located within genomic regions surrounding chip - seq peaks (fig. 1 and supplementary fig. next, we studied olig2 target genes in rat opcs by mapping chip - seq data on rn4 by cobweb. we identified 10,756 chip - seq peaks in opcs upon differentiation into oligodendrocytes. from these, we extracted the peaks located within a distance of 5000 bp from protein coding genes. finally, we identified a set of 1553 olig2 target genes that satisfied fe 10 and fdr 0.1 (supplementary table 2). the peaks were distributed in the upstream (9.2%), 5utr (11.8%), 3utr (1.3%), coding exonic (10.4%), and intronic (59.5%) regions. importantly, the set of 740 genes among them were overlapped between pmns and opcs (supplementary table 3, underlined in supplementary tables 1 and 2). importantly, functional annotation analysis by david showed that 320 genes (43.2%) out of the set of 740 olig2 target genes overlapping between pmns and opcs were significantly related to alternative splicing in the swiss - prot (sp)/protein information resource (pir) keyword (p = 3.73e31 corrected by bonferonni ; underlined in supplementary table 3). next, we studied molecular networks of olig2 target genes by using three distinct pathway analysis tools of bioinformatics. by using david, we identified functionally associated gene ontology (go) terms. for 5966 olig2 targets in pmns, the most significant go terms included cell morphogenesis (go:0000902 ; p = 3.17e16 corrected by bonferroni) for biological process, plasma membrane (go:0005886 ; p = 5.54e18) for cellular component, and metal ion binding (go:0046872 ; p = 6.46e20) for molecular function. for 1533 olig2 targets in opcs, (go:0005886 ; p = 1.13e05) for cellular component, and ion binding (go:0043167 ; p = 3.07e04) for molecular function. by kegg pathway analysis, the set of 5966 olig2 targets in pmns showed a significant relationship with top three pathways defined as (mmu05200 ; p = 5.08e08 corrected by bonferonni), axon guidance (mmu04360 ; p = 1.76e09) (fig. 3) and hedgehog signaling pathway (mmu04340 ; rank 18, p = 0.033), where patched homolog 1 (ptch1), the receptor for shh, corresponded to one of olig2 targets (table 1). from the 5966 genes described above, we extracted the set of 4717 olig2 target genes that satisfied 10 times more stringent fdr (fdr 0.01) (supplementary table 4). we imported them into the functional annotation tool of david to identify relevant kegg pathways. again, we found that the set of 4717 olig2 target genes in pmn showed the most significant relationship with (mmu04360 ; p = 1.76e09 corrected by bonferroni), pathways in cancer (mmu05200 ; (mmu04510 ; p = 2.7304), validating the reliability of initial results. for the 1533 olig2 targets in opcs, the top three kegg pathways included (rno04010 ; p = 1.49e05 corrected by bonferroni), long - term depression (rno04730 ; p = 3.34e05), and vascular smooth muscle contraction (rno04270 ; p = 3.57e03). next, we studied molecular networks of 5966 olig2 targets in pmns by using the core analysis tool of ipa. (p = 3.64e15), well consistent with the results of kegg. for the 1533 olig2 targets in opcs ipa also identified functional networks highly relevant to the 5966 olig2 targets in pmns, defined as cancer, cell - to - cell signaling and interaction, cellular assembly and organization (p = 1.00e54), auditory disease, connective tissue disorders, dermatological diseases and conditions (p = 1.00e54), cancer, gastrointestinal disease, organismal injury and abnormalities (p = 1.00e52), and rna post - transcriptional modification, embryonic development, hair and skin development and function (p = 1.00e52), where both cul1 (cullin 1) and cul3 (cullin 3), which constitute the cullin - ring ubiquitin ligase (crl) complex, play a central role in the olig2 target gene network (fig., ipa identified a functional network defined as cell death and survival, cellular compromise, neurological disease next, we studied molecular networks of the 5966 olig2 targets in pmns by using keymolnet. the neighboring network - search algorithm extracted the extremely complex network composed of 5839 molecules and 13,818 molecular relations (supplementary fig. finally, we studied a possible role of olig2 target genes in the process of motor neuron degeneration in a mouse model of als and lumbar spinal cord tissues of als patients. we identified the set of 277 genes downregulated in lcm - purified spinal cord motor neurons derived from presymptomatic sod1 g85r transgenic mice, which satisfied a q - value 0.01 and log2 fold change 1.0 (supplementary table 5). among them, the set of 77 genes (27.8%) corresponded to olig2 target genes in pmns (table 2, underlined in supplementary table 5). we also identified the set of 1583 genes downregulated in lumbar spinal cord tissues of als patients, which satisfied a q - value 0.01 and log2 fold change 1.0 (supplementary table 6). among them, the set of 473 genes (29.9%) corresponded to olig2 target genes in pmns (underlined in supplementary table 6). since olig2 generally acts as a transcriptional repressor of direct target genes,5,13 these results suggest that downregulation of olig2 target genes possibly due to overactivation of olig2 plays a key role in progression of motor neuron degeneration both in mutant sod mice and in als patients. als is a fatal neurodegenerative disease that chiefly affects motor neurons in the brain and spinal cord. all motor neurons in the spinal cord arise from a common set of progenitor cells located within the pmn domain.6,7 recent studies have convincingly indicated an active involvement of oligodendrocyte dysfunction in the pathogenesis of als.24 olig2, expressed selectively by pmn progenitor cells, plays an indispensable role in the development and differentiation of both motor neurons and oligodendrocytes in the spinal cord.59 here, we characterized the comprehensive set of chip - seq - based olig2 direct target genes and their molecular networks in pmns and opcs with relevance to the pathogenesis of als. first, we identified a reproducible set of 5966 olig2 target genes in pmns from the chip - seq dataset numbered srp007566. they included previously reported olig2 direct targets in pmns, such as nkx2.2, pax6, and irx3,10 supporting the validity of our results. next, we identified the cardinal set of 1553 olig2 target genes in opcs from the chip - seq dataset numbered srp015333. then, we extracted the core set of 740 olig2 target genes overlapping between pmns and opcs. alternative splicing in the category of sp / pir keywords are highly enriched in olig2 targets shared between pmns and opcs. increasing evidence indicates that rna metabolism, including regulation of transcription and alternative splicing, is profoundly disturbed in als.27,28 notably, tdp-43 (tardbp) and fus, both of which are causative genes of familial als and play a key role in rna processing and regulation of exon splicing, are mislocated from the nucleus to the cytoplasm in degenerating motor neurons of als.29 most importantly, we found that approximately one - third of the downregulated genes in lcm - purified spinal cord motor neurons of presymptomatic sod1 g85r transgenic mice, as well as in lumbar spinal cord tissues of als patients, correspond to olig2 targets in pmns, suggesting an involvement of overactivation of olig2 in the pathogenesis of als, beginning from the very early stage of the disease. we intensively studied molecular networks of olig2 target genes in pmns and opcs. by analyzing with kegg and ipa, molecular mechanisms and pathways in cancer and axon guidance signaling, while 1533 olig2 target genes in opcs exhibited relevance to synaptic long term depression, mapk signaling pathway, and wnt/-catenin signaling. interestingly, synaptic plasticity regulated by a balance between long - term depression and potentiation is altered in the brain of sod g93a transgenic mice.30 conditional ablation of erk1/2 in oligodendrocytes in the adult cns reduces the expression of a key transcription factor named the myelin gene regulatory factor (myrf), which is indispensable for myelin gene expression.31 protein levels of wnt4 and wnt inhibitory factor-1 (wif1) are elevated in the spinal cord of sod1 g93a mice.32 smad - interacting protein-1 (sip1 ; zeb2) activates smad7 that antagonizes the bone morphogenetic protein (bmp) and wnt/-catenin signaling pathways pivotal for the development of astrocytes.19 olig2 binds to the motor neuron and pancreas homeobox 1 (mnx1, hb9) promoter and represses its transcription to keep the replication - competent state of pmns during neural tube development.14 olig2 binds to the promoter of cyclin - dependent kinase inhibitor 1a (cdkn1a, p21) and directly suppresses its expression.33 we identified zeb2 (sip1), mnx1, and cdkn1a as olig2 targets in pmns. these results suggest that olig2 downregulates a wide range of target genes involved in diverse neuronal and glial functions under physiological conditions during development to avoid premature differentiation of olig2-expressing cells and under pathological conditions to suppress oncogenesis of these cells. however, olig2 is expressed in not only normal mature oligodendrocytes but also oligodendroglioma and diffuse glioma irrespective of their grades.34 furthermore, we found a close relationship between olig2 targets in pmns and kegg glioma pathway. the apparent discrepancies might be derived from the proliferative functions of olig2 affected by post - transcriptional modifications, which are largely controlled in neural progenitor cells by developmentally regulated phosphorylation of a triplet serine motif of ser10, ser13, and ser14 located on the n - terminus of olig2.35 olig2, phosphorylated at the triplet serine motif and expressed in p53-positive human gliomas, inhibits biological responses to p53.36 interestingly, keymolnet indicated that the molecular network of olig2 targets in pmns is the most relevant to the network of transcriptional regulation by p53. the ubiquitin - proteasome system, pivotal for protein turnover to prevent accumulation of abnormal proteins in the cell, is severely compromised in als.37 ipa showed that olig2 target genes in pmns have relevance to the functional network defined as rna post - transcriptional modification, embryonic development, hair and skin development and function, where cul1 and cul3, both of which are central components of the crl complex involved in regulation of protein quality control, serve as a hub in the olig2 target gene network. these observations suggest the possibility that even subtle overactivation of olig2 could induce a serious defect in physiological function of the crl complex essential for cellular protein homeostasis, leading to neurodegeneration due to accumulation of disease - associated proteins.38 by reanalyzing chip - seq datasets, we identified the set of 5966 olig2 target genes in pmns and the set of 1553 olig2 target genes in opcs. the genes related to the sp / pir keyword alternative splicing are clustered in the core set of 740 targets overlapping between pmns and opcs. approximately one - third of downregulated genes in purified motor neurons of presymptomatic mutant sod1 transgenic mice and in lumbar spinal cord tissues of als patients correspond to olig2 target genes in pmns. molecular network analysis suggests that olig2 downregulates a wide range of target genes involved in diverse neuronal and glial functions. we identified a novel olig2 target gene network composed of the crl complex, which is possibly involved in clearance of disease - associated proteins. these observations lead to a novel hypothesis that aberrant regulation of olig2 function, by affecting biology of both motor neurons and oligodendrocytes, might be involved in the pathogenesis of als. supplementary figure 1. fastqc profile of five chip - seq data analyzed in the present study. fastq format files of cleaned short read ngs data derived from srr315585 (panel a), srr315586 (panel b), srr315590 (panel c), srr548313 (panel d), and srr548314 (panel e) were imported into the fastqc program. the per - base sequence quality score is shown with the median (red line), the mean (blue line), and the interquartile range (yellow box). the consensus motif sequence surrounding olig2 chip - seq peaks was identified by gadem. the canonical e - box consensus sequence defined as 5-canntg-3 were found on 2376 peaks among a total of 20,043 peaks in pmns detected by macs. entrez gene ids of 5966 olig2 target genes in pmns were imported into the functional annotation tool of david. glioma pathway (mmu05214) as the 17th rank pathway (table 1). the neighboring network - search algorithm extracted the extremely complex network composed of 5839 molecules and 13,818 molecular relations, showing the most significant relationship with white nodes exhibit additional nodes extracted automatically from the core contents of keymolnet to establish molecular connections. the molecular relation is indicated by solid line with arrow (direct binding or activation), solid line with arrow and stop (direct inactivation), solid line without arrow (complex formation), dash line with arrow (transcriptional activation), and dash line with arrow and stop (transcriptional repression). the set of 5,966 chip - seq - based olig2 target genes in motor neuron progenitor cells. the set of 1,553 chip - seq - based olig2 target genes in oligodendrocyte progenitor cells. the set of 740 olig2 target genes overlapping bewteen motor neuron progenitor cells and oligodendrocyte progenitor cells. the highly stringent set of 4,717 chip - seq - based olig2 target genes in motor neuron progenitor cells. the set of 277 genes downregu - lated in motor neurons of mutant sod1 transgenic mice supplementary table 6. the set of 1,583 genes down - regulated in lumbar spinal cord tissues of als. | backgroundamyotrophic lateral sclerosis (als) is an intractable neurodegenerative disease that primarily affects motor neurons in the cerebral cortex and the spinal cord. recent evidence indicates that dysfunction of oligodendrocytes is implicated in the pathogenesis of als. the basic helix loop helix (bhlh) transcription factor olig2 plays a pivotal role in the development of both motor neurons and oligodendrocytes in the progenitor of motor neuron (pmn) domain of the spinal cord, supporting evidence for the shared motor neuron / oligodendrocyte lineage. however, a comprehensive profile of olig2 target genes in pmns and oligodendrocyte progenitor cells (opcs) with relevance to the pathogenesis of als remains to be characterized.methodsby analyzing the chip - seq datasets numbered srp007566 and srp015333 with the strand ngs program, we identified genome - wide olig2 target genes in pmns and opcs, followed by molecular network analysis using three distinct bioinformatics tools.resultswe identified 5966 olig2 target genes in pmns, including nkx2.2, pax6, irx3, ngn2, zep2 (cip1), trp3, mnx1 (hb9), and cdkn1a, and 1553 genes in opcs. the genes closely related to the keyword alternative splicing were enriched in the set of 740 targets overlapping between pmns and opcs. furthermore, approximately one - third of downregulated genes in purified motor neurons of presymptomatic mutant sod1 transgenic mice and in lumbar spinal cord tissues of als patients corresponded to olig2 target genes in pmns. molecular networks of olig2 target genes indicate that olig2 regulates a wide range of genes essential for diverse neuronal and glial functions.conclusionsthese observations lead to a hypothesis that aberrant regulation of olig2 function, by affecting biology of both motor neurons and oligodendrocytes, might be involved in the pathogenesis of als. |
melanocortin 1 (mc1) receptor is an attractive molecular target for melanoma imaging because of its overexpression on both murine and human melanoma cells. recently, we have identified a class of tc - labeled -melanocyte stimulating hormone (-msh) peptides to target mc1 receptors for melanoma imaging. specifically, the cyclic rxd motifs { arg - x - asp - dtyr - asp, x = gly, ala, val, thr, ser, nle, phe, and dphe } were attached to [cys, d - phe, arg]-msh313 via a lysine linker to yield rxd - lys-(arg)ccmsh peptides. interestingly, single amino acid at the x position yielded a profound impact on the melanoma targeting and clearance properties of tc - rxd - lys-(arg)ccmsh peptides. for instance, the substitution of gly in tc - rgd - lys-(arg)ccmsh with ala, thr, val, and ser improved the mc1 receptor binding affinities and enhanced the melanoma uptake in b16/f1 melanoma - bearing c57 mice. on the other hand, the substitution of gly in tc - rgd - lys-(arg)ccmsh with nle decreased the mc1 receptor binding affinity. although the substitution of gly in tc - rgd - lys-(arg)ccmsh with phe and dphe increased the mc1 receptor binding affinities, both tc - rfd - lys-(arg)ccmsh and tc - rfd - lys-(arg)ccmsh exhibited much higher liver uptake as compared to tc - rgd - lys-(arg)ccmsh. despite the promising melanoma targeting results, extremely high renal uptake (67135% id / g at 2 h postinjection) is a common issue associated with tc - rxd - lys-(arg)ccmsh peptides. thus, it is desirable to reduce the nonspecific renal uptake of tc - rxd - lys-(arg)ccmsh peptides to facilitate their potential therapeutic applications. in our previous reports, l - lysine co - injection significantly reduced the renal uptake of tc - rxd - lys-(arg)ccmsh peptides by 37%51% at 2 h postinjection without affecting their tumor uptake.l - lysine is a positively charged amino acid. the effect of l - lysine co - injection in reducing the renal uptake indicated that the overall positive charges of tc - rxd - lys-(arg)ccmsh peptides contributed to their nonspecific renal uptake. obviously, the substitution of the positively charged lys linker with a neutral amino acid can decrease the overall charges of tc - rxd - lys-(arg)ccmsh peptides. according to the effect of l - lysine co - injection in decreasing the renal uptake, we hypothesized that the substitution of the lys linker with a neutral -ala linker would decrease the renal uptake of tc - rxd - lys-(arg)ccmsh peptides. to examine our hypothesis, we synthesized six peptides with -ala linkers, namely, peptides 16. the mc1 receptor binding affinities of these six peptides were examined in b16/f1 melanoma cells. we further determined the biodistribution properties in b16/f1 melanoma - bearing c57 mice for these six tc - peptides. thereafter, we determined the imaging property of tc-4 in b16/f1 melanoma - bearing c57 mice. the peptides were synthesized and purified by reverse phase - high performance liquid chromatography (rp - hplc) according to our previously published procedures. the chemical purities of the peptides were greater than 95% after the hplc purification (table 1). the measured molecular weight was 2123 da for peptide 1, 2137 da for peptide 2, 2135 da for peptide 3, 2107 da for peptide 4, 2064 da for peptide 5, and 2080 da for peptide 6 (table 1). the ic50 value was 2.76 0.51 nm for peptide 1, 1.56 0.63 nm for peptide 2, 1.99 0.16 nm for peptide 3, 0.35 0.01 nm for peptide 4, 3.34 0.28 nm for peptide 5, and 3.84 0.71 nm for peptide 6 in b16/f1 melanoma cells, respectively. competitive binding curves of peptide 1 (, pink), peptide 2 (, black), peptide 3 (, orange), peptide 4 (, blue), peptide 5 (, green), and peptide 6 (, red) in b16/f1 murine melanoma cells. the ic50 values were 2.76 0.51 nm for peptide 1, 1.56 0.63 nm for peptide 2, 1.99 0.16 nm for peptide 3, 0.35 0.01 nm for peptide 4, 3.34 0.28 nm for peptide 5, and 3.84 0.71 nm for peptide 6. the tc - peptides were separated from their excess nonlabeled peptides by rp - hplc. the specific activities of tc-1, tc-2, tc-3, tc-4, tc-5, and tc-6 were 8.62 10, 8.57 10, 8.57 10, 8.68 10, 8.85 10, 8.79 10 mbq / g, respectively. the retention times of tc-1, tc-2, tc-3, tc-4, tc-5, and tc-6 were 13.1, 13.0, 14.1, 13.7, 17.0, and 14.2 min, respectively. all six tc - peptides were stable in mouse serum at 37 c for 24 h (figure 3). radioactive hplc profiles of tc-1 (a), tc-2 (b), tc-3 (c), tc-4 (d), tc-5 (e), and tc-6 (f) in mouse serum after incubation at 37 c for 24 h. the arrows denote the original retention times of tc-1 (13.1 min), tc-2 (13.0 min), tc-3 (14.1 min), tc-4 (13.7 min), tc-5 (17.0 min), and tc-6 (14.2 min), prior to the incubation in mouse serum. the melanoma targeting and pharmacokinetic properties of tc-1, tc-2, tc-3, tc-4, tc-5, and tc-6 are shown in tables 27. all six tc - peptides exhibited similar tumor uptake pattern in b16/f1 melanoma - bearing c57 mice. the highest tumor uptake appeared either at 2 or 4 h postinjection. among these six tc - peptides, tc-4 showed the highest tumor uptake of 15.66 6.19% id / g at 2 h postinjection. the tumor uptake of tc-4 gradually decreased to 14.67 3.81 and 7.79 2.68% id / g at 4 and 24 h postinjection. co - injection of 10 g (6.1 nm) of nonradiolabeled ndp - msh with tc-4 decreased the tumor uptake to 2.43 0.53% id / g at 2 h postinjection, demonstrating that the tumor uptake was mc1 receptor - mediated. kidneys were the excretion routes for all six tc - peptides. among these six tc - peptides, tc-4 showed the lowest renal uptake of 20.18 3.86% id / g at 2 h postinjection. the renal uptake of tc-4 gradually decreased to 19.83 6.34 and 3.92 0.99% id / g at 4 and 24 h postinjection. co - injection of 10 g (6.1 nm) of nonradiolabeled ndp - msh with tc-4 did not significantly reduce the renal uptake (p > 0.05) at 2 h postinjection, indicating that the renal uptake was nonspecific. the substitution of the positively charged lys linker with the neutral -ala dramatically decreased the renal uptake of tc - rxd--ala-(arg)ccmsh peptides. interestingly, further reduction of the overall positive charges of tc-5 and tc-6 did not decrease the renal uptake further as compared to tc-4. approximately 6878% of tc - peptides cleared through the urinary system by 2 h postinjection, whereas approximately 7786% of tc - peptides washed out through the urinary system by 4 h postinjection. the effect of l - lysine co - injection on the renal uptake of tc-4 at 2 h postinjection is presented in figure 4. co - injection of 15 mg of l - lysine significantly (p < 0.05) reduced the renal uptake of tc-4 from 20.18 3.86% id / g to 13.06 3.62% id / g without significantly affecting the tumor uptake at 2 h postinjection. the data are presented as percent injected dose / gram or as percent injected dose (mean sd, n = 4). () p < 0.05 for determining the significance of differences in tumor and kidney uptake between tc-1 with or without ndp - msh peptide blockade at 2 h postinjection. the data are presented as percent injected dose / gram or as percent injected dose (mean sd, n = 4). () p < 0.05 for determining the significance of differences in tumor and kidney uptake between tc-2 with or without ndp - msh peptide blockade at 2 h postinjection. the data are presented as percent injected dose / gram or as percent injected dose (mean sd, n = 4). () p < 0.05 for determining the significance of differences in tumor and kidney uptake between tc-3 with or without ndp - msh peptide blockade at 2 h postinjection. the data are presented as percent injected dose / gram or as percent injected dose (mean sd, n = 4). () p < 0.05 for determining the significance of differences in tumor and kidney uptake between tc-4 with or without ndp - msh peptide blockade at 2 h postinjection. the data are presented as percent injected dose / gram or as percent injected dose (mean sd, n = 4). () p < 0.05 for determining the significance of differences in tumor and kidney uptake between tc-5 with or without ndp - msh peptide blockade at 2 h postinjection. the data are presented as percent injected dose / gram or as percent injected dose (mean sd, n = 4). () p < 0.05 for determining the significance of differences in tumor and kidney uptake between tc-6 with or without ndp - msh peptide blockade at 2 h postinjection. effect of l - lysine co - injection on the tumor and kidney uptake of tc-4 at 2 h postinjection. the blue and green columns represent the tumor and renal uptake of tc-4 without and with l - lysine co - injection : () p < 0.05 for determining the significance of differences in tumor and kidney uptake between tc-4 without and with l - lysine co - injection. because tc-4 showed the highest tumor uptake and the lowest renal uptake than the other five tc - peptides at 2 h postinjection, we further determined the tumor imaging property, specificity of tumor uptake, and urinary metabolites of tc-4 in b16/f1 melanoma - bearing c57 mice. whole - body spect / ct image at 2 h postinjection is presented in figure 5. flank b16/f1 melanoma lesions were clearly visualized by spect using tc-4 as an imaging probe. the spect image of tumor accurately matched its anatomical location obtained in the ct image. the spect image showed high contrast of tumor to normal organ except for kidneys, which was consistent with the biodistribution results. as shown in figure 5, the tumor uptake was blocked by unlabeled ndp - msh, demonstrating that the tumor uptake was receptor - mediated. the urinary metabolites of tc-4 at 2 h postinjection are shown in figure 6. representative whole - body spect / ct image of b16/f1 melanoma - bearing c57 mice 2 h after injection of tc-4 without (a) and with (b) peptide blockade. flank melanoma lesions (t) are highlighted with an arrow on the image. the arrow denotes the original retention time of tc-4 prior to tail vein injection. in our previous reports, we have found the importance of single amino acid at the x position in the tumor targeting properties of tc - rxd - lys-(arg)ccmsh peptides in b16/f1 melanoma - bearing c57 mice. specifically, the substitution of gly in tc - rgd - lys-(arg)ccmsh with ala, thr, val, and ser improved the mc1 receptor binding affinities and enhanced the melanoma uptake in b16/f1 melanoma - bearing c57 mice. despite the promising melanoma targeting results associated with tc - rxd - lys-(arg)ccmsh peptides, it is desirable to reduce the nonspecific renal uptake (67135% id / g at 2 h postinjection) of tc - rxd - lys-(arg)ccmsh peptides to facilitate their potential therapeutic applications. in this study, we substituted the positively charged lys linker with the neutral -ala linker to determine whether such linker change could reduce the renal uptake of tc - rxd--ala-(arg)ccmsh peptides. furthermore, we replaced the rad moiety with nad and ead moieties to examine whether the further reduction of the overall positive changes of tc - nad--ala-(arg)ccmsh and tc - ead--ala-(arg)ccmsh could decrease their renal uptake further. the substitution of lys linker with -ala linker slightly affected the receptor binding affinities of rxd--ala-(arg)ccmsh peptides. the receptor binding affinities of rxd--ala-(arg)ccmsh peptides were approximately 2-fold weaker than rxd - lys-(arg)ccmsh peptides, respectively. despite the fact that the -his - dphe - arg - trp- motif is the binding moiety for the mc1 receptor, the decrease in receptor binding affinity with the -ala linker substitution indicated that the linker might somehow interact with the receptor binding moiety. the decrease in receptor binding affinities of rxd--ala-(arg)ccmsh peptides also resulted in the reduction in tumor uptake of tc - rxd--ala-(arg)ccmsh peptides by 2145% in b16/f1 melanoma - bearing c57 mice. specifically, the tumor uptake of tc-4 was 79% of the tumor uptake of tc - rad - lys-(arg)ccmsh at 2 h postinjection. the substitution of lys linker with -ala linker dramatically decreased the renal uptake of tc - rxd--ala-(arg)ccmsh peptides by 6479% in b16/f1 melanoma - bearing c57 mice. for instance, the renal uptake of tc-4 was only 22% of the renal uptake of tc - rad - lys-(arg)ccmsh at 2 h postinjection. it is worthwhile to note that there is a positively charged arg residue in the rad moiety of tc-4. thus, we were interested in whether the replacement of arg with nle (neutral) and glu (negatively charged) could further decrease the renal uptake of tc-5 and tc-6 as compared to tc-4. interestingly, the replacement of arg with nle and glu did not further decrease the renal uptake of tc-5 and tc-6 as compared to tc-4. clearly, the tumor targeting and clearance properties of tc-4 were more favorable than the other tc - peptides investigated in this study.. the b16/f1 melanoma lesions could be clearly visualized by spect / ct using tc-4 as an imaging probe. at the present time, tc-(arg)ccmsh and tc(edda)-hynic - ggnle - cycmshhex were reported as promising cyclic imaging probes for melanoma. remarkably, tc-4 displayed comparably high melanoma uptake (14.67 3.81% id / g) as tc-(arg)ccmsh and tc(edda)-hynic - ggnle - cycmshhex at 4 h postinjection. however, the renal uptake of tc-4 was higher than those of tc-(arg)ccmsh (11.66 1.44% id / g) and tc(edda)-hynic - ggnle - cycmshhex (7.52 0.96% id / g). the difference in renal uptake was likely due to the structural differences among these tc - peptides. interestingly, we found that l - lysine co - injection significantly reduced the renal uptake of tc-4 by 35% at 2 h postinjection without affecting its tumor uptake significantly (figure 4). therefore, l - lysine co - injection could be utilized to further decrease the renal uptake of re - rad - lys-(arg)ccmsh to facilitate its potential therapeutic application. the substitution of the lys linker with the -ala linker dramatically decreased the renal uptake of tc - rxd--ala-(arg)ccmsh peptides. among these six tc - peptides, tc-4 exhibited the highest tumor uptake and the lowest renal uptake at 2 h postinjection. the replacement of arg with nle and glu did not further decrease the renal uptake of tc-5 and tc-6 as compared to tc-4. the tumor targeting and clearance properties of tc-4 highlighted it as a lead peptide for future studies. i - tyr-[nle, dphe]--msh { i-(tyr)-ndp - msh } was obtained from perkinelmer, inc. all other chemicals used in this study were purchased from thermo fischer scientific (waltham, ma) and used without further purification. b16/f1 murine melanoma cells were obtained from american type culture collection (manassas, va). six new peptides were synthesized using fluorenylmethyloxycarbonyl (fmoc) chemistry according to our previously published procedures with slight modification on sieber amide resin by an advanced chemtech multiple - peptide synthesizer (louisville, ky). briefly, 70 mol of sieber amide resin and 210 mol of fmoc - protected amino acids were used for the synthesis. intermediate scaffolds of h2n - arg(pbf)-ser / thr / val - asp(otbu)-dtyr(tbu)-asp(o-2-phenylisopropyl)--ala - cys(trt)-cys(trt)-glu(otbu)-his(trt)-dphe - arg(pbf)-trp(boc)-cys(trt)-arg(pbf)-pro - val and h2n - arg(pbf)/nle / glu(otbu)/-ala - asp(otbu)-dtyr(tbu)-asp(o-2-phenylisopropyl)--ala - cys(trt)-cys(trt)-glu(otbu)-his(trt)-dphe - arg(pbf)-trp(boc)-cys(trt)-arg(pbf)-pro - val were synthesized on sieber amide resin. the protecting group of 2-phenylisopropyl of each scaffold was removed, and each peptide was cleaved from the resin treating with a mixture of 2.5% of trifluoroacetic acid (tfa) and 5% of triisopropylsilane. after the precipitation with ice - cold ether and characterization by ms, each protected peptide was dissolved in h2o / ch3cn (50:50) and lyophilized to remove the reagents such as tfa and triisopropylsilane. each protected peptide was further cyclized by coupling the carboxylic group from the asp with the amino group from the arg, nle, or glu at the n - terminus. the cyclization reaction was achieved by overnight reaction in dimethylformamide (dmf) using benzotriazole-1-yl - oxy - tris - pyrrolidinophosphonium hexafluorophosphate (pybop) as a coupling agent in the presence of n, n - diisopropylethylamine (dipea). the protecting groups were totally removed by treating with a mixture of tfa, thioanisole, phenol, water, ethanedithiol, and triisopropylsilane (87.5:2.5:2.5:2.5:2.5:2.5) for 2 h at room temperature (25 c). each peptide was precipitated and washed with ice - cold ether four times, purified by rp - hplc, and characterized by liquid chromatography mass spectrometry (lc ms). the chemical purity of each peptide was determined by waters rp - hplc instrument (milford, ma) on a grace vydac c-18 reverse phase analytic column (deerfield, il) using a 20 min gradient of 1828% acetonitrile in 20 mm hcl aqueous solution at a flow rate of 1 ml / min. the ic50 values of the peptides for the mc1 receptor were determined in b16/f1 melanoma cells. the b16/f1 cells were seeded into a 24-well cell culture plate at a density of 2.5 10 cells / well and incubated at 37 c overnight. after being washed with binding medium { modified eagle s medium with 25 mm n-(2-hydroxyethyl)piperazine - n-(2-ethanesulfonic acid) (hepes), ph 7.4, 0.2% bovine serum albumin (bsa), 0.3 mm 1,10-phenathroline }, the cells were incubated at 25 c for 2 h with approximately 30 000 counts per minute (cpm) of i-(tyr)-ndp - msh in the presence of increasing concentrations (1010 m) of each peptide in 0.3 ml of binding medium. the cells were rinsed twice with 0.5 ml of ice - cold, ph 7.4, 0.2% bsa/0.01 m phosphate buffered saline (pbs) to remove any unbound radioactivity and lysed in 0.5 ml of 1 m naoh for 5 min. the activities associated with the cells were measured in a wallac 2480 automated counter (perkinelmer, nj). the ic50 value for each peptide was calculated using prism software (graphpad software, la jolla, ca). the standard deviation of ic50 value was generated by two independent experiments in triplicate for each peptide. the peptides were labeled with tc via a direct reduction reaction using sncl2 as a reducing agent. briefly, 10 l of 1 mg / ml sncl2 in 0.1 m hcl, 40 l of 0.5 m nh4oac (ph 5.2), 100 l of 0.2 m na2 tartate (ph 9.2), 100 l of fresh tco4 solution (3774 mbq), and 10 l of 1 mg / ml of each peptide in aqueous solution were added into a reaction vial and incubated at 25 c for 20 min to form the tc - labeled peptide. each tc - peptide was purified to a single species by waters rp - hplc (milford, ma) on a grace vydac c-18 reverse phase analytic column (deerfield, il) using a 20 min gradient of 1828% acetonitrile in 20 mm hcl aqueous solution at a flow rate of 1 ml / min. each purified peptide was purged with n2 gas for 20 min to remove the acetonitrile. the ph of final peptide solution was adjusted to 7.4 with 0.1 n naoh and sterile normal saline for stability, biodistribution, and imaging studies. the serum stabilities of tc-1, tc-2, tc-3, tc-4, tc-5, and tc-6 were determined by incubation in mouse serum at 37 c for 24 h and monitored for degradation by rp - hplc. briefly, 100 l of each hplc - purified peptide solution (7.4 mbq) was added into 100 l of mouse serum (sigma - aldrich corp, st. louis, mo) and incubated at 37 c for 24 h. after the incubation, 200 l of a mixture of ethanol and acetonitrile (v : v = 1:1) was added to precipitate the serum proteins. the resulting mixture was centrifuged at 16000 g for 5 min to collect the supernatant. the supernatant was purged with n2 gas for 30 min to remove the ethanol and acetonitrile. the resulting sample was mixed with 500 l of water and injected into rp - hplc for analysis using the gradient described above. all the animal studies were conducted in compliance with institutional animal care and use committee approval (12 - 100851-hsc). the biodistribution properties of the tc - peptides were determined in b16/f1 melanoma - bearing c57 female mice (harlan, indianapolis, in). each c57 mouse was subcutaneously inoculated on the right flank with 1 10 b16/f1 cells. the weight of tumors reached approximately 0.2 g at 10 days after cell inoculation. each melanoma - bearing mouse was injected with 0.037 mbq of each tc - peptide via the tail vein. groups of four mice were sacrificed at 0.5, 2, 4, and 24 h postinjection, and tumors and organs of interest were harvested, weighed, and counted. the specificity of tumor uptake was determined by co - injecting each tc - peptide with 10 g (6.1 nmol) of unlabeled ndp - msh at 2 h postinjection. the effect of l - lysine co - injection on the renal uptake of tc-4 was examined in b16/f1 melanoma - bearing c57. a group of four mice were injected with an aqueous mixture of 0.037 mbq of tc-4 and 15 mg of l - lysine. the mice were sacrificed at 2 h postinjection, and tumor and kidneys were harvested, weighed, and counted. tc-4 was the lead peptide because of its highest tumor uptake and the lowest renal uptake. thus, we further determined the melanoma imaging property of tc-4 and the specificity of melanoma uptake. approximately 3.74.1 mbq of tc-4 with or without 10 g (6.1 nmol) of unlabeled ndp - msh was injected into b16/f1 melanoma - bearing c57 mice via the tail vein, respectively. the mice were euthanized for small animal spect / ct (nano - spect / ct, bioscan, washington, dc) imaging 2 h postinjection. the 9 min ct imaging was immediately followed by the spect imaging of whole body. reconstructed data from spect and ct were visualized and co - registered using invivoscope (bioscan, washington, dc). approximately 3.7 mbq of tc-4 was injected into a b16/f1 melanoma - bearing c57 mouse via the tail vein to determine the urinary metabolites. the collected urine sample was centrifuged at 16000 g for 5 min before the hplc analysis. a 20 min gradient of 1626% acetonitrile/20 mm hcl with a flow rate of 1 ml / min was used for urine analysis. statistical analysis was performed using the student s t test for unpaired data to determine the significance of differences in tumor and kidney uptake with / without peptide blockade in biodistribution studies described above. | the purpose of this study was to examine whether the substitution of the lys linker with the -ala could reduce the renal uptake of 99mtc - labeled arg - x - asp - conjugated and x - ala - asp - conjugated -melanocyte stimulating hormone (-msh) peptides. rsd--ala-(arg11)ccmsh (1) { c[arg - ser - asp - dtyr - asp]--ala - cys - cys - glu - his - dphe - arg - trp - cys - arg - pro - val - nh2 }, rtd--ala-(arg11)ccmsh (2), rvd--ala-(arg11)ccmsh (3), rad--ala-(arg11)ccmsh (4), nad--ala-(arg11)ccmsh (5), and ead--ala-(arg11)ccmsh (6) peptides were synthesized and evaluated for their melanocortin 1 (mc1) receptor binding affinities in b16/f1 melanoma cells. the biodistribution of their 99mtc - conjugates were determined in b16/f1 melanoma - bearing c57 mice. the substitution of the lys linker with -ala linker dramatically reduced the renal uptake of all six 99mtc - peptides. 99mtc-4 exhibited the highest melanoma uptake (15.66 6.19% id / g) and the lowest kidney uptake (20.18 3.86% id / g) among these 99mtc - peptides at 2 h postinjection. the b16/f1 melanoma lesions could be clearly visualized by single photon emission computed tomography (spect)/ct using 99mtc-4 as an imaging probe. |
however, orexigenic (acylated and desacylated ghrelin and preptin) and anorexigenic (nesfatin-1 and leptin) peptide hormones of the endocrine system may play a critical role in the development of obesity by regulating the energy balance and affecting the eating center and satiety center in the paraventricular nucleus, arcuate nucleus, and nucleus of the solitary tract. of the orexigenic peptides, ghrelin was discovered in 1999 by kojima. in the x / a cells of the fundus and pylorus areas of the rat stomach and p / d1 cells of the stomach in humans. ghrelin, which contains 28 amino acids, is called acylated ghrelin when it has a fatty acid attached to the n terminus of the third serine (octanoic acid), and is called desacylated ghrelin when it has no fatty acid attached [2, 3 ]. both forms of ghrelin the effect of desacylated ghrelin on food intake in mice is weaker than acylated ghrelin. behavioral studies led to controversial results regarding desacylated ghrelin, and albeit several studies suggest that it is anorexigenic peptide counteracting some of ags actions. ghrelin levels in humans decrease with obesity and calorie intake and increase with hunger and in anorexia nervosa patients. preptin is a 34-amino acid peptide hormone cosecreted from the cells of pancreas along with insulin, amylin, and pancreastatin [7, 8 ]. its precursor is pro - igf - ii, which also produces insulin - like growth factor ii (igf - ii). igf - ii is involved in the regulation of cell growth, differentiation, and metabolism. there is a strong correlation between obesity and hyperinsulinemia and insulin resistance, and these get stronger with increasing body weight. nesfatin-1, a recently found anorexigenic peptide, is derived from the 82-amino acid protein called nucleobindin-2 (nucb2), known as a satiety molecule in the hypothalamus [11, 12 ]. the middle segment of nesfatin-1 (residues 24 to 53) is biologically active, and its injection reduces food intake, whereas the n-23 and the c-29 amino acid terminal segments are inactive. nesfatin-1 is a new anorexigenic factor and energy stabilizer [13, reviewed ]. shown to reduce food intake, nesfatin-1 has an inhibitory effect on food intake and thus alleviates obesity in a dose- and time - dependent manner upon intracerebroventricular and intraperitoneal injection, as well as after intranasal administration. it is also known that there is a slightly positive but inconsistent correlation of nesfatin-1 with bmi in humans, since variables as sex and stress seem to confound this relationship [13, reviewed ]. serum leptin levels correlate with body mass index (bmi), serving as the key regulator of body weight through its neuroendocrine functioning. leptin is bound in low - weight (thin) individuals but is free in obese individuals, its rhythmic release being affected by the time of eating, with lowest level in the morning and peaking at night. leptin levels are also affected by sex, being higher in women than in men. since it is involved in the hunger and satiety centers of the brain, it functions primarily as a metabolic signal associated with the sufficiency rather than a surplus of energy. its signal when reaching the hypothalamus brings the indication that fat reserves are full and thus inhibit expression of orexigenic peptides, neuropeptide y in particular, while increasing the expression of anorexigenic peptides, thereby decreasing food intake and increasing energy consumption [19, 20 ]. in the light of these data, this study investigated cross - sectional in five bmi groups from underweight to morbidly obese subjects the serum levels of several peptides involved in the regulation of hunger and satiety : ghrelin in its acylated and desacylated form, nesfatin-1, leptin, and the physiologic amplifier of glucose - mediated insulin secretion preptin.it was found that leptin, preptin, and acylated ghrelin (ag) levels increased with higher bmi, whereas desacylated ghrelin (dag) decreased and nesfatin-1 showed no clear relationship with bmi. the study was carried out in the internal medicine department and biochemistry department of firat university, school of medicine. after the approval of the ethics board had been obtained, the patients were informed about the study and written consents obtained. registered individuals ranging from 18 to 70 in age study were allocated to one of 5 groups depending on their bmis. in order to assess subjective appetite sensations, visual analogue scale (vas) was applied. classification of groups by their bmis was as follows : group i (bmi 40 kg / mmorbidly obese). insulin resistance was calculated using the homoeostasis model assessment of insulin resistance (homa - ir) index (fasting insulin (units per milliliter) fasting glucose (millimolar)/22.5). bmi (kg / m) was calculated by using body weight (kg) and the height in square meters (m). none of the subjects had diabetes type 1 or 2 (including the family history), moderate to severe hypertension (resting blood pressure (bp) > 130/80>140/85 mmhg), acute infectious disease, and chronic medical illness. pregnant women and subjects who had gastrointestinal disease were excluded and anyone using use drugs, tobacco products (former and current), and alcoholic drinks. those doing intense exercise regularly (> 15 min of aerobics 3 times per week) were also excluded. none of the subjects had undergone gastrointestinal surgery. to conduct biochemical analyses, venous blood samples (8 ml) the remaining 4 ml was put into tubes containing 500 kallikrein inhibitor unit (kiu) aprotinin and centrifuged at 4000 rpm (1792 g) for 5 min. serum samples from the centrifuging process were transferred to eppendorf tubes and stored at 20c until analyzed. blood glucose, total cholesterol, low - density lipoprotein (ldl), ldl - cholesterol, high - density lipoprotein (hdl), hdl - cholesterol, very low - density lipoprotein (vldl), vldl - cholesterol, triglyceride (tg), urea, creatine, aspartate aminotransferase (ast), and alanine aminotransferase (alt) were analyzed using the olympus au 600 autoanalyzer. thyroid function (serum triiodothyronine (st3), total serum thyroxin (st4), thyroid stimulating hormone (tsh), adrenocorticotropic hormone (acth), cortisol, insulin, and c - peptide) was assessed using the immulite 200 device and hba1c shimadzu silver 20a prominence apparatus. serum acylated ghrelin levels were analyzed using human acylated ghrelin elisa commercial kit (cat. no : a05106 spi - bio, human acylated ghrelin enzyme immunoassay kit, france), and desacylated ghrelin was measured using human unacylated ghrelin elisa commercial kit (cat. a05119, spi - bio, human unacylated ghrelin immunoassay kit) in an elx 800 elisa reader. csb - e09772 h, cusabio biotech co. ltd.), serum nesfatin-1 with human / mouse / rat nesfatin enzyme immunoassay kit (cat. eia - nes-1, raybiotech, inc.), and serum leptin with leptin (sandwich) elisa kit (cat. possible differences between the parametric data of groups used anova and post hoc tukey test, when necessary, while possible correlation among parameters used the pearson 's correlation analysis method. after adjusting age and bmi, pearson 's and spearman 's correlation coefficients with a bonferroni correction were calculated to examine the relationship between orexigenic and anorexigenic peptides and obesity. the comparison of the groups in terms of their demographic characteristics showed a statistically significant difference between the mean age and bmi values of the groups (p < 0.001). the highest mean age among the groups was in group iii (55.2 12.8) and the lowest mean age in group i (28.8 16.2). the significantly lowest bmi occurred in group i (17.6 0.8) ; in the other groups bmis were in ascending order from group ii (21.7 1.6), group iii (27.4 2.1), group iv (34.9 2.46), to group v (44.8 4.2). fasting glucose levels increase from underweight to overweight and then are lower when measured in different states of obesity. additionally, insulin, homa - ir, total cholesterol, ldl, and triglycerides are higher in group ii, iii, or iv than those of morbidly obese subjects (table 1). however, it is possible that comorbidities and medication may play a role in the fluctuations of these parameters. serum acylated ghrelin levels of the participants by bmi were 16.0 11.1 in group i, 16.07 5.8 in group ii, 16.8 4.1 in group iii, 19.6 3.6 in group iv, and 19.7 5.6 pg / ml in group v (figure 1). when the groups were compared individually with each other, serum acylated ghrelin levels followed an ascending order from group i to group v ; that is, they were the lowest in low - weight (thin) individuals and the highest in obese individuals (figure 1). serum desacylated ghrelin levels (figure 2) were 692 345 in group i, 628.4 344.2 pg / ml in group ii, 522.0 249.5 in group iii, 356.8 219.4 in group iv, and 257.7 16.1 pg / ml in group v. comparison of groups with each other showed that serum desacylated ghrelin levels decreased with increasing bmi. the highest desacylated ghrelin levels were in low - weight (thin) individuals and the lowest in morbidly obese individuals. in normal - weight individuals, the levels were significantly lower than in obese and morbidly obese individuals (p < 0.01, p < 0.001, resp.) (figure 2). serum preptin levels were the lowest in the normal - weight individuals of group ii. they were 137 168 in group i, 91 85 in group ii, 151 193 in group iii, 255 153 in group iv, and 262 166 pg / ml in group v. preptin levels in low - weight and overweight individuals were slightly higher than in normal - weight individuals. obese and morbidly obese groups had significantly higher preptin levels than low - weight and overweight individuals (p < 0.001) (figure 3). serum nesfatin-1 levels (figure 4) were 5.2 0.9 in group i, 5.6 0.9 in group ii, 5.8 1.7 in group iii, 4.2 2.1 in group iv, and 4.4 0.9 ng / ml in group v. comparing each group with the others, levels followed the following ascending order : group iv < group v < group i < group ii < group iii. comparison of group ii with groups iv and v showed that group ii had significantly higher serum nesfatin-1 levels than the other 2 groups (p < 0.01, p < 0.05, resp.). similarly, comparing nesfatin-1 levels of group iii with those in groups iv and v, significantly elevated levels were present in group iii (p < 0.001, p < 0.01, resp.) (figure 4). serum leptin levels were the lowest in low - weight individuals : 4.3 4.4 in group i, 6.0 3.94 in group ii, 14.9 4.92 in group iii, 23.9 9.0 in group iv, and 24.6 11.3 pg / ml in group v. leptin levels were higher in the individuals who had high bmis. overweight individuals had statistically significantly higher leptin levels than low- and normal - weight individuals (p < 0.001, p < 0.01). leptin levels in the obese group were higher than those in low - weight, normal - weight and overweight individuals, the differences being statistically significant (p < 0.001, p < 0.001, p < 0.01 ; figure 5). correlations found between acylated and desacylated ghrelin, preptin, nesfatin-1, and leptin levels and bmi are given in table 2. based on age, there were also correlations in groups ii and iv (table 2). obesity, which is becoming increasingly widespread around the world, is estimated to have a prevalence of 8.2%. when obesity was accepted as a bmi 30 kg / m, us studies between 1982 and 1984, and between 1988 and 1998, showed that obesity increased from 16.5 to 25% in females and from 12 to 20% in males. these rather high figures are similar to those in almost all developed and developing countries of the world. a study was conducted in turkey in 1996 as the first of its kind ; the prevalence of obesity was 18.6%, a figure that rose to 21.9% in 2002 [23, 24 ]. thus, the prevalence of obesity in turkey was not different from that in the developed countries of the western world, and it reached markedly high levels particularly in females, among whom the prevalence of obesity was as high as 30%. obesity has a greater effect on alt than on ast. in line with the results of our study concerning the relation between alt and obesity, we found that 16% of the individuals who had a bmi of 30 kg / m or above had higher alt levels, consistent with bruckert. and serum lipid levels also rose with increasing bmi from group i to group iv, being statistically significant in all groups. obesity develops when the chronic mismatch between energy intake and consumption produces a surplus of energy, which is stored as excess fat in the form of tg in the adipose tissue. in a normal human being, the rate of feeding is reduced to prevent excessive storage once fat and carbohydrate reserves exceed the optimal level. previous studies showed that plasma ghrelin levels were higher in cachexia and lower in obesity [29, 30 ]. reported reduced serum ghrelin levels in the gastrointestinal system tissues and serum of rats, which were obese due to diet. we think that the decrease in desacylated ghrelin levels in our study resulted from elevated glucose levels in obesity. desacylated ghrelin levels are known to decrease with increasing glucose and increase with decreasing glucose. however, surprisingly, active acylated ghrelin levels in our analysis were elevated in line with increased bmi, although the increase was not statistically significant. phoenix pharmaceuticals belmont, ca company ghrelin kits measure total ghrelin, not specifically acylated ghrelin. increased acylated ghrelin concentrations observed in obesity might represent a physiological adaptation to the regulation of energy balance associated with obesity. collectively, these data suggest why acylated ghrelin increased with bmi, which needs to be further investigated. the decrease in serum desacylated ghrelin levels in obese and morbid obese individuals was statistically significant compared to lower level in normal - weight participants. leptin and insulin have been shown to be peripheral regulators of ghrelin secretion, and a reciprocal relationship exists between plasma ghrelin and leptin or insulin levels. increased leptin might cause a decrement of desacylated ghrelin beside acylated ghrelin as reported here. in this study indeed, desacylated ghrelin levels are decreased in human obesity, whereas leptin levels are increased, and the effects of desacylated ghrelin on energy homeostasis are opposite to those of leptin and acylated ghrelin. also, it was first time shown that serum preptin concentrations increased with increasing bmi. however, we could not find any report to compare the effects of preptin levels and appetite and bmi in obese individuals. yang., reported that the circulating level of preptin was 398 13 ng / l in normal - weight individuals, with levels in males being lower than in females. their study showed a positive correlation between plasma preptin level and diastolic blood pressure, tg, total cholesterol, hba1c, and homa - ir index. our preptin levels rose with increasing bmi, as in yang., but the increase was not statistically significant.. found that nesfatin-1 was a depot - specific adipokine produced preferably by the adipose tissue in obese individuals and individuals with arranged dietary deprivation. nesfatin-1 levels were statistically higher in mice fed on a high - fat diet (p < 0.05) and correlated positively with human bmi (p < 0.01). they fell in food - deprived individuals compared to the control group (p < 0.01). prepared especially sensitive elisa to measure nesfatin-1 level after oral glucose tolerance test (ogtt) and food tests following overnight fasting. there were 43 nonobese males (age : 24.5 0.3 ; bmi : 21.2 0.3 kg / m) and 9 males with a high bmi (age : 32 3.7 ; bmi : 37.3 3.8 kg / m), all of whom were given 75 g ogtt and a food test before their fasting nesfatin-1 concentrations were quantified. the concentrations showed a significant negative correlation with bmi, body fat percentage, body fat weight, and blood glucose (p < 0.05). however, fasting plasma nesfatin-1 levels were significantly lower in the individuals with a high bmi than those with a normal bmi. nesfatin-1 decreased with increasing body weight and functioned as a new anorexigenic factor and energy stabilizer. reduction in the blood nesfatin-1 level with rising bmi might be related to impaired insulin sensitivity and glucose homeostasis. in our groups, compared plasma ghrelin and leptin responses to exogenous and endogenous stimuli in intact rats and other that had been starved for 16 h to inhibit the increase in ghrelin secretion due to hunger. high insulin levels led to higher leptin levels. additionally, high and low ambient temperatures, stress, or insulin supplementation affected plasma ghrelin. bell - anderson and bryson successfully used leptin in the treatment of leptin - deficient obese patients and consequently determined that leptin levels were associated with bmi. preptin and leptin levels, however, rise with increasing bmi. also, acylated ghrelin rose in obesity and nesfatin-1 showed no clear relationship to bmi. | this study examines the levels of acylated and desacylated ghrelin, preptin, leptin, and nesfatin-1 peptide changes related to the body mass index (bmi). the subjects were allocated to 5 groups depending on their bmis as follows : group i (bmi 40 kg / m2). serum acylated and desacylated ghrelin, preptin, and leptin levels were measured by the enzyme - linked immunosorbent assay (elisa) and nesfatin-1 was measured by the enzyme immunoassay (eia). desacylated ghrelin levels showed a gradual and statistically significant drop from group i to group v, while preptin and leptin levels exhibited a gradual and significant increase from group i to group iv. serum nesfatin-1 levels gradually, but not significantly, increased from group i to group iii and showed a significant decrease in groups iv and v. in conclusion, leptin, preptin, and acylated ghrelin (ag) levels increased with higher bmi, whereas desacylated ghrelin (dag) decreased and nesfatin-1 showed no clear relationship to bmi. |
intrauterine growth restriction (iugr) affects 1015% of all infants born in the usa and as many as 24% of babies born in developing countries [1, 2 ]. worldwide, iugr is the second leading cause of perinatal morbidity and mortality behind premature birth and is a major predisposing factor to metabolic disorders throughout postnatal life [4, 5 ]. children born sga due to iugr are more likely to develop insulin resistance and obesity at young ages [68 ]. as adults, these individuals face greater incidence of type 2 diabetes, hypertension, and other health issues [912 ]. in fact, iugr offspring are 18 times more likely to develop metabolic syndrome than offspring born at an appropriate size for their gestational age (aga) [10, 13 ]. though aga at birth, these infants are often growth - restricted between birth and term because their oral intake of protein can not match the levels supplied by the placenta. skeletal muscle accounts for ~40% of the body 's mass and thus plays a major role in metabolic homeostasis. growth and metabolism of skeletal muscle are influenced by a number of factors, including nutrient availability, growth factors, and endocrine signals. in this paper, we will focus on the role of the adrenergic system in fetal adaptations to intrauterine insults alter growth, development, and metabolic set - points in skeletal muscle during late gestation and throughout postnatal life. a frequent cause of iugr is placental insufficiency, which can occur spontaneously and from undiagnosed etiology. as the fetus grows, the stunted placenta can not keep up with the increasing nutritional demands of the fetus, resulting in chronic fetal hypoglycemia and hypoxemia throughout late gestation. plasma norepinephrine and epinephrine concentrations are modestly elevated by fetal hypoglycemia [1719 ] but greatly elevated by hypoxemia [20, 21 ]. fetal adrenal chromaffin cells contain oxygen - sensitive k channels that stimulate catecholamine secretion in response to low blood oxygen content, while the splanchnic nerve develops [21, 22 ]. in iugr human and rat fetuses, hypoxemia increases catecholamine concentrations in plasma and amniotic fluid by as much as 5-fold [2325 ]. plasma epinephrine and norepinephrine are also elevated in iugr fetal sheep where placental insufficiency is the known etiology [2628 ]. catecholamines act via the g - protein coupled receptors, adr and adr [29, 30 ], which express multiple subtypes (1a, 1b, 1d, 2a, 2b, 2c, 1, 2, and 3) with distinct physiological and pharmacological properties. receptor expression patterns determine how tissues respond to catecholamines, and skeletal muscle predominantly expresses adr1 and adr2 subtypes, but adr3 and adr subtypes are also present. even in healthy pregnancies, brief cord occlusions and poseiro effects cause transient periods of fetal hypoxemia and hypoglycemia [32, 33 ], making it necessary for the fetus to have a protective mechanism to conserve glucose and oxygen. skeletal muscle accounts for ~65% of fetal glucose consumption and its metabolic functions are responsive to endocrine regulation, making it a prime site for glucose and oxygen conservation. both hypoxemia and hypoglycemia can impact global fetal metabolism, and the response depends upon the duration of the insult. we have shown that acute (< 1 hour) fetal hypoxemia suppresses glucose - stimulated insulin secretion by increasing circulating norepinephrine and epinephrine (yates and limesand, unpublished), which then activate inhibitory adr2 receptors on pancreatic -cells [20, 26, 35, 36 ]. the combination of high circulating catecholamines and low insulin concentrations contributes to hyperlactatemia, acidosis, and hypocarbia in the fetus (yates and limesand, unpublished). we postulate that this reflects a temporary reduction in skeletal muscle glucose oxidation to spare glucose and oxygen for neural tissues. this transient coping mechanism is accompanied by increased utilization of nonglucose substrates for energy production. to illustrate, skeletal muscle enzymes associated with fatty acid oxidation are upregulated in fetal rats 24 hours after uterine artery ligation, and fatty acid mobilization rates in the sheep fetus increase after six hours of hypoglycemia. additionally, a greater proportion of amino acids are diverted for oxidization in these fetal sheep [39, 40 ]. placental insufficiency causes a chronic state of fetal hypoxemia and hypoglycemia, and therefore hypercatecholaminemia and suppression of glucose oxidation are sustained. as a result, endocrine and metabolic adaptations develop to conserve fetal nutrients by lowering skeletal muscle energy requirements for protein synthesis and growth [4143 ]. accordingly, amino acid oxidation rates in the fetal sheep return to normal after the 8th week of hypoglycemia. similarly, the ability to mobilize fatty acids is reduced in the iugr sheep fetus near term [4446 ]. in addition to lower oxidative metabolism, the iugr fetus induces hepatic glucose production and the cori cycle, which utilizes lactate produced by anaerobic glycolysis in skeletal muscle as a substrate for glucose [47, 48 ]. lactate clearance by the liver stabilizes plasma lactate concentrations in iugr fetuses, creating only mild hyperlactatemia compared to acutely hypoxemic fetuses. thus, long durations of nutrient or oxygen deprivation produce a metabolic shift that may be explained by adaptations to catecholamine levels in fetal circulation. comparisons between fetal sheep made chronically hypoglycemic and those with placental insufficiency (hypoxemic and hypoglycemic) show that hypoxemia has a greater propensity than hypoglycemia for inducing metabolic adaptations, possibly due to greater adrenergic activity associated with hypoxemia. chronic hypoglycemia increases protein breakdown and rates of amino acid oxidation, lowers plasma insulin and glucose uptake, and slows fetal growth rate, but the response is transient and euglycemic recovery normalizes these parameters within a few days [39, 49 ]. conversely, in fetal sheep with placental insufficiency, euglycemic correction fails to restore glucose homeostasis or improve growth rate and in fact worsens hypoxemia and hypoinsulinemia, resulting in acidosis. therefore, the metabolic changes associated with placental insufficiency are dependent on placental oxygen supply and can not be alleviated by removing just the nutrient deprivation. ultrasonic measurements of iugr fetuses show that muscle mass is reduced [51, 52 ], and animal studies show that nutrient restriction impairs fiber formation [53, 54 ]. muscle fiber numbers, size, and metabolic phenotypes develop at distinct fetal stages and thus these aspects of muscle formation and growth are affected differently depending upon the timing of the fetal insult (figure 1). fiber numbers are determined by myogenesis (formation of new fibers), which occurs in 3 distinct phases and is completed early in the third trimester [55, 56 ]. primary myotubes are generated from the fusion of progenitor cells midway through the first trimester, creating the scaffold around which smaller, secondary myotubes form near the end of the first trimester. a final wave of secondary (sometimes called tertiary) myotubes fills in the spaces not already occupied by existing fibers and completes myogenesis early in the third trimester. nutritional insults during early or mid - gestation interfere with myotube formation and reduce fiber density in skeletal muscle. for example, maternal nutrient restriction between the mid - first and mid - second trimester in sheep lowers the number of secondary fibers per fasciculi in the fetal longissimus dorsi muscle. in pregnant ewes recovering from malnourishment at peri - conception, secondary fiber density was also lower in the fetal semitendinosus muscle. although iugr can result from maternal nutrient restriction during early gestation, placental insufficiency does not cause fetal hypoxemia and hypoglycemia until later stages of gestation, most likely after myogenesis is complete [53, 54 ]. as a result, placental insufficiency would reduce muscle mass by impairing fiber growth to a greater extent than total fiber number. after myogenesis, muscle growth continues via fiber hypertrophy and requires myoblast incorporation to increase genomic dna content [5965 ]. myonuclei incorporation precedes protein accumulation, and the size of a muscle fiber is dependent on dna content [5963 ]. because muscle fiber myonuclei are postmitotic, dna accumulation depends on incorporation of new nuclei from myoblasts. in fact, 5099% of total skeletal muscle dna content accumulates postnatally. in fetal sheep with placental insufficiency, skeletal muscle fibers contain fewer myonuclei than fibers from control fetuses, resulting in 33% less dna, 40% less rna, and 76% less protein per fiber [53, 54 ]. human fetuses diagnosed as iugr also have reduced skeletal muscle dna content in late gestation but have normal protein - to - dna ratios. our preliminary evidence indicates that myogenic cell populations are smaller in iugr fetal skeletal muscle and that myoblasts isolated from iugr fetal sheep may proliferate and differentiate at slower rates than those isolated from control fetuses (yates, limesand, and rhoads, unpublished). this scenario would indicate that lower myonuclei content is a major limiting factor in iugr skeletal muscle fiber growth and that iugr myoblasts are impaired. histological measurements reveal a smaller proportion of oxidative - to - glycolytic muscle fibers in some skeletal muscles, which is another mechanism by which fetal developmental adaptations reduce muscle oxidative metabolism. in the ovine tibialis cranialis, newly forming secondary fibers express myosin - heavy chains for type ii (glycolytic) fibers exclusively, but under normal conditions, ~60% of these fibers stain positive for type i (oxidative) myosin - heavy chains by the start of the third trimester. the fiber - type ratio continues to shift toward oxidative fibers until a few weeks after birth [54, 68 ]. together, these data reveal a multifaceted defect in iugr skeletal muscle growth, which manifests in myoblast developmental programming that lowers myonuclei content and alters fiber phenotypes, thus preventing normal metabolic regulation. adaptations in skeletal muscle growth and metabolism appear to be facilitated by chronic exposure to circulating catecholamines (figure 2). in fact, intravenous infusion of norepinephrine or epinephrine for 8 days reduces plasma insulin and blood co2, increases plasma lactate, and slows hindlimb muscle growth rate in otherwise uncompromised fetal sheep. catecholamines affect skeletal muscle directly by selectively impairing insulin signaling and indirectly by suppressing insulin secretion from pancreatic cells [70, 71 ]. under normal conditions, insulin regulates muscle metabolism by stimulating glucose uptake, glycogenesis, glucose oxidation, and protein synthesis via the akt2 and mapk - erk1,2 signaling pathways [7274 ] and by stimulating lipid metabolism via akt1. insulin also promotes myoblast proliferation and differentiation [7577 ] by activating akt2 via irs1 [73, 7779 ], and increases protein synthesis in fetal skeletal muscle [80, 81 ] and in myotubes derived from isolated fetal myoblasts. however, placental insufficiency in fetal sheep reduces plasma insulin by 78% [20, 26, 69, 83 ] and skeletal muscle akt2 content by 40%. furthermore, in adult rats chronically infused with epinephrine, insulin administration is less effective in stimulating irs1 tyrosine phosphorylation, irs1 complex with pi3k and shp2, and akt phosphorylation in skeletal muscle. in adult humans, infusion of dobutamine (adr1 agonist) acutely reduces glucose oxidation rates and increases lipid oxidation rates in skeletal muscle. salbutamol (adr2 agonist) has no effect on glucose oxidation rates but slightly increases lipid oxidation. furthermore, catecholamines activate hormone - sensitive lipase to release fatty acids from fat stores [86, 87 ], which may help replace glucose as a metabolic substrate in muscle (akt1 expression is not altered by catecholamines). one major developmental adaptation in response to chronic catecholamine exposure is modified adrenergic signaling via alteration of adr expression. findings in other tissues show that adr1, adr2, and adr3 have subtype - specific effects on insulin signaling. in adipocytes, adr1 and adr3 stimulation reduces insulin signaling by uncoupling irs1 phosphorylation [88, 89 ] and adr1 suppresses insulin activation of akt in cardiac muscle. conversely, adr2 amplifies insulin activation of mapk - erk1,2 in ovarian cells and has been shown to stimulate myoblast proliferation directly in chicks and mice [92, 93 ]. however, we have found that expression of adr2 is reduced in myoblasts isolated from iugr sheep fetuses (table 1 ; limesand and yates, unpublished findings), meaning that adrenergic enhancement of insulin signaling is reduced. meanwhile, myoblast adr1 and adr3, which inhibit insulin - stimulated proliferation and differentiation, are expressed normally. likewise, adr2 mrna expression is reduced in hindlimb skeletal muscle of iugr fetal sheep and in those administered 7-day norepinephrine infusions, but adr1 and adr3 expression remain normal (sw limesand and x chen, unpublished data). the end result is a greater inhibitory effect on skeletal muscle insulin signaling which, along with reduced insulin secretion, would impair myoblast proliferation and incorporation into muscle fibers and insulin - driven glucose metabolism. furthermore, skeletal muscle adr2 continues to be reduced in placental insufficiency - compromised lambs at one month of age, showing that the adaptive adr profile may be a contributing factor in postnatal metabolic disorders. hypoglycemia and hypoxemia are alleviated by birth, but the thrifty metabolic adaptations persist into postnatal life [4, 5 ]. children born with sga have less skeletal muscle mass as infants and skeletal muscle mass grows at a slower rate through four years of age compared to their aga counterparts [9496 ]. arm muscle size is reduced in infants at birth and at 3, 6, and 9 months of age and upper - arm circumference and muscle area is less at 8 years of age. similarly, iugr lambs have substantially reduced weight and protein content in the semitendinosus muscles at birth [53, 99 ], and daily protein accretion over the first few months of life is slowed. as adults, sga - born individuals have less lean muscle, greater fat - to - muscle ratios [100103 ], and reduced muscle strength [102, 104 ]. abdominal and leg muscle mass is reduced in otherwise healthy men at 19 and 22 years of age, and total lean muscle is lower at 50, 68, and 70 years of age [103, 106, 107 ]. in lambs and piglets, iugr also impairs perinatal development of the vascular architecture [68, 108 ]. this may reflect an inability of myocytes to stimulate angiogenesis [109, 110 ] and is likely the origin of altered perfusion characteristics associated with metabolic syndrome, including vascular resistance, reduced responsiveness to adrenergic regulation, and endothelial dysfunction. after birth, myoblasts form solely from the populations of quiescent satellite cells that develop along the basal lamina of muscle fibers [54, 112 ]. these populations, which control lifetime muscle growth and repair, accrue during fetal development and are subjected to iugr conditions. thus, the impairment of myoblast proliferation and differentiation responsible for slowing fetal skeletal muscle growth would also explain slower muscle growth rates in children and reduced lean mass in adults. the thrifty metabolic phenotype that develops in utero also persists after birth. at 12 years of age, sga - born children exhibit similar basal metabolic rates compared to aga - born counterparts, but a smaller fraction of energy production is due to glucose oxidation and a larger fraction is from lipid oxidation. persistence of limited glucose oxidation rates in iugr skeletal muscle can be associated with a combination of factors. this scenario explains lower rates of systemic glucose oxidation but does not explain reduced muscle - specific glucose uptake [113, 114 ]. dulloo [115, 116 ] postulates a second factor for reduced skeletal muscle glucose oxidation : glucose is preferentially redistributed to adipose tissues to replenish depleted fat stores. this glucose redistribution hypothesis has been applied to the perinatal period after iugr as well as recovery from prolonged nutrient restriction at older ages. however, sga - born individuals continue to exhibit thrifty glucose metabolism throughout their lives, well after fat reserves are replenished, which indicates that the timing of the insult is important for persistence of the metabolic phenotype. evidence for the permanence of developmental adaptations includes decreased oxidative - to - glycolytic fiber proportions in 8-month - old sheep exposed to fetal nutrient restriction and in mature pigs classified as runts (much smaller than littermates) at birth [45, 118 ]. skeletal muscle biopsies from young - adult men born sga reveal reduced insulin - signaling enzymes (e.g., pi3k, p85, p110, pkc, glut4) despite normal insulin receptor content. in rats, insulin signaling via akt is reduced in offspring from dams exposed to a hypoxic or malnourished environment during pregnancy. together, these studies indicate that the sustained response is not completed after adipose stores are replenish but is rather a product of a new nutrient utilization set - point established by fetal developmental programming to iugr conditions. this phenomenon was described by hales and barker [4, 5 ] as metabolic dysregulation, but the connotation of a disorder may only apply because these individuals are subjected to a lifetime of diets that exceed their nutritional requirements. placental insufficiency results in conditions that restrict fetal skeletal muscle development and growth by reducing the capacity of the myofiber to maintain glucose homeostasis. altered adrenergic receptor expression profiles in myoblasts and skeletal muscle of iugr sheep fetuses indicate that slower growth rates and thrifty metabolism are the result of fetal adaptations to chronic catecholamine exposure in utero. as the proportion of adr2 to adr1 declines in iugr skeletal muscle, adrenergic regulation promotes insulin resistance, reduced myoblast incorporation, less fiber hypertrophy, and lower rates of glucose oxidation developmental programming of skeletal muscle adrenergic receptors in utero helps explain metabolic and endocrine differences in iugr offspring as well, and the impact on metabolism may result in differential nutrient utilization and requirements. | fetal adaptations to placental insufficiency alter postnatal metabolic homeostasis in skeletal muscle by reducing glucose oxidation rates, impairing insulin action, and lowering the proportion of oxidative fibers. in animal models of intrauterine growth restriction (iugr), skeletal muscle fibers have less myonuclei at birth. this means that myoblasts, the sole source for myonuclei accumulation in fibers, are compromised. fetal hypoglycemia and hypoxemia are complications that result from placental insufficiency. hypoxemia elevates circulating catecholamines, and chronic hypercatecholaminemia has been shown to reduce fetal muscle development and growth. we have found evidence for adaptations in adrenergic receptor expression profiles in myoblasts and skeletal muscle of iugr sheep fetuses with placental insufficiency. the relationship of -adrenergic receptors shifts in iugr fetuses because adr2 expression levels decline and adr1 expression levels are unaffected in myofibers and increased in myoblasts. this adaptive response would suppress insulin signaling, myoblast incorporation, fiber hypertrophy, and glucose oxidation. furthermore, this -adrenergic receptor expression profile persists for at least the first month in iugr lambs and lowers their fatty acid mobilization. developmental programming of skeletal muscle adrenergic receptors partially explains metabolic and endocrine differences in iugr offspring, and the impact on metabolism may result in differential nutrient utilization. |
on january 24, 2007, s. sonnei strain ucn59 was isolated from a 4-year - old girl admitted to robert debr hospital, paris, for bloody diarrhea and fever. the strain was resistant to ampicillin, trimethoprim, sulfonamides, and cotrimoxazole but susceptible to quinolones, third - generation cephalosporins, and doxycycline according to the disk - diffusion technique. mics of macrolides were markedly increased for s. sonnei ucn59 compared with those for a susceptible control s. sonnei ucn62 (table). from january to april 23, 2007, a total of 50 cases of laboratory - confirmed shigellosis were identified. isolates included, in addition to ucn59, 31 s. sonnei that had an azithromycin mic > 64 mg / l from 31 children 256 mg / l by etest and 2 isolates with azithromycin mic 97% similarity were considered to be closely genetically related. profile 1) representative of the 32 isolates of the 2007outbreak with azithromycin (mic > 256 mg / l by etest). profile 2) 1 of 6 isolates from sporadic cases (20032006) with azithromycin mic 1 mg / l, resistant ; 24 mg / l, which suggests that none had acquired resistance to azithromycin. surveillance for resistance to azithromycin in shigella spp. requires specific breakpoints for this species (3). the mph(a) gene has been detected in the sequence of transposon tnsf1 isolated from s. flexneri (j.h. chen and j.y. af188331). the mph(a) gene was first reported in an e. coli isolate from japan (10). since then, the gene has been found in aeromonas hydrophila, pseudomonas spp., stenotrophomonas spp., and a variety of enterobacteria (listed at http://faculty.washington.edu/marilynr/ermweb4.pdf). azithromycin was used to treat shigellosis in france only after the release of the french recommendations in 2004. subsequent rapid emergence of azithromycin - resistant isolates may be a limitation for the use of macrolides in shigellosis. because use of azithromycin is proposed for treatment of shigellosis, susceptibility of the isolates to azithromycin should be routinely tested. | shigella sonnei ucn59, isolated during an outbreak of s. sonnei in january 2007, was resistant to azithromycin (mic 64 mg / l). the isolate contained a plasmid - borne mph(a) gene encoding a macrolide 2-phosphotransferase that inactivates macrolides. emergence of the mph(a) gene in s. sonnei may limit usefulness of azithromycin for treatment of shigellosis. |
high affinity rna - protein interactions are critical to cellular function, but directly identifying the determinants of binding within these complexes is often difficult. here, we introduce a stable isotope mass labeling technique to assign specific interacting nucleotides in an oligonucleotide - protein complex by photo - cross - linking. the method relies on generating site - specific oxygen-18-labeled phosphodiester linkages in oligonucleotides, such that covalent peptide - oligonucleotide cross - link sites arising from ultraviolet irradiation can be assigned to specific sequence positions in both rna and protein simultaneously by mass spectrometry. using lin28a and a let-7 pre - element rna, we demonstrate that mass labeling permits unambiguous identification of the cross - linked sequence positions in the rna - protein complex. |
|
attenuation of pressor response is one of the most keenly researched subjects in the field of anaesthesiology, the reason being the non - availability of a ' procedure / drug of choice ' for the same. airway instrumentation, i.e., endotracheal extubation, is invariably linked with certain cardiovascular changes such as tachycardia or bradycardia, rise in blood pressure and a plethora of cardiac arrhythmias. the pressor response can lead to various adverse events such as myocardial ischaemia, pulmonary oedema, acute heart failure and cerebrovascular accidents in susceptible individuals. the anaesthetisiologist aims to provide an incident - free extubation process devoid of adverse cardiovascular events. this holds, especially true for patients having prior coronary artery disease and long - standing hypertension. as the morbidity associated with these cardiovascular diseases is on the rise, we thus aimed to establish an efficient method of obtaining a safe extubation in this group of patients for day to day anaesthesia practice. drugs such as lignocaine, beta - blockers such as esmolol, have been tried and newer options like dexmedetomidine are routinely employed for attenuation of the pressor response. literature review advocates the swapping of the endotracheal tube with laryngeal mask airway (lma) before emergence from anaesthesia (bailey manoeuvre) as one of the methods for attenuation of pressor response at extubation. bailey manoeuvre has also been mentioned for safe extubation in the at - risk algorithm of difficult airway society extubation guidelines. proseal lma (plma) was introduced in the year 2000 and is widely considered to be an advancement over the previous design. plma is a 2 generation supraglottic airway device with a modified cuff and drainage tube, designed for a better seal with both the respiratory and gastrointestinal tracts, notwithstanding the access to the alimentary tract. as an overwhelming majority of the available literature review involved the use of bailey manoeuvre in the american society of anesthesiologists (asa) physical status i patients, we conducted this randomised controlled study on controlled hypertensive patients (asa ii), in whom the attenuation of the pressor response is of utmost importance. we aimed to compare the use of plma intervention before endotracheal extubation versus conventional endotracheal extubation in controlled hypertensive patients scheduled for elective surgeries under general anaesthesia and thus check for the superiority of one over the other for attenuation of pressor response at extubation. after approval by the hospital ethics committee, sixty consenting adult patients aged 1865 years of either sex of asa ii (controlled hypertensives) posted for elective surgery under general anaesthesia were included in this prospective randomised study. joint national committee 8 defines hypertension as persistent elevation of blood pressure > 140/90 mmhg. controlled hypertensives as per asa ii are patients with a bp 6.5%), long duration surgeries (> 4 h with major fluid shifts), impaired kidney or liver function, anticipated difficult airway, progressive neurological disease and bleeding diathesis were excluded from the study. patients allotted to group e were asa ii hypertensives posted for elective surgery under general anaesthesia, in whom endotracheal extubation was performed by employing the standard technique of extubation. patients allotted to group p were asa ii hypertensives posted for elective surgery under general anaesthesia in whom plma was inserted before endotracheal extubation (bailey manoeuvre). in both the study groups, standard extubation criteria were ensued, which incorporated the following convention : alert and co - operative patient, smooth spontaneous ventilation, sustained head lift, stable haemodynamics. a complete pre - anaesthetic checkup of patients was performed before their scheduled allotment into the two study groups. patients in both groups were pre - medicated with 0.25 mg the night before surgery and at 6:00 am on the morning of surgery with sips of water. on shifting the patient to the operation theatre (ot), monitoring devices were attached including 5 lead electrocardiogram (ecg), pulse oximeter, non - invasive blood pressure monitor. anaesthesia was induced with injection fentanyl 2 g / kg and propofol 2 mg / kg, till the loss of response to verbal commands. after giving injection vecuronium bromide 0.1 mg / kg iv, and ventilating the patients with n2o and o2(50:50%) for 3 min, intubation was performed with cuffed oral endotracheal tube of appropriate size for airway management. patients having unanticipated difficult airway requiring multiple attempts (2 or more) at intubation or laryngoscopy time of more than 15 s were excluded from the study. anaesthesia was maintained with sevoflurane (minimum alveolar concentration- [mac 1 ]) and nitrous oxide in oxygen (50:50) at flow rate of 2 l / min. the mechanical ventilator was set to achieve an end - tidal carbon dioxide (etco2) of 3540 mmhg. additional doses of vecuronium bromide if necessary were administered to maintain adequate surgical relaxation. during maintenance of anaesthesia, additional doses of injection fentanyl 1 g / kg were administered after 90 min of the initial dose, according to haemodynamic variables. during surgery, all patients received an iv infusion of ringer lactate as a maintenance dose. besides this, the 3 space loss was taken as 3 and 4 ml / kg body weight and blood loss was accounted for as per the type of surgery. ten minutes before the end of the surgery, after oropharyngeal suctioning at isoflurane mac 1 level, the plma was inserted behind the endotracheal tube and its cuff inflated in patients belonging to group p. the endotracheal tube cuff was then deflated and removed. after confirming position of the plma by auscultation, capnography and exhaled tidal volume, the patients were ventilated by the same until consciousness was regained in both group of patients and neuromuscular blockade was reversed with injection neostigmine 0.05 mg / kg and injection glycopyrrolate 0.01 mg / kg following which the plma and endotracheal tube was removed in the respective groups. all haemodynamic data were measured on arrival in ot, after reversal (before extubation), after extubation at 1, 3, 6, 8 and 10 min by an independent observer. the study was conducted in a single - blinded manner, and allocation concealment was performed using sequentially numbered opaque sealed envelopes. random allocation sequence generation (utilising block randomisation protocol of four blocks, coupled with equal allocation) and enrollment of volunteers in the study protocol was done under the direct supervision of the chief investigator. the block randomisation protocol of four blocks ensured that allocation of patients in both groups was equal after every four patients enrolled. the parameter monitored as the primary outcome during the study was heart rate (hr). the secondary outcomes were systolic blood pressure (sbp), diastolic blood pressure (dbp), mean blood pressure (mbp), 5 lead ecg, oxygen saturation by pulse oximetry and etco2 by capnography. data were analysed using microsoft excel 2010. sample size of 60, with thirty patients in both the groups, was determined for primary variable (hr), using the information obtained from a pilot study of 6 patients with mean hr (standard deviation) of 84.2 beats per min (4.2). the estimation was performed using a two - sided test with the power of the study set at 0.9 (corresponding z - value 1.28) and = 0.05 (z value for two - tailed analysis 1.96). the sample size was calculated to be 29.33 rounded off to 30 in each group and a total sample size of 60 was, therefore, taken up for the study. two - tailed paired student 's t - test was employed for comparison between the two study groups. the value of p < 0.05 was considered as statistically significant. the patient characteristics, demographic data and surgical procedures were comparable in the two groups. [table 1 ] there was no loss of patients enrolled after randomisation was performed [figure 1 ]. demographic characteristics a statistically significant decline in the hr was observed in group p as compared to group e [p = 0.001, figure 2 ]. heart rate changes in the two groups overall, there were marginal changes in sbp, dbp and mbp in group p. on comparing the sbps of the two groups, we observed statistically insignificant change in both groups, p and e (p = 0.437). the dbps also revealed changes which were not statistically significant in the groups p and e (p = 0.436). the mbps of the two groups, were also statistically insignificant in groups p and e [p = 0.802, figure 3 ]. in this study, we noticed attenuation of hr (primary outcome) with bailey manoeuvre, but no significant changes in sbp, dbp and mbp. a safe extubation strategy is one in which haemodynamic pressor response is limited, with minimal discomfort to the patient and an acceptable cost. catecholamine release during extubation is thought to be responsible for hypertension and tachycardia associated with the procedure. bailey manoeuvre as a method of attenuation of the haemodynamic response at extubation has been employed widely. in their study confirmed the safety of bailey manoeuvre as a method for smooth extubation in a wide variety of surgeries for cardiovascular high - risk patients. another research revealed that exchange of an endotracheal tube for an lma under deep plane of anaesthesia in elderly patients posted for upper abdominal surgeries can significantly reduce the pressor responses at extubation. this is in sharp contrast to our study in which we only observed a statistically significant decline in hr [figure 2 ] in the group where plma (group p) was used as compared to the other group where endotracheal extubation was performed by the standard technique (group e). however, a decline in sbp, dbp and mbp did occur in group p as compared to group e but was considered statistically insignificant. [figure 3 ] from this study, we infer that although bailey manoeuvre has been regarded as an efficient method for attenuating the pressor response at extubation in previous studies, we observed different results. our results indicate that bailey manoeuvre is probably an over - stated method for reducing the haemodynamic response at extubation and one can not solely rely on this as a foolproof technique. studies have been carried out to compare different types of lmas in attenuating the extubation responses to establish the best device possible. in a study comparing classic lma with ambu lma as an exchange device to the endotracheal tube before extubation, it was found that ambu lma was associated with superior haemodynamic stability as compared to classic lma. studies till now on bailey manoeuvre have included patients of asa grades i and ii in totality. this could be attributed as the reason for the difference in results that we encountered as compared to previous studies where bailey manoeuvre proved as an efficient method for attenuating the haemodynamic response at extubation. owing to these contradictions, a well - structured systematic review and meta - analysis in this subject area may throw light on the actual scenario. hence, in the target group of patients where actually attenuation of the pressor response to extubation is most warranted, like the groups in this study, bailey manoeuvre may not be an efficacious method to be completely relied on. the limitations of our study included lack of data pertaining to pharyngeal morbidity and the confounding effects of antihypertensive medications ; these can be addressed by additional studies in future. bailey manoeuvre fails to be an efficient method in the target group of controlled hypertensives and thus, can not be completely relied upon for attenuation of pressor response at extubation. | background and aims : swapping of the endotracheal tube with laryngeal mask airway (lma) before emergence from anaesthesia is one of the methods employed for attenuation of pressor response at extubation. we decided to compare the placement of proseal lma (plma) before endotracheal extubation versus conventional endotracheal extubation in controlled hypertensive patients scheduled for elective surgeries under general anaesthesia.methods:sixty consenting adult patients were randomly allocated to two groups of thirty each ; group e in whom extubation was performed using standard technique and group p in whom plma was inserted before endotracheal extubation (bailey manoeuvre). the primary outcome parameter was heart rate (hr). the secondary outcomes were systolic, diastolic and mean blood pressure (mbp), electrocardiogram, oxygen saturation and end - tidal carbon dioxide. two - tailed paired student 's t - test was used for comparison between the two study groups. the value of p < 0.05 was considered as statistically significant.results:the patient characteristics, demographic data and surgical procedures were comparable in the two groups. a statistically significant decrease was observed in hr in group p as compared to group e. secondary outcomes such as systolic, diastolic and mbp depicted a statistically insignificant difference.conclusion:bailey manoeuvre was not effective method to be completely relied upon during extubation when compared to standard extubation. |
detection of malformation is tremendously improved with improvement in imaging technology. in majority of countries worldwide, second trimester scan between 18 and 22 weeks remains the standard of care for fetal anatomical assessment ; however, most recent literature shows a significant improvement in detection of fetal abnormalities in first trimester of pregnancy. besides nuchal abnormalities a wide range of central nervous system, heart, anterior abdominal wall, urinary tract, and skeletal abnormalities can be diagnosed between 11 and 14 weeks of scan. the clear benefits of first trimester ultrasound are early detection and exclusion of major congenital anomalies (not compatible with life or followed by severe handicap), reassurance, and relatively easier pregnancy termination if required. currently, the review of recent literature suggests classification of fetal abnormalities as always detectable, potentially detectable, and undetectable till first trimester and anomaly scan. the diagnostic efficacy of first trimester anomaly scan and echocardiography between 11 and 14 weeks has been assessed in medium risk population by becker and wegner. the overall detection rate of fetal anomalies including cardiac defects was 84% and increased with raised nuchal thickness particularly more than 2.5 mm. this highlights the scope of first trimester scan apart from its conventional role in detection of chromosomal abnormality. first trimester screening is now no more limited to detection of raised nuchal thickness (nt). analysed 6879 cases to assess the prevalence and detection rate of major anomalies by applying first trimester anomaly scan and fetal echocardiography. they concluded that a significant number of fetal anomalies occur with normal nt and more than half of them could be detected in first trimester. hence, even fetuses with normal nt should be offered first trimester anomaly scan and fetal echocardiography considering the ethical principles of nonmaleficence, justice, and respect for autonomy of pregnant women. even in this era we frequently encounter malformations always or potentially detectable during first trimester scan at third trimester or in postnatal period. it depends on both the expertise and resources available along with the awareness and sensitization in general population. this fact of diagnosis is particularly more important in countries like india where medical termination of pregnancy is legally allowed up to 20 weeks of gestation irrespective of malformation being lethal. we see a fair number of patients who are diagnosed with fetal malformation beyond 20 weeks and in that situation they are forced to seek termination services at small substandard centres since they get refusals from all relatively good hospitals due to legal issues associated with termination. many of such patients get deteriorated due to septic abortion and unnecessary hysterotomy and so forth. question then arises that where lies the fault, the awareness of the patients or the expertise of the sonologist. henceforth, the study was planned to assess the prevalence of fetal malformation in a tertiary care referral centre and to assess the present status of first trimester ultrasonography in the detection of fetal malformations in a tertiary care centre in india. this was a retrospective observational study conducted at sanjay gandhi postgraduate institute of medical sciences. all pregnant women attending department of maternal and reproductive health, opd, from august 2009 till october 2013 were enrolled in the study. all pregnant women underwent ultrasound (general electrical voluson s8) and those with fetal structural malformations were evaluated. malformations were classified according to gestational age of diagnosis, system involved, and type of malformation. a total number of 4080 pregnant women underwent usg and amongst them 312 (7.6%) patients had fetal structural malformation. malformations were classified according to various systems as shown in table 2. out of total malformed fetuses, 103 (33%) were detected prior to 20 weeks of gestational age and 209 (66.9%) were detected after 20 weeks of gestational age. out of 103 women who were diagnosed with fetal malformations before 20 weeks, only 5 (1.6%) were detected prior to 12 weeks of gestational age and the remaining 98 (31.4%) were diagnosed between 12 and 20 weeks. six patients amongst them presented before 12 weeks but malformations were missed and diagnosed later between 12 and 20 weeks. these cases were omphalocele, osteogenesis imperfecta, harlequin ichthyosis, stickler syndrome, fraser syndrome, and dandy - walker malformation. these conditions, diagnosed to have malformation prior to 20 weeks, 80 patients willingly underwent termination of pregnancy in view of malformation being lethal like a fetus with occipital encephalocoele terminated at 20 weeks of gestational age (figure 1). we had prescribed protocol of oral mifepristone (200 mg) followed by misoprostol induction after 48 hours of mifepristone. all of them had postpartum neonatal intervention in the department of pediatric surgery, neonatology and plastic surgery, respectively (for posterior urethral valve, extra lobar sequestration, tracheoesophageal fistula, anorectal malformation, congenital diaphragmatic hernia with good lh ratio, meningocele, polycystic kidneys, megacystis, vesicoureteral reflux, and cleft lip palate). biggest agony is that two amongst those continuing pregnancies with known lethal malformations had hysterotomy and two had cesarean section for anomalous fetus which could have been avoided. we found that with the present available technology majority of malformation could be diagnosed before 20 weeks (box 1). we found that there are few malformations which could be easily diagnosed before 12 weeks (box 2). five patients were diagnosed prior to 12 weeks for neural tube defect, holoprosencephaly, gastroschisis, cystic hygroma, and anencephaly. out of 312 pregnant women with malformations, 209 (66.9%) were diagnosed after 20 weeks. 109 had their first usg after 20 weeks and 100 had usg prior to 20 weeks but malformations were missed. out of those 100 patients, 6 patients presented to our institute before 20 weeks and malformations were not confirmed until 24 weeks. in 94 women, they went for usg prior to 20 weeks at some other centre and malformation was missed. amongst those six patients who presented to sgpgi prior to 20 weeks but were missed, there were one case each of dandy - walker malformation, autosomal dominant polycystic kidneys, late onset hydrocephalus, and tetralogy of fallot. two fetuses, one with cleft lip and one with neural tube defect, could have been diagnosed but were missed. there exists a group of malformation which lies in the grey zone of diagnosis before 20 weeks (box 3). out of 209 detected cases after 20 weeks, 70 (33.4%) patients had malformations which were detected after 20 weeks and are acceptable because these include conditions which tend to be diagnosed late in gestation like hydrocephalus (figures 2(a) and 2(b)), agenesis of corpus callosum (figure 2(c)), congenital cystic adenomatoid malformation (figure 2(d)), various cardiac structural malformations, cystic kidney diseases, horseshoe kidney, dandy - walker malformations and variants, vein of galen aneurysm, duodenal atresia, fetal goitre, intra - abdominal tumours, gonadal cyst, hirschsprung disease, and isolated fetal ascites. even though missed in first trimester, in 139 (66.5%) patients, fetal malformations could have been diagnosed between 12 and 20 weeks as shown in box 1. these included malformations like neural tube defect (figures 3(a) and 3(b)), acrania - exencephaly - anencephaly sequence (figures 4(a), 4(b), and 4(c)), skeletal dysplasia (figures 5(a), 5(b), and 5(c)), multicystic dysplastic kidneys (figure 5(d)), and limb body wall complex (figures 6(a), 6(b), and 6(c)). prenatal interventions in very unique complications of monochorionic twins have become the treatment of choice but diagnosis of acardiac twinning was delayed till 24 weeks (figure 6(d)). this delayed pick - up of these potentially salvageable conditions leads to high likelihood of adverse pregnancy outcome. the overall prevalence of severe and lethal fetal structural malformation in our study was 7.6% which was higher than that reported in the literature for general population (35%), possibly because it was a referral centre for high risk pregnancy and fetal medicine ; there is overreporting of cases. as such, preconceptional folic acid is not commonly practiced in our study population. we realize that almost half (52.1%) of our patients had their first usg for anomaly detection after 20 weeks. it reflects the existing darkness of unawareness and vacuum of knowledge in patients and also in basic health care that are first to encounter pregnant women. we found that, out of the total number of women with diagnosed fetal malformation, 203 (65%) presented before 20 weeks. hence, equally important is the fact to realize that almost half of these patients who had malformations detected after 20 weeks had their obstetrical sonography before 20 weeks and were missed. this missing out of an anomaly may be because of scarcity of good resolution machines, busy schedules, and lack of expertise as well. for years together, there have been substantial advances in magnification imaging and signal processing which increased the ability to visualize fetal anatomy ; there has been great concern on the possibility to diagnose a wide range of fetal anomalies at the time of nuchal translucency scan by transvaginal and transabdominal sonography [79 ]. almost half of malformations in our study were amenable to be diagnosed in first trimester as reported in current literature. these fetuses were having malformations like neural tube defects, anencephaly, holoprosencephaly, and gastroschisis (box 2). castro - aragon and levine reported that 6067% of malformations could have been diagnosed prior to 12 weeks. this is far away from our scenario where we found that only 1.6% (5/312) were diagnosed prior to 12 weeks. this is possibly due to the lack of awareness and lack of expertise as well. fong. in their study scanned 8,537 women between 11 and 14 weeks of gestation (crown rump length, 4584 mm) ; there were 175 fetuses with an increased nt. besides nuchal abnormalities, a wide range of other congenital anomalies can be diagnosed with us at 1114 weeks of gestation, including defects of the central nervous system, heart, anterior abdominal wall, urinary tract, and skeleton. analyzed 1085 pregnancies ; 21 (1.93%) fetuses had at least one major structural defect considered detectable by routine ultrasound screening. 14 (1.29%) were identified at early (first trimester) screening and an additional 5 (0.47%) were identified at late (second trimester) usg. they found that majority of fetal structural abnormalities can be detected by sonographic screening at 1114 weeks, but detailed fetal anatomic survey performed at 1822 weeks should not be abandoned. rossi and prefumo also laid stress that first trimester ultrasound can detect half of fetal malformations. they included nineteen studies on 78,002 fetuses, with 996 with malformations that were confirmed by postnatal or postmortem examinations. usg at 11 to 14 weeks detected malformation in 472 of the malformed fetuses (51%). detection rate was highest for neck anomalies (92%) and lowest for limbs, face, and genitourinary anomalies (34% for each). multiple defects were more likely to be identified than isolated malformations (60% versus 44%). detection rates ranged from 1% to 49% for spina bifida or hydrocephalus, ranged from 50% to 99% for valvular disease and septal defects, were 100% for acrania and anencephaly, and were 0% for corpus callosum agenesis and bladder exstrophy. combination of transabdominal and transvaginal techniques resulted in a 62% detection rate versus 51% for transabdominal technique only and 34% for transvaginal technique only. although first trimester ultrasound can detect about 50% of fetal malformations, it can not replace second trimester ultrasound because several malformations develop later than the first trimester. also to be kept in mind is the fact that accuracy of early ultrasonography can be compromised by transient findings like midgut herniation, small septal defects, and hydronephrosis which might get resolved during intrauterine life. did a prospective two - centre 2-year study of 5472 consecutive unselected pregnant women examined at 12 to 13 + 6 gestational weeks. the first trimester scan identified 40.6% of the cases detected overall and 76.3% of major structural defects. major congenital heart disease (either isolated or associated with extracardiac abnormalities) was 90%. fetuses with increased nuchal translucency (nt), the first trimester dr for major anomalies, were 96% compared to 66.7% amongst those with normal nt. there have been several studies seeing application for an extended protocol in which first trimester sonography is supported by a second anomaly scan. the obvious advantage of an extended protocol is that parents are offered the option of earlier and safer termination of pregnancy for the large majority of severe / lethal abnormalities. early ultrasound might be more accurate than second trimester ultrasonography for detection of malformations associated with oligohydramnios and anhydramnios which lead to poor visualization at later gestation necessitating amnioinfusion. we have applied this kind of protocol at our centre particularly in high risk women. first trimester sonography with targeted imaging for fetal malformation appeared particularly more helpful in high risk women with previous history of fetus / neonates with malformations, known risk factors, for example, type 2 diabetes, patients prone for teratogenicity, for example, thromboembolic and valve replacement patients on warfarin, methotrexate intake for connective tissue disorders, and so forth, antiepileptic, chemotherapeutic drugs, and history of infection exposure like rubella. we diagnosed and terminated patients before 16 weeks with rubella exposure and subsequent pulmonary stenosis, severe bony stippling and craniofacial malformation associated with high doses warfarin, vsd associated with type 2 diabetes, neural tube defect with antiepileptic and tetraphocomelia with chemotherapeutic agents, renal agenesis in previous history of fraser 's syndrome, encephalocoele in previous meckel - gruber syndrome, arpkd and adpkd, and so forth. however, a detailed first trimester examination protocol involves supplementary resources : additional examination time and specialized personnel for the abnormal suspected / detected cases. healthcare systems are yet to determine whether early first trimester diagnosis of most major structural abnormalities is cost - effective. previous research, albeit using inferior ultrasound technology and a less extended protocol, found that the first trimester anomaly scan was cost - efficient in terms of medical and economic expenses, although they obtained lower detection rates [15, 16 ]. the present research about the effectiveness of early ultrasonography in the diagnosis of structural defects does have some conflicts, which made it a challenge that to what extent structural congenital abnormalities could be detected by the routine scanning of fetal anatomy combined with nuchal translucency measurement. few other basic prerequisites associated with early prenatal diagnosis consist of the high experience required and high costs in terms of time and equipment. even with all these circumstances, the situation in our country is such that a huge number of patients, 209 (66.9%), were diagnosed after 20 weeks which shows the lacunae which need to be filled. in our study we realized that even in a tertiary care centre only 1.6% fetuses with malformation are identified in first trimester. in a way, it throws light on the importance of screening as well as an immense need for early diagnosis and timely intervention in the field of prenatal detection of congenital malformation. a detailed examination of fetal anatomy during the routine 1114 weeks of gestation scan provides a comprehensive assessment of fetal anatomy and can detect approximately half of major structural defects in both low - risk and high - risk pregnancies. detection rate increases markedly beyond 13 weeks of gestation compared with 11 weeks of gestation. we have seen to be better convinced to diagnose holoprosencephaly, achondrogenesis, osteogenesis imperfecta, and spondylocostal dysostosis at 14 weeks compared to 12 weeks. it is also expected that because of the late development of some organ systems and the delayed onset of a significant number of major anomalies in the second and third trimester it is very unlikely that the early scan may replace second trimester ultrasonography. we need to identify structural malformations before 20 weeks except those conditions which are said to appear further late or reported with confirmation at a later gestational age like few posterior fossa abnormalities, duodenal atresia, and few renal abnormalities. the most important implication is safe termination and avoiding maternal threat to life by forced termination at resourceless and substandard centres. there could be an option of incorporating anomaly scan between 18 and 20 weeks in our health plans and guides at well registered centres with expertise at reasonable cost. focus and emphasis should aim at detection of malformation earlier than 12 weeks owing to the very unique and clear facts that first trimester detection leads to easy termination of pregnancy and lessening of women 's mental, physical, and psychological trauma. | background. early detection of malformation is tremendously improved with improvement in imaging technology. yet in a developing country like india majority of pregnant women are not privileged to get timely diagnosis. aims and objectives. to assess the present status and potential of first trimester ultrasonography in detection of fetal congenital structural malformations. methodology. this was a retrospective observational study conducted at sanjay gandhi postgraduate institute of medical sciences. all pregnant women had anomaly scan and women with fetal structural malformations were included. results. out of 4080 pregnant women undergoing ultrasound, 312 (7.6%) had fetal structural malformation. out of 139 patients who were diagnosed after 20 weeks, 47 (33.8%) had fetal structural anomalies which could have been diagnosed before 12 weeks and 92 (66.1%) had fetal malformations which could have been diagnosed between 12 and 20 weeks. conclusion. the first trimester ultrasonography could have identified 50% of major structural defects compared to 1.6% in the present scenario. this focuses on the immense need of the hour to gear up for early diagnosis and timely intervention in the field of prenatal detection of congenital malformation. |
reduced ocular perfusion pressure is a risk factor for the prevalence, incidence and progression of glaucoma. the death of retinal ganglion cells appears to involve primary and secondary insults. glaucoma is a family of multifactorial optical neuropathies characterized by loss of retinal ganglion cells (rgcs) leading to typical optic nerve head (onh) damage and distinctive visual field defects. although the pathogenesis of the disease is unknown, it is well established that the main risk factor for glaucoma is elevated intraocular pressure (iop). reducing iop is effective in slowing down the progression of the disease but some patients still progress despite adequately controlled iop. several studies implicated vascular risk factors in the pathogenesis of glaucoma, blood pressure (bp) and ocular perfusion pressure (opp) being the most studied. this vascular hypothesis is based on the premise that abnormal perfusion and the subsequent ischemia of the onh play a major role in the glaucomatous damage. as such the opp can be estimated as the difference between the arterial pressure and iop. some studies indicate that systemic hypertension is a risk factor for glaucoma [13 ]. on the other hand some studies indicate that low systemic bp is a risk factor for development and progression of glaucoma. a direct and clear relationship between bp level and glaucomatous damage has, however, not been established. the good irrigation of the ocular tissues is ensured by an adequate opp depending on a complex regulation process that balances bp and the iop. as such dealing with the concept of opp and bp at the same time large epidemiological studies have shown that low opp is a risk factor for the prevalence, incidence and progression of glaucoma. in the barbados eye study subjects with the lowest 20% of diastolic perfusion pressure were 3.3 times more likely to develop glaucoma. in the proyecto ver study it was established that patients with a diastolic perfusion pressure as low as 45 mmhg had a three times greater risk of developing glaucoma compared to those with a diastolic perfusion pressure of 65 mmhg. this is in keeping with data from the egna neumarkt study showing that the prevalence of the disease in patients with diastolic perfusion pressure less than 50 mmhg increases 4.5 fold compared to patients with diastolic perfusion pressure of 65 mmhg. data on glaucoma progression are available from the early manifest glaucoma trial (emgt). low systolic perfusion pressure was a predictor of progression with an almost 50% higher risk. more in depth reviews on the data linking opp to glaucoma prevalence, incidence and progression have been provided. this review, however, will formulate some hypotheses as to why opp is a risk factor. vascular factors have been identified in many chronic neurodegenerative disorders including alzheimer 's disease and amyotrophic lateral sclerosis. in glaucoma the hypothesis of a vascular involvement in the disease process has been formulated a long time ago. the evidence that low opp is a risk factor for the disease has further supported this concept. indeed it assumes that mean arterial pressure (map) as measured at the brachial artery is a good measure of map at the level of the ophthalmic artery. in addition, there is evidence that the difference between venous pressure and iop is increased in patients with glaucoma. this is related to the phenomenon of spontaneous venous pulsations in the central retinal vein, which appear to be a risk factor for glaucoma. as such it is likely that the relationship between true opp and glaucomatous damage is much stronger than indicated above. whilst it is well - established that reduced opp (as currently estimated) is a risk factor for glaucoma there is considerable controversy as to why this is the case. in the following we present a theory describing pathways that may depend on opp and contribute to glaucomatous damage. as indicated in figure 1 we assume that loss of rgcs is the consequence of primary and secondary insults as suggested previously. the site of primary insult to rgc axons in glaucoma is most likely within the onh, more specifically at the lamina cribrosa. increased iop may be responsible for this loss of rgc axons modulated by the biomechanical properties of the ocular tissues and the level of cerebrospinal fluid pressure (csf) [1820 ]. as such, low csf pressure may be one of the factors by which opp modulates the risk of glaucoma because changes in either of them lead to a change in the trans - lamina cribrosa pressure gradient. another factor in the primary glaucomatous insult that may be enhanced by low opp is onh ischemia associated with reduced flow of nutrients to the rgc axons. some investigators assume that this ischemia at the onh is primary and at least in some cases associated with systemic disease. another possibility is that iop - related strain within the peri - papillary sclera affects perfusion through the scleral branches of the short posterior ciliary arteries. the vasculature of the onh is complex and the post - laminar regions of the onh are supplied by branches of the posterior ciliary arteries. owing to its deep anatomical location little is known about blood flow (bf) and its regulation in this part of the onh. most quantitative data about onh bf regulation stem from the anterior onh regions that are supplied by the central retinal artery. once a primary insult has occurred at the level of the onh rgcs appear to function at reduced energy levels with affected mitochondria. this is supported by numerous experimental data including electrophysiological studies in the primate revealing that affected rgcs retain some of their functionality. as such neuroprotective strategies indeed targeting mitochondria may offer a wide range of strategies for rgc survival including the dynamic processes of mitochondrial fission and fusion, the electron transport chain components, ion channels and defense strategies against oxidative stress. oxidative stress associated with extensive production of reactive oxygen species (ros) such as free radicals, hydrogen peroxide, or singlet oxygen is another factor that may be enhanced by ischemia associated with low opp. free radicals are molecules containing unpaired electrons in their outer orbits. singlet oxygen and hydrogen peroxide oxidative stress occurs when the balance between production of ros and endogenous antioxidative defense systems is disturbed either owing to increased ros activity or owing to reduced antioxidative capacity. strategies may be wide and include inhibition of ros formation, administration and/or supplementation with antioxidants or with agents that increase the reducing power necessary for ros detoxification or stimulation of gene expression for increasing mitochondrial antioxidant defenses. another pathway in which reduced opp may contribute is related to secondary insults associated with abnormal autoregulation or a breakdown in neurovascular coupling. here it is assumed that rgcs that function at low energy states are susceptible to periods of ischemia or reduced nutritional support. such periods can happen if opp falls below the lower autoregulatory limit or if the functional hyperemic reaction to visual stimulation is dysfunctional in patients with glaucoma. autoregulation is the ability of a vascular bed to maintain its bf despite changes in perfusion pressure. we have recently provided an in - depth review on the relation between opp and ocular bf and as such only some of the aspects that are relevant for the present topic will be covered. nowadays there is evidence that retinal, onh and choroidal bf show some regulatory capacity in response to changes in opp. traditionally it is assumed that at the lower limit of autoregulation vessels are fully dilated. this is, however, not the case because the hyperemic vasodilator response to flicker stimulation is fully preserved even below the lower limit of autoregulation. the mechanisms of autoregulation are complex and not fully understood. in the retina and the onh it appears that autoregulation is strongly dependent on myogenic and metabolic mechanisms. in the choroid the rich parasympathetic, sympathetic and sensory innervation as well as intrinsic choroidal neurons plays a key role in bf regulation in face of changes in opp. in glaucoma this includes experiments in which iop was modified and studies in which the response to posture changes was assessed. evidence for altered autoregulatory capacity in glaucoma also arises from group correlations between ocular bf and opp [3032 ]. the reason for abnormal autoregulation in glaucoma patients is not fully understood (figure 2). obviously reduced opp as well as increased opp variability may lead to a fall of bf when the lower limit of autoregulation is reached. increased variability of opp and nocturnal bp dipping have indeed been identified as risk factors for glaucoma. evidence has accumulated that, at least in the choroid, bf regulates better when map is modified than when iop is modulated. this means that at the same level of opp bf may also depend on the absolute value of map and iop. the authors have developed a rabbit model in which map can be modulated by placing an occluder around the thoracic vena cava. this allows for measurement of choroidal bf while opp is modified although iop is held constant. interestingly bf regulated better when iop was kept constant at levels of 5 mmhg than at levels of 25 mmhg. in recent years we have performed several studies indicating that this is also the case in humans. as such any reduction in iop is associated with an improvement in bf regulation. alterations in autoregulation in glaucoma may also arise from a phenomenon called primary vascular dysregulation. this term was introduced by flammer describing otherwise healthy subjects that show abnormal regulation in response to temperature changes and mechanical or emotional stress. the basis for this dysregulation is not clear, but may be related to vascular endothelial dysfunction. in addition, both endothelin and nitric oxide (no) are key regulators of onh and choroidal bf at baseline and during isometric exercise. in the onh this may be related to loss of autoregulation in glaucoma, because astrocytes are considered to play a key role in tissue remodeling of the onh. it is, however, unclear how early this activation of astrocytes occurs although there is evidence that release of substances such as glutamate and tumor necrosis factor from astrocytes is involved in rgc death. in the onh astrocytes are involved in autoregulation during an increase in iop, because the gliotoxic agent l-2-aminoadipic acid modifies the bf response during the decrease in opp. in the brain and the retina bf increases when neurons get active, a response called functional hyperemia. this phenomenon called neurovascular coupling has attracted much interest because an abnormal bf response to neuronal stimulation causes cell death caused by inadequate nutrient supply. our understanding of the mechanisms that underlie neurovascular coupling has increased significantly in the recent years. briefly, synaptically released glutamate activates n - methyl - d - aspartate receptors and metabotropic glutamate receptors in neurons and astrocytes, respectively. this leads to an increase in intracellular ca activating arachidonic acid pathways associated with the synthesis of vasodilators such as prostaglandins and epoxyeicosatrienoic acids and vasoconstrictors such as 20-hydroxy - eicosatetraenoic acid. in addition no synthesized from no synthase-1 in neurons may play a role in the vasodilator response. indeed, no synthase inhibition blunts the retinal hyperemic response to flicker stimulation in humans. generally it is, however, believed that no has a modulatory rather than a mediating role in the human retinal neurovascular coupling, because the activity of the enzymes in the arachidonic acid pathways depend on the level of no. as such the hyperemic response may also depend on endothelial no related to flow - mediated mechanisms. in glaucoma the response of retinal and onh bf to flicker stimulation is reduced [5153 ]. primary vascular dysregulation appears to be associated with abnormal retinal neurovascular coupling, because vasospastic subjects show a reduced response to flicker stimulation. in keeping with this idea endothelial dysfunction the level of iop, however, does not appear to be directly related to the reduced hyperemic response, because short - term elevation does not influence flicker - induced vasodilatation. activated astrocytes in glaucoma are also potential sources of impaired vasodilator response to flicker stimulation, although this hypothesis remains unproven. independently of the mechanisms contributing to reduced flicker responses in glaucoma it may well be that abnormal neurovascular coupling plays a role in the secondary insults to rgcs as shown in figure 1. one of the reasons why our understanding of the relation between opp and glaucoma is still limited lies in the difficulties to measure retinal and onh bf [5558 ]. doppler optical coherence tomography may become a technique capable of measuring bf in a valid and reproducible way [5961,62 ]. this improvement in technology is associated with the hope of gaining more insight into ocular bf regulation. it is pharmacologically difficult to increase opp. on the other hand one needs to be careful not to induce systemic hypertension with such approaches. an exception may be reducing anti - hypertensive treatment in patients with systemic hypertension in order to prevent very low opps. when neuroprotective strategies are implemented it appears that it is not enough to focus on the pathways that are involved in programmed cell death of rgcs (figure 4). most probably neurovascular as well as neuroinflammatory pathways (not described in this review) need to be targeted as well. generally the pathways leading to primary and secondary insults in glaucoma need to be better described to target the neurovascular component in glaucoma. papers of particular interest, published within the period of review, have been highlighted as: of special interest of outstanding interest of special interest of outstanding interest | graphical abstracthighlights reduced ocular perfusion pressure is a risk factor for the prevalence, incidence and progression of glaucoma. the death of retinal ganglion cells appears to involve primary and secondary insults. reduced opp may enhance both primary and secondary insults. abnormal autoregulation and neurovascular coupling may lead to ganglion cell death. |
from the early expansion of human populations, and particularly with the agricultural revolution (about 10,000 years ago), human activity has resulted in increased diversity and severity of disease. this phenomenon is generally known as the first epidemiological transition (armelagos. the number of parasites that humans share with domestic animals appears to be proportional to the time spent since domestication (southwood 1987). the second epidemiological transition followed the industrial revolution and was characterised by a dramatic decrease in disease - induced mortality in human populations. we may now be facing the third epidemiological transition, where an increasing number of parasites (in the context of this review including pathogens) emerge or re - emerge. even those parasites that previously were considered to be under control can re - emerge, and sometimes in highly virulent forms (barrett. 1998). this third epidemiological transition may due to parasite evolution driven by human activity, including ecological changes related to modern agricultural practices (stearns and ebert 2001 ; lebarbenchon.. intensive farming of plants and animals creates conditions for parasite transmission and growth that are drastically different from conditions experienced by parasites in wild host populations. therefore, intensive farming may alter selection on various traits, such as life - history traits and virulence. we focus our review on intensive animal farming (defined as practices involving large numbers of animals raised on limited land and which require large amounts of food, water and medical inputs), because several issues complicate plant parasite evolution, some of them including spatial structure, crop rotation and aspects related to soil ecology (kiers. farmed host populations are usually of very high local density (several orders of magnitude greater than in the wild), have reduced genetic variation (down to single host lines or genotypes) and are bred for high yield. rapid evolution can occur in parasites infesting such populations, as illustrated by the repeated emergence and spread of drug resistance in a wide range of parasite species (coles 2006 ; hastings. but although recent epidemic outbreaks (e.g. avian influenza h5n1, foot - and - mouth disease, swine influenza h1n1) have highlighted the risks associated with intensive farming practices, most work on parasites has focused on reducing the short - term economic losses imposed by parasites, such as application of chemotherapy. most research on parasite evolution has been conducted using laboratory model systems, often unrelated to economically important systems. such research is of importance to evolutionary biologists, but is perhaps less relevant for determining farm management policies. the aim of this review is to examine the possible evolutionary consequences of intensive farming by relating current knowledge of the evolution of parasite life - history and virulence with specific conditions experienced by parasites on farms. first, there has been a recent worldwide spread of intensive farming providing very dense, rapidly expanding and well - connected (by human assisted transport) host populations, which may favour the evolution of fast - reproducing parasites. second, under intensive farming conditions, parasite populations are facing cycles of rapid growth followed by drastic declines (caused by either slaughtering of hosts or drug treatment). such boost - and - bust cycles may select for fast - growing parasites in a way that is similar to serial passage experiments conducted in the laboratory. in this kind of experiments, parasites are transferred from one host to another under conditions that are expected to make the traits of interest evolve. at the end of the experiment, these traits are compared to those in the ancestral lines of parasites (ebert 1998). serial passage experiments often yield clear - cut conclusions on the evolution of parasite life - history. for example, shorter host lifespan or higher host availability is known to select for faster life - histories of parasites (crossan. we then discuss how the predicted changes in parasite life - history may result in increased parasite virulence (parasite - induced host mortality). as an illustration, we examine the effects of fish farming which, to our sense, provides one of the best frameworks for studying the impact of modern food production on the evolution of parasites. on intensive farms, animals are kept at very high densities all year round. in epidemiological theory, host population density has a central role since an increase in the number of hosts affects the probability for parasite transmission stages to contact new hosts (anderson and may 1978 ; may and anderson 1978). mean parasite abundance should therefore increase with increasing host density, as this has been observed for parasites of mammals (arneberg. everything else being equal, the basic reproductive ratio (r0) of parasites increases with host density, so that dense host populations are easier to colonise (r0 > 1) for a higher number of parasite species and hence are likely to harbour higher parasite species richness (dobson. this pattern has been observed both amongst fish (morand. 2000) and mammals (arneberg 2002). the proportion of hosts being infected with more than one parasite strain (multiple infections) should therefore be higher in dense populations. central to the theory of life - history evolution is the idea that organisms trade off fecundity against mortality in a way that maximises their lifetime reproductive success (stearns 1992 ; roff 2002). an expanding host population will represent an increased resource base for the parasite population, and this will make current reproduction more valuable in relation to future survival. in addition, early infectivity was traded - off against larval longevity. as confirmed by a simulation model, the optimal infection strategy in this system depends on the balance between infectivity and survival until successful contact with new hosts (crossan. a higher frequency of multiple infections has also often been suggested to favour faster growth of parasites, and hence a change in life history towards earlier reproduction, due to increased within - host competition (may and nowak 1995 ; ebert and mangin 1997 ; gandon. the structuring of host populations has also changed, sometimes drastically, with intensive farming. some host populations have become more clustered : whilst animals within the same farm are in close contact with each other, amongst - farm contacts are relatively rare, most of them being indirect through the supply of new, young individuals coming from common stocks (e.g. farmed salmonids, munro and gregory 2009). a high degree of clustering for example, the 2001 outbreak of foot - and - mouth disease in the uk highlighted the importance of amongst - farm contacts in the spread of the disease. the restrictions then imposed on animal transport (thus increasing the degree of clustering) were still insufficient in preventing the epidemic, which justified the preventive culling of neighbouring uninfected farms around infected spots (ferguson. host population structuring was rarely considered in former epidemiological models (grenfell and dobson 1995), but is now increasingly recognised as an important factor affecting disease transmission (read and keeling 2003 ; keeling and eames 2005 ; webb. 2007 ; dangerfield. 2009). in the early stages of an epidemic, a high degree of clustering is predicted to increase the spread of infection (basic reproductive ratio r0) because it makes susceptible hosts more easily available to infective stages. in the second and subsequent generations, because of increased immunity in previously infected hosts, clustering may reduce the number of new contacts and may therefore have the opposite effect on r0 (keeling 2005). however, not all host taxa have induced immunity. on some types of intensive farms where a high degree of clustering is combined with the regular arrival of new susceptible individuals (e.g. munro and gregory 2009), the first positive effect of clustering on transmission rate may be predominant. in this case, as discussed earlier, increased transmission should select for faster parasite life - histories. but here again, selection for faster life - histories related to host population clustering should not be taken as a general consequence of all intensive farming practices. this discussion makes clear that the effect of host population structure on parasite life - histories is important, but that it depends on the parameters of each host - parasite system and on management practises. for parasites any increase in adult mortality, caused by either intrinsic factors typical to host - parasite interactions or extrinsic factors such as host death or anti - parasite drugs, reduces the prospects for future transmission. hence, increased mortality should select for faster within - host growth, earlier onset of reproduction and increased investment in early reproduction. comparative studies have investigated the links between parasite life history and host longevity. in parasitic nematodes, time to release of transmission stages (prepatency) is correlated with female body size (skorping. 1991). amongst nematode parasites of primates (e.g. oxyurids), there is a positive association between female body length and longevity of their primate hosts, regardless of phylogeny or host body size. in other words, parasite species associated with shorter - lived host species mature on average earlier than those associated with longer - lived host species (harvey and keymer 1991 ; sorci. additionally, formal models have explored life - history trade - offs in parasites from a theoretical perspective. for example, a simple optimality model where delayed reproduction had opposite consequences for fecundity and pre - reproductive survival could explain about 50% of the observed variation in nematode prepatency (gemmill. 1999). considering that this model made quite crude assumptions and did not explicitly consider host mortality, this result suggests that the fecundity / mortality trade - off is a major determinant of parasite life - history. in another model where mortality could be caused either by intrinsic mortality or by host death, optimal time to patency was found to be inversely related to both types of mortality (morand and poulin 2000). finally, in the particular case of obligately killing parasites (i.e. parasites where transmission requires the death of the host), life - history was modelled assuming density - dependence of within - host growth. here again, the higher the host background mortality, the earlier the optimal time for killing the host (ebert and weisser 1997). these theoretical predictions are supported by experimental studies specifically designed to test the effect of host lifespan on parasite life history. the most clear - cut example comes from a recent study of holospora undulata, a bacterial parasite of the ciliate paramecium caudatum. in an experimental evolution study where hosts were killed either early or late, parasites from early - killing treatment lines had a shorter latency (time until the release of infectious forms) than parasites from late - killing treatment lines (nidelet. interestingly, a similar experiment using the horizontally transmitted intestinal parasite glugoides intestinalis of the crustacean daphnia magna yielded opposite results : within - host growth was found to be lower in the lines where the parasites had low life expectancy (ebert and mangin 1997). however, in the latter experiment, high mortality was achieved by weekly replacing 7080% of the hosts, whereas low mortality consisted in no replacement at all. as a consequence, the frequency of multiple infections and hence within - host competition was probably higher in the low - mortality lines. as later formally confirmed, within - host competition selects for earlier parasite life - history (gandon. adult survival of parasites is reduced on intensive farms and there are two main reasons for this. first, host lifespan is usually shorter than in wild host populations because of frequent culling of animals. second, parasites experience high direct mortality caused by anti - parasite treatments (e.g. antibiotic treatments). according to theory, such reductions in adult survival should favour higher investment in current reproductive effort (fig. 1), and. therefore, frequent use of drugs by the farming industry does not only selects for drug resistance (coles 2006 ; hastings. 2006 ; hastings and watkins 2006 ; read and huijben 2009), but is also likely to exacerbate selection for faster growth and transmission of parasites (webster. 2008).fig. 1graphical model for the optimal reproductive effort of parasites in wild and farmed host populations in the presence of a trade - off between current and future reproductive effort. with lower adult survival of parasites in farmed host populations, prospects for future reproduction are reduced (the trade - off curve is lower).the optimal level of current reproductive effort is found at the point the trade - off curve is tangent to a line (the adaptive function) going through all combinations of both variables that result in the same fitness (e.g. cody 1966)here a 45 degrees line. farming conditions are therefore predicted to select for higher levels of current reproductive effort graphical model for the optimal reproductive effort of parasites in wild and farmed host populations in the presence of a trade - off between current and future reproductive effort. with lower adult survival of parasites in farmed host populations, prospects for future reproduction are reduced (the trade - off curve is lower).the optimal level of current reproductive effort is found at the point the trade - off curve is tangent to a line (the adaptive function) going through all combinations of both variables that result in the same fitness (e.g. cody 1966)here a 45 degrees line. a currently widely accepted view is that virulence (parasite - induced host mortality) is both a consequence of parasite transmission and an obstacle to it and that there should be an optimal, intermediate level of virulence (jensen. a minimum level of host exploitation is necessary for the production of propagules but, on the other hand, increasing host mortality reduces parasite fitness, so that there is an adaptive cost to virulence (reviewed in alizon.. however, the higher the host availability, the smaller the predicted cost of virulence. therefore, very high host densities on intensive farms are likely to favour higher levels of virulence, because the constraints due to the cost of virulence are relaxed. in addition, the use of vaccines reducing pathogen growth and/or toxicity may also reduce the cost of virulence by reducing the risk of host death, and hence select for higher virulence ; this may, however, not apply to other types of vaccines such as infection - blocking vaccines (gandon. as discussed earlier, intensive farming is likely to select for faster within - host growth and earlier transmission of parasites. although the generality of a relation between parasite life - history and virulence is still debated (ebert and bull 2003 ; alizon. 2009), empirical results from a variety of host - parasite systems suggest that selection for early transmission can result in increased virulence. for example, experimental selection for early transmission resulted in higher virulence of the nuclear polyhedrosis virus of the gypsy moth lymantria dispar (cooper. similar results were obtained in the protozoan paramecium caudatum and its bacterial parasite holospora undulata (nidelet. 2009). in humans the reduction in host lifespan due to hiv coinfection has been suggested to select for higher virulence of tuberculosis (basu and galvani 2009). however, a selective change in parasite life history towards earlier reproduction does not necessarily imply higher virulence. increased virulence might be expected if the extraction rate of host resources is enhanced or if early parasite reproduction is otherwise linked to increased virulence (e.g. in parasites which need to kill for transmission). but parasites might also trade off quality versus quantity of offspring, e.g. by producing more and cheaper transmission stages earlier (without extracting more host resources). low quality transmission stages may not be able to survive long in the external environment, but this may not be necessary in high density host populations (bonhoeffer. multiple infections have often been suggested to favour faster growth of parasites and higher levels of virulence (may and nowak 1995 ; ebert and mangin 1997 ; gandon. 2001a) because in hosts infected by more than one strain (or species) of parasite, there is little reproductive benefit for the parasite in sparing its the host if it allows other unrelated parasites to compete for the same resource (within - host selection). however, too high levels of virulence are costly in single infected hosts, so that the benefits of increased virulence also depend on the frequency of multiple infected hosts in the population (between - host selection) (de roode. 2005 ; coombs. 2007 ; another factor tempering selection for high virulence in multiple infected hosts is the level of relatedness between co - infecting strains. low levels of virulence can be expected when strains within the same host are closely related (brown. classical epidemiological models show that increasing extrinsic host mortality can lead to higher levels of parasite virulence in the absence of superinfection (a particular case of multiple infections where one strain replaces the other inside the host) (gandon. there are two cases, however, where virulence might decrease with increasing host mortality. first, when mortality causes reduction in the density of infected hosts, the rate of superinfection decreases and, as a consequence, lower within - host competition may in turn select for lower virulence (gandon. this effect is probably of little importance in most farmed host populations, where the density of infected hosts is likely to be higher than in wild host populations. virulence can also decrease with increasing extrinsic host mortality when it makes a host more susceptible to other sources of mortality (e.g. predation), because then parasites with low virulence have greater chances of survival (williams and day 2001). this scenario may apply to some extent to farming conditions, for example when diseased fish are removed from culture cages. but the opposite scenario may also occur if diseased animals are preferably excluded from slaughtering (and left for recovery). here, more detailed data on specific farming management practices are needed to predict how human - induced selection is acting on parasites. a further difference from natural host populations that may be significant to parasite virulence is the often low level of genetic variation in farmed host populations, which may favour the spread of diseases (altermatt and ebert 2008 ; ganz and ebert 2010). additionally, farmed animal lines are selected for rapid growth and high yield, but usually not for resistance to parasites. more importantly perhaps, host genotypes are sometimes replaced after slaughtering by individuals from the same common stock (e.g. common salmon smolt production sites munro and gregory 2009), independently of the infection status of individuals in the preceding generation, so that selection can no longer act on host traits involved in immune defence. in these conditions, parasites would keep adapting to counter host immune defences, whereas hosts would be left more and more susceptible to parasitic infection. replacing hosts after each slaughtering with individuals coming from a different stock than the previous one may hamper local adaptation of parasites and therefore slow down their evolution (ebert and hamilton 1996 ; ebert 1998). finally, animal movements due to human transportation sometimes at an intercontinental scale will greatly increase the effective population sizes and mix host and parasite genotypes, thereby altering rates of local adaptation and maladaptation between hosts and parasites. more detailed knowledge of host and parasite demography is necessary to accurately predict the direction and extent to which virulence evolves in farmed populations. quantitative data about parasite prevalence, mortality due to parasitic infection, replacement rates and management of genetic variation in farmed host populations may exist but, unfortunately, such information is not easily accessible from farming industries. however, even in the absence of detailed information, the prevailing conditions on farms (high density, use of chemotherapy, high replacement rate and low levels of innate immunity in highly selected lines) are likely to increase the degree to which parasites exploit their hosts and thus lead to increased virulence. amongst the different types of intensive farming, fish farming has increased the most rapidly in the last decades. the farmed fish population has increased 100-fold globally in 60 years : from 320,000 tons in 1950, aquaculture fish production reached 32,000,000 tons in 2007 (fao 2008 ; fig. 2). for migrating marine fish species, this enormous increase in population size is associated with another change : year - round presence of fish in coastal seawater, which provides a highly predictable resource for parasites. altogether, these recent changes in fish ecology can be considered a large - scale natural experiment providing good conditions to study parasite evolution (skorping and read 1998), especially because many farmed fish are still genetically close to their wild conspecifics, which makes comparisons easier than in other, older farmed animal species.fig. 2increase in the global production of farmed fish (freshwater & marine species) since 1950 (source : fao statistics 2009) increase in the global production of farmed fish (freshwater & marine species) since 1950 (source : fao statistics 2009) the most compelling evidence for increased pathogen virulence on intensive farms comes from a recent study of flavobacterium columnare, a pathogen of salmon smolts (salmo salar), trout smolts (salmo trutta) and rainbow trout (oncorhynchus mykiss). in the last 23 years, the incidence, severity of symptoms and mortality of this pathogen have steadily increased in finnish freshwater farms. antibiotic treatments that were increasingly used from 1992 onwards failed to control mortality. rearing conditions on farms, coupled with the ability of the pathogen to be transmitted from dead to live fish have likely favoured the emergence and spread of increasingly virulent strains (pulkkinen. 2010). faster life history and increased investment in early reproduction is likely to be evolving in other farmed fish - parasite systems. in particular, the ecology of the atlantic salmon salmo salar, one of the most abundant farmed fish worldwide (fao 2008), has radically changed since the beginning of intensive farming (gross 1998). on salmon farms, parasitic infestations have been increasingly reported and disease epidemics have become a major problem. epidemiological factors such as higher host density and lower host diversity both facilitate the spread of diseases (grenfell and dobson 1995 ; altermatt and ebert 2008) and can therefore be expected to select for faster life history of parasites. unfortunately, little evidence is available so far to support this claim since most work on parasites of farmed salmon did not focus on life history but rather on drug resistance and vaccine development. however, we will discuss here the possibility that life - history and virulence may be evolving in two major parasites and pathogens of farmed salmon which are causing major economic losses in addition to the threat they impose on wild salmonid stocks. the salmon louse lepeophtheirus salmonis is a natural marine ectoparasite of salmonids that that was first reported in the nineteenth century, but salmon louse epidemics did not occur until after cage culture began, in the 1960s in norway, in the 1970s in scotland and in the 1980s in north - america. soon after the first outbreaks, organophosphates were used to control sea lice populations, and national sea lice monitoring programs have been initiated to help reduce the costs to the farming industry (reviewed in pike and wadsworth 2000). however, salmon lice have rapidly evolved resistance to widely used chemotherapeutants such as, hydrogen peroxide, dichlorvos and enamectin benzoate (treasurer. 2000 ; fallang. 2004 ; lees. l. salmonis is now a major problem wherever salmon is farmed in the northern hemisphere. the life cycle of salmon lice consists in eight successive developmental stages. after infection, copepodid larvae develop into four successive chalimi stages attached to the host s skin by a frontal filament before moulting into two pre - adult stages that are mobile on the fish. highly infested salmons often have severe skin wounds causing osmoregulatory stress, reduced weight gain and increasing the risk of secondary infections by other pathogens (pike and wadsworth 2000). soon after mating, adult female lice start extruding fertilized eggs enclosed in a matrix that binds the eggs together in egg strings. egg strings remain attached to the female until hatching but are functionally independent (pike and wadsworth 2000). female lice keep producing eggs (up to 11 successive pairs of egg strings) at regular, temperature - dependent intervals for the rest of their lifespan (heuch. age at maturity and both the number and volume of eggs produced in each pair of egg strings especially in the first pair are quite variable (a. mennerat, pers. there is therefore potential for evolution of these life history traits, and indeed preliminary data (a. mennerat, unpublished data) indicate that salmon lice coming from an intensively farmed area of the norwegian coast reproduce significantly earlier on average than lice coming from an area without salmon farming, which tends to support the theoretical predictions discussed earlier. another pathogen causing major economic loss for salmon farms isa virus is an orthomyxovirus comprised of two distinct clades, one european and one north - american that diverged before 1900 (krossoy. this divergence indicates that an ancestral form of the virus was present in wild salmonids before the start of cage - culture. accumulating evidence points to vertical transmission (parent - to - offspring transmission) as the major transmission route of the virus. horizontal transmission (transmission between members of the same species that are not in a parent - offspring relationship) may also occur to a smaller extent (nylund. the haemagglutinin - esterase (he) surface glycoprotein, assumed to be of importance in virulence, contains a highly polymorphic region (hpr), the region of greatest sequence variation (mjaaland. is commonly found in healthy marine and freshwater fish, where it has never been associated with any of the classical clinical signs of isa disease. in particular, hpr0 variants were found in 22 of 24 sampled norwegian smolt production sites, which indicates that most smolt imported from freshwater sites to marine cages carry isa virus in its avirulent form (nylund. the first outbreaks of isa were recorded in 1984 on salmonid farms in norway (thorud and djupvik 1988) and subsequently in canada, maine, scotland, faroe islands and chile (ritchie. more than 20 pathogenic hpr variants have been described so far, probably resulting from differential deletions of the hpr0 avirulent precursor gene (mjaaland. the emergence of these isa virulent variants has been suggested to be a consequence of increased transmission from natural reservoirs to dense, farmed atlantic salmon populations (mjaaland. overall, most variance in disease spread is likely to be explained by epidemiological changes. however, this should not distract us from the problems we create by inducing evolutionary changes in the parasites. the evolutionary response of the parasite often reduces the efficiency of our control measures, which may lead to a cultural genetic arms race between farmers (cultural evolution : improve methods to control parasites) and parasites (adapt to new conditions). such cultural genetic arms races are well known from our attempts to control bacteria with the help of antibiotics, where nowadays the problem is considered to be an evolutionary issue. the salmon farming industry does not have yet the same problems as we see in drug resistance of human diseases, but the above examples suggest that life history and virulence of parasites and pathogens may be evolving, potentially rendering our attempts to manage these diseases useless. more detailed knowledge on the characteristics of each system and the traits responding to selection would help predict the direction and rate of such evolution. evolutionary biologists have recently raised concerns about the impact of human intervention on the evolution of parasites and disease agents (e.g. palumbi 2001 ; altizer. 2008 ; smith and bernatchez 2008 ; waples and hendry 2008 ; restif 2009). long - term evolutionary effects of parasite management strategies have received little attention so far from the farming industry (pike and wadsworth 2000 ; ebert and bull 2003). instead, the majority of research has focused on how to reduce economic losses caused by parasitic infestations of farmed animals and the proposed solutions are mostly driven by short - term motivations targeting the parasite directly or reducing transmission. the farming industry s neglect of the evolutionary impact of intensive farming may simply reflect diverging interests (reducing the risk of virulence is of little financial interest), but it may also be due to the lack of empirical evidence. however, we caution not to draw conclusions based on simplified models (ebert and bull 2003). host - parasite systems are often characterised by idiosyncrasies, which may play an important role for the evolution of the system and which may lead to apparently counter intuitive outcomes. therefore, before management plans are put into practice, we suggest investigating if the host or the parasite population is already showing an evolutionary response to the altered environmental conditions typical of farming. with this knowledge at hand, refined models can be developed and the direction and rate of parasite evolution may be predicted for the particular epidemiological and demographic settings of the host - parasite association under consideration. in the long term, understanding parasite evolution and taking appropriate actions to prevent it may be the most successful and cost - effective way to control disease. furthermore, using evolutionary principles to prevent or influence parasite evolution (as opposed to chemical parasite control) is likely to be in the interest of sustainable farming practice. | an increasing number of scientists have recently raised concerns about the threat posed by human intervention on the evolution of parasites and disease agents. new parasites (including pathogens) keep emerging and parasites which previously were considered to be under control are re - emerging, sometimes in highly virulent forms. this re - emergence may be parasite evolution, driven by human activity, including ecological changes related to modern agricultural practices. intensive farming creates conditions for parasite growth and transmission drastically different from what parasites experience in wild host populations and may therefore alter selection on various traits, such as life - history traits and virulence. although recent epidemic outbreaks highlight the risks associated with intensive farming practices, most work has focused on reducing the short - term economic losses imposed by parasites, such as application of chemotherapy. most of the research on parasite evolution has been conducted using laboratory model systems, often unrelated to economically important systems. here, we review the possible evolutionary consequences of intensive farming by relating current knowledge of the evolution of parasite life - history and virulence with specific conditions experienced by parasites on farms. we show that intensive farming practices are likely to select for fast - growing, early - transmitted, and hence probably more virulent parasites. as an illustration, we consider the case of the fish farming industry, a branch of intensive farming which has dramatically expanded recently and present evidence that supports the idea that intensive farming conditions increase parasite virulence. we suggest that more studies should focus on the impact of intensive farming on parasite evolution in order to build currently lacking, but necessary bridges between academia and decision - makers. |
aesthetics and color of the teeth are reflection of systemic health. several intrinsic and the extrinsic factors can influence tooth color. while intrinsic discoloration of the tooth may be caused following trauma, loss of vitality, endodontic treatment, and restorative procedures apart from known local and systemic factors. extrinsic tooth stains occur due to poor tooth brushing techniques, smoking, dietary intake of tannin - rich foods, excess use of chlorhexidine mouth wash, and/or consumption of metal salts. many techniques have been evolved for the purpose of managing discolored non - vital tooth. amongst these techniques, inside / outside bleaching technique is an effective and conservative treatment option compared to placing restorations. in this technique, bleaching is carried out within the tooth and on the outside of the tooth simultaneously. here a 30-year - old female patient reported to the institution with a complaint of discolored upper front tooth and desired the discolored tooth be treated [figure 1 ]. on examination, intra oral periapical radiograph with maxillary left central incisor revealed a complete root canal obturation without periapical pathology. patient was explained about the bleaching procedure and consented for the inside and outside in - office power bleaching therapy to correct discolored tooth. discolored maxillary left central incisor tooth using rubber dam, the tooth to be bleached was isolated and cleaned with pumice and the shade was recorded [figure 2 ]. the obturated material was removed from the tooth up to 2 mm below the gingival margin. 1 mm glass ionomer cement (type 1, gc corporation, singapore) was placed over the gutta - percha. using 37% phosphoric acid, pulp chamber was etched for 30 - 60 s, washed and dried, which resulted in the opening of dentinal tubules. following this, 38% hydrogen peroxide (pola office ultradent, usa), bleaching agent was mixed into thick paste and placed immediately in the pulp chamber and on the external labial surface of the tooth [figure 3 ]. after 10 - 15 min, the tooth was cleansed and the residue bleach inside was removed with water using a high suction unit. tooth shade was evaluated, which matched with adjacent tooth and satisfactory results were achieved [figure 4 ]. the access and the partially empty pulp chamber were restored using tooth colored composite resin. internal and external bleaching in progress guma barrier applied for external bleaching post bleaching appearance of the discolored teeth using rubber dam, the tooth to be bleached was isolated and cleaned with pumice and the shade was recorded [figure 2 ]. the obturated material was removed from the tooth up to 2 mm below the gingival margin. 1 mm glass ionomer cement (type 1, gc corporation, singapore) was placed over the gutta - percha. using 37% phosphoric acid, pulp chamber was etched for 30 - 60 s, washed and dried, which resulted in the opening of dentinal tubules. following this, 38% hydrogen peroxide (pola office ultradent, usa), bleaching agent was mixed into thick paste and placed immediately in the pulp chamber and on the external labial surface of the tooth [figure 3 ]. after 10 - 15 min, the tooth was cleansed and the residue bleach inside was removed with water using a high suction unit. tooth shade was evaluated, which matched with adjacent tooth and satisfactory results were achieved [figure 4 ]. the access and the partially empty pulp chamber were restored using tooth colored composite resin. internal and external bleaching in progress guma barrier applied for external bleaching post bleaching appearance of the discolored teeth different options are used in the treatment of discolored endodontically treated anterior tooth. in - office, the bleach has many advantages over the conventional options and is especially, useful in treating the crown and intrinsic discoloration of the tooth. the in - office bleach, which was used in this patient, is discussed here. for a tooth that had discolored following de - vitalization, bleaching is preferable to the crown placement when the tooth is relatively intact. in vitro studies suggested that it is the bulk of the remaining tooth structure rather than the dowel that provides strength and resistance to fracture of the endodontically treated tooth. a previous study reported no significant difference in the success rate achieved between anterior non - vital teeth with and without crowns. trabert. also concluded no appreciable difference in the resistance to fracture between untreated anterior teeth and endodontically treated anterior teeth. further despite small proximal restorations, most pulp less anterior teeth with sound coronal tooth structure can be conservatively restored with the lingual composite restoration. interestingly, there was no advantage in reinforcement by cementing posts in endodontically treated anterior teeth. in contrast placement of a dowel and crown in such a tooth is likely to weaken rather than strengthening it. for instance, intact endodontically treated anterior teeth with natural crowns demonstrate greater strength against fracture than teeth built - up with pin retained amalgam cores or cast gold dowel cores. further central incisors were three times more resistant to fracture than the teeth, which were restored with dowel core and crowns. it may mask the discoloration, but also may undergo fracture, debonding, and marginal leakage. however, it requires tooth preparation and is irreversible. considering the above reasons in - office the major advantage of this approach is (1) it is more conservative (2) more effective in stain removal and (3) significantly improves the appearance of tooth color. hence, in - office bleaching should be the most commonly adapted method by the dentist as it provides complete control on the process throughout treatment. moreover, in - office bleaching is usually a rapid process and the results are evident even after a single intervention. nevertheless, many of the patients prefer this bleaching approach by the dental professional because it requires less active participation on their part. pola office ultradent xtra boost containing 38% hydrogen peroxide chemically activated without light and heat was used in the current procedure. hydrogen peroxide releases oxygen that breaks down conjugated bonds associated with the stains into a single bond, which in turn can be washed out with water and hence effectively removes the stains. the use of light in bleaching had no demonstrable benefit over the chemically activated tooth whitening system. anterior tooth trauma, with or without fracture / s may or may not involve the pulp. the amount of tooth structure destroyed, location of the fracture and the severities of discolorations are considered while selecting a type of treatment, a type of restorative material and kind of tooth preparation. when anterior tooth is discolored and non - vital, but is structurally intact, it should be preferentially endodontically treated with the minimal access cavity opening and using inside and outside bleach. this approach is minimally invasive than complete ceramic, ceramic fused to metal, or veneers, which removes substantial amount of tooth structure, leading to irreversible damage, and are expensive. the type of intrinsic stain can play a significant part in the ultimate outcome of tooth bleaching, and choice of treatment depends on clinical experience and judgment of dentist in context of patient 's circumstances. | intrinsic discoloration of a non - vital permanent incisor tooth due to trauma may have a significant esthetic and social impact on children and adolescents. treatment options for discolored non - vital teeth are bleaching, crowns or veneers. however, this restorative crown or veneer approach has a significant drawback of being an invasive technique. intervention should be minimal destruction of tooth structure and should not compromise future restorative options. the advantage bleaching over crown is that it offers simple conservative approach in removal of stain and whitening discolored teeth without damaging tooth structure. |
squamous cell carcinoma of the head and neck (scchn) is the 6 most common malignancy worldwide and has a poor prognosis which has not improved over the last 25 - 30 years. like many other human tumor types, approximately 50% of the scchn tumors show mutations in the well - known tumor suppressor gene tp53. so far, factors of proven prognostic significance for scchn tumors are presence of regional lymph node metastasis (n - status) and amplification of chromosome 3q, where the tp53 homolog, p63, is located. the six members of the p63 family, which is crucial for formation of the oral mucosa, are deregulated in scchn[69 ] and overexpression of p63 has been correlated to aggressive disease and poor outcome in this tumor type. we have also shown that repressing p63 in scchn cell lines decreases their survival and sensitizes them to chemotherapy and radiotherapy. scchn is a very heterogeneous group of tumors and looking at only intraorally located scc ; we recently showed that p63 status differs between tumors of different subsites within this limited area. tongue tumors, in contrast to gingival and tongue / floor of the mouth tumors, showed downregulation of p63 compared to corresponding normal tissue. this indicates that apart from being an important player in scchn tumors, p63 's role differs depending on subsite of the tumor. although the downstream pathways of p63 are the focus of many studies, pathways regulating p63 are not well characterized. one way of regulating gene expression is through micrornas (mirnas), noncoding rnas that can regulate protein coding genes by inducing mrna degradation or by interfering with mrna translation. results from mouse and human cell lines also indicate a role for mirnas in activation of translation. one of the first mirnas detected in the human genome was mir-21, a mirna found to be overexpressed in different tumor types including scchn.[1823 ] transfection with mir-21 mimics in scchn cell lines caused statistically significant increased cell growth and overexpressing mir-21 enhanced tumor cell survival in tongue scc. in glioblastoma cells, mir-21 targets the full length p63 isoforms, tap63, and can also indirectly affect the function of its relative, p53. a mirna directly regulating p53 is mir-125b and overexpression of mir-125b caused repression of the p53 protein in human neuroblastoma cells and human lung fibroblasts, while knockdown of mir-125b increased the levels of p53 protein in lung fibroblasts. levels of mir- 125b are downregulated in scchn and transfection of mir-125b into oscc cells reduced cell proliferation. a mirna identified to target np63 isoforms, at least in vitro in mouse keratinocytes, is mir- 203, and mir-203 regulates np63 levels in scchn upon genotoxic damage. mir-203 is expressed in suprabasal layers of stratified epithelia with the primary role to suppress the proliferative capacity of epithelial cells upon differentiation. only a few studies have mapped mir-203 status in scchn, showing downregulation in scchn cell lines and oral scc compared to non - cancerous oral mucosa. in our previous analysis of 836 mirnas in formalin fixed paraffin - embedded samples from tongue scc, we identified 54 mirnas to be differentially expressed. among these, mir- 21 was the second highest upregulated, and mir-203 among the most downregulated mirnas. in this study, we have mapped expression of three mirnas and the levels of two of their potential target proteins in tumor samples from patients with scchn. in accordance with our previous data, we also clearly show differential expression for mirnas based on tumor subsite. furthermore, the correlations previously seen between mirnas and their target proteins in vitro were not as clear - cut in tumors in vivo. after obtaining informed consent, tumor biopsies were collected from 23 patients with squamous cell carcinoma in the oral cavity. for patient data, tumors were divided into three groups based on subsite, with one group of gingival tumors, one group of tongue tumors, and one mixed group comprising four tumors originating in the tongue with overgrowth into the floor of the mouth and three tumors originating in the floor of the mouth with overgrowth into the tongue. a biopsy was also taken from clinically normal tissue of the same subsite as the tumor from all patients. from the mixed group, clinically normal tissue was taken from the tongue in six patients and from the floor of the mouth in one patient. tissue samples were snap - frozen in liquid nitrogen and stored at 80c until rna and protein were extracted. the project was approved by the local ethical committee (dnr 08 - 003 m). one part of each biopsy was homogenized in trizol using a precellys (bertin technologies, aix - en - provence, france) and total rna including mirna extracted using chloroform. after dilution in water, rna concentration was measured with a nanodrop (thermoscientific). for the cdna reaction, 20 ng of total rna was used with the mercury lna universal cdna synthesis kit according to the manufacturer 's protocol (exiqon, vedbaek, denmark), total volume of each reaction was 20 l. the expression levels of mir-21, mir-125b, mir-203, and the reference gene u48 were analyzed with real - time pcr amplification for individual assays using lna primer sets for mirna (exiqon). protein was extracted from the other half of each biopsy using a micro - dismembrator (b. braun. one hundred microliters of lysis buffer containing 0.5% np-40, 0.5% na - doc, 0.1% sds, 150 mm nacl, 50 mm tris ph 7.5, 1 mm edta, 1 mm naf, and protease inhibitor cocktail (sigma - aldrich) were then added and samples were homogenized. protein concentration was determined using bca protein assay kit (pierce, rockford, usa). for protein analysis, 30 g protein extract was run on 10% clear page, sds - polyacrylamide mini - gels (vwr international, radnor, usa). proteins were transferred to a pvdf membrane (millipore) and stained with ponceau red for evaluation of transfer efficiency and loading. primary monoclonal antibodies used were 4a4 anti - p63 (abcam ab3239) diluted 1/500, p53 (abcam ab80645) diluted 1/1000, and actin (chemicon international mab1501r, temecula, usa) diluted 1/5000. secondary antibody was peroxidase - labeled rabbit anti - mouse (dakocytometric) diluted 1/50,000. for chemiluminescence detection, chemidoc xrs (bio - rad) was used in combination with ecl, electrochemiluminescence, advance (ge healthcare, uppsala, sweden). twenty - one of the 23 samples included had previously been analyzed for expression of p63. wilcoxon - signed rank test was used for calculation of differences between tumor and normal samples and spearman 's rank correlation coefficient for correlation analysis. after obtaining informed consent, tumor biopsies were collected from 23 patients with squamous cell carcinoma in the oral cavity. for patient data, tumors were divided into three groups based on subsite, with one group of gingival tumors, one group of tongue tumors, and one mixed group comprising four tumors originating in the tongue with overgrowth into the floor of the mouth and three tumors originating in the floor of the mouth with overgrowth into the tongue. a biopsy was also taken from clinically normal tissue of the same subsite as the tumor from all patients. from the mixed group, clinically normal tissue was taken from the tongue in six patients and from the floor of the mouth in one patient. tissue samples were snap - frozen in liquid nitrogen and stored at 80c until rna and protein were extracted. the project was approved by the local ethical committee (dnr 08 - 003 m). one part of each biopsy was homogenized in trizol using a precellys (bertin technologies, aix - en - provence, france) and total rna including mirna extracted using chloroform. after dilution in water, rna concentration was measured with a nanodrop (thermoscientific). for the cdna reaction, 20 ng of total rna was used with the mercury lna universal cdna synthesis kit according to the manufacturer 's protocol (exiqon, vedbaek, denmark), total volume of each reaction was 20 l. the expression levels of mir-21, mir-125b, mir-203, and the reference gene u48 were analyzed with real - time pcr amplification for individual assays using lna primer sets for mirna (exiqon). protein was extracted from the other half of each biopsy using a micro - dismembrator (b. braun. one hundred microliters of lysis buffer containing 0.5% np-40, 0.5% na - doc, 0.1% sds, 150 mm nacl, 50 mm tris ph 7.5, 1 mm edta, 1 mm naf, and protease inhibitor cocktail (sigma - aldrich) were then added and samples were homogenized. protein concentration was determined using bca protein assay kit (pierce, rockford, usa). for protein analysis, 30 g protein extract was run on 10% clear page, sds - polyacrylamide mini - gels (vwr international, radnor, usa). proteins were transferred to a pvdf membrane (millipore) and stained with ponceau red for evaluation of transfer efficiency and loading. primary monoclonal antibodies used were 4a4 anti - p63 (abcam ab3239) diluted 1/500, p53 (abcam ab80645) diluted 1/1000, and actin (chemicon international mab1501r, temecula, usa) diluted 1/5000. secondary antibody was peroxidase - labeled rabbit anti - mouse (dakocytometric) diluted 1/50,000. for chemiluminescence detection, chemidoc xrs (bio - rad) was used in combination with ecl, electrochemiluminescence, advance (ge healthcare, uppsala, sweden). twenty - one of the 23 samples included had previously been analyzed for expression of p63. wilcoxon - signed rank test was used for calculation of differences between tumor and normal samples and spearman 's rank correlation coefficient for correlation analysis. three selected mirnas, mir-21, mir-125b, and mir-203, previously reported to be connected to two important factors in scchn, p53 and p63, were analyzed in 23 patients with oral scc and corresponding clinically normal tissue from each patient used as control. levels of mirna were measured using qrt - pcr and results showed that all mirnas examined were significantly altered in tumor tissue compared to corresponding normal tissue. in general, there were relatively large interindividual variations in mirna expression. in accordance with previous studies, mir- 21 was significantly upregulated in tumors compared to normal tissue in 20/23 patients [figure 1a ] (p < 0.001). on the other hand, mir-125b and mir-203 were significantly downregulated in 22/23 and 18/23 patients, respectively, [figures 1b and c ] (p < 0.001), also in agreement with previous data. altered microrna (mirna) expression in oral squamous cell carcinoma (scc). to analyze differences in expression of mir-21, mir-125b, and mir-203 in oral scc tumors mir-21 expression was significantly upregulated (p < 0.001) (t = tumors, c = controls) (a), and mir-125b and mir-203 significantly downregulated in tumors compared to corresponding normal tissue (p < 0.001 and p < 0.001, respectively) (b and c). dividing tumors into different subsites showed mir-21 to be significantly upregulated in tongue and tongue / floor of the mouth tumors but not in gingival tumors (d). mir-125b showed significant downregulation in tumor samples compared to controls regardless of subsite (e). mir-203 showed downregulation in all three subsites, but significant only in tongue tumors (f). the mir-21 ratio is calculated as expression in tumor divided to expression in corresponding normal control (ct) (g). ct for mir-125b in the different locations (h) and ct for mir-203 (i) when dividing tumors into different subsites, results showed that expression of individual mirnas was only significantly altered in specific tumor sites. thus, mir-21 was not significantly altered in gingival tumors but significantly upregulated in both tongue and tongue / floor of the mouth tumors [figure 1d ]. for mir-125b, tumors in all three subsites showed significant downregulation compared to clinically normal tissue of the same subsite [figure 1e ], whereas mir-203 was neither significantly altered in gingival nor in tongue / floor of the mouth tumors but significantly downregulated in tumors in the tongue [figure 1f ]. analyzing data at the individual level by calculating a ratio between mirna expression in each tumor divided by its corresponding normal control showed similar pattern as when analyzing samples group wise [figures 1g i ]. mirnas can have effect both through destabilization of mrna and through blocking of protein translation, but whichever way regulation occurs the effect will be seen at protein levels. protein levels of the two potential targets, p53 and p63, were therefore measured in the same samples. results showed p53 to be significantly upregulated in 18/23 samples [figure 2a ] (p < 0.01). looking at protein expression based on subsite, p53 was significantly increased in the group of tongue / floor of the mouth tumors but not in gingival and tongue tumors [figure 2b ]. it is well known that missense mutations in tp53 occur in about 50% of tumors including scchn and lead to a dramatic stabilization of p53 protein, although other mechanisms may also induce protein stabilization of wild - type (wt) p53. thus, very high levels of p53 equate to missense mutations and low levels of p53 equate to wt status, whereas moderately increased levels of p53 are seen in roughly equal proportions of tumors containing wt and mutant p53. in order to evaluate the mutational status of p53, the specimens were divided into the three groups based on intensity of western blot bands, where very high - level expression was classified as mutated p53 (mut) and weak expression represented wt p53, whereas intermediate expression levels were not classified since they may represent mutated or wt tp53. results showed that eight samples had mutated p53, seven wt p53, and eight of the samples could not be determined [table 1 ]. when analyzing mirna expression based on p53 mutation status, wt - p53 tumors had higher levels of mir-125b compared to mutated p53 tumors (p = 0.021), whereas expression of mir- 21 and mir-203 was not significantly altered between tumors with wt or mutated p53. microrna (mirna) target protein expression in oral squamous cell carcinoma (scc). by using western blot, levels of the mirna target p53 p53 protein expression was significantly upregulated in tumor tissue (p < 0.01) (t = tumors, c = controls) (a). taking subsite into consideration, only tongue/ floor of the mouth tumors showed significant upregulation of p53 protein (b) even if both gingival and tongue tumors showed a trend toward upregulation of p53 protein protein levels of p63 in 21 of the samples have previously been reported. the addition of two tumors and corresponding clinically normal tissue did not alter results, showing p63 to be significantly downregulated in tumors compared to corresponding normal samples (p < 0.01). when dividing tumors into different subsites, significantly lower expression of p63 was seen in tongue tumors, but not in the other two groups, in accordance with previous results. whatever mirnas that are changed in tumors, the important task is to map the effect of these changes at protein levels of their potential targets in the in vivo situation. in order to do this, when comparing all samples as one group, mir-21 showed significant correlation with both p53 (positive) and p63 (negative) [table 2 ], whereas mir-125b showed significant negative correlation with p53 only [table 2 ]. mir-203 in turn did not show any correlation with either p53 or p63 [table 2 ]. as the number of tumors in each subsite was limited, no correlation analysis based on subsites was performed. three selected mirnas, mir-21, mir-125b, and mir-203, previously reported to be connected to two important factors in scchn, p53 and p63, were analyzed in 23 patients with oral scc and corresponding clinically normal tissue from each patient used as control. levels of mirna were measured using qrt - pcr and results showed that all mirnas examined were significantly altered in tumor tissue compared to corresponding normal tissue. in general, there were relatively large interindividual variations in mirna expression. in accordance with previous studies, mir- 21 was significantly upregulated in tumors compared to normal tissue in 20/23 patients [figure 1a ] (p < 0.001). on the other hand, mir-125b and mir-203 were significantly downregulated in 22/23 and 18/23 patients, respectively, [figures 1b and c ] (p < 0.001), also in agreement with previous data. altered microrna (mirna) expression in oral squamous cell carcinoma (scc). to analyze differences in expression of mir-21, mir-125b, and mir-203 in oral scc tumors mir-21 expression was significantly upregulated (p < 0.001) (t = tumors, c = controls) (a), and mir-125b and mir-203 significantly downregulated in tumors compared to corresponding normal tissue (p < 0.001 and p < 0.001, respectively) (b and c). dividing tumors into different subsites showed mir-21 to be significantly upregulated in tongue and tongue / floor of the mouth tumors but not in gingival tumors (d). mir-125b showed significant downregulation in tumor samples compared to controls regardless of subsite (e). mir-203 showed downregulation in all three subsites, but significant only in tongue tumors (f). the mir-21 ratio is calculated as expression in tumor divided to expression in corresponding normal control (ct) (g). ct for mir-125b in the different locations (h) and ct for mir-203 (i) when dividing tumors into different subsites, results showed that expression of individual mirnas was only significantly altered in specific tumor sites. thus, mir-21 was not significantly altered in gingival tumors but significantly upregulated in both tongue and tongue / floor of the mouth tumors [figure 1d ]. for mir-125b, tumors in all three subsites showed significant downregulation compared to clinically normal tissue of the same subsite [figure 1e ], whereas mir-203 was neither significantly altered in gingival nor in tongue / floor of the mouth tumors but significantly downregulated in tumors in the tongue [figure 1f ]. analyzing data at the individual level by calculating a ratio between mirna expression in each tumor divided by its corresponding normal control showed similar pattern as when analyzing samples group wise [figures 1g i ]. mirnas can have effect both through destabilization of mrna and through blocking of protein translation, but whichever way regulation occurs the effect will be seen at protein levels. protein levels of the two potential targets, p53 and p63, were therefore measured in the same samples. results showed p53 to be significantly upregulated in 18/23 samples [figure 2a ] (p < 0.01). looking at protein expression based on subsite, p53 was significantly increased in the group of tongue / floor of the mouth tumors but not in gingival and tongue tumors [figure 2b ]. it is well known that missense mutations in tp53 occur in about 50% of tumors including scchn and lead to a dramatic stabilization of p53 protein, although other mechanisms may also induce protein stabilization of wild - type (wt) p53. thus, very high levels of p53 equate to missense mutations and low levels of p53 equate to wt status, whereas moderately increased levels of p53 are seen in roughly equal proportions of tumors containing wt and mutant p53. in order to evaluate the mutational status of p53, the specimens were divided into the three groups based on intensity of western blot bands, where very high - level expression was classified as mutated p53 (mut) and weak expression represented wt p53, whereas intermediate expression levels were not classified since they may represent mutated or wt tp53. results showed that eight samples had mutated p53, seven wt p53, and eight of the samples could not be determined [table 1 ]. when analyzing mirna expression based on p53 mutation status, wt - p53 tumors had higher levels of mir-125b compared to mutated p53 tumors (p = 0.021), whereas expression of mir- 21 and mir-203 was not significantly altered between tumors with wt or mutated p53. microrna (mirna) target protein expression in oral squamous cell carcinoma (scc). by using western blot, levels of the mirna target p53 were analyzed in the same tumors that were analyzed for mirna expression. p53 protein expression was significantly upregulated in tumor tissue (p < 0.01) (t = tumors, c = controls) (a). taking subsite into consideration, only tongue/ floor of the mouth tumors showed significant upregulation of p53 protein (b) even if both gingival and tongue tumors showed a trend toward upregulation of p53 protein protein levels of p63 in 21 of the samples have previously been reported. the addition of two tumors and corresponding clinically normal tissue did not alter results, showing p63 to be significantly downregulated in tumors compared to corresponding normal samples (p < 0.01). when dividing tumors into different subsites, significantly lower expression of p63 was seen in tongue tumors, but not in the other two groups, in accordance with previous results. whatever mirnas that are changed in tumors, the important task is to map the effect of these changes at protein levels of their potential targets in the in vivo situation. in order to do this, when comparing all samples as one group, mir-21 showed significant correlation with both p53 (positive) and p63 (negative) [table 2 ], whereas mir-125b showed significant negative correlation with p53 only [table 2 ]. mir-203 in turn did not show any correlation with either p53 or p63 [table 2 ]. as the number of tumors in each subsite was limited, no correlation analysis based on subsites was performed. scchn is a disease with poor prognosis and a survival rate that has not improved much over the last decades. lately, much research has focused on the expression of mirnas and their role in tumor progression, and numerous studies have identified altered mirna expression profiles in different tumor types. mirna genes represent about 1% of the genome but are estimated to regulate up to 30% of human genes and single mirnas may target up to 200 different mrnas. therefore, it is important not only to study the expression of mirnas but also to map their effect on expression of putative targets. however, few studies have so far attempted to connect mirna expression with expression of target proteins in vivo. therefore, we set out to analyze expression of selected mirnas in correlation to their suggested targets in the p53 family in tissue samples from patients in one subgroup of scchn, scc in the oral cavity. based on our recent results showing differences in p63 expression between different oral subsites, site of origin of the tumors there were large interindividual variations in mirna expression, which have previously been shown in normal and psoriatic skin. our results clearly showed expression of all three mirnas studied to be altered in tumor tissue compared to clinically normal tissue from the same patients. in accordance with previous studies, mir-21 was significantly upregulated in tumors compared to control samples, whereas mir-125b and mir-203 showed significantly decreased expression in tumor samples compared to controls, indicative of a role for all these mirnas in this tumor type. taking subsite into consideration, tongue tumors showed significant changes in expression of all three mirnas, gingival tumors showed significant changes in mir-125b, and tongue / floor of the mouth tumors showed significant changes in mir-21 and mir-125b expressions. this subsite - based difference in mirna expression highlights the importance of taking subsite of tumors into consideration when analyzing oral scc. in contrast to our data, however, a previous study of mir-21 did not report any difference in expression among tumors in oropharynx, oral cavity, larynx, and hypopharynx. in that study, however, no division of intraoral tumors based on subsite was made. for p63 expression, the significant decrease in p63 protein in tongue tumors, the slight increase in tongue / floor of the mouth tumors, and the unaffected expression in gingival tumors have previously been reported for 21 of the 23 samples analyzed here. significantly increased expression of p53 protein (irrespective of mutation status) was seen in tongue / floor of the mouth tumors but not in tongue and gingival tumors. in that study, however, no division of intraoral tumors based on subsite was made. when correlating mirna levels to expression of their potential target proteins, significant positive correlation was seen between mir-21 and p53 and significant negative correlation between this mirna and p63. as mirnas are known to have both repressive and activating functions, this could indicate a dual role for mir-21 on these target proteins. as many of the previous results are derived from tissue other than scchn, a tissue - specific effect of mir-21 in oral scc could also be suggested. a significant negative correlation between mir-125b and p53, in accordance with previous results in lung fibroblasts, was also observed. however, as we analyzed whole biopsies we can not say whether the mir-125 expression is in the tumor cells or in the stromal cells. as the activity of the p53 tumor suppressor is commonly lost in tumors by missense mutations, we also analyzed the expression of mirnas in wt and mutant tumors. the finding that tumors with mutant p53 had low levels of mir-125b is therefore in keeping with a role for this mirna in transcriptional inhibition as an alternative to gene mutation for inactivating p53 tumor - suppressor function in these tumors. of the mirnas included in this study, both mir-21 and mir-203 we could, however, not see any correlation between mir-203 and p63 in the tumors analyzed and only a moderate, but significant, correlation between mir-21 and p63, once again emphasizing the fact that results from studies on tumor cell lines can not be directly translated to tumors in the in vivo situation. to further evaluate the role of the mirnas in scchn, it would be interesting to study the underlying mechanisms for the differential expression of mirna in scchn. several mechanisms have been suggested in regulation of mirna expression, for example structural genetic alterations such as chromosomal abnormalities and mutations, defects in the mirna biogenesis machinery, regulation by other mirnas, and epigenetic changes such as methylation and histone deacetylase inhibition. in summary, we show that mir-21, mir-125b, and mir-203 are significantly altered in oral cavity scc, and that, in accordance with previous data, tumor subsite is an important factor that must be taken into consideration when interpreting results. data also indicate that there may be a tumor type specific adverse effect of different mirnas on their target proteins. an important thing to keep in mind is also that mirna regulation is a network of signaling with many factors working together, and that one mirna is thus not the single regulator of a protein. studying overexpression or inhibition of a specific mirna in vitro is therefore unlikely to accurately reflect the complex regulatory networks that exist in vivo, and such data require confirmation in primary material. the present data once again emphasize the need to take subsite into consideration when analyzing oral scc and clearly show that data from in vitro studies can not be transferred directly to the in vivo situation. karin nylander, department of medical biosciences / pathology ume university, building 6 m, 2 floor, se 901 85 ume, sweden. linda boldrup, department of medical biosciences / pathology ume university, building 6 m, 2 floor, se 901 85 ume, sweden. philip john coates, division of medical sciences, university of dundee, ninewells hospital and medical school, dundee dd1 9sy, uk. magnus wahlgren, department of clinical sciences / ent, ume university, se 901 85 ume, gran laurell, department of clinical sciences / ent, ume university, se 901 85 ume, sweden. | background : micrornas (mirnas) are small noncoding rna molecules with an essential role in regulation of gene expression. mirna expression profiles differ between tumor and normal control tissue in many types of cancers and mirna profiling is seen as a promising field for finding new diagnostic and prognostic tools.materials and methods : in this study, we have analyzed expression of three mirnas, mir-21, mir-125b, and mir-203, and their potential target proteins p53 and p63, known to be deregulated in squamous cell carcinoma of the head and neck (scchn), in two distinct and one mixed subsite in squamous cell carcinoma in the oral cavity.results:we demonstrate that levels of mirna differ between tumors of different subsites with tongue tumors showing significant deregulation of all three mirnas, whereas gingival tumors only showed significant downregulation of mir-125b and the mixed group of tumors in tongue / floor of the mouth showed significant deregulation of mir-21 and mir-125b. in the whole group of oral squamous cell carcinoma (scc), a significant negative correlation was seen between mir-125b and p53 as well as a significant correlation between tp53 mutation status and mir-125b.conclusion:the present data once again emphasize the need to take subsite into consideration when analyzing oral scc and clearly show that data from in vitro studies can not be transferred directly to the in vivo situation. |
external dacryocystorhinostomy (dcr) was initially described by toti in 1904 and further modified by dupuy - dutemps and bourguet in 1921. since its introduction, external dcr has been successfully performed with some modifications all over the world and remains the gold standard for lacrimal surgery. external dcr can be completed under either local or general anesthesia (la or ga) [25 ]. current insight into how much pain is experienced while under la is limited to results from a single study by maheshwari. to gain additional information on pain during dcr, the visual analog scale (vas) was used to quantify pain experienced during the surgical procedure. these scores were then compared to pain scores following an intramuscular (i m) gluteal injection of prophylactic antibiotic administered at the beginning of surgery. each patient experienced both procedures within a short time interval and was able to compare them. the results from this study can translate into patient education, thereby equating the pain associated with dcr under la to the pain from a universal experience (i m gluteal injection). the prospective study included 50 patients who underwent external dcr on 1 side with ga, followed 2 days later by external dcr on the opposite side with la, between 2006 and 2008. the same surgeon, anesthesiologist, and scrub nurse were involved in every case. furthermore, all surgeries were performed in the same operating room (or) with the same set of instruments, using the same surgical technique. the inclusion criterion for our study was bilateral dacryocystitis, and we selected 73 patients. twenty - three patients were excluded from the study for 1 of the following reasons : 1) an unwillingness to participate in the research in 14 cases ; 2) a history of midface trauma in 1 case ; 3) poor candidacy for ga in 6 cases (american society of anesthesiology (asa) status iv) ; 4) lacrimal sac asymmetry (1 was dilated) ; and 5) concurrent treatment with warfarin in 1 case. careful preoperative explanation of the proposed anesthesia, surgical procedure, and expectations during surgery, including both tactile and auditory sensations was provided to each patient. oxymetazoline 0.1% solution was sprayed into the nose of every patient 1 hour before surgery. at the same time, an i m gluteal injection of prophylactic antibiotic (cefuroxime 1.5 g) was administered. a 22 g cannula was introduced into the cubital vein to establish venous access, if needed. all patients were given intranasal oxygen at 4 l / min and subjected to constant monitoring of the electrocardiogram, blood pressure, and pulse oximetry throughout the procedure. bp (blood pressure), hr (heart beat rate) and oxygen saturation (os) in the beginning of the procedure were noted. minimal and maximal values and time (when it was reached during surgery) of bp, hr and os were noted. a fiberoptic coaxial headlight facilitated illumination for the dcr. to monitor pain levels during dcr, we subdivided the surgical technique into stages easily understood by the patients : in the or, 3 to 5 cotton tipped applicators (depending on nostril diameter), moisturized with oxymetazoline 0.1%, were introduced into the nostrils for 1015 minutes. three minutes after installation of the applicators, 5 drops of tetracaine - hydrochloride 2% were instilled to anesthetize the nasal mucosa. topical anesthetic drops (tetracaine hydrochloride 2%) were also instilled in both conjunctival sacs. each patient received 3 1.5ml injections of 1 : 1 (v / v) mixture of lidocaine 2% epinephrine 1 : 200,000 and bupivacaine 0.75% via a 16 mm 25 g needle : 1) above the infraorbital foramen and immediately above the lower orbital floor periosteum, at the maximum depth needle length, 2) into the medial extraconal orbit and above the medial ligament, at the maximum depth permitted by the needle length, and 3) subcutaneously into the lacrimal sac region. after the 3 injections, 0.3 ml of mixture was used to moisturize the cotton tipped applicators previously introduced into the nose. a medial canthal incision was performed with blunt dissection of the orbicularis muscle carried down to the level of the medial canthal tendon. the medial canthal tendon and periosteum were incised and reflected with a periosteal elevator to expose the lacrimal fossa. the thin lacrimal bone was infractured, and a 3 mm tip kerrison punch was used to create an osteotomy. silicone stents were passed along the canalicular system and into the osteotomy site, exiting via the naris. the anterior nasal mucosal flap was anastomosed to the anterior aspect of the lacrimal sac, and the incision was closed in a layered fashion using a 6 - 0 vicryl suture. the patients were asked to rest for 12 hours without applying ice packs following surgery and to avoid nose - blowing for 1 week. all patients were asked 30 minutes after surgery to rate the intensity of pain experienced during the i m gluteal injection of prophylactic antibiotic and at each stage of the surgery using the vas scale (0= the least amount of pain, and 10= the greatest amount of pain). to assimilate the pain data from all surgical stages, sample size for the study was calculated and 18 patients were sufficient to get reliable results. the wilcoxon signed - rank test was used to assess the significance of the differences between vas pain levels during different stages of surgery. in the or, 3 to 5 cotton tipped applicators (depending on nostril diameter), moisturized with oxymetazoline 0.1%, were introduced into the nostrils for 1015 minutes. three minutes after installation of the applicators, 5 drops of tetracaine - hydrochloride 2% were instilled to anesthetize the nasal mucosa. topical anesthetic drops (tetracaine hydrochloride 2%) were also instilled in both conjunctival sacs. each patient received 3 1.5ml injections of 1 : 1 (v / v) mixture of lidocaine 2% epinephrine 1 : 200,000 and bupivacaine 0.75% via a 16 mm 25 g needle : 1) above the infraorbital foramen and immediately above the lower orbital floor periosteum, at the maximum depth needle length, 2) into the medial extraconal orbit and above the medial ligament, at the maximum depth permitted by the needle length, and 3) subcutaneously into the lacrimal sac region. after the 3 injections, 0.3 ml of mixture was used to moisturize the cotton tipped applicators previously introduced into the nose. a medial canthal incision was performed with blunt dissection of the orbicularis muscle carried down to the level of the medial canthal tendon. the medial canthal tendon and periosteum the thin lacrimal bone was infractured, and a 3 mm tip kerrison punch was used to create an osteotomy. silicone stents were passed along the canalicular system and into the osteotomy site, exiting via the naris. the anterior nasal mucosal flap was anastomosed to the anterior aspect of the lacrimal sac, and the incision was closed in a layered fashion using a 6 - 0 vicryl suture. the patients were asked to rest for 12 hours without applying ice packs following surgery and to avoid nose - blowing for 1 week. all patients were asked 30 minutes after surgery to rate the intensity of pain experienced during the i m gluteal injection of prophylactic antibiotic and at each stage of the surgery using the vas scale (0= the least amount of pain, and 10= the greatest amount of pain). to assimilate the pain data from all surgical stages, sample size for the study was calculated and 18 patients were sufficient to get reliable results. the wilcoxon signed - rank test was used to assess the significance of the differences between vas pain levels during different stages of surgery. a total of 50 patients ranging in age from 3183 years (63.649.64) underwent external dcr. the group included 40 females between 31 and 74 (63.809.32) years of age and 10 males between 46 and 83 years of age (63.0011.35). no statistically significant differences in pain levels, blood pressure and variations of bp during surgery, heart beat rate and hr variations and oxygen saturation and variations of os during surgery existed between groups with respect to gender (for all p>0.005) (table 1). patients were divided in 3 groups based on their level of education (primary school, secondary school and college). there were no statistically significant differences between groups in pain levels during any stage of surgery and in overall level of pain. pain recorded at all stages of dcr was minor (figure 1). among these minor pain values, the lowest vas pain level (median, 1) was present at multiple times : 1) at the introduction of the cotton tipped applicators ; 2) at the beginning of the surgical procedure (skin incision and dissection of the lacrimal sac) ; 3) during nasal manipulation after bone cracking (incision and suture of nasal mucosa) ; 4) during intubation ; 5) during wound closure ; and 6) during nasal packing at the end of the procedure. medium levels of pain (median, 2) were noted during the i m gluteal injection of prophylactic antibiotic, the la injection, and the ostium opening, and for overall pain (table 2). no statistically significant differences in pain levels between i m gluteal injection, la injection, and ostium opening were observed (p>0.05). la injection did not result in hemorrhage, and none of the patients experienced uncontrolled intranasal bleeding during the procedure. no cases of postoperative epistaxis requiring nasal packing occurred, and no one experienced dislodged tubing. success was confirmed with patent lacrimal passages on irrigation in 49 of 50 patients after 6 months. one patient (2%) complained of recurrence of profuse watering after the procedure and required further surgery. forty - seven of the 50 participants (94%) stated that they preferred the next procedure to be performed in the same way. the remaining 3 patients (6%) preferred ga ; they did not complain of pain, and the vas pain levels were not statistically different from the rest of the group (p>0.05). in 2 cases, ga was selected because participants did not want to be consciously involved in the procedure (they preferred to be asleep and remain unaware). in the third case, we have not received another such a complaint in the 300 + procedures that we have performed using la. performing dcr under la has been an accepted procedure for years, especially for elderly patients [68 ]. the specific risks of ga are, of course, avoided with la. a much lower incidence of postoperative nausea and vomiting ponv after dcr was observed with la compared with ga in a previous study. anesthetics used for ga also act as vasodilators and enhance bleeding. based on these findings, the use of la is often recommended to the patient. however, when patients inquire about pain experienced during surgery with la, little scientific data exists to support claims that patients do not complain and that the procedure is not painful. measuring pain levels during different stages of our surgical technique generated more precise data on when pain occurred. by comparing bone cracking to an i m injection, we tried to associate 2 painful events. bone cracking showed the highest levels of pain experienced during surgery according to the vas scores (range 0 to 4, median 2). the median value of pain experienced during ostium opening was the same as the median pain values during the administration of la and i m injection (difference was not statistically significant). all manipulations involving the nasal structures (introducing cotton tipped applicators, forming nasal mucosa flaps, and intubation) induce similar levels of pain (median 1), and the differences among those procedures was not statistically significant. we did not perform syringing in the beginning of surgery in order to measure exact level of pain during syringing. the syringing procedure is similar to intubation, so we may presume that level of pain during manipulations involving nasal structures is similar to syringing. none of the 50 patients included in study needed any tooth removal so we could not make this comparison. maheshwari tried to measure the level of pain during dcr using a verbal rating scale (vrs) and concluded that la was acceptable for patients. we compared our vas - based pain scores with maheshwari s vrs scores (table 3) and achieved similar results. minor differences existed in the procedure itself, including opening the lacrimal sac at the beginning after elevating periosteum in our cases. the formation of the sac flap was recorded as being as painful as the creation of bone ostium in our series, and as painful as the creation of the nasal mucosa flap in maheshwari s study. patients may not have distinguished opening the lacrimal sac from creating the nasal mucosa flap because the procedures occurred right after each other in maheshwari s study. the fact that recorded pain levels for both procedures is the same strongly suggests that patients put the 2 stages of maheshwari s study together. few other studies have addressed pain during dcr, and all concluded that patients did not complain of pain [1012 ]. the following sentences are direct quotes from these papers : all patients found the technique acceptable, and none stated afterwards that they would have preferred to have had a general anesthetic. in our technique of la, properly localized and sufficient nerve block effectively eliminates patient pain and provides hemostasis which ensures surgeon s comfort during dcr. patients in both groups reported that they were comfortable during and immediately after surgery. hurwitz jj. reported procedures with la but did not comment on the effectiveness of la or the level of patient acceptance. pain was likely tolerable and not severe enough for the patient to complain of discomfort. smith measured pain during injection of la in the region of the lacrimal fossa using vas. the percentage of patients experiencing levels of pain lower than 2.6 were almost identical to our results (table 4). one major difference was noted between the results of our study and smith. if any of the patients respond during injection of la that the pain was the worst imaginable (pain level 7, 610), anesthesia should be converted at that time to ga. clearly, the pain threshold varies from patient to patient and may be related to cultural differences as well. all of our patients were satisfied with the procedure, similar to previously published studies [6,7,1013 ]. distinguishing pain directly related to the operation site from discomfort associated with sensory clues (ie, unpleasant tastes, sights, or sounds) that patients record as pain is a limitation to this study. dcr can be associated with unpleasant sounds (bone cracking) and unpleasant tastes (blood in the throat). a comparison of dcr with tooth extraction (the only commonly performed procedure with la that involves the sound of bone cracking) may provide useful information about this perceived pain based on the experience of these 50 patients, we can claim that pain experienced during external dcr under la, if it is present, is low on the vas scale. furthermore, the most painful stage of external dcr under la (bone cracking) was no more painful than the i m injection experienced at the beginning of the procedure. other stages (opening nasal mucosa, intubation, and nose packing) induced even lower levels of pain on the vas and can be compared to syringing. pain experienced under la during external dcr can best be described to patients as similar to the pain experienced from an i m gluteal injection. patients should also be informed before and during the procedure that there will be a sound of bone cracking, not unlike when a tooth is extracted, and that they may experience pain equal to or less than that associated with an i m injection. | summarybackgroundexternal dacryocystorhinostomy (dcr) is often performed under local anesthesia (la) without adequate knowledge of the pain experienced by the patient.material/methodswe subdivided our surgical technique into stages easily understood by the patients (introducing cotton tipped applicators, performing parabulbar injection, creating the incision, bone cracking (opening the ostium), manipulating the nose, intubating, closing the wound, and packing with gauze). a total of 50 patients ranging in age from 31 to 83 years of age (63.649.64) underwent external dcr. each patient was asked 30 minutes after surgery to indicate the intensity of pain experienced at each stage of the surgery and during intramuscular (i m) injection of an antibiotic using a visual analog scale (vas).resultsanalysis of the vas - based pain scores indicated 3 statistically equal occurrences of pain coinciding with the opening of the ostium, and receiving both parabulbar anesthetic and i m antibiotic injections.conclusionsthe level of pain experienced during the most unpleasant stage of external dcr (ostium opening) was similar to the pain experienced from an i m injection. patients can be informed that pain during external dcr with local anesthesia is comparable to receiving an i m gluteal injection. |
until recently, the cerebrovascular stenosis has been treated mainly medically, and the endovascular treatment such as stent - angioplasty has been controversial and criticized primarily due to limited evidence and lack of prospective and controlled trials, especially for intracranial stenosis6). clearly, the periprocedural risks are pretty considerable2,6). even though, the periprocedural morbidity and mortality might be expected to diminish with technical advances and accumulation of clinical experience, the indication of revascularization surgery such as stent - angioplasty should be very limited at the present time11,19,20). undoubtedly, the cerebral arterial stenosis with sufficient collaterals and without clinical symptoms has been hardly regarded as the target of surgical or endovascular intervention. because the degree of the stenosis itself can not reflect accurate regional cerebral hemodynamics, confirmation of the substantial decrease of regional blood flow and impaired cerebrovascular reserve capacity decreased cerebrovascular reserve capacity has been assessed by single photon emission computed tomography (spect) scan with administration of cerebrovascular vasodilator such as acetazolamide (acz). however, its low image resolution and inconvenience in performance are major drawbacks in general10). meanwhile, perfusion computed tomography (pct) imaging has shown relatively high resolution power. besides it can be performed easily, pct provides multiple perfusion parameters such as cerebral blood flow (cbf), mean transit time (mtt), and cerebral blood volume (cbv)2,3,5,7,14,22). we used pct with acz challenge to assess the change of cerebrovascular perfusion before and after treatment for the patients with unilateral cerebrovascular stenotic lesions in the anterior circulation. from august 2007 to may 2010, 30 patients (20 men, 10 women) underwent pct scans with acz challenge. patients ranged from 31 to 85 years of age (meanstandard deviation : 65.811.7 years). thirteen patients had stenotic lesions in proximal cervical internal cerebral artery (ica), 4 patients in intracranial ica, and the other 13 patients in proximal middle cerebral artery (mca). we typically require that candidates for this study have only one symptomatic stenotic lesion in unilateral anterior circulation (ica or mca), which is confirmed through catheter angiography. the symptoms were acute or subacute infarctions or transient ischemic attacks (tias). and as a matter of course, there was no other stenotic lesion on both sides of cerebral vasculatures. the other exclusion criteria were histories of previous infarction, trauma, or mass lesions that can influence the results of the perfusion imaging. twenty - two patients had ipsilateral border - zone infarct before pct scan (2 to 71 days, mean 17.718.1 days), and the other eight patients had symptoms of tias related to stenotic lesion (table 1, fig. pct scans were performed on a ct unit equipped with a 16-detector array (lightspeed, ge healthcare, milwaukee, wi, usa). after non - enhanced ct of the whole brain, 4 adjacent 5-mm - thick sections were selected at the level of the basal ganglia that covered all 3 vascular territories ; anterior, middle and posterior cerebral arteries. a bolus of 50 ml of iodinated contrast material (ultravist 300 mol) was injected at a rate of 4.0 ml / s into an antecubital vein with a power injector. at 10 seconds after the injection, dynamic (continuous) scanning was initiated with the following technique : 120 kvp, 60 ma, 45 mm - thick sections, and 1-second per rotation for 50 seconds. the 1-second images were reformatted at 0.5-second intervals, and the 5-mm - thick sections were reformatted into two 10-mm - thick sections. pct was performed repeatedly after the so - called baseline pct, approximately 15 minutes after intravenous bolus injection of 1 g of acz. with the aid of the skin marks the perfusion images were generated using the anterior cerebral artery (aca) contralateral to the stenosis as arterial input and superior sagittal sinus as the venous outflow to maintain a constant technique. the regions of interest (rois) were drawn as expected territories of the aca, mca and posterior cerebral artery (pca) and contralateral rois were also drawn as mirrored images generated by cine data set by using a workstation (advantage windows, ge healthcare) with pct software. from each map of rois, the absolute values of the mtt, cbf, and cbv were calculated (fig. the cerebral hemodynamic status was also assessed by hemispheric ratio and percent changes only in the mca territories. hemispheric ratio was determined by dividing the absolute values in the stenotic hemispheres by those in the non - stenotic sides. the hemispheric ratio changes in each hemisphere were calculated as follows : ratio changes (%) = (parametersacz - parametersbaseline)/parametersbaseline100, where parameterbaseline and parametersacz represented parameters before and after intravenous injection of acz, respectively. two - tailed paired t - tests were used to 1) compare mean perfusion parameter values in stenotic hemispheres with those in non - stenotic sides, 2) compare the mean mtt, cbf, and cbv hemispheric ratios before injection of acz with those after challenge, and 3) compare mean perfusion parameter values before and after angioplasty. the angiographic working view was identified during angiography that best demonstrated the stenotic lesion, the guiding catheter and the disease - free distal artery. the degree of stenosis was calculated as percent stenosis from the catheter angiogram using the following formula : percent stenosis (%) = 100(1-s / n), where s is the diameter of the residual lumen at the point of maximum stenosis and n is the width of the disease - free distal artery at the point where the vessel walls were approximately parallel (fig. we compared continuous variables by using student 's t - tests and compared categorical variables by using pearson 's chi - square tests. all statistical tests were two - sided and all analyses were performed using statistical software (spss for windows, 15.0 standard version, ibm, ny, usa). from august 2007 to may 2010, 30 patients (20 men, 10 women) underwent pct scans with acz challenge. patients ranged from 31 to 85 years of age (meanstandard deviation : 65.811.7 years). thirteen patients had stenotic lesions in proximal cervical internal cerebral artery (ica), 4 patients in intracranial ica, and the other 13 patients in proximal middle cerebral artery (mca). we typically require that candidates for this study have only one symptomatic stenotic lesion in unilateral anterior circulation (ica or mca), which is confirmed through catheter angiography. the symptoms were acute or subacute infarctions or transient ischemic attacks (tias). and as a matter of course, there was no other stenotic lesion on both sides of cerebral vasculatures. the other exclusion criteria were histories of previous infarction, trauma, or mass lesions that can influence the results of the perfusion imaging. twenty - two patients had ipsilateral border - zone infarct before pct scan (2 to 71 days, mean 17.718.1 days), and the other eight patients had symptoms of tias related to stenotic lesion (table 1, fig. pct scans were performed on a ct unit equipped with a 16-detector array (lightspeed, ge healthcare, milwaukee, wi, usa). after non - enhanced ct of the whole brain, 4 adjacent 5-mm - thick sections were selected at the level of the basal ganglia that covered all 3 vascular territories ; anterior, middle and posterior cerebral arteries. a bolus of 50 ml of iodinated contrast material (ultravist 300 mol) was injected at a rate of 4.0 ml / s into an antecubital vein with a power injector. at 10 seconds after the injection, dynamic (continuous) scanning was initiated with the following technique : 120 kvp, 60 ma, 45 mm - thick sections, and 1-second per rotation for 50 seconds. the 1-second images were reformatted at 0.5-second intervals, and the 5-mm - thick sections were reformatted into two 10-mm - thick sections. pct was performed repeatedly after the so - called baseline pct, approximately 15 minutes after intravenous bolus injection of 1 g of acz. with the aid of the skin marks the perfusion images were generated using the anterior cerebral artery (aca) contralateral to the stenosis as arterial input and superior sagittal sinus as the venous outflow to maintain a constant technique. the regions of interest (rois) were drawn as expected territories of the aca, mca and posterior cerebral artery (pca) and contralateral rois were also drawn as mirrored images generated by cine data set by using a workstation (advantage windows, ge healthcare) with pct software. from each map of rois, the absolute values of the mtt, cbf, and cbv were calculated (fig. the cerebral hemodynamic status was also assessed by hemispheric ratio and percent changes only in the mca territories. hemispheric ratio was determined by dividing the absolute values in the stenotic hemispheres by those in the non - stenotic sides. the hemispheric ratio changes in each hemisphere were calculated as follows : ratio changes (%) = (parametersacz - parametersbaseline)/parametersbaseline100, where parameterbaseline and parametersacz represented parameters before and after intravenous injection of acz, respectively. two - tailed paired t - tests were used to 1) compare mean perfusion parameter values in stenotic hemispheres with those in non - stenotic sides, 2) compare the mean mtt, cbf, and cbv hemispheric ratios before injection of acz with those after challenge, and 3) compare mean perfusion parameter values before and after angioplasty. the angiographic working view was identified during angiography that best demonstrated the stenotic lesion, the guiding catheter and the disease - free distal artery. the degree of stenosis was calculated as percent stenosis from the catheter angiogram using the following formula : percent stenosis (%) = 100(1-s / n), where s is the diameter of the residual lumen at the point of maximum stenosis and n is the width of the disease - free distal artery at the point where the vessel walls were approximately parallel (fig. we compared continuous variables by using student 's t - tests and compared categorical variables by using pearson 's chi - square tests. all statistical tests were two - sided and all analyses were performed using statistical software (spss for windows, 15.0 standard version, ibm, ny, usa). we attempted to administer stent - angioplasty in all 30 patients, after pre - procedural pct evaluation. stent - angioplasty were successful in 28 patients (93.3%) with nearly zero percent of residual stenosis, but failed in two patients due to too tight and tortuous stenosis to be capable of wire passage in proximal cervical ica stenosis and severe tortuous course of ica siphon incapable of stent delivery in mca stenosis, respectively. there were two cases of peri - procedural complications, the first case was procedure - related thromboembolism in mca stenting and the other was post - procedural pneumonia due to poor general condition in proximal ica stenting. of 30 patients with unilateral cerebrovascular stenosis, 28 patients had greater mtt values on stenotic sides than contralateral non - stenotic side before acz challenge, however all patients had greater mtt value after acz challenge, and mtt values were changed (i.e. increased more than the value before acz challenge) after acz challenge in 29 patients (table 1). twenty - four patients had lower cbf values on stenotic sides than non - stenotic side before acz challenge, but 27 patients had lower cbf values after acz challenge. cbf values were changed (i.e. decreased more than the value before acz challenge) after acz challenge in 24 patients. in case of cbv, only 17 patients had lower cbv values on stenotic sides than non - stenotic side before acz challenge, but 24 patients had lower cbv values after acz challenge. meanwhile, cbv values were changed (i.e. decreased more than the value before acz challenge) after acz challenge in 22 patients. the mean values of the hemispheric ratios before and after acz challenge are shown in table 2. statistically significant increases in mean mtt ratio and decrease in cbf and cbv ratio were demonstrated after acz challenge. there were also linear relationships between the rate of stenosis and each hemispheric ratio before and after acz challenge and linear regression plots of the stenosis rate versus each parameter were shown in fig. we also compared the mean value of the hemispheric ratio according to the stenosis rate. when we specified the standard stenosis rate as 70% and found significant differences between the group of patients with stenosis rate below 70% and above 70% (table 3) however, there were less significant differences when we specified the standard stenosis rate as 80%, especially in the comparison of the amount of hemispheric ratio changes (i.e. differences between the roi ratios before and after acz challenge). meanwhile, even though most patients included in this study had relatively poor collateral circulations, it was very difficult to classify the degree of the collateral circulations quantitatively. however, we found interesting results in the comparisons according to the degree of symptom severity and proximity of the lesion site. when we compared the rois ratio according to the presenting symptoms (infarct vs. tias), stenosis rate itself did not differ significantly between these two divided groups, but all the roi ratios of mtt were increased more in the patients presented with infarct than the patients with tias (table 4). however, when compared according to the proximity of the lesions (ica vs. mca), there was no difference between these two divided groups (table 5). among 30 patients, only 24 patients (80.0%) underwent pct in 2 days after angioplasty. perfusion study was not necessary in two patients in whom we failed to do stent - angioplasty, and in two patients with peri - procedural complications described above, it was impossible. of 24 patients who had been conducted follow up pct after angioplasty, 16 patients had greater mtt values on stenotic sides than non - stenotic side before acz challenge, and 20 patients had greater mtt value after acz challenge thirteen patients had lower cbf values on stenotic sides than non - stenotic side before acz challenge, and 15 patients had lower cbf values after acz challenge. eight patients had lower cbv values on stenotic sides than non - stenotic side before acz challenge, and 12 patients had lower cbv values after acz challenges. the mean values of the hemispheric ratios before and after acz challenge are shown in table 6. no significant differences were found with respect to mtt and cbf ratio. in case of cbv ratio, though the difference reached statistical significance, it was weaker than that in the pre - procedural ratio comparisons. there were significant differences between pre - procedural and post - procedural pct values only except baseline cbv ratio (table 7). however, the amount of percent change after acz challenge was different significantly only in case of mtt ratio. we attempted to administer stent - angioplasty in all 30 patients, after pre - procedural pct evaluation. stent - angioplasty were successful in 28 patients (93.3%) with nearly zero percent of residual stenosis, but failed in two patients due to too tight and tortuous stenosis to be capable of wire passage in proximal cervical ica stenosis and severe tortuous course of ica siphon incapable of stent delivery in mca stenosis, respectively. there were two cases of peri - procedural complications, the first case was procedure - related thromboembolism in mca stenting and the other was post - procedural pneumonia due to poor general condition in proximal ica stenting. of 30 patients with unilateral cerebrovascular stenosis, 28 patients had greater mtt values on stenotic sides than contralateral non - stenotic side before acz challenge, however all patients had greater mtt value after acz challenge, and mtt values were changed (i.e. increased more than the value before acz challenge) after acz challenge in 29 patients (table 1). twenty - four patients had lower cbf values on stenotic sides than non - stenotic side before acz challenge, but 27 patients had lower cbf values after acz challenge. cbf values were changed (i.e. decreased more than the value before acz challenge) after acz challenge in 24 patients. in case of cbv, only 17 patients had lower cbv values on stenotic sides than non - stenotic side before acz challenge, but 24 patients had lower cbv values after acz challenge. meanwhile, cbv values were changed (i.e. decreased more than the value before acz challenge) after acz challenge in 22 patients. the mean values of the hemispheric ratios before and after acz challenge are shown in table 2. statistically significant increases in mean mtt ratio and decrease in cbf and cbv ratio were demonstrated after acz challenge. there were also linear relationships between the rate of stenosis and each hemispheric ratio before and after acz challenge and linear regression plots of the stenosis rate versus each parameter were shown in fig. we also compared the mean value of the hemispheric ratio according to the stenosis rate. when we specified the standard stenosis rate as 70% and found significant differences between the group of patients with stenosis rate below 70% and above 70% (table 3) however, there were less significant differences when we specified the standard stenosis rate as 80%, especially in the comparison of the amount of hemispheric ratio changes (i.e. differences between the roi ratios before and after acz challenge). meanwhile, even though most patients included in this study had relatively poor collateral circulations, it was very difficult to classify the degree of the collateral circulations quantitatively. however, we found interesting results in the comparisons according to the degree of symptom severity and proximity of the lesion site. when we compared the rois ratio according to the presenting symptoms (infarct vs. tias), stenosis rate itself did not differ significantly between these two divided groups, but all the roi ratios of mtt were increased more in the patients presented with infarct than the patients with tias (table 4). however, when compared according to the proximity of the lesions (ica vs. mca), there was no difference between these two divided groups (table 5). among 30 patients, only 24 patients (80.0%) underwent pct in 2 days after angioplasty. perfusion study was not necessary in two patients in whom we failed to do stent - angioplasty, and in two patients with peri - procedural complications described above, it was impossible. of 24 patients who had been conducted follow up pct after angioplasty, 16 patients had greater mtt values on stenotic sides than non - stenotic side before acz challenge, and 20 patients had greater mtt value after acz challenge. thirteen patients had lower cbf values on stenotic sides than non - stenotic side before acz challenge, and 15 patients had lower cbf values after acz challenge. eight patients had lower cbv values on stenotic sides than non - stenotic side before acz challenge, and 12 patients had lower cbv values after acz challenges. the mean values of the hemispheric ratios before and after acz challenge are shown in table 6. no significant differences were found with respect to mtt and cbf ratio. in case of cbv ratio, though the difference reached statistical significance, it was weaker than that in the pre - procedural ratio comparisons. there were significant differences between pre - procedural and post - procedural pct values only except baseline cbv ratio (table 7). however, the amount of percent change after acz challenge was different significantly only in case of mtt ratio. because the indications of endovascular treatment such as stent - angioplasty have been controversial until now, especially for intracranial stenosis, it is important to rely on valid and objective imaging study, even when the treatment appears to be clinically inevitable6). all the subjects of this imaging study were patients with symptomatic unilateral anterior cerebral stenosis, not occlusion, because the aim of this study is to evaluate the feasibility of pct to assess cerebral hemodynamics in patients with unilateral stenosis of anterior cerebral circulation. the ct scanners used to perform pct studies are available in most hospital, and pct studies, even combined with acetazolamide challenge, are also rapid and require little time to post - process2,8,10,13,14,17,18). besides, the quantitative results potentially available with pct such as hemispheric ratios of cbf, cbv and mtt may also be an added advantage of pct. in the present study, the percent changes of each value of pct after acz challenge were correlated well with the unilateral stenosis before angioplasty (table 2). and then these changes were almost disappeared after angioplasty (table 6, 7). these findings may be helpful to neurologists, neurosurgeons, and neurointerventionists when they should decide whether to attempt revascularization therapy for these stenotic diseases or not. however, pct with acz challenge has several limitations in the interpretation of the results. first of all, the accurate rois of vessel territories are variable according to vascular anatomic and physiologic circumstances of each patients9). to complement this limitation, in this study, all the pct maps and rois were drawn manually by a well - trained neurosurgeon without automatic software aid, because of the anatomical variability according to each patient. the standard cross section was a transverse section through the level of the basal ganglia which best displayed not only the representative territories of mca, but also aca and pca, therefore offering the opportunity to find abnormalities in each of these major vascular territories. hand - drawn rois of mca territory included basal ganglia because the most mca (m1) stenotic lesions, in this study, were covered or before lenticulostriate arteries and the others were proximal to mca i.e. ica. second, pct imaging can not reflect exactly the physiologic status of viable cells but only the anatomical patency of vasculature, however multiple studies have revealed that the values from pct are correlated well with the clinical setting1,4,23). and then pct with acz challenge provides satisfactory and reliable data for assessing cerebral hemodynamic reserve in a manner similar to that used in spect, and xenon ct12,15,16,25,26). mtt and/or time to peak have been known to be very sensitive to hemodynamic changes such as arterial stenosis or occlusion, and these were also same in our study8,17,24). meanwhile, cbv is known to remain unchanged or even increase despite a decrease in cbf in the early stage of ischemia21). however, in this study, it appeared that cbv before acz challenge was nearly unchanged and then showed a strong tendency to decrease after acz challenge. all the patients had ischemic symptoms after long standing atherosclerotic stenosis, not due to acute occlusion such as thromboembolism. therefore, the mechanism of autoregulation i.e. vascular reserve capacity might already deplete, and consequently could no longer compensate for a further reduction in cbf. this simultaneous decrease of cbf and cbv means oligemic tissue status with insufficient compensation21). vascular reserve capacity, meanwhile, is manly determined by collateral circulations in steno - occlusive diseases, and accordingly the cbf status. however, we could not classify the degree of the collateral circulations objectively, because quantitative measuring was nearly impossible with preoperative conventional angiograms. therefore we attempted to compare rois ratio according to the degree of symptom severity and proximity of the lesion site. all the rois ratios of mtt were more increased in the patients presented with infarct than the others, and rois ratio of cbf and cbv were decreased more at least after acz challenge (table 4). considering the stenosis rates of both groups were not different significantly, symptom severity is suspected to be associated with the degree of the collateral circulations. meanwhile, comparison according to the proximity of the lesions (ica vs. mca) did n't show any difference between the groups only except rois of mtt before acz challenge (table 5). this result may mean all the patients included in this study have much the similar degree of collateral circulations, regardless of lesion site. the most important result of current study is the linear relationship between the rate of stenosis and each hemispheric ratio before and after acz challenge (fig. therefore, we suspected that cerebral perfusion status is in inverse proportion to the rate of arterial stenosis as a precondition of symptomatic severe stenosis. besides, there was also a linear relationship between the stenosis rate and the hemispheric ratio change (i.e. hemispheric ratio after acz challenge - hemispheric ratio before acz challenge) (fig. this hemispheric ratio change may mean a corresponding reserve capacity, though not the exactly same one. then, if so, the amount of ratio change above zero may mean the depletion of reservoir capacity, and the cases with stenosis rate about 60% or more were suspected to be depleted reservoir capacity in fig. the hemispheric ratio change of mtt was roughly 25%, and that of cbf and cbv were 10% at the point of 70% of stenosis rate. therefore, when we specified the standard stenosis rate as 70%, we found significant differences of all three pct values between the two divided groups (table 3). however, when we specified the standard stenosis rate as 80%, there were lesser significant differences between the two divided groups especially in the comparison of the amount of hemispheric ratio changes (i.e. differences between the roi ratios before and after acz challenge). it is suspected that the patients with severe stenosis over 70% and relevant symptoms may have reasonable depletion of reserve capacity. almost all data were changed dramatically after angioplasty, and the ratio differences of each pct values were disappeared (table 6). and then, in the comparison between pre- and post - procedural pct parameters, most parameters showed noticeable differences, of course, mtt value was the most prominent one (table 7). therefore these pct imaging might be useful for not only preoperative evaluation, but also postoperative follow - up evaluation of cbf status and even predictions of hemodynamic changes such as restenosis before conventional angiography. pct with acz challenge appears to be a useful tool to evaluate patients with unilateral anterior circulation stenosis, especially when we would decide to administer angioplasty and evaluate postoperative follow - up status. we could not define the exact cut - off value of hemispheric ratio change because the number of patients included was relatively small and this study is only an imaging study rather than a controlled clinical study. however, patients with symptomatic severe stenosis over 70% are showed meaningful decrease in cerebral perfusion, and the more severe the symptoms were, the more prominent the perfusion decreased. | objectiveperfusion computed tomography (pct) has the ability to measure quantitative value and produce maps of mean transit time (mtt), cerebral blood flow (cbf), and cerebral blood volume (cbv). we assessed cerebral hemodynamics by using these parameters and acetazolamide (acz) challenge for pre- and post - procedural evaluation in patients with unilateral cerebrovascular stenotic disease.methodsthirty patients underwent pre - procedural pct with acz challenge, and 24 patients (80%) was conducted follow up pct after angioplasty with same protocol. the mean mtt, cbf, and cbv were measured and compared in both middle cerebral arterial (mca) territories before and after acz challenge. hemispheric ratio and percent change after acz challenge were calculated before and after angioplasty.resultsthe mean stenosis rate was 76.6%. significant increases in mtt (32.6%, p=0.000) and significant decreases in cbf (-14.2%, p=0.000) were found in stenotic side mca territories. after acz challenge, there were significant changes in mtt (37.4%, p=0.000), cbf (-13.1%, p=0.000), and cbv (-10.5%, p=0.001) in pre - procedural perfusion study. however, no significant increases were found in mtt, or decreases in cbf and cbv in post - procedural study. there were no significant changes after acz challenge also. in addition, the degrees of these changes (before and after acz challenge) were highly correlated with the stenotic degrees in pre - procedural perfusion study.conclusionpct with acz challenge appears to be a useful tool to assess the cerebral perfusion status especially in patients with unilateral symptomatic stenotic disease. |
a 52-year - old male, 30-pack - year current smoker, visited the emergency room complaining of severe chest pain and dyspnea. a chest x - ray showed a large amount of pneumothorax in the right pleural cavity (fig. initial computed tomography showed diffuse lung emphysema, sequelae of tuberculosis in the right lung, and multiple bullae in the right upper and lower lobes. surgery was required because of continuous air leakage through the chest drain for 4 days after a closed thoracostomy. after multiple wedge resections of the right upper and lower lobes, the resection sites were covered with an absorbable polyglycolic acid sheet (neoveil ; gunze ltd., a mixture of 40 mg of viscum album extract (european mistletoe, abnoba viscum f ; abnoba helmittel gmbh, pforzheim, germany) with 50 ml of normal saline was administered into the pleural space by needle instillation upon the visceral and parietal pleura. until the second postoperative day, the recovery was uneventful, with both lung fields clear on chest x - ray (fig. the patient started to complain of worsening dyspnea even at rest, and a follow - up chest x - ray showed loculated right pleural effusion and bilateral lung infiltration. arterial blood gas analysis under 5 l of oxygen inhalation showed that arterial oxygen pressure (pao2) was 42.0 mm hg and oxygen saturation was 78.9%. after intubation and mechanical ventilator support, the follow - up arterial blood gas analysis showed a pao2 of 66.9 mm hg under with a fraction of inspired oxygen of 60%. in addition, the follow - up complete blood cell count showed a white blood cell count of 10,940/mm, a neutrophil percentage of 88.0%, and a lymphocyte percentage of 10.0%. bronchoscopy indicated that bronchial secretion was minimally purulent, and there were no abnormal findings suggesting the presence of bronchitis or pneumonia (fig., the patient was diagnosed with acute respiratory distress syndrome (ards) resulting from insult and an immunologic response to viscum album. methylprednisolone (50 mg / day) was administered starting on the fourth postoperative day. though the initial signs suggested the development of ards, the clinical course after mechanical ventilator support was quite smooth, with good response to glucocorticoid therapy. the lung infiltration on the chest x - ray rapidly resolved after 3 days of steroid administration. the patient was discharged in good general condition on the 16th postoperative day (fig. 3). a follow - up chest x - ray 1 month after discharge showed no pleural effusion and no abnormal lung infiltration. many therapeutic options have been used to treat uncontrolled air leaks from the lung or pleural effusion. among these, chemical pleurodesis using sclerosing agents, such as tetracycline, erythromycin, hydrophilic fumed silica, and talc powder, is one of the most important treatment modalities. irritation of the pleura by instilled chemical agents promotes the sealing of the visceral pleural defect and prevents fluid accumulation. however, chemical pleurodesis is also associated with many complications, such as high fever, severe chest wall pain, fibrothorax, empyema thoracis, and acute respiratory failure. it is believed that transpleural absorption and intrapulmonary deposition of sclerosing agents occur via lymphatic stomata in the parietal pleura, resulting in the development of ards. the instilled drugs induce diffuse inflammation, pleural coagulation, fibrinolytic imbalance, formation of fibrin adhesions, and recruitment and subsequent proliferation of fibroblasts and collagen production in the pleural space. several new chemical agents are being investigated for their efficacy as pleurodesis agents with fewer complications, and viscum album extract is one of the most promising. abnoba viscum f is an extract of viscum album (european mistletoe), which grows on trees of the genus fraxinus. this extract is one of the most frequently prescribed medications for the complementary treatment of cancer patients in a number of european countries. it is known to stimulate the immune system, thereby enhancing quality of life and alleviating the side effects of chemotherapy and radiotherapy, which may improve survival. in addition, viscum album instilled into the pleural cavity can induce diffuse inflammation and pleural coagulation / fibrinolytic imbalance, causing the formation of fibrin adhesions, recruitment and subsequent proliferation of fibroblast, and collagen production in the pleural space. these reactions irritate the pleural surface, thus promoting the sealing of pleural defects and preventing fluid accumulation. complications of viscum album pleurodesis have been reported and are mostly minor, including transient pleural effusion, a mild burning sensation, and mild fever episodes ; there have been no reports of serious complications. viscum alum can also serve as an effective agent for chemical pleurodesis in the treatment of congenital chylothorax and pneumothorax with continuous air leak. cho. reported a case of viscum album - related ipsilateral acute pneumonitis after wedge resection for pneumothorax, and stated that it was self - limiting and had a benign clinical course. however, in our case, the patient complained of progressive dyspnea with chest pain 2 days after wedge resection and chemical pleurodesis with viscum album. the follow - up chest x - ray showed loculated pleural effusion and bilateral lung infiltration. the blood gas analysis result and chest x - ray findings met the criteria of ards. the materials used in surgery, such as neoveil and fibrin glue, are unlikely to be related to the development of ards, and we could not find any report of such an association. in addition, the intraoperative course and postoperative course were similar to that of any other routine wedge resection, and otherwise uneventful. furthermore, the pathophysiology of ards is thought to be related to immune reaction, which is the modality of action for viscum album as a pleurodesis and antitumor agent. therefore, we assumed that the immune response to the viscum album extract was the cause of this episode of ards. this is the first documented case of viscum album - related ards, to our knowledge. respiratory deterioration was acute and progressive, which required placing the patient under intubation and mechanical ventilation. fortunately, the response to steroid therapy was almost instantaneous and the patient showed almost full recovery without any notable sequelae or relapse after scheduled tapering down of the steroid. based on our experience, even though viscum album pleurodesis is considered to be a generally safe and effective procedure without serious complications, patients must be carefully monitored for signs of acute respiratory failure, which might be serious if appropriate treatment is not applied in time. in addition, the pathophysiology of ards due to the immunologic response to viscum album extract must be investigated by scientific research, including animal studies. | a 52-year - old male patient who underwent multiple wedge resections experienced postoperative acute respiratory distress syndrome in both lungs after viscum album pleurodesis. despite initial rapid deterioration in clinical condition and rapid progression of bilateral lung infiltration, he exhibited a relatively smooth clinical recovery with marked response to glucocorticoid treatment. our case report suggests that care must be taken to guard against the development of acute respiratory complications in the use of viscum album for pleurodesis. however, in view of the clinically benign course, initial aggressive management of complications can prevent suffering and sequelae. |
provision of adequate safe blood is challenging in developing countries due to the paucity of voluntary blood donors, poor facilities for storage and blood component preparation as well as inappropriate blood ordering and utilization. in addition, excessive ordering of blood can lead to an unintentional misuse of blood bank services. it appears that surgeons and physicians order request for cross - matching of blood on the basis of habit or as part of hospital routines, and there is a tendency in most emergency medical and surgical departments to order more units of blood than what are actually needed. these unutilized but cross - matched units are held in reserve (usually for 72 h) and thus are unavailable for other needy patients which impose inventory problems for blood bank, loss of shelf life, and expiry of precious blood without being transfused. by demanding excessive blood units in routine for elective surgeries, of which little is ultimately used, results in consumption of valuable supplies, resources, time, and manpower. this also leads to extra strain on blood banks, especially on those with limited resources. therefore, we must identify areas where costs could be significantly cut without impacting the quality of care. a review of blood ordering habits and blood utilization statistics in hospital transfusion committee (htc) meetings can help in improving these services and initiate measures to regulate existent blood transfusion practices. cross - match to transfusion ratio (ctr) is used as a measure of the efficiency of blood ordering practice. ctr of more than 2.5 indicates excessive cross - matching of blood for a specific procedure. a ctr of > 2.5 means that < 40% of the cross - matched units are transfused. the more accurately the clinicians predict patient 's blood needs, the closer the ctr will be to 1:1. thus, a low ctr signifies efficient hospital transfusion policy and practice. with the aim to evaluate the blood transfusion practices by determining the pattern of transfusion requests, blood utilization, ctr, and nonusage probability (nup) ; this study was undertaken at a teaching hospital in north india. this study carried out in a 626-bedded educational and charitable hospital which currently has major clinical departments such as general surgery (subunits : general surgery, gastroenterology, urology, and neurosurgery), internal medicine, pediatrics, gynecology and obstetrics, ophthalmology, orthopedics, oncology, emergency, psychiatry, dialysis, and dental surgery as well as intensive care unit (icu), nicu, sicu, iccu. this was a prospective study conducted by the department of transfusion medicine of a teaching hospital from september 1, 2014 to february 28, 2015. the blood request forms and the cross - match worksheets of the blood bank were accessed and the required data from the clinical units (orthopedics, general surgery, obstetrics and gynecology (o and g), ear, nose and throat [ent ], ophthalmology, dental surgery, pediatrics, oncology, and general medicine) were extracted. the number of patients for whom transfusion requests was made, units cross - matched, units issued, units transfused, and units unutilized were calculated. using microsoft office professional plus 2010, the generated data were analyzed into percentages, ctr (total units cross - matched / total units transfused), and nup (total units not transfused / total units requested) were determined. all cross - matched units not collected for transfusion within 72 h were considered as not issued out as they were reserved and stored in the blood bank and re - cross - matched for other patients. all units issued out and not returned to the blood bank within 2 h were considered utilized (transfused) because as per the hospital policy all issued out, but unutilized blood units were returned to the blood bank for proper storage. a total of 2268 units were cross - matched for 1487 patient requests for transfusion during the 6 months study period. medicine unit had the highest number of transfusion requests followed by o and g, i.e., 489 (32.8%) and 313 (21%), respectively. maximum number of blood units were cross - matched for general medicine 715 (31.6%) for two main causes, i.e., ongoing bleeding (upper gastrointestinal bleed 138 [6.1% ] and lower gastrointestinal bleed 16 [0.7% ]) and anemia (chronic kidney disease / dialysis 226 [10% ] and anemia for causes other than these 335 [14.8% ]) [table 1 ]. number of patients for whom transfusion requests were made, units cross - matched, units transfused, and not transfused out of 2268 cross - matched units, 1515 units were issued, but only 1455 (64.2%) were transfused. this gave an average ctr of 1.6 for the entire hospital (ent, ophthalmology, and dental surgery were excluded from the final calculations as the total requests from these departments were negligible). the o and g department had the highest ctr of 2.7 followed by general surgery and orthopedics, i.e., 2.1 and 1.9, respectively while the oncology, pediatrics, and general medicine have the lowest ctr of 1, 1, and 1.1, respectively. overall, ctr is higher for the surgical (2.2) and quite lower for the medical (1.1) units indicating optimum usage of blood by medical departments when compared to the surgical ones [table 2 ]. nonusage probability and crossmatch to transfusion ratio according to the clinical departments nup for the hospital stood at 35.8% as up to 813 of the 2268 cross - matched units were actually not transfused. nup was higher for the surgical units (54.2%) and lower for the medical units (5.9%). nup was highest for the department of o and g, i.e., 62.5% with o and g surgical nup being even higher 64.7% followed by orthopedics and surgery which had comparatively lower nup of 52.8% and 47.5%, respectively. the nup was more than 50% of for few surgical units, i.e., gastroenterology (62%), trauma (52.6%), and urology (50%) while nup was quite lower for pediatrics (3.3%), oncology (2.7%), and general medicine (11.7%) departments indicating good transfusion practices of medical units [table 2 ]. a total of 813 (35.8%) blood units were not transfused. out of these 813 unutilized units, 60 units, i.e., 4% of the total issued units (1515) surgery department had the highest number of unutilized blood units, i.e., 258 (31.8%) followed by o and g, i.e., 240 (29.5%) while pediatrics had the least with 1 (0.1%) unutilized units. the main reason for nonutilization was transfusion not required now and it accounted for 762 (93.7%) of the total unutilized but cross - matched blood units followed by postponement of surgical procedure 37 (4.6%) and patient expired 14 (1.7%) [table 3 ]. number of units issued, transfused, unutilized with reasons for nonutilization according to the clinical departments cost is a serious consideration for patients in developing countries, especially in the private health sector where without state support and insurance companies, expenses are borne by the patients themselves. in a study from pakistan, neither the public nor the private hospitals were rational in the use of blood. regular auditing and periodic feedbacks are vital to improve the blood utilization practices. by a team approach involving the surgeon, anesthesiologist and blood bank doctors and technical staff, we can reduce the number and pattern of ordering blood for various surgeries. overall, ctr recorded in this study was 1.6 which was quite lower than that reported from other studies from benin (2.2) and saudi arabia (2.96). the observed differences may be due to the variable blood stocks and different transfusion policies at different hospitals. moreover, indications for blood transfusions vary depending on the clinical status of patients and their treating clinicians. common causes for a high ctr includes lack of clear blood ordering policies in hospitals, lack of clinical audits, and lack of communication between clinicians and blood bank health - care workers. suboptimal transfusion practice characterized by high ctr and nup leads to wastage of blood and unavailability of blood for patients in need as cross - matched blood is usually held in reserve for variable period of time (usually 72 h) before dereservation. this may be attributable to premature transfusion requests made by junior doctors which were eventually canceled after a review by senior consultants or due to the postponement of operative procedures arising from improper patient preparation or busy schedule of operation theaters. in this study, 37 (4.6%) of nonutilization of cross - matched blood units were due to the postponement of surgical procedures which could be avoided if requisitions for blood transfusion were sent after complete patient preparations in elective surgery cases and keeping in view the operation theater schedules. similarly, 93.7% of the unutilized but cross - matched units were not used because transfusion was no longer required that time. this practice results in increased workload on blood bank personnel 's as well as wastage of cross matching reagents with cost implications to both the patient and blood bank. the general medicine unit had the highest consumption of requested blood with a ctr 1.1 and nup 11.7%% which was even lower than that of musa. similarly, pediatrics and oncology have lower ctr (1 each) and nup (3.3% and 2.7%, respectively) indicating an optimum usage of blood by medical units. on the other hand, ctr and nup were quite higher for surgery (2.1, 52.8%) and o and g (2.7, 62.5%) departments. similar results with higher ctr and nup for surgery and o and g departments were concluded in studies from benin and saudi arabia. reviews of blood transfusion practices have found that most surgical procedures do not require blood transfusion which supports the study results. according to a previous study from literature, blood has routinely been ordered excessively in neurosurgery patients while in the present study, nup (15.3%) and ctr (1.2) both were lower for neurosurgery patients indicating the appropriate use of blood by neurosurgery unit. in view of the minimal but definite risk of transmitting hiv, hepatitis, and other transfusion hazards, blood transfusion should be avoided as far as possible and over ordering of blood should be curtailed. many hospitals in developed countries have adopted the policy of using a type and screen protocol instead of cross - match for transfusion practices. other measures with proven improvement in ctr and nup are maximum surgical blood ordering schedule (msbos) and type, screen, save, and abbreviated cross - match (tssac). the msbos specifies the number of blood units to be routinely cross - matched for elective surgical procedures based on retrospective analysis of actual blood usage for these procedures. the tssacs entail typing patient 's blood for abo and rh blood group systems and screening for irregular antibodies. in the absence of irregular antibodies, no cross - match is carried out. however, a quick spin cross - match is conducted when blood is eventually needed. for patients with irregular antibodies, full cross - match is performed at the outset with corresponding antigen - free blood. fewer studies from literature have concluded msbos as a viable option for reducing unnecessary cross matching and achieving significant cost savings in the blood bank while for murphy., use of an msbos does not appear to influence clinical usage of blood for transfusion. similar to murphy., palmer. concluded that patient - specific blood ordering system which includes patient and surgeon variables in transfusion prediction, is more accurate than the msbos which uses only surgical procedure while nuttall. formulated a surgical blood ordering equation which incorporated patient factors in the ordering of blood for surgical patients. from these studies, it can be concluded that msbos should be flexible keeping in view the clinical factors related to individual patients. although overall ctr and nup were low in this study, still they are higher for o and g and surgery departments (especially gastroenterology unit 2.6 ; 62%), indicating the need for formulation of msbos for these two departments. in addition, in surgeries with insignificant blood loss, only blood grouping of the patient should be done ensuring the availability of blood before starting surgery. for elective surgeries, blood should be arranged after the completion of preanesthetic checkup and when final surgery is planned. blood ordering strategies should be a part of an overall perioperative strategy which seeks to avoid wastage of scarce resources, and limits transfusion to those patients who have a realistic expectation of benefit. although blood transfusion is a life - saving measure for many patients, it should be restricted to patients who are in real need for transfusion. regular audits, htc meetings, reviewing the transfusion policies, and implementation of msbos and tssac can further lower the ctr, nup, and can reduce the total cost without compromising the quality of patient care. | background : blood transfusion plays vital roles in the medical and surgical practice. to achieve optimum use of blood, transfusion has to be appropriate and judicious consuming minimal resources and manpower.objective:to evaluate the pattern of blood transfusion requests and utilization with the aim of determining transfusion practice.materials and methods : blood request forms and cross - match worksheets at the blood bank were analyzed over a 6-month period. numbers of requisitions, blood units cross - matched, issued out, transfused, and nontransfused were calculated. nonusage probability (nup) and the cross - match to transfusion ratio (ctr) for each clinical unit were computed.results:two thousand two hundred and sixty - eight units of blood were cross - matched for 1487 patient 's transfusion requests, out of which only 1455 (64.2%) were transfused giving a total ctr of 1.6 for the hospital. the ctr for the various clinical units were : obstetrics and gynecology (o and g) 2.7, surgery 2.1, orthopedics 1.9, medicine 1.1, pediatrics 1, and oncology 1.conclusions:the overall ctr (1.6) of the hospital was within the optimal range except for the o and g and surgery department which were having very high nup and ctr indicating their suboptimal transfusion practices. introducing revised transfusion guidelines, maximum surgical blood ordering schedule and type, screen, save, and abbreviated cross - match method can help toward adequate requisition and utilization of blood thereby reducing wastage of resources, time, and manpower. |
the load theory of attention (lavie 1995, 2005) provides a compelling resolution to the fundamental controversy in psychology research over whether or not perception depends on the allocation of attention. this issue has long been debated between views of perception as a limited capacity process that requires focused attention and views of perception as an automatic involuntary process with unlimited capacity that does not depend on the allocation of attention (driver 2001 ; kahneman and treisman 1984 for reviews). load theory reconciles these opposing views by proposing that, although perceptual capacity is limited, perceptual processing proceeds automatically and involuntarily on all stimuli within capacity, irrespective of whether they are relevant or irrelevant to the task at hand, as long as capacity is available. load theory predicts that high perceptual load in the task will exhaust attentional capacity, leaving no capacity for the perception of any task - irrelevant stimuli. by contrast, in tasks of low perceptual load, the resources not used for task - relevant processing are automatically allocated to the irrelevant stimuli that are consequently perceived. these predictions have been confirmed in many studies (lavie 1995 ; schwartz. 2005 ; yi. 2004 for review) showing that irrelevant distractors are nevertheless perceived and elicit bold changes in tasks of low perceptual load and that these behavioral and neural effects of distractors are diminished in tasks of high perceptual load. this research resolves the controversy over the effects of attention on perception, but the underlying neural mechanisms remain to be elucidated. here we tested an account of the effects of load in terms of a modulation of the excitability of visual cortex, measured by transcranial magnetic stimulation (tms). according to this account, the reduction in distractor - related activity with high perceptual load may be explained by a reduction in the ongoing excitability in sensory neural populations that mediate perception of task - irrelevant stimuli. notably the previous demonstrations of the effects of perceptual load indicate that different stimuli, processed in different brain areas, share a common capacity - limited resource. 1997) showed that the level of perceptual load in a lexical task concerning static words determined the bold response in v5/mt related to processing a task - irrelevant motion stimulus. in this study, we thus hypothesized that high perceptual load in a static letter search task would reduce the excitability of sensory neurons in the task - irrelevant area v5/mt. the level of cortical excitability in v5/mt was measured in human observers by applying a single - pulse tms over the right v5/mt and assessing the intensity of stimulation required to elicit moving phosphenes (stewart. the threshold in terms of the magnetic stimulator intensity required to induce the perception of v5 phosphenes provides a measure of neural excitability (aurora and welch 1998 ; battelli. perceptual load in the letter search task was manipulated by varying the search set size from one (low load) to six (high load). this load manipulation is well established and has successfully increased the demand on attention in many previous studies (lavie 2005 for review). immediately following the visual search response (or before the search response in experiment 4), subjects were required to indicate whether a phosphene was present or absent. the coil was positioned to produce a moving phosphene in a location peripheral to the letter circle. phosphene threshold was expressed as the percentage of stimulator output that elicits phosphenes on 50% of the trials (with correct search task responses) determined with a staircase procedure. six subjects participated in experiments 14. three of these also participated in experiment 5 with three further subjects.1 all subjects were ucl students ; age range, a single tms pulse was delivered over v5/mt in the right hemisphere at the onset of each task display using a 70-mm figure - eight coil with a magstim super rapid stimulator (magstim company). v5/mt was localized using a functional method in which the center of the coil is placed on the surface of the skull such that the stimulation elicits phosphenes that intrude on the center of the visual field (stewart. the starting location for stimulation was 2 cm dorsal and 4 cm lateral from the inion. the coil was moved slightly to find a region from which the moving phosphenes induced appear at a position that does not overlap with search letters positions (typically to the left of the letters level with the display center). the average coil position was 3 cm dorsal and 5 cm lateral from the inion. the site of stimulation was co - registered with high - resolution structural mri scans for each subject. for each individual, the location of stimulation was transformed into normal space (talairach coordinates) using the fsl software package (fmrib), and good agreement was found with the location of v5/mt reported in imaging studies (mean stimulation location : 41, 66.7, 1.4, compared with 44, 67, 0 reported by dumoulin. once the tms location was determined, the coil was clamped in place for the duration of the experiment and was oriented with its handle held horizontally and pointing in posterior to anterior direction. e - prime was used to run the experiment and control the tms timing and intensity. participants searched for the letter x or n and pressed 0 for x and 2 for n on the keyboard number pad. the instructions emphasized performance accuracy in the task the target x or n was equally likely and was presented in any of six possible locations equally spaced on a circle (with a 1.4 radius) on each trial. in the high load conditions, the nontargets were k, h, v, z, and w. in the low load conditions, the nontargets were dot place holders (subtending 0.1). 0.9. letter configurations were selected at random from all available permutations on each trial. ten blocks were run (5 for each of the load conditions) in a different random order for each subject. (the average number of trials per block varied from 16 to 21 between the different experiments.) phosphene thresholds were determined using a modified binary - search paradigm (mobs) (tyrell and owens 1988), an adaptive threshold finding algorithm. tms intensity was increased or decreased according to the subject 's report on the previous trial. tms was delivered at the onset of the visual stimulus. following the load task response, phosphene reports were made by pressing either the 0 (for yes) or 2 (for no) keys. experiments 25 followed the same procedure as experiment 1 with the following exceptions. in experiment 2, the load task was not performed ; instead, following the search displays, subjects pressed either 0 or 2 at random and then made their phosphene detection response. in experiment 3, the tms pulse was delivered 500 ms from the onset of the visual stimulus. in experiment 4, the order of the judgments was reversed. subjects indicated the presence or absence of a phosphene first followed by the load - task response. in experiment 5, working memory (wm) load was manipulated using the procedure reported by lavie. a memory set with either six digits (in the 5 high - wm load blocks) or one digit (in the 5 low - load blocks) was presented for 500 ms at the start of each trial followed by a mask presented for 500 ms. phosphene report was made using the same keys as before and was followed by a memory probe of one digit (presented until response). the subject pressed the 2 key to indicate that the memory probe was present in the memory set or the 0 key to indicate that it was absent. six subjects participated in experiments 14. three of these also participated in experiment 5 with three further subjects.1 all subjects were ucl students ; age range, a single tms pulse was delivered over v5/mt in the right hemisphere at the onset of each task display using a 70-mm figure - eight coil with a magstim super rapid stimulator (magstim company). v5/mt was localized using a functional method in which the center of the coil is placed on the surface of the skull such that the stimulation elicits phosphenes that intrude on the center of the visual field (stewart. the starting location for stimulation was 2 cm dorsal and 4 cm lateral from the inion. the coil was moved slightly to find a region from which the moving phosphenes induced appear at a position that does not overlap with search letters positions (typically to the left of the letters level with the display center). the average coil position was 3 cm dorsal and 5 cm lateral from the inion. the site of stimulation was co - registered with high - resolution structural mri scans for each subject. for each individual, the location of stimulation was transformed into normal space (talairach coordinates) using the fsl software package (fmrib), and good agreement was found with the location of v5/mt reported in imaging studies (mean stimulation location : 41, 66.7, 1.4, compared with 44, 67, 0 reported by dumoulin. once the tms location was determined, the coil was clamped in place for the duration of the experiment and was oriented with its handle held horizontally and pointing in posterior to anterior direction. e - prime was used to run the experiment and control the tms timing and intensity. participants searched for the letter x or n and pressed 0 for x and 2 for n on the keyboard number pad. the target x or n was equally likely and was presented in any of six possible locations equally spaced on a circle (with a 1.4 radius) on each trial. in the high load conditions, the nontargets were k, h, v, z, and w. in the low load conditions, the nontargets were dot place holders (subtending 0.1). 0.9. letter configurations were selected at random from all available permutations on each trial. ten blocks were run (5 for each of the load conditions) in a different random order for each subject. (the average number of trials per block varied from 16 to 21 between the different experiments.) phosphene thresholds were determined using a modified binary - search paradigm (mobs) (tyrell and owens 1988), an adaptive threshold finding algorithm. tms intensity was increased or decreased according to the subject 's report on the previous trial. tms was delivered at the onset of the visual stimulus. following the load task response, phosphene reports were made by pressing either the 0 (for yes) or 2 (for no) keys. experiments 25 followed the same procedure as experiment 1 with the following exceptions. in experiment 2, the load task was not performed ; instead, following the search displays, subjects pressed either 0 or 2 at random and then made their phosphene detection response. in experiment 3, the tms pulse was delivered 500 ms from the onset of the visual stimulus. in experiment 4, the order of the judgments was reversed. subjects indicated the presence or absence of a phosphene first followed by the load - task response. in experiment 5, working memory (wm) load a memory set with either six digits (in the 5 high - wm load blocks) or one digit (in the 5 low - load blocks) was presented for 500 ms at the start of each trial followed by a mask presented for 500 ms. following a blank retention interval of 1.5 s, phosphene report was made using the same keys as before and was followed by a memory probe of one digit (presented until response). the subject pressed the 2 key to indicate that the memory probe was present in the memory set or the 0 key to indicate that it was absent. the search task accuracy results confirmed the effectiveness of the perceptual load manipulation in this study. search accuracy was significantly reduced in the high load condition (75%) compared with the low load condition [98% ; t(5) = 11.997, p < 0.001 for the difference ]. as predicted from the hypothesis that high perceptual load reduces cortical excitability in task - irrelevant areas, the v5 phosphene threshold was significantly increased in the high load compared with the low load condition [t(5) = 2.773, p = 0.039 ; fig. experiment 2 confirmed that the effect of perceptual load on the phosphene threshold was not caused by any difference in the visual stimuli between the load conditions. phosphene thresholds for the two load conditions did not differ [t(5) = 0.981, p = 0.37 ] when subjects were presented with the same stimuli as in experiment 1 but did not perform the visual search task (fig. a comparison of the difference in phosphene thresholds between the two load conditions in experiment 1 and experiment 2 confirmed a significant reduction in the effect of load on the phosphene threshold in experiment 2 [t(5) = 2.56, p = 0.025 ]. in experiment 3, we sought to rule out general nonperceptual effects of task difficulty such as effects on the overall level of arousal or response criterion. the search task of experiment 1 was used, but tms was now delivered 500 ms from onset of the search display (fig. 1, experiment 3)a time window selected to encompass postperceptual processes such as response selection (pashler and johnston 1998). as in load theory, the effects of perceptual load are caused by perceptual capacity limits rather than general task difficulty ; we predicted that perceptual load would not affect neural excitability at this late postperceptual time window. the results supported this prediction. the search data confirmed a significant effect of perceptual load on the letter search accuracy [the accuracy was reduced in the high load condition (m = 79%) compared with the low load condition (m = 98%), t(5) = 6.452, p < 0.001 ]. however, the phosphene thresholds for the two load conditions no longer differed [t(5) = 0.928, p = 0.39 ], and a comparison of the load effects on the phosphene stimulation threshold between experiment 1 and experiment 3 confirmed a significant reduction in the effect of load on the phosphene threshold in experiment 3 [t(5) = 2.33, p = 0.034 ]. experiment 4 ruled out response - priority and memory - based accounts for the effects of load on the phosphene thresholds. in this experiment, the order of report was reversed : subjects made the phosphene report first and the search response second. as in experiment 1, the search performance accuracy was significantly reduced in the high - load (m = 72%) compared with the low - load (m = 93%) conditions [t(5) = 9.156, p < 0.001 ], and the phosphene threshold was again significantly higher in the high compared with low - load conditions [t(5) = 5.028, p = 0.004 ; fig. the effect of load on the phosphene threshold did not differ between experiment 1 and experiment 4 [t(5) = 0.827, p = 0.446 ], despite the different order of phosphene and search responses. this comparison reinforces the fact that the phosphene stimulation threshold is determined by perceptual load rather than processes associated with the response order (such as the likelihood of memory decay). experiment 5 confirmed the specificity of the perceptual load effect by distinguishing it from the effect of working memory load (see lavie. a single pulse was delivered over v5/mt while subjects rehearsed a memory set of either one digit (low wm load) or six digits (high wm load). accuracy was significantly reduced in the high - load condition (m = 71%) compared with the low - load condition [m = 96% ; t(5) = 4.683, p = 0.005 ], an effect of comparable magnitude to that found with perceptual load in the previous experiments. however, in contrast to the effects of perceptual load, the phosphene thresholds did not significantly differ between the low (m = 49%) and high (m = 51%) wm load conditions (t < 1). a comparison of the effect of wm load on the phosphene threshold with that of perceptual load (experiment 1) confirmed the significant reduction in the effect of wm load compared with that of perceptual load [t(5) = 2.69, p = 0.023].2 the results of these five experiments provide clear support for our prediction that the level of perceptual load in a letter search task would determine visual cortex excitability in a task - irrelevant area, in this case v5/mt. furthermore, by finding the effect of perceptual load irrespective of whether the phosphene report was made before or after the search task responses and by establishing that there were no changes in the phosphene threshold as a function of differences in the visual stimuli, wm load and thus general task difficulty and general demands on cognitive control resources, or when the phosphene was induced at a later postperceptual time window, we can exclude any effects not specific to perceptual load. our findings suggest that previous demonstrations of the effects of perceptual load on behavioral and neural responses related to task - irrelevant stimuli are caused by a change in the excitability of task - unrelated sensory cortices. the finding that phosphene thresholds are unaffected by wm load not only reinforces the specificity of the effect to perceptual load but also has implications for the load theory. it suggests that the increase in distractor processing previously found with high wm load (de fockert. 2001) may not be caused by enhanced cortical excitability (but rather indicate effects of wm load on later postsensory processes, such as those related to the distractor effects on response selection). the effects of perceptual load were found in response to direct stimulation of v5/mt bypassing the retina and lgn and therefore preclude accounts of the modulation of v5/mt phosphene threshold in terms of forward gating by the lgn. accounts of the modulation of v5/mt phosphenes by load in terms of modulation of the recursive projections from v5/mt to v1 as well as superior colliculus (sc) and the lgn remain possible. these accounts can accommodate previous findings that high perceptual load modulates lateral geniculate nucleus activity related to task - irrelevant stimuli (o'connor. 2002) and that high perceptual load modulates activity related to irrelevant motion distractors in a network of motion responsive areas including v5/mt, v1/v2, and the sc (rees. 1997). whether the effects of perceptual load on visual cortex reflect modulations of feedforward or backprojections this research was supported by wellcome trust grant wt080568ma to n. lavie and an medical research council grant to v. walsh. | much recent research has shown that the level of perceptual load in a task determines the perception of task - irrelevant stimuli and associated neural activity, but the mediating neural mechanisms remain unclear. here we show that increasing the level of perceptual load in a static letter search task results in an increase in the intensity of transcranial magnetic stimulation over v5/mt required to elicit the perception of a moving phosphene. these findings suggest that the neural mechanisms mediating the effects of perceptual load involve reduced visual cortex excitability in task - unrelated areas. |
the internship training period is an important period needed to consolidate the practical experience and theoretical knowledge of new graduates. whether it is in medicine, medical laboratory technology (mlt) or nursing, it is an essential part of training and qualification.13 students who would like to pursue a profession in laboratory medicine need to understand their critical role as medical laboratory professionals in the health care system. they must realize that they will be required to perform their duties in the clinical laboratories and interact with other health care professionals. they must be competent, knowledgeable and reliable.46 the department of mlt, college of applied medical sciences at king faisal university (kfu) mandates the completion of the internship period after a four - year curriculum of study before the award of a bachelor of science degree in mlt.7 the goal for this training period is to acquire the practical in - service experience, required for the assumption of professional responsibility. this training is essential to enable the graduate mlt attain the desired level of expertise and experience necessary for practice in the different hospital laboratories as well as in medical research establishments. in the earlier years of the program, the candidates used to do a four - month rotation each through three laboratory sections according to the following choices ; hematology and blood banking or microbiology and immunology / serology with either clinical chemistry or histotechnology. after many discussions on curriculum reform, an evaluation of a system of rotations through all laboratory sections whereby interns would do a two - month rotation in all laboratory disciplines : clinical chemistry, hematology, blood banking, microbiology, serology/ immunology, and histotechnology was suggested. each student was expected to participate fully in the different professional activities and duties performed in each laboratory, and assessed in accordance with a specific evaluation format. the criteria for assessment included the quality of blood collection, knowledge, technical ability, interpretation of tests, safety, reliability, punctuality, and ethics etc. clinical laboratory science educators must plan curricula and training programs to meet present needs and anticipate possible changes in order to give graduates the necessary competencies. educators of allied health professionals are being asked to design programs that produce graduates with skills in different areas.8 the primary goal of the kfu mlt program is the acquisition of technical skills that employers demand. the main objective of this study was to survey mlt graduates in order to gather descriptive data of their attitudes towards the internship training period, and their feelings towards their chosen profession. the study was carried out during a two - year period from december 1 2002 to december 31 2004 in order to cover many graduates as possible since the average number of students in each graduating group is 30. the purpose of this survey was to gain a better understanding of mlt graduates attitudes towards the internship training period. the specific objectives were to determine the following : does the mlt graduate believe that an internship training period is necessary ? is the internship an important requirement for certification ? a total of 115 mlt graduates working in the different affiliated hospitals in the eastern province participated in the survey. a stratified random sample with proportional allocation was selected. two - hundred questionnaires were distributed and 115 were returned with complete data, so sample reduction was due to missing data. a five - point likert scale, ranging from 1 (strongly agree) to 5 (strongly disagree), was created for some of the questions. there were fill - in the blanks, yes / no questions and multiple - choice responses. data was collected under the supervision of the chief investigator. after explaining to the graduates the research objectives, the questionnaire 's different components and questions, they were asked to complete them. statistical analysis was performed using the statistical package for the social sciences (spss) pc, software program. all 115 graduates (100%) strongly agreed that the internship training period was important, necessary and should not be eliminated. the majority of the respondents 95 (82.6%) defined the internship training period as a bridge between undergraduate training and working as a technologist. ninety - four (81.7%) agreed to the importance of the evaluation report at the end of the training period. one hundred and ten (95.6%) said they always applied their theoretical knowledge on the job. all 115 graduates (100%) understood the importance of and always practiced universal safety precautions. one hundred seven (93%) responded that they needed to start working immediately after finishing the internship training period. ninety - five (82.6%) agreed that the hospital set - up and the cooperation of laboratory staff were vital for the success of training. one hundred and seven (93%) agreed that training in all laboratory sections was better than rotating in only three laboratory disciplines. ninety - eight (85%) agreed that there should be an elective rotation according to choice and interest of the intern. ninety - nine (86%) agreed that the kfu curriculum and internship program were satisfactory. one hundred and six (92.2%) agreed that mlt was a wise important career choice. the most favorite laboratory rotation for training was microbiology followed in rank order by immun - ology / serology, histotechnology, hematology, blood banking and clinical chemistry. one open - ended question was to assess the graduates views on the technical competencies needed for mlt practice (this was to collect data without the authors bias). the majority responded in the following rank order : (1) ability to work well alone, (2) manual dexterity with ability to work fast, (3) knowledge, (4) team work and a professional attitude, (5) punctuality. summary of attitudes towards the internship in their opinion, the laboratories which required the most supervision and guidance in rank order were blood bank from 88 respondents (76.5%), hematology 83 (72.7%), and histotechnology 78 (67.8%). the last question asked the participants to give their definition of the internship training period in their own words, and the three main opinions in rank order were : (1) application of theoretical knowledge in a practical way, (2) a period of continuous training and knowledge, and (3) a transition phase between undergraduate years and real life work. the internship provides students / interns an opportunity to relearn basic skills and to gain experience in management and problem solving. it is over a decade since the mlt program was established at kfu, and it has produced over 250 graduates.7 the main objective of the mlt program at kfu, is to train competent clinical laboratory personnel to meet present and future needs of the health care services. the demand for allied health professionals ; laboratory technologists, physiotherapists, and respiratory therapists is increasing in the kingdom of saudi arabia.9 in order to meet these demands and challenges, institutions must do their best to structure curricula and design new training programs to meet the health needs of hospitals and clinical services in the kingdom. it is useful to study the attitudes of students and graduates to their programs and educational needs to help in the implementation of changes for the best possible improvements. the explosion of scientific and technological advances in the clinical laboratories have effected profound changes in the laboratory services ultimately making significant impact on the expected roles of medical laboratory technologists. it is mandatory that as educators we examine these changes and identify the possible impact on the educational needs of the next generation of technologists. in this survey, they also exhibited satisfaction with mlt as a profession ; the majority thought mlt is a wise choice and an important profession. it has been reported that medical laboratory technology is a career with a high job satisfaction,10 that has been traditionally female - dominated.11 the respondents understood the basic objective of this period as clearly seen in their responses on the definition of the internship period. the most favorite laboratory discipline for training was microbiology followed by serology then histotechnology, hematology, blood banking and clinical chemistry. it emerged after many discussions with mlt students and graduates that they preferred microbiology because it allowed them to use their theoretical knowledge to work with their hands and sometimes with automation to clinical chemistry for which an array of automated instruments are used. their responses to questions revealed that they understood that automated technology gave them the opportunity to use their skills in new and challenging ways in order to eliminate mundane tasks. successful automation and new technologies are very important in the career of mlts.14 many mlt graduates considered hematology and blood banking difficult. the change in the internship program to include all laboratory disciplines was a significant improvement. it not only exposed graduates to all areas of expertise but also ensured that there was an adequate number of staff to cover the different laboratories and eliminate the overcrowding that resulted from too many interns choosing the same rotations. this system was in the better interest of the interns and graduates especially for employment since the assignment of newly employed graduates to different laboratories was based on need and shortage rather than on the preference of the employee. another important benefit of the internship period is the exposure of trainees to the different clinical laboratories and facilities. this enables interns to assess the institution and staff, and provides the institution the opportunity to evaluate the interns for possible future employment. many hospital laboratories prefer to hire interns trained in their own facilities, and already evaluated and assessed as potential employees.12 the inclusion of an elective rotation to the program has been debated for some time in the department of mlt and is still under discussion. electives during medical internship, for example, are important and have proved to be useful in the choice of future careers.13 on the issue of future career choices, the majority of graduates were in favor of beginning their working life immediately after the internship period. the reason for this is to gain hands - on experience and explore their areas of interest. to improve the quality of the internship training and maximize the benefits, an ideal structured hospital training program which would foster collaboration between academic and laboratory staff. the interns are, therefore, sent to affiliated hospital laboratories with satisfactory arrangements and qualified staff designated to provide the interns the necessary supervision and guidance to achieve the expected objectives. the responses indicate that the interns had given thought to the obstacles in their training. one of concerns registered was the disparity in the level of supervision and guidance in the different hospital laboratories. a majority of interns expressed their concern about the evaluation report submitted by the trainers at the end of the training period. student 's portfolio to help in the assessment.15 also very important for health professionals is the knowledge of universal safety precautions, which all interns knew and practiced. all respondents agreed that it was of primary importance to read and review the theory and principles underlying the routine investigations. this is very important in laboratory medicine and vital to the career of mlts whose function it is to obtain test results and unravel problems in automated machinery. moreover, the need to read in order to keep abreast with new instrumentation and tests is of the utmost importance. it is a time when they are also encouraged to have continuous medical education (cme) after internship and higher certification. cme is necessary for health care professionals because they not only have to maintain their skills but also continue to improve on them.1618 although no national certification for mlt has been established, graduates are encouraged to obtain certification elsewhere.16 the interns identified five major areas of competence important for mlt practice. these included depth of knowledge, technical ability to work alone and fast, working in a team and punctuality. it was important to know their views about the most desirable attributes of an mlt. this can help educators design curricula, assessment methods and guidance for students who are considering a career in mlt. the interns comments indicated the importance of adopting an attitude of personal responsibility, for they emphasized the importance of being able to work independently as well as in the health care team. we would like to conclude with the following recommendations : establishment of career development programs for new graduates. the majority wanted to start working immediately after internship.identification of better methods of evaluation, because evaluation is essential to the assurance of the quality and appropriateness of a learning program.identification of better methods of collaboration between institutions training mlts.establishment of a national society or board for mlt in the kingdom, to give recognition to these professionals. identification of better methods of evaluation, because evaluation is essential to the assurance of the quality and appropriateness of a learning program. establishment of a national society or board for mlt in the kingdom, to give recognition to these professionals. it is vital that mlt graduates are motivated and given the adequate support to ensure the development and maturing of qualified saudi laboratory leadership teams. mlt graduates stressed that internship - training period after completion of the undergraduate training was important and should not be eliminated. certain suggestions have been made for implementation to give the mlt graduates support, motivation and validate their chosen profession. | objectives : the objective of this present survey was to look into the attitudes of medical laboratory technology (mlt) graduates towards the internship training period of the mlt department, college of applied medical sciences, king faisal university.material and methods : a self - administered questionnaire was designed and distributed for this purpose. the study period was from december 1st 2002 31st december 2004. two - hundred questionnaires were distributed to recent graduates, and 115 were returned completed.results:all respondents agreed with the importance and necessity of the internship period, and felt it should not be reduced or eliminated. the most favorite laboratory where they liked to work was microbiology (70%). they all agreed that evaluation report with hospital staff and laboratory set up were vital in achieving the goals of the internship period. the majority stressed the significance of safety precautions and the application of theoretical knowledge before performing technical assignments.conclusion:the respondents had very positive attitudes towards the internship - training period stressing its importance. the most favorite laboratory rotations were in rank order : microbiology, serology followed by histotechnology, hematology, blood banking and finally clinical chemistry. the majority of graduates had a very positive attitude also towards medical laboratory technology as a profession. |
unilateral s - shaped anomaly with a contra lateral normal kidney has been reported sparsely in the literature. herein we present perhaps the first case of bilateral presentation with associated pelviureteric junction obstruction on the left and renal stones on the right side. sixteen - year - old male patient presented to us with left dull aching flank pain. intravenous urogram (ivu) showed an excretory kidney on right side with three radiopaque shadows apparently outside the pelvicalyceal system [figure 1 ]. a retrograde pyelogram showed an s - shaped kidney on the right side with the upper calyces pointing laterally and the medial calyces pointing medially [figure 2 ]. on the left side computed tomography scan showed bilateral s - shaped kidneys with the upper calyces pointing posterolaterally and the lower calyces pointing anteromedially. on the left side severe cortical thinning and non - excretion of contrast were noted [figure 3 ]. a 99m - dtpa acid scan revealed right s - shaped renal anomaly with a non - functioning kidney on the left side. as the patient was symptomatic on the left side we proceeded with left renal exploration. the left kidney was found to have s - shaped renal anomaly with two separate set of calyces oriented in opposite directions with a common pelvis and ureter. ivu with right renal stones in s - shaped kidney retrograde pyelogram showing s - shaped kidney ct scan of bilateral s shaped kidneys the common s - shaped kidney reported in the literature is a fusion anomaly where the contra lateral kidney crosses to fuse with its mate leaving the opposite renal fossa empty. this is theorized as a ureteral phenomenon with the developing ureteric bud wandering to the opposite side and inducing differentiation of the contra lateral nephrogenic analge. in contrast the s - shaped renal anomaly reported in our case has been reported in the literature albeit with a normal opposite kidney. as ivu denotes near normal course of distal ureter we do not consider the defect at the ureteral bud origin. the ct urogram and rgp vividly demonstrate the collecting system anatomy in which the obtuse angulation of major calyces is noted, this could explain the near separation of two moieties and resultant development of this type of kidneys, so we propose a defect in the dichomotous branching of the ureteral bud as the cause of this anatomy in which the first ureteric division was at a greater angle then normal resulting in large spatial separation of the two units with subsequent normal branching, with spatial separation providing enough space for both the kidneys to develop. a similar embroyological hypothesis accounts for supernumeray kidneys. a second ureteral bud or a branching from the initial bud is considered a necessary step. alternatively, the nephrogenic analge may divide into two metanephric tails, which separate entirely when induced to differentiate by the separate or bifid buds. the s - shaped renal anomaly may be at an earlier stage where complete separation does not occur. a differential diagnosis of bilateral supernumerary kidney was considered but the presence of single pelvis and ureter ruled out the possibility. a concomitant pujo caused renal loss on the left side and an association between the two conditions may be present. | a bilateral s - shaped kidney is a rare anomaly in which both the kidneys are in their normal position, in contrast to the commonly reported s - shaped fusion anomaly, in which the contralateral kidney crosses the midline to fuse with opposite kidney leaving the ipsilateral renal fossa empty. here we present the diagnosis and management of a case of bilateral s - shaped renal anomaly with associated left pelviureteric junction obstruction and nonfunctioning kidney and right renal stones. left kidney was managed by open nephrectomy and right kidney by pnl. |
more than 10.2 million people worldwide are held in prisons. as per the world prison population list-2013, there is a general trend of growth in prison population in majority of nations, including in india. as of 2013, the latest figures available for india, there are 4,11,992 prisoners (including pre - trial detainees). majority of prisoners in india are uneducated, poor, and belong to marginalized or socially disadvantaged groups and have limited knowledge about health and practice unhealthy lifestyles. thus, they represent a distinct and vulnerable health group needing priority attention. while putting aside the fact that the ignorance of the health of prisoners is an issue of immense human rights concern the need to control disease in prisons as a part of the larger agenda of public health and a part of primary healthcare is a concept yet to catch up in india. this article discusses the current status of prison healthcare in india and explores various potential opportunities which the prison window provides to reach those sections of the society who do not or are incapable of accessing primary healthcare facilities. owing to increasing crime rates, rise in population, and a more authoritative judicial system (leading to higher conviction rates), there is severe overcrowding and exhaustion of prison facilities in india. this makes the prison environment rather unhealthy and it serves as hot - spots for infectious disease transmission. the walls of the prison however can not prevent disease transmission thereby making prison health a very significant part of public health. more than one third of prisoners are imprisoned for less than 3 months in india. thus, there is a great deal of interaction between the two communities on either side of prison walls. even if prisoners are not released there is significant interaction within the prison - system itself prisoners being circulated in different cells, different prisons, between judiciary systems and jails and even between prisons and health centers. prisoners are known to be at a high risk for diseases like sexually transmitted infections (stis), hiv - aids, hepatitis b and hepatitis c. a study published in 2007 reported that in 20 countries, hiv prevalence was more than 10% within prison populations. evidence regarding the high burden of hiv / stis in indian prisoners is available but scarce. a study on the prevalence of hiv in indian prisons revealed that 1.7% of male and 9.5% of female inmates were hiv positive. this is significantly higher than the national hiv prevalence of 0.32% in males and 0.22% in females. various factors have been implicated for this including intravenous drug abuse and frequent visitations to sex workers. the report on prevention of spread of hiv amongst vulnerable groups in south asia from united nations office on drug and crimes revealed that 63% of prisoners in india had a history of drug abuse. continuance of high risk behaviors such as unprotected sex and substance abuse after release from prison is also very common. lack of conjugal life in prisons has also led to prisoners engaging in male - to - male sexual acts. a study conducted in a north indian jail revealed that 28.8% were homosexual or bi - sexual, 68% had multiple partners and 80.6% engaged in unprotected sex. intravenous drug abusers generally have criminal history (mostly for minor crimes), and they too avoid utilizing health services for fear of persecution, ostracism and discrimination. consensual homosexual encounters are considered a criminal offence in india which entails a maximum punishment of life imprisonment. the lgbt (lesbian - gay - bisexual - transsexual) community has also faced tremendous stigma and is by and large outside the radars of primary health care systems. as such prisons might be the only opportunity for the health system to appropriately intervene with these individuals and their communities to evaluate their health needs and problems. if appropriately utilized primary healthcare professionals might use the prison window to impart knowledge of healthy lifestyles and habits including safe sex practices and drug de - addiction services. an additional benefit of such health education campaigns might actually be that knowledge so acquired will be passed on to their own marginalized communities which are mostly out of reach of the government 's primary healthcare system due to their closed nature owing to stigmatization in the larger society. in fact, these prisoners can be potentially rehabilitated as community primary healthcare workers. over time they would become a team of dedicated community health workers who can easily help establish communication and expand networks into the hitherto unreachable sections of societies like the lgbt community. occupancy rates in prisons vary between states with the national average for 2013 being 118.4% up from previous years. this apart from a combination of other factors like inadequate ventilation, poor nutritional status of prisoners, unsafe sex practices and needle - sharing habits all add up to why tuberculosis (tb) is very commonly seen in indian prisons. high rates of tb have been reported by human rights watch in india and a study in 2008 had found that 9% of prison deaths was attributed by tb. in fact, a study from brazil has empirically demonstrated transmission of tb from prison to community by showing that 54% of mycobacterium tuberculosis strains in an urban population were related to strains from persons in prisons. with hiv being another one of the major killers in prisons and the specter of mdr - tb looming large over the nation, urgent emphasis to tb control in prisons is crucial for control of tb in the community at large. mental illness is yet another significant public health problem and its prevalence among prisoners is very high. identification and treatment of people with mental health conditions is of utmost importance for the cause of justice as well as to ensure provision of basic human rights studies done internationally have found the prevalence of mental illnesses to be three times higher in prisons when compared to the general population. however, the official prison statistics of india 2012 report that only, 1.9% of convicted, 0.8% of under - trial detainees and 0.4% of detained inmates as mentally ill. a comprehensive mental health program is needed to thus estimate the true prevalence in prisons. drug abuse is an identified problem among criminals and there is a need to provide detoxification facilities in the prison itself instead of the current practice of shifting to hospitals for treatment of withdrawal symptoms. it is also important to ensure that those on de - addiction treatments in prisons are followed up till completion of their treatment schedules in the community once released. counseling for inmates, particularly women should form an integral part of health care provisions within prisons and continuity of these services even after they are released is essential to ensure successful rehabilitation. it is evident from these facts that involving primary healthcare professionals in prisons becomes essential. the proportion of deaths due to suicide in indian prisons has been reported to be as high as 58%. a robust prison health system capable of identifying prisoners at high risk of committing suicide and provision of timely interventions would be extremely beneficial and help avoid unnecessary controversies. the model prison manual for india has iterated in details the constituents and requirements of medical care to prisoners. unfortunately for example, the prison policy in india lays emphasis on ensuring proper standards for ventilation, sanitation and hygiene. yet indian prisons have consistently been rated poorly by human rights activists for not being able to provide these basic living standards. prison inmates who are completely dependent on the state for provision of even basic medical care are often side - lined citing security and safety concerns. basic healthcare provided in prisons is seen as cheap care and there is a need to provide primary healthcare services in standards no less that that provided to non - prison citizens of india. a previously published human rights report suggests that even the primary health care services being provided in indian jails is of poor quality. the report had noted that for most parts, it meant dispensation of one drug, which was described to us as a pain killer that reduced fever perhaps aspirin. prison policies in india prevent condom distribution policies, despite strong evidence that prisoners engage in high - risk behaviors. there are neither any permanent hiv / sti education programs being run in most prisons nor any prison - based needle and syringe programs proper screening for infectious diseases like hiv, stis and tb in addition to measures to prevent their transmission need to be implemented probably at standards higher than that provided by national health programs at the community level (since they represent a high - risk vulnerable population.). politicians, policy makers and the general public in india are prejudiced by the traditional notion that sinners deserve neither mercy nor money. owing to this mind - set policy makers tend to allocate the resources as per law rather than as per needs. even this is provided only after significant lobbying by pressure groups like human / prison rights activists. sadly the media too presents prison health as a human rights issue and not an issue of public health concern. the very fact that almost all prisoners return back to the community makes it imperative to link prison health with the public health system and bring them under the coverage of primary health care. policy makers as well as the general public need to understand that the prison and the community are at continuum. the much needed overhaul of the prison health system by linking it with public health can not be achieved without a sustained campaign aimed at changing these dogmas. historical data from nations which have separate health systems for prisons clearly indicate very poor quality of services. the need of the hour is a major renovation of prison health policies (box 1). there is an urgent need for further research on various aspects of prison health and particularly its epidemiology. factors which propagate the spread of disease from communities to prisons and vice versa need to be studied and interventions to control them must be implemented. a resilient partnership between primary healthcare professionals and prison authorities can pave the way for achieving the desired changes in the existing prison health care system, thereby increasing the overall well - being of those serving their sentences and the community as a whole. | as of 2013, the latest statistics available, more than 400,000 individuals are lodged in indian prisons. prisoners represent a heterogeneous population, belonging to socially diverse and economically disadvantaged sections of society with limited knowledge about health and healthy lifestyles. there is considerable evidence to show that prisoners in india have an increased risk of mental disorders including self - harm and are highly susceptible to various communicable diseases. coupled together with abysmal living conditions and poor quality of medical services, health in prisons is a matter of immense human rights concern. however, the concept and the subsequent need to view prison health as an essential part of public health and as a strategic investment to reach persons and communities out of the primary health system ambit is poorly recognized in india. this article discusses the current status of prison healthcare in india and explores various potential opportunities the prison window provides. it also briefly deliberates on the various systematic barriers in the indian prison health system and how these might be overcome to make primary healthcare truly available for all. |
the complexity of choosing a particular treatment for an individual patient while keeping her informed about the relevant options and considerations keeps increasing as personal genetic information becomes more commonly available. this is leading clinicians and patients to question their role in the decision - making process. for example, what role should patients take in choosing between alternative treatment options, in particular when the benefits and risks of each option are not crystal clear ? to what extent should clinicians share their own hesitations about the best treatment choice, exposing their patients to the incomplete knowledge about each alternative ? how should clinicians take such decisions without exposing patients to superfluous stress when current knowledge about the advantages and drawbacks of available therapy options is far from complete ? these questions, and the doctor 's dilemma, have long been the topic of public discourse. over 800 years ago, maimonides, a prominent jewish philosopher and practicing physician, wrote that ' the risk of a wrong decision is preferable to the terror of indecision '. although this remains as true as ever, should we not be asking what role patients have in taking a treatment decision - even when current knowledge is incomplete ? such questions seem to be more pertinent as we enter the age of personal genomes, when an individual 's pharmacogenomic data may affect their choice between treatment options [1 - 3 ]. can patients comprehend complex diagnostic information and act on it when they face a choice between alternative therapeutic options, based on their personal genomic data ? in other words, should patients be made aware of the fine details of current medical knowledge, including the gaps in it, when crucial treatment decisions have to be made ? inevitably, some of those decisions may later turn out to have been the wrong ones for them. wendy lorizio and colleagues have examined this charged issue in a real - world personalized medicine scenario by following the treatment choices of 235 breast cancer patients currently taking or planning to take tamoxifen for prevention of cancer recurrence and who were offered the cyp2d6 genotyping test. their study is a fine example of our current knowledge limitations : at the time of conducting their cyp2d6 genotyping and follow - up patients survey (march 2008 to may 2010), most published studies, based on retrospective data, indicated that individuals having a cyp2d6 poor metabolizer genotype (predictive of complete lack of the enzyme activity) were less likely to benefit from tamoxifen for the prevention of breast cancer recurrence. however, more recent meta - analysis and studies cast doubt about the relevance of cyp2d6 genotypes for breast cancer recurrence in tamoxifen - treated patients. thus, it could well be that a similar study taking place today would find other results, namely that patients would be less likely to change from tamoxifen to another drug following genotyping. as long as no consensus has been reached on the effect of cyp2d6 genotypes on the efficacy of tamoxifen for preventing breast cancer recurrence, monitoring the serum level of endoxifen, its active metabolite, seems the most appropriate biomarker for adjusting tamoxifen dosages. including this biomarker as a decision making tool in breast cancer therapy seems to be justified at our currently incomplete state of knowledge. moreover, it will remain a valuable biomarker once endoxifen itself, currently in clinical trials, is eventually approved as a drug. the study by lorizio. found that 46% (6 of 13) of the breast cancer patients prescribed tamoxifen and genotyped as poor cyp2d6 metabolizers elected to change their medication to another drug within the following 6 months. this crucial treatment decision, while obviously taken along with their attending physicians, must have been affected by their participation in the informational session held by the researchers before the genetic testing, in which the results of studies examining the effects of cyp2d6 genotypes on breast cancer recurrence were presented. notably, the authors found that about half the patients had previous knowledge about the relevance of cyp2d6 genotypes for tamoxifen therapy, with the source of this knowledge being their nurses or clinicians, the medical literature or the general media (internet, tv and newspapers). yet it seems that performing the genotyping tests and learning about their results in a medical setting affected the decision on switching treatment. this study does not examine the extent to which the decision about changing the medication was driven by the patients or their clinicians. the genotyping results were transferred to patients through their attending physicians, who did not receive specific recommendations along with the laboratory results. it would have been of interest to also interview the clinicians and find out about their role and considerations in taking this decision ; however, this would require a larger study, as in this one only 13 patients of the 235 who were genotyped were found to be cypd6 poor metabolizers. however, this study illustrates that when genotyping relevant to drug response is carried out in a clinical setting along with informing patients about the test implications in advance of the testing, a decision about medication change followed for about half the patients whose test results indicated (at that time) that they were unlikely to benefit from tamoxifen. this study conveys important insights for moving personalized medicine forward : offering patients pharmacogenetic testing in the clinical setting along with an educational session on the test relevance for their medication choices is an effective route for taking informed treatment decisions.. the challenge will be to keep medicine participatory and patients fully informed when medicine and personal genomes meet - which may not be as far away as it seemed just a decade ago. | informing patients about risks and benefits of alternative treatment options and choosing between them is becoming a bigger challenge as knowledge about the relationship between the individual 's genetic profile and the efficacy and safety of available medications accumulates. putting personalized medicine into practice requires new modes of information sharing and decision making by patient and physician. this is illustrated by a case study on treatment choices of breast cancer patients following genotyping for cyp2d6, recently published in genome medicine.see research article : http://genomemedicine.com/content/3/10/64 |
a 55-year - old male underwent implantation of a secondary prevention dual chamber boston scientific incepta implantable cardioverter - defibrillator (icd). a dual coil df-4 lead (endotak reliance llhh 64 cm) was positioned at the right ventricular apex (rva) with normal intracardiac electrograms (egm). parameters were satisfactory (r - wave sensing of 7.9 mv, impedance of 960, threshold of 0.6 v @ 0.5 ms, and a high voltage impedance of 39) and defibrillation threshold testing (dft) was acceptable. subsequent to defibrillation testing, unusual low amplitude and medium frequency signals were observed on the ventricular egm (fig. 1) and detected on the marker channel during pacing threshold testing (fig. fluoroscopic review of set - screw positioning was unremarkable and manipulation of the device did not influence the signals. no further intervention was performed at that stage and pacing threshold testing the next day demonstrated no over sensing recurrence and he proceeded to have an event free six - week follow - up. a 42-year - old female underwent implantation of a secondary prevention dual chamber medtronic maximo ii df-4 icd with a dual coil (sprint quattro secure 6947 m 64 cm) ventricular lead at the rva. after multiple attempts at positioning the lead, the best r - wave sensing obtained was only 6.8 mv, while other pacing parameters were satisfactory (v - lead impedance of 684, v - lead threshold of 0.5 v @ 0.5 ms, high threshold impedance of 42 and a dft test of 3000). chest x - ray demonstrated the pin beyond the set - screw (fig. 4). during pocket revision, whilst the lead was still connected, only tapping the header reproduced similar noise, while traction of the lead and movement of the generator were unremarkable. a moderate hematoma was evacuated and lead testing unconnected to the header was also unexceptional. interrogation after the header was cleaned and reconnected showed normalized function with no further over - sensing. in this report, we present two unusual cases of intermittent ventricular over - sensing in the new df-4 connector system. in both cases, causes of inappropriate sensing of physiologic signals such as myopotentials, t waves, p waves, r - wave double counting, after potentials, and far - field physiologic signals were not present. these include electromagnetic interference from an external source, lead / connector problems (loose set screw, adapter, or header), and lead failure (insulation defect or conductor coil fracture). both of our cases share several similar characteristics : (1) the over - sensing occurred acutely post implantation (within 24 h) ; (2) the over - sensing was intermittent and did not have a constant relationship to the cardiac cycle ; (3) although the over - sensing could be reproduced with specific maneuvers (during pacing in case 1, and only with tapping of the header in case 2), manipulation of the leads and generator did not recreate the over - sensing ; (4) the over - sensing had resolved spontaneously (as in the first case) or on reconnection without replacing the lead or the device (as in the second case) ; (5) peri - procedural lead function was normal ; (6) there was no evidence radiographically to suggest incomplete lead advancement ; and (7) no sources of electromagnetic interference, including electro - cautery were present. these features seem to make an obvious lead - connector problem or lead failure unlikely. case 1 likely relates to the improper venting of the grommet seal plug (and similar issues have been previously reported with is-1 systems). the seal plug is a polymer plug with a narrow slit through which the set - screw torque wrench is inserted through to the grommet. it is designed to allow access of the wrench to the set - screw and maintain electrical isolation afterwards by preventing body fluids from entering the header ports once the wrench is removed. at wrench insertion, care should be exercised to locate the pre - slit depression of the seal plug and carefully guide the wrench through the slit to the set - screw cavity beneath prior to insertion of the lead into the port. this will open up the seal plug, relieving any potential pressure build - up within the lead port by providing a pathway to release trapped fluid or air during lead insertion. if this is not performed adequately, or if damage occurs during wrench insertion or faulty from manufacturing, the trapped air (an electrical insulator) is able to intermittently escape the header, altering the baseline contact between the normally separated extracellular fluid and the conductive elements of the connector causing transient alterations in the voltage input to the sense amplifier and resulting in make - break potentials. once the air has fully escaped, there is equilibration of charge and the over - sensing ceases,. in our case, it is likely that the wrench was not adequately engaged prior to lead insertion into the header considering that gross review of the seal plugs revealed no clear abnormality, and that the signals resolved spontaneously without the need for generator replacement. the resulting signals, however, had occurred post dft testing only, and over - sensed during ventricular threshold testing. during defibrillation testing chest wall movement or transient pressurization from the shock or both, could also have encouraged air - bubble release. curiously, the over - sensing had only occurred during instances when the signals were located just after the post - pacing blanking period. after a paced ventricular event, all icds have the ability to adjust sensitivity dynamically, beginning from the end of the blanking period, with the threshold starting at a more sensitive setting. our second case, however, raises some novel risks that may need to be considered with this new generation lead - connector system. this technology encompasses a combined single port cavity with four contacts of which both high- and low - voltage applications can be placed within the same cavity which result in compromised space for insulation and sealing. furthermore, contact pressure of the seals and the pins has to be limited to allow for easy insertion and retraction of the lead connector. this was achieved by alterations in the design with integration of the sealed rings within the header itself (instead of being mounted on the lead) as well as the development of a unique torque wrench activated levering of the spring loaded pin contacts. consequently, df-4 lead plugs have to go through four seals with three intermediate spring contacts while its predecessor, the is-1 lead connectors, have only one seal on the lead and no spring contacts. this raises potential issues with sealing failures, which may cause sensing problems or short circuits. in case 2, we hypothesize that blood from the hematoma may have entered the header via a grommet punch - out post wrench removal (which has been previously reported in medtronic df-1 header connections) or forced into the header through imperfections of the more complex - designed sealed rings. the silicone rubber used for seal plugs has a shape memory. however, during the re - bonding process after wrench removal, they may require a short time to reseal. until the seal fully closes, it is possible that the header may be infiltrated by body fluid. this could have been further compounded by issues with trapped air that were mentioned earlier in the manuscript. the extracellular fluid in the header from case 2 could then have contributed to minute misalignment of the newly developed spring contacts with the lead, causing the observed increase in impedance and the intermittent non - physiological ventricular over - sensing. this hypothesis was supported by the resolution of the noise when the system was cleaned and simply reconnected without changing the device, as well as by the lack of any macroscopic appearance of lead - connecter or set - screw issues. to the best of our knowledge, cases of non - physiological ventricular over - sensing have rarely been reported involving the new df-4 system. the advantages of this standard over its predecessor mainly relate to procedural ease and patient comfort by reducing the risk of lead - to - port mismatch, reduced risk of lead - to - can abrasion (because of fewer connectors), a reduced size of device header and subsequently a much less bulky pocket. however, these design changes may have several potential risks as we have highlighted as well as some logistical drawbacks. the compact system is also likely to be less flexible like in instances where there may be a need for the addition of pace / sense leads (in cases of sensing problems) or additional shock leads (e.g. subcutaneous arrays). currently, a single post - market study has demonstrated that the df-4 lead has performed well at a 36-month follow - up period in 1701 cases with complication rates reported to be at a low 0.015 per patient - year of follow - up with no adverse set - screw events. however, it is important to note that there have been two previous adverse event reports found in the manufacturer and user facility device experience (maude) database run by the fda. they both relate to noise and inappropriate therapy, and were put down to lead - connection issues but with no conclusive evidence of set - screw problems. the df-4 connector system is becoming industry standard but our current cases underscore that potential problems regarding lead header attachment, that were seen with the older connector systems, continue to remain an identifiable cause for over - sensing. furthermore, they highlight certain concerns over novel lead - connector problems that need to be adequately tackled to reduce improper delivery of device therapies and increased patient morbidity. unanticipated problems with df-4 icd leads are likely to accumulate. in a comprehensive review on this topic in europace in april 2012, sticherling and burri express concern that the complex design of the header / lead interface could lead to sensing or electrical isolation problems. correct torque wrench technique continues to be an important aspect in device implantation, but it is clear that further research and development is required to address any other potential newer causes of non - physiological over - sensing whose magnitude of risk may not yet be fully evident at the present time. | the df-4 is a new defibrillator lead technology. we present two cases of non - physiological transient ventricular over - sensing in patients who underwent implantation of an icd for secondary prevention. case 1 had ventricular over - sensing during pacing threshold evaluation post defibrillation testing while case 2 had the lead integrity alert triggered immediately post discharge with transient over - sensing. no lead - connector issues were found. case 1 was likely due to improper venting of the header and trapped air. case 2 was hypothesized to be due to intermittent header pin non - contact secondary to blood in the header. these cases reveal that df-4 leads are subject to both reported and potentially novel causes of transient acute ventricular over - sensing. |
inflammatory responses in the brain parenchyma have been associated with the etiopathogenesis of different neurological disorders, including central nervous system (cns) infection, brain ischemia, multiple sclerosis, alzheimer 's disease, and parkinson 's disease [17 ]. then, it is presently clear that neuroinflammation is a key feature shared by many neurodegenerative disorders [8, 9 ]. different cns cells, such as microglia, astrocytes, oligodendrocytes, and neurons produce a plethora of inflammatory mediators, which act either in a paracrine or an autocrine fashion, leading to an intricate cross - talk between these different cell types. among these mediators, many studies have demonstrated that cns cells produce prostanoids and that these mediators might contribute to the normal cns function or to enhance the neuroinflammatory and neurodegenerative processes. herein, we review the current knowledge on the role of prostaglandins, as well as the enzymes that synthesize them, in neuroinflammatory and neurodegenerative diseases. due to the variety of prostaglandins presently known, it is reasonable to speculate that these lipid mediators might play different roles in the cns. below, we describe some in vivo and in vitro data with regard to the potential role of specific prostanoids in neuroinflammation. to date, three prostaglandin (pg) e synthases (pgess) have been characterized : the microsomal pgess (mpges-1 and mpges-2) and the cytosolic pges (cpges) [1114 ]. mpges-1 is an inducible enzyme and is expressed also in activated microglia [15, 16 ]. there are at least four characterized pge2 receptors, namely, ep1, ep2, ep3, and ep4. for example, pge2 and ep agonists inhibited the expression of inducible nitric oxide synthase (inos) and nitric oxide (no) generation and enhanced the expression of cyclooxygenase (cox)-2 induced by lypopolysaccharide (lps) in cultured microglia. moreover, an ep2 agonist inhibited interleukin (il)-1 release by cultured primary rat microglia stimulated with lps, although no reduction of this cytokine was observed with ep1, ep3, and ep4 agonists. intraperitoneal injection of lps increased the expression of ep4 receptors in microglial cells and in the hippocampus of mice. interestingly, activation of ep4 receptors reduced the expression of different cytokines, cox-2 and inos in bv-2 and primary mouse microglial cells. a 6-day infusion of lps in the fourth cerebral ventricle of rats enhanced the pgd2 production in the brain. it has been shown that pgd2 produced by microglia acts on dp1 receptors of astrocytes, leading to astrogliosis. moreover, oligodendroglial apoptosis was reduced by hematopoietic prostaglandin d synthase (hpgds) inhibitor and in hpgds - null mice, suggesting an important effect of pgd2 in demyelination in twitcher mice, a model of krabbe disease. expression of dp1 and hpgds is also increased in the brains of patients with alzheimer 's disease. pgd2 also induced apoptosis of mouse oligodendrocyte precursor (mop) cells, what could interfere in the demyelination process that occurs in multiple sclerosis. it was shown that mice deficient in lipocalin - pgds reveal an increased number of apoptotic neurons and olygodendrocytes, suggesting a protective role of lipocalin - type pgds in the genetic demyelinating mouse twitcher. 15d - pgj2 is a metabolite of pgd2 and is formed from pgd2 by the elimination of two molecules of water. at least some effects mediated by 15d - pgj2 are mediated by activation of the peroxisome proliferator - activated receptors (ppars). this prostaglandin has been shown to inhibit no and tumor necrosis factor (tnf)- production as well as expression of major histocompatibility complex (mhc) class ii in activated microglia, suggesting that this prostaglandin might be important to modulate microglia functions. similar effects, such as downregulation of inos and cytokines, have also been observed in astrocytes. few studies were carried out to investigate the role of pgi2 in the cns. in general, these studies suggest a neuroprotective role for pgi2 against different stimuli. for example, enhancement of pgi2 synthesis in neuron - glia cultures by adenoviral gene transfer of pgi synthase (pgis) reduces the expression of different inflammatory mediators induced by lps, such as tnf-, and pgi2 receptor ligands prevented the death of hippocampal neurons induced by high oxygen, xanthine + xanthine oxidase, or serum deprivation. interestingly, 15-deoxy-(16-m - tolyl)-17,18,19,20-tetranorisocarbacyclin methyl ester, a selective central type pgi2 receptor ligand, reduced brain damage induced by middle cerebral artery occlusion. in rat primary neuronal culture, hypoxia increased pgf2 content. pgf2 reduced tnf- in primary spinal cord cultures stimulated with lps. in a model of unilateral middle cerebral artery occlusion, knockout (ko) mice to fp, the receptor for pgf2, have less neurological deficit and smaller infarct volumes. the ko animals were also less sensitive to excitotoxicity induced by unilateral intrastriatal n - methyl - d - aspartate injection. in agreement with that, in the same model, the fp agonist latanoprost increased neurological deficit and infarct size in wildtype (wt) mice. as previously mentioned, there are strong evidences that inflammation contributes to etiopathogenesis of neuroinflammatory and neurodegenerative diseases. ms is an autoimmune demyelinating disorder characterized by distinct episodes of neurologic deficits attributable to white matter lesions. it is the most common of the demyelinating disorders, which affects predominantly northern europeans. the disease becomes clinically apparent at any age, although onset in childhood or after 50 years of age is relatively rare. the frequency of relapses tends to decrease during the course of the disease, but there is a steady neurologic deterioration in a subset of patients. modeling clinical aspects of any human disease in rodents and cells is a big challenge in all fields of research. however, it is especially more challenging to model ms, because this is an exclusively human disease, its etiopathogenesis is unknown, and this disease is multifaceted, which occur in a relapsing - remitting manner. as the toxin - induced models of demyelination such as those induced by cuprizone, ethidium bromide and lysolecithin are important to understand demyelination and remyelination but do not resemble the human disease as efficiently as the autoimmune model (experimental autoimmune encephalomyelitis eae), this paper will be focused on the roles played by prostaglandins in this model because of its presumed higher predictive validity. there is a large body of evidence demonstrating the role played by prostanoids in the onset and progression of eae in a wide variety of animal models as well as in in vitro studies. within the last decade, some studies have demonstrated that cytosolic pla2 (cpla2) plays a key role in the etiopathogenesis of eae [3639 ]. there are evidences supporting distinct roles played by different isoforms of pla2 in the onset or progression of eae. cpla2 plays a role in the onset of eae, calcium - independent pla2 in the onset and progression, and secretory type ii pla2 in the later remission phase. immunohistochemical labeling of cpla2 was shown in either immune or endothelial cells in the spinal cord lesions of mice with eae induced by myelin oligodendrocyte glycoprotein (mog). both preemptive and therapeutic treatments with a selective cpla2 inhibitor resulted in marked reduction in the onset and progression of eae. accordingly, the reduced clinical score parallels with reduced spinal protein concentration of cox-2 and both gene expression and protein concentrations of dozens of inflammatory mediators, including several cytokines and chemokines which are implicated with the etiopathogenesis of eae. cpla2 inhibitors diminish the ability of antigen - presenting cells to induce antigen - specific effector t - cell proliferation and inflammatory cytokine production, inhibit microglial activation, and increase oligodendrocyte survival. the latter study also showed that if cpla2 inhibitors are administered at the peak of disease or during remission relapsing - remitting model, the subsequent relapse is abolished. consistently with these pharmacological studies, a genetic study showed that cpla2-deficient mice are resistant to eae. cox-1 and -2 are upregulated in the cns of animals in different eae models [36, 38, 41 ]. accordingly, different selective and nonselective inhibitors of cox isoforms induce beneficial effects in different animal models of eae. eae onset is delayed if diet is supplemented with acetylsalicylic acid shortly after its induction in lewis rats. pge2 seems to be the eicosanoid which is more strongly implicated with eae onset and progression. bolton and colleagues investigated the cns concentrations of pge2, 6-oxo - pgf1, and pgf2 in acute eae - affected guinea pigs. they showed that a pge2 concentration increase in spinal cord and cerebellum precedes eae onset, whereas the other two prostanoids were found to peak after the observation of the first clinical signs of eae. the behavioral syndrome associated with eae is also preceded by increased cns concentration of pge2 in mice. a wide screening that examined the correlation between many arachidonic acid (aa) pathway products and eae onset and progression showed that pge2 (concomitantly with its receptors ep1, ep2, and ep4) is synthesized more markedly than other eicosanoids, suggesting an important role in exacerbating eae. pge2 exacerbates th1 and th2 responses via ep2 and ep4 receptors during mouse eae onset and protects the brain from immune cell infiltration via ep4 receptor. mpges-1 upregulation occurs in microglia / macrophages in the spinal cord lesions of mice with eae induced by mog as well as in brain tissues from ms patients. mpges-1-deficient mice exhibit a better clinical score and suppressed th1 and th17 responses when compared with those of nongenetically modified control mice after eae induction. regarding the untoward gastric and cardiovascular effects induced by cox inhibitors, there is an eagerness to discover compounds that target mpges-1 for treating inflammatory diseases [4951 ] because this enzyme is downstream to cox-2 in aa pathway. systemic treatment with 15d - pgj2 inhibits eae progression in mice, and this is associated with reduced demyelination, neuroinflammation, il-12 production by macrophage / microglial cells, t - cell proliferation, and il-12-induced t - cell responses. moreover, pretreatment with this agonist of ppar delays the onset of eae and reduces the spinal cord infiltration of cd4 t cells and macrophages. 15d - pgj2 suppresses the production of cytokines and/or chemokines in cultured t cells, microglia, and astrocytes [5355 ]. providing further support to the role played by 15d - pgj2 in eae etiopathogenesis, it was shown that ppar antagonists reverse the inhibition of eae clinical signs and th1 response by this cyclopentanone prostaglandin. as there is a correlation between increased spinal pgds concentration and the initiation of relapsing phase of eae indeed, pgd2 is released from mast cells in allergic reactions, and it is suggested to modulate allergic inflammation [58, 59 ]. on the other hand, a more recent study showed that pgd2, pgi2 and 5-lipoxygenase pathways are suppressed in the acute phase of eae and returns to constitutive levels in the chronic phase. however, in a relapsing - remitting model, pgd2 remained unaffected throughout all phases. the first evidences supporting a role played by inflammation on ad onset rose up in the late 1980s, when many signs of inflammation in postmortem brains from ad patients were observed, such as activated lymphocytes and microglial cells in plaque and tangle lesions, presence of complement proteins, cell lysis, and opsonisation of debris [6064 ]. it was hypothesized that the long - term use of nonsteroidal anti - inflammatory drugs (nsaids) could reduce the risk for ad or delay disease onset. observed a clear negative correlation between the prevalence of ad in general population versus that in rheumatoid arthritis patients taking nsaids, mainly salicylates. reinforcing this evidence, a clinical trial conducted shortly afterwards, showed that treatment with indomethacin, a nonselective cox inhibitor, improves cognitive deficits in ad patients. since then, epidemiological studies have been showing either beneficial or detrimental effects induced by cox inhibitors on ad risk and delay of onset, though beneficial effects are mostly observed. despite controversy cpla2, which cleaves aa from cellular membrane phospholipids, is elevated in ad brain. the cyclooxygenation and subsequent isomerization of aa produces prostaglandins, which regulate immune responses and neurotransmission [69, 70 ]. accordingly, increased expression of cox-1 and -2 is observed in ad - affected brains [71, 72 ]. one of the most versatile products of this cascade is pge2, which is produced by glial cells and neurons. an increased expression of mpges-1 and mpges-2 is observed in the brain of ad brains [73, 74 ]. moreover, patients with probable ad have higher cerebrospinal fluid (csf) concentrations of pge2 than age - matched control subjects. it has been shown that pge2 increases amyloid precursor protein (app) gene expression and production in vitro [7678 ]. this effect is inhibited by immunosuppressants in astrocytes and is associated with ep2 receptor activation in microglial cells. on the other hand, there is evidence supporting an anti - inflammatory role played by pge2 mediated by ep4 receptor in lps - stimulated cultured microglial cells. however, pge2 increases app production via both ep2 and ep4 receptors (but not via ep1 and ep3 ones) both in vitro and in vivo [76, 79 ].. showed that pge2-dependent internalization of ep4 receptor increases -secretase activity, which in turn leads to higher proteolysis of app. in transgenic mice overexpressing app, selective inhibition of cox-2 blocks amyloid (a)-induced suppression of hippocampal long - term potentiation (ltp) and memory function independently of reductions in a42 and inflammatory cytokines, but markedly dependent on pge2 concentrations, showing an additional mechanism by which nsaids may protect against ad progression and an important synaptic role of pge2 in this setting. ep2 receptors are important mediators of pge2 actions on electrophysiological properties of hippocampal neurons, as ep mice exhibit cognitive deficits in social memory tests associated with a deficit in long - term depression in hippocampus. not exogenously applied pgd2 or pgf2, regulates hippocampal neuronal plasticity [69, 70 ]. one of the first studies which assessed prostaglandins concentrations in postmortem cerebral cortices of probable ad patients showed that only pgd2 was increased in comparison with age - matched control subjects. indeed, pgds expression was found to be localized in microglial cells surrounding senile plaques, and dp1 receptor expression was observed in microglial cells and astrocytes within senile plaques in human ad brains. in tg2576 transgenic mice a model of ad disease, the dp1 receptor expression increases in parallel with a deposition. as 15d - pgj2 induces neuronal apoptosis, it was initially suggested that this prostanoid is associated with neurodegeneration. however, it was shown afterwards that 15d - pgj2 reduces microglial production of no, il-6, and tnf- induced by a40, which suggests anti - inflammatory indirect neuroprotective effect. accordingly, not only 15d - pgj2, but also troglitazone and ciglitazone, other compounds known to activate ppar and attenuate the a-induced impairment of hippocampal ltp in vitro, supporting a possible beneficial effect on ad progression. pd is the second most common neurodegenerative disease, characterized by abnormal motor symptoms such as stiffness, postural instability, slowness of movement, resting tremor, and bradykinesia. the neuropathological features of pd are progressive death of dopaminergic neurons in the substantia nigra (sn) pars compacta that project to the striatum. the exact cause of this cell death is not clear, but recent studies have shown that the process may involve inflammatory reactions, in addition to oxidative stress, mitochondrial dysfunction, neural excitotoxicity, and insufficient neurotrophic factors [8587 ]. it is known that, in the sn of pd brains, microglia is activated, and its activation has been strongly associated with cns pathology of pd, by production of proinflammatory and cytotoxic factors, such as cytokines, chemokines, no, reactive oxygen species (ros), and aa metabolites [88, 89 ]. it has been shown that mice carrying a mutation of the cpla2 gene, leading to an absence of cpla2 activity, are resistant to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (mptp), a precursor to 1-methyl-4-phenylpyridinium (mpp) -induced neurotoxicity, a well - known model of pd. in fact, different studies have shown an upregulation of cox-2 in animal models of pd [9294 ]. cox-2 increased expression has been also demonstrated in the sn of postmortem pd specimens in comparison to normal controls [95, 96 ]. moreover, it has been shown that cox inhibition [93, 94, 97, 98 ] and cox transgenic ablation [99101 ] in in vivo models of pd increased survival of dopaminergic neurons. however rofecoxib, a cox-2 inhibitor, did not change mptp - induced neurodegeneration and, paradoxically, caused a significantly augmented basal prostaglandin production. regular use of nsaids is associated with a lower risk of pd compared with nonregular users of these drugs [85, 102 ]. however, this is still controversial, since recent studies could not demonstrate a protective effect of nsaids in pd [103105 ]. considering that these drugs might have other mechanisms of action unrelated to cox inhibition, it is important to evaluate the effect of specific compounds in the prevention or treatment of pd. it has been observed that pge2 is significantly elevated in the csf and sn of pd patients in comparison to control subjects. moreover, incubation of slices of sn with aa induced an increased production of pge2 synthesis, suggesting an enhancement of the enzymes responsible to its production. release of aggregated -synuclein, a major component of lewy bodies in pd, after neuronal damage, may activate microglia. this activation could, in turn, lead to production of proinflammatory mediators, such as pge2, contributing to the progression of nigral neurodegeneration. a pretreatment of primary mesencephalic neuron - glia mouse cultures with -synuclein enhances the production of pge2. apparently, phagocytosis of -synuclein activates nadph oxidase, which produces ros, and has a crucial role in microglial activation and associated neurotoxicity. in primary mesencephalic mixed neuron - microglia cultures, mpp, a neurotoxin that causes dopaminergic neuronal death, induced pge2 production. however, this effect was not observed in enriched microglia and enriched neuron cultures, indicating that is necessary an interaction between microglia and neurons for mpp - induced increase of the pge2 production, probably due to cox-2 activity. moreover, pge2 was not enhanced neither in enriched astroglia nor in neuron - astroglia cultures. conversely, pge2 was significantly reduced in the hippocampus, striatum, and cortex of animals injected with 6-hydroxydopamine (6-ohda). it has been shown that ep receptors are expressed differently in the sn. to date, in the rat, ep1 is restricted to dopaminergic neurons, while ep3 is expressed exclusively by nondopaminergic cells. on the other hand, ep2 is localized to both dopaminergic and nondopaminergic cells. in rats, ep1, but not ep2 and ep3 receptor antagonists, reduced the dopaminergic neuronal death induced by 6-ohda, suggesting an important effect of ep1 receptor in the neurotoxicity induced by pge2. also, culture of dopaminergic neurons displayed ep2 receptors after 6-ohda neurotoxicity, and butaprost, a selective ep2 agonist, significantly increased survival of tyrosine hydroxylase positive cells, suggesting a possible neuroprotective role of ep2 of activation. interestingly, in comparison to microglia obtained of wt animals, microglia of ep2 ko mice reveal an enhanced capacity to clear aggregated -synuclein in human mesocortex tissue of patients with lewy body disease. moreover, ep2 mice were more resistant to neurotoxicity induced by mptp, an effect that is associated with attenuated formation of aggregated -synuclein in the sn and striatum. pgj2 and its metabolites might alter the process of protein folding and aggregation, contributing to the development of pd. in human neuroblastoma sk - n - sh cells, pgj2 disrupts the structural integrity of microtubules and actin filaments. in vitro, this molecule also hindered the polymerization of highly purified tubulin from bovine brain. interestingly, in cells treated with pgj2, microtubule / endoplasmatic reticulum collapse coincides with the formation of protein aggregates, such as ubiquitinated proteins and -synuclein. in mouse and human neuroblastoma cells, as well as in rat primary embryonic mesencephalic cultures, pga1, pgd2, pgj2, and its metabolite -pgj2 induced accumulation of ubiquitinated proteins and cell death. the ubiquitination induced by -pgj2 might be due to inhibition of ubiquitin c - terminal hydrolase (uch) l3 and uch - l1, implicating in an alteration of de - ubiquitinating enzymes, possibly contributing to the accumulation and aggregation of ubiquitinated proteins, what leads to inflammation associated with the neurodegenerative process. modification of uch - l1, an enzyme that functions predominantly during monoubiquitin recycling in the ubiquitin - proteosome system, by cyclopentenone prostaglandins, induced unfolding and aggregation of the protein. therefore, the deleterious effect of cox-2 in pd could be due to the production of cyclopentenone prostaglandins. in addition to that, pga1 has been shown to reduce nuclear factor kappa b translocation to the nucleus, caspase 3 activation, and apoptosis of human dopaminergic sh - sy5y cells induced by rotenone. this neuropathological condition can be classified as familial, in which mutations in the enzyme superoxide dismutase-1 (sod1) can occur, or as sporadic, which encompasses 90% of als patients. neuroinflammation seems to play an important role in the progress of this disorder. in als, microglia activation and proliferation is observed in regions where there is neuron loss, like motor cortex, motor nuclei of the brainstem and corticospinal tract. it has been shown that cpla2 is expressed in astrocytes and motor neurons of the spinal cord of transgenic mice carrying the gene encoding a mutant form of human sod1 [120, 121 ]. in agreement with that, cpla2 immunoreactivity was also observed in the spinal cord of human sod1-mutated familial als and in sporadic als patients [120, 122 ]. an increase in cox-2 expression is observed in the spinal cord of sod1 transgenic mice [123, 124 ] and human cases of als [125, 126 ]. postmortem examination of the ventral horn of the spinal cord of sporadic als patients revealed that cox-2 immunoreactivity was increased in motor and interneurons, as well as in glia, in comparison with non - als controls. on the other hand, cox-1 expression was detected in microglia, but not in neurons, of als and controls tissues, albeit no difference was observed between the two groups of patients. few attempts have also been made to elucidate the effect induced by cox inhibitors in models of als. in organotypic spinal cord cultures, the cox-2 selective inhibitor sc236 significantly reduced the excitotoxic damage of motor neurons induced by threo - hydroxyaspartate, a compound that inhibits astroglial transport of glutamate. therefore, it is possible that cox-2 might be involved in the excitotoxicity induced by glutamate. moreover, in vivo studies also suggested that cox might be a potential target for als treatment. it has been shown that traditional nsaids and cox-2 inhibitors reduced different pathological features developed by sod1 transgenic mice, such as loss of motor neurons and glial activation in the spinal cord, motor impairment and weight loss, as well as these compounds prolonged the survival of the animals [120, 129131 ]. considering these evidences, minghetti suggested that cox-2 enhancement could be deleterious in als not only due to the enhancement of glutamate release by pge2, but also because of the ros produced by cox peroxidase activity. on the other hand, almer. have shown a drastically reduced pge2 production in the spinal cord of transgenic sod1/cox-1 mice, suggesting a minor role for cox-2 in the production of pge2 in the disease. moreover, deficiency of cox-1 did not affect motor neuron loss and survival of the animals. pge2 is elevated in the spinal cord of sod1 mice and in the serum and csf of als patients [127, 135 ], though the levels of this prostaglandin did not correlate with clinical state of the patients. the role of pge2 was further investigated in in vitro models of als. in an organotypic spinal cord slice model, motor neuronal death induced by d, l - threo - hydroxyaspartate is reduced by pge2, as well as butaprost and sulprostone, ep2 and ep3 receptor agonists, respectively. interestingly, in the same study, sc58236, a cox-2 inhibitor, also reduced motor neuron loss. ep2 receptor expression is increased in astrocytes and microglia of sod1 mice and in astrocytes of human als spinal cord. deficiency of ep2 receptor in sod1 mice increased the survival and grip strength in comparison with sod1/ep2 and sod1/ep2 mice. the absence of ep2 receptor also reduced the production of different inflammatory mediators in this animal model of als. recently, it has been shown that mpges-1 is enhanced in the spinal cord of sod1 in comparison with wt mice. interestingly, aad-2004, a molecule that inhibits mpges-1 and free radical formation, reduced microglia activation and motor neuron loss, as well as it improved motor function and increased survival. 15d - pgj2 immunoreactivity is increased not only in motor neurons, but also in astrocytes and reactive microglia in the spinal cord of als patients. hd is a progressive neurodegenerative disease that reveals movement disorders and dementia as main features. this pathological condition is an autosomal - dominant pathological condition disease [139, 140 ]. although there are evidences that neuroinflammation is present in hd, it is not known whether it contributes to the etiopathogenesis of the disease or whether it is solely an epiphenomenon. it has been shown that in r6/2 mice, an animal model of hd, the number of microglia is reduced in some brain regions in comparison with their wt littermates. microglia of animals at 14.5 weeks of age were also smaller in size than the same cells in the animals at 7 weeks of age, and they also revealed condensed nucleus and fragmentation of the cytoplasm within processes, suggesting an impaired function of these cells in this pathological condition. on the other hand, activated microglia are present in the neostriatum, cortex, and globus pallidus of hd brains. importantly, the reactive microglia appeared in association with pyramidal neurons presenting huntingtin - positive intranuclear inclusions. although a causal link between neuroinflammation and hd onset or progression has not been demonstrated, it is reasonable to assume that microglia might play a role in its development. although there are different genetic models of hd, some compounds such as 3-nitropropionic acid (3-np) and quinolinic acid (qa) are also used to induce striatal neuron toxicity, being therefore considered hd animal models [144146 ]. cox-2 immunoreactivity is enhanced in striatal tissues 12 h after treatment of animals with qa. this enhancement was observed predominantly in neurons and microglia. chronic treatment with different cox inhibitors, such as rofecoxib, celecoxib, nimesulide, and meloxicam improved spontaneous locomotor activity and the motor performance, as well as these medicines reduced biochemical and mitochondrial alteration induced by qa [148150 ]. naproxen and valdecoxib, two cox inhibitors, also reduced 3-np - induced motor and cognitive impairment. this study suggested that these effects could be due to a reduction in the oxidative stress induced by the drugs. although beneficial effects were observed induced by cox inhibitors in drug - induced models of hd, similar effects are not observed in transgenic mice. for example, administration of acetylsalicylate from weaning did not induce any alteration of rotarod performance and ventricle enlargement n171 - 82q mice in comparison with untreated animals. rofecoxib also did not change motor performance and lifespan of r6/2 mice. on the other hand, acetylsalicylate and celecoxib shortened life expectancy of r6/2 and n171 - 82q mice, respectively [152, 153 ]. administration of 3-np enhances pge2 and pgf2 in the striatum [154, 155 ]. these prostaglandins are reduced by licofelone, a competitive inhibitor of cox-1, cox-2, and 5-lox isoenzymes. in addition, this compound reduced the impairment in locomotor activity and motor performance, as well as it reduced apoptotic markers. expression of cox-2, as well as pge2 production, is increased in the ipsilateral side compared with the contralateral vehicle - injected side in the striatum and cortex of rats by unilateral intrastriatal injection of qa. moreover, it has also been shown that qa injection induced ep3-positive striatal neuronal loss, whereas activated microglia expressed ep3 in vivo after excitotoxicity injury. a role for pga1 has also been suggested. this prostaglandin attenuated dna fragmentation and neuronal loss and increased dopamine d1 receptor expression induced by qa in the striatum it also reduced the qa - induced activation of nuclear factor kappa b, but not activator protein-1, in this brain region. acute inflammation in the cns is triggered by a neuronal injury or infection and is short - lived. this acute response is believed to have protective aspects, since it could avoid further injury and induce tissue repair. although an acute stimulus may trigger, for example, oxidative stress, this short - term event would not interfere with long - term neuronal survival. it is known that moderate microglia activation might induce neuroprotective effects, such as to scavenger neurotoxins, remove cell debris and secrete mediators which are important for neuronal survival. acute activation of these cells is a normal response to injuries, and it contributes to wound healing. on the other hand, chronic neuroinflammation persists for a long time after the initial insult and normally is self - perpetuating. this condition induces neuronal death, and the molecules released by the dead neurons can further activate microglia, which enhances cell death. this vicious cycle, together with the continuous production of factors that activate microglia, contributes to the chronicity of this process. intense activation and accumulation of these cells at the site of injury can induce neuronal damage, since they release a variety of neurotoxic substances. for example, the a protein, which is involved in ad, can activate microglia and lead them to release neurotoxic factors such as no, tnf-, and superoxide, leading to the progression of this disorder. an interesting finding is that a chronic inflammation induced by the infusion of lps (a substance that strongly activates microglia) in the brain of rats resembles different features observed in ad patients. actually, it is presently not clear why the neuronal or glial cells can not prevent the chronicity of the inflammatory process. abnormal synthesis of some proteins by neurons could continuously activate microglia, leading them to the release of neurotoxic factors. moreover, oxidative stress is another important event that contributes to the neuronal damage observed in chronic neuroinflammation. it is also possible that the senescence of immune system in the cns could contribute to chronicity of this process. for example, it has been shown that microglia from old transgenic ps1-app mice release an increased amount of inflammatory mediators and do not phagocytose a properly in comparison to microglia from young mice. therefore, microglia senescence could play a role in the development of some neurodegenerative conditions [161, 166 ]. despite these facts, the adaptive immune system might also play a role, as it has been shown that it is involved in the etiopathogenesis of pd. in this context, one might assume that the production of lipid mediators, such as prostaglandins, might differently modulate neuroinflammation and neurodegeneration. considering the roles of prostaglandins and depending on the stage of inflammation, as well as different microenvironments generated by a variety of substances, these lipid mediators could determine the survival or death of neurons. here we summarized the evidences that prostaglandins might play a key role in the etiopathogenesis of neuroinflammatory and neurodegenerative diseases. prostaglandins have a plethora of actions in cns cells that differently affect the progress of inflammation and neuronal death or survival. therefore, inhibition of the production of a specific prostanoid or its action on its receptor would be a better mechanism to control some pathological processes. on the other hand, inhibiting the effects of some prostaglandins could also be deleterious. thus, further studies are important to make a more complete idea the role of these lipid mediators in neuroinflammation and neurodegeneration. this knowledge might serve to develop pharmacological strategies for the treatment of neurological diseases. | increasing data demonstrates that inflammation participates in the pathophysiology of neurodegenerative diseases. among the different inflammatory mediators involved, prostaglandins play an important role. the effects induced by prostaglandins might be mediated by activation of their known receptors or by nonclassical mechanisms. in the present paper, we discuss the evidences that link prostaglandins, as well as the enzymes that produce them, to some neurological diseases. |
for a wide range of directly transmitted infectious diseases, the household plays a pivotal role in transmission due to the greater strength of contacts between individuals sharing living arrangements [1, 2 ]. we can conceptualize many infections as transmitting readily to household members, but transmitting at a lower rate to individuals in the wider community. this concept led to both early work on quantifying these effects using clinical data and to more recent attempts to incorporate households into models of pandemic influenza in britain [46 ]. a large body of modelling work explores the spread of infection in populations structured into households, considering both thresholds for large - scale epidemics and optimal deployment of vaccination (see [79 ] and references therein). however, this work has largely been theoretical and has often not sought to relate results to available data or to consider vaccination measures that would be practically achievable. here we consider household models relevant to the spread of pandemic influenza, and using data from the 2001 census examine the range of geographical heterogeneities in early epidemic behaviour. recent concerns over pandemic influenza have prompted a cascade of model development [4, 1017 ] with many models acknowledging the role played by households and structure the population and transmission accordingly [4, 10 ]. some of these models are highly complex, and consider the role of transmission in households, schools and workplaces as well as incorporating localized spatial transmission [10, 12 ]. here we take a simpler approach and focus exclusively on the implications of strong household transmission together with weaker transmission to the local community. our model (see online supplementary information, and) and analysis operate at the scale of wards ; there are around 10 000 wards in great britain (england, wales and scotland) with populations of between 1000 and 35 000 individuals in each according to the 2001 census. the aggregation scale used in this paper is the 2001 census standard table wards referred to simply as wards throughout although strictly speaking such standard table wards are distinct from (but related to) both other statistical wards, and also electoral wards used in local government. the mathematical model essentially provides a sophisticated and dedicated tool for translating demographic characteristics into epidemiological properties. we begin by considering household sizes and number of dependent children, both in terms of distributions within great britain and in terms of variability between wards. using our household model, this variability is translated into early expected growth rates of an epidemic allowing us to explore the geographical distribution of this most important epidemiological quantity. finally, we consider the advantages of prophylactic vaccination targeted towards dependent children compared to vaccination at random or focused towards entire households. households consisting of just one or two individuals dominate, with decreasing numbers of households with larger occupancy (fig. 1 a). we note that the 2001 census does not contain precise information on households containing eight or more occupants, and therefore assume in our model that values of eight or more are exactly eight, which makes little quantitative or qualitative difference to our results compared to any other realistic approach. this variability in household size is clearly important : large households have a greater chance of being infected (as there are more members to potentially bring infection in from the community) and a higher rate of internal transmission (due to the greater number of contacts). however, quantifying the impact of these features requires the type of detailed mathematical model developed in the next section (and online supplementary information). (a) the distribution of household sizes plotted as the total number of households of each size in great britain. (b) the proportions of households with a given number of dependent children separated into household sizes. (c) the distribution of dependent children as percentages of the ward population size. (d) the correlation between percentage of dependent children and the mean household size within a ward ; dots represent the values for each of the 9976 standard table wards in great britain ; a simple linear fit and associated confidence intervals are shown in red. crown copyright material is reproduced with the permission of the controller of hmso.) (a) the distribution of household sizes plotted as the total number of households of each size in great britain. (b) the proportions of households with a given number of dependent children separated into household sizes. (c) the distribution of dependent children as percentages of the ward population size. (d) the correlation between percentage of dependent children and the mean household size within a ward ; dots represent the values for each of the 9976 standard table wards in great britain ; a simple linear fit and associated confidence intervals are shown in red. crown copyright material is reproduced with the permission of the controller of hmso.) given the importance of large households it is important to consider their composition in more detail and to determine relationships with other demographic measures. considering dependent children (fig. 1 b) we find, as expected, that larger households tend to have more dependent children. as such less than 10% of households of five or more are solely occupied by adults, whereas over 90% of households of size two have no dependent children. for this we can see that numbers of dependent children and household sizes are closely linked. we observe, as shown in figure 1 c, great geographic diversity in the proportion of dependent children in each ward while the average is around 23%, extremes as low as 5% and as high as 40% exist. finally, we observe that the proportion of dependent children within a ward closely correlates with the average household size in that ward (fig. 1d), although we note that there are several points this figure exhibiting large mean household size but with few dependent children ; the demographic features (such as student houseshares) that can lead to this are discussed more fully in the supplementary information. it is against the above background of heterogeneous host demography that our mathematical model operates. our model of household - based transmission is relatively simple and parsimonious, and aims to identify the effects of different household patterns across great britain. two transmission rates are used : transmission between members of the same household and transmission to general members of the local population (ward). transmission between wards is not included, for model simplicity and transparency of results. while movement between wards and continuous importation of infection from abroad are likely to have a significant impact on the behaviour of pandemic influenza, these operate at a different scale from household - level transmission and so as a first approximation can be ignored. the general spread of infection within the ward community is modelled as frequency - dependent transmission, in accordance with general modelling of large human populations [19, 20 ], while transmission within the household is assumed to be density dependent, such that individuals interact in a pairwise manner irrespective of household size. in practice, household transmission probably lies between the extremes of frequency and density dependence, but the precise scaling is likely depend on the type of household and ages of occupants. by assuming such density - dependent transmission we are maximizing the degree of heterogeneity other assumptions produce weaker results but do not effect the qualitative conclusions. although our modelling framework can deal with a range of dynamic aspects of infection, here we simply consider the early (asymptotic) growth rate of infection within each ward. in particular, a range of standard theory shows that starting with a low level of infection within the population, and following some initial short - lived transients, the disease incidence and prevalence is predicted to increase exponentially [20, 22, 23 ] ; it is this early exponential growth rate that is of primary interest here. in particular, we seek the basic reproductive ratio, r0, defined such that the early growth of infected cases (i) is given by i(t)~exp([r01]gt) where 1/g is the average infectious period. we note that this value of r0 defined in terms of growth rates differs from the r0 defined in terms of number of secondary cases ; although both agree at the invasion threshold r0=r0=1 (see online supplementary information for a more detailed discussion). we decided to use r0 as its definition most closely matches observations taken during an epidemic. while a relatively simple formulation, our model is parameterized to match observables concerning pandemic influenza. using the national distribution of household sizes, we fix the household and community transmission rates to yield a 40% chance of transmission between any two household members (often called the secondary attack rate) and a basic reproductive ratio of approximately 2 for great britain as a whole, which is consistent with statistical work in this field [1, 2 ]. figure 2 shows the geographical distribution of basic reproductive ratios (r0 values) in each ward in great britain. we observe in figure 2 b an approximate 25% variation in r0 between the mean and most extreme wards, which corresponds to a 50% variation in early epidemic growth rates. in general, high growth rates reflect a greater than average abundance of large household sizes and high proportion of dependent children, although the precise relationship is complex and nonlinear. it is clear from both the locations of wards with highest r0 (fig. 2 a), and the discussion in the supplementary information, that high values of r0 tend to be associated with the large conurbations of great britain, with the areas of highest r0 having around 20 times the mean population density of great britain. epidemiologically, those wards with the highest r0 will require the greatest levels of control and therefore may be targeted with high priority during an epidemic ; in addition, the fact that these high r0 wards are generally in urban areas may mean that pandemic influenza (or any other novel pathogen) is likely to enter such wards early in a national epidemic. fig. 2distribution of r0 values in great britain, highlighting the predicted variation in early epidemic growth rates. (a) wards are shown in their geographic locations and coloured according to their r0 value. the histograms in (b) utilize the same colour scale and hence provide a reference for the ward - based map. (electronic information on ward boundaries is census output, which is crown copyright and is reproduced with the permission of the controller of hmso and the queen 's printer for scotland. crown copyright 2003.) distribution of r0 values in great britain, highlighting the predicted variation in early epidemic growth rates. (a) wards are shown in their geographic locations and coloured according to their r0 value. the histograms in (b) utilize the same colour scale and hence provide a reference for the ward - based map. (electronic information on ward boundaries is census output, which is crown copyright and is reproduced with the permission of the controller of hmso and the queen 's printer for scotland. prophylactic vaccination may be a key epidemiological tool in combating any future uk epidemic, either to eliminate completely the risk of a large - scale epidemic or to be used in conjunction with other methods such a social distancing, antivirals or contact tracing. for simplicity, this efficacy does not change our qualitative results but will make any vaccination strategy less effective. figure 3 a considers three methods of targeting the delivery of vaccination within wards, with the results for each ward displayed as a point. the results of our household model agree with previous findings in terms of the critical level of vaccination coverage required to prevent an outbreak. this is because effective herd immunity at the household level can be achieved without the need to vaccinate all household members ; in essence vaccine is being wasted on individuals who already have some protection through being in partially vaccinated households. vaccinating individuals at random (red) is a simpler and better strategy, and is found to outperform the expected vaccination threshold (black line) predicted by simpler unstructured models [19, 20, 26 ]. the improvement over the prediction from unstructured models is because random vaccination of individuals effectively biases vaccination towards larger households, thereby targeting control at these most epidemiologically important units. however, an ideally targeted strategy prioritizing individuals in households with the most susceptibles has even greater benefits with the required level of critical vaccination never exceeding the random - mixing prediction of 50%. we see overall that ideal targeting can reduce by about 40% the amount of vaccine required nationally. (a) critical levels of vaccine coverage needed to prevent the spread of infection within a ward are shown for three strategies, along with the prediction from standard models in which there is no population structure. (b) the effects on the distribution of ward rv values of three vaccination strategies. these distributions are calculated at individual level since ward - level results are slightly biased by the trend for less populated wards to have smaller household sizes. the box - whisker plots show the mean, 1 and 2 standard deviations and outliers. (d) comparison of the ward - level effects of vaccinating dependent children and heterogeneous random vaccination, in which the same proportion of each ward is vaccinated. the nine exceptional wards in which heterogeneous random vaccination outperforms vaccinating dependent children are highlighted (red circles) in plots (c) and (d). (a) critical levels of vaccine coverage needed to prevent the spread of infection within a ward are shown for three strategies, along with the prediction from standard models in which there is no population structure. (b) the effects on the distribution of ward rv values of three vaccination strategies. these distributions are calculated at individual level since ward - level results are slightly biased by the trend for less populated wards to have smaller household sizes. the box - whisker plots show the mean, 1 and 2 standard deviations and outliers. (d) comparison of the ward - level effects of vaccinating dependent children and heterogeneous random vaccination, in which the same proportion of each ward is vaccinated. the nine exceptional wards in which heterogeneous random vaccination outperforms vaccinating dependent children are highlighted (red circles) in plots (c) and (d). therefore we seek an alternative proxy that incorporates insights from the ideal strategy and readily allows vaccination to be targeted towards a proportion of individuals in the larger households. from figure 1 b we predict that vaccinating children biases protection towards the larger households, yet does not waste vaccine immunizing all members ; in addition it is likely to be both ethically and socially acceptable. with this in mind, we consider three forms of vaccination at the ward level : (1) vaccination of dependent children (who account for about 23% of the gb population) ; (2) heterogeneous random vaccination, where individuals are vaccinated at random with the proportion vaccinated equal to the proportion of children within the ward ; and (3) homogeneous random vaccination, where individuals are vaccinated at random in every ward, such that the proportion vaccinated nationally matches the proportion of dependent children. alternatively, we can consider heterogeneous and homogeneous vaccination as randomizations of the vaccination of dependent children ; heterogeneous vaccination randomizes the distribution of vaccine within each ward, whereas homogeneous vaccination randomizes the distribution of vaccine over the whole of great britain. as such, comparing these three strategies allow us to access the impact of targeting children, both in terms of efficient deployment within a ward and also as a means of proportioning vaccine between wards. even though all three strategies ultimately vaccinate the same number of individuals (around 23% of the population), it is clear that targeting has advantages (fig. we measure the efficacy of vaccination through rv (the equivalent of r0, but after vaccination). vaccinating dependent children causes a 35% drop in this reproductive ratio (from 2 to 13), whereas both homogeneous and heterogeneous vaccination only cause a reduction of around 25%. comparing homogeneous and heterogeneous vaccination in more detail allows us to assess the impact of targeting wards with the most children, without targeting large families within those wards. the histograms and box - whisker plots of rv show that the targeting inherent in heterogeneous vaccination offers negligible mean benefit over homogeneous vaccination (fig. however, this ward - level targeting does significantly reduce the variability in epidemic growth rates bringing those wards with extremely high growth rates under greater control. figure 3 (c, d) considers the behaviour at the ward level, with particular focus on r0 before vaccination and the equivalent measure rv after a proportion of the population has been vaccinated. in general targeting vaccination towards dependent children not only reduces the average reproductive ratio (rv) but also significantly reduces much of the variability (fig. wards that originally had high r0 values due to large average household sizes with many children are now brought much closer to the average. in only nine wards (red circles) out of over 10 meaning that at a local as well as a national scale vaccinating children is overwhelmingly effective. the precise socio - demographic characteristics of these nine outliers is explored more fully in the supplementary material, but all these wards have either large student or older adult households, breaking the general rule that large households are associated with many dependent children. our model of household - based transmission is relatively simple and parsimonious, and aims to identify the effects of different household patterns across great britain. two transmission rates are used : transmission between members of the same household and transmission to general members of the local population (ward). transmission between wards is not included, for model simplicity and transparency of results. while movement between wards and continuous importation of infection from abroad are likely to have a significant impact on the behaviour of pandemic influenza, these operate at a different scale from household - level transmission and so as a first approximation can be ignored. the general spread of infection within the ward community is modelled as frequency - dependent transmission, in accordance with general modelling of large human populations [19, 20 ], while transmission within the household is assumed to be density dependent, such that individuals interact in a pairwise manner irrespective of household size. in practice, household transmission probably lies between the extremes of frequency and density dependence, but the precise scaling is likely depend on the type of household and ages of occupants. by assuming such density - dependent transmission we are maximizing the degree of heterogeneity although our modelling framework can deal with a range of dynamic aspects of infection, here we simply consider the early (asymptotic) growth rate of infection within each ward. in particular, a range of standard theory shows that starting with a low level of infection within the population, and following some initial short - lived transients, the disease incidence and prevalence is predicted to increase exponentially [20, 22, 23 ] ; it is this early exponential growth rate that is of primary interest here. in particular, we seek the basic reproductive ratio, r0, defined such that the early growth of infected cases (i) is given by i(t)~exp([r01]gt) where 1/g is the average infectious period. we note that this value of r0 defined in terms of growth rates differs from the r0 defined in terms of number of secondary cases ; although both agree at the invasion threshold r0=r0=1 (see online supplementary information for a more detailed discussion). we decided to use r0 as its definition most closely matches observations taken during an epidemic. while a relatively simple formulation, our model is parameterized to match observables concerning pandemic influenza. using the national distribution of household sizes, we fix the household and community transmission rates to yield a 40% chance of transmission between any two household members (often called the secondary attack rate) and a basic reproductive ratio of approximately 2 for great britain as a whole, which is consistent with statistical work in this field [1, 2 ]. our qualitative conclusions are robust to the precise choice of parameters. figure 2 shows the geographical distribution of basic reproductive ratios (r0 values) in each ward in great britain. we observe in figure 2 b an approximate 25% variation in r0 between the mean and most extreme wards, which corresponds to a 50% variation in early epidemic growth rates. in general, high growth rates reflect a greater than average abundance of large household sizes and high proportion of dependent children, although the precise relationship is complex and nonlinear. it is clear from both the locations of wards with highest r0 (fig. 2 a), and the discussion in the supplementary information, that high values of r0 tend to be associated with the large conurbations of great britain, with the areas of highest r0 having around 20 times the mean population density of great britain. epidemiologically, those wards with the highest r0 will require the greatest levels of control and therefore may be targeted with high priority during an epidemic ; in addition, the fact that these high r0 wards are generally in urban areas may mean that pandemic influenza (or any other novel pathogen) is likely to enter such wards early in a national epidemic. fig. 2distribution of r0 values in great britain, highlighting the predicted variation in early epidemic growth rates. (a) wards are shown in their geographic locations and coloured according to their r0 value. the histograms in (b) utilize the same colour scale and hence provide a reference for the ward - based map. (electronic information on ward boundaries is census output, which is crown copyright and is reproduced with the permission of the controller of hmso and the queen 's printer for scotland. source : 2001 census, output area boundaries [28, 29 ]. crown copyright 2003.) distribution of r0 values in great britain, highlighting the predicted variation in early epidemic growth rates. (a) wards are shown in their geographic locations and coloured according to their r0 value. the histograms in (b) utilize the same colour scale and hence provide a reference for the ward - based map. (electronic information on ward boundaries is census output, which is crown copyright and is reproduced with the permission of the controller of hmso and the queen 's printer for scotland. prophylactic vaccination may be a key epidemiological tool in combating any future uk epidemic, either to eliminate completely the risk of a large - scale epidemic or to be used in conjunction with other methods such a social distancing, antivirals or contact tracing. for simplicity, this efficacy does not change our qualitative results but will make any vaccination strategy less effective. figure 3 a considers three methods of targeting the delivery of vaccination within wards, with the results for each ward displayed as a point. the results of our household model agree with previous findings in terms of the critical level of vaccination coverage required to prevent an outbreak. this is because effective herd immunity at the household level can be achieved without the need to vaccinate all household members ; in essence vaccine is being wasted on individuals who already have some protection through being in partially vaccinated households. vaccinating individuals at random (red) is a simpler and better strategy, and is found to outperform the expected vaccination threshold (black line) predicted by simpler unstructured models [19, 20, 26 ]. the improvement over the prediction from unstructured models is because random vaccination of individuals effectively biases vaccination towards larger households, thereby targeting control at these most epidemiologically important units. however, an ideally targeted strategy prioritizing individuals in households with the most susceptibles has even greater benefits with the required level of critical vaccination never exceeding the random - mixing prediction of 50%. we see overall that ideal targeting can reduce by about 40% the amount of vaccine required nationally. (a) critical levels of vaccine coverage needed to prevent the spread of infection within a ward are shown for three strategies, along with the prediction from standard models in which there is no population structure. (b) the effects on the distribution of ward rv values of three vaccination strategies. these distributions are calculated at individual level since ward - level results are slightly biased by the trend for less populated wards to have smaller household sizes. the box - whisker plots show the mean, 1 and 2 standard deviations and outliers. (d) comparison of the ward - level effects of vaccinating dependent children and heterogeneous random vaccination, in which the same proportion of each ward is vaccinated. the nine exceptional wards in which heterogeneous random vaccination outperforms vaccinating dependent children are highlighted (red circles) in plots (c) and (d). (a) critical levels of vaccine coverage needed to prevent the spread of infection within a ward are shown for three strategies, along with the prediction from standard models in which there is no population structure. (b) the effects on the distribution of ward rv values of three vaccination strategies. these distributions are calculated at individual level since ward - level results are slightly biased by the trend for less populated wards to have smaller household sizes. the box - whisker plots show the mean, 1 and 2 standard deviations and outliers. (d) comparison of the ward - level effects of vaccinating dependent children and heterogeneous random vaccination, in which the same proportion of each ward is vaccinated. the nine exceptional wards in which heterogeneous random vaccination outperforms vaccinating dependent children are highlighted (red circles) in plots (c) and (d). therefore we seek an alternative proxy that incorporates insights from the ideal strategy and readily allows vaccination to be targeted towards a proportion of individuals in the larger households. from figure 1 b we predict that vaccinating children biases protection towards the larger households, yet does not waste vaccine immunizing all members ; in addition it is likely to be both ethically and socially acceptable. with this in mind, we consider three forms of vaccination at the ward level : (1) vaccination of dependent children (who account for about 23% of the gb population) ; (2) heterogeneous random vaccination, where individuals are vaccinated at random with the proportion vaccinated equal to the proportion of children within the ward ; and (3) homogeneous random vaccination, where individuals are vaccinated at random in every ward, such that the proportion vaccinated nationally matches the proportion of dependent children. alternatively, we can consider heterogeneous and homogeneous vaccination as randomizations of the vaccination of dependent children ; heterogeneous vaccination randomizes the distribution of vaccine within each ward, whereas homogeneous vaccination randomizes the distribution of vaccine over the whole of great britain. as such, comparing these three strategies allow us to access the impact of targeting children, both in terms of efficient deployment within a ward and also as a means of proportioning vaccine between wards. even though all three strategies ultimately vaccinate the same number of individuals (around 23% of the population), it is clear that targeting has advantages (fig. we measure the efficacy of vaccination through rv (the equivalent of r0, but after vaccination). vaccinating dependent children causes a 35% drop in this reproductive ratio (from 2 to 13), whereas both homogeneous and heterogeneous vaccination only cause a reduction of around 25%. comparing homogeneous and heterogeneous vaccination in more detail allows us to assess the impact of targeting wards with the most children, without targeting large families within those wards. the histograms and box - whisker plots of rv show that the targeting inherent in heterogeneous vaccination offers negligible mean benefit over homogeneous vaccination (fig. however, this ward - level targeting does significantly reduce the variability in epidemic growth rates bringing those wards with extremely high growth rates under greater control. figure 3 (c, d) considers the behaviour at the ward level, with particular focus on r0 before vaccination and the equivalent measure rv after a proportion of the population has been vaccinated. in general targeting vaccination towards dependent children not only reduces the average reproductive ratio (rv) but also significantly reduces much of the variability (fig. wards that originally had high r0 values due to large average household sizes with many children are now brought much closer to the average. in only nine wards (red circles) out of over 10 meaning that at a local as well as a national scale vaccinating children is overwhelmingly effective. the precise socio - demographic characteristics of these nine outliers is explored more fully in the supplementary material, but all these wards have either large student or older adult households, breaking the general rule that large households are associated with many dependent children. there are a wide range of regional heterogeneities within great britain which it may be very important to capture or appreciate if detailed mathematical models are to be effectively used in containment planning. our results follow the general epidemiological tenet that such heterogeneities can be used to target control measures efficiently. however, ideal targeting is impractical and socially unacceptable ; instead we show that targeting prophylactic vaccination towards dependent children may be an effective (and acceptable) means of targeting intervention towards the largest and therefore most epidemiologically important households, without the disadvantages associated with vaccinating entire households. we have also found an interesting demographic pattern in the small number (< 01%) of wards that do not obey this rule, which are dominated either by student or older adult socio - demographic categories. our model is obviously a simplification of the complex reality of pandemic ' flu transmission in great britain ; however, our model is sufficiently detailed to highlight the role that household structure can play and the implications of geographic heterogeneities recorded in the 2001 census. the simplifying assumptions that we believe to be most relevant when considering extensions to our work are as follows. first, we assume a compartmental paradigm where individuals are either susceptible, infectious or recovered. in reality, pathogen levels and infectiousness vary during the course of infection and also between individuals. second, we have assumed that the strength of contacts between individuals within a household and between members of the general population are independent of household size. finally, we have ignored other geographic diversities in assuming that the general rate of transmission in the population is the same across great britain, when in fact it is likely to be higher in areas with higher population density, bigger workplaces and busier transport links, which will probably inflate the variation already observed. bearing these limitations in mind, we believe that modelling offers a good tool for understanding socio - demographic patterns and their epidemiological consequences. in particular, our work on household structure offers the robust conclusion that vaccination of children is expected to be an effective approach to control of emergent infectious diseases, since it targets vaccine towards both wards and households with the greatest transmission risk. furthermore, vaccinating children is likely to be socially acceptable and although not sufficient to prevent an epidemic may help to support other control measures such as social distancing, antimicrobial drugs or quarantine. finally, we believe that insights from our work can be useful in evaluation and planning of schemes for control of diseases with existing childhood vaccination schemes (such as measles) where the geographic diversity in epidemiologically relevant quantities that we have considered here may prove important for prioritization of efforts to maintain and increase uptake of vaccine. in this context it is interesting to note that the numbers of gp surgeries and statistical wards in the uk is approximately equal, leading to equivalent levels of geographic diversity. | summaryone of the central tenets of modern infectious disease epidemiology is that an understanding of heterogeneities, both in host demography and transmission, allows control to be efficiently optimized. due to the strong interactions present, households are one of the most important heterogeneities to consider, both in terms of predicting epidemic severity and as a target for intervention. we consider these effects in the context of pandemic influenza in great britain, and find that there is significant local (ward - level) variation in the basic reproductive ratio, with some regions predicted to suffer 50% faster growth rate of infection than the mean. childhood vaccination was shown to be highly effective at controlling an epidemic, generally outperforming random vaccination and substantially reducing the variation between regions ; only nine out of over 10 000 wards did not obey this rule and these can be identified as demographically atypical regions. since these benefits of childhood vaccination are a product of correlations between household size and number of dependent children in the household, our results are qualitatively robust for a variety of disease scenarios. |
artificial vaginas are designed to imitate the female sex organ and to achieve this, they are made out of a soft material, lubricated, and sometimes heated. further, the artificial vaginas are made for medical research purposes, animal breeding, or as a sex toy for erotic stimulation. the internal artificial vagina (iav) usually permits semen sampling, as well as mating ability evaluation among animals. iavs of male - to - female transsexuals ' are constructed by penile skin invagination. in females with vaginal agenesis an artificial vagina for the purposes of human sexual stimulation is essentially an aid to human masturbation, and it is designed to simulate the sensation of sexual intercourse. it will often have moving parts such as vibrators that increase stimulation. in this instance, a middle - aged male was found dead in his bathroom with an artificial vagina in situ. wife of the deceased heard that her 46-year - old husband was shouting in the bathroom around 6 pm. the door of the bathroom was forced open and the deceased was found lying unconscious. he had been brought to a tertiary care hospital of sri lanka within half an hour, but was pronounced dead on admission. he was a carpenter by profession and had no history of any significant illness including diabetes mellitus, epilepsy, or on long - term treatment, but was a chronic smoker. after removing the sarong, it was evident that the penis was inside an artificial sex toy, an in situ artificial vagina [figures 1 and 2 ]. on inspection of the artificial vagina, evidence of ejaculation was not apparent, and the laboratory report for seminal or sperms was negative. there was no history of previous similar practices, and the wife was not aware about this apparatus. in situ artificial vagina the artificial vagina complicated atheromatous plaques were found mainly in the infrarenal part of the aorta. the heart was 350 g in weight, and the lumen of the left anterior descending artery was pinpoint [figure 3 ], the right coronary and left circumflex branches showed more than 75% narrowing. the left ventricle was hypertrophied, and fibrotic areas were found in the anterior, lateral, and posterior walls. the lumen of the anterior descending artery was pinpoint the cause of death was ischemic heart disease due to coronary artery atherosclerosis. (a) no evidence of violence, (b) toxicology tests were negative, (c) histopathology re - confirmed the cause of death, and (d) ischemic heart disease could have been precipitated due to indulging abnormal sexual activity using an artificial vagina. usually, the artificial vagina for human sexual stimulation has a realistic or close to realistic appearance with a sleeve, where the penis can be inserted. however, in this case, such sleeve was not found and did not simulate the real appearance of female vulva. ischemic heart disease is the most common cause of sudden death, and the coronary atheroma is the most common contributor. pin - hole lumen was due to concentric narrowing of the coronary arteries due to atheroma. the left ventricular hypertrophy could have been due to a condition such as hypertension that may have been left unknown due to masking by another nonsignificant illness, ignorance, misinterpretation, or rationalization. in the presence of fibrotic areas with all the three coronaries that were narrow, the autopsy findings were compatible with the cause of death ; ischemic heart disease due to coronary artery atheroma. ischemic heart disease precipitates due to relative ischemia and due to transient risk factors such as exertion, psychological stress, heavy meal, and sexual activities. in this circumstance, the presence of an in situ artificial vagina suggests that the deceased would have been practicing an abnormal sexual activity, and it could have caused relative ischemia and the death of this person. since this special device was left hidden under the sarong, it had not been removed by the relatives before the admission. had it been removed before admission, this circumstance could not be ascertained. this is the first reported case in the forensic literature of a man being pronounced dead with an artificial vagina in situ. removal of such devices before admission to hospitals could be the reason why such incidents do not come to light. | artificial vaginas are designed to imitate the female sex organ. this is the first reported case in the forensic literature of a man being pronounced dead with an artificial vagina in situ. a middle - aged man was found unconscious in a bathroom when the door was forced open and was pronounced dead on admission. autopsy revealed that the penis was inside an artificial vagina. there were no injuries, but there were left ventricular hypertrophy, myocardial fibrosis, and narrow coronaries. the cause of death was ascertained as ischemic heart disease due to coronary atherosclerosis and the comments included were no evidence of violence, and ischemic heart disease could have been precipitated due to abnormal sexual activity. if removal of artificial vagina was done before the admission, this circumstance could not have ascertained. removal of such devices before admission to hospitals could be the reason why such incidents do not come to light. |
internal resorption (ir) is a pathologic intra - radicular process that rarely involves permanent teeth during which transforming pulp cells resorb dentinal walls. the exact cause of ir is unknown ; however, chronic inflammation of coronal pulp tissues and loss of predentin following traumatic injuries have been stated as the major reasons for starting ir. radiographically, ir illustrates a uniform radiolucent lesion inside the root canal space that disturbs root canal natural outline and its relation with the root canal space would not displace following obtaining radiographic images with different angulations.[13 ] most authors suggested immediate treatment of ir following diagnosis to stop more dentine destruction and prevent perforation of the root canal wall. the treatment of ir is to remove vital tissues from the root canal space to prevent further resorption of dentine. the strategy for treatment of non - perforating ir is mainly based on using naocl irrigation for dissolving vital tissues that culprit for the ir and dressing the root canal space with calcium hydroxide (ch) between the appointments for dissolving and removing the rest of the pulp tissues. mineral trioxide aggregate (mta) has been widely used as root - end filling material, pulp capping agent and perforation repair material. several case reports have used mta for nonsurgical and surgical treatment of internal resorption with perforations in primary and permanent teeth.[712 ] however, none of those case reports represented surgical intervention for treating internal resorption with unfavorable crown - to - root ratio. this report presents a case with a history of trauma and root perforation due to extensive internal resorption and very poor prognosis because of unfavorable crown - to - root ratio that successfully treated by a surgical intervention. a 22 year old female was admitted to the postgraduate endodontic clinic for treating her right maxillary central incisor (tooth no. 8). she had no remarkable medical history and her chief complaint was tooth mobility and yellowish discoloration in addition to the presence of a sinus tract above the tooth no.8 [figure 1a ]. patient 's past dental history illustrated that she had a complicated crown fracture 15 years ago which was treated by a general practitioner. radiographic examination showed an extensive internal resorption defect and several swimming gutta - percha cones inside the root canal space [figure 1b ]. the results of sensibility tests (heat test, cold test, and electric pulp tester) were normal for all maxillary anterior teeth except for the tooth no.8 that was not responded to the tests. during dental examination grade ii mobility and probing depth of 6 mm at the buccal aspect of the tooth as well as patient tenderness in percussion and palpation had been noticed. based on radiographic size of the resorption and pocket depth the prognosis was considered very poor to hopeless. other treatment options such as replacement of the tooth with a single tooth implant or fixed prosthetic restoration was recommended to the patient ; however, she refused to accept those treatment options and insisted in retaining her tooth despite extremely poor prognosis. therefore, after administrating 2% lidocaine with 1/80000 epinephrine (darupakhsh, tehran, iran) as anesthetic solution, rubber dam was placed and a standard access cavity was prepared. the gutta - percha cones were removed and the root canal was instrumented and irrigated. severe bleeding was encountered during gutta - perch removal ; therefore, the root canal was dressed with a thick ch paste (golchai, tehran, iran) for two weeks. at the second visit the patient was instructed to use 0.2% chlorhexidin mouth wash from 48 h before surgical intervention. a rectangular full mucoperiosteal flap was prepared. after raising the flap we have encountered no bone at the buccal aspect of the right maxillary incisor and the apical part of the root had no attachment to the rest of the tooth structure due to extensive internal resorption. therefore, the apical part was removed [figure 1c ] and the coronal part of the tooth was filled with gray mta (proroot mta, maillifere, dentsply, balligues, switzerland) as root canal filling material through the access cavity [figure 1d ]. the coronal level of root filling was up to the cervical part of the tooth and a moist cotton pellet was placed over mta before placing temporary restoration. bone auto graft which was prepared from the wall of apical part of the tooth no.8 was used for periodontal regenerative process and placed over the buccal aspect of the root before suturing. then the flap was sutured (4/0 silk sutures, gc, tehran, iran) and the anterior teeth were splinted by wire composite resin for 2 weeks. patient was prepared with conventional postsurgical instructions in addition to use soft diet during next couple of days after surgery. after 5 days the sutures were removed and the access cavity was restored with compost resin. fourteen months later patient was completely symptom free with normal mobility as well as 2 - 3 mm gingival pocket depth at all aspects of the tooth and radiographic image showed favorable healing [figures 2a and 2b ]. two years after surgical intervention, the esthetic was improved by providing a new composite resin restoration [figure 2c ]. three years after treatment the patient has been still enjoying normal mobility [figure 2d ]. (a and b) photographic and radiographic view of tooth no.8 showed discoloration and extensive internal resorption and several swimming gutta - percha cones inside the root canal. (d) radiographic image of root canal obturation with mineral trioxide aggregate (a) periapical radiograph 14 months following surgery. (c) esthetic of the tooth no. 8 was improved by restorative procedure. this case report illustrates a successful treatment of root perforation due to extensive internal resorption by surgical intervention and use of mta as root filling material. several case reports have been published that represented successful surgical and nonsurgical treatment of internal resorption with mta.[712 ] ideally, nonsurgical treatment of perforating resorption is always advocated ; however, in the present case, the authors encountered persistent bleeding which was not controlled with irrigation and ch dressing between the appointments. surgical intervention revealed that separation of the apical part of the root from the coronal part made it impossible to overcome the bleeding even if more appointments had been scheduled. there was very difficult to be sure about the separation of apical part of the root with routine radiographic imaging. for this reason, we suggest that during treatment of extensive ir when persistent bleeding was encountered, that is not controlled with irrigation and ch dressing, the possibility of root separation should be considered. cone beam computed tomography has been suggested as reasonable equipment for 3 dimensions tooth structure evaluation particularly detecting pathologic changes in root structure whenever perforating internal resorption has been encountered by a clinician. in a case series study, caliskan and turkun have reported 3 out of 28 cases needed surgical intervention for treating internal resorption cases that did not respond to nonsurgical treatment. it has been generally accepted that mta has osteo - inductive and osteo - conductive ability. patel, in their review of literature recommended mta as the material of choice for treating internal resorption in case of root perforation due to the pathologic process. in the present case, mta was used as root canal filling material when we encountered the separation of apical part of the tooth from the coronal part during the surgery. caliskan and turkun have believed that the presence of a periodontal pocket even if it could not be probed is the reason for the failure. in the present case, bone loss at the buccal aspect of the root and separation of root apical part can be considered as the causes of unsuccessful nonsurgical attempt for overcoming bleeding. crown - to - root ratio has been considered as one of the most important factors for long term survival when a tooth with compromising prognosis should be treated. a recent review on crown - to - root ratio from prosthodontic point of view has emphasized that decision on keeping a tooth or removing it should be made case by case. in the present case, despite unfavorable crown - to - root ratio, patient enjoyed normal mobility, pocket depth, and reasonable esthetic up to 3 years after surgery. absence of traumatic occlusion and immediate splinting following surgery help patient to have successful treatment. absence of buccal cortical bone has been shown as one of the signs that may occur by a primary endodontic lesion. in the present case, perforating internal resorption can be assumed as the cause of bone loss at the buccal aspect of the root. therefore, providing bone auto graft during surgery as well as sealing the root canal with mta and removing apical part of the root may be considered as the reasons for enjoying successful treatment. the importance of short and long time follow - up in teeth with a history of trauma has been emphasized for preventing unfavorable results. in the present case, inadequate previous treatment and remaining inflamed tissue inside the root canal space could be considered as the cause of perforating internal resorption. the presented case illustrates a successful surgical treatment of a perforating internal resorption that remained asymptomatic for 3 years following treatment. patient is very satisfied with the results of the treatment keeping her own tooth despite poor prognosis at the early evaluation. | internal resorption is a rare lesion in permanent teeth. managing perforating internal resorption is a great challenge for dentists. this report presents a successful surgical treatment of a maxillary central incisor that had extensive root perforation due to internal resorption. after unsuccessful nonsurgical approach, during surgical intervention apical part of the resorption defect was removed and the coronal part was filled with mineral trioxide aggregate. three years later the tooth was symptom free with normal mobility and pocket depth despite unfavorable crown - to - root ratio. this case report have shown that surgical intervention and using mineral trioxide aggregate as root canal filling material in a tooth with extensive internal resorption and unfavorable crown - to - root ratio can be considered as a treatment option. |
chronic pain syndromes associated with degenerative diseases of the lumbar spine remain a problem because of the high prevalence of these morbid conditions ; pain syndromes without nerve root compression form the majority of cases.13 it has been reported that target - specific minimally invasive interventions can cause problems due to difficulties in detecting the main source of pain, but are, nevertheless, essential to achieve at least satisfactory results.47 the classification of pain syndromes, based on the prevalence of axial or leg pain, can complicate the diagnostic process because pseudoradicular complaints could be a component of noncompressive pain syndromes.713 it is evident that diagnostic interventions should be applied in order to validate the pain source ; however, it has been reported that discography could have a significant frequency of false positive results.1416 diagnostic facet joint blocks is a subjective method because of the necessity of using the visual analog scale (vas) to assess the results.6 furthermore, various authors use different criteria to validate it.1719 nucleoplasty and radiofrequency facet joint denervation have been reported to be an effective treatment option in cases of noncompressive discogenic pain and facet joint pain, respectively, in both short- and long - term results.1825 in the majority of studies, different pain syndromes have been studied separately with emphasis on the efficiency of the particular treatment modality ; however, a particular diagnostic strategy could also influence the frequency of clinically significant results. furthermore, the reported low frequency of clinically significant results in some studies could reflect the disadvantages of the applied diagnostic algorithm and could be partly relevant to the intervention used. studying the possible effects of various diagnostic strategies and the relative contribution of various structures could be beneficial in order to determine the optimal diagnostic strategy in treating patients with noncompressive pain syndromes. this study was a prospective, nonrandomized cohort study of 83 patients presenting with a noncompressive pain caused by degenerative processes of the lumbar spine. the participants underwent surgical interventions during the period of march 2009 to october 2010 ; 25 patients were treated with nucleoplasty and 62 with radiofrequency denervation of facet joints. the results of nucleoplasty were analyzed in 25 participants (100%) and the results of radiofrequency denervation of facet joints in 58 cases (93.5%). according to the results of diagnostic procedures and minimally invasive interventions, a conclusion was made in regard to the contribution of various structures in pain syndromes associated with the degenerative processes. also, the impact of the diagnostic strategy on the results of the minimally invasive procedures used was studied. patients that presented with pain syndromes caused by degenerative processes in the lumbar spine (lumbalgia, lumbosciatalgia) were selected for this study using the following selection criteria : no evidence of nerve root compression according to the results of physical examination and neuroimaging ; patients resistant to at least 1 month of a conservative therapy (including different types of blocks with corticosteroids) ; pain intensity of no less than 40 on the 100-point vas and no less than 40 on the oswestry disability index (odi). the potential benefits, risks, advantages, and disadvantages were explained, and written informed consent was received from all participants (concerning the applied type of surgery and participation in the study). the exclusion criteria were : uncontrolled psychological disorders ; evidence of nerve root compression ; evidence of spinal stenosis, infection, and tumors ; spinal surgery in anamnesis (any type). before the interventions initially all of them presented with a noncompressive pain pattern ; in all cases, they were negative in regard to nerve root tension symptoms and neurological deficit.26 all participants were examined preoperatively using the vas (scale of 0100 was applied) and odi questionnaire version 1.2729 all patients underwent magnetic resonance imaging tomography (1,5 t siemens magnetom symphony, siemens ag healthcare sector, erlangen, germany). computer myelography was applied in case of pseudoradicular pain pattern in addition to magnetic resonance imaging to exclude nerve root compression. discography was utilized to reproduce pain in cases when discogenic origin of pain was suspected. the reproduction of pain was classified as concordant, partly concordant, discordant, and negative ; standard technique using lateral extrapedicular approach was applied.30,31 diagnostic facet joint blocks were performed twice in sterile conditions under the guidance of fluoroscopy (general electric oec 9800 plus, van buren charter township, mi, usa) with two different anesthetics of different time action. needles were introduced using standard landmarks for the medial branch location (junction of the upper border of the transverse process base and the lateral border of the upper articular process base). at least two of the adjacent medial branches the nerve supply of the supposed source of pain were blocked on each side. different types of anesthetic were used perform diagnostic blocks (novocaine, lidocaine, bupivacaine). the results were classified as any subjective pain relief, at least 50% pain relief, and at least 80% pain relief during the anesthetic action. sacroiliac joints blocks were applied to determine the reasons for failure after nucleoplasty and radiofrequency facet joint denervation. different types of anesthetic were used to perform diagnostic blocks under the control of fluoroscopy using anesthetics of different time action as described by maigne.32 nucleoplasty was performed by several surgeons in sterile conditions under the guidance of fluoroscopy ; six channels were created within the disc using a radiofrequency wand (arthrocare system controller 2000, arthrocare corporation, austin, tx, usa), applying an ablation and coagulation mode. the surgical technique was standard without acceptance of any variances, as described elsewhere.21,22,33 radiofrequency facet joint denervation was performed by several surgeons in sterile conditions under the guidance of fluoroscopy. thermal lesions of medial branches were performed using 22 g radiofrequency probes with a 5 mm active tip (rf lesion generator system rfg-3c plus, integra radionics inc, burlington, ma, usa). the medial branch lesion was performed on at least two adjacent levels, proven to be the nerve supply of pain source. after the radiofrequency lesioning of medial branches was performed at temperature 80c for 60 seconds. the conventional technique of radiofrequency facet joint denervation has been previously described.18,34 participants were examined after 1 month, 3 months, 6 months, 12 months, and 18 months. no less than 50% pain intensity relief applying the vas and at least a 40% decrease in the odi score were considered to be clinically significant.35,36 the 6-month period was the cutoff between long - term and short - term results for facet joint denervation and 12 months for the nucleoplasty cases.6 facet joint diagnostic blocks and sacroiliac joint blocks were applied postoperatively to determine the reasons for failure after the minimally invasive procedures. fisher s exact test was used for dichotomized data sets ; if a statistically significant difference was established, the logistic regression analysis was applied (quasi - newton algorithm). for continuous data sets, the normality test (shapiro wilk test), wilcoxon test, kruskal statistical power was calculated twice (planning the study and a posteriori) using the monte carlo method (2000 simulations). smirnov, and pearson s chi - squared goodness of fit tests were applied for the distribution fitting of the data sets (required for the statistical power calculation using the monte carlo method). patients that presented with pain syndromes caused by degenerative processes in the lumbar spine (lumbalgia, lumbosciatalgia) were selected for this study using the following selection criteria : no evidence of nerve root compression according to the results of physical examination and neuroimaging ; patients resistant to at least 1 month of a conservative therapy (including different types of blocks with corticosteroids) ; pain intensity of no less than 40 on the 100-point vas and no less than 40 on the oswestry disability index (odi). the potential benefits, risks, advantages, and disadvantages were explained, and written informed consent was received from all participants (concerning the applied type of surgery and participation in the study). the exclusion criteria were : uncontrolled psychological disorders ; evidence of nerve root compression ; evidence of spinal stenosis, infection, and tumors ; spinal surgery in anamnesis (any type). initially all of them presented with a noncompressive pain pattern ; in all cases, they were negative in regard to nerve root tension symptoms and neurological deficit.26 all participants were examined preoperatively using the vas (scale of 0100 was applied) and odi questionnaire version 1.2729 all patients underwent magnetic resonance imaging tomography (1,5 t siemens magnetom symphony, siemens ag healthcare sector, erlangen, germany). computer myelography was applied in case of pseudoradicular pain pattern in addition to magnetic resonance imaging to exclude nerve root compression. discography was utilized to reproduce pain in cases when discogenic origin of pain was suspected. the reproduction of pain was classified as concordant, partly concordant, discordant, and negative ; standard technique using lateral extrapedicular approach was applied.30,31 diagnostic facet joint blocks were performed twice in sterile conditions under the guidance of fluoroscopy (general electric oec 9800 plus, van buren charter township, mi, usa) with two different anesthetics of different time action. needles were introduced using standard landmarks for the medial branch location (junction of the upper border of the transverse process base and the lateral border of the upper articular process base). at least two of the adjacent medial branches the nerve supply of the supposed source of pain were blocked on each side. different types of anesthetic were used perform diagnostic blocks (novocaine, lidocaine, bupivacaine). the results were classified as any subjective pain relief, at least 50% pain relief, and at least 80% pain relief during the anesthetic action. sacroiliac joints blocks were applied to determine the reasons for failure after nucleoplasty and radiofrequency facet joint denervation. different types of anesthetic were used to perform diagnostic blocks under the control of fluoroscopy using anesthetics of different time action as described by maigne.32 nucleoplasty was performed by several surgeons in sterile conditions under the guidance of fluoroscopy ; six channels were created within the disc using a radiofrequency wand (arthrocare system controller 2000, arthrocare corporation, austin, tx, usa), applying an ablation and coagulation mode. the surgical technique was standard without acceptance of any variances, as described elsewhere.21,22,33 radiofrequency facet joint denervation was performed by several surgeons in sterile conditions under the guidance of fluoroscopy. thermal lesions of medial branches were performed using 22 g radiofrequency probes with a 5 mm active tip (rf lesion generator system rfg-3c plus, integra radionics inc, burlington, ma, usa). the medial branch lesion was performed on at least two adjacent levels, proven to be the nerve supply of pain source. after the radiofrequency lesioning of medial branches was performed at temperature 80c for 60 seconds. participants were examined after 1 month, 3 months, 6 months, 12 months, and 18 months. no less than 50% pain intensity relief applying the vas and at least a 40% decrease in the odi score were considered to be clinically significant.35,36 the 6-month period was the cutoff between long - term and short - term results for facet joint denervation and 12 months for the nucleoplasty cases.6 facet joint diagnostic blocks and sacroiliac joint blocks were applied postoperatively to determine the reasons for failure after the minimally invasive procedures. fisher s exact test was used for dichotomized data sets ; if a statistically significant difference was established, the logistic regression analysis was applied (quasi - newton algorithm). for continuous data sets, the normality test (shapiro wilk test), wilcoxon test, kruskal statistical power was calculated twice (planning the study and a posteriori) using the monte carlo method (2000 simulations). the anderson darling, kolmogorov smirnov, and pearson s chi - squared goodness of fit tests were applied for the distribution fitting of the data sets (required for the statistical power calculation using the monte carlo method). prior to treatment, patients presented with noncompressive pain syndromes ; in 52 cases there was a domination of axial pain and 31 patients presented with a pseudoradicular syndrome (a prevalence of leg pain ; however, the symptoms of nerve root tension were negative and no neurological deficit was evaluated). in 22 cases, the clinical findings were similar to those described in manuscripts dedicated to the study of facet joint syndrome presentation.37,38 the decision to perform radiofrequency facet joint denervation was based on : clinical presentation ; evidence of facet joint degeneration from imaging results ; reproduction of pain during pain provocation before radiofrequency lesioning. in 61 cases, the decision to perform discography and diagnostic facet joint blocks was based on : disc height no less than 50% of normal discography was applied ; negative results of discography repeated facet joint blocks were administered ; disk height loss more than 50% repeated facet joint blocks were administered. of the discographies performed, only 25 cases experienced a concordant pain reproduction ; those patients were treated with nucleoplasty. in 36 cases, the results of facet joint blocks were classified as any subjective pain relief, at least 50% pain relief, and 80% pain relief according to the results of vas application. all 36 patients presented with subjective pain relief, but only 26 presented with at least 50% pain relief and eleven presented with 80% pain relief. in all cases of subjective pain relief, radiofrequency facet joint denervation was applied. after nucleoplasty, eleven (44%) patients presented with unsatisfactory results. to find the reasons for nucleoplasty failure, facet joint blocks were applied and nine of the eleven patients experienced at least 80% pain relief during the time of the anesthetic action, thereafter the hyperdiagnostics of discogenic pain was evident. after the nine patients had been excluded, the results of nucleoplasty were reassessed and this procedure turned out to be positive in both the short- and long - term. after nucleoplasty, statistically significant decreases in pain intensity and pain disability were observed (p = 0.0006 and p = 0.0008, respectively). throughout the period of observation, no statistically significant changes were observed in pain intensity and pain disability (p = 0.8817 and p = 0.4813, respectively ; friedman test). in all cases of clinically significant pain relief, it is obvious that in a considerable number of cases the results of provocative discography were false positive. even though the proportion of patients treated with nucleoplasty was low, the negative input of discogenic pain hyperdiagnostics was statistically significant (proportions of clinically significant results were 14/16 versus 14/25 if diagnostic facet blocks were not introduced into the diagnostic algorithm prior to discography ; p = 0.0477). in cases when the decision to apply radiofrequency denervation was based on clinical findings and the results of imaging, the rate of clinically significant results within the first 3 months was only 13 out of 22. within 6 months, it was only twelve out of 22, followed by a further reduction in the number of patients presenting clinically significant results because of medial branch regeneration proven by diagnostic facet joint blocks (table 5). the reasons for failure were sacroiliac joint pain in one case, complex biomechanical impairment of spinal segments that could not be reduced to the pathology of a particular structure in six cases, and undetermined source of pain in two cases. the application of facet joint blocks with making diagnostic criteria gradually stricter was analyzed in a group of 36 patients (table 5). in cases when any subjective pain relief was applied as a diagnostic criterion, the rate of clinically significant results was the same as when there was no application of facet joint blocks. by introducing a restriction (50% pain intensity relief applying vas), it became possible to exclude ten cases with negative results of facet joint denervation. further restrictions (80% pain relief applying vas) resulted in a statistically significant increase in the clinically significant results rate within the first 6 months, but it produced nine false negative results in regard to the prediction of clinically significant results at 1218 months. this effect is statistically significant (zero false negative results if 50% pain relief was applied as the criterion versus nine false negative results if 80% pain relief was applied ; p = 0.0012 for 6-month results). the regeneration of medial branches within the 612-month period of observation neglected the estimated differences (the regeneration of medial branches was confirmed by the results of facet joint blocks). the reasons for unsatisfactory results were studied in a group of patients treated with radiofrequency facet joint denervation after application of diagnostic blocks. the sacroiliac joints were the dominant pain source in five cases, the biomechanical impairment of spinal segments in eight cases, and the source of pain was not able to be detected in three cases. it should be mentioned that nine patients out of 20 with clinically significant results of facet joint radiofrequency denervation initially presented with a pseudoradicular syndrome (domination of leg pain with lateralization). according to the results, the overall effect of facet joint blocks being introduced into a diagnostic algorithm with the criterion of 50% pain relief in all cases of noncompressive pain syndromes increased the efficacy of minimally invasive treatment by diminishing the hyperdiagnostics of discogenic pain and the number of cases in which the cause of pain syndrome could be simplified down to the pathology of facet joints only (the rate of clinically significant results was 55.3% [95% confidence interval 41.1%69.5% ] if facet joints blocks were not applied versus 84% [95% confidence interval 74.3%94.2% ] if applied in all cases of noncompressive pain syndromes ; p = 0.0037, fisher s exact test). according to the results of this study, the facet joint was detected as the main source of pain in 50.6% of cases (95% confidence interval 44.1%66.3%) ; discogenic pain in 16.9% of cases (95% confidence interval 9.5%26.7%), and sacroiliac joint pain in 7.2% cases (95% confidence interval 2.7%15.0%). it has been reported that the evaluation of the main pain source in cases of spine degenerative diseases could be associated with certain difficulties. because of the same segmental innervation, the patterns of pain originating from different structures could bear some resemblance.3945 furthermore, every movement of the lumbar spine involves all vertebral segments, therefore clinical provocative tests without application of diagnostic interventions can hardly determine the cause of pain syndrome.17,4648 in the current study, it was determined that cases of discogenic pain and facet joint pain could present with a pseudoradicular syndrome that can be misleading in the attempt to evaluate discogenic pain. the significant rate of false positive pain provocations when applying discography could result in a considerable number of diagnostic mistakes and affect the success rate of nucleoplasty. the interference of these errors must be taken into consideration when studying the results of intradiscal interventions in order to make a valid conclusion in regard to the efficacy of the particular intervention used. the results of the current study show that nucleoplasty is effective in cases of noncompressive discogenic pain ; however, false positive results of discography could have a negative effect on the results of nucleoplasty. apparently, because of the attempt to apply a diagnostic algorithm with an emphasis on diagnosing discogenic pain in cases of pseudoradicular pain presentation and because of false positive results of discography, the hyperdiagnostics of discogenic pain could be one of the frequent diagnostic mistakes. diagnostic facet joint blocks proved to be the only method that provided a valid conclusion on pain origin ; nevertheless, the information concerning the optimal criteria remains controversial. although 80% of pain relief after facet joint blocks is recommended as the criterion of facet joint pain diagnosis, some authors apply the criterion of 50% or 70% pain relief.4,6,1719,49 using any pain relief as a criterion of facet joint pain without vas application, no statistically significant increase in the rate of clinically significant results was achieved. according to the current results, if an 80% criterion was applied, a statistically significant increase in the rate of clinically significant results could be achieved, compared with that estimated in the group without facet block application ; however, the loss of sensitivity could be another potential effect of this specificity increase. by applying a 50% pain relief criterion, it became possible to predict the failure of facet joint denervation in ten cases. in addition, no false negative results using this criterion were observed. by making the criterion stricter (80% pain relief), a maximal exclusion of false positive results of diagnostic blocks was achieved, although a considerable number of false negative results was observed in predicting the result of facet joint denervation. it is questionable whether such a tactic is rational in daily practice because the procedure of radiofrequency facet joint denervation was proven to be safe and capable in providing short- and long - term pain relief in cases of pain caused by facet joint degeneration.36,50 false negative results could necessitate the application of more aggressive modalities or the elongation of treatment ; however, fast recovery could have been achieved with minimally invasive treatment. in other words, false negative results of various diagnostic tools could result in a considerable negative social impact. analysis of the main causes of noncompressive pain syndromes reports similar results to previous reports and illustrates that facet joints are the most frequent source of chronic pain syndrome associated with degenerative processes of the lumbar spine.4,51 in terms of this specificity, it is rational to adjust the diagnostic strategy to the probability of detecting a particular pain source. another reason to start off with diagnostic blocks of facet joints in questionable and uncertain situations is that diagnostic and therapeutic procedures in those cases are rarely associated with complications, whereas discography and nucleoplasty could cause spondylodiscitis and it is still debatable whether those procedures could cause further degeneration of the disc.5256 there are some limitations to this study. its fusion of a population study, efficacy of diagnostic measures, and assessment of interventions could be considered a weak point ; however, this design could be beneficial in disclosing the additional significant effects that could be important in daily practice. it is rational to adjust the diagnostic algorithm to the probability of detecting a particular pain source and, in doing so, reduce the number of invasive diagnostic measures to evaluate a pain source. false positive results of diagnostic measures can negatively affect the overall efficacy of a particular technology ; therefore, all reasons for the failure should be studied in order to provide an unbiased conclusion. in choosing diagnostic criteria, not only should the success rate of a particular technology be taken into consideration but also the rate of false negative results. | purposeto study the possible effects of various diagnostic strategies and the relative contribution of various structures in order to determine the optimal diagnostic strategy in treating patients with noncompressive pain syndromes.study designprospective, nonrandomized cohort study of 83 consecutive patients with noncompressive pain syndromes resistant to repeated courses of conservative treatment. the follow - up period was 18 months.resultsnucleoplasty was effective in cases of discogenic pain ; the consequences related to false positive results of the discography were significant. the most specific criterion was 80% pain relief after facet joint blocks, whereas 50% pain relief and any subjective pain relief were not associated with a significant increase in the success rate. a considerable rate of false negative results was associated with 80% pain relief, whereas 50% pain relief after facet joint blocks showed the optimal ratio of sensitivity and specificity. facet joint pain was detected in 50.6% of cases (95% confidence interval 44.1%66.3%), discogenic pain in 16.9% cases (95% confidence interval 9.5%26.7%), and sacroiliac joint pain in 7.2% cases (95% confidence interval 2.7%15%). it was impossible to differentiate the main source of pain in 25.3% of cases.conclusionit is rational to adjust the diagnostic algorithm to the probability of detecting a particular pain source and, in doing so, reduce the number of invasive diagnostic measures to evaluate a pain source. false positive results of diagnostic measures can negatively affect the overall efficacy of a particular technology ; therefore, all reasons for the failure should be studied in order to reach an unbiased conclusion. in choosing diagnostic criteria, not only should the success rate of a particular technology be taken into consideration but also the rate of false negative results. acceptable diagnostic criteria should be based on a rational balance of sensitivity and specificity. |
clostridium difficile is a gram - positive spore - forming anaerobic bacillus that is the major cause of antibiotic - associated diarrhea, accounting for 1525% cases of nosocomial antibiotic - associated diarrhea.1 given the presentation of c. difficile infection (cdi), loose stools are usually sought for diagnosis and are thought to harbor higher bacterial loads of the pathogen than semiformed or formed stools. bristol stool scale was developed by lewis and heaton in order to establish a clinical tool to monitor changes in intestinal function (fig. 1).2 the scale was significantly correlated with this parameter in terms of stool form and defecatory frequency. the european society of clinical microbiology and infectious diseases in its latest guidelines on cdi diagnosis and treatment include bristol stool scale in the definition of diarrhea associated with this infection.3 the scale is also included as a tool for the assessment of cdi severity in the guidance on the management and treatment of cdi published by public health england.4 a study by caroff examined the positivity of c. difficile diagnostic assays, enzyme immunoassays (eias) for glutamate dehydrogenase, and toxin a / b followed by a nucleic acid amplification test (naat), in correlation with the bristol stool scale. they demonstrated that a correlation between bristol stool scale and results of c. difficile assays was lacking with the organism being recovered more frequently from semiformed stools (bristol scores of 5 or 6) than from liquid stools (bristol score of 7) with naat. the authors questioned whether the low fecal load of the organism or its toxin concentration in semiformed stools may have been associated with false - negative results obtained with eia. therefore, we aimed to address this issue through assessing the correlation between bristol stool scale and the quantitative fecal load of c. difficile in order to elucidate whether low bacterial loads, particularly toxin - producing vegetative cells, may be associated with false - negative results of eia testing for c. difficile toxin as well as whether semiformed stools carry sufficient amounts of the organism to be sought for cdi diagnosis. a secondary objective of the study was to assess the correlation of stool frequency with fecal c. difficile spores and vegetative cells to find out whether the presence of correlation may support the finding of the primary objective. this is a descriptive observational study where we used data from a randomized, open - label study that we conducted to compare the effect of fidaxomicin versus oral vancomycin on c. difficile bacterial load of both spores and vegetative cells.6 the study protocol was approved by the hartford hospital institutional review board, and all patients provided written, informed consent prior to entry into the trial. in this study, three stool samples were collected from enrolled patients who tested positive for c. difficile by naat. samples were collected at baseline (before initiation of intervention), at a midpoint during the therapeutic course (days 35) and at the end of the therapeutic course (days 1013). samples were cultured, depending on availability, on either chromid c. difficile plates (biomrieux sa)or cycloserine - cefoxitin - fructose agar (ccfa) plates (bd) since no difference in c. difficile recovery and quantitative colony counts was reported between the two types of media.7 chromid and ccfa plates were incubated under anaerobic conditions in bd gaspak anaerobic chambers (bd) at 37c for 24 and 48 hours, respectively. each sample was plated twice, once without treatment and once after treatment with ethanol in order to kill vegetative cells and keep spores. thus, untreated plates contained colonies (colony forming unit, cfu) that represent both spores and vegetative cells, while ethanol - treated plates contained spores only. vegetative cells cfus were counted by subtracting the number of spores cfus in the ethanol - treated plate from the total number of cfus in the untreated plate. log10 cfu / g of stool for both spores and vegetative cells was then calculated and plotted. the lower limit of quantification of the culturing assay is 40 cfu / g stool. stool frequency was determined based on a number of bowel movements over the last 24 hours prior to each sample collection. wilk test for normality, spearman correlation coefficient (rs) was calculated to measure the strength of the relationship between bristol stool scale and the bacterial load of c. difficile in stool at each of the three time points. the same test was used to evaluate the correlation of stool frequency with c. difficile fecal counts. a p value of 0.05 was considered significant, and hence, a correlation between the two variables was deemed existent. a total of 83 stool samples were collected from 30 patients at the three sampling points over 24 months : 28 samples were collected at baseline, 30 samples at the midpoint of therapy, and 25 samples at the end of therapy. reasons for the decline in the number of samples from the midpoint of therapy going forward were either loss to follow - up or treatment failure and subsequent exclusion from the study. an additional sample from a patient who failed therapy was collected at the day of attrition, which was within the midpoint window. in the case of another cdi patient, a baseline sample failed to be delivered to our laboratory ; however, samples at subsequent sampling points were collected and analyzed. the mean age of patients was 67.3 15.3 years ; 20 (66.6%) of them acquired their infection from the community and only 7 (23.3%) of the infections were because of the north american pulsed - field gel electrophoresis type 1 (nap1) strain of c. difficile (identified by ribotyping and commonly designated nap1/bi/027), which is known to be more virulent and associated with more severe diseases than other strains of the organism.1 figure 2 shows scatter plots of log10 cfu / g of stool for spores and vegetative cells at the three sampling points. bristol stool scale and log10 cfu / g of stool for c. difficile spores and vegetative cells showed rs values of 0.14 and 0.05 (p = 0.53 and 0.77, respectively), 0.14 and 0.32 (p = 0.52 and 0.08, respectively), and 0.25 and 0.26 (p = 0.25 and 0.22, respectively) at baseline, at the midpoint of therapy, and at the end of therapy, respectively. the non - significant p values of the correlations of baseline samples indicate that a correlation bet ween bristol stool scale and log10 cfu / g of stool for both spores and vegetative cells was lacking at the diagnostic phase of cdi. likewise, no correlation was found between bristol stool scale and quantitative fecal load of c. difficile during and after completion of cdi therapy. stool frequency showed a weak, although statistically significant, correlation with fecal load of c. difficile with rs values of 0.22 (p = 0.04) and 0.24 (p = 0.03) for spores and vegetative cells, respectively, which indicates the presence of higher bacterial cfus with more frequent stools (fig. to our knowledge, this is the first study to examine the correlation between fecal loads of c. difficile with bristol stool scale and stool frequency. in the context of clinical disease, it would appear that the quantitative cfu of c. difficile was sufficiently high to detect the pathogen, irrespective of stool consistency, when diagnosing symptomatic patients presenting with frequent bowel movements. in addition, semiformed and formed stools can also harbor the organism at detectable quantitative levels. both of these findings explain why naat (a test that detects the organism, whether in vegetative or in spore form, rather than the toxin of the organism) was more successful in detecting c. difficile in semiformed stool (bristol scores of 5 or 6) as the organism may have presented in quantitative amounts in the study by caroff.5 moreover, c. difficile detectability by eia may not be associated with the fecal load of the organism, but rather with the concentration of its toxins since eia is a test for c. difficile toxins. therefore, a study examining the correlation between bristol stool scale and the concentration of c. difficile toxins in stool may further aid answering the lower detectability of c. difficile by eia in semiformed stools. | decision to test for clostridium difficile infection (cdi) is usually made when patients have loose stools with bristol stool score of 5. we aimed to assess the relationship between bacterial load of c. difficile and bristol stool scale, as well as stool frequency in stool samples collected from patients infected with the organism. samples were collected at baseline, during therapy, and at the end of therapy. spearman correlation test was used to evaluate these relationships. no correlation between bristol stool scale and fecal load of c. difficile was found for both spores and vegetative cells at all time points as counts were persistently high (p = non - significant). weak positive correlations were found between stool frequency and fecal load of c. difficile spores and vegetative cells (rs = 0.22 and 0.24, p = 0.04 and 0.03, respectively). these findings indicate that quantitative colony counts were sufficiently high to detect c. difficile, irrespective of stool consistency, and suggest that semiformed stool should be sought for the pathogen in symptomatic patients with frequent stools. |
aloe vera is one of the endemic plants in southern iran, which has been mentioned in the textbooks of persian medicine since 2500 years ago. the aim of this study was to compare the effectiveness and cost of aloe vera gel with conventional treatments in patients with chronic ulcers. this comparative study was conducted on 60 patients with chronic ulcers (more than 3 weeks) in al - zahra hospital (isfahan, iran) in 2015. the participants were divided into two groups of 30 patients per group. in one group, we used conventional treatment plus aloe vera gel and in the other group, only the conventional treatment was used. in the aloe vera group, the patients were followed - up a week after the treatment and then monthly for 3 months. the male : female ratio was 1:1 in each group. the mean age of the aloe vera and control groups were 62.311.2 and 63.19.6, respectively. after three months follow - up, wound healing occurred in 28 (93.3%) patients in the aloe vera group and 14 (46.7%) patients in the control group (p<0.05). the overall mean time of wound healing was 31.2511.2 and 63.220.4 in the aloe vera and control groups, respectively (p<0.05). the mean hospitalization time was 35.26.4 and 67.48.9 in the aloe vera and control groups, respectively (p<0.05). the average cost of aloe vera gel and conventional treatment per patient was $ 2 and $ 10 daily, respectively (p<0.05). aloe vera gel is a beneficial treatment and cost effective for patients with chronic ulcers. the use of aloe vera gel in chronic ulcer is recommended in developing countries to lessen the financial burden. | background : aloe vera is one of the endemic plants in southern iran, which has been mentioned in the textbooks of persian medicine since 2500 years ago. the aim of this study was to compare the effectiveness and cost of aloe vera gel with conventional treatments in patients with chronic ulcers.methods:this comparative study was conducted on 60 patients with chronic ulcers (more than 3 weeks) in al - zahra hospital (isfahan, iran) in 2015. the participants were divided into two groups of 30 patients per group. in one group, we used conventional treatment plus aloe vera gel and in the other group, only the conventional treatment was used. in the aloe vera group, we used aloe vera gel twice a day. the patients were followed - up a week after the treatment and then monthly for 3 months.results:the male : female ratio was 1:1 in each group. the mean age of the aloe vera and control groups were 62.311.2 and 63.19.6, respectively. after three months follow - up, wound healing occurred in 28 (93.3%) patients in the aloe vera group and 14 (46.7%) patients in the control group (p<0.05). the overall mean time of wound healing was 31.2511.2 and 63.220.4 in the aloe vera and control groups, respectively (p<0.05). the mean hospitalization time was 35.26.4 and 67.48.9 in the aloe vera and control groups, respectively (p<0.05). the average cost of aloe vera gel and conventional treatment per patient was $ 2 and $ 10 daily, respectively (p<0.05).conclusion : aloe vera gel is a beneficial treatment and cost effective for patients with chronic ulcers. the use of aloe vera gel in chronic ulcer is recommended in developing countries to lessen the financial burden. |
orofacial pain (ofp) includes pains whose origin is below the orbitomeatal line, above the neck and anterior to the ears and pain within the mouth. it can be a symptom of various disorders, however the majority of ofp is due to dental causes (for example, toothache) and facial trauma, and in most cases it is acute. the remainder is considered chronic ofp, and temporomandibular disorders (tmd) represent one of the most common forms of chronic ofp. tmd is a collective term, for disorders characterized by joint pain, masticatory muscle tenderness, joint noises and restricted jaw movements. the percentage of the population presenting with tmd is estimated at 3 - 4%, however up to a quarter of the population may report the symptoms during the past month. it has been suggested that there is a relationship between the removal of third molars and the postoperative onset of temporomandibular joint pain / dysfunction. as early as 1969, greene. reported that 48% of patients with tmd attributed the onset of their symptoms to a specific event, including prolonged oral surgery procedures. however there is equivocal evidence on a relationship between tmd symptoms and third molars removal : while some studies supported this finding [5 - 8 ], others did not find any association [9 - 11 ]. these studies involved patient populations, university students, health plan enrolees and dental service enrolees. one study involved cases diagnosed in clinic and controls from dental health survey. none of the above studies were conducted in general population, i.e. they were all prone to selection bias as not all people with ofp seek treatment and not everybody enrolled in health and dental plans. the aim of the current study was to investigate whether there was a relationship between a history of third molar removal and the prevalence of orofacial pain in a sample of the general population. the study was a four year follow - up of the population survey conducted by macfarlane.. the original survey included randomly selected participants aged 18 - 65 years registered with a general medical practice in south east cheshire, north west england. random selection ensured that the study population could represent equally all genders, ages, ethnicities and social class. as general practice registers cover more than 99% of the population in england (http://www.statistics.gov.uk) and access to most health service care is through the general medical practitioner, the practice age - sex resister is a convenient frame for a general population survey. ethical approval for the study was granted by south cheshire local research ethics committee. sample size for the baseline survey was calculated using the results of a pilot study using ofp prevalence estimate of 25%. every participant in the main survey who gave permission to be contacted again was included in the follow - up survey (only 3 participants of the baseline survey did not wish to be contacted again). each participant received a postal questionnaire, with follow - up of non - responders by a reminder postcard, questionnaire and, if necessary, a short questionnaire and a telephone call. ofp was defined as present if participants during the past month " had any pain in their face, mouth or jaws that has lasted for one day or longer ". body pain was defined as present if participants during the past month " had any ache or pain in the body which has lasted for one day or longer ". deprivation was measured by the townsend index, an area - based score derived from postcode sectors or wards. participants were also asked if they had their wisdom teeth removed and permission to be contacted again. in addition, participants were asked permission for their dental records to be examined, and in case of positive reply, were asked to indicate the name and address of their dentist. data were extracted in duplicate (both clinical examiners) from 10 records to investigate reliability. one clinical examiner repeated data extraction from 10 dental records twice to investigate reproducibility. the magnitude of association between third molar removal and ofp was described by the relative risk (rr). rr here is a measure of the risk of ofp in one group compared to the risk of ofp in another (reference) group. a relative risk of one means there is no difference between two groups in terms of their risk of ofp. a relative risk of greater than one or of less than one means that being exposed to a factor either increases (relative risk greater than one) or decreases (relative risk less than one) the risk of ofp. the data were analysed using stata 10 for windows (statacorp, lp, usa, 2008) and spss 16.0 for windows (spss inc., chicago, il, usa, 2008) statistical packages. a total of 1680 persons (81% adjusted participation rate after excluding those who were no longer registered with the practice, deceased or who were not able to complete the questionnaire due to illness or disability or expressed a wish at baseline not to be contacted again) participated in the follow - up survey, and the full study questionnaire was completed by 1510 participants. the remainder completed a short version of the questionnaire which did not include question on third molar removal. adjusted participation rate was higher in women (83%) compared to men (77%) (chi - square test p 0.6, p < 0.05) agreement when reliability and reproducibility of information regarding third molars extracted from dental records. the minimum cohen 's kappa value was 0.61, maximum 1.00, median was 0.71, indicating at least substantial agreement, according to classification by landis and koch. to validate the answers in the questionnaire regarding perceived third molar removal, this question was cross tabulated against the extractions recorded by dentists (table 1). of those who reported at least one perceived extraction, 20 (37%) had extractions recorded in dental records, while for those who did not report history of extractions in the questionnaire, this figure was 27 (6%). all four third molars were present in 113 (25%) of participants who did not report extractions. only 9 (3%) of participants who reported that they had third molars removed had all four third molars present. validity of self - reported third molar extractions information was missing for 33 participants. participants who reported third molar extractions in the questionnaire were more likely to report ofp (adjusted relative risk [rr ] 1.29) ; (95% confidence interval [ci ] 1.01 - 1.65) (table 2). when only information from the dental records was used and participants with all four molars present were compared to those with at least one extraction, the rr was 1.50 (95% ci 0.90 - 2.49). however when time since last extraction was investigated, the increase was evident only in relatively recent extractions (rr = 1.91, 95% ci 1.10 - 3.32) for people with third molar extraction less than eight and a half years ago, whilst the number of third molars remaining did not show any particular pattern. relationship between third molar extractions and orofacial pain (ofp) 100 months was a median time since extraction and therefore was chosen as a cut - off point. this population - based epidemiological study has provided evidence that individuals who report third molar extractions are more likely to report ofp. when extraction information was validated using dental records, this association was only found in relatively recent extractions. any dental intervention that alters the occlusion has the potential to alter the position of the mandibular condyle in the mandibular (glenoid) fossa and predispose to tmd symptoms. the incidence of tmd has been shown to rise after 19 years of age. it has been suggested that this could be attributed to occlusal changes as a consequence of teeth exfoliation and eruption of permanent successors, or the eruption of third molars leading to overcrowded dental arches. third molar removal could lead to tmd development as a consequence of the required surgery, which may necessitate wide mouth opening and the application of relatively large forces to the posterior mandible. traumatic arthritis has been reported after third molar removal although the occurrence is rare. tmd patients with a history of trauma or non - temporomandibular joint - related operations have reported higher prevalence, severity and frequency of ofp than controls. it has been postulated that nerve damage in hard and soft tissues can cause sensitisation of both peripheral and central neurons. hypothetically, the increased pain perception following surgical third molar removal could tip the threshold balance toward tmd. there are methodological issues which need to be considered when examining the study results. the study involves a sample of the population of one geographic area in the united kingdom and therefore may not be representative. while the overall participation rate at follow - up was high, non - participants were more likely to be male, younger and from lower socio - economic background. nevertheless, these differences would only affect the comparisons in the present study if the relationship between these factors and presence of ofp were different in those subjects who participated compared with those who did not. questionnaires were posted together with a covering letter from the general medical practitioner informing practice members of the practice participation in the study. non - respondents were followed up by a postcard reminder, a further questionnaire, and, if necessary, a short questionnaire and a telephone call. although there was a statistically significant increase in risk (30%) of ofp associated with self - reported extractions, we did not find a statistically significant association between at least one third molar extraction determined from the dental records and ofp (50% increased risk). firstly, there was less statistical power when information from dental records was analysed, as not all participants who completed the questionnaire had information from dental records. however we have adjusted in the statistical analysis in both cases for other potential risk factors such as other body pain and psychological distress. thirdly, it has been shown that that there was good correspondence between subjective self - reports of well - defined oral health conditions and clinical findings, for example the number of teeth and the presence of dentures. finally, there was a statistically significant increase in risk among participants with more recent extractions, which support the findings of huang and rue, who also found elevated risk in more recent extractions. while the study has achieved high participation rate and acceptable reliability when extracting information from dental records, several problems were encountered. although participants had reported third molar removal in the original questionnaire, it may not be entirely accurate. for approximately half of all cases, third molars were marked as absent in the records but with no record of extraction. it was impossible to determine from the notes whether third molars marked as absent in this way were : 1) congenitally absent ; 2) unerupted ; 3) had been extracted before the origin of the notes. this problem was accentuated in the older age groups, where early dental records were not available. in rare cases it was obvious that after early extraction of first molars, third molars were being recorded. in some cases charting of the tooth could change several times throughout the notes. better recording of dental notes would help resolve some of these problems in primary dental care research. in addition, this study is a cross - sectional survey and therefore the associations we report are not necessarily causal. this research has shown that there is a weak relationship between self - reported history of third molar removal and self - reported orofacial pain, and the depth and detail of evidence is still inconclusive. the authors are grateful to staff and patients of lawton house surgery, dental practice of ar mellor & associates, canal street dental practice, moody terrace dental practice and tdu miller dental practice in congleton, cheshire, united kingdom for their help with the study. d. king, university of manchester, manchester, uk and mrs. c. mackie, manchester dental school, manchester, uk, for help with access to dental records. | abstractobjectivesthe aim of the current study was to investigate whether there was a relationship between a history of third molar removal and the prevalence of orofacial pain in a sample of the general population.material and methodsa survey was conducted in south east cheshire, united kingdom (81% participation rate). information was collected using postal questionnaires (n = 1510) and dental records (n = 809).resultsparticipants who reported third molar extractions were more likely to report orofacial pain (rr = 1.29 ; 95% confidence interval [ci ] 1.01 - 1.65). participants with a more recent history of extractions (< 8 years ago) as recorded in dental records were more likely to report orofacial pain compared to those who had all third molar present (rr = 1.91 ; 95% ci 1.10 - 3.32).conclusionsthis research suggests that self - reported third molar removal is linked to self - reported orofacial pain, however evidence from one study is not sufficient to give an unequivocal answer. |
one of the most important aims of operative dentistry is increasing the long - term prognosis of restorations. indirect techniques and polymerization of composite in a laboratory can decrease gap formation between the restoration and tooth structure. although fabricating indirect restorations without any gap between tooth and restoration is still impossible, use of a thin layer of cement plays an important role in sealing of margins and prevention of micro leakage and reduction of gap formation. polymerization of indirect composite takes place by heat, vacuum, higher amount of light or combination of all ; therefore, physical and mechanical properties are improved which can lead to stronger restoration, better polished surface and more resistance to plaque and stain collection.[35 ] since polymerization takes place in a laboratory completely and homogenously, few numbers of monomers will be available for chemical bond between composite and resin cement which can reduce the bond strength. in order to increase bond strength, we should increase the surface roughness of the restoration so that mechanical retention can improve and more number of free carbon bonds on surface can be made available. there are different methods of creating mechanical and chemical surface treatment of composite and ceramic crowns which include sandblasting, use of silane, etching and laser. laser can be used for soft tissue surgery, pit and fissure sealant, sterilization of root tip, change in enamel and dentin surfaces for improving their resistance against caries and facilitate bond to composite resin, curing of composite, bleaching of teeth, reducing dentin hypersensitivity and for drilling dental hard tissue. the aim of the present study is to evaluate the bond strength of two indirect composites using different surface treatment methods (sandblast, silane, laser beam with three different power energies). in this experimental study, two different types of indirect resin composites (gradia and signum plus) and one type of resin cement (panavia) were used. half of composite blocks were made from gradia and another half were made from signum plus indirect composites. after primary curing using halogen light curing unit, all samples were post cured again inside laboratory light (hager werber) for another 10 min. all samples were polished using 220 - 1200 grit sandpaper under running water to make an even surface. samples were rinsed with water for 20 s, air dried for 10 s, after that 37% phosphoric acid was applied, rinsed and air dried. one layer of silane (from panavia kit) was applied on samples and thin dried after 3 minutes using air spray. group 2 : for this group samples were treated using aluminum oxide particles of 50 with 2 mm distance and 80 psi for 10 s, samples were cleaned in an ultrasonic device for 2 min, air dried and then were treated with silane. group 3 : in this group surface treatment of composite was done using laser beam of 0/5 w and pulse energy of 25 mj and air pressure of 11% without water. surface treatment of this group was done with a mild speed for 3 - 5 s with 1 - 2 mm distance from surface. the laser beam used was er, cr : ysgg with wave length of 2780 nm (biolase company, usa). group 4 : in this group composite surface was treated with 1 w of 50 mj pulse energy. group 5 : in this group laser beam of 2 w with pulse energy of 100 mj was used. the rest of work was similar to group 3. from each group for both composite samples (before bonding the resin cylinders), one sample was selected for sem evaluation so that type and amount of surface changes can be evaluated. for this step we used tygon tube with internal dimension of 0/7 mm and height of 1 mm. the tygon tubes were placed over treated surface of composite blocks and then resin cement (panavia) was mixed according to manufactures instructions and was packed inside tygon tube ; each tube was light cured for 40 s, after 1 h tubes around the resin cylinders were cut off using bp blade and removed from around the resin and samples were kept at 37c temperature for 24 h. for testing the bond strength, we used micro tensile bond strength tester machine and in order to evaluate micro shear bond strength of samples we converted the tester machine. speed of 0/5 mm / min was applied till failure occurred. the results of the study were evaluated using spss statistical analysis software and two - way anova test. for comparison between two groups, tukey 's multiple comparison test was used. for this step we used tygon tube with internal dimension of 0/7 mm and height of 1 mm. the tygon tubes were placed over treated surface of composite blocks and then resin cement (panavia) was mixed according to manufactures instructions and was packed inside tygon tube ; each tube was light cured for 40 s, after 1 h tubes around the resin cylinders were cut off using bp blade and removed from around the resin and samples were kept at 37c temperature for 24 h. for testing the bond strength, we used micro tensile bond strength tester machine and in order to evaluate micro shear bond strength of samples we converted the tester machine. the results of the study were evaluated using spss statistical analysis software and two - way anova test. for comparison between two groups, tukey 's multiple comparison test was used. results of the present study are shown in tables 1 and 2 and graph 1. the highest amount of microshear bond strength was seen in gradia composite with sandblasted surface treatment and in signum plus with laser beam of 1 w. microshear bond strength of samples with same surface treatment of two composites tukey 's multiple comparison test average and mean deviation of microshear bond strength of different groups the least amount of strength belonged to surface treatment with 2 w laser beam for both the composites. two - way anova showed significant differences between two different types of composite in such a way that gradia composite showed higher bond strength than signum plus (p<0). there was no statistically significant differences between sandblasted and lased (1 w) groups for both the composites, but there were statistically significant differences between these 2 groups and group lased with 2 w. composite surface of control group which was polished using sand paper of 220- 1200 grit was even and smooth for both types of composites ; but for sandblasted surface of composite, surface roughness was obvious and even throughout of treated surface and no destruction of composite structure was seen. this even surface roughness had created an increased bond surface by increasing surface roughness, depressions also created on the surface and destruction of composite could also be seen. for lased surfaces, in addition to creating surface roughness and irregularities, deep depressions could also be seen which could be the reason for subsurface destruction and weak bond. recently indirect composite restorations have been widely used in the field of operative dentistry due to their good esthetics. despite many advances in indirect composite resin systems and laboratory polymerization techniques which have caused significant improvement in physical properties of these types of restorations, the reasons for reduced bond strength could be increased degree of conversion and decreased unreacted methacrylate groups available for bond due to secondary polymerization methods like light, high temperature, pressure and electromagnetic methods. one study showed that degree of conversion for light curing was 42 - 45% and after secondary curing in laboratory was 68 %. some studies have shown that composites during laboratory procedure show 25 - 80% decrease in bond strength. surface treatments of composite using chemical or mechanical methods are very essential for indirect composites. start many methods are advised for increasing bond strength like micro abrasion, etching with hydrofluoric acid, increasing surface roughness using sandblast and laser. in the present study, two different types of indirect composite (gradia and signum plus) were used and different surface treatment methods like sandblasting, laser and silane methods were used. silanes are double molecules which cause chemical bonds of silicon dioxides with hydroxyl groups of ceramic surface (si - o - si) and have little ability to copolymerize with organic resin matrix. in many studies, effect of silane on increasing bond strength of ceramic and composite crowns with resin cement has been shown, which facilitates chemical bond to composite surface. according to bailey gh and davidson cl, using silane with silica base is an essential factor for improving chemical bond. silane can increase wettability of surface and create hydrophobic surface, which in turn can improve penetration of cement inside resin and decrease void formation. in second group, sandblasting was used for surface treatment which showed the highest amount of bond strength for both types of composite. research has shown that the type of effected surface treatment for each material depends on the characteristics and composition and particles present in that material. they recommend that etching should be used for all porcelains containing sio2 particles, but composite should not be etched because etching cause destructive changes in resin. they conclude that the best method for all studied composites is sandblasting for 10 s along with silane. many studies have shown that micromechanical retention of internal surface of indirect composites is also essential for better bond strength between composite and resin cement, which is mainly due to loss of resin matrix and exposure of filler particles as a result of increasing effect of bond with resin. different factors should be considered in using air abrasion like pressure, particle size, type and hardness of particles, dimension of particles, tip size, distance from surface, angle of contact of particles with surface, time and speed of flow of particles. in the present study, similar to a study conducted by burnett, we used a micro etcher device and aluminum oxide particles of 50 dimension with a contact angle of 90 for 10 s for the whole surface and 80 psi pressure from a distance of 2 mm from the surface. laser is one of the methods of surface treatment used for improving micromechanical retention and bond strength of resin cement to ceramic. use of er : yag laser has been increasing in the field of dentistry for removing dental caries without damaging the surrounding sound tooth structure. this laser has got fda (food and drug administration) approval in 1997 for dental treatment. he showed that use of one type of laser with specific parameter can have different effects on material. for three groups of the present study, er : cavalcanti showed that lower amount of laser energy caused lesser amount of changes in this type of ceramic and higher amount of energy caused destruction of material and increased carbonization. in the present study, results of sem evaluation showed that exposure of composites to laser beams caused irregularities and surface roughness which do not follow particular pattern. by increasing the laser power, but in gradia composite, increasing the surface roughness and depressions did not necessarily increase bond strength. in sandblasted groups, bond strength was higher than laser group, despite creating more regular and even surface without any under cuts. it can be explained that during sandblasting, removal of resin matrix can facilitate bond between silane and sio2 filler particles, but laser beams along with creating micromechanical retention and deep undercuts could also cause destruction of crystalline and matrix phase and also separation of these two phases from each other. in group 4 of signum composite where 1 w laser beam was used, it showed higher bond strength compared to sandblasted group. it can be explained that absence of sio2 filler particles in this material prevented effect of sandblast technique compared to gradia composite which has got this type of filler. as it has been mentioned before, one of the most important reasons for improving bond strength after sandblasting and using silane in porcelains containing sio2 filler particles is creating si - o - si bond between silane molecules and this filler, the same can be explained with composites with silica filler particles like gradia. bond strength in laser group of 2 w energy for both types of resin composite was very low. the differences between these two groups could be due to physical destruction because of increased temperature and increased destruction of chemical structure and crystals present in composite and decrease ability of molecules to bond with silane and or resin cement. considering the above - mentioned factors affecting bond strength of indirect composites, it is difficult to draw a precise conclusion, unless more studies to be done under different conditions to see best results. sandblasting of gradia composite and lasing signum plus composite with 1 w showed highest bond strength.use of 2 w laser power can decrease bond strength.use of sandblast and laser along with silane for surface treatment can improve bond strength of indirect composites. sandblasting of gradia composite and lasing signum plus composite with 1 w showed highest bond strength. use of sandblast and laser along with silane for surface treatment can improve bond strength of indirect composites. | aim : to determine the effect of surface treatment on micro shear bond strength of two indirect composites.materials and methods : blocks of 2 7 20 mm dimensions were made from two kinds of resin composites, gradia and signum plus. samples were subjected to secondary curing to complete polymerization. they were divided into five groups : control without any preparation, second group sandblasted with aluminum oxide, third, fourth and fifth groups were lased under a beam of 0.5, 1 and 2 w respectively. panavia resin cement was placed on the composite blocks using tygon tubes and cured and micro shear bond strength was measured. one sample of each group was observed under electronic microscope. data was analyzed by two - way anova and tukey 's multiple comparison tests.results:for gradia composite, the sandblasted group showed highest strength (25.72.9 mpa) followed by the laser beam of 1 w group (with 23.6 2.8 mpa). in signum composite, the laser beam of 1 w (21.44.2 mpa) showed the highest strength followed by the sandblasted group (with 19.43.2 mpa).conclusion : surface treatments using sandblast and laser beam of 1w power along with silane are two effective methods to increase the bond strength of composites. |
osteochondroma is a bone tumor appearing in a bone that is formed as a result of endochondral ossification. it generally occurs mainly in the metaphysis of a long bone, such as femur or tibia. it is a benign tumor that occurs, though rarely, also in the facial skeleton. the areas of its predominant occurrence in the facial skeleton include the coronoid process1, the mandibular condyle2, the tongue3, the maxillary sinus4, and the zygoma5. it is also known to occur mainly in the mandibular posterior region if its occurrence is, though rarely, in a bone6. this disease appears as a radiopaque lesion that has a relatively clear boundary in a radiograph. radiopaque tumors that appear in the mandibular condyle include osteoblastoma, ossifying fibroma, chondroma, and synovial chondromatosis. since chondrosarcoma or osteosarcoma among the malignant tumors occurs commonly, differential diagnosis of them is required7. osteochondroma that has occurred in the condylar area may show a variety of symptoms, such as facial asymmetry, posterior open bite, pain in the condylar area during mouth opening, or the temporomandibular joint (tmj) internal derangement. morphologically, it may show condylar length increase or condylar hyperplasia, for which traditional therapies include surgical tumor excision, condylectomy, and tmj reconstruction8, and relapses have been rarely reported9. about 1 - 2% of monostotic osteochondroma in a long bone shows a malignant change as chondrosarcoma, but it is generally known to be without malignant metastasis in the jawbone10. in this case, the patient came to and was received by our hospital due to neck pain during swallowing at the request of another hospital. she had been showing a carbuncle in the right face and a chin deviation to the left side since three years earlier, but she did not show any pain or mouth opening limitation. in a radiological examination of the patient, a giant osseous lesion presumed to be osteochondroma this department reports that it has satisfactorily treated both giant osteochondroma and facial asymmetry contracted in the mandibular condyle by performing surgical tumor excision through the mandibular swing approach. a 70-year - old female patient came to and was received by the department of oral and maxillofacial surgery at dankook university dental hospital due to neck pain during swallowing and an edema on her right face at the request of another hospital. as for her medical history, she had hypertension in terms of her whole body. and complaining of an occlusal disorder as well as an edema on her right face and a chin deviation to the left side which had begun three years earlier, she visited another hospital as mentioned above, which then requested our hospital for examination of her on behalf of it. in clinical examination, the patient did not show any limitation in the amount of mouth opening or any pain in the condylar area. she did not show any unusual symptoms such as mandibular trauma, teeth clenching or teeth grinding. she showed an occlusal disorder which had begun along with a carbuncle on her face. she complained of pain in the right oropharyngeal area when swallowing something or undergoing palpation. there was nothing unusual detected in the blood test, urinalysis, electrocardiogram, and chest radiograph of the patient. in a panoramic radiograph, we confirmed a giant radiopaque image suspected of a bone lesion in the right condylar area.(fig. 1) in an magnetic resonance imaging picture and in computed tomography, we observed an about 5.02.5 cm giant osseous tissue penetrating the parapharyngeal space in the posterior medial direction of the right condylar head, which was then shown to have been pushed laterally as a result of it.(fig. 2) the shape of the joint disk was relatively normal. in the bone scan using tc, we could see uptake of radioisotopes locally toward inside the right mandibular condyle.(fig. 3) we planned to perform surgical tumor excision including some part of the right mandibular condyle on the assumption that the patient had a benign tumor in the right mandibular condyle through comprehensive consideration of the examination results of her medical history and clinical symptoms as well as the radiographic findings in the patient. an extraoral approach was achieved through lip split incision and extension of the incision line on the inferior margin area of the right mandible in order to secure easy access to and a field of view of the parapharyngeal space in the posterior medial part of the condylar head where the lesion was located and also obtain a space for excision of the giant tumor. in addition, mandibulotomy was performed in the mandibular molar area, followed by lateral displacement of the cut bone fragment. the condylar head had been separated from the skull base, and there was neither deformation nor perforation of the joint disk. the mesial articular eminence portion was removed together with the periosteums around the tumor and the cartilage in the superior area using condylectomy.(fig. a) the excised tumor was 533 cm in size and its satisfied was lined by cartilaginous tissue. b) in the histopathological findings from the tissue at low magnification, we could see the bone portion in the interior area and the cartilagious cap in the superior area and also observe endochondral ossification between the bone and the cartilage.(figs. b) accordingly, we finally confirmed the osteochondroma that had occurred in the mandibular condyle. although a little amount of facial asymmetry remained due to the right - sided unilateral hypertrophy of the mandibular bone after condylectomy, the patient did not want any more improvement on it, and we confirmed removal of the tumor that had occupied the posterior medial part of the right condylar head in the computed tomography performed after the surgical operation.(figs. 6, 7) active physical treatment was conducted for three weeks after the surgery. the temporary mandibular movement disorder and pain that had occurred immediately after the surgery disappeared. langenskild11 insisted in 1967 that osteochondroma occurs in the wake of proliferation of undifferentiated cell layers in the epiphyseal area and the following inferior displacement of these cells onto the metaphyseal area. this can explain a lesion around the condylar head but can not explain a lesion that occurs in a membranous bone such as a maxillary bone12. in 1974, allan and scott13 explained most osteochond - romas that occur in the mandible as reactive hyperplasia or developmental disorders. in 1951, lichtenstein7 said that osteochondroma occurs in the wake of endochondral ossification that follows the formation of cartilage due to the natural or induced metaplasia of the periosteum that can form osteoblast and chondroblast. this is a hypothesis that can explain the osteochondroma that has occurred in the extracondyle area where no tendon exists. in 1982, kaneda.14 announced that trauma and infection serve as causative factors in the formation of osteochondroma in the mandibular condyle. although a lot of hypotheses have been announced on the occurrence mechanism of osteochondroma so far, debate is still underway as to whether osteochondroma is indeed a developmental problem, whether it is a true neoplasm, or whether it is a simple exuberant repair activity. in most cases, the growth of osteochondroma occurs in proportion to skeletal growth13. in the case of a long bone, once its growth ends, the growth of the tumor will also end. in the case of the mandibular condyle, however, the tumor continues to grow15, and the continuous growth of the tumor in the mandibular condyle may be due to the continuous stimulus from the tendon during mandibular movement16. the osteochondroma occurring in a long bone and the osteochondroma occurring in the craniofacial area are more or less different. in the case of a long bone, osteochondroma occurs regardless of sex or tends to occur a little more often in male persons. it occurs in people in their relatively early years with the average age of 20 years, and being often asymptomatic, it is observed without surgery10. on the other hand, in the case of the jawbone, osteochondroma tends to occur predominantly in female persons, and the average age of onset is high -40 years9. osteochondroma contracted in the mandibular condyle often leads to functional and cosmetic abnormalities, thus needing to be removed9,10. osteochondroma is either monostotic or polyostotic, and 90% of all the cases of osteochondroma are monostotic. monostotic osteochondroma shows the occurrence rate of 60% in people in their teens to thirties, and its malignant metastasis is less than 1%. it is known that there are hereditary factors in the case of polyostotic osteochondroma, which occurs mostly in people of not more than 20 years of age, with its occurrence being more frequent in male persons than in female persons by the ratio of three to one15. the bony part consists of regular bony trabeculas formed by endochondral ossification, and you can see the activity of osteoblasts there. the cartilaginous part that covers this bone consists of hyaline cartilages with various thicknesses and has chondrocysts arrayed in parallel, with an average thickness of 6 mm13,17. these histological findings are similar to the histological findings of the mandibular condyle prior to the completion of endochondral ossification. histologically, osteochondroma needs to be distinguished from ostoma, benign osteoblastoma, chondroma and chondroblastoma18. most cases of osteochondroma having occurred in the mandibular condyle are unilateral, and it is located in the anterior medial part of the mandibular condyle. tumor may be accelerated along with such related clinical symptoms as a posterior open bite on the affected side, a reversed occlusion on the non - affected side, a horizontal maxillary incline that occurs in compensation for the increased vertical dysplasia of the mandible, a masticatory disorder, and/or anterior protrusion of the jaw joint and the accompanying facial asymmetry. it may also be accompanied by jaw joint symptoms, such as jaw joint pain, a mandibular movement disorder, crepitation, a headache, and/or neck pain. also in this case, like the general osteochondroma of the mandibular condyle, osteochondroma was contracted in the unilateral mandibular condyle and accompanied by such typical symptoms as the vertical dysplasia of the mandible, a facial asymmetry and a masticatory disorder. surgical tumor excision, condylectomy, or mandibular vertical osteotomy accompanied by condylectomy is used for treatment of osteochondroma that has occurred in the condylar head. surgical tumor excision is used to remove only abnormal tumors which exist in the condylar head and includes the preauricular approach, the posterior medial approach, and tumor excision performed by following the articular arch19. in the case of removal of tumors using surgical tumor excision, vezeau.17 reported as follows : if a tumor is located in the anterior medial part of the condylar head, some part of the tumor may remain in the form of a spur, but a satisfactory result my be obtained after pursuit and observation of it for a long time. it is used to remove the tumor and the normal bone tissue together, and the scope of tumor excision varies depending on the size and location of the tumor and the condition of the joint disk. if the size of the tumor is small and its location is limited to the condylar area, excision of the tumor in the inferior part of the condylar head is used. if the size of the tumor is large and the position and form of the joint disk are good, the tumor is removed by performing oblique osteotomy in the superior part of the of the mandible and then the part of oblique osteotomy is placed back in its original position after tumor removal. if the condylar head can not be conserved when the tumor is excised, it is also possible to immediately reconstruct it using an artificial condylar prosthesis20. vertical osteotomy accompanied by condylectomy is a very efficient treatment method for osteochondroma where there is a facial asymmetry, an abnormal position of the joint disk or a pain in the condylar head during mastication. this case was a giant osteochondroma that infiltrated the right parapharyngeal space, for which tumor excision accompanied by condylectomy was performed using the mandibular swing approach in order to secure easy access to, a field of view of, and a space for excision of the giant tumor in the parapharyngeal space in the posterior medial part of the condylar head where the lesion was located, instead of using the preauricular approach, the postauricular approach and excision performed by following the articular arch, which are generally used for removal of osteochondroma, and as a result we obtained satisfactory results, including improvement of the posterior open bite and alleviation of the chronic pain. from now on, periodical clinical course observation of this case is required for future evaluation of the prognosis after removal of the osteochondroma. | osteochondroma is a common benign tumor of the axial skeleton, especially in the distal metaphysis of the femur and the proximal metaphysis of the tibia, that can occur on the facial skeleton (albeit rarely). osteochondroma is differentiated from chondroma, osteochondromatosis and osteoma. osteochondroma shows an irregular radiopaque lesion and chondromatic area surrounded by the osteoma. when it develops in the long bone, it has a marked tendency to occur at 10 to 20 years of age and ceases with the end of pubertal growth. however, when it develops in the mandibular condyle, it is prevalent in the third decade and continuous to develop. tumors that develop in the long bone have a predilection for men, but tumors in the mandible have a predilection for women. in osteochondroma of the mandibular condyle, clinical features presented include occlusal changes, facial asymmetry, headaches, pain and joint noise on the temporomandibular joint, mouth opening limitations, and jaw deviation at the involved site. the first choice of treatment for the massive osteochondroma is surgical removal. a 70-year - old female patient with an osteochondroma on her right mandibular condyle visited our clinic. we surgically removed the mass with favorable results. it is presented here along with a review of literature on osteochondroma. |
nasal swab specimens from outpatients with influenza - like illness (ili), ari, or both were collected by sentinel physicians participating in sentinel surveillance in germany during weeks 3244 in 2014 and sent to the robert koch institute (berlin, germany). all specimens were tested in parallel for respiratory viruses, including influenza viruses a and b, rhinovirus / enterovirus, respiratory syncytial virus, adenovirus, and metapneumovirus by specific real - time reverse transcription pcrs (technical appendix). the rhinovirus / enterovirus real - time pcr detected rhinovirus at a limit of detection of 26 copies / reaction. ev - d68 was identified at a slightly lower sensitivity of 118 copies / reaction. rhinovirus / enterovirus positive specimens were screened for ev - d68 by sequencing the viral protein (vp) 4/vp2 gene regions. rhinovirus / enterovirus negative specimens and samples without sequencing results were additionally analyzed by using a specific ev - d68 pcr (12). vp4/vp2 and vp1 regions were sequenced (genbank accession nos. kp189380kp189403 and kp657730kp657747) for ev - d68positive specimens. rhinovirus / enterovirus was detected in 44% (143/325) of the specimens ; 98 were identified as rhinovirus types a c and 25 as ev - d68. the remaining 20 specimens could not be subtyped, but were negative for ev - d68 by using the specific pcr. ev - d68 was initially detected from week 36 (august) through 38 (september) and continuously from week 41 through week 44 in october (figure 1). detection of enterovirus d68 (ev - d68), germany, week 3244, 2014. in addition to the other viruses tested, ev - d68positive specimens were screened for parainfluenza virus 14, coronaviruses (nl63, oc43, hku1, 229e), and bocavirus. none of these viruses was detected in ev - d68positive patients, which suggested that ev - d68 played a major role in causing respiratory disease. major symptoms associated with ev - d68 infection included sudden onset, fever / shivers, cough, and sore throat (table 1). pneumonia was diagnosed in a 7-year - old boy and a 10-year - old girl, and a 2-year - old girl was hospitalized because of obstructive bronchitis. for 11 (44%) of 25 case - patients, a concurrent chronic condition was reported : 5 with a respiratory condition, 3 with a cardiac condition, 2 with diabetes, and 1 with a neurologic disorder. ev - d68 was detected in 10 children and 15 adults ; 56% of these patients were male. +, positive ; ili, influenza - like illness ;, negative ; ari, acute respiratory infection ; na, not available. patients infected with ev - d68 came from different federal states in germany ; no epidemic cluster or outbreak was detected in the context of these patients. syndromic surveillance data of corresponding sentinel practices showed only a partial coincidence of ev - d68positive patients and an increase of ari activity in the practice. sequence analysis is not regularly performed for rhinovirus / enterovirus positive specimens within sentinel surveillance in germany. however, comparative data can be provided for week 36 through week 20 for the 200910 and 201011 seasons (table 2). during those seasons, patients with ili in 5 age groups (60 years) were investigated by using the rhinovirus / enterovirus real - time reverse transcription pcr. within the seasons, an average of 21% (198/952 for 200910) and 13% (128/1002 for 201011) of specimens were positive for rhinovirus / enterovirus (table 2). at least 20% of the rhinovirus / enterovirus positive specimens were arbitrarily chosen for sequencing (mainly rv a, b, or c ; 1 echovirus), but no ev - d68 was identified. phylogenetic analysis of ev - d68 strains detected in germany was conducted for the vp1 and the vp4/vp2 genomic regions (figure 2). analysis placed ev - d68 isolates from germany into major groups 1 or 3 and clustered with strains from the united states and the netherlands from 2014, which indicated circulation of similar strains in the united states and europe. phylogenetic analysis of selected enterovirus d68 (ev - d68) strains based on nucleotide sequences of a) partial viral protein (vp) 4/vp2 region (357 nt) corresponding to nt 7331089 in the fermon strain (genbank accession no. ay426531) ; and b) partial vp1 region (339 nt) corresponding to nt 25212859 in the fermon strain. trees were constructed by using maximum - likelihood estimation (tamura 3-parameter with 5 gamma distributed rates among sites) with 1,000 replicates through mega 5.2 (http://www.megasoftware.net/). reference sequences were selected from the united states, countries in europe, and other regions, mainly during 20052014. selected reference sequences are not identical in both trees because complementary vp1 and vp4/vp2 sequence data are not available for all reference viruses. major groups 1, 2, and 3 are shown as described by meijer. scale bar indicate nucleotide substitutions per site. some parts of the trees are collapsed. for an expanded version of figure 2, sees the technical appendix. in the 2014 outbreak in the united states, 36% (2,600) of specimens were positive for ev - d68 ; children were predominantly affected. because testing was prioritized for children with severe respiratory illness, there were probably more cases of mild infections (8). this finding might be caused by insufficient sampling of patients with ari or limited detection of ev - d68 by laboratory diagnostics (9). sporadic cases of neurologic disease after ev - d68 infection were reported from france and the united kingdom (9,10). investigation for ev - d68 has been continuously performed in the netherlands since the increase in infections in 2010 (13). the ili / ari sentinel system in the netherlands identified 24 ev - d68 infections in 2010, none in 2011, 7 in 2012, 3 in 2013, and 5 in 2014 (by week 40) (13,14), which probably increased toward the end of that year (9). for the 2014 season, a hospital in the netherlands reported an increase of ev - d68 ; 16 patients were infected (12). such an increase in ev - d68 infections was already seen in 2010 at the same hospital along with an increased number of cases throughout the country (13). this finding increased the possibility that an increase in ev - d68 infections in primary care will also extend to increased numbers of infections in patients in secondary care. so far, we report low ev - d68 circulation in germany : 25 sporadic cases in 2014. clinical patterns in patients in germany were largely determined by the ili / ari case definition for collecting specimens. severe disease was observed in 3 children who had obstructive bronchitis and pneumonia, and 1 child required hospital care. similarly, mild respiratory disease was predominantly observed for patients in the netherlands (14). however, more severe cases were detected among hospitalized children who had life - threatening respiratory illness, as described in the united states (6,12,14). more than half of patients with severe respiratory illness in germany and the netherlands had concurrent conditions (12,14), which seem to be a major factor for development of severe disease after ev - d68 infection (6). phylogenetic analysis of ev - d68 from germany showed high similarity with current strains from the united states and the netherlands (12,14). these new genetic clusters reflect the evolution of ev - d68 and might be associated with an increasing activity of this virus. for an improved understanding of the factors determining local and temporal differences in respiratory disease outbreaks, continuous collection of global data by representative surveillance systems supplemental methods used for detection of enterovirus d68associated acute respiratory infections, germany, 2014. | we used physician sentinel surveillance to identify 25 (7.7%) mild to severe infections with enterovirus d68 (ev - d68) in children and adults among 325 outpatients with acute respiratory infections in germany during august october 2014. results suggested low - level circulation of enterovirus d68 in germany. viruses were characterized by sequencing viral protein (vp) 1 and vp4/vp2 genomic regions. |
recently, more and more genomes have been sequenced and annotated, and the data of proteins and gene interactions are accumulating. biological data are mostly digital and stored in a wide variety of formats in heterogeneous systems. biological data exist all over the world as various web services, which provide biologists with much useful information. however, when users actually make use of them, they need to access to web services (databases) one by one. if they want to compare many different kinds of data, they need to do cumbersome task. actually, a large part of the work of biologists today consists in distributing local data, querying multiple remote heterogeneous data source, and integrating retrieved data manually. therefore, distributing and integrating biological data is a very important task and has been recognized as a key component of today s genome biology research. many communities have devoted to a large amount of work on the exchange and integration of biological data (1). the difficulties in dealing with the bioinformatics data exchange and integration come from the following technical issues:1)the volume of biological data grows at an exponential rate.2)data are disseminated in a myriad of different databases and managed by different database management system (dbms).3)biological data from different sources have heterogeneous formats (2).4)the platforms or systems for distributing data are different, and the interaction and independence is lacked among these platforms or systems.5)hypertext markup language (html), as a language used widely for database browsing, data publishing, gathering, submission and analysis, is not suitable for extracting and integrating data. data are disseminated in a myriad of different databases and managed by different database management system (dbms). the platforms or systems for distributing data are different, and the interaction and independence is lacked among these platforms or systems. hypertext markup language (html), as a language used widely for database browsing, data publishing, gathering, submission and analysis, is not suitable for extracting and integrating data. data integration consists in wrapping data sources and either loading retrieved data into a data warehouse or returning it to the user. nowadays, database federation is a main technology for solving data integration problem (3). database federation offers the promise of a unified view of these disparate data and detailed query through a single easy - to - use interface available via the world wide web. there are two approaches for implementing database federation : concrete and virtual (or loose) federation. some systems such as entrez, srs, discoverylink, and dbget (4), have been designed for the specific integration of biomolecular data. however, there are some shortcomings by using database federation technology for integrating data. first, the retrieved data by concrete federation are not always the latest and greatest. second, because the retrieved data by virtual federation are web pages (html format), it is an arduous task to parse the result documents. third, a client of virtual federation must be tied to the upstream web service directly. web services, a kind of service - oriented architecture, have been used worldwide to exchange and integrate data in e - commerce. actually, the shortcomings described above are addressed in part by web services and xml (extensible markup language) technologies. the flat file format (ff format) however, it is very difficult to parse the ff format for extracting the interesting information. xml provided a generic way to represent structured and typed data, which makes it easy to write a script for parsing an xml document. a web service is a unit of business logic, located somewhere on the internet, which is accessible through standard - based internet protocols such as http or simple message transfer protocol (smtp). the core of today s web services technology is made up by soap (simple object access protocol), wsdl (web service description language) and uddi (universal, description, and discovery integration ; figure 1). web services have some features for solving the problems of information exchange, data integration and distributed application:1)web service is xml - based. all of web services use xml as the data representation layer.2)web service is loosely coupled. a client of a web service is not tied to the web service directly.3)web service is coarse - grained. the technology provides a natural way of defining coarse - grained services that access the right amount of business logic.4)web service supports remote procedure calls (rpcs). it allows clients to invoke procedures, functions, and methods on remote object using xml - based protocol.5)web service supports a transparent exchange of documents to facilitate data and documents integration. the technology provides a natural way of defining coarse - grained services that access the right amount of business logic. it allows clients to invoke procedures, functions, and methods on remote object using xml - based protocol. xml is a markup language that specifies neither the tag set nor the grammar for that language, and is a meta language used to define other language. xml allows one to define his own markup language, which consists of his own tags. furthermore, the meaning of tags is essentially different between xml and html. unlike html, the tags defined in xml indicate the semantics of a document rather than display a document. the set of tags and grammar, or schema, for an xml language, describing admissible combinations of tags in a document, can be formalized and enforced by standard parsing tools. it is clear that xml has some interesting features addressing the problems of data exchange and integration introduced above. for one thing, xml makes it very advantageous to exchange data among data sources if all of them adopt the same standardization in xml documents. thirdly, it is convenient to extract interesting information from xml documents, which helps to data integration. in life science, many commercial and academic communities are now adopting xml as a standard for their genome biology data management (http://scbi.scu.edu.cn/xml/). a web service is a unit of business logic, located somewhere on the internet, which is accessible through standard - based internet protocols such as http or simple message transfer protocol (smtp). the core of today s web services technology is made up by soap (simple object access protocol), wsdl (web service description language) and uddi (universal, description, and discovery integration ; figure 1). web services have some features for solving the problems of information exchange, data integration and distributed application:1)web service is xml - based. all of web services use xml as the data representation layer.2)web service is loosely coupled. a client of a web service is not tied to the web service directly.3)web service is coarse - grained. the technology provides a natural way of defining coarse - grained services that access the right amount of business logic.4)web service supports remote procedure calls (rpcs). it allows clients to invoke procedures, functions, and methods on remote object using xml - based protocol.5)web service supports a transparent exchange of documents to facilitate data and documents integration. the technology provides a natural way of defining coarse - grained services that access the right amount of business logic. it allows clients to invoke procedures, functions, and methods on remote object using xml - based protocol. xml is a markup language that specifies neither the tag set nor the grammar for that language, and is a meta language used to define other language. xml allows one to define his own markup language, which consists of his own tags. furthermore, the meaning of tags is essentially different between xml and html. unlike html, the tags defined in xml indicate the semantics of a document rather than display a document. the set of tags and grammar, or schema, for an xml language, describing admissible combinations of tags in a document, can be formalized and enforced by standard parsing tools. it is clear that xml has some interesting features addressing the problems of data exchange and integration introduced above. for one thing, xml provides an open framework for standard specifications in managing bioinformatics data., xml makes it very advantageous to exchange data among data sources if all of them adopt the same standardization in xml documents. thirdly, it is convenient to extract interesting information from xml documents, which helps to data integration. in life science, many commercial and academic communities are now adopting xml as a standard for their genome biology data management (http://scbi.scu.edu.cn/xml/). using web services, soap and xml, a simple web service client was constructed to retrieve xml nucleotides data. the extensible stylesheet language (xsl) was used to transform xml data into html form. the web service client is available at http://scbi.scu.edu.cn / webservices/. the new and exciting web services and xml technologies are drastically changing the way people conduct business, vastly altering the competitive landscape of information technology industries, and significantly improving enterprise efficiency. the influences of the web services and xml technologies are becoming increasingly visible, and their momentum will greatly become more significant over the next several years. under the web services, a single application can tap into the services of millions of applications scattered throughout the internet. the promise of web services is to enable a distributed environment in which any number of applications, or application components, can interoperate seamlessly among and between organizations in a platform - neutral, language - neutral fashion. the interoperation brings heterogeneity to the world of distributed computing. nowadays, web services are revolutionizing the internet, and are used in e - commerce worldwide. as a promising standard, web services and xml technologies will undoubtedly be a chance to exchange and integrate biological data on the bioinformatics community. it supports an integrated view for managing remote or local heterogeneous biological data sources with advanced data accessing. we propose to replace the flat file format by xml and to distribute data by web services, which would provide the programmers a uniform access to the biological data and a standardized interface for interoperable applications. in this paper, the author examined only a simple application for integrating biological data using web service client and xml technologies, but an architecture of web services is obviously more complex than the application that makes the web service call directly (figure 2). our service client is implemented by the hardware of pentium iv 1.8 g with 512 mb memory and 18 g hard disk. the set of software is redhat linux 8.0, jakarta tomcat 4.1.24, java (j2sdk1.4.1_02), apache axis 1.1, and apache 1.3.27. apache axis (apache extensible interaction system, http://ws.apache.org/axis/) is an open - source implementation of the soap submission to w3c. it is essentially a soap engine a framework for constructing soap processors such as clients, servers, gateways, etc. the current version of axis is written in java the server provides various servers, including blast, fasta, clustalw, and so on (6). the getentry is one of the appropriate servers for getting entries by specifying accession number. using soap message, our service sends a request into the getentry server to call the method getxml_ddbjentry. the information of the getentry server is obtained from the wsdl document (http://xml.nig.ac.jp/wsdl/getentry.wsdl ; fig. consider, for example, that the same xml document may need to be displayed in html, pdf, and postscript form respectively. without xsl, the xml document would have to be manually duplicated, and then converted into each of these three formats. instead, xsl provides a mechanism of defining stylesheets to accomplish these types of tasks. rather than having to change the data because of a different representation, xsl provides a complete separation of data, or content, and presentation. to transform xml documents into html form, an xsl file named it is a key advantage of xml to bioinformatics data integration that xml documents are parsed easily. sax (the simple api of xml), dom (the document object model) and jaxp (java api for xml parsing) are three major apis (application programming interface) to parse xml documents. by parsing xml documents, data extracted from various xml documents can be dumped into a database, or integrated into an xml document, which is the major task of bioinformatics data integration (figure 5). moreover, application interoperability, standardizing the interfaces between stand - alone applications such as the data generated from one application flow as the input to another application, will be convenient. the server provides various servers, including blast, fasta, clustalw, and so on (6). the getentry is one of the appropriate servers for getting entries by specifying accession number. using soap message, our service sends a request into the getentry server to call the method getxml_ddbjentry. the information of the getentry server is obtained from the wsdl document (http://xml.nig.ac.jp/wsdl/getentry.wsdl ; fig. consider, for example, that the same xml document may need to be displayed in html, pdf, and postscript form respectively. without xsl, the xml document would have to be manually duplicated, and then converted into each of these three formats. instead, xsl provides a mechanism of defining stylesheets to accomplish these types of tasks. rather than having to change the data because of a different representation, xsl provides a complete separation of data, or content, and presentation. to transform xml documents into html form, an xsl file named it is a key advantage of xml to bioinformatics data integration that xml documents are parsed easily. sax (the simple api of xml), dom (the document object model) and jaxp (java api for xml parsing) are three major apis (application programming interface) to parse xml documents. by parsing xml documents, data extracted from various xml documents can be dumped into a database, or integrated into an xml document, which is the major task of bioinformatics data integration (figure 5). moreover, application interoperability, standardizing the interfaces between stand - alone applications such as the data generated from one application flow as the input to another application, will be convenient. | it is widely recognized that exchange, distribution, and integration of biological data are the keys to improve bioinformatics and genome biology in post - genomic era. however, the problem of exchanging and integrating biological data is not solved satisfactorily. the extensible markup language (xml) is rapidly spreading as an emerging standard for structuring documents to exchange and integrate data on the world wide web (www). web service is the next generation of www and is founded upon the open standards of w3c (world wide web consortium) and ietf (internet engineering task force). this paper presents xml and web services technologies and their use for an appropriate solution to the problem of bioinformatics data exchange and integration. |
mammalian nitric oxide synthase (nos) is a homodimeric flavo - hemoprotein that catalyzes the oxidation of l - arginine to no, with nadph and o2 acting as cosubstrates. there are three nos isoforms : endothelial, neuronal, and inducible (enos, nnos, and inos, respectively). each nos subunit contains a c - terminal electron - supplying reductase domain with binding sites for nadph (the electron source), fad, and fmn and an n - terminal catalytic heme - containing oxygenase domain. the oxygenase and fmn domains are connected by a calmodulin (cam) binding linker, which is tightly bound to cam in inos at a basal calcium level, while cam binding to nnos and enos requires a significantly higher ca concentration. the binding of cam activates no synthesis in enos and nnos by (i) enabling the fmn domain transitions between its electron - accepting position (input state) and an electron - donating position (output state) and (ii) facilitating the proper docking of the fmn domain on to the oxygenase domain, which enables efficient fmn cam is also important for proper alignment of the fmn and heme domains in inos. heme iet is essential for the delivery of electrons required for o2 activation in the heme domain and the subsequent no synthesis by nos. the crystal structures are only available for truncated nos domains, including the oxygenase domains of each of the nos isoforms, rat nnos reductase constructs, and cam - bound human inos fmn domain, along with cam bound to peptides corresponding to the cam - binding region in enos, nnos (pdb i d 2o60), and inos (pdb i d 3gof). although high - resolution x - ray crystallographic structures have been obtained for certain segments of nnos and other nos isoforms, the details of how the various tethered nos domains interact with cam and how cam binding influences functionally important interactions among the domains are not known. herein we employed the pulsed electron paramagnetic resonance (epr) relaxation - induced dipolar modulation enhancement (ridme) technique to monitor the binding of spin - labeled cam (sl cam) to nnos and to determine the position of the nitroxide spin label (sl) with respect to the heme centers of the dimeric oxygenase domain. wild - type cam does not contain cysteine amino acid residues, but a cysteine can be readily introduced at a selected cam site by site - directed mutagenesis. in this work, to enable the spin - labeling, a cysteine was introduced at position 110. recent work showed that this mutation has little effect on nnos enzyme activation. in order to simplify the system, we used the bidomain nnos oxyfmn construct, which contains the oxygenase and fmn domains, as well as the cam binding region, but lacks the nadph and fad binding domains. this nos construct is a valid model of the electron - donating (output) state of the fmn domain. construction, purification, and spin - labeling of t110c mutant cam are described in the supporting information. the spin - labeling efficiency and selectivity have been confirmed by tryptic digestion and mass spectrometry (figure s1 in the supporting information). the rat nnos oxyfmn plasmid was cotransformed with cam expression vector (p209) into escherichia coli bl21(de3) cells by electroporation. the transformed cells were grown at 37 c in terrific broth in the presence of 100 g / ml ampicillin and 34 g / ml chloramphenicol. protein expression was induced by adding induction cocktail (0.5 mm isopropyl -d - thiogalactopyranoside, 0.4 mm -aminolevulinic acid, and a pinch of riboflavin) when the cell culture reached an optical density of 1.0 at 600 nm. after incubation at 25 c for 40 h, the cells were harvested at 4 c. cells were resuspended in the lysis buffer (ph 7.5) containing 50 mm tris - hcl, 10% glycerol, 200 mm nacl, 0.5 mm cacl2, 5 mm -mercaptoethanol, three complete protease inhibitor tablets (roche), 10 m h4b, and 0.5 mg / ml lysozyme. the lysate was centrifuged at 30 000 rpm for 40 min at 4 c. the supernatant was then loaded onto a co - chelating column (talon metal affinity resin, clontech) pre - equilibrated with five bed - volumes of equilibration buffer (50 mm tris - hcl, 10% glycerol, 200 mm nacl, 0.5 mm cacl2, ph 7.5). the column was washed with ten bed - volumes of equilibration buffer containing 15 mm imidazole, and the contents were then eluted with a 15150 mm imidazole gradient in the elution buffer (50 mm tris - hcl, 10% glycerol, 200 mm nacl, 0.5 mm cacl2, ph 7.5). the eluted protein was pooled, concentrated, and dialyzed into the storage buffer (50 mm tris - hcl, 10% glycerol, 200 mm nacl, 1 mm dtt, 10 m h4b, ph 7.5). for preparation of the sl cam - bound nnos epr samples, the coexpressed cam was removed by dialysis against the storage buffer containing 2 mm egta. the molar concentration of the nnos protein was determined on the basis of the heme content via difference spectra of the ferrous chelex 100 iron form resin (bio - rad) was used to remove the background ca from the nanopure water for preparation of the calcium - free epr buffer (50 mm bis - tris propane, 200 mm nacl, 3 mm imidazole, 42% ethylene glycol, ph 7.4). imidazole was added to convert the heme centers of the nnos oxyfmn construct to the low - spin fe(iii) state. the spin - labeled t110c cam and nnos oxyfmn were concentrated and dialyzed into the epr buffer and the epr buffer containing 20 m h4b, respectively. solutions containing sl cam and nnos oxyfmn were gently mixed (final concentration 110 m and 55 m, respectively), and cacl2 was then added to prepare solutions with final total ca concentrations of 0.22, 0.5, 1, 2, and 5 mm. about 40 l of each solution was transferred into epr tubes and rapidly frozen in a pentane and liquid nitrogen slurry. the experiments have been performed on the homemade broad - band pulsed epr spectrometer at the university of arizona. the overall structural model of this work is shown in figure 1. according to this model, without ca present in solution, cam does not form a complex with nnos (panel a of figure 1). as the ca concentration increases, cam binds ca (up to four ca ions per cam molecule), and cacam can now bind to the cam binding region spanning residues 725745 of the flexible tether connecting the oxygenase and fmn domains of nnos (panels b and c in figure 1). (a) without ca in solution, no cam binding to nnos occurs, and the docking complex between the fmn domain and the heme domain does not form. (b and c) when ca ions are present in solution (up to four ca ions per cam molecule), cam binds to the nnos cam - binding motif, which facilitates the formation of the iet - competent docking complex between the fmn and heme domains. the cam - bound nnos is in equilibrium between the structurally disordered open state (b) and the iet - capable docked state (c). for the purposes of this work, we will distinguish two qualitatively different structural states of the cam - bound nnos : the open (undocked) state, where the bound cam can move freely within the range of positions permitted by the flexibility and length of the tether (panel b in figure 1), and the docked state (panel c), where the docking of the bound cam to the oxygenase domain facilitates and strengthens the docking of the fmn domain. the specific structural models for the docked and undocked states used in the interpretation of the experimental results of this work will be presented below. the structural arrangements described in the previous section can be distinguished by using ridme, one of the pulsed epr techniques sensitive to the magnetic dipole interaction between the sl and the fe(iii) ions of the heme centers. the meaningful use of the alternative pulsed epr technique sensitive to the magnetic dipole interaction between the paramagnetic centers, the electron electron double resonance (eldor), is hampered for this system by the unfavorable epr properties of the ferric heme centers (strong n electron spin - echo envelope modulation (eseem) and significant g - anisotropy). this has been discussed in our previous work, where the distance of 18.8 between the heme center and the fmn semiquinone radical of the docked fmn domain was determined by ridme. the ridme measurements were performed using the refocused stimulated electron spin - echo (ese) pulse sequence (figure s2 in the supporting information). the refocused stimulated ese signal from the sl was measured as a function of the interval between the first and second mw pulses,, at a fixed time interval between the second and third pulses, t. these measurements were performed at two temperatures, tlow and thigh, selected in such a way that the longitudinal relaxation time of the heme center, t1fe, was very long at tlow (t1fe t) but relatively short at thigh [0.5 mm by the trace obtained at [ca ] = 0. this is the first operation of those used to obtain the data shown in figure 3 above, which eliminates the effect from uniformly distributed matrix nnos. the resulting traces represent a sum of two contributions : (i) the generally nonconstant (decaying or oscillating) contribution from the camnnos complexes and (ii) the constant contribution from the free cam molecules (if any). the black solid trace 1 in each panel of figure 4 shows the result of the division of the average of the ridme traces corresponding to [ca ] 0.5 mm (since these traces were similar, the average was taken to increase the signal - to - noise ratio) by the trace corresponding to [ca ] = 0. in order to analyze this trace, one has to take into account that the oxygenase domain contains two heme fe(iii) centers that simultaneously interact with the sl. the longitudinal relaxation of these heme centers during the time interval t (between the second and third mw pulses of the refocused stimulated ese sequence) at 25 k results in the spin flip probability of 0.5 for each of these centers. the resulting distribution of the relaxation outcomes is as follows : 25% of the fe(iii) pairs do not flip ; in 50% of the fe(iii) pairs, one of the spins flips (25% each) ; and in 25% of the fe(iii) pairs, both spins flip. in the last group, one - half of the population undergoes a flip between | and | states, while the other half flips between | and | states. the statistics of the fe(iii) spin flips is used to evaluate the resulting change in the local magnetic field at the position of the sl and to calculate the ridme effect. solid black trace 1 in each panel is the experimental ridme effect in the samples of cam - bound nnos oxyfmn. (a) traces in group 2 are examples of simulations based on the docking model in figure 5. the various traces are simulated for the distances between the sl and the two fe(iii) centers of (36, 31) (long dashes), (40, 36) (short dashes), and (31, 26) (dots). the solid cyan trace is an average over several sl positions within the uncertainty range, including the above three, (38, 27), and (34, 33). the simulated traces were multiplied by 0.4 to provide for convenient scaling of the figure. (b) long - dashed trace 2 is simulated using the open state model in figure 6. short - dashed trace 3 is obtained from trace 2 by multiplication by 0.45 to approximately equalize its slope with that of the experimental trace. (c) an example of simulation (solid cyan trace) with a superposition model corresponding to 12% of the docked state and 88% of the open state. traces 2 and 3 show the contributions of the open and docked states, respectively, into the cyan trace. see the text for details. the experimental ridme trace of figure 4 can not be explained by a single structure with a fixed distance between the sl and the heme centers because in this case oscillations rather than a monotonous decay would be observed (relevant examples are shown by the dashed and dotted traces in figure 4a and discussed below). this indicates that the majority of the cam - bound nnos is in the open state (figure 1b) that is characterized by a broad distribution of the sl positions relative to the oxygenase domain. the lack of well - defined oscillations also prevents one from obtaining accurate information on the cam position in the docked state directly from the ridme trace using the standard approach, which consists of estimating the characteristic distance from the oscillation frequency. in this situation, we have to rely on the structure of the docked state obtained from docking calculations for validating the results of numerical simulations of the ridme kinetics. next we will describe the structural information pertaining to our analysis of the experimental ridme trace of figure 4 in terms of relative populations of the docked and open states. the crystal structures of nnos oxygenase domain and of the cam unit bound to the cam - binding region are available (pdb i d 2g6k and 2o60, respectively), and the solution structures will be assumed to be the same. although the crystal structure of the docked state has not yet been determined, the computer modeling allows one to predict the relative arrangement of the oxygenase and fmn domains and the bound cam unit in the docked state. we constructed a docking model of nnos fmn domain along with cam on to the oxygenase domain (figure 5). this was accomplished by closely referencing to the docking model reported recently for the system of murine inos based on hydrogen deuterium exchange mass spectrometry results. according to our model, the sl in the docked state is located at the distances of about 36 and 31 (as measured to the o atom of thr110, which corresponds in the mutant cam to s of cys110, to which the sl is attached) from the iron ions of the two heme centers of the oxygenase domain, the distance between which is 34. docking model of nnos fmn domain (purple, pdb i d 1tll) onto the dimeric oxygenase domain (cyan and green, pdb i d 4jsh) in the presence of cam (gray, pdb i d 2o60). for clarity the sl site (res110) in cam is labeled, so are the terminal residues in oxygenase and fmn domains that connect with the cam - binding peptide. the docking model was constructed by carefully cross - checking against the inos model reported recently in terms of which residues are involved in the docking surface among the proteins. in the open state, the sl position is assumed to be uniformly distributed within a sphere of the radius corresponding to the full extension of the flexible tether joining the oxygenase domain with the bound cam, with the exclusion of inaccessible regions, in particular, the part of space occupied by the oxygenase domain (also see below). the flexible tether joining the oxygenase domain with the bound cam is a random coil spanning residues 706731. with 3.53.6 per residue, this corresponds to the maximum backbone extension of 89 1. the sl is located at about 15 from phe731, which makes the total maximum possible distance between the oxygenase domain and the sl equal to 104. the sl position is averaged over the sphere centered at the peptide nitrogen of tyr706, with the radius of 104. the regions occupied by the oxygenase domain and the gray part of the sphere on the far side of the oxygenase domain (40 from the center to the cutoff plane) are excluded from the calculation as inaccessible. the size of the dimeric oxygenase domain has characteristic dimensions of 90 50 50 and is comparable with the tether length. therefore, the bound cam can not reach the parts of the spherical region on the far side of oxygenase domain. predicting the exact shape of this inaccessible region requires calculating all possible configurations of the tether wrapping around the oxygenase domain surface. since the oxygenase domain shape is not accurately described by any analytical function (e.g., a sphere or an ellipsoid), such a calculation is prohibitively time - consuming and practically unrealistic. an approximate exclusion region, however, can be predicted on the basis of comparison of the characteristic size of the oxygenase domain with the tether length. in this particular case it represents a part of the sphere on the far side of the oxygenase domain shown by the gray area in figure 6. since the specific conformation of the sl or distribution thereof in cam is unknown (which is a common situation in site - directed spin - labeling), one has to consider the uncertainty in the position of the > n o radical fragment arising from the rotational degrees of freedom of single bonds between the > n o fragment and the s s bridge, which is approximately 6 in every direction (see figure s4 of the supporting information). this uncertainty is not important for the open state of nos because the distances there are distributed within very large limits (100 in every direction). for the docked state, however, this uncertainty has to be considered explicitly (see below). using the structural models presented above, we performed numerical simulations of the ridme effect for the docked and open states of nnos. in these simulations, such an approximation is unavoidable because the orientations of the heme g - frames with respect to the oxygenase domain of nnos are not known. neglecting the actual g - anisotropy [(g1, g2, g3) = (1.85, 2.30, 2.52) ], however, does not result in the loss of potentially obtainable structural information because (i) the anisotropy is fairly small, (ii) in the open state the heme sl radius vectors are orientationally disordered with respect to the g - frames, and (iii) in the docked state the potential changes in the ridme frequencies resulting from taking the g - anisotropy into account are smaller than the changes from the uncertainty in the sl position. the results of the calculations for the docked state are shown by group 2 of dashed and dotted traces in figure 4a. these traces were calculated for three different sl positions within the 6 range of uncertainty mentioned above. note that they exhibit well - defined oscillations with the frequencies equal to the dipole interactions (expressed in frequency units) between the sl and the heme centers and are very different from the experimental trace 1. a distribution of the sl position within the uncertainty range does not create a better agreement : while the oscillations are suppressed, the trace practically flattens out starting from 250 to 300 ns (solid trace of cyan color in figure 4a). the long - dashed trace 2 in figure 4b shows the calculation result for the open state. this trace exhibits significantly smaller curvature and greater slope than the experimental one (trace 1). although the slope of the calculated trace can be reduced by assuming less than 100% formation of the low - spin ferric state of the heme centers or the presence of some unbound cam (short - dashed trace 3 in figure 4b), this does not help with improving the agreement because the curvature then becomes even smaller. while the docked or open state models by themselves result in simulated ridme traces significantly different from the experimental one, the agreement can be reached for a combination of the two states. to estimate the relative contributions of the docked and open states, the calculated ridme trace for the open state (long - dashed trace in figure 4b) was multiplied by the scaling factor copen n o fragment and the predicted anchoring position at s is about 10). using the obtained values of scaling factors copen and cdock, the population of the docked state can be estimated as pdock = cdock/(cdock + copen). the population of the open state is popen = 1 pdock. on the basis of the range of copen (0.450.52) and the corresponding range of cdock (0.10.075), one can estimate pdock = 15 3%, with the smaller values corresponding to the more probable solution with sl 75. the simulation for sl = 75 that is in reasonable agreement with the experimental ridme trace and with the docking model is shown in figure 4c. the results of the present ridme work indicate that the slfe(iii) distance is highly distributed and dynamic, even in the cam - bound nnos. this is consistent with the fmn domain tethered shuttle model : cam activates nnos by enabling transitions between conformational states, and the fmn domain moves back and forth to contact the ferredoxin nadp - reductase module and the nos heme domain. cytochrome p450 reductase and p450 bm3 (e.g., a hinge movement of the fmn domain toward the heme domain in p450 bm3 was proposed), which derives from p450 reductase and p450 bm3 structures, including the crystal structure of the bm3 heme heme iet occurs in the docked state, but the interdomain fmn heme interactions in nos enzymes are rather weak, and the docking complexes are short - lived. oxyfmn construct is therefore limited by the relatively infrequent formation of the docked iet - competent complexes. we have recently shown that the retarded iet in the e546n mutant of human inos oxyfmn is not caused by an altered conformation of the docked fmn heme complex but by a lower population of the iet - active conformation. on the other hand, in the nnos holoenzyme, the electron transfer to the heme center is more likely limited by passage through a conformational bottleneck (that does not exist in the oxyfmn construct). it is interesting to compare the findings of our ridme study with the results of fmn fluorescence lifetime investigations performed in solutions at room temperature. the populations of the docked and open conformations of cam - bound nnos oxyfmn in frozen solution estimated from our ridme measurements are about 15% and 85%, respectively. the corresponding populations estimated for inos oxyfmn from room temperature fmn fluorescence measurements are about 2530% and 7570%. fluorescence lifetime data for nnos oxyfmn construct have not been reported yet, but the population breakdown obtained for the full - length nnos enzyme suggests that the nnos oxyfmn construct in terms of the docked and open state populations should be similar to that of inos oxyfmn. one has to note that the docked state population estimates in the literature depend on the assignment of the fluorescence component with 1 ns lifetime. while there is little doubt that this component is caused by the fmn heme interaction, it is not clear if the relative arrangement of the oxygenase and heme domains enabling this interaction is unique and corresponds to the docking complex only. therefore, we believe that the 2530% population of the docked state derived from the fluorescence investigations represents an upper limit estimate. another factor that makes the comparison of the ridme and fluorescence lifetime results not entirely straightforward is that the former pertain to the nos - bound cam, while the latter pertain to fmn. the comparison is justified by the fact that fmn and cam are located in close proximity (they are separated by a linker that is only 7 residues long, compared to 25 residues between cam and the oxygenase domain) and can be approximately considered as a single structural unit. therefore, we conclude that the ridme and fluorescence data are at least in a semiquantitative agreement. on a more general level, the above comparison tests a commonly used paradigm that the structural distribution in a frozen solution represents a snapshot of the dynamic equilibrium in fluid solution. while this paradigm is obviously convenient, it has to be used with caution. the relevant literature appears to be rather scarce, but examples of both small and large temperature- and phase - dependent conformational distribution changes are available. the joint results of this ridme investigation and the fmn fluorescence studies indicate that for the nos oxyfmn constructs the snapshot approximation is at least semiquantitative. the broad structural distribution of cam - bound nnos detected by ridme is in agreement with a low - resolution cryo - electron microscopy (em) study of enos holoenzyme, which indicated that a large (although unquantified) fraction of nos is in distributed conformations even when cam is bound. the overall conformational equilibrium in cam - bound nnos was estimated in another cryo - em study, which showed that the cam - bound nnos holoenzyme adopts an ensemble of open and closed conformational states, with only about 15% in the closed conformation. the closed state as used in the em work represents a structural category that corresponds to the nnos protein folded on itself, as opposed to the extended and intermediate (v - shaped) states where the oxygenase fmn reductase domain this classification of the conformational states categorizes the perceived overall shapes of the entire nnos dimer, but not the relative arrangement of the specific structural parts of the protein. it is important to note that although the docking complex studied in our work obviously corresponds to a subset of the closed conformations in the em work, the specific closed conformation stabilized by cross - linking and characterized in detail is very different and is far from optimal for the fmn heme iet since the fmn domain there is still too far (100) from the hemes. in addition, the fmn domain in the three - dimensional reconstruction model is proximal to the side of substrate - access channel of the heme domain (but kinetics and mutational studies have consistently shown that the fmn domain docks to the back face of the heme domain where the heme is closest to the protein surface). further fmn domain motions (swing and rotation) are clearly required prior to the iet. therefore, the 15% population of the closed state found in the cryo - em work does not translate directly to the population of the fmn heme iet - competent conformation and represents, at best, the upper limit estimate for the docked fmn / heme state. to improve the docked state geometry and statistics estimates, a high - resolution structure of the functional full - length nos state should be obtained. although the docked fraction of about 15% estimated by ridme measurements is relatively small, it is not negligible : its presence indicates that the free energies of the docked and open states are comparable. the presence of the measurable population of the docked state is also important from the mechanistic viewpoint because it implies a possibility of minor local structural adjustments in the docked state itself to reach the fmn finally, our results are agreeable with the notion that cam docking with the oxygenase domain is necessary to facilitate the rather weak interdomain fmn heme interactions required for efficient iet, which was first experimentally established in an isotope exchange mass spectrometry study of murine inos oxyfmn protein. the system investigated in this work is characterized by a wide distribution of distances between the paramagnetic centers, and the ridme trace represents a relatively featureless monotonous decay. in a recent pulsed eldor study of the magnetic dipole interaction between flavin semiquinone radicals in fad and fmn domains of nnos (a system qualitatively similar to ours, with two domains connected by a flexible tether), clear oscillations in the eldor trace were observed, indicating that a significant fraction of the protein was in well - defined structural states. unfortunately, no analysis of the distributed fraction was performed in their work, and the percentages allotted to each fraction were not determined. in this work, we have studied the binding of sl cam to nnos oxyfmn bidomain construct using pulsed epr (the ridme technique) to detect the specific magnetic dipole interaction between the sl and the ferric heme centers of nnos. it was found that the binding saturates at [ca]/[cam ] 4, which is expected from the number of the calcium binding sites in cam. the analysis of the ridme traces has shown that only about 15 3% of the cam - bound nnos is in the iet - competent docked state at any given time, while the remaining 85 3% of the protein is in the open conformations characterized by a wide distribution of the distances between the bound cam and the oxygenase domain. the low population of the docked state found in this ridme study indicates that the cam - controlled docking between the primary functional fmn and heme domains is highly dynamic. the overall approach of this work to the analysis of the ridme data can be used for obtaining information about the structural state(s) of other protein systems consisting of domains connected by a flexible tether. | the binding of calmodulin (cam) to neuronal nitric oxide synthase (nnos) enables formation of the output state of nnos for nitric oxide production. essential to nos function is the geometry and dynamics of cam docking to the nos oxygenase domain, but little is known about these details. in the present work, the domain docking in a cam - bound oxygenase / fmn (oxyfmn) construct of nnos was investigated using the relaxation - induced dipolar modulation enhancement (ridme) technique, which is a pulsed electron paramagnetic resonance technique sensitive to the magnetic dipole interaction between the electron spins. a cysteine was introduced at position 110 of cam, after which a nitroxide spin label was attached at the position. the ridme study of the magnetic dipole interaction between the spin label and the ferric heme centers in the oxygenase domain of nnos revealed that, with increasing [ca2 + ], the concentration of nnoscam complexes increases and reaches a maximum at [ca2+]/[cam ] 4. the ridme kinetics of cam - bound nnos represented monotonous decays without well - defined oscillations. the analysis of these kinetics based on the structural models for the open and docked states has shown that only about 15 3% of the cam - bound nnos is in the docked state at any given time, while the remaining 85 3% of the protein is in the open conformations characterized by a wide distribution of distances between the bound cam and the oxygenase domain. the results of this investigation are consistent with a model that the ca2+cam interaction causes cam docking with the oxygenase domain. the low population of the docked state indicates that the cam - controlled docking between the fmn and heme domains is highly dynamic. |
with an ever increasing global population, demands for food and energy become difficult to ignore and the major portion of available food and energy is produced by agriculture and livestock activities. furthermore, more healthy food is needed. to attain a sustainable development in the agricultural sector, farmers welfare and health should be considered. measures taken to protect their health against occupational hazards include identifying hazards and threatening diseases (1). pesticides can not selectively activate, that is, in addition to affecting targets and pests, they also have side effects on non - target species (including humans) (2). previous research has indicated that, in the united states alone, more than 2 billion pounds of pesticides have been used in a variety of different sectors, including agriculture and forestry (3). due to the high consumption rate people have more exposure to pesticides, and, as a result, adverse effects on people s health are becoming more apparent. american public health association (apha) indicates that many american farmers are exposed to different types of pesticides (4). a significant portion of the pesticides produced globally were used in developing countries (5). increases in poisoning by agricultural pesticides have been observed due to increased use and high accessibility in these countries, compared to that in developed countries. poisoning by agricultural pesticide especially organophosphorus pesticides is estimated to cause many deaths among farmers in china (6). as a society, we have resorted to using pesticides as one of the more practical ways for controlling and fighting plant pests to prevent loss of agricultural products. pesticides consist of chemical components that are often highly toxic to human health and are the active ingredients for controlling the population of plant pests, insects, and vermin (7, 8). the us environmental protection agency (usepa) had defined pesticides as any substance or mixture of substances intended for preventing, destroying, repelling, or mitigating any pest (9). more than 800 different types of chemicals are used to control insects, weeds, plant pests, and disease - carrying insects. increases in the amount of agricultural products and decreases in the number of parasitic diseases are the positive outcomes of using such chemicals. about 500,000 cases of pesticide poisoning are reported annually and, in addition, about 5000 cases of death are recorded. most of the acute poisoning cases occur in lower income countries, which is attributed to the storing pesticides at home near food items (10). the world health organization (who) supervises the safety and toxic effects of pesticides. although all pesticide containers must carry warning labels, due to the lack of proper education and illiteracy of villagers, they have gone unnoticed. with the lack of monitoring of the manufacturing, production, and selling of non - standard pesticides and their high availability in the market, these pesticides are often used improperly, which leads to additional effects on environment and public health in the long run and immediate adverse effects on farmers health (7). some researchers have drawn attention to the association between pesticides exposure and some types of cancers, including blood, lymphatic system, lip, stomach, lung, brain, and prostate cancers (11). a prospective cohort study of 57,311 licensed pesticide applicators in iowa and north carolina failed to show any relationships between exposure to glyphosate and some types of cancer (12). children s exposure to pesticides is another important issue (13). previous research in california failed to show any correlation between pesticide use and cancer incidence, but there were some exceptions, including a correlation between leukemia and atrazine (r=0.40) and brain cancer and atrazine (r=0.54) (14). risk of death in agricultural workers is twice as high as that in other fields. providing occupational health services, keeping medical records, monitoring agricultural workplaces, and improving quality and production of healthy agricultural products are important components in decreasing threats to farmers health (10). who has classified agricultural pesticides in three classes : in fact, who advocates the policy of restricting or banning use of class i pesticides and using fewer pesticides with minimum adverse health effects on individuals (7, 8, 15, and 16). therefore, given the high levels of pesticide usage, human exposure to these pesticides is almost inevitable, and can occur quite accidentally as a result disposal of pesticides and their containers into the environment (1720). the incidence of poisoning in developing countries is 13 times greater than that in industrial countries. according to iran s census bureau data, a total of 15,800 tonnes of pesticides were sold in 1996 ; 27,200 tonnes in 2001 ; and 20,890 tonnes in 2006. hence, it can be assumed that in the past half - century, approximately 1 million tonne pesticide has been imported into iran (21). agricultural activities are the main activity for people living in fasa, iran and are an important source of income for people in this region. the objectives of this research were to gather information about the demographic features of farmers, previous poisonings, and the extent of farmers knowledge on the use of pesticides and their hazards in the different counties and villages of fasa, fars province, iran. this cross - sectional study was carried out from march to july 2012 in the nobandegan and sheshdeh counties, and villages including miandeh, fedshkuyeh, senan, rahimabad, and others in the fasa suburban countryside. in fact, a total of 200 farmers were selected according to family records, a list of households with at least one member employed in agriculture (either as a main or secondary occupation). in this list, the household s numbers were recorded and proportionated to the village population ; necessary samples were selected (sheshdeh with 6204 people ; nobandegan with 2720 people ; villages, including miandeh, with 5603 people ; rahimabad with 646 people ; senan with 1832 people ; and fedshkuyeh with 4638 people). to collect data, an appropriate questionnaire designed by the authors was implemented. the information gathered included : demographic features (age, working experience, and education levels of farmers)agricultural products (barley, maize, wheat, canola, cotton, and sugar beet) and acreage under cultivationtype of used pesticides (organophosphate and organochlorine) and the purpose of pesticide use (controlling pests, insects and vermin)severity of reactions (acute and chronic toxicity of pesticides such as digestive response, eye response, motor response on the basis of hospital records and farmers interview)any history of poisoning with pesticides (on the basis of hospital admitting and farmers interview)pesticide spraying methods (man - carried motorized sprayer, tractor - carried sprayer, and hand - held sprayer)use of personal protection equipmentknowledge of adverse effects of pesticides (knowing about adverse effects of pesticides on human health, environment (air, water, and soil), and other species such as animals and plants) demographic features (age, working experience, and education levels of farmers) agricultural products (barley, maize, wheat, canola, cotton, and sugar beet) and acreage under cultivation type of used pesticides (organophosphate and organochlorine) and the purpose of pesticide use (controlling pests, insects and vermin) severity of reactions (acute and chronic toxicity of pesticides such as digestive response, eye response, motor response on the basis of hospital records and farmers interview) any history of poisoning with pesticides (on the basis of hospital admitting and farmers interview) pesticide spraying methods (man - carried motorized sprayer, tractor - carried sprayer, and hand - held sprayer) use of personal protection equipment knowledge of adverse effects of pesticides (knowing about adverse effects of pesticides on human health, environment (air, water, and soil), and other species such as animals and plants) the data was analyzed using descriptive statistical testing for determining the mean and standard deviation values with the spss 16 statistical software package (spss inc., chicago, illinois, united states of america). this cross - sectional study was carried out from march to july 2012 in the nobandegan and sheshdeh counties, and villages including miandeh, fedshkuyeh, senan, rahimabad, and others in the fasa suburban countryside. the cluster - sampling method was used to select farmers. in fact, a total of 200 farmers were selected according to family records, a list of households with at least one member employed in agriculture (either as a main or secondary occupation). in this list, the household s numbers were recorded and proportionated to the village population ; necessary samples were selected (sheshdeh with 6204 people ; nobandegan with 2720 people ; villages, including miandeh, with 5603 people ; rahimabad with 646 people ; senan with 1832 people ; and fedshkuyeh with 4638 people). the information gathered included : demographic features (age, working experience, and education levels of farmers)agricultural products (barley, maize, wheat, canola, cotton, and sugar beet) and acreage under cultivationtype of used pesticides (organophosphate and organochlorine) and the purpose of pesticide use (controlling pests, insects and vermin)severity of reactions (acute and chronic toxicity of pesticides such as digestive response, eye response, motor response on the basis of hospital records and farmers interview)any history of poisoning with pesticides (on the basis of hospital admitting and farmers interview)pesticide spraying methods (man - carried motorized sprayer, tractor - carried sprayer, and hand - held sprayer)use of personal protection equipmentknowledge of adverse effects of pesticides (knowing about adverse effects of pesticides on human health, environment (air, water, and soil), and other species such as animals and plants) demographic features (age, working experience, and education levels of farmers) agricultural products (barley, maize, wheat, canola, cotton, and sugar beet) and acreage under cultivation type of used pesticides (organophosphate and organochlorine) and the purpose of pesticide use (controlling pests, insects and vermin) severity of reactions (acute and chronic toxicity of pesticides such as digestive response, eye response, motor response on the basis of hospital records and farmers interview) any history of poisoning with pesticides (on the basis of hospital admitting and farmers interview) pesticide spraying methods (man - carried motorized sprayer, tractor - carried sprayer, and hand - held sprayer) use of personal protection equipment knowledge of adverse effects of pesticides (knowing about adverse effects of pesticides on human health, environment (air, water, and soil), and other species such as animals and plants) the data was analyzed using descriptive statistical testing for determining the mean and standard deviation values with the spss 16 statistical software package (spss inc., chicago, illinois, united states of america). endosulfan was a dominant organochlorine pesticide and is being phased out due to its acute toxicity and carcinogenic nature. in addition, the use of endosulfan has been banned (22). the dominant mode of spraying was tractor - carried sprayer machine (69%) and the second most common method was man - carried motorized sprayer (26%). thirty percent of participants used no personal protection equipment when spraying pesticides and only 32% used personal respiratory protection devices, such as masks, during the activity. it should be noted that farmers used only disposable masks, and others deemed covering their face with a veil to be sufficient. our findings also indicated that about 22.5% of participants had been poisoned on at least one occasion, with 16.25% going to the doctor at least once due to the adverse effects of pesticides, and with 2% being hospitalized at least once. regarding the extent of farmers knowledge of proper use of the pesticides, our findings indicated that only 22% of participants understood the instructions attached to the pesticide containers. overall, we found out that farmers knowledge about pesticides usage and associated adverse effects was extremely limited. forty - two percent of farmers disposed of the empty container in the farmlands and only 31% of them disposed of these containers in a healthy and environmentally friendly fashion. as shown in table 1, some farmers reported experiencing pesticide poisoning symptoms, including giddiness (50%) and nausea (23%). a major hurdle in the understanding of the adverse health effects of pesticides in agricultural occupational health is illiteracy and the lack of information available to farmers (7). the high rate of illiteracy among farmers leads to their lack of knowledge about the side effects of pesticides and methods to alleviate these side effects (8). it is highly recommended that training courses for farmers should be held to educate farmers on the side effects of pesticides, improve their knowledge, and to encourage them to acquiring literacy (7). the average age of participants (46.65) and high rate of illiteracy (55%) naturally accounts for their lack of knowledge and partially for their poor performance ; although, knowledge is necessary for proper performance, it is not sufficient and other factors such as cheap and affordable personal protection equipment need to be considered. furthermore, introduction of modern methods of controlling pests is necessary (8). the prevalence of symptoms was approximately 22.5%, according to participants self - reporting, which is quite high and consistent with related figures in developing countries (2324). reading and acting according to the instructions on the pesticide containers, using protective devices, keeping pesticides in the original containers, and buying only the amount you need may help to reduce exposure risks (25). eighty - six percent of the participants used organophosphorus based pesticides, a common and effective pesticide. it is recommended that in every region and depending on the importance and prevalence of using pesticides, instruction booklets should be prepared to make farmers familiar with pesticides, how to use them, and ways to minimize short- and long - term adverse effects under the supervision of a well - defined unit of experts (7). the booklets should be in persian, which will hopefully result in a better understanding of booklets. it should be noted that only a few people resorted to health and treatment centers after poisoning and only 38% of them are diagnosed as occupational poisoning. in many cases, applicators of the pesticides deem the symptoms related to poisoning as coming from fatigue, work pressures, and an integral part of the work, and hence, give little attention to poisoning (7, 8, and 26). as poisoning via mouth, respiration, and skin absorption is prevalent, and the symptoms often appear as acute poisoning, it seems that the severity of poisoning is higher than the predicted level, which necessitates more research. it is evident that the chronic and long - term effects of poisoning and symptoms, including nervousness, memory loss, dizziness and tremors, lend additional dimensions to the issue (27). attempts to regulate sale and use of pesticides, decreases in pesticide use and use of other anti - pest methods, changes public attitudes about pesticide - free products, providing cheap and affordable protective facilities, preparing proper educational material through mass media, training health workers, especially in villages, and education on poisoning symptoms and relevant first aid are recommended (2830). organic farming emphasizes on keeping the ecological balance and improving biological processes, which add to the sustainability of agricultural ecosystems (31). as mentioned before an extended study in 2004 in the us carried out on 18,782 farmers who using pesticides concluded that there was a link between neurological symptoms in farmers and the number of days when the farmer used pesticides. this research indicates that new strategies are needed to improve farmers work environment to prevent occupational hazards to the farmers. monitoring workers health and preparing and implementing proper regulations are essential parts of a program (7). our findings also showed that about 30% of participants did not use any personal protective devices. as using effective protection devices is an important approach to prevent poisoning, it is recommended that briefing sessions for farmers should be held to provide information about the ways to use personal protection devices and effects on their health. another issue is the lack of facilities for spraying farmers and employers neglect in providing these facilities. the farmers knowledge of pesticide use is lacking, given that 78% of them did not read and understand the container labels. this can be attributed to their highly specialized language or farmers illiteracy of foreign languages. illiteracy played an important role here. with preparing booklets and labels and holding briefing sessions in persian in a way that meets the farmers needs to understand the material, the issue could be solved to a great extent. given the environmental hazards of disposing of containers of pesticides, the issues of regulations, and the farmers lack of knowledge may give rise to further issues. by providing training for farmers about ways to burn or to dispose of these containers, important outcomes could be achieved. occupational and safety requirements and trainings could help to promote occupational safety and health in workplaces (32). in summary, given the toxicity and hazards of pesticides and their adverse effects on farmers health, effective measures should be adopted to decrease in the amount of pesticides used. conducting training programs for considering the carcinogenic effects of pesticides, it is suggested that the association of these factors is investigated in future studies. | background : with the growing global population, it is becoming increasingly difficult to ignore the demands for food and energy. a major portion of the food and energy is produced via agriculture and livestock activities. the objectives of this research are to gather information regarding the demographic features of farmers, previous poisoning, and the extent of farmers knowledge in the use of pesticides and associated hazards in different counties and villages in fasa, a city located in the fars province of iran.methods:this cross - sectional study was carried out from march to july 2012 in the nobandegan and sheshdeh counties, and villages including miandeh, fedshkuyeh, senan, rahimabad, and other places in the fasa suburban countryside. to collect data, an appropriate questionnaire was designed and implemented.results:a total of 200 farmers participated in the study. we found that 55% of farmers were illiterate. approximately 86% of used pesticides were organophosphorus compounds. around 30% of the farmers used no protective equipment while working with pesticides, and only 22% of farmers had read and understood the instructions on the pesticide containers.conclusion:given the toxicity and hazards of pesticides and their adverse effects on farmers health, effective measures should be adopted to decrease the amount of pesticides used. conducting training programs for farmers may help to reduce pesticide exposure risks. |
a finalidade do trabalho foi avaliar as alteraes da microdureza e o desgaste provocado pelo jato de bicarbonato de sdio em esmalte bovino e o posterior efeito remineralizador da saliva artificial. utilizaram - se 15 espcimes de esmalte (4,0 mm 4,0 mm) que constituram os grupos : sem tratamento (mi) ; tratamento com jato de bicarbonato de sdio (mii e di) ; tratamento com jato de bicarbonato de sdio e imerso em saliva artificial por uma hora (miii e dii), 24 horas (miv e diii) e sete dias (mv e div). foram realizados testes de microdureza com um microdurmetro nos grupos m e testes de desgaste com um rugosmetro nos grupos d. os dados foram avaliados pela anlise de varincia a um critrio e pelo teste de tukey. o valor das mdias da microdureza, em khn, nos grupos mi, mii, miii, miv e mv foram 359,80 ; 335,46 ; 369,20 ; 377,73 e 341,86 ; respectivamente, enquanto que os valores mdios, em m, do desgaste para o grupo di, dii, diii e div foram 0,564 ; 0,519 ; 0,441 e 0,428, respectivamente. o jato de bicarbonato de sdio causou desgaste e diminuio da microdureza superficial ; a saliva promoveu o retorno da microdureza superficial condio inicial e reduziu o desgaste ; o efeito reparador da saliva sobre as alteraes na microdureza superficial j ocorreu com uma hora de tratamento, no havendo diferena estatisticamente significante do efeito obtido com 24 horas ; o melhor efeito reparador da saliva sobre o desgaste ocorreu com 24 horas de tratamento. on the development of dental caries, bacterial plaque, plays an essential role, and thus, both the chemical and mechanical plaque control methods have been enphasized in modern dentistry. one of the available professional and prophylactic methods consists in employing a sodium bicarbonate jet, which acts promoting a mechanical remotion of plaque and also a polishing from the dental surfaces (professional prophylaxis). when a professional prophylaxis is carried out, a wear of the dental surface occurs. several studies4,12,13,16,19 have quantified the ocurrence of sound enamel wear, but there is no consence as to the results, although it is known that the wear is higher when the prophylaxis is performed on the previously demineralized enamel3,5,8. besides, there is a lack of information about the consequences related to this procedure on the superficial microhardness of enamel. however, it is known that when there is a mineral loss on a tooth, a remineralization by the action of saliva occurs 1,10,17. saliva contains in its composition the main components of dental structure, as calcium and phosphate having a protective action on enamel and dentine 11. although it is undoubtfull the benefit for caries prevention resulting from the plaque control, it is known that : the mechanical plaque remotion causes a certain wear of the enamel surface which quantification is not completely clarified yet ; there is a lack of information on what happens to the enamel microhardness submitted to the prophylaxis ; the enamel alterations originated from prophylaxis can be minimized by the remineralizator power of saliva, but it is still questionable how much of repair occurs and in which time span it occurs. the present study intended to contribute to a better understanding of those aspects having as a purpose : to evaluate in vitro whether the application of the sodium bicarbonate jet on bovine enamel promotes wear and reduction of its surface microhardness and which is the effect of artificial saliva, in different periods of action, on the repairing of the possible occurred alterations. after the remotion of the roots from 30 incisors bovine, the crowns were imbedded in thermoactivated godiva in a cristal acrilic plate, which has been coupled to a precision cutting device (isomet low speed saw). with the aid of two duble faced diamond discs xli 2205, " high concentration ", and a stainless steel spreader (7 cm diameter, 4 mm wide, and central orifice 1.3 cm) between the discs, 30 enamel specimens with 4 mm x 4 mm taken from the plane portion of the crown, making a double secction in cervico - incisal direction and other in the mesiodistal direction. then, the enamel blocks were fixed with sticking wax in the center of a cristal acrilic disc (30 mm x 8 mm), with the purpose of firstly perform the dentine planification. the set disc / tooth was adapted in a metalographic polishing device (apl4, arotec, cotia, sp). for the planification a carbide silicon sandpaper granulation 320 (extec corp.) following, the blocks were inverted and now fixed with the enamel placed on the upside face. the set was adapted to the polishing device and the enamel was polish with a carbide silicone sandpaper (extec corp.) granulation 600, and further with a granulation 1200 sandpaper. in order to finish the polishing, a wet felt with a diamond suspention of 1m (buehler), was used. the initial enamel surface microhardness was assessed using a microhardness measuring machine (hmv-2000/shimadzu corporation, japan) coupled to a microcomputer and a software specific for analysing images (cams - win - new age industries / usa). a knoop indenter was used, with static load of 25 g, applied for 5 seconds. in each sample the blocks which microhardness was 10% over or under the average of all blocks, and those whose standard deviation was 10% above the value of its own mean were discarted. from the 30 specimens, the research was carried out with the same 15 bovine enamel specimens wich were submited to surface microhardness and enamel wear tests. for the study related to the surface microhardness (m) and enamel wear (d) five groups of specimens were constituted, according to the stage of treatment they were, such as : mi group no treatment ; mii and di groups treatment with sodium bicarbonate jet ; groups miii and dii treatment with sodium bicarbonate jet and immersion in artificial saliva for one hour ; miv and diii groups - treatment with sodium bicarbonate jet and immersion in artificial saliva for 24 hours ; mv and div groups - treatment with sodium bicarbonate jet and immersion in artificial saliva for seven days. for the treatment with sodium bicarbonate jet, half of the surface of each specimen was protected with red nail polishing. on the other half was applied the sodium bicarbonate jet (dabi atlante industrias mdico odontolgicas ltda) with a distance of 5 mm from the bovine enamel, during 10 seconds, with a 90 angulation, without interruption. after this procedure, the nail polishing film was removed and, in this right moment, the specimens constituted the groups mii and di. the enamel surface was evaluated with a rugosimeter hommel tester t 1000 (hommelwerke, gmbh, alte tuttinger strebe 20 d-7730 vs schwenningen) which was connected to a microcomputer. with the aid of a equipment software (turbo datawin - nt version 1.34, copwright 2001), besides the rugosity data, the measurement was carried out in five different sites of each block and the mean was obtained. twenty ml of saliva were utilized which were individually stored in covered plastic vials, in incubator at 37 c, for different periods of time, constituting the groups miii and dii (1 hour), miv and diii (24 hours) and mv and div (7days). the obtained data were submmited to a statistical procedure by the variance analysis at one criterium and by the tukey test. the mean value (khn) of superficial microhardness of bovine enamel, in the diferent experiment estages, can be seen in table 1. same letters denote no statistically significant difference (p>0.05) by tukey test there was a statistically significant reduction in the enamel superficial microhardness following the treatment with sodium bicarbonate jet (mii), when compared to the initial superficial microhardness. data have shown that the permanency of the specimens in artificial saliva permited that the enamel surface microhardness, which was low after the prophylaxis (mii), has returned to the initial condition, because the values, both from group miii, and group miv as well as group mv, did not present statistically significant differences related to the values of initial surface microhadness (mi). considering the immersion period of time of the specimens in saliva, there was no statistically significant difference in enamel superficial microhardness in group miii (1 hour), compared to group miv (24 hours). table 2 contain the mean values (m) of the wear observed in bovine enamel, in the different phases of the experiment. same letters denote no statistically significant difference (p>0.05) by tukey test the simulation of prophilaxis (di) caused a enamel wear of 0.564 m which was repaired by the treatment with saliva. within one hour immersion of the specimens in saliva (dii) the wear value had reduced to 0.519 m, but the difference compared to the wear obtained following the prophylaxis simulation (di) was not statistically significant. the treatment with saliva for 24 hours (diii) and by seven days (div) presented better results, because the wear values in these groups were lower than the value found in the specimens immediately after the prophilaxis simulation procedure (di) at a level statistically significant. this research was carried out with the same 15 bovine enamel specimens which were submitted to sucessive treatments. the employed methodology permitted this procedure. in the wear testing, the rugosimeter was used, which does not alter the tested surface allowing the further performance of other stages of the experiment. in the microhardness test, the knoop indenter was used, which neither produces distortions nor damages the enamel structure15. these methods have made possible to evaluate sucessive alterations occurring in a same specimen. the enamel surface profile was evaluated by a rugosimeter. as the bovine enamel was polished, the surface outline not treated by the sodium bicarbonate jet was similar to a straight line and thus, the alteration of this line observed on the enamel expressed the result of the prophylaxis simulation. by the literature, it was possible to infer that, even though the enamel abrasion has not been considerable, it has been observed after prophylaxis procedures. although there is report of wear on the enamel of deciduous tooth with the sodium bicarbonate jet9, it was not verified abrasion in sound enamel of permanent tooth with this procedure 3,6,13,16. the wear caused by the sodium bicarbonate jet only occurred in human demineralized enamel3. as the human enamel is less porous than the bovine enamel 2,14,20, results of wear of both of them must not be compared without a careful understanding of this fact. in bovine enamel, it was evaluated the wear caused by the sodium bicarbonate. gerbo7 (1993) had observed no wear, whereas honrio8 (2003) and fraga5 (2005), verified the presence of rugosity, which was higher on enamel previously demineralized than on the sound enamel. in the present study, it was found a mean wear of 0.564m, following the simulation of prophylaxy with sodium bicarbonate jet. this value is higher than the one reported by honrio8 (2003), which was of 0.418m, and by fraga5 (2005) which verified a wear of 0.319 m. it is known that small alterations on the enamel surface can reflect in its physical properties, one of them is the microhardness. in this study the microhardness mean value of the initial bovine enamel surface, before any treatment, was 359.80 khn, very close to the value reported by newbrun ; timberlake ; pigman15 (1959), and higher than the value reported by fraga5 (2005) which was of 300.47 khn and lower compared to honrio8, wich was 394.0 khn. with the treatment of profylaxis simulation with sodium bicarbonate jet, the bovine enamel microhardness has reduced from 359.80 khn to 335.46 khn, being the difference statistically significant. there was, therefore a loss of enamel hardness. in a research carried out by fraga5 (2005) the application of the sodium bicarbonate jet has not altered the superficial microhardness of sound bovine enamel, but its mean value on the enamel presenting artificial carious lesion increased in a significant level, following the simulation of prophylaxis. it is difficult to explain how, working in similar conditions, there was a discordance of results as to the sound enamel surface microhardness observed in the present study as well as in fragas study5. the lack of previous studies in the literature, assessing the effect of sodium bicarbonate on the enamel related to the microhardness, impossibilitates a comparison of the values found in this research. this makes difficult to afirm if the result obtained here was the one expected or not. once that, in this in vitro study, alterations on the bovine dental enamel were found by the action of sodium bicarbonate jet, it is important to consider that if those alterations can occur in the clinical practice, although minimally, it can be expected the return to the initial conditions, simply by the fact that the tooth is constantly bathed by saliva. in the present study, the specimens were treated by artificial saliva by periods of one hour, 24 hours, and 7 days. these periods of time were based on the study carried out by fraga5 (2005) due to the lack of informations in the literature about the right moment when the effects of saliva can be detected in the repairing of the alterations resulting from the prophylaxis in sound enamel. fraga5 (2005) could not detect any alterations in the microhardness value in sound teeth subjected to the prophylaxis simulation with sodium bicarbonate jet. thus it is natural that the further treatment with saliva has not been reflected in this value. only with the immersion period in saliva for 28 days fraga5 (2005) obtained an alteration in wear and microhardness of enamel. in the present research, in which there was a reduction in initial microhardness value following the treatment with the sodium bicarbonate jet, when the specimens were immersed in saliva, it could really be verified its effect in the restitution of the tissue integrity. the specimens immersion in saliva, for just one hour, was enough for the microhardness to reach a value that was not different, statistically significant, from the initial value. the same has occurred with the immersion of the blocks in saliva for 24 hours and for 7 days, permiting to afirm that the repairing of the alterations generated by simulation prophylaxis already occurs, right after the contact with the saliva. the treatment with saliva also had a repairing effect on the wear. with one hour of the specimens immersion in saliva, the wear value of 0.564m caused by the prophylaxis simulation was reduced to 0.519m, although the difference has not been statistically significant. however the treatment with saliva by 24 hours, had an expressive reduction of wear, which value was 0.441 with statistically significant difference from the value found after the application of the sodium bicarbonate jet. there was no higher value in the result of wear with the extended period of immersion of the specimens in saliva for 7 days. great discrepancy was found between these results and the fragas results5 which study the immersion period of 4 hours in saliva was not sufficient to alter the microhardness and the wear of hygid bovine enamel. only with 28 days period of the specimens immersion in saliva, fraga5 (2005) however, the too long interval between the two observations (4 hours and 28 days) did not permit to know which was the period of time necessary to visualize an effect of treatment. the results of the current research are in agreement to the johansson10 (1965). the repairing effect of saliva, in the present work on the alterations on superficial microhardness and wear enamel was revealed in, at most, 24 hours, and, with the aditional time of 7 days no benefit was noted. in the study of johansson10 (1965) using demineralized human teeth, the remineralizing process by saliva occurred rapidly within the first 24 hours and there was no increment of mineral deposition with the immersion in saliva by a period of up to 3 weeks. a possible explanation for this fact is that, with the passing time, must occur an ionic difusion blocking toward the inner enamel, due to the mineral deposition in the most external layer. this immediate remineralizing of enamel, when saliva or artificial remineralizing solutions with high calcium concentration are used, was verified in a literature review carried out by silverstone19 (1977). also, gaard ; ten bosch18 (1994) observed in vivo that the remineralization in the presence of saliva is a relatively rapid process. although it is not known, in which extension, the obtained results can be transfered to the clinical reality, the indication that the remineralizing process occurs very fast, simply by the action of saliva, this fact gives the dentist reassurement to perform the professional prophylaxis how many times it is necessary. the application of sodium bicarbonate jet caused a wear and a reduction in the surface microhardness on bovine enamel. the repairing effect of saliva on the surface microhardness alterations has occured as fast as one hour of treatment, presenting no statistically significant difference from the effect obtained with 24 hours. the wear resulting from the application of sodium bicarbonate jet were repaired in, at most, 24 hours, following the immersion in artificial saliva. | purpose : the aim of the present study was to evaluate the alterations of surface microhardness and wear caused by the sodium bicarbonate jet on bovine enamel and the further remineralizing effect of artificial saliva.methods:fifteen enamel samples (4,0 mm 4,0 mm) were used, which constituted the groups : no treatment (mi) ; treatment with sodium bicarbonate jet (mii and di) ; treatment with sodium bicarbonate jet and immersion in saliva for one hour (miii and dii), 24 hours (miv and diii) and 7 days (mv and div). microhardness tests were carried out using a microdurometer in groups m and wear tests by a rugosimeter in groups d. the data were assessed by the one criterion variance analysis and tukey test.results:the mean value of microhardness, in khn, in groups mi, mii, miii, miv and mv were 359,80 ; 335,46 ; 369,20 ; 377,73 and 341,86, respectively, whereas the mean values in m, of wear for group di, dii, diii and div were 0,564 ; 0,519 ; 0,441 and 0,428, respectively.conclusions:the sodium bicarbonate jet caused a wear and a reduction in microhardness on the enamel surface ; saliva promoted the recovery of initial condition surface microhardness and reduced the wear ; the repairing effect of saliva on the surface microhardness alterations occurred within one hour of treatment, having no significant statistical difference from the effect obtained in 24 hours ; the best saliva repairing effect on the wear occurred with treatment of 24 hours. |
in august 2000, a 38-year - old thai man came to an outpatient department of king chulalongkorn memorial hospital, bangkok, with daily fever, headache, intermittent chill, sweating, and malaise for 4 days. his home was in a suburb of bangkok, where no malaria transmission has been reported. during the past few months before the present illness, he spent several few weeks in a hilly forest area in prachuap khiri khan province in southern thailand, 300 km from bangkok near the thai - myanmar border. he did not know of any underlying illness and had not experienced any previous malaria attacks. although he stayed in a cottage and slept inside a mosquito net, he remembered being bitten frequently by mosquitoes, especially at dusk and dawn. upon examination, his hemoglobin was 14.0 g / dl, hematocrit was 0.4, and erythrocyte count was 4.2 x 10 cells/l. levels of other laboratory investigations, including urinalysis, blood sugar, liver function test, blood urea nitrogen, and creatinine, were normal. examination of giemsa - stained thin blood films showed 10% young trophozoites, 45% growing trophozoites, 40% schizonts, and 5% gametocytes (n = 300). the parasite structure was compatible with that of p. malariae. the parasite density inferred from the number of malarial parasites per 500 leukocytes in thick blood smear yielded 1,155/l or equivalent to parasitemia 0.03%. the patient was treated with 10 mg / kg of oral chloroquine initially, followed by 5 mg / kg, 6 hours later on the day 1, and 5 mg / kg / day for the next 2 days. on day 2, with a temperature of 37.5c, he came to the hospital. meanwhile, we recently evaluated a dna - based diagnostic method by the polymerase chain reaction (pcr) targeting the small subunit ribosomal rna (ssu rrna) genes of all four species of human malaria as reported (8). ten isolates each for p. falciparum, p. vivax, and p. malariae and four isolates of p. ovale were used as positive controls. results showed that all isolates gave concordant positive pcr products with those diagnosed by microscopy except an isolate from this patient (data not shown). retrospective examination of blood smears has shown several developmental stages of malaria parasites similar to those typically seen in p. malariae. however, some erythrocytes that harbored mature asexual parasites possessed fimbriated margins. the cytoplasm of some young trophozoites appeared spread out into the network of irregular pseudopodia, and the chromatin was distributed into fragments, conforming to the tenue forms. pinkish dots varying from fine to large irregular masses called sinton and mulligan 's stippling developed intracorpuscularly with the maturation of some parasites (figure 1). giemsa - stained thin blood films depicting a) ring stage, b) tenue form of young trophozoite, c) band - shaped growing trophozoite, d) growing trophozoite with little or no amoeboid activity, e) double growing trophozoites, f) early schizont, g) late schizont in an erythrocyte with fimbriated margins, and h) mature macrogametocyte. discernible sinton and mulligan stippling is in c, d, and f. to elucidate the species of malaria infecting our patient, we determined the ssu rrna gene by using similar methods as described by others (9), except that extaq dna polymerase (takara, japan), pgem - t vector (promega, usa), and escherichia coli strain jm109 were used. results showed that the ssu rrna sequence contained 97.8% to 99.6% homology with those of p. knowlesi transcribed during asexual stages or the type a gene (genbank accession no. nucleotide sequence data reported in this study are available in the embl, genbank, and ddjb databases under the accession no. phylogenetic tree showed that p. knowlesi in this study was closely related to the w1 and nuri strains, although its divergence from malaysian human isolates was not supported by bootstrap analysis (figure 2). consistently, the mitochondrial cytochrome b gene of this isolate, determined by the methods similar to previous report except the pcr primers (mtpk - f:5-aggtattatattctttatacaaatattaac-3 and mtpk - r:5-tcttttataatgaacaagtgtaaataatc-3), displayed perfect sequence identity with that of p. knowlesi strain h from monkey (af069621) (4). neighbor - joining tree based on the asexually transcribed ssu rrna sequences displaying the phylogenetic position of isolate a1 in this study in relation to other plasmodium knowlesi isolates (ay327549-ay327556 from humans, and l07560, u72542, and ay327557 from monkeys) and p. fragile (m61722). p. knowlesi is prevalent among crab - eating macaques, macaca fascicularis, in the malaysian peninsula and the philippines (2,10). other known natural hosts include pig - tailed macaques, m. nemestrina, and leaf monkeys, presbytis melalophos (2,10). (11) had shown that p. knowlesi isolated from monkey could be infectious to humans, the first naturally acquired human infection with p. knowlesi was not reported until 1965 (6) ; the patient was infected in a malaysian forest. in 1971 the second case, albeit presumptive, occurred in a man who also acquired the infection in a forest in malaysia (12). recently, a large cluster of human infections caused by p. knowlesi has been identified from malaysian borneo (9). our report has expanded the geographic range for natural transmission of p. knowlesi to a forest in thailand near southern myanmar border, where wild populations of crab - eating macaques, despite being considered endangered, are still substantial. the prevalence of naturally acquired primate malaria in humans can be underestimated from examination of blood films. the reported abundance of ring stages of p. knowlesi found in the first naturally acquired human case led to the initial diagnosis of p. falciparum, while the mature parasites could masquerade as those of p. malariae, as we encountered in this patient (6). although structural descriptions of young trophozoites of p. knowlesi have been delineated, we were unable to find the ring form with double chromatin dots (9). conversely, a few young trophozoites resembled the tenue forms, proposed by stephens in 1914 (13) to be a distinct species. however, the tenue form has recently been recognized to be a p. malariae variant found in myanmar (8). the presence of the tenue form in the blood smears of our patient, despite the low number, rather suggests a shared structural feature among species of malaria. the possibility of coinfection between p. knowlesi with one or more of the four human malaria species was not supported by our pcr detection. the structure of p. knowlesi is highly dependent on the host erythrocytes, i.e., resembling p. vivax in m. fascicularis, p. falciparum in rhesus monkeys, and p. malariae in humans (2,9,11,12). although stippling was not seen among p. knowlesi infected blood smears of sarawak 's patients, the presence of sinton - mulligan stippling in infected erythrocytes in this study is in accord with the report by fong., in which erythrocytic stippling served as one of the diagnostic feature (9,12). such discrepancy could partly arise from differences in the condition for giemsa staining, infecting parasite strains, or both. the complete asexual erythrocytic cycle of p. knowlesi in human and its natural macaque host requires 24 hours, coinciding with a quotidian fever pattern. however, fever pattern per se may not be a precise indicator for differentiating malaria caused by p. knowlesi and p. malariae. although the merogony cycle of p. malariae has been generally known to be 72 hours, fever patterns might not be strictly quartan (14). meanwhile, the preexisting immunity to p. vivax has reportedly conferred partial resistance to induced infection during malariotherapy (2). whether naturally acquired immunity against p. vivax can reduce symptoms in p. knowlesi infection requires further investigation. to date, little is known about the extent of variation in the p. knowlesi population. analysis of the ssu rrna gene from the isolate in this study has shown minor difference from those of p. knowlesi from monkeys and patients in malaysian borneo (3,9). evidence from malariotherapy showed that p. knowlesi could lose or increase its virulence on blood passage in humans, which suggests that strain difference could occur in wild populations and might effect humans differently (2). in conclusion, p. knowlesi could contribute to the reemergence of simian malaria in thailand and southeast asia, where its vectors, anopheles leucosphyrus group, are abundant (15). | we describe a case of naturally acquired infection with plasmodium knowlesi in thailand. diagnosis was confirmed by the small subunit ribosomal rna and the mitochondrial cytochrome b sequences. the occurrence of simian malaria in human has signified the roles of wild primate populations in disease transmission in some malaria - endemic areas. |
despite continuous progress in cancer treatment, lung cancer remains the most common cause of cancer - related deaths in korea as well as worldwide. although the overall survival (os) rate has gradually improved, lung cancer still has a high mortality rate because local and distant failures are common. non - small cell lung cancer (nsclc) is a heterogeneous group of diseases that accounts for about 80%of lung cancer cases. although surgery can be curative at the early stages of nsclc, the majority of patients with nsclc may already be in a locally advanced stage that is not amenable to curative resection at diagnosis. historically, thoracic radiotherapy has played a major role in the management of locally advanced nsclc, and many prospective clinical trials [3 - 5 ] have established the benefits of incorporating chemotherapy with radiotherapy over radiotherapy alone. in recent years, the improvement in survival rates has been attributed to the development of modern chemotherapeutic agents and advances in radiation therapy techniques which improved local tumor control without significantly increasing radiation - related morbidity there are some variations in the standard of care for patients with locally advanced disease. while surgery can be the treatment of choice for selected n2 positive patients, a neoadjuvant treatment scheme may be used for potentially resectable diseases. other treatment options, such as induction chemotherapy followed by chemoradiation, chemoradiation followed by consolidation chemotherapy or preoperative chemoradiation followed by surgery can be used, but outcomes have not been established. there are frequently encountered problems such as gross residual diseases after surgical resection, especially in stage iii patients, or locally recurrent disease. in patients with a good performance status, aggressive treatment, such as concurrent chemoradiation, some reports have shown that the survival of patients with locally recurrent nsclc is comparable to that of patients initially diagnosed with locally advanced nsclc. furthermore, there has been a study reporting that patients with locally recurrent nsclc who were treated with curative intent survived much longer than those who were treated with palliative intent. in the current study, we retrospectively analyzed treatment results, clinical responses, toxicities, and prognostic factors associated with the os of patients who received concurrent chemoradiation for locally advanced stage iii nsclc, postoperative gross residual diseases, and locally recurrent nsclc. mary 's hospital lung cancer multidisciplinary treatment team enrolled 55 patients who were histologically confirmed as having nsclc. this included locally advanced stage iii nsclc, postoperative gross residual diseases, and locally recurrent nsclc. among these 55 patients all patients had pathologically confirmed measurable disease, an eastern cooperative oncology group performance status (ecog ps) of 0 - 2, and acceptable pulmonary, bone marrow, liver and renal functions. for stage evaluation, patients underwent a chest x - ray, computed tomography (ct) scans of the chest including upper abdomen, bronchoscopy, and positron emission tomography / computed tomography (pet / ct). tc-99 m whole body bone scans, whole abdominal ct scans, and magnetic resonance imaging of the brain were selectively performed when clinically indicated. mediastinoscopy was not routinely done ; it was performed in 6 of 28 patients in the definitive chemoradiation group to discriminate between n2 and n3 diseases. all patients underwent ct simulation for three - dimensional conformal radiotherapy planning, and radiation was delivered with 6 mv to 15 mv of photon beam energy by linac - based radiation units. the total radiation dose was 16 - 66.4 gy (median, 59.4 gy), and the fractional size of 1.8 or 2 gy was prescribed 5 times a week. the gross tumor volume (gtv) was defined as the primary tumor mass plus the involved lymph nodes. the clinical target volume (ctv) was defined as the gtv plus a 3-d expansion of 0.5 - 1 cm including the ipsilateral hilum. the planning target volume (ptv) was defined as the ctv plus a 1 cm expansion circumferentially and a 1 - 2 cm expansion in the superior - inferior directions. dose limits for normal tissue were as follows : spinal cord received45 - 49 gy (at any point), the lung volume received20 gy (v20)25 - 30%, and a mean lung dose (mld)18 - 20 gy. beam arrangement was planned to minimize the irradiated lung volume usually using 3 to 5 coplanar oblique beams. some patients having a bulky tumor were treated with an anteroposterior - posteroanterior field to include the ctv for the first 30 - 40 gy, followed by off - cord oblique beams usually composed of 3 - 5 beams. boost field to gtv with reduced margin was routinely used after 46 - 50 gy. chemotherapy was administered weekly using one of the following regimens : cisplatin (30 mg / m), paclitaxel (60 mg / m), docetaxel (20 mg / m) plus cisplatin (20 mg / m). when hematologic toxicity was severe during treatment, chemotherapy administration was delayed based on the medical oncologist 's decision. consolidation chemotherapy was administered 4 weeks after the finish of the chemoradiation course by the following regimens : 2 - 4 cycles of docetaxel and cisplatin in 8 patients, 4 cycles of paclitaxel and cisplatin in 4 patients, and 1 cycle of gemcitabine and carboplatin in 1 patient. blood chemistry and a complete blood count were obtained weekly, or more frequently, if needed during the treatment periods. we performed chest ct and/or pet / ct for the evaluation of treatment responses between 4 and 12 weeks after the end of the chemoradiation treatment course. the world health organization (who) criteria were used for response evaluations. these consisted of complete response (cr), partial response (pr), stable disease (sd) or progressive disease (pd). acute toxicity was assessed using the national cancer institute common toxicity criteria (nci ctcae) ver. os was defined as the time from the histologically confirmed date to the date of death or to the patient 's last visit. progression free survival (pfs) was defined as the time from the histologically confirmed date to the date of disease progression or the date of the patient 's last visit. in case of locally recurrent disease, a starting point for the calculation of os or pfs was the date on which recurrence was confirmed by serial radiologic findings, or histologically if specimens were available. for statistical analysis, spss ver.12.0 (spss inc., chicago, il) was used. a log - rank test was used to compare survival differences between treatment groups, and the cox proportional hazards regression model was used to identify independent prognostic factors and to determine the impact of factors on os. mary 's hospital lung cancer multidisciplinary treatment team enrolled 55 patients who were histologically confirmed as having nsclc. this included locally advanced stage iii nsclc, postoperative gross residual diseases, and locally recurrent nsclc. among these 55 patients all patients had pathologically confirmed measurable disease, an eastern cooperative oncology group performance status (ecog ps) of 0 - 2, and acceptable pulmonary, bone marrow, liver and renal functions. for stage evaluation, patients underwent a chest x - ray, computed tomography (ct) scans of the chest including upper abdomen, bronchoscopy, and positron emission tomography / computed tomography (pet / ct). tc-99 m whole body bone scans, whole abdominal ct scans, and magnetic resonance imaging of the brain were selectively performed when clinically indicated. mediastinoscopy was not routinely done ; it was performed in 6 of 28 patients in the definitive chemoradiation group to discriminate between n2 and n3 diseases. all patients underwent ct simulation for three - dimensional conformal radiotherapy planning, and radiation was delivered with 6 mv to 15 mv of photon beam energy by linac - based radiation units. the total radiation dose was 16 - 66.4 gy (median, 59.4 gy), and the fractional size of 1.8 or 2 gy was prescribed 5 times a week. the gross tumor volume (gtv) was defined as the primary tumor mass plus the involved lymph nodes. the clinical target volume (ctv) was defined as the gtv plus a 3-d expansion of 0.5 - 1 cm including the ipsilateral hilum. the planning target volume (ptv) was defined as the ctv plus a 1 cm expansion circumferentially and a 1 - 2 cm expansion in the superior - inferior directions. dose limits for normal tissue were as follows : spinal cord received45 - 49 gy (at any point), the lung volume received20 gy (v20)25 - 30%, and a mean lung dose (mld)18 - 20 gy. beam arrangement was planned to minimize the irradiated lung volume usually using 3 to 5 coplanar oblique beams. some patients having a bulky tumor were treated with an anteroposterior - posteroanterior field to include the ctv for the first 30 - 40 gy, followed by off - cord oblique beams usually composed of 3 - 5 beams. boost field to gtv with reduced margin was routinely used after 46 - 50 gy. chemotherapy was administered weekly using one of the following regimens : cisplatin (30 mg / m), paclitaxel (60 mg / m), docetaxel (20 mg / m) plus cisplatin (20 mg / m). when hematologic toxicity was severe during treatment, chemotherapy administration was delayed based on the medical oncologist 's decision. consolidation chemotherapy was administered 4 weeks after the finish of the chemoradiation course by the following regimens : 2 - 4 cycles of docetaxel and cisplatin in 8 patients, 4 cycles of paclitaxel and cisplatin in 4 patients, and 1 cycle of gemcitabine and carboplatin in 1 patient. blood chemistry and a complete blood count were obtained weekly, or more frequently, if needed during the treatment periods. we performed chest ct and/or pet / ct for the evaluation of treatment responses between 4 and 12 weeks after the end of the chemoradiation treatment course. the world health organization (who) criteria were used for response evaluations. these consisted of complete response (cr), partial response (pr), stable disease (sd) or progressive disease (pd). acute toxicity was assessed using the national cancer institute common toxicity criteria (nci ctcae) ver. os was defined as the time from the histologically confirmed date to the date of death or to the patient 's last visit. progression free survival (pfs) was defined as the time from the histologically confirmed date to the date of disease progression or the date of the patient 's last visit. in case of locally recurrent disease, a starting point for the calculation of os or pfs was the date on which recurrence was confirmed by serial radiologic findings, or histologically if specimens were available. for statistical analysis, spss ver.12.0 (spss inc., chicago, il) was used. a log - rank test was used to compare survival differences between treatment groups, and the cox proportional hazards regression model was used to identify independent prognostic factors and to determine the impact of factors on os. the number of patients in each treatment group was as follows : 28 in locally advanced stage iii nsclc, 11 in postoperative gross residual disease, and 12 in locally recurrent nsclc. the median age was 63 years (range, 40 to 79 years), and 82.4% of patients were male. the majority of patients had an ecog ps score of 0 - 1 (92.1%), and the distribution of histology findings were squamous cell carcinoma (54.9%) and adenocarcinoma (33.3%). stage was determined by the 6th edition of the american joint committee on cancer (ajcc) staging system. if pathologic specimens were available, we used pathologic stages for tumor - node - metastasis (tnm) staging. the distribution of clinical stages was as follows : iiia (37.3%), iiib (56.9%). four patients were treated with radiation doses of less than 50 gy, which was inappropriate for achieving an optimal radiation effect. in one patient, treatment was discontinued after 16 gy of radiotherapy because acute dyspnea developed after 2 cycles of concurrent chemoradiation. these symptoms were probably due to a hypersensitivity reaction to the chemotherapeutic agent. in another patient, treatment was discontinued after 42 gy of radiotherapy because abrupt pneumothorax developed during treatment. in the remaining 2 patients, treatment - related toxicities were not severe, but the treatment was discontinued after their respective radiation doses of 32.4 gy and 46.8 gy by patient decision because of poor general conditions or other reasons. the median number of chemotherapy cycles during the concurrent chemoradiation treatment was 6 (range, 2 - 8). forty - five patients (88.2%) were treated with at least 6 cycles of chemotherapy. response evaluation was done by chest ct with or without pet / ct. the number of patients with a response evaluation at 1 month after the end of chemoradiation was 8. the overall response rate (cr+pr) was 84.3% (n=43), including 23 cr (45.1%). the postoperative gross residual group showed a relatively high cr rate (81.8%), probably due to the reduced tumor burden after surgical resection. there was no difference in the overall response rates among different chemotherapeutic regimens (p=0.194). at the time of this analysis tumors recurred in the following sites : locoregional sites (23.6%) and distant organs (27.5%). all of the patients with recurrent disease received palliative treatments including chemotherapy, molecular targeted therapy or localized radiotherapy. the median follow - up duration in the entire population was 40.8 months (range, 3 to 69.9 months). the median pfs in the entire population was 12.5 months, and the 1-year and 2-year pfs rates were 51% and 23%, respectively. there was no statistically significant difference between treatment groups (p=0.583) (figs. 2 and 3). the median os in the entire population was 17.6 months, and the 2-year and 3-year os rates were 42% and 17.8%, respectively. median survival was different between treatment groups but not statistically significant (p=0.638) (figs. 2 and 3). the results of univariate and multivariate analysis affecting os in the entire population are shown in table 3. the covariables were gender, age, histologic type, ecog ps score, number of chemotherapeutic agents, chemotherapeutic regimen, clinical tumor response, t stage, n stage, clinical stage and tumor size. in the univariate analysis, a better ecog ps score (0 vs. 1 - 2, p=0.042) and higher clinical tumor response (cr+pr vs. sd+pd, p=0.002) were significantly associated with improved os, and a trend was detected that patients with<65 years had better survival than those with65 years (p=0.062). among these factors, clinical tumor response (p=0.002) was the only independent factor associated with improved os in the multivariate analysis. kaplan - meier os curves stratified by clinical tumor response in the overall patients group is shown in fig. 4. we performed subgroup analysis of the definitive chemoradiation arm to evaluate prognostic factors. this analysis included age, gender, histologic type, ecog ps score, number of chemotherapeutic agents, chemotherapeutic regimen, t stage, n stage, clinical stage, tumor size, use of consolidation chemotherapy, total radiation dose, which was converted into biologically equivalent dose (bed), and clinical tumor response. among these factors, the use of consolidation chemotherapy (p=0.042), bed1070 (p=0.011) and higher clinical response (p=0.0049) were significantly associated with improved os in the univariate analysis. in the multivariate analysis, the use of consolidation chemotherapy (p=0.022), bed1070 (p=0.007), and higher clinical tumor response (p=0.030) were the independent prognostic factors associated with improved os. the results of univariate and multivariate analyses of the definitive chemoradiation arm are shown in table 4 and kaplan - meier os curves stratified by clinical tumor response, bed10 and use of consolidation chemotherapy are shown in fig. the incidence of neutropenia (grade 3) and esophagitis (grade 3) were 31.4% and 27.5%, respectively. the volume of lung that received 20 gy (v20) were 31% and 41%, and 30 gy (v30) were 24% and 32%, respectively. one death was caused by viral pneumonia superimposed on acute radiation pneumonitis during hospitalization around 1 month after the end of the treatment. another patient died of acute respiratory distress syndrome during hospitalization 3 months after the end of treatment. chronic esophageal toxicities were observed in 2 patients who presented with esophageal stricture and fistula, respectively. the number of patients in each treatment group was as follows : 28 in locally advanced stage iii nsclc, 11 in postoperative gross residual disease, and 12 in locally recurrent nsclc. the median age was 63 years (range, 40 to 79 years), and 82.4% of patients were male. the majority of patients had an ecog ps score of 0 - 1 (92.1%), and the distribution of histology findings were squamous cell carcinoma (54.9%) and adenocarcinoma (33.3%). stage was determined by the 6th edition of the american joint committee on cancer (ajcc) staging system. if pathologic specimens were available, we used pathologic stages for tumor - node - metastasis (tnm) staging. the distribution of clinical stages was as follows : iiia (37.3%), iiib (56.9%). four patients were treated with radiation doses of less than 50 gy, which was inappropriate for achieving an optimal radiation effect. in one patient, treatment was discontinued after 16 gy of radiotherapy because acute dyspnea developed after 2 cycles of concurrent chemoradiation. these symptoms were probably due to a hypersensitivity reaction to the chemotherapeutic agent. in another patient, treatment was discontinued after 42 gy of radiotherapy because abrupt pneumothorax developed during treatment. in the remaining 2 patients, treatment - related toxicities were not severe, but the treatment was discontinued after their respective radiation doses of 32.4 gy and 46.8 gy by patient decision because of poor general conditions or other reasons. the median number of chemotherapy cycles during the concurrent chemoradiation treatment was 6 (range, 2 - 8). forty - five patients (88.2%) were treated with at least 6 cycles of chemotherapy. response evaluation was done by chest ct with or without pet / ct. the number of patients with a response evaluation at 1 month after the end of chemoradiation was 8. the overall response rate (cr+pr) was 84.3% (n=43), including 23 cr (45.1%). the postoperative gross residual group showed a relatively high cr rate (81.8%), probably due to the reduced tumor burden after surgical resection. there was no difference in the overall response rates among different chemotherapeutic regimens (p=0.194). at the time of this analysis, recurrence has been observed in 21 patients (41%). the distribution of the first site of recurrence is shown in fig. tumors recurred in the following sites : locoregional sites (23.6%) and distant organs (27.5%). all of the patients with recurrent disease received palliative treatments including chemotherapy, molecular targeted therapy or localized radiotherapy. the median follow - up duration in the entire population was 40.8 months (range, 3 to 69.9 months). the median pfs in the entire population was 12.5 months, and the 1-year and 2-year pfs rates were 51% and 23%, respectively. there was no statistically significant difference between treatment groups (p=0.583) (figs. 2 and 3). the median os in the entire population was 17.6 months, and the 2-year and 3-year os rates were 42% and 17.8%, respectively. median survival was different between treatment groups but not statistically significant (p=0.638) (figs. 2 and 3). the results of univariate and multivariate analysis affecting os in the entire population are shown in table 3. the covariables were gender, age, histologic type, ecog ps score, number of chemotherapeutic agents, chemotherapeutic regimen, clinical tumor response, t stage, n stage, clinical stage and tumor size. in the univariate analysis, a better ecog ps score (0 vs. 1 - 2, p=0.042) and higher clinical tumor response (cr+pr vs. sd+pd, p=0.002) were significantly associated with improved os, and a trend was detected that patients with<65 years had better survival than those with65 years (p=0.062). among these factors, clinical tumor response (p=0.002) was the only independent factor associated with improved os in the multivariate analysis. kaplan - meier os curves stratified by clinical tumor response in the overall patients group is shown in fig. 4. we performed subgroup analysis of the definitive chemoradiation arm to evaluate prognostic factors. this analysis included age, gender, histologic type, ecog ps score, number of chemotherapeutic agents, chemotherapeutic regimen, t stage, n stage, clinical stage, tumor size, use of consolidation chemotherapy, total radiation dose, which was converted into biologically equivalent dose (bed), and clinical tumor response. among these factors, the use of consolidation chemotherapy (p=0.042), bed1070 (p=0.011) and higher clinical response (p=0.0049) were significantly associated with improved os in the univariate analysis. in the multivariate analysis, the use of consolidation chemotherapy (p=0.022), bed1070 (p=0.007), and higher clinical tumor response (p=0.030) were the independent prognostic factors associated with improved os. the results of univariate and multivariate analyses of the definitive chemoradiation arm are shown in table 4 and kaplan - meier os curves stratified by clinical tumor response, bed10 and use of consolidation chemotherapy are shown in fig. hematologic and esophageal toxicity were major acute toxicities. the incidence of neutropenia (grade 3) and esophagitis (grade 3) were 31.4% and 27.5%, respectively. the volume of lung that received 20 gy (v20) were 31% and 41%, and 30 gy (v30) were 24% and 32%, respectively. one death was caused by viral pneumonia superimposed on acute radiation pneumonitis during hospitalization around 1 month after the end of the treatment. another patient died of acute respiratory distress syndrome during hospitalization 3 months after the end of treatment. chronic esophageal toxicities were observed in 2 patients who presented with esophageal stricture and fistula, respectively. after many randomized trials revealed that the integration of systemic chemotherapy with radiotherapy would be more beneficial than radiotherapy alone [3 - 5 ], combination chemoradiation, especially concurrent chemoradiation rather than sequential chemoradiation, has become one of the standard treatments. recently, the intergroup 0139 study showed improved survival with preoperative chemoradiation followed by surgery over definitive chemoradiation in iiia - n2 nsclc when lobectomy was possible. this neoadjuvant chemoradiation protocol can be used to treat selected minimal n2 nsclc patients who become resectable. however, additional trials with more population - based studies would be required to show conclusive results. in the current study, we analyzed the treatment results of 3 different groups : locally advanced stage iii nsclc, postoperative gross residual disease, and locally recurrent nsclc. the median os time for all patients was 17.6 months, and the 2-year and 3-year os rates were 42% and 17.8%, respectively. those treatment outcomes are comparable with previous reports [7 - 11,18 ]. among the different groups, the clinical development of third generation chemotherapy showed potent radiosensitization effects, and those chemotherapeutic agents are commonly used with radiotherapy in the definitive chemoradiation setting. the proportion of patients in our study receiving combined taxane chemotherapy (paclitaxel or decetaxel) was 82.4%, which was a very high frequency. however, differences in a number or regimen of chemotherapeutic agent (single vs. double, taxane vs. non - taxane, platinum vs. non - platinum) did not affect os significantly (table 3). our study showed different median survival durations between treatment groups : 17.6 months in full analysis patients, 13.2 months in the definitive chemoradiation group, 26.4 months in the locally recurrent group, and 23.9 months in the postoperative gross residual group. in the definitive chemoradiation group, this was probably due to the fact that most of the patients enrolled in our study were in stage iiib (71.4%), and a few of those patients had shorter follow up periods. we compared the effect of the total radiation dose on os between two groups of patients-9 patients who received 66 gy and another 12 patients who were treated with 59 - 60 gy. however, we found that there was no significant difference in os between the two groups. this lack of significance might be due to the small sample size of the group or the narrow range of total radiation dose differences between the two groups. therefore, re - evaluation with longer follow up of larger sample sizes will be required for more definitive conclusions. in the locally recurrent group, we noted reliably longer os with a non - inferior outcome when compared with the initially diagnosed locally advanced nsclc group. this was supported by the several previous studies, which implies that aggressive treatment such as concurrent chemoradiation or dose escalation radiotherapy would result in improved survival in locally recurrent cases. among 12 locally recurrent patients in our study, two had only bronchial stump recurrence and ten had mediastinal lymph node recurrence with or without bronchial stump recurrence. there have been a few studies reporting that bronchial stump recurrence has better prognosis than cases combined with mediastinal lymph node recurrence or chest wall invasion. the median survival was 26 months in the radical intent group and 10.5 months in the palliative intent group. although we included the majority of mediastinal lymph node recurrences, our patients had relatively long os durations. our concurrent chemoradiation scheme might contribute to this outcome, and this scheme could be justified for locally recurrent cases, especially those with mediastinal lymph node recurrences. further studies are now required to define the beneficial role of combining chemotherapy with radiotherapy in loco - regionally recurrent nsclc. however, there were 2 toxic deaths associated with radiation pneumonitis, 1 - 3 months after completion of chemoirradiation in 2 elderly patients, which suggests that a careful evaluation of pulmonary function and close follow up will be needed after treatment in an immune - suppressed host. in the analysis of prognostic factors, the clinical tumor response was significantly associated with os not only in the entire patient cohort, but also in the definitive chemoradiation group. however, we could not find any significant factors associated with good responses such as total radiation dose, chemotherapeutic regimen, tnm stage or histologic type. from the fact that the reduced tumor burden after surgery resulted in a relatively high cr rate (81.8%), we can only infer that the tumor burden (tumor volume) could be a significant factor. in our study, the t or n stage was not associated with the response rate, and this may be due to a small sample size. there have been significant advances in molecular biology, and these will help pinpoint the factors associated with responses to therapy. there are several known pre - treatment prognostic factors associated with os in nsclc such as weight loss, tumor stage, performance status and pulmonary function. we could n't examine all of these factors due to the limitations of a retrospective study. however, among the pre - treatment factors, ecog ps was the most strongly associated with os. in subgroup analysis of the definitive chemoradiation group, the use of consolidation chemotherapy, bed1070, and higher clinical tumor response were the independent prognostic factors that improved os. furthermore, our subgroup analysis of locally recurrent and postoperative gross residual diseases indicated that clinical tumor response and ps are significant prognostic factors affecting os (data not shown). this means that more radical tumor control will eventually be connected to improved survival in nsclc. in the swog 9504 trial, concurrent chemoradiation with etoposide - cisplatin followed by consolidation docetaxel were administered to stage iiib patients. the result was encouraging with a median survival time of 26 months, and 3-year and 5-year survival rate were 37% and 29%, respectively. after the swog 9504 trial, several phase iii randomized trials were conducted to define the role of consolidation chemotherapy in locally advanced nsclc. however, different results were shown among the studies, and some studies showed a relatively high frequency of high - grade hematologic and esophageal toxicities. in the most recently reported interim analysis of a multinational phase iii randomized trial (cchein), consolidation chemotherapy with docetaxel plus cisplatin (dp) after concurrent chemoradiation (ccrt) with weekly dp was shown to be feasible and tolerable, but there were no statistically significant differences in time to progression and median os between observation and consolidation arms. as a result, further investigations are needed to precisely define the role of consolidation chemotherapy after ccrt in locally advanced nsclc. we would cautiously infer that stage iiib patients with good ps will benefit mostly from the consolidation chemotherapy. in the same context, our study showed that the benefit of consolidation chemotherapy was probably due to the high proportion of iiib patients in the definitive chemoradiation arm. to further evaluate the radiation dose effect, we calculated bed using an /ratio of 10 because the fractional size was different. however, some patients treated with a less than optimal radiation dose were included in the study, and we did not apply a time factor in calculating bed. thus, a follow up study including a larger cohort should be performed. in our study, patients treated with bed1070 showed a better os when compared to those with bed1070, and this was the independent prognostic factor associated with improved os in the multivariate analysis (hazard ratio, 6.184 ; 95% confidence interval, 1.644 to 23.259 ; p=0.007). this result needs careful interpretation : it should be interpreted as the optimal minimum dose to get the radiation effect attributed to improving overall survival, not the appropriate radiation dose in the ccrt setting. many clinical trials have been performed with a radiation dose of 60 - 74 gy, and the optimal radiation dose in concurrent chemoradiation setting remains unclear. although some studies showed that a higher radiation dose may be correlated with improved local control and os, the results of the ongoing phase iii intergroup study (rtog 0617) (60 gy vs. 74 gy) will more definitively identify the additional role of a higher radiation dose in the chemoradiation setting. the current study demonstrated that ecog ps and clinical tumor response were the independent prognostic factors despite heterogeneous composition of the subgroups. in subgroup analysis of the definitive chemoradiation group, the use of consolidation chemotherapy, bed1070 and higher clinical tumor responses were the independent prognostic factors correlated with the improved os. in locally recurrent nsclc, however, our study needs a longer follow up with more population group for more precise outcomes. further investigations would be required to define the factors associated with improving tumor response, the role of optimal radiation dose in definitive chemoradiation setting, and the optimal treatment scheme in locally recurrent nsclc. | purposeto evaluate treatment outcomes and prognostic factors in non - small cell lung cancer (nsclc) patients treated with concurrent chemoradiation.materials and methodsfrom january 2005 to june 2009, 51 patients were treated with concurrent chemoradiation for 3 different aims : locally advanced stage iii, locally recurrent disease, and postoperative gross residual nsclc. median age was 63 years. distribution of stages by the 6th edition of american joint committee on cancer (ajcc) was as follows : iiia (37.3%), iiib (56.9%). chemotherapy was administered every week concurrently with radiation using one of the following regimens : paclitaxel (60 mg / m2), docetaxel+cisplatin (20 mg / m2 + 20 mg / m2), cisplatin (30 mg / m2). total radiation dose was 16 - 66.4 gy (median, 59.4 gy).resultsmedian follow - up duration was 40.8 months. the overall response rate was 84.3% with 23 complete responses. the median survival duration for the overall patient group was 17.6 months. the 3-year survival rate was 17.8%. a total of 21 patients had recurrent disease at the following sites : loco - regional sites (23.6%), distant organs (27.5%). in the multivariate analysis of the overall patient group, a clinical tumor response (p=0.002) was the only significant prognostic factor for overall survival (os). in the multivariate analysis of the definitive chemoradiation arm, the use of consolidation chemotherapy (p=0.022), biologically equivalent dose (bed)10 (p=0.007), and a clinical tumor response (p=0.030) were the significant prognostic factors for os.the median survival duration of the locally recurrent group and the postoperative gross residual group were 26.4 and 23.9 months, respectively.conclusionour study demonstrated that clinical tumor response was significantly associated with os in the overall patient group. further investigations regarding the optimal radiation dose in the definitive chemoradiation and the optimal treatment scheme in locally recurrent nsclc would be required. |
hip arthroscopy has increased in popularity tremendously in the last five to ten years. in a recent cross - sectional study, an increase of 250% was observed with this surgical technique in the united states between 2007 and 2011. the annual frequency of hip arthroscopy was four cases per 10 000 orthopaedic patients in 2011. although femoroacetabular impingement (fai) is still the main indication for hip arthroscopy, the discovery of other intra - articular and extra - articular entities have increased its frequency. this paper will review the current state of different key points of this surgical technique. positioning during hip arthroscopy depends on the available system and the experience of the surgeon. both positions, supine and lateral, offer advantages. the supine position is performed by a larger number of surgeons, because it is the simplest way to start performing hip arthroscopy. a classic fracture table can be used and the c - arm positioning is part of the operating room (or) setup. for central compartment access, axial traction is necessary in abduction followed by adduction of the limb on the oversized perineal post. this forces the hip to dislocate distally and laterally. for peripheral compartment access, which is the first step with some surgeons, the hip is flexed in the range of 30 to 45. this can be accompanied by removal of the central post to allow easier rotation of the hip while avoiding medial compression. in the lateral position, the advantage is the anatomical orientation for hip surgeons who perform hip replacement in the lateral position but this requires more preparation in the or to adapt the traction system and the c - arm positioning. the post in both positions should be placed at a width of more than 10 cm to reduce the incidence of neuroapraxis and perineal injury. fluoroscopy is widely used to establish the first portal although anatomical references can be used to establish this portal without need for the radiographic c - arm. for central compartment access first, under traction, a capsulotomy is usually performed between the anterior (a) and anterolateral (al) portals, parallel to the acetabular surface, to allow easy manoeuvrability inside the hip joint. some surgeons continue this capsulotomy in a t - fashion along the axis of the neck, which allows a birds - eye view of the hip joint. the posterolateral (pl) portal is not routinely performed but it facilitates the access to the posterior part of the hip down to the 10 oclock position. the main iatrogenic injury with this portal is damage to the sciatic nerve but it can be very helpful for the removal of posterior loose bodies. the mid - anterior and proximal mid - anterior can be used while working on the peripheral compartment. arthroscopic portals (right hip). asis, antero superior iliac spine ; gt, greater trochanter ; a, anterior portal ; al, anterolateral portal ; pl, posterolateral portal ; dal, distal anterolateral portal ; pal, proximal anterolateral portal. for access to the peripheral compartment as a first approach, the proximal anterolateral (pal) portal or proximal mid - anterior portal (pmap) are the first portals. these portals should be used for the treatment of lesions at the head - neck junction or other pathologies in the peripheral compartment. a distal anterolateral portal (dal) or mid - anterior portal (map) are useful for work on the lateral and anterolateral neck and are safer portals for anchor placement to avoid penetrating the acetabulum. usually, more lateral portals give better access to the lateral and pl articular lesions. nevertheless, more anterior portals give better access to the anterior articular pathology, but with higher risk of damage to the lateral femoral cutaneous nerve (lcnt). distal portals are better used for anchor placement from the 1 oclock to 3 oclock positions. medial portals have also been described to access the joint described as anterior, posterior and distal posterior to the adductor longus. hip arthroscopy in young adults frequently reveals a chondrolabral lesion on the articular side. a systematic review study reported a prevalence of labral injury on mri without intra - articular contrast in 68.1% of hips in an asymptomatic population. fifteen years ago, labral treatment was limited to debridement or resection of this sort of lesion, but today it has progressed towards preservation or restoration of the anatomy and biomechanics as much as possible. furthermore, revision hip arthroscopy is usually performed due to chondrolabral residual lesions. labral vascularity, with a radial peri - acetabular distribution, explains the need for bony refreshment of the acetabular rim in order to achieve good revascularisation and secure re - fixation. several in vitro and finite - element studies have shown the importance of labral structure in the stability and kinetics of the hip joint. maintenance of the labral seal and increase of acetabular surface ensure hip stability while increasing contact area and normal pressure distribution. current clinical studies also support acetabular labral preservation. a randomised clinical study compared resection with labral repair in patients with pincer and combined fai. the authors demonstrated better results for function, quality of life and subjective symptoms with labral repair. this study has stronger evidence than papers with historical series or retrospective analyses, but they all reported better results with labral repair. interestingly, the results of labral repair alone are as good as labral re - fixation with acetabular rim resection. in cases where the acetabular labrum is irreparable, labral reconstructions are becoming an increasingly satisfactory option since there is no re - growth after labral resection. different types of graft can be considered as viable graft options and some clinical series show promising results but with a lack of conclusive evidence. after labral lesions, articular cartilage lesions at the anterosuperior acetabular rim are the second most common pathology in patients undergoing hip arthroscopy. however, this technique is recognised to be an incomplete solution to deal with these lesions. when there is a stable well - preserved delaminated flap, fibrin adhesive or chondral sutures have been used to stabilise and preserve the native cartilage. unstable flaps and big cartilage defects can be treated with enhanced bone marrow stimulation techniques like bst cargel, amic techniques or with chondrocyte cultures. these are promising techniques but there is still a lack of long - term results (fig. a) labrum, b) chondrolabral delamination, c) cotyloid fossa, d) femoral head. the role of fai as a cause of osteoarthritis of the hip has been related to cam type impingement but there is still some concern about radiological findings of fai in an asymptomatic population are around 20% and increase up to 60% to 80% in athletes. the authors concluded that the physical examination findings should be carefully correlated with radiological findings. as the relationship between fai and hip osteoarthritis is not clear, the current literature does not show any benefit with prophylactic surgical procedures in the asymptomatic population who have radiological signs of fai. fai is often related to sports activities that eventually need a hip arthroscopy. in a retrospective study of athletes undergoing hip arthroscopy for fai, the most common sports related to fai surgery were hockey, soccer and american football. participating in cutting sports was associated with a younger age group at surgery than other sports. in football players, increasing the return to sport after fai surgery was investigated in a systematic review of a cohort of 418 athletes, with a rate of return to the previous level of competition of 88%. pincer deformity was poorly defined (four studies (15%) ; focal anterior overcoverage, acetabular retroversion, abnormal cea or acetabular index, coxa profunda, acetabular protrusio, ischial spine sign, cross - over sign and posterior wall sign). related to these findings, a retrospective study evaluated the progression of 96 asymptomatic hips with radiological signs of fai. different studies have mentioned radiological measures as main definers of the deformity. although focal anterior overcoverage, acetabular retroversion, abnormal acetabular index, coxa profunda, acetabular protrusio, ischial spine sign, cross - over sign and posterior wall sign are widely described in different studies, their variability casts doubt on their routine use to guide surgical treatment. excessive acetabular rim trimming should be avoided, since 1 mm rim trimming will decrease by approximately 2.4 of the ce angle. therefore, acetabular rim resections greater than 4 to 5 mm could create an iatrogenic dysplastic hip. currently, limited acetabuloplasty and labral re - fixation without detachment have demonstrated the same clinical outcomes as acetabuloplasty with labral detachment in the treatment of cam deformity in fai appears commonly at the anterosuperior head - neck junction and extends from the medial synovial fold to the anterolateral insertion of the retinacular vessels (fig. playing some types of sports, such as football, more than three times a week by patients during skeletal growth was associated with a pathological alpha angle. restoration of the normal head - neck shape should be our main goal but clinical outcome is more related to the pre - operative articular damage than the post - operative head - neck shape restoration. rarely, extensive risk factors associated with this complication are violation of weight - bearing restrictions, female sex and age older than 50 years. herniation pit at the head - neck junction, b) arthromri with pathological alpha angle (60), c) intra - operative view of the herniation pit at the head - neck junction after resection of cam deformity. peripheral compartment pathology often requires extensive capsulotomy that should be anatomically closed at the end of the surgery to avoid iatrogenic instability. in recent cadaveric studies, authors demonstrated that larger size capsulotomies significantly increase joint instability and hip external rotation while proper repair restored the normal range of motion and capsule stability. quality of life scores improved up to 76.6% at one year in non - arthritic patients who underwent hip arthroscopy for fai. although joint space width is the main risk factor, there is a lack of consensus regarding how much joint space is the limit to indicate the need for arthroscopic treatment of fai in symptomatic patients. hip arthroscopy in patients with fai and joint space greater than 2 mm is considered a cost - effective intervention. fai arthroscopic treatment showed up to 80% of good or excellent clinical results at the mid - term. even in patients older than 50 years, most patients revealed initial clinical improvement, but 43% underwent a total hip replacement (thr) when less than 2 mm was measured before hip arthroscopy. based on the development of imaging techniques and further progress in hip arthroscopy instrumentation, extra - articular hip arthroscopy has greatly increased in numbers over the last five years. there are several extra - articular space pathologies that predispose to damage of soft tissues around the hip and, eventually, intra - articular structures. antero - inferior iliac spine (aiis) syndrome was described as an impingement between a prominent aiis and the femoral neck or acetabular labrum (fig. 4). arthroscopic sub - spine decompression of 1 to 1.5 cm of the proximal aiis, associated with the surgical treatment of other fai findings, should be the elective treatment option. psoas impingement (pi) explains labral tears at the 1 oclock to 2 oclock positions for a right hip or the 10 oclock to 11 oclock positions for the left hip. patients have impingement between the psoas tendon and the anterior labrum (fig. 5). some authors recommend being cautious in performing psoas tendon tenotomy with borderline dysplasia, in order to avoid anterior instability. sound at the medial area of the groin when they move from flexion and external rotation to extension and internal rotation of the hip. it is commonly asymptomatic and typically present in sports that require repetitive hip flexion such as ballet. gold standard. when conservative options fail, arthroscopic tenotomy of the psoas tendon can relieve the symptoms. arthroscopic psoas tenotomy can be performed at different levels along the tendon and it has demonstrated better recovery than open surgery. endoscopic iliopsoas tendon release at the level of the lesser trochanter and arthroscopic tenotomy from the central compartment are the two most popular options. clinical results of both techniques are comparable and selection of one over the other only depends on the surgeon s preference. snapping hip is a cause of trochanteric pain due to the friction between the iliotibial band and the trochanter. if conservative management fails, arthroscopic surgical release or lengthening of the iliotibial band is a good option. gluteus medius and minimus tears can be a common cause of greater trochanteric pain syndrome (gtps). patients are usually female with trochanteric bursitis and partial abductor tears. open or arthroscopic repair provides good clinical results (fig. open surgery seems to have higher post - operative complications but takes less operative time for full thickness tears. deep gluteal syndrome (dgs) is an underdiagnosed entity characterised by pain and dysaesthesia in the buttock area, posterior thigh and radicular pain due to a non - discogenic sciatic nerve entrapment in the subgluteal space. piriformis syndrome, a term related to the presence of fibrous bands, obturator internus syndrome, ischiofemoral pathology, hamstring conditions and gluteal disorders. clinical assessment of patients with dgs is difficult since the symptoms are imprecise and may be confused with other lumbar and intra- or extra - articular hip diseases. it is usually characterised by a set of symptoms occurring in isolation or in combination. intolerance of sitting for more than 20 to 30 minutes, limping, disturbed or loss of sensation in the affected extremity and pain at night getting better during the day are other symptoms reported by patients. the concept of fibrous bands playing a role in causing symptoms related to sciatic nerve mobility and entrapment represents a radical change in the current diagnosis of and therapeutic approach to dgs. recently, a new pathological classification of these bands has been published : type 1 : compressive or bridge - type bands limiting the movement of the sciatic nerve from anterior to posterior (type 1a) or from posterior to anterior (type 1b).type 2 : adhesive or horse - strap bands, which bind strongly to the sciatic nerve structure, anchoring it in a single direction. they can be attached to the sciatic nerve laterally (type 2a) or medially (type 2b).type 3 : bands anchored to the sciatic nerve with undefined distribution (type 3). the recently described endoscopic decompression of the sciatic nerve appears to be useful in improving function and diminishing hip pain in sciatic nerve entrapments within the subgluteal space (fig. type 1 : compressive or bridge - type bands limiting the movement of the sciatic nerve from anterior to posterior (type 1a) or from posterior to anterior (type 1b). type 2 : adhesive or horse - strap bands, which bind strongly to the sciatic nerve structure, anchoring it in a single direction. they can be attached to the sciatic nerve laterally (type 2a) or medially (type 2b). type 3 : bands anchored to the sciatic nerve with undefined distribution (type 3). the recently described endoscopic decompression of the sciatic nerve appears to be useful in improving function and diminishing hip pain in sciatic nerve entrapments within the subgluteal space (fig. three - dimensional ct reconstruction in sub - spine impingement : a) antero - inferior iliac spine (aiis), b) femoral neck impingement area against aiis. psoas impingement (circle in dotted line) : a) femoral head, b) capsule - labral recess, c) psoas tendon. although the hip joint is very stable because of its bone shape, the capsule and labrum also play an important role in hip stability. traumatic instability is associated with sports (skiing, rugby, biking, football and soccer). atraumatic instability is usually associated with hip dysplasia and connective tissue disorders, such as marfan s or ehlers - danlos syndromes. it has been related to the tearing of the ligamentum which gives stability in limiting internal rotation during sports such as martial arts, ballet, soccer, golf and kicking in american football. when compared with ligamentum teres reconstruction,, hip arthroscopy is currently increasing its indications and new entities are appearing as a result of the increase in knowledge of hip pathology. in future, long - term clinical results after the treatment of these new hip pathologies will demonstrate whether hip arthroscopic techniques are a trend or a real advance. the author or one or more of the authors have received or will receive benefits for personal or professional use from a commercial party related directly or indirectly to the subject of this article. | hip arthroscopy is an evolving surgical technique that has recently increased in popularity.although femoroacetabular impingement was an important launch pad for this technique, extra - articular pathology has been described through hip endoscopy.good clinical results in the medium term will allow improvements in this technique and increase its indications.cite this article : efort open rev 2017;2:58 - 65. doi : 10.1302/2058 - 5241.2.150041 |
the numerous anecdotal reports of catastrophic medical equipment failure in close proximity to electromagnetic field emitters (such as mobile phones or other wireless devices) have recently been supported by formal studies. add to this growing literature database by reporting the effects of electromagnetic interference (emi) produced by newer generation mobile phone signals on medical devices commonly used in an intensive care unit (icu). based on a high (43%) rate of emi - related incidents at a median distance of 3 cm, they reasonably conclude that mobile phone use in critical care units should be restricted to the usual 1 m distance from the critical care bedside. these investigators used a worst case scenario in their study design, simulating electromagnetic (em) fields at the maximum signal strength generated by mobile phones and intentionally targeting poorly shielded locations on the tested medical devices. the high rate of hazardous incidents that they found may not represent what would be expected from routine mobile phone use. other studies reporting on the susceptibility of commercial medical devices to emi in real life (as opposed to laboratory) environments using reasonable distance restrictions have found fewer clinically relevant emi events [3 - 5 ]. although van leishout 's data can be interpreted as supportive of the use of mobile phones 94% of hazardous events occurred at a distance of 30 cm or less the danger of relying on a 1 m restriction is highlighted. the catastrophic failure of a ventilator at a distance of 3 m from a mobile phone signal raises serious concerns about industrial standards, as the authors note in their conclusions. industrial standards for life - supporting medical devices (international electrotechnical commission [iec ] standard 60060 - 1 - 2) fall substantially short of achievable standards for example, for military equipment (mil - std-461). almost a decade ago, the institute of electrical and electronics engineers (ieee) committee on man and radiation noted that technology existed to protect most medical devices from radiofrequency fields much more intense than the iec standards, and that shielding, grounding and filtering, were not costly when incorporated into the initial device design. despite that, and in the face of growing evidence of emi in the literature, there have been no substantial changes to emi susceptibility standards for medical devices in the last decade. newer generation wireless devices are rapidly expanding into frequency spectrums not covered by current standards for medical devices, necessitating more frequent reevaluation of those standards. hospitals rely on manufacturers ' stipulated adherence to emi standards, typically based on third - party susceptibility testing of a small number of sample devices. electromagnetic susceptibility of an individual medical device may vary due to poor quality control during construction. compliance with standards can not be guaranteed, which may explain why some devices fall below the food and drug administration (fda) standard when tested in hospital environments. regardless of the potential risks, wireless technology is becoming increasingly prevalent in the critical care environment. hospitals are routinely using wireless solutions for patient monitoring, data collection, and enhanced communication. several companies are now offering wireless solutions for electronic - icu applications, using either their own proprietary networks, or ' piggybacking ' on existing hospital networks. a new generation of transport monitors and external defibrillators offers wireless transmission to hospital telemetry systems. current data suggest that wireless area networks (802.11) and bluetooth systems do not carry a risk of emi with medical devices. however, the rapid development of new wireless telecommunication technologies makes much of the current literature obsolete. with each new generation of wireless technology, information technologists and medical engineers must determine the impact on existing hospital network infrastructure and medical devices. there are those that argue that the intangible benefits of improved communication using wireless devices far outweigh the small risk of a hazardous event from emi. as wireless devices become less expensive and consequently more prevalent we are also seeing increasing use of data transmission (email, web access) in addition to voice communication, by staff and visitors. increased awareness of the risks of emi, by staff, patients and visitors, is essential to ensure sensible use of wireless devices. there are other aspects of electromagnetic interference that may need to be considered, such as bandwidth competition by medical devices employing the same local wireless networks, or between medical devices and personal wireless products. as restrictions on the use of wireless technology are relaxed, increased vigilance and testing of new wireless devices and their transmission networks is essential, in our own hospital environments with our own equipment. emi = electromagnetic interference ; em = electromagnetic ; fda = food and drug administration ; icu = intensive care unit ; iec = international electrotechnical commission ; ieee = institute of electrical and electronics engineers. | wireless communication and data transmission are playing an increasing role in the critical care environment. early anecdotal reports of electromagnetic interference (emi) with intensive care unit (icu) equipment resulted in many institutions banning these devices. an increasing literature database has more clearly defined the risks of emi. restrictions to the use of mobile devices are being lifted, and it has been suggested that the benefits of improved communication may outweigh the small risks. however, increased use of cellular phones and ever changing communication technologies require ongoing vigilance by healthcare device manufacturers, hospitals and device users, to prevent potentially hazardous events due to emi. |
falls among the elderly constitute a significant health problem, as approximately every third person over 65 and every second individual over 85 falls at least once a year1, 2. the multi - disease phenomenon may significantly negatively affect functional dexterity in the elderly and result in gait and balance impairment. various consequences of somatic diseases, combined with reduced dexterity and physical activity, influence the quality of life in older adults, especially those who have already lost independence for activities of daily living (adl), and are residents of nursing homes. their independence is usually lower and they belong to the group at high risk of falling. thus, fall risk assessment should include various tests for static and dynamic balance. the physical and functional consequences of falls (fractures, soft tissue injury, premature institutionalization, and death) have been well documented. long - term consequences may include loss of independence, restriction of physical activity, lowered quality of life, increased social isolation, or depression3, 4. fear of falling affects psychological well - being and constitutes an independent risk factor for reduced mobility and lowered quality of life5. numerous methods have been developed to evaluate balance and risk of falling among older adults, including the timed up and go (tug) test, tinetti performance oriented mobility assessment (poma) test, berg balance test (bbs), and one - legged stance test (olst). these tests assess various parameters, especially standing balance, stepping ability, general function, reaction time, lower limb strength, dual tasking, gait variability, gait cadence, and vision (visual acuity, contrast, and field)6. they may also identify those at risk of falling who require lifestyle interventions, including exercises and home environment safety modifications7, 8. a physiotherapist, as a member of the geriatric team, should implement adequate preventive and therapeutic measures. the aim of the study was to determine which gait and balance tests generated the most reliable results for assessment of risk of falling, based on the number of falls over the last 12 months. the study was conducted in accordance with the declaration of helsinki and the local ethics committee approved the study protocol (no. this study was conducted in 5 nursing homes in poznan, poland. out of 400 individuals (aged > 65), a group of 153 residents who were able to walk a distance of 3 m unaided or using orthopedic equipment (i.e., performed the tug test) and scored > 18 points on the mini - mental sate examination (mmse) were identified. patient characteristics are presented in table 1table 1.patient characteristicscharacteristicsmalefemalenumber of patients 31122age (years)mean sd73.0 8.077.6 8.1median (range)72 (6581)77 (6594)educationprimary school (completed 7 years)639vocational school (completed 3 years)1414high school (completed 4 years)755university degree (completed 5 years)414number of diseasesdegenerative disease1476stroke411hypertension1659osteoporosis27diabetes mellitus 517ischemic heart disease 646visually impaired316others1586number of medicationsmean sd3.2 3.42.7 3.7median (range)1 (09)1 (014)barthel scale (points)mean sd96.2 6.489.8 13.2median (range)100 (85100)95 (45100)mmse score (points)mean sd25.4 2.826.5 3.1median (range)25.5 (1930)27 (1930)number of falls over the last 12 monthsmean sd1.03 1.61.01 1.7median (range)0 (06)0 (08). comprehensive geriatric assessment was performed in 153 subjects to determine the program of rehabilitation. various scales were used, including the barthel scale to measure adl performance, (020 points : very dependent, 2185 : moderately dependent, 86100 : independent)9. the mmse was used to evaluate cognitive function10, which in older adults aids in design of the physiotherapy treatment. the scale assesses 5 areas of cognitive function : orientation, registration, attention and calculation, recall, and language. tests to predict the risk of falling have been used to evaluate balance in the elderly ; for example, tug assesses proactive balance. the patient is instructed to rise from the chair (approximate seat height of 46 cm), walk at a comfortable and safe pace to a line on the floor 3 m away, then turn and walk back to the chair and sit down again. patients should wear their usual footwear and may use their customary walking aid (cane or walker), if necessary11. a score of 20 s indicates that the individual requires a significant amount of help from others while walking, and usually heralds the need to implement an intervention. a tug score of 13.5 poma consists of 2 parts for assessment of balance and gait, and is frequently used to evaluate balance in elderly populations. scores of 2619 reveal the presence of a problem, which might lead to a fall, whereas a score of 2628 is normal12. it consists of 14 items, with a maximum total score of 56 points. bbs scores have been identified for the ability to walk without an aid (49/56 points) and the ability to walk without a 4-wheeled walker (43/56 points)14. steady - state balance may also be evaluated with the use of olst, which is used as a screening method to determine balance impairment in elderly populations. the person is instructed to stand on one leg without support of the upper extremities. the maximum test time is 30 s. in this study, the participants were instructed to keep their eyes open. normal ranges with the eyes open are : 6069 years : 22.5 8.6 s, and 7079 years : 14.2 9.3 s15. gehlsen and whaley demonstrated that people who fall usually score lower on this test, whether with the eyes open or closed (10.9 s vs. 18.7 s, p<0.001, and 3.6 s vs. 5.2 s, p<0.05)16. in this study, the results were analyzed according to the number of falls during the last 12 months. quantitative variables are presented as mean and standard deviation. due to the non - parametric distribution of some variables, median and range of parameters were taken into account. the mann - whitney test, spearman s rank correlation coefficient, and the deming linear regression (because parameters were in different units : points and seconds) were used in the analysis the results of the tests are presented in table 2table 2.gait and balance assessmentparametersresultsfallersnon- fallersage (years)mean76.67 8.3 78.7 7.975.2 8.3 median 76.57974range6594 6594 6591 tug (sec)mean18.6 9.3 20.75 9.2 16.5 9.1 median 161614range552 548052poma (pts)mean20.4 5.7 19.1 5.7 21.4 5.4 median 222023range428428828bbs (pts)mean41.3 12.738.9 13.443.1 11.9 median 454446range056056456olst (sec)mean5.3 7.83.5 6.06.6 8.6 median 204range030027s030sn=71, p<0.01, p<0.05. out of 153 subjects, only 46% were deemed eligible for the olst test. deming linear regression (n=153) revealed statistically significant correlations between the number of falls, longer results for tug r=0.27 (p<0.001), and lower scores for poma r=0.24 (p<0.001) and olst r=0.17 (p<0.01). table 3table 3.correlation between number of falls in males and females, age and tests results genderage (years)tug (sec)poma (pts)bbs (pts)olst (sec)male (n=31)r=0.5046r=0.5627r=0.3739r=0.3450r=0.4027female (n=122)r=0.1811r=0.2393r=0.2294r=0.1380r=0.1314p<0.01, p<0.001, p<0.05 presents results after the study group was subdivided according to gender. a statistically significant correlation between age and the number of falls in males (p<0.01) and females (p<0.05) was detected with spearman s correlation. a high correlation was also found between the number of falls and both longer tug results (males p<0.001, females p<0.01) and lower poma scores (males p<0.05, females p<0.05). no correlation was found between gender and the bbs score, whereas results of the olst test correlated with gender only in the case of males (p<0.05). n=71, p<0.01, p<0.05 p<0.01, p<0.001, p<0.05 based on the results, the evaluation of balance in fallers and non - fallers among elderly residents of nursing homes showed that all tests, i.e., tug, poma, bbs, and olst, enabled adequate assessment of balance and identification of patients in need of interventions to prevent falls. in nursing homes, it is essential to apply tests that will identify people who need services to prevent falls. the olst was least useful, as it could only be conducted in 46% of the subjects. the difference between fallers and non - fallers was statistically significant in a comparison of tug (p<0.01) and poma (p<0.01) results. for bbs and olst, a difference was present at a level of significance of p<0.05. compared with non - fallers, tug, poma, bbs, and olst scores in fallers were 4.25 s longer, 2.3 points lower, 4.2 points lower, and 3.1 s shorter, respectively. also evaluated balance in fallers vs. non - fallers, but used bbs and computerized dynamic posturography (cdp). the bbs and cdp results in fallers were significantly lower compared to non - fallers17. this study confirmed that the risk of falling increases with age in both males and females over 65. nakano. demonstrated that female patients in their 70s show a significant decline in functionality, i.e., physical performance and balance, as compared to their male peers. older females display greater loss of muscle mass and muscle strength, which predisposes to frailty syndrome18. duckham. showed that males over 65 had significantly greater rates of outdoor falls while engaging in recreational or vigorous activities. in turn, older females tended to have significantly higher rates of indoor falls, which more often proved to be injurious19. this study found a correlation between the number of falls in the 12 months before the study and the score for the tug test (p<0.001), followed by poma (p<0.001) and olst (p<0.01). king. investigated patients with parkinson s disease, who might have difficulty turning over, and also found tug to be superior to poma and bbs20. on the other hand, chiu. compared 4 functional tests, i.e., bbs, poma, the elderly mobility scale (ems), and tug, in fallers and non - fallers and concluded that bbs proved to be the most reliable in discriminating between fallers and non - fallers21. some authors are of the opinion that standing balance is only one of the myriad competencies that contribute to an individual s ambulatory ability. bbs evaluates the dynamic aspects of balance, and thus it could be used to influence decisions about an individual s ambulation status or serve as targets for intervention strategies13, 14. regardless, bbs should be combined with other balance tests in patients after stroke13. sibley. showed that in canada 70% of physiotherapists use olst and bbs to evaluate balance, whereas tug is used by only 56.9% of physical therapy practitioners, mainly due to lack of time during their work and lack of sufficient knowledge22. the use of balance tests in their work also depends on the goal of such an assessment. tug evaluates the basic level of activity, whereas bbs supplies information about more complex balance - related problems. barry., in a systematic review and meta - analysis, showed that tug has limited ability to predict falls among community - dwelling older adults, and should not be used alone to identify individuals at high risk of falling23. on the other hand, zasadzka. the abovementioned tests will enable physiotherapists working with elderly residents of nursing homes to identify individuals who require prophylactic measures to prevent falls, including introduction of exercises that improve gait, balance, muscle strength, and coordination. according to schoene., sensorimotor training with pneumatic compressors, balance platforms, and diversified exercises, including balance and aerobic exercises, should be included25. based on the findings of the present study, it seems advisable to use 2 or more tests to assess the risk of falling in elderly residents of nursing homes. as indicated by the results, tug and poma are the most useful tools to screen for balance and gait impairment in this population. | [purpose ] the risk of falls in the elderly is an important public health problem. suitable tests may help detect those at risk of falling. this study determined which balance test for older adults generates the most reliable results in terms of fall risk assessment, based on the number of falls over the last 12 months. [subjects and methods ] a total of 153 individuals (31 males, 122 females, aged 76.67 8.3 years ; median 76.5, range 6594) were investigated. the subjects were subdivided between fallers (a fall over the last 12 months) and non - fallers (no falls over the last 12 months). all participants were assessed with the following : barthel scale, mini - mental state examination, timed up and go, tinetti performance - oriented mobility assessment), berg balance test, and one - legged stance test. [results ] statistically significant differences were detected between fallers and non - fallers in tug, poma, bbs, and olst scores. the number of falls correlated positively with the results for tug, poma, and olst. [conclusion ] tug and poma were the most useful screening tests for balance and gait impairment in elderly nursing home residents. two or more tests should be performed for more precise assessment of the risk of falling. |
interventional radiology (ir) is an invasive speciality with the potential for complications as with other invasive specialities. the world health organization (who) produced a surgical safety checklist to decrease the morbidity and mortality associated with surgery. the cardiovascular and interventional society of europe (cirse) set up a task force to produce a checklist for ir. use of the checklist will, we hope, reduce the incidence of complications after ir procedures. it has been modified from the who surgical safety checklist and the rad pass from holland. |
|
the first one is the capability of self - movement ; namely, a living organism is able to pursue autonomously the direction of its own motion, whereas a nonliving object can be only pushed or pulled by an externally applied force. the second difference is that the dynamics of each component depends on the simultaneous dynamics of the other components, so that the ensemble of components behaves in unison in a correlated way. it is just this collective dynamics which makes possible the self - movement of the system, allowing a continuous change of the organism without disrupting its fundamental unity. the main actor of the time evolution of the organism is not the ensemble of molecules but the ensemble of their correlations. for this reason, we can not assume that the molecular components of a living organism are independent molecules moving in a diffusive way, but we are forced to assume a holistic dynamics able to preserve the unity of the organism amidst a huge number of externally applied stimuli and challenges. in particular, molecules encounter each other in the organism not at random but apparently according to organic codes evolving in space and time, as, for example, the genetic code. this means that molecules which, taken individually, can interact chemically with any kind of other molecules, acquire within the living organism the property of selecting their chemical partners according to codes evolving in time. in this framework, the problem of communication becomes a crucial issue in the understanding of living organisms. the existence of this array of molecular communications, able to adapt to a wide number of external stimuli and constraints, is a permanent feature of every organism which disappears at death only. the array of communications among molecules does not depend on external causes but is inherent in the modus operandi of the molecular dynamics. in other words, the spreading of information about each event depends on the same dynamics which produces the event. biochemical reactions and the spreading of information about them should be two different aspects of the same dynamics and in particular do not need additional expenses of energy. the problem of biocommunication has been addressed in recent times within the frame of the molecular paradigm, which states that a living organism is an ensemble of appropriate molecules kept together solely by chemical forces, whose essential features are that they can be always reduced to pairwise interactions. in this frame, the problem of communication has been reduced to the ligand - receptor model as described in section 2. in section 2 first, the existence of chemical codes remains unexplained since no reason is given why a molecule is able to encounter its molecular partner in the sequence underlying the given biological cycle just in the right place at the right time ; this would demand a long - range recognition and attraction among molecules. the second reason is that the spreading of information about each molecular event to the other component molecules of the organism would require the emission of signals, such as chemical messengers or electromagnetic signals, whose formation would require energy. the huge ensemble of all the signals necessary to keep other parts of the organism informed about what is going on in one part, so that they are able to act in an holistic way, would demand an immense consumption of energy. on the contrary, we know that the energy demands of an organism are quite moderate. therefore we are compelled to opt for a different paradigm, which is offered naturally by modern quantum field theory [35 ]. according to quantum physics, each object can not but fluctuate ; not only material particles but also fields are undergoing spontaneous fluctuations, that is, fluctuations occurring without any external supply of energy. under conditions clarified by the theory which we will shortly describe in section 4 the quantum fluctuations of many objects are able to correlate with their phases, producing a common oscillation of all the components in unison. the system therefore enters into a state which in the physical jargon is termed coherent state. the energy of an ensemble of components in a coherent state is lower than the energy of the same ensemble in a noncoherent state, since the onset of coherence eliminates all the useless movements of components which give rise to the entropy of the system and concentrates the energy on a smaller number of degrees of freedom able to use this energy to produce external work [69 ]. this property of coherent systems could implement the requirements of prigogine for dissipative structures. in order to abide by the second law of thermodynamics, the process of energy concentration demands that some energy should be released outwards, so that, in order to become coherent, a system should be an open system. in a coherent system made up of atoms / molecules, there is therefore a physical field able to keep the long - range correlation among the components. this correlation field can be shown to be just the electromagnetic potential, whose space - time derivatives give rise to the well - known electromagnetic fields. therefore, what keeps the molecular components correlated among them not in a pairwise way but in a truly collective many - body way is not the electromagnetic field whose production would demand energy but the electromagnetic potential whose appearance in a coherent system produces a net saving of energy [1317 ]. the physical variable responsible for correlation in this vision is not the energy but the phase of the system. recently, strong experimental evidence about the existence of coherent correlations among biomolecules and the role of electromagnetism in biocommunication has been reported [18, 19 ]. the perspective outlined above emerges from modern quantum physics whose validity in the understanding of elementary particles, atoms, and molecules has been fully established in the last century. moreover, this approach, contrary to the physics of the past, either classical physics or old quantum mechanics, does not allow us to address physical objects in isolation but only as parts of an extended reality, the field, where its connectedness with other objects is pivotal. the communications among all the components of the physical systems occur via quantum fluctuations which can not be reduced to the actual fluctuations of the components but also include the fluctuations of the vacuum. the vacuum therefore could be assumed to be an agent for the spreading of communication among components. quantum field theory only recently has been able to get out of the microscopic world of elementary particles and has been used to analyze macroscopic systems too, such as crystals and superconductors. it can be proposed as a good candidate for understanding living organisms [35 ]. the aim of the present paper is to provide first a concise overview of the historical development of the problem of biocommunication and of the formation of a collective dynamics in living organisms, second to point out the deficiencies of the purely molecular approach and the need for coherence in the living dynamics, and third to sketch the conceptual framework offered by quantum field theory for the understanding of the onset of coherence in matter and living organisms., we will describe the problem of biocommunication and the emergence of collective behavior within the molecular paradigm of biology. in section 3, we will discuss the contributions offered by approaches to biology different from molecular biology ; in section 4 we will introduce and discuss the possibilities provided by the quantum field theoretical approach, in section 5 we present some experimental corroborations for this approach, and finally in section 6 we will draw some conclusions and provide some outlook. modern views still are fundamentally based on ehrlich 's ligand - receptor model stating that biological reactions can only be elicited by messenger molecules (such as hormones and neurotransmitters) binding to receptors (which can be cell - membrane bound ones, cytoplasmic proteins, or other molecules). clark 's receptor occupation theory in 1933 postulated four rules for the action of transmitter substances on receptors : (1) the effect increases proportionally with the number of occupied receptors ; (2) for each receptor 's action an all - or - nothing lock - and - key fashion ; and (4) the occupation of one receptor does not interfere with the function of other receptors. although a great number of bioreceptors have been found, for a number of reasons there has been growing criticism of this model [2225 ]. this static and mechanistic approach implies biological response to be strictly local and linear (the response is proportional to the stimulus). already the first attempt to extend the model, undertaken in 1961 by paton, implicitly questioned the receptor hypothesis. paton 's rate theory, which is in much better agreement with experience, states that the number of contacts between receptor and transmitter molecules is essential for biological efficacy. secondly, the control of the dissociation and association rate of the receptor - transmitter complex becomes a central part of the regulatory function. thus, communication is not any more restricted to the structural level, that is, the structural manifold of biochemical messenger molecules ; any factor able to influence the coupling of molecules (i.e., an electromagnetic coupling) has to be taken into consideration. the regulation of the binding activity as well as that of subsequent steps that typically involve signal amplification toward some biological response is today thought to be chemical as well. but the discovery of chemical messengers and receptors, which doubtlessly has greatly enlarged biological understanding, may not be the last word about biological communication. their identification still leaves open some essential questions of biological communication, such as : what coordinates the biological processes ? what directs the right number of molecules needed at the right time to the right place ? how does the coupling to the receptor trigger the ensuing response ? also, there are indications that the speed of the signal conveyed at least in some biological communication processes clearly exceeds the speed range of molecular transmission. such a complement has been proposed for the surface receptor - cytoplasm communication across the membrane. according to adey, the glycoproteins on the cell surface which mediate the cell - cell recognition also can act as antennae for e.m. signals. after the transmission across the membrane, the signal is propagated to the cytoplasm by cytoskeleton - mediated events, in which again e.m. the task of studying the individual biochemical reactions in vitro has been so enormous and absorbing that little work has been devoted to the question of how the reactions are organized and how the reactants are moved in vivo. as rowlands remarks, it is inconceivable that the cell has to wait for the chaotic brownian motion (and diffusion, for this matter) to accomplish these things by chance. therefore we must come to the same conclusion as szent - gyorgyi who stated that biologists might not be able to formally distinguish between animate and inanimate things because they concentrate on studying substances to the neglect of two matrices without which these substances can not perform any functions water and electromagnetic fields. already weiss has pointed to the fact that cells can recognize each other and their surroundings and can find their proper destinations in the organism even when customary routes are blocked [32, 33 ]. additionally, cells of the same type tend to aggregate and actively preserve this aggregation not only in the body but also in vitro. mutual recognition between cells of the same type later has been shown for dissociated liver and kidney cells from a vertebrate embryo. the aggregation of identical cells (liver - liver, kidney - kidney) takes place at a faster rate than that of the mixed cells. rowlands found that erythrocytes actively attract each other to form rouleaux when the cell membranes are still 4 m apart, a distance ten thousand times the range of the known chemical forces [35, 36 ]. he suggests that long - range cell interactions of this type are also responsible for the very fast attraction of platelets to the cells of a damaged cell wall and may also underlie the ability of leukocytes to actively look for and destroy elements foreign to the host organism. bistolfi proposes that this effect may explain the preference of neoplastic metastases for certain target organs. weiss in 1959 has asked the questions that biology today still has not been able to answer satisfactorily [32, 33 ] : how do mixed cell populations achieve this ? do like cells attract each other ? do they recognize each other only after chance encounters ? weiss was convinced that these phenomena are of the same general nature than immune reactions, enzyme - substrate interactions, the pairing of chromosomes, fertilization, parasite infection, and phagocytosis. it may well be that we are dealing with a mechanism that is even more general and, on the microscopic side, also extends to atomic and molecular interactions and to interactions between organisms on the macroscopic side. mechanism may be responsible for the recognition between macromolecules, such as between enzyme and substrate, dna and rna, and antigen and antibody, and between cells. according to rowlands the phenomenon of erythrocyte attraction shows the existence of a species - specific, electromagnetic ultralong - range interaction, a mechanism by which similar cells may recognize each other and join up. paul has explained these long - range forces between human blood cells by the use of coherent states of the e.m. an interpretation of these phenomena in terms of a coherent dynamics has been proposed by del giudice. [29, 35 ]. communication on all levels of biological organization constitutes an essential element of an electromagnetic theory of the living organism. biological functions such as the control of enzymatic activity, photorepair, and immunological functions, particularly, are obviously based on some process of pattern recognition and thus suggest understanding in terms of coherent interactions. as to the microscopic level, we need a new way to look at molecular interactions, which fits to the field picture of life. of the many factors able to influence the coupling of molecules, the electromagnetic field may be the essential one. as bistolfi pointed out, the chemical structure of biomolecules is not in itself enough to characterize intermolecular recognition interactions. the wide range of chemical shift values as determined by nmr shows that organic molecules not only differ in their chemical structure but also in the way they resonate when adequately stimulated, that is, in their electromagnetic patterns. thus bistolfi postulates that resonance capacity in a more general sense than that appearing in nmr spectroscopy must be considered since not only the paramagnetic nuclei but also the molecular structures are involved in it. bistolfi takes this evidence from nmr to be a good indirect indication of the existence of long - range, frequency - dependent e.m. radiation emitted by functional groups on molecules induces specific orientations / conformations / alignments in complementary molecules and thereby generates an electromagnetically induced geometrical template of the two molecular regions. molecules themselves have to be considered as ordered electromagnetic structures [41, 42 ]. the main factors in molecular interaction, in the conventional quantum chemical view, are the spatial conformation of the molecules involved and the charge distribution of the valence electrons (chemical potentials). it is primarily the charge distribution on the surface of molecules that determines their physical and chemical properties, such as bonding ability, orientation, and mutual position. when the geometrical configuration of two molecules fits in such a way that a minimum of the (electrical) coulomb potentials of the valence electrons is achieved, a chemical bonding can take place. however, charge distribution through its time variations is also responsible for the properties of the e.m. radiation which molecules emit, such as polarization, spatial distribution, and direction, and for their interaction with impinging radiation. field envelope of the molecule, which may be the real mediator of the molecule 's interaction with other molecules. a field approach to intermolecular interaction is fundamental to any electromagnetic model of living organisms. li suggests using the de broglie wave picture of matter in looking at nonradiative interaction between particles [4345 ]. in this view, atomic orbits represent interference patterns of electron waves within their coherence (or uncertainty) volume. the attractive superposition of the quantum - mechanical wave functions, in the case of the bonding of two hydrogen atoms, is identified to destructive interference of their electron waves, while the repulsive superposition of the wave functions, in the antibonding case, is equated to the constructive interference of the electron waves. in atoms and molecules thus the same mechanism is seen at work as that used to explain galle 's observations on the ultraweak bioluminescence of daphnia aggregations. according to popp 's biophoton theory, the same kind of approach can be used for the case of atoms and molecules influencing each other only by means of the radiation field, when, for instance, the same two atoms are sufficiently separated that no electron wave function overlap is possible [4345 ]. as long as two (or more) radiating atoms or molecules remain within the coherence length, they can be arbitrarily far apart and still exhibit some correlation effect. within the coherence volume, which is the region within which the wave remains coherent, the photons emitted are completely delocalized. the exchange of photons between the particles builds interference patterns, the basis of a communication linkage among the particles, which thereby form a complex cooperative system that has to be considered as a whole. as well as to the interaction between atoms and molecules, this model applies to the interaction between macromolecules and cell components, between cells, and between organisms in populations. more recently, irena cosic has presented a resonant recognition model of biomolecular interaction which postulates that these interactions are of electromagnetic nature [41, 42, 47, 48 ]. based on the finding that proteins produce electromagnetic emission and absorption in the range of infrared and visible light, cosic proposes that molecules recognize their targets by electromagnetic resonance and that electromagnetic waves are also used by them to influence each other at a distance and to attract molecular partners. by means of electromagnetic resonance, selective interactions are taking place at distances greatly exceeding the range of chemical interactions however, even if it brings a laudable progress in the right direction, cosic 's model is fraught with the serious deficiency of not considering the actual physical value of the photon - atom cross - section governing the electromagnetic interaction of atoms, which is in fact quite small. if the e.m. field is assumed to be, as in the usual case, a flow of photons travelling at the speed of light and therefore having a small probability of encountering atoms, the cosic proposal has a small chance of explaining the actual biological interaction. however, the cosic proposal assumes a very important value when it is included within a dynamics able to put, in a sense, the e.m. field at rest, that is, to trap it within a self - produced cavity, as we will see in section 3. in this case, the coupling between the e.m. we will see in section 4 that this occurrence is produced by the presence of water, whose essential role is usually neglected in the biological modelling. this crucial role of water in intermolecular interaction is also neglected in cosic 's model. as a matter of fact, molecular interactions within a biological organism are not taking place in the empty space, but they occur in an aqueous medium, since water, as we will point out in section 4, is the main constituent of living matter. the formation of electromagnetic cavities in living matter appears as an essential task for elucidating the biomolecular interaction dynamics. in modern physics the formation of coherent electromagnetic fields has been historically connected with the development of laser. as said above, the appearance of a coherent field occurs in the presence of an external supply of energy, a pump in the physical jargon. moreover an externally supplied cavity, whose size allows us to select a specific wavelength of the coherent field, is needed. coherence appears when suitable boundary conditions are met and only when the system is pumped. however this could not be the case for living systems where no pumps and cavities are provided from outside. a first contribution to the solution of this problem has been offered by dicke [49, 50 ], whose theory justifies the occurrence of a large increase of the field energy (superradiance) together with the appearance of the typical quantum phenomenon known as stimulated emission radiation (superfluorescence). in the present paper we do not deal with the complete dicke theory, but only with its application, proposed by li, to the emergence of coherence without an externally provided cavity. li 's model is based on the radiation theory advanced by dicke in 1954, according to which, for distances between two emitters smaller than the wavelength of the light emitted, the emission must happen cooperatively, and the field between the emitters can not be random but has to be coherent. the better this dicke condition is fulfilled, the more the coherence increases. the emitters then can not be considered as independent individuals, because they are embedded in and interacting with a common radiation field. field, they are part of a communicating system and are continuously getting information about each other. field is not emitted out of the ensemble of molecules to which it is coupled but is kept within it, so this case could be termed subradiance. this property will be a major feature of the quantum electrodynamics (qed) treatment given in section 4. for the optical range of ultralow bioluminescence (biophotons), the dicke condition is always fulfilled in biopolymers within the cell. dna fulfills it optimally, as the distances between base pairs (3 ngstrom) are much smaller than the wavelength of visible light (~5000). for the volume of the cell popp postulates that destructive and constructive interference between radiating sources of biological systems (biomolecules, organelles, cells, organs, organisms, and populations) may play a central role in biological organization. within the coherence volume between the emitting systems, the radiation may sustain a coherent interference field for considerable lengths of time. by the mechanism of destructive interference, which leads to the cancellation of force vectors, the system can trap photons and thereby store energy. on the other hand, by constructive interference, in the coherence volume between the radiators, stored photons this is equivalent to the creation of a photochemical potential and constitutes a basic mechanism of energy transfer and of communication. the same mechanism also creates long - range attraction and repulsion forces in the coherence volume between identical systems, by which pattern formation and cell adhesion may be achieved. this force does not depend on electrical charges or magnetic moments, only on coherence length, the amount of stored energy, and the planck constant. li contends that the theory of dicke is a major breakthrough in radiation theory as fundamental as planck 's and is universal for the discussion of all real systems including biological systems, whilst the realm of validity of planck 's theory is an ensemble of independent radiators in thermal equilibrium. the nature of the interaction between particles that the conventional approach visualizes as a random, mechanical collision of isolated, hard ball - like particles thus is promoted to a highly ordered communicative and cooperative interconnectedness in a connecting field. as dicke himself stated, his theory also is an alternative formulation of the laser concept. the usual technical approach of engineers treats the laser as a feedback amplifier, the amplification being treated as resulting from stimulated emission, the upper energy state having an excess population. the second approach treats the laser not as an amplifier, but rather as a source of spontaneous emission of radiation with the emission process taking place coherently. it is an important predecessor of the quantum field approach we will present in section 4, in that it first suggested how the electromagnetic field can be trapped within matter, thereby forming a novel form of matter - field unity and giving rise to a laser - like process. however, it still considers the collective interaction as an ensemble of two - body interactions and therefore can not fully account for the embedded and interactive nature of all living systems. in the first half of the 20th century, a number of holistic approaches to biology, based on long - range correlations between molecules and cells, have been developed, mainly in developmental biology [15, 16 ]. they were part of a countermovement to the reductionist program of the berlin school of physically oriented physiologists, among them emil dubois - reymond and hermann von helmholtz, whose work laid the foundations for molecular biology and scientific medicine. the development was initiated by the controversy between wilhelm roux and hans driesch about their embryological experiments with frog and urchin eggs in the late 1880s and early 1890s, where driesch showed that, in the early stages of development, the embryo possessed the faculty of regulation, that is, was able to develop into a whole organism even when parts were damaged or destroyed. driesch concluded that the state of each part of the organized whole of the organism was dynamically codetermined by the neighbouring parts, such that there is a relational structure between the parts that is specific for the organism. biological function was dependent on the position within the whole, not on the mechanical preformation of parts, as roux had assumed. therefore driesch countered roux ' mechanistic mosaic theory of development with his own theory of a vitalistic entelechy, a field - like factor responsible for organismic form and structure that he deemed not accessible to scientific investigation. driesch 's vitalistic challenge caused a fundamental crisis in developmental biology which led to a reformulation of basic concepts in experimental embryology and cell biology. at first, a number of outstanding biologists followed driesch by assuming one of several kinds of neovitalistic stances, among them jacob von uexkll, john scott haldane, constantin von monakow, and richard semon, but by 1930 the movement culminated in a series of proposals for a nonvitalistic alternative to mechanistic biology under the name of holism or organicism. this group of approaches, far from being marginal, played a considerable role in european, american, and russian biology from the 1920s to the 1950s. inspired by the work of spemann on inducers and organizers, a number of mainly british and american biologists, among them paul weiss, joseph needham, ross harrison, conrad waddington, and alexander gurwitsch, set out to identify the organizing principles in developing systems by careful analysis on the level of tissues [54, 55 ]. in the work of these scientists, emerged as a central metaphor for uniting both the organizer and the organized tissues and for understanding the integrating and organizing principles in organisms. implicitly, the field properties of living organisms were already recognized in driesch 's 1891 suggestion that the whole embryo was a the field concept was introduced into biology by gurwitsch and by weiss who also first proposed to use the concept of system in biology in 1924. weiss, who had trained as an engineer and was well grounded in the physical sciences, first used it to explain the results of his and others ' work on limb regeneration in amphibians but later generalized it to ontogeny as a whole. in 19251930, he concluded from his work on bone regeneration that a limb field was directing differentiation in the amputated stump ; it was a property of the field district as a whole and not of a particular discrete group of elements. in the 1940s his studies on nerve orientation in repair and growth processes led him to think that tissue behaves as a coherent unit. in the 1950s weiss investigated chondrogenesis (cartilage formation) and specified the role of tissue environment in general and of mechanical stresses in particular in the differentiation of mesenchyme cells into cartilage. the observation that precartilaginous cells of different types developed in cell culture into the respective specific type of cartilage according to the in vivo pattern convinced him that they possessed highly specific fields with distinctive morphogenetic properties determining the particular pattern of cell grouping, proliferation, and deposition of ground substance which, in due course, lead to the development of a cartilage of a distinctive and typical shape. distinctive morphogenetic properties determining the particular pattern of cell grouping, proliferation, and deposition of ground substance which, in due course, lead to the development of a cartilage of a distinctive and typical shape. weiss referred to the ordering processes leading to the emergence of organ and tissue structuring during development as field actions but emphasized that this should not be taken as an explanation. he defined the biological field as a condition to which a living system owes its typical organization and its specific activities. these activities are specific in that they determine the character of the formations to which they give rise. () inasmuch as the action of fields does produce spatial order, it becomes a postulate that the field factors themselves possess definite order. the three - dimensional heterogeneity of developing systems, that is, the fact that these systems have different properties in the three dimensions of space, must be referred to a three - dimensional organization and heteropolarity of the organizing fields. a condition to which a living system owes its typical organization and its specific activities. these activities are specific in that they determine the character of the formations to which they give rise. () inasmuch as the action of fields does produce spatial order, it becomes a postulate that the field factors themselves possess definite order. the three - dimensional heterogeneity of developing systems, that is, the fact that these systems have different properties in the three dimensions of space, must be referred to a three - dimensional organization and heteropolarity of the organizing fields. the fields were specific that is, each species of organism had its own morphogenetic field. within the organism, there were subsidiary fields within the overall field of the organism, thus producing a nested hierarchy of fields within fields. the russian embryologist and histologist alexander g. gurwitsch was the first to introduce the field concept into biology in 1922, under the name of embryonal, or morphogenetic field. the place of the embryonal formative process is a field (in the usage of the physicists) the boundaries of which, in general, do not coincide with those of the embryo but surpass them. embryogenesis, in other words, comes to pass inside the fields (). thus what is given to us as a living system would consist of the visible embryo (or egg, resp.) and a field. the place of the embryonal formative process is a field (in the usage of the physicists) the boundaries of which, in general, do not coincide with those of the embryo but surpass them. embryogenesis, in other words, comes to pass inside the fields (). thus what is given to us as a living system would consist of the visible embryo (or egg, resp.) and a field. while driesch 's entelechy was of the aristotelian type of biological fields, that is, organizing principles immanent to the organism, evolving with the organism, and playing a causal role in organizing the material systems under their influence, gurwitsch 's morphogenetic fields rather belong to the platonic type ; that is, they are eternal, changeless transcendent forms or ideas of essentially mathematical or geometric naturespatial, but immaterial factors of morphogenesis. however, although inspired by driesch, in contrast to the german scientist, gurwitsch was determined to put the hypothesis of the biological field to the experimental test. in experiments first with onion roots and later with many other organisms, cells, and tissues, he discovered what he called mitogenetic radiation and today is known as ultraweak photon emission or biophoton emission, an ultraweak electromagnetic broad - band (200800 nm) radiation emitted by practically all living organisms [51, 62, 63 ]. with his suggestion that the morphogenetic field produces a thermodynamic nonequilibrium in the molecular ensembles of cells and tissues and that, on the other hand, the potential energy released by the decomposition of such excited non - equilibrium molecular complexes can be transformed into kinetic energy leading to directed movement of substance, he became one of the early proponents of what is today known as dissipative structures. although the field concepts of these early 20th century biologists referred to the model of physical, especially electromagnetic, fields, the organicists generally considered the biological field as a purely heuristic concept, a tool for understanding the phenomena of development, regeneration, and morphogenesis and for making predictions for experimental testing. even those of them tending to the aristotelian position usually preferred not to go beyond the analogy and to leave the exact nature of the fields open. the notion of real electrical, electromagnetic, or otherwise physical fields of long - range force carried too clearly vitalist implications for them. on the other hand, to their taste, the ideal, strongly geometrical fields of gurwitsch were too dematerialized and too far from biochemical reality. for weiss, the field concept was also a mean to remain open as to the nature of the organizing factors as long as the tools for determining it were not adequate. it seems that at that time both, biology and physics, were not yet enough developed to accommodate such a possibility. in physics, there was neither enough experimental evidence for the existence of electromagnetic fields in living organisms nor for the biological effects of e.m. fields, and the implications of quantum theory for a field perspective of life were not yet recognized. another reason for the late acceptance of the electromagnetic aspect of organisms was the success of the biochemical approach to life. among the several reasons quoted in for the fact that the concept of the biological field has almost completely vanished from biology in the 1950s, the most important one was the rise of genetics as an alternative program to explain development. in the 1930s the biological field had been a clear alternative to the gene as the basic unit of ontogeny and phylogeny, and this was seen as a threat to the rise of genetics as the leading field of biology. this was the reason why thomas hunt morgan, one of the founders of modern genetics and himself originally a developmental biologist, actively fought the concept of the morphogenetic field and tried to denounce and ridicule it in all possible ways, although morgan was not able to present any evidence against fields [6466 ]. with the breakthrough of genetically oriented molecular biology through watson and crick 's 1953 model of dna, field theories were definitely out, and the predominance of the biochemical - molecular approach in biology began, as we know it today. the group of structural biologists around brian c. goodwin has advocated the concept of the biological field as an adequate basis for a unified theoretical biology [6769 ]. they state that field properties of organisms underlie both reproduction and regeneration which share the essential feature that from a part a whole is generated. reproduction is not to be understood in terms of weismann 's germ plasm or dna but rather as a process arising from field properties of the living state. they postulate a feedback loop between morphogenetic fields and gene activity : the fields generate ordered spatial heterogeneities that can influence gene activities ; gene products, in turn, can influence the fields, destabilizing certain patterns and stabilizing others. more recently, a group of leading biologists, gilbert, opitz, and raff, have challenged the adequacy of genetics for alone explaining evolution and the devaluation of morphology and have demanded the rehabilitation of the biological field [64, 66 ]. they suggest that evolutionary and developmental biology should be reunited by a new synthesis in which morphogenetic fields are proposed to mediate between genotype and phenotype and to be a major factor in ontogenetic and phylogenetic changes. gene products should be seen as first interacting to create morphogenetic fields in order to have their effects ; changes in these fields would then change the ways in which organisms develop. serious progress in bioelectromagnetic field theory, although there were earlier precursors like keller, crile, lund, and lakhovsky, started not before the work of harold s. burr [74, 75 ] and presman. the concept of burr and northrop, based on burr 's work on bioelectric potentials, is summarized in the following quote : the pattern of organization of any biological system is established by a complex electro - dynamic field, which is in part determined by its atomic physicochemical components and which in part determines the behavior and orientation of those components. this field is electrical in the physical sense and by its properties it relates the entities of the biological system in a characteristic pattern and is itself in part a result of the existence of those entities. more than establishing pattern, it must maintain pattern in the midst of a physicochemical flux. therefore, it must regulate and control living things, it must be the mechanism the outcome of whose activity is wholeness, organization and continuity. the electro - dynamic field then is comparable to the entelechy of driesch, the embryonic field of spemann, the biological field of weiss. the pattern of organization of any biological system is established by a complex electro - dynamic field, which is in part determined by its atomic physicochemical components and which in part determines the behavior and orientation of those components. this field is electrical in the physical sense and by its properties it relates the entities of the biological system in a characteristic pattern and is itself in part a result of the existence of those entities. more than establishing pattern, it must maintain pattern in the midst of a physicochemical flux. therefore, it must regulate and control living things, it must be the mechanism the outcome of whose activity is wholeness, organization and continuity. the electro - dynamic field then is comparable to the entelechy of driesch, the embryonic field of spemann, the biological field of weiss. the groundbreaking work of presman marks the beginning of modern e.m. fields have played some, if not a central, role in the evolution of life and also are involved in the regulation of the vital activity of organisms. living beings behave as specialized and highly sensitive antenna systems for diverse parameters of weak fields of the order of strength of the ambient natural ones. according to presman, e.m. fields play an important role in the communication and coordination of physiological systems within living organisms and also mediate the interconnection between organisms and the environment. however, bioelectromagnetic field theories only recently have reached a certain maturity due to the general progress in electromagnetic theory, bioelectromagnetics, and particularly non - equilibrium thermodynamics and quantum theory. mainly this was achieved in the work of herbert froehlich and what could be called the froehlich school of biophysics, including the prague group of pokorny and the kiev group of davydov and brizhik, in the quantum field theoretical approach of umezawa, preparata, del giudice, and vitiello and in the biophoton research of the popp group in germany. quantum physics has emerged from a major paradigm shift with respect to classical physics which still provides the framework of the vision of nature of most scientists. this change of paradigm has not yet been completely grasped by contemporary science so that not all the implications of this change have been realized hitherto. the classical paradigm assumes that every physical object can be isolated from any external influence and can be studied independently of other objects. since the system is isolated, the relevant physical variables can be unambiguously defined and assume specific values which remain constant in time ; in this way we are able to derive a number of principles of conservation such as, for instance, of energy, momentum, and angular momentum. in this scheme change and movement matter is consequently considered inert and can move only if acted upon by an external agent applying a force. therefore physical reality is assumed to be a collection of separate objects, for instance, atoms, having an independent a priori existence, kept together by external forces whose existence demands a suitable space - time distribution of energy. the formation of an aggregate of atoms requires therefore an adequate supply of energy ; the same requirement applies to every change of its configuration. the components of an aggregate are considered to have the same nature when they are isolated and when they are aggregated ; the interaction is not changing their nature and remains somehow peripheral. the quantum paradigm not only gets rid of the concept of inert matter but also denies the possibility to simultaneously define all the variables of a physical system. every physical object (either a material particle or a field) is conceived as intrinsically fluctuating ; its definition should therefore involve a phase. it exhibits different aspects not simultaneously compatible when addressed from different points of view. this amounts to the choice of different subsets of mutually compatible variables to define the system and therefore to different representations of it. different families can not be defined simultaneously so that the principle of complementarity holds that different families of variables, once defined, give rise to different pictures of the same object, not simultaneously compatible among them. quantum physics supports the objection against localizability raised by zeno of elea who used to say that a flying arrow is not moving since it is at each moment of time in its own place. in this context, a role is played by the quite subtle concept of the quantum vacuum. the strict definition of the vacuum is the minimum energy state of a physical system. the energy of the vacuum should be conceived as the energy necessary to maintain the bare existence of the system. however, since a quantum system can not be ever at rest (in quantum physics there is a horror quietis, i.e. fear of resting), the vacuum should contain the energy related to the system 's quantum fluctuations. however, quantum fluctuations can not be observed directly, and their existence must be inferred from indirect evidence. consequently, physicists are forced to formulate a principle of invariance of the lagrangian (the mathematical function which gives rise to the equations of motion from which the actual behavior of the system is inferred) with respect to arbitrary changes of the local phase of the system (the so - called local phase invariance of the lagrangian). in the following we describe its consequences in nonmathematical terms. the local phase invariance is shown to hold if a field exists which is connected to the space - time derivatives of the phase. in the case of a system made up of electrically charged components (nuclei and electrons of atoms), as, for instance, a biological system, this is just the electromagnetic (e.m.) potential a, where is the index denoting the four space - time coordinates x0 = ct, x1, x2, x3. the electric and magnetic fields are suitable combinations of the space - time derivatives of a. in order to get the local phase invariance, we should assume that the lagrangian is invariant with respect to specific changes of the field a. thus a specific principle of invariance, named denotes a. actually it is well known that the maxwell equations just obey the gauge invariance, which in quantum physics becomes the natural partner of the phase invariance to produce our world ; quantum fluctuations give rise to e.m. this gives an intrinsic nonlocalizability to the system and prevents a direct observation of quantum fluctuations. through the e.m. interactions occur in a two - level way ; the potential keeps the interacting particles phase - correlated whereas the combination of its space - time derivatives, named e.m. the lower level, the potential, becomes physically observable only when the phase of the system assumes a precise value. the structure of electrodynamics makes possible the presence of a potential also when both electric and magnetic fields are absent, whereas on the contrary fields are always accompanied by potentials. the above solution which stems from the mathematical formalism of quantum field theory (qft) opens the possibility of tuning the fluctuations of a plurality of systems, producing therefore their cooperative behavior. let us, first of all, realize that in quantum physics the existence of gauge fields, such as the e.m. potential, dictated by the physical requirement that the quantum fluctuations of atoms should not be observable directly, prevents the possibility of having isolated bodies. for this reason, the description of a physical system is given in terms of a matter field, which is the space - time distribution of atoms / molecules, coupled to the gauge field with the possible supplement of other fields describing the nonelectromagnetic interactions, such as the chemical forces. in quantum physics, the space - time distribution of matter and energy has a coarse - grained structure which allows its representation as an ensemble of quanta (particle representation). however, according to the principle of complementarity, there is also another representation where the phase assumes a precise value ; this representation which focuses on the wave - like features of the system can not be assumed simultaneously with the particle representation. the relation between these two representations is expressed by the uncertainty relation, similar to the heisenberg relation between position and momentum, (1)n12 connecting the uncertainty n of the number of quanta (particle structure of the system) and the uncertainty of the phase (which describes the rhythm of fluctuation of the system). consequently, the two representations we have introduced above correspond to the two extreme cases. if n = 0, the number of quanta is well defined, so that we obtain an atomistic description of the system but lose the information on its capability to fluctuate, since becomes infinite. this choice corresponds to the usual description of objects in terms of the component atoms / molecules. if = 0, the phase is well defined, so that we obtain a description of the movement of the system but lose the information on its particle - like features which become undefined since n becomes infinite. such a system having a well - defined phase is termed coherent in the physical jargon. if n = 0, the number of quanta is well defined, so that we obtain an atomistic description of the system but lose the information on its capability to fluctuate, since becomes infinite. this choice corresponds to the usual description of objects in terms of the component atoms / molecules. if = 0, the phase is well defined, so that we obtain a description of the movement of the system but lose the information on its particle - like features which become undefined since n becomes infinite. such a system having a well - defined phase is termed coherent in the physical jargon. in the phase representation, the deepest quantum features appear since the system becomes able to oscillate with a well - defined phase only when the number of its components becomes undefined, so that it is an open system and able to couple its own fluctuations to the fluctuations of the surroundings ; in a sense, such a coherent system, like a biological one, is able to feel the environment through the e.m. a coherent system involves two kinds of interaction : an interaction similar to that considered by classical physics, where objects interact by exchanging energy. can not travel faster than light, this interaction obeys the principle of causality ; an interaction where a common phase arises among different objects because of their coupling to the quantum fluctuations and hence to an e.m. there is no propagation of matter and/or energy taking place, and the components of the system talk to each other through the modulations of the phase field travelling at the phase velocity, which has no upper limit and can be larger than c. an interaction similar to that considered by classical physics, where objects interact by exchanging energy. can not travel faster than light, this interaction obeys the principle of causality ; an interaction where a common phase arises among different objects because of their coupling to the quantum fluctuations and hence to an e.m. the components of the system talk to each other through the modulations of the phase field travelling at the phase velocity, which has no upper limit and can be larger than c. the process of the emergence of coherent structures out of a crowd of independent component particles has been investigated in the last decades and is presently quite well understood [3, 11 ]. let us describe a simple case where a large number n of atoms of the same species, whose particle density is n / v, are present in the empty space in the absence of any externally applied field. field should always be assumed to be present, namely, the field arising, as said above, from the quantum fluctuations of the vacuum. the presence of this field has received experimental corroboration by the discovery of the so - called lamb shift, named after the nobel prize winner lamb. he discovered as far back as in 1947 that the energy level of the electron orbiting around the proton in the hydrogen atom is slightly shifted (about one part per million) with respect to the value estimated when assuming that no e.m. further corroboration for the existence of vacuum fluctuations is provided by the casimir effect [7880 ]. therefore a weak e.m. field is always present, just the one arising from the vacuum quantum fluctuations. let us assume, for the sake of simplicity, that the atoms can exhibit just two configurations : the minimum energy state which is the vacuum of the atom and the excited state having an excitation energy e = h (the einstein relation connecting e to the frequency of a photon having the same energy, where h is the planck constant). a quantum fluctuation having the same frequency and a corresponding wavelength = c/, where c is the speed of light, is therefore able to excite an atom present in the volume v = of the fluctuation, that is, to raise it from the ground configuration to the excited configuration. the excited atom releases the excitation energy and comes back to the ground configuration after a typical time dictated by atomic physics, that is, the decay time of the excited state. we should now pay attention to an important mismatch of the scales present in the problem we are dealing with. an atom has a size of about 1 ngstrom () which amounts to 10 cm, whereas a typical excitation energy is in the order of some electron volts (ev 's), corresponding to a wavelength of the associated e.m. fluctuation) able to induce a change of configuration in the atom is some thousands of times wider than the atom itself. hence a single quantum fluctuation can simultaneously involve many atoms ; in the case, for instance, of the water vapor at boiling temperature and normal pressure, the exciting e.m. mode (in this case 12 ev) would include in its volume 20,000 molecules. let us assume now that in the volume v = of the fluctuation there are n atoms. lamb shiftlike phenomena) that an isolated atom is excited by an e.m. quantum fluctuation. therefore the probability pn that one out of the n atoms gets excited by the fluctuation is (2)pn = pn = p3(nv)=p3d, where d is the density of atoms. we can see that there is a critical density dcrit such that pn = 1, which means that the fluctuation excites with certainty one atom. in such conditions, the virtual photon coming out from the vacuum is handed over from one atom to another and gets permanently entrapped within the ensemble of atoms, being busy in keeping always at least one atom excited ; according to this dynamics atoms acquire an oscillatory movement between their two configurations. in a short time, many quantum fluctuations pile up in the ensemble, producing eventually a large field which keeps all atoms oscillating between their two configurations. moreover, the field gets self - trapped in the ensemble of atoms since its frequency becomes smaller ; actually the period of oscillation t of the free field should be extended by adding the time spent within the excited atoms. the mass m of the photon, which is zero in the case of a free field, becomes imaginary. in fact, by using the einstein equation for the photon mass and energy, we get (3)m2=e2c2p2=h2(2c22)h2(freec22)=0. the fact that free implies that the squared mass m of the trapped photon becomes negative and the mass m imaginary, which implies furthermore that the photon is no longer a particle and can not propagate. the field generated within the ensemble of atoms can not be irradiated outwards and keeps the atoms oscillating up and down between the two configurations. finally, in this way the ensemble of atoms becomes a self - produced cavity in which the e.m. mode is trapped, and, like in the cavity of a laser, the field becomes coherent, that is, acquires a well - defined phase, in tune with the oscillations of the atoms, which therefore become coherent, too. the more realistic case of atoms having a plurality of excited states has been also successfully addressed and needs a more sophisticated mathematics. among all the excited levels, the one selected for giving rise to the coherent oscillation the region becomes a coherence domain (cd) whose size is the wavelength of the e.m. mode, where all atoms have tuned their individual fluctuations to each other and to the oscillation of the trapped field. the size of the coherence domain can not be arbitrary but is determined in a self - consistent way by the dynamics underlying the emergence of coherence via the wavelength of the involved e.m. mode. the fact that a biological system appears to be a nested ensemble of cavities within cavities of different sizes (organs, tissues, cells, organelles, etc.) having well - defined sizes is a strong indication for its coherence. in a cd there is a common phase, specific of the cd, which is therefore an object governed by a dynamics which eliminates the independence of the individual components and creates a unitarily correlated behavior of all of them, governed by the e.m. field. it is interesting to note that the german botanist julius sachs, as far back as in 1892, coined the term energide to denote the unity of matter and field constituting the nature of cells, namely, the unity of matter and the so - called vital force which gives to biological matter its special active properties discriminating it from inert nonliving matter. communication within the domain takes place at the phase velocity, since the messenger is the e.m. moreover, the correlation can involve only atoms / molecules able to oscillate at the same frequency or some harmonics thereof (resonance). finally, the emergence of coherence is a spontaneous event once the critical density dcrit = (n / v) is exceeded. the above argument has not taken into account temperature and thermal effects, which are limiting constraints for coherence generation. when we include the thermal motion of atoms and the related thermal collisions, we realize that a fraction of the coherent atoms will be pushed out of tune by the collisions, so that above the critical temperature where this fraction becomes the unity, the coherent state can not exist anymore. in conclusion, an ensemble of microscopic units (atoms, molecules, etc.), provided that they are composite systems having a plurality of internal configurations, becomes always spontaneously coherent once a critical density is overcome and temperature is lower than a critical threshold. the coherent dynamics outlined above produces stable coherence domains since the coherent state is a minimum energy state, where the energy is lower than the energy of the original ensemble of noncoherent independent particles, because of the interaction between the atoms / molecules and the self - trapped e.m. field. therefore the coherent system can not decay spontaneously into another state having a still lower energy. the coherent state can be dismantled only by a supply of external energy large enough to overcome the energy gap, that is, the difference of energy between the coherent state and the noncoherent ensemble of its components before the onset of coherence. the energy gap therefore protects both the integrity and stability of the coherent system and the individual integrity of the components against (small) external disturbances. however, the examples of coherent systems that are more widely known in common scientific culture, for example, lasers, occur in the presence of an external supply of energy, which in the physical jargon is termed a pump. coherence in these cases appears only when the system is pumped, so that it can not arise and survive spontaneously, and the system is faced by the limiting element of the inverse process, decoherence. the analogy of living organisms with lasers should therefore be considered as a metaphor. in the present context, a decisive role is ascribed to water, as this is the case in the living organism. therefore let us now treat the special case of the formation of coherence domains in this life - sustaining substance, which has been examined in depth and which allows us also to come back to the coherent dynamics envisaged above [3, 81, 8386 ]. the emergence of coherence, as described above, accounts successfully for the vapor - liquid phase transition and for the thermodynamics of water. a quantitative agreement with experimental evidence has been found [87, 88 ]. the coherent oscillation of the water molecules, which induces the formation of the coherence domains, occurs between the molecule 's ground state and an excited state at 12.06 ev, which is slightly below the ionization threshold at 12.60 ev. the electron cloud of the water molecule oscillates between a configuration where all electrons are tightly bound (in this configuration water is an insulator and a mild chemical oxidant, since it is able to bind an extra electron) and a configuration where one electron is almost free (in this configuration water becomes a semiconductor and a chemical reducer, since it is able to release electrons). we have therefore the following consequences.within the cd a coherent plasma of quasifree electrons is present ; the coherence of the plasma is the consequence of the coherence of molecules. this plasma is able to give rise to coherent cold vortices, since coherence prevents collisions among electrons which would occur, should electrons be independent, when external energy is supplied. in this way the water cd acquires a spectrum of coherent excited states. for water cd 's we can iterate the argument given above for atoms / molecules and we get, in the case of water, a hierarchy of levels of coherence which starts from the elementary domains, whose size is 0.1 microns (which is the wavelength corresponding to an e.m. mode of 12.06 ev) and reaches much higher scales corresponding to superdomains as wide as microns (cells), centimeters (organs), and meters (organisms), parallel to the corresponding hierarchy found in biology. this hierarchy underlies the fractal nature of living organisms ; it has been recently proven that fractals are just the consequence of the sequence of nested coherent dynamics.water cd 's are able to release electrons, either by quantum tunneling or by mild external excitations. the pair coherent water - noncoherent water (as it is present at the boundary of a domain) is therefore a redox pile able to supply the electrons needed in the redox chemical processes which produce the bulk of the biological energy. szent - gyorgyi has long ago shown that electrons should be available on biological surfaces [22, 31, 91 ]. a difference of electric potential in the order of several tens of millivolts (the same order as the membrane potential) has been estimated to be present across the interface at the boundary of water cd 's. within the cd a coherent plasma of quasifree electrons is present ; the coherence of the plasma is the consequence of the coherence of molecules. this plasma is able to give rise to coherent cold vortices, since coherence prevents collisions among electrons which would occur, should electrons be independent, when external energy is supplied. in this way the water cd acquires a spectrum of coherent excited states. for water cd 's we can iterate the argument given above for atoms / molecules and show that water cd 's can become coherent among them, giving rise to a supercoherence. we get, in the case of water, a hierarchy of levels of coherence which starts from the elementary domains, whose size is 0.1 microns (which is the wavelength corresponding to an e.m. mode of 12.06 ev) and reaches much higher scales corresponding to superdomains as wide as microns (cells), centimeters (organs), and meters (organisms), parallel to the corresponding hierarchy found in biology. this hierarchy underlies the fractal nature of living organisms ; it has been recently proven that fractals are just the consequence of the sequence of nested coherent dynamics. water cd 's are able to release electrons, either by quantum tunneling or by mild external excitations. the pair coherent water - noncoherent water (as it is present at the boundary of a domain) is therefore a redox pile able to supply the electrons needed in the redox chemical processes which produce the bulk of the biological energy. szent - gyorgyi has long ago shown that electrons should be available on biological surfaces [22, 31, 91 ]. a difference of electric potential in the order of several tens of millivolts (the same order as the membrane potential) has been estimated to be present across the interface at the boundary of water cd 's. in conclusion, liquid water (which contributes about 70% of the total mass and 99% of the total number of component molecules of a living organism) exhibits a twofold inner dynamics. (1) through the hierarchical scale of nested coherence domains just described, water is able to store energy in the coherent electron vortices in the cd 's whose lifetime can be very long because of coherence ; the long lifetime of the single excitations enables a pile - up of excitations which are unified by coherence into single excitations of higher energy, producing a sharp decrease of entropy. this feature confirms the proposal of schrodinger about the need of negative entropy (negentropy) for the appearance of order in living systems. the water cd appears as a device able to collect energy from the environment as an ensemble of many independent low - energy excitations (high entropy) and to transform them into a single excitation of high energy (low entropy). this property makes water cd 's likely candidates to be dissipative structures la prigogine. appearance of coherence in a physical system implies a spontaneous decrease of its entropy, since energy gets concentrated to a smaller set of degrees of freedom than before the onset of coherence. this phenomenon is possible without violating the second law of thermodynamics only if the system is open ; the release of energy outwards, with the connected increase of entropy of the environment, is just the condition for the decrease of the internal entropy of the system. moreover the spontaneous decrease of its internal entropy transforms its total energy into free energy able to perform external work. when the energy stored in a cd changes the frequency of the cd so that it becomes equal to the frequency of one nonaqueous molecule present in the surroundings, this molecule can be accepted as a further partner of the cd and receives by resonance the stored energy, getting chemically activated and able to react chemically. the energy released in the chemical reaction is in turn taken over by the water cd, which correspondingly changes again its own frequency and becomes able to attract different molecular species. the range of attraction between cd 's and coresonating molecules has the size of the cd and then provides the long - range selective attraction among molecules that is sorely missing in modern biochemistry [8, 81 ]. the above consideration allows us to sketch a first rough scheme of a picture of biochemical processes not based on diffusion and random molecular movements, where molecular encounters are not random but obey specific organic codes evolving in time and where each step of the biochemical sequence is determined by the previous one. in the dynamics outlined here (2) there is, however, a second dynamics always coupled with the first one, which plays a major role in the communication at a long distance. an ensemble of nested time - dependent coherence domains, such as those possible in aqueous systems (living organisms are of course aqueous systems), exhibits therefore an extended phase field evolving in time. within this field, communication travels faster than light, providing a connection at a large distance among the parts. according to the concepts described in the first part of this section, the variations of the phase produced by the dynamics of the biochemical scheme discussed above are carried within the larger coherent region by the e.m. potential which at each point triggers changes in the molecular dynamics (recall that the potential appears in the schrodinger equation of the molecule). in this scheme the information gets spread around by an agent, the phase, able to travel faster than light, provided that the journey takes place within the coherent region, but no actual propagation of energy occurs. the energetic requirements of the flow of information are met solely by the energy present locally. in other words, the sequence of events is as follows : an energetic event (e.g., a chemical reaction) occurs at some place of the coherent region, its output energy induces a change of the phase of the host cd, and an e.m. potential then arises which reaches with a speed faster than light far away regions whose phase is correspondingly changed, implying a change of the local molecular dynamics. an actual transfer of energy and/or matter does not take place at any point in this sequence of events, removing therefore the usual objection raised against the real existence of phenomena which seem to imply the existence of an instantaneous action at a distance by living organisms. the existence of a coupling among components of a living organism mediated by the e.m. potential could also provide a surprising unexpected rationale for the seeming paradox of large biological effects induced by the application of very weak electromagnetic fields. this occurs, for instance, when cell cultures are irradiated by low - intensity microwaves. cells exhibit large biological effects when the microwave irradiation occurs at selected values of the microwave frequency, according to a spectrum specific of the cell species. above a very tiny threshold, the effect does not depend on intensity, provided that the intensity is below the value where thermal effects begin to be significant. this nonthermal effect of radiation coupled to the seeming paradox of effects disproportional to the amount of supplied energy could be understood by assuming that the effective agent is not the field but the potential. further information on the effect of potentials on biological targets will be provided in section 5 when we will discuss the experimental corroboration for the present theoretical scheme. we should now come back to the properties of the usual normal water, by realizing that the above complex dynamics with the interplay between chemistry and coherent quantum electrodynamics can not occur in normal bulk water, that is, water far from surfaces. the reason is that in normal bulk water the interplay between electrodynamic processes inducing coherence and thermal processes hampering coherence gives rise to a continuously changing dynamic equilibrium where each molecule crosses very swiftly from a coherent to a noncoherent state, and vice versa. in such a situation the total number of molecules belonging to the two fractions, coherent and non - coherent, is constant at each temperature, as it occurs in the well - known case of superfluid liquid helium. however, the molecules actually belonging to the two fractions are continuously crossing over between the two fractions, producing a flickering landscape at a microscopic level. since every observation implies a time average of the observed features on the time necessary for the observation, this explains why liquid water (and the other liquids too) looks homogenous and not like the two - phase liquid it really is. consequently, a water cd does not live long enough to exhibit its long - time features and to produce a history. however, close to a surface, a wall, or a molecular backbone able to attract water, the attraction energy adds up to the energy gap produced by the coherent dynamics and gives rise to a better shielding against thermal disruption. as a consequence, there is no point of the aqueous medium further removed from some surface or macromolecular chain than a fraction of a micron, so that we can infer that almost the whole biological water is interfacial and therefore coherent. the above property accounts for the observation that water in the hydration shells of biomolecules exhibits quite different properties than usual bulk water. in particular, it has been observed that this water looks like water at subzero temperatures (overcooled water), which resembles more and more to a glass when lowering temperature. this property has been investigated in the qed framework by buzzacchi. who have shown that the coherent fraction of water increases at decreasing temperature and coincides with the whole mass of the liquid at temperature around 200 k. at a temperature of 250 k coherent fraction has already a very high value, about 0.7. it is not strange that when coherent fraction gets increased by the interaction with a surface water looks like overcooled water. this property has been observed by many authors as, for instance, levstik.. let us quote verbatim the statement of pagnotta and bruni : interfacial and intracellular water is directly involved in the formation of amorphous matrices, with glass - like structural and dynamical properties. we propose that this glassiness of water, geometrically confined by the presence of solid intracellular surfaces, is a key characteristic that has been exploited by nature in setting up a mechanism able to match the quite different time scales of protein and solvent dynamics, namely to slow down fast solvent dynamics to make it overlap with the much slower protein turnover times in order to sustain biological functions. additionally and equally important, the same mechanism can be used to completely stop or slow down biological processes, as a protection against extreme conditions such as low temperature or dehydration. interfacial and intracellular water is directly involved in the formation of amorphous matrices, with glass - like structural and dynamical properties. we propose that this glassiness of water, geometrically confined by the presence of solid intracellular surfaces, is a key characteristic that has been exploited by nature in setting up a mechanism able to match the quite different time scales of protein and solvent dynamics, namely to slow down fast solvent dynamics to make it overlap with the much slower protein turnover times in order to sustain biological functions. additionally and equally important, the same mechanism can be used to completely stop or slow down biological processes, as a protection against extreme conditions such as low temperature or dehydration. a more impressive consequence of the interaction between liquid water and solid surfaces has been provided by the group led by pollack [98101 ]. they have found that the water layer close to a hydrophilic surface assumes peculiar properties. this layer may be as thick as some hundreds of microns andexcludes all solutes ; hence the name exclusion zone (ez) is given to such layer;is about tenfold more viscous than normal water, looking like a glass;becomes fluorescent for wavelengths of 270 nm;assumes a surface charge of the same sign of the solid surface ; exhibits a difference of electric potential with respect to the neighbouring bulk water of about 100 mv. excludes all solutes ; hence the name exclusion zone (ez) is given to such layer ; is about tenfold more viscous than normal water, looking like a glass ; becomes fluorescent for wavelengths of 270 nm ; assumes a surface charge of the same sign of the solid surface ; exhibits a difference of electric potential with respect to the neighbouring bulk water of about 100 mv. all these properties have been accounted for in the qed framework in a recent paper. the presence of electromagnetic fields in the water layers close to the surface produces the appearance of a nondiffusive regime for particles present in these layers or on theirs surfaces. as a matter of fact moreover the role of this nondiffusive regime near surfaces has been detected in the belousov - zhabotinsky (bz) systems, where the self - ordering disappears when the amount of water decreases below a threshold. the large size of the layers of ez water (up to 500 m) is much larger than the size of cds of water molecules (0.1 m) calculated in [3, 86 ], showing that the phenomenon of coherence among coherence domains as suggested by is at work. the complex dynamics arising from the interplay of many scales of coherence which can not occur in normal water therefore can arise near surfaces (recall the possible role of lagoons and clay surfaces in the origin of life ; see [104, 105 ]) and can be safely at work within living organisms, suggesting the possibility of understanding at last their deepest dynamics. the theoretical framework outlined above has increasingly received support by a growing body of evidence. first of all, one should realize that the qft picture satisfies the two main requirements demanded by biological evidence we have discussed in the introduction : the existence of selective recognition and attraction among biomolecules (organic codes) and long - range connections among biocomponents which can not be accounted for by the very short - range interactions implied by a purely chemical dynamics. however, we are now confronted by more direct evidence. in the last decade, the investigation of photosynthetic systems has produced evidence for the existence of coherent long - range connections between biomolecules. let us quote verbatim from the abstract of a recent paper published in nature : intriguingly, recent work has documented that light - absorbing molecules in some photosynthetic proteins capture and transfer energy according to quantum - mechanical probability laws instead of classical laws at temperatures up to 180 k. this contrasts with the long - held view that long - range quantum coherence between molecules can not be sustained in complex biological systems, even at low temperatures. here we present two - dimensional photon echo spectroscopy measurements on two evolutionarily related light - harvesting proteins isolated from marine cryptophyte algae, which reveal exceptionally long - lasting excitation oscillations with distinct correlations and anti - correlations even at ambient temperature. these observations provide compelling evidence for quantum coherent sharing of electronic excitation across the 5 nm wide proteins under biologically relevant conditions, suggesting that distant molecules within the photosynthetic proteins are wired together by quantum coherence for more efficient light - harvesting in cryptophyte marine algae. intriguingly, recent work has documented that light - absorbing molecules in some photosynthetic proteins capture and transfer energy according to quantum - mechanical probability laws instead of classical laws at temperatures up to 180 k. this contrasts with the long - held view that long - range quantum coherence between molecules can not be sustained in complex biological systems, even at low temperatures. here we present two - dimensional photon echo spectroscopy measurements on two evolutionarily related light - harvesting proteins isolated from marine cryptophyte algae, which reveal exceptionally long - lasting excitation oscillations with distinct correlations and anti - correlations even at ambient temperature. these observations provide compelling evidence for quantum coherent sharing of electronic excitation across the 5 nm wide proteins under biologically relevant conditions, suggesting that distant molecules within the photosynthetic proteins are wired together by quantum coherence for more efficient light - harvesting in cryptophyte marine algae. the amount of pioneering research done on photosynthetic systems (see also the references of the quoted paper) opens the way to extended research on other biological systems in order to test the assumption that a coherent connection among biomolecules could be the general rule in biology. a direct corroboration of the electromagnetic nature of the biological dynamics and of the central role played by water in it has been provided by some recent work performed by a group led by the nobel prize winner montagnier. bacterial dna sequences are suspended in pure bidistilled deionized water, and subsequently water is added increasing the dilution of the dna sequences. the cuvette containing the suspension is put within a coil connected with a signal amplifier. above a threshold of dilution, low - frequency e.m. fields (5003000 hz) are found at the condition that a very low - frequency (a few hz) e.m. the ensemble of these two circumstances suggests that water interacting with the dna is responsible for the emission of fields and that, as illustrated in the last section, the energy of the signals is provided by the ambient noise being stored in water. additional evidence is given by the circumstance that by further diluting the solution the intensity of the signals gets enhanced. a further fundamental feature appearing in the experiment is obtained by supplying the emitted signals to pure water contained in another vessel for a suitable time. this second vessel can even be located very far away and receive the signal coded in the first vessel at a distance, removing therefore the possibility of molecular contamination between the two vessels. after adding pcr molecules (the basic chemical components of dna) to the irradiated water, the experimental evidence is consistent with the outcome of our theoretical framework that the supplied field induces a space - time distribution of the phase (which induces in turn an e.m. this in turn drives the formation of a coherent biological aggregate, once the necessary biomolecules are supplied. potential) emitted from living organisms or from cosmic sources could affect the genic structure of organisms and have therefore possibly an impact on the species evolution. direct evidence for this is obtained by a number of experiments performed in the last years (see, e.g., [13, 17 ]). smith observed significant clinical effects on patients after their exposition to the action of fields produced by coils wound around ferromagnetic toroids ; in this case, the magnetic field is tightly trapped within the toroid and can not leak out so that the only field which can be present outside the toroid is the magnetic vector potential. hence the appearance of clinical effects on the exposed patients can be produced solely by the magnetic vector potential. since quantum physics prescribes that a pure potential can affect coherent systems only, the smith results provide evidence suggesting that the living organism is a coherent system. more compelling evidence is provided by the trukhan and anosov experiment which does not involve human subjects. in their experiment the probed system is an ensemble of red blood cells suspended in water, and the measured variable is the velocity of sedimentation. the magnetic vector potential is switched on and off by switching on and off the electric current in the coil wound around the toroid. a significant change of the velocity of sedimentation of the erythrocytes is observed when the potential is present. again, we obtain evidence that the affected biological targets are coherent systems and that a physical variable as the e.m. a last body of evidence comes from the appearance of new properties of liquid water when undergoing a special physical treatment. an israeli group has been able to observe a significant change of the physical properties of an aqueous system after irradiation by microwaves ; they termed this specially treated water they observed that the space structure of the electrochemical deposits, left on the electrodes when using the neowater as a solvent, was much different from that left in the case of normal water, suggesting a different space distribution of the fields present in the solvent. the same properties were induced in water by using the suspension of microspheres of barium titanate or by the addition of fullerene molecules as a treating agent instead of microwaves. this is a surprising result since the same outcome has been produced by three completely different physical treatments. in our picture this would correspond to three different ways of enhancing the same feature, that is, the coherence of water. an intriguing feature appearing in neowater is the presence of a spatially ordered, crystal - like stable array of gas micro - bubbles. in normal water microbubbles since nonaqueous molecules are expelled from within the coherence domains (because they are unable to resonate with water cd 's), a bubble is going to appear in the interstice between a cd and its next neighbouring domain. the ordered array of microbubbles is therefore the consequence of the existence of an ordered array of water cd 's, as it occurs when cd 's become coherent among them (supercoherence). since supercoherence can occur in a permanent way, as pointed out in section 3, in interfacial water and biological fluids, neowater is a liquid where the possibility of supercoherence is extended to the bulk of the water by the physical treatment. they show that, by suspending triturated vegetal leaves and algae in water, after a suitable physical treatment, properties similar to those exhibited by neowater appear. the trituration of the suspended vegetals is meant to induce a highly enhanced coherent activity by them, because their instinct of survival induced by the irritation fields connected with this activity would then, as in the montagnier experiment, imprint the surrounding water and produce coherence among coherence domains, namely, supercoherence. the quantum field theoretical picture, outlined in the present paper which has already got some experimental corroboration, opens new perspectives for future research. the feasibility of such a point of view has been already anticipated in some discussion on the origin of interconnectedness in biology. a holistic picture of the living organism emerges which combines all the achievements reached by modern molecular biology with the collective dynamics made possible by the achievements of modern quantum physics. in each biological cycle, biomolecules encounter each other and behave exactly as in the ways discovered by molecular biology. however, molecular encounters do not occur through random diffusion movements but are driven by extended e.m. fields arising from the collective dynamics of water whose decisive role in the biological dynamics has been at last recognized. consequently, a living organism can not be conceived any longer as a mere collection of independent molecules mutually coupled by chemical interactions only but must be seen as a coherent ensemble, a matter field, whose evolution is driven by long - range e.m. the ensuing picture of a living organism becomes that of a hologram, as suggested by pribram for the brain. the corresponding complex dynamics could be summarized as follows : water molecules, which account for the vast majority of molecular components of the organism, organize themselves into extended coherence domains where e.m. these coherence domains are able to collect chaotic energy (high entropy) from the environment and store it in the form of coherent excitations (low entropy) which change the frequency of the trapped e.m. fields. when this frequency matches the frequency of some nonaqueous molecules present in the surroundings, those molecules are attracted to the boundaries of the water cd 's, coating them and possibly producing membranes. the attracting forces are of the same type as the forces arising on the boundaries of laser beams and are the consequence of the following theorem : two particles able to oscillate at the respective frequencies 1 and 2 when immersed in an extended e.m. field oscillating at a frequency 0, develop an attracting force (dispersive force), whose range coincides with the size of the background field. the attractive force becomes very large when the three frequencies 0, 1, and 2 do not differ more than the thermal noise kt. the above theorem puts a constraint on which molecular species can be involved in the above dynamics. a molecule is able to participate in the coherent dynamics driven by water if and only if a frequency i is present in its spectrum such that (4)h|icd|kt. when molecules satisfy the constraint put by equation (4), they can steal energy from the thermal noise in order to resonate with the frequency of the cd and thus be involved in the coherent dynamics. notice that the frequencies of oscillation of water cd 's have been estimated to be in the infrared range (0.2 0.3 ev), so that the relevant part of the spectra of biomolecules is just the infrared one. in conclusion, in order to become a biomolecule, a given molecule is required to have in its spectrum a frequency contained in the range of the values of frequencies the water cd can assume. on this base the validity of the present scheme could be subjected to a test. notice that, out of the about 100 amino acids known to chemists, only 20 are present in the biochemistry of living organisms. here, the question must be asked why the other 80 amino acids are neglected by the organism. the occurrence of chemical reactions and the corresponding release of energy, as we have seen in section 4, changes the frequency of the water cd and consequently also changes the involved molecular species ; in such a way, we get finally a time - dependent scheme of molecular recognition and recall. future research will have to work out testable schemes of biochemical reaction sequences, based on a detailed knowledge of infrared molecular spectra. potential, so that they affect each other in such a way that we do not have linear sequences of local events but sequences where each step is a synchronous ensemble of coordinated events spanning the whole region. the growing organism attracts new molecules through the field already formed within itself, so that the attraction does not occur at random but according to a code provided by the ensemble of frequencies present in the field. this attraction is a long - range attraction, since the field is falling off at the cd interface, as it occurs in all self - trapping cavities, and produces an exponentially decreasing evanescent tail. it is just this tail that allows the coherent system to explore its surroundings. in this way these features of the evanescent field as responsible for the attraction of molecules on the cd surface account for the astonishing lack of biochemical mistakes, unavoidable within a random dynamics, and for the rapidity of the growth process which is well known to occur in a highly coordinated fashion. ho and her colleagues have already proposed in 1994 that the morphogenetic field governing the growth of an embryo coincides with an e.m. potential. a fascinating survey of morphogenesis has been given by. a highly interesting contribution to this line of thinking however a detailed study of morphogenesis has not yet been performed and is a topic for future investigations. the necessity of a resonance between biomolecules and water is at the origin of the appearance of geometrical shapes in living organisms. the frequency of oscillation of biomolecules should coincide with the frequency of oscillation of water cd 's ; however, the frequency of biomolecules depends on their chemical or other short - range bindings with neighbouring molecules. these bindings depend in turn on the mutual position of the interacting partners. on the contrary, the frequency of oscillation of cd 's is not dependent on these local features. as a consequence, in order to match the frequency of the cd, biomolecules are compelled to assume those well - defined positions in space which allow them to oscillate at the same frequency as the cd 's, hence the appearance of specific geometrical shapes in the structure of living organisms. the time dependence of the coherent dynamics implies a time dependence of the geometrical shapes, and this property could account for the interesting findings of claverie and jona lasinio about molecular structures. the concept of coherence applied here to biology has found so far a large scale application in the studies on brain dynamics [113119 ]. according to this body of investigations, the activity of the brain is not the result of the activity of single neurons but emerges from the mass action (as freeman has termed this collective activity) of macroscopic regions of the brain. a further offspring of this study is an approach to the problem of the emergence of consciousness [115, 116 ], which arises just from the permanent interaction of the brain with some part of the environment, that is, the ensemble of external oscillators resonating with the brain oscillators ; vitiello terms the external ensemble of oscillators the double of the brain. a final topic we address in this concise outlook concerns the concept of health. a healthy organism, according to the present scheme, should be a system where all the physiological and psychological subsystems are optimally synchronized and coherent with each other in a highly coordinated way. within this systemic state of coherence which is maintained by the communication through the e.m. potentials described above, the coherent interplay between fields and matter plays a decisive role. frequency must find a molecule able to respond to it, and each molecule present in the coherent region is governed by a corresponding field resonating with the respective molecular frequency. this could be a possible root of the well - known principle of biological homeostasis. it is entirely possible that the well - studied chemical effects of drugs could in actual practice be supplemented by electromagnetic effects induced by their presence. for instance, oligoelements are known to be essential for the health of human organisms. however, their actual concentration in the body is so low (10 mol) to make the assumption unlikely that their effect is the consequence of their presence on specific sites. a likely explanation, which of course demands experimental testing, could be that the atoms of an oligoelement do not act as chemical subjects but as e.m. antennae ; these atoms could be conceived as the elements of a chain of e.m. the above speculation would suggest the existence, besides the local chemical effect, of an action at a distance of selected molecular species of drugs. the identity and stability of the coherent system are protected by the energy gap which is the amount of energy necessary to destroy coherence. actually, a change of the structure of some components of a coherent ensemble by varying their oscillation frequency would put them out of tune with the general oscillation and hamper coherence. however, these local changes of the structure of the components would demand a supply of energy larger than the energy gap. actually, local chemical reactions or other kinds of local processes could possibly release amounts of energy larger than the energy gap ; for example, this release of energy could come from the local interaction of a microorganism hosted in the organism and some microscopic components of a larger coherent unit of the organism. in the case of an energy output of an interaction larger than the energy gap of the components, these last ones would be pulled out of coherence, damaging the wholeness of the organism. in this case the microorganism would turn into a pathogen, and illness would set in. in the conventional perspective, the therapy demands the killing of the pathogen, that is, a specific local therapy. however, the scheme presented here would suggest the alternative strategy of increasing the height of the energy gap through the enhancement of coherence, making it unchallengeable by the local productions of energy (i.e., improving the terrain as old medical doctors used to say). in summary, we think that a new perspective opens to biological research. it accepts all the achievements of modern molecular biology but embeds them within a collective dynamics originating from the basic quantum features of nature and is able to create an overall dynamic order in the organism. | intermolecular interactions within living organisms have been found to occur not as individual independent events but as a part of a collective array of interconnected events. the problem of the emergence of this collective dynamics and of the correlated biocommunication therefore arises. in the present paper we review the proposals given within the paradigm of modern molecular biology and those given by some holistic approaches to biology. in recent times, the collective behavior of ensembles of microscopic units (atoms / molecules) has been addressed in the conceptual framework of quantum field theory. the possibility of producing physical states where all the components of the ensemble move in unison has been recognized. in such cases, electromagnetic fields trapped within the ensemble appear. in the present paper we present a scheme based on quantum field theory where molecules are able to move in phase - correlated unison among them and with a self - produced electromagnetic field. experimental corroboration of this scheme is presented. some consequences for future biological developments are discussed. |
non - alcoholic fatty liver disease (nafld) is characterized by pathological fat accumulation in hepatocytes in the absence of excessive alcohol consumption, which comprises a wide spectrum of liver disease ranging from steatosis to steatohepatitis, cirrhosis and even hepatocellular carcinoma. it is clear that nafld is strongly associated with insulin resistance, obesity, dyslipidemia and diabetes but its pathogenesis is not fully understood. according to the two hit hypothesis, hepatic steatosis and insulin resistance occur first because of an increased uptake of lipids and/or decreased fatty acids oxidation, inadequate de novo synthesis of triglycerides, and/or decreased synthesis or secretion of very low density lipoproteins (vldls) in liver. this induces a chronic inflammatory condition characterized by the release of pro - inflammatory cytokines and oxidative stress. both of which are responsible of the second hit, which induces the progression from steatosis to more advanced stages of liver damage. this theory, however, should be revised since the increased ratio of saturated - to - un - saturated fatty acids within the liver directly induce hepatic inflammation and insulin resistance, which may worsen nafld progression. currently, the first - line treatment of nafld is based on diet and lifestyle modification. studies of the dietary habits of nafld patients showed low intake of n-3 poly - unsaturated fatty acids (pufas) and/or a lower relative concentration of n-3 pufas in tissues and blood [46 ]. indeed, insufficient intake of n-3 pufas is associated with increased risk of nafld independent of traditional risk factors and data strongly support the detrimental role of high n-6/n-3 ratio on metabolic parameters. deficiency of n-3 pufas leads to hepatic steatosis and insulin resistance, whereas dietary supplementation of n-3 pufas appears to safely reduce nutritional hepatic steatosis in adults. the present review discusses the potential mechanisms through which n-3 pufas may show its benefits in nafld, and the current data supporting its use. fatty acids, essential components of all cell membranes, play a number of key roles in metabolism such as being a major metabolic fuel (storage and transport energy), and the ligands for transcription factors. although animals can synthesize saturated fatty acids and some monounsaturated fatty acids from carbon groups in carbohydrates and proteins, they lack the enzymes, desaturases, which are necessary to insert a cis double bond at the n-6 or the n-3 position of a fatty acid. consequently, linoleic acid (la, c18:2 ; n-6) and alpha - linolenic acid (ala, c18:3 ; n-3) are essential nutrients that must be taken from food. human can synthesize long - chain n-6 pufas, such as arachidonic acid (aa ; c20:4;n-6) from la and long - chain n-3 pufas, such as eicosapentaenoic acid (epa ; c20:5 ; n-3) and docosahexaenoic acid (dha ; c22:6 ; n-3) from ala (fig. 1). however, epa and dha have to be obtained from diet because mammals inefficiently convert ala to epa and dha. n-3 pufas are enriched in fish oil, flaxseed and some nuts whereas n-6 pufas are found predominantly in grain and vegetable oil. it has been estimated that the ratio of n-6 to n-3 pufas in the diet of early humans was 1:1, but the ratio in the typical western diet is now almost 10:1 due to increased use of vegetable oils rich in la as well as reduced fish consumption. a lower intake in dietary sources of n-3 pufas seems to be associated with nafld. in fact, patients with hepatic steatosis present a lower n-3/n-6 pufa ratio in liver tissue biopsies, namely in phospholipids subfractions, and in red blood cells. health benefits of dietary n-3 pufas include decrease of triglyceridemia and hepatic steatosis in human and rodent models of obesity. indeed, n-3 pufas supplementation lessened the hepatic steatosis in ob / ob mice [1316 ] and in rats fed a high - fat diet (hfd). in addition to improvement in hepatic steatosis, these rodent models had lowered plasma alanine aminotransferase (alt) and aspartate aminotransferase (ast) levels. the lipid - lowering effect of n-3 pufas in rats fed high fat / cholesterol has been associated with the downregulation of de novo lipogenesis and upregulation of lipid oxidation. lipogenesis is thought to be regulated via the transcription factors carbohydrate response element binding protein (chrebp) and sterol regulatory element binding protein-1c (srebp-1c), which are activated by glucose and insulin, respectively. on the contrary, peroxisome proliferator activated receptor (ppar) is a transcription factor known to decrease plasma lipids and induce enzymes and other proteins involved in lipid oxidation within the mitochondria, microsomes and peroxisomes. the increased hepatic srebp-1c / ppar ratio and steatosis are strongly correlated with insulin resistance and n-3 pufa depletion in obese patients. administration of n-3 pufas to obese patients and nafld - prone rodents decreased the nuclear abundance of chrebp / srebp-1c while induced ppar in the liver. furthermore, the expression of chrebp / srebp-1c - dependent, glycolytic / lipogenic enzymes were reduced, while that of ppar-dependent, oxidative enzymes were increased by n-3 feeding. fish oil feeding is also associated with elevated concentration of adiponectin in the circulation and visceral adipose tissue. adiponectin, one of the insulin - sensitizing adipokines, has been shown to reduce hepatic lipids by activating fatty acid oxidation and inhibiting hepatic lipogenesis in liver. specifically, nafld patients have lower levels of adiponectin whereas fish oil supplementation to the obese increases adiponectin in most [2931 ], but not all studies. besides the function on metabolic homeostasis, there is evidence from several studies that n-3 pufas have also shown the anti - inflammatory and anti - oxidant effects to protect the cells from ros - induced damage. overall, these results suggest that n-3 pufas reduce hepatic lipids, markers of inflammation, and improve insulin sensitivity, all major events in nafld development and/or progression. although increasing the ratio of dietary n-3 to n-6 pufas might be beneficial in the prevention and treatment of dyslipidemia, obesity, insulin resistance, nafld and diabetes, it is difficult to ascertain the contribution of certain n-3 pufas per se, without the potential confounding effects of other dietary components. since no pure n-3 and n-6 fatty acids are available, the major sources of the required n-3 and n-6 pufas are from fish oils and plant seed / vegetable oils, respectively. these two kinds of oils contain different bioactive compounds, such as saturated fatty acids, monounsaturated fatty acids, cholesterol, anti - oxidants, contaminants and other unidentified substances, that affect the study outcomes. indeed, while it is generally accepted that fish oil improves the serum lipid profile, it is controversial whether dietary flaxseed oil has a similar effect. studying the effects of dietary n-3 pufas in the context of high fat feeding has proven to be rather complicated because incorporation of n-3 pufas into rodent diets often prevents weight gain. therefore it is ideal to develop a transgenic mouse capable of converting n-6 to n-3 pufas so that the results obtained in such an animal model will be more reliable and easy to interpret in terms of the effects of n-3 and n-6 pufas. generated fat-1 transgenic (fat-1) mice expressing the caenorhabditis elegans fat-1 gene encoding an n-3 fatty acid desaturase that converts n-6 pufas to n-3 pufas (fig. 1). this allows production of two different fa profiles (low vs high n-6/n-3 ratios) in the fat-1 mice and wild - type littermates by using just a single diet, thus eliminating the potential diet variations. hence, the fat-1 mice are valuable in vivo system for elucidating the role of n-3 pufas and the n-6/n-3 ratio in nafld development and progression. studies on fat-1 mice yielded interesting results including reduction of inflammation, bone loss, colitis, colon cancer, melanoma growth, invasiveness of lung cancer cells, and seizure susceptibility [3742 ]. white. reported that transgenic restoration of n-3 pufas in insulin target tissues improved resolution capacity and alleviated obesity - linked inflammation and insulin resistance in hfd - fed mice. the authors proposed that the endogenous n-3 pufas exerted their protective effects through their lipid oxygenation products, which reduced macrophage infiltration and inflammation in the expanding adipose tissue of obese mice. however, the hepatic lipid accumulation was not changed in both hfd - fed wild - type and fat-1 mice, showing different results from dietary n-3 pufas supplementation reversed hepatic steatosis in ob / ob mice. we have recently reported that endogenously synthesized n-3 pufas could ameliorate hfd - induced fatty liver and hyperlipidemia in fat-1 mice, leading to significant attenuation of nafld and hepatic injury, as reflected by significant decreases in either triglyceride (tg) or liver enzymes, including ast and alt. protection against hyperlipidemia in fat-1 mice was associated with significant upregulation of genes involved in cholesterol uptake (ldlr), bile acid metabolism (cyp7a1) or excretion (abcg5 and abcg8), and downregulation of apoa4, a component of chylomicrons and hdl. these results suggested that endogenously synthesized n-3 pufas ameliorated fatty liver and hypercholesterolemia through modulating cholesterol and bile acid metabolism. recently, cholesterol accumulation is proposed to participate to the pathogenesis of nafld and non - alcoholic steatohepatitis. the sole pathways for hepatic cholesterol elimination are bile acid synthesis and cholesterol exported into the bile. cyp7a1 is the rate - limiting enzyme in the bile acid synthetic pathway that converts cholesterol into bile acids in the liver. recent studies have shown that transgenic mice overexpressing cyp7a1 were protected against hfd - induced hypercholesterolemia, obesity, and insulin resistance. moreover, the hepatic cholesterol transporters abdg5 and abcg8 were significantly induced in cyp7a1-tg mice, as shown in fat-1 mice. therefore, the findings regarding to the regulation of ldlr and cyp7a by endogenous n-3 pufas paralleled its effects on circulating cholesterol, tg, and ldl cholesterol levels during hfd treatment and provided mechanistic evidence for decreased cholesterol accumulation and increased hepatic uptake of circulating ldl cholesterol. although simple steatosis is relatively benign and principally reversible, steatohepatitis is the progressive form of nafld and can develop cirrhosis, hepatic failure, and hepatocellular carcinoma. the only approved management of nafld is lifestyle modification including increased physical activity, dietary behaviors, and weight reduction. dietary n-3 pufas reduce hepatic steatosis, inflammation and oxidative stress and improve insulin sensitivity. studies on fat-1 mice revealed that endogenously synthesized n-3 pufas ameliorated fatty liver and hypercholesterolemia resulting from enhanced hepatic cyp7a1 expression. these findings underscore the importance of endogenous n-3 pufas to maintain whole - body bile acid homeostasis, which plays a key role in lipid, glucose, and energy homeostasis. to confirm the clinical relevance of the preventive effect of exogenous n-3 pufas on nafld, the physiological concentration of n-3 pufas required to produce similar effects on the fatty livers of fat-1 mice should be determined. for this purpose it will be helpful to investigate the concentrations of n-3 pufas in the liver after administration of various doses exogenous n-3 fas in wt mice compared to fat-1 mice. | non - alcoholic fatty liver disease (nafld) is one of the most common causes of chronic liver disease that affects one - third of adults in westernized countries. nafld represents a wide spectrum of hepatic alterations, ranging from simple triglyceride accumulation in the liver to steatohepatitis. several pharmaceutical approaches to nafld management have been examined, but no particular treatment has been considered both safe and highly effective. growing evidence reveal that supplemental fish oil, seal oil and purified n-3 fatty acids can reduce hepatic lipid content in nafld through extensive regulation by inhibiting lipogenesis, promoting fatty acid oxidation and suppressing inflammatory responses. recently, the fat-1 transgenic mice capable of converting n-6 to n-3 polyunsaturated fatty acids (pufas) have been used to examine the effects of endogenous n-3 pufas on nafld. the increased n-3 pufas in fat-1 transgenic mice reduced diet - induced hyperlipidemia and fatty liver through induction of cyp7a1 expression and activation of cholesterol catabolism to bile acid. this article introduces the n-3 pufas, and addresses the evidence and mechanisms by which endogenously synthesized n-3 pufas or increased dietary n-3 pufas may ameliorate nafld. |
erectile dysfunction (ed) is the inability of a man to achieve or sustain erection for satisfactory sexual intercourse. some men who have this problem are often shy to complain because of loss of self - esteem associated with this condition thus resulting in late presentation that delays early treatment. some men do prefer to seek remedy to this condition by patronizing african traditional herbal practitioner. ed is commonly seen among men with hypertension, diabetic mellitus and psychosis when it is often related to the disease as well as the medications. it is common among married men and those with significant alcohol ingestion and cigarette smoking. ed is quite common in a community survey, and psychiatric outpatient cross - sectional survey in nigeria as well as worldwide. we are not aware of any study of ed in outpatients attending urology surgical clinic in our environment. therefore, we reviewed the data of men who attended the urology surgical outpatient in our tertiary hospital over a 10 year period. this was done to evaluate the percentage of men with ed and the frequency per year, their characteristics, treatment offered and the outcome of such treatment. this retrospective study was conducted at a tertiary hospital in ibadan, in the south - western part of nigeria. ibadan is the capital of oyo state with a total area of 1,190 sq m (3,080 km). ibadan has a population of 3.2 million and metro density of 600/square m (250/km). the data of men with ed who attended the urology surgical outpatient clinic between july 2004 and june 2014 was retrieved. the indices studied were the number of cases per year, the age, and the body mass index (bmi), duration of symptom, etiology, social habits, the treatment offered, and the outcome of such treatment. the treatment was said to be successful once the patient could consistently achieve a satisfactory erection during sexual intercourse. the success rate was determined from the actual numbers of patients that were followed up at the outpatient clinic. the data was analyzed using both microsoft excel spread sheath of window 2010 and statistical package for social science (spss version 16, chicago, il, usa). a continuous variable was expressed in mean, median, and standard deviation (sd) while nonparametric variables were expressed in numbers and percentages. chi - square was used to analyze numeric variables while nonparametric variables were analyzed using pearson 's coefficient correlation (r). the level of significance was placed at p < 0.05 with a confidence interval of 95%. over the study period, a total of 5,572 patients were seen at the urology surgical outpatient with 89 (2%) of them diagnosed to have ed. the mean age of ed was 39.6 1.2 sd (range 1976) years with a median age of 39 years. figure 1 shows the decline over the years of the surgical outpatient clinic attendance of men who had ed. in the 1 year of study, there were 16 patients, and this dropped to seven at the last year of study with an average of 8.9 men per year. the number of men with erectile dysfunction seen per year figure 2 shows the exact organic causes of ed. hypertension and its medication was the commonest cause of ed accounting for 14 (43%). other organic causes were diabetes mellitus and it medications 5 (15%), traumatic spinal cord disease, and sickle cell diseases complicated by priapism were each 3 (9%), respectively. less common causes were psychosis 2 (6%), peyronie 's disease 2 (6%), and primary testicular failure 2 (6%) while a patient (3%) had hyperprolactinemia and another man (3%) had both retroviral infection and hypertension. the details of organic causes of erectile dysfunction seen at ibadan in table 1, under the age of 29 years, 23.6% of men had ed. thereafter it decline to 30.3% at 4564 years and remained low 4.5% at age 65 years and above. characteristic of erectile dysfunction at ibadan sixty - seven (75%) of men with ed had their bmi recorded while there was no record for 22 (25%). of the 67 men whose bmi were recorded ; 5 (5.6%) were underweight < 18.5 kg / m, 59 (66.3%) were within normal range, 2 (2.2%) were overweight and 1 (1.1%) morbidly obese. there was a positive pearson 's coefficient correlation between bmi and age of men with ed, r = 0.018 with significant two - tailed, p = 0.885. fifty - five (61.8%) men with ed were married, and 28 (31.5%) were single. others were separated 3 (3.4%), widowed 2 (2.2%) and 1 (1.1%) was divorced. of the social habits ; 62 (69.7%) men with ed neither smoked a cigarette nor drank alcohol, 19 (21.3%) took alcohol, and only 8 (9.0%) smoked a cigarette and also ingested alcohol. there was a weak pearson 's coefficient correlation between marital status and social habits, r = 0.221. sixty - nine men (77.5%) had ed for up to 5 years before presenting at the hospital, while 15 (16.9%) of them had ed for 610 years. 3 (3.3%) had ed for 1630 years. table 1 also shows the distribution of the various categorical causes of ed where 40 (45%) were psychogenic, 33 (37%) were organic, 15 (17%) were idiopathic, and 1% was familial. forty - one men with ed were treated with phosphodiesterase type 5 inhibitor (pde5-i) alone namely sildenafil, vardenafil, or tadalafil of which 25 of them had improvement of their symptoms, 13 were lost to follow - up and no improvement in three. eleven men had a combination of pde5-i and other treatment such as modification of anti - hypertensives, psychotherapy, anticholinergic, physiotherapy, tamoxifen, and bilateral varicocelectomy. the success rate of pde5-i with other treatment was 91% (10 of 11). ten men received other treatments such as varicocelectomy (5), physiotherapy and anxiolytic (1), intramuscular testosterone (1) and rehydration and analgesics for the patient with sickle cell post priapism (3). of the eight men who had psychotherapy and sex therapy, seven responded satisfactorily to the treatment with a success rate of 90%. nineteen men were still on evaluation for the cause of their ed while 13 were lost to follow - up. the incidence of ed among men who patronized the urology outpatient clinic in the tertiary teaching hospital was very low in this study despite the high prevalence of 55.1% reported by adebusoye. at the general outpatient clinic in 2005 in the same institution in ibadan. the prevalence in community studies was similarly reported to be high in nigeria that is 41.5% in niger delta region, 45.7% and 57.4% in lagos, and 43.8% in osogbo. the overall prevalence of ed in europe, asia, and brazil was 15% in brazil, 17% in italy, 22% in malaysia, 34% in japan, and 52% in boston and massachusetts in the usa. omisanjo., reported that only 31% of men with ed actually discussed their problem. men with ed in our environment are often embarrassed, have low self - esteem and often preferred to take herbal medications the efficacies of which are not well documented. it is therefore not surprising that the number of patients seen per year in this study dropped to an average of 8.9 men per year. the mean age of 39.9 years of men with ed in this study is similar to that of other studies in nigeria that were between 33.6 years and 36.8 years. it has been reported that ed increases with increase in age, however, in this study, it was more common (65.2%) below age 44 years and declined with increase in age. this is in contrast to a community study at osogbo in nigeria where the majority of respondent were in the age group of 2029 years. this may be due to the larger aging population in the western world with an average life expectancy of 70 years in 2011 compared to nigeria with a life expectancy is 52 years in the same year. in this study, majority (43.8%) of the men had normal bmi, kg / m, and only 24.7% were overweight and obese. the bmi, kg / m correlated with the age (pearson correlation coefficient significant r = 0.018 and two - tail, p = 0.884) in this study and is in consonance with the finding by olugbenga - bello., and adebusoye. the men with ed, who were overweight, were slightly < 25% (62 of 248 men with ed) previously reported by adebusoye. 3.3% of men were frankly obese that is comparable to 4.8% reported by olarinoye. in ilorin. the high prevalence of ed in overweight and obese men was due to the effect on blood vessels and reduced testosterone. the limitation in this retrospective study was that the bmi of 24.7% of men with ed were not documented. therefore, we can not conclusively state what proportions of men with ed in this study that were normal, overweight, or obese. this is in consonance with other reports in nigeria of 60.7% by idung. and 64.8% by adebusoye. in ibadan. it is not surprising because married men are more likely to be more concerned about sexual issues that may threaten their marriage. therefore, they are often more likely to seek any means of solving their problems. olarinoye., reported a very high percentage of married men with ed (96.1%) among diabetics. of note about 1/3 of men with ed in this study were single, which implies that both married and single men were concerned about their ed. as with other studies, this study also showed that hypertension and its medications, diabetes and its medication, traumatic spinal cord disease, and sickle cell disease complicated by priapism were common organic causes of ed. these conditions cause progressive thickening and disruption of the endothelium and or occlusion of the vessels that ultimately affect effective blood flow and venous drainage to and from the penis manifesting as ed. the introduction of pde5-i is reported to achieve satisfactory penile erection in 78%, and 95% of men with ed. this is similar to this study where 89% of men treated with pde5-i achieved satisfactory erection. as in other studies, psychotherapy and sex therapy, modification of medications and combination of pde5-i with other treatment modalities in this study all resulted in accepted penile erection in 9091% of men with ed. with this level of success it is hoped that more men would turn up for the treatment of their ed. unfortunately, men with ed constituted only 2% of all urological patients seen at our tertiary hospital. this is in contrast to the high incidence of ed reported in many community studies. there is a missing link between high community incidences of ed and low hospital patronage despite the acceptable outcome of treatment for ed among men who present at the hospital. it is possible that men with ed are not well informed about the high success rate of treating this problem and where to go. there is a need to ensure proper dissemination of information in the management of ed, such as discussing ed at a regularly period in different media facility as well as in small community gathering. this information should include the incidence of this condition, the possible causes, the available treatment and the outcome as well as where the treatment can be given. the hospital patronage for the treatment of ed is very low despite the favorable outcome of treatment. | background : erectile dysfunction is becoming a public health issue with high incidences reported in community studies.objective:to evaluate the characteristics and outcome of treatment in men with erectile dysfunction in a tertiary center in ibadan southwestern nigeria.methods:data of men with erectile dysfunction was retrieved between july 2004 and june 2014 and analyzed using spss version 16 statistical software.results:eighty-nine men with erectile dysfunction were managed which constituted 2% of all urological cases seen during the study period. their median and mean ages were 39 years and 39.6 1.2sd (range 19 - 76 years). the peak age incidence at 30 - 44 years was 41.6% and reduced with increasing age after 65 years to 4.5%. the etiologies were psychogenic in 55%, organic in 27%, idiopathic in 17% and 1% was familial. 67.5%, 31.5% and 3.4% were married, single and separated respectively. seventy percent neither smoked cigarette nor drank alcohol, 21.3% drank alcohol and 9% took both alcohol and smoked cigarette. seventy seven and half percent of men presented within 5 years of their symptom. the treatments offered were pde type 5 inhibitors alone or in combination with psychotherapy or modification of medications. the outcome of these treatments ranged from 89% to 91% success rate.conclusion:the number of men with erectile dysfunction managed in the tertiary hospital is very low though the outcome of treatment is within acceptable range. increase public enlightenment may encourage increase hospital patronage and access to the available treatments for erectile dysfunction. |
martins., first reported on the antimicrobial effect of riboflavin and uva in vitro. an inhibition of growth was seen in both drug sensitive as well as drug resistant bacteria, but no effect was observed on the growth of candida albicans. subsequently, schrier., reported the effectiveness of a combination of riboflavin and uva exposure for 30 minutes against staphylococcus aureus as well as pseudomonas aeruginosa. makdoumi., tested the effects of riboflavin and uva on bacterial suspensions in a fluid solution. they demonstrated that exposure for 60 minutes achieved a high degree of eradication of bacteria in vitro, whereas an exposure for 30 minutes achieved only a limited eradication. in vitro and animal - model studies from multiple centers failed to show a beneficial effect of this treatment against acanthamoeba. using a rabbit model, galperin. in contrast, no effect of a similar treatment was observed on fusarium solani and c. albicans isolates in an in vitro experiment performed by kashiwabuchi. the modality has been studied in bacterial, fungal, viral, and acanthamoeba keratitis. case selection appears arbitrary. a lack of homogeneity in terms of predisposing factors, clinical presentation and responsible organisms makes interpretation of results difficult. treatment protocols range from a single 5-minute exposure of uva to multiple sessions lasting up to 45 minutes. surgical procedures performed during active infection include keratoplasty, amniotic membrane transplantation, phototherapeutic keratectomy, flap amputation, intracorneal voriconazole injection, and enucleation. outcome assessment is largely subjective, as a clear definition of what constitutes resolution or healing is missing in a majority of reports. almost all results are confounded by the concurrent use of standard of care medical therapy. though these reports seem to indicate that cxl may be an option in the treatment of infection, one can not conclusively say it is effective as no control groups are available to compare against. we have carried out in vitro experiments to test the effects of a combination of riboflavin and uva exposure on drug sensitive as well as multi - drug resistant bacteria, fungi, and acanthamoeba. we used the standard dresden protocol including 30 minutes of soaking time with 0.1% riboflavin in dextran and a 30-minute exposure of 3 mw / cm to 370 nm uv light. we conducted our experiments at lv prasad eye institute in four arms, control, riboflavin only, uv only, and combined riboflavin + uv. we found the group with combined riboflavin and uv exposure had the greatest efficacy in reducing growth of the exposed microbes. in our experience, the treatment was most effective against bacterial isolates, with drug resistant strains requiring multiple exposures. we have not been able to demonstrate arrest the growth of fungi or acanthamoeba in vitro with this treatment. looking at the mixed published results as well as our own experimental data, we have been hesitant thus far to use cxl as a therapeutic option in cases of microbial keratitis. we have, however, managed cases treated elsewhere, which seemed to show equivocal results. we havent yet seen a patient with either fungal or acanthamoeba keratitis where cxl helped in resolution of the infectious process following failure of specific therapy. we believe the next steps should be aimed at evaluating the response of the cornea with active keratitis to cxl and changes that occur over time rather than a cross - sectional observation. the ideal model for this kind of data would be an animal model of keratitis treated with cxl to observe changes in histology at various stages following the exposure. the promise of a simple, effective, and safe alternative to anti - microbial medication or keratoplasty is somewhat of a holy grail in the management of microbial keratitis. putative mechanisms include the genome damage resulting from intercalation of activated flavins with nucleic acids and direct free radical insult to microbial deoxyribose nucleic acid (dna), in addition to the presumably increased resistance of the cornea to melting due to cxl - induced stiffening. proof of principle exists, as demonstrated by the successful use of this technology in transfusion medicine. in vitro studies show mixed results. the modality seems to be able to inhibit growth of bacteria, with drug - resistant strains requiring greater exposure time. studies on fungi have conflicting results, and activity against acanthamoeba seems even less convincing. most cases reported include ulcers that would probably heal well with adequate duration of standard of care therapy. ethical constraints preclude the use of cxl in isolation, without first using anti - microbial drugs. potential concerns include endothelial damage in corneas that are already thin, as well as corneal melts and reactivation of viral keratitis. gray areas include optimum concentration of riboflavin and uva exposure duration needed to combat microbes. based on available evidence, it is difficult to say whether cxl is effective in cases of microbial keratitis where we need it the most - drug resistant organisms, advanced keratitis and keratitis caused by organisms such as fungi and acanthamoeba, which are refractory to conventional medical therapy. an ideal study would be prospective, with an adequate sample size, well - defined inclusion and exclusion criteria, appropriate outcome measures, and unbiased assessment as well as a robust interpretation of data. the preliminary results reported by price., are part of an ongoing prospective, multi - center study. parallels in transfusion medicine and data from laboratory experiments indicate the photochemical reaction used in cxl holds promise as a future therapeutic option for microbial keratitis. well - designed studies investigating the safety and efficacy of this modality in appropriately chosen cases of microbial keratitis are sorely needed. | the success of collagen cross - linking as a clinical modality to modify the clinical course in keratoconus seems to have fueled the search for alternative applications for this treatment. current clinical data on its efficacy is limited and laboratory data seems to indicate that it performs poorly against resistant strains of bacteria and against slow growing organisms. however, the biological plausibility of crosslinking and the lack of effective strategies in managing infections with these organisms continue to focus attention on this potential treatment. well - conducted experimental and clinical studies with controls are required to answer the questions of its efficacy in future. |
sinus of valsalva aneurysm (sva) is a rare cardiac anomaly and is involved in less than 1% of cardiac operations.1) most patients with unruptured svas are asymptomatic ; however, a ruptured sva results in a devastating course and causes various clinical manifestations such as aortic regurgitations or arrhythmic disorders. acute coronary syndrome may occur with compression of the coronary artery2) or severe acute aortic regurgitation. we present a case of a ruptured sva mimicking acute myocardial infarction (ami), without either significant coronary artery compression or aortic regurgitation. a 39-year - old male patient presented with chest discomfort and dyspnea that had lasted for 12 hours. a grade 3/6 diastolic murmur was auscultated at the left third intercostal space, and an electrocardiogram showed mild st segment depression on precordial leads (fig. the creatine kinase mb (ck - mb), troponin t, and serum creatinine levels were 208.4 ng / ml (reference value, < 5 ng / ml), 2.54 ng / ml (reference value, < 0.1 ng / ml), and 4.1 mg / dl, respectively. transthoracic echocardiography (tte) showed slightly reduced left ventricular systolic function (ejection fraction, 51%) with apical akinesia and mild aortic regurgitation (grade 1). the pattern of apical akinesia was dissimilar to that associated with the apical ballooning caused by stress - induced cardiomyopathy. the patient had unstable vital signs, and his echo window was very poor due to severe obesity ; a thorough echocardiographic study was impossible. emergency coronary angiography was planned under the impression of ami, but cardiac arrest occurred immediately before coronary angiography. coronary flow was within normal limits, and there was no evidence of plaque disruption or thrombosis. cardiac catheterization showed elevated right ventricular and pulmonary artery pressure (peak, 55 mmhg). subsequent transesophageal echocardiography (tee) revealed shunted flow from the sva of right coronary cusp to the right atrium and grade 1 aortic regurgitation (fig. exposure of the ascending aorta and right atrium revealed a sva on the right coronary cusp, which had ruptured to the right atrium (fig. after successful direct closure of the rupture site, intraoperative tee result did not showed shunted flow or aortic valve dysfunction. preoperative multiple organ failure (mof) was aggravated despite intraaortic balloon pump with a high dose of cardiotonics and continuous renal replacement therapy. electroencephalography showed that severe cerebral injury might have been caused by the prolonged preoperative cpr. most cases of ami, with svas, are associated with a left sinus origin and compression of the left coronary artery.3) another hypothesis is that aortic regurgitation and a left - to - right shunt lead to a severe coronary oxygen supply - demand mismatch, causing myocardial ischemia.4)5) in this case, sva originated from the right sinus, and there was neither significant aortic regurgitation nor compression of the coronary artery. the initial tte study did not yield a correct diagnosis because of a poor echo window and the patient 's lack of cooperation in facilitating a thorough examination. even with the indefinite findings of the electrocardiogram, primary coronary angiography was mandatory owing to the regional wall motion abnormality and the markedly elevated cardiac enzyme levels. the possible mechanisms of myocardial infarction, without coronary compression or severe aortic regurgitation, are as follows : acute, severe shunt from the aorta to the right heart causing systemic hypoxia and flow insufficiency to the coronary artery, and decompensation, with left ventricular dysfunction, caused by myocardial infarction - aggravated systemic and myocardial ischemia. although unruptured svas are mostly asymptomatic, fatal complications such as right ventricular outflow obstruction, malignant arrhythmias, and acute coronary syndrome can occur in ruptured svas. acute, massive left - to - right shunts can cause myocardial infarction and rapidly progressive mof, without definite obstruction of coronary blood flow or severe aortic regurgitation. with the experience of this case, the possibility of sva rupture should be considered in cases of ami without significant coronary obstruction ; careful echocardiographic evaluation is needed. | we present a rare case involving a ruptured sinus of valsalva aneurysm (sva) and acute myocardial infarction in a 39-year - old male patient. coronary angiography showed normal findings ; however, the patient showed remarkably elevated levels of cardiac enzymes and decreased left ventricular function with apical akinesia on transthoracic echocardiography. transesophageal echocardiography revealed shunt flow from the sva to the right atrium without significant aortic regurgitation. preoperative cardiac arrest was managed by cardiopulmonary resuscitation, and surgical repair was performed by closing the entrance of the aneurysm. however, the compromised hemodynamic status was not reversed by surgery. |
the receptor for advanced glycation end products (rage), which belongs to the immunoglobulin superfamily, was first identified and described in terms of its ability to bind advanced glycation end products (ages) [1, 2 ]. due to the ability of rage to recognize three - dimensional structures rather than specific amino acid sequences, rage is capable of engaging a diverse class of ligands that lack sequence similarities. because of this feature, this multiligand receptor can therefore be considered a pattern - recognition receptor (prr) [1, 3 ]. ligands that have been found to be recognized by rage include ages, amyloid -peptide, dna binding protein high mobility group box-1 (hmgbl)/amphoterin, and s100/calgranulins. in humans and mice, the gene encoding rage is located on chromosome 6 close to major histocompatibility complex iii (mhc class iii), in the vicinity of the genes for lymphotoxin, tumour necrosis factor (tnf), and the homeobox gene hox12 [7, 8 ]. translation of the mrna transcribed from this human rage gene (~1.4 kb) results in a protein of 404 amino acids with a molecular mass of about 55 kda. rage is composed of a single hydrophobic transmembrane - spanning domain, a highly charged cytosolic tail, and an extracellular region (figure 1). this extracellular region consists of one n - terminal v - type immunoglobulin domain and two c - type (c1 and c2) immunoglobulin domains [3, 9 ]. a flexible linker separates the fully independent c2 domain from the integrated structural unit formed by the v - type and c1 domains. the v - type domain is considered as the principal site for interactions between rage and potential extracellular ligands [10, 11 ]. on the other hand, the short cytosolic tail, which lacks known signalling motifs like kinase domains or phosphorylation sites, has been shown to be critical for rage - mediated intracellular signalling [3, 9 ]. a truncated form of rage, in which the cytosolic tail is deleted, has been used to prove the essentiality of this cytosolic tail in intracellular signalling. although this form of rage is capable of recognizing and binding to the rage ligands like the wild - type receptor, it can not mediate any cellular activation upon ligand ligation. rage can be constitutively or inducibly expressed in different cells, depending on the cell type and developmental stage [5, 12 ]. during embryonic development, compared to embryonic cells, there is relatively low expression of rage in a wide range of differentiated adult cells such as cardiomyocytes, neurons, neutrophils, monocytes / macrophages, lymphocytes, dendritic cells (dcs), and vascular endothelial cells [12, 13 ]. unlike constitutive rage expression during embryonic development, rage this means that rage expression can be induced in situations when there is an accumulation of ligands and inflammatory mediators [3, 14 ]. however, skin and lung have been identified to be exceptions, as rage has been found to be constitutively expressed at high levels throughout life in these organs. in the lung, the basolateral membranes of alveolar type i epithelial cells and alveolar type ii cells are where the expression is localized [15, 16 ]. however, the exact role or function of this high expression in the physiology of these cells remains poorly defined. the membrane - bound form of rage consisting of three domains extracellular domain, transmembrane domain, and cytosolic domain is named full - length rage (fl - rage). besides fl - rage, there are 19 naturally occurring splice variants for human rage that have been identified on mrna and protein level. these isoforms, including srage1, srage2, srage3, hragesec, n - truncated and secretory, rage_v4-rage_v13, rage, ntrage, srage [21, 22 ], and 8-rage, are characterized by either n - terminal or c - terminal truncations. later, hudson and colleagues summarized all of these human rage isoforms and renamed them into rage_v1 to rage_v19 according to the human gene nomenclature committee. as shown in figure 1, both endogenous secretory rage (esrage or rage_v1) and cleaved rage (crage) are soluble isoforms termed as soluble rage (srage). these soluble isoforms have the same v - type and c - type regions (extracellular domain) as fl - rage but lacking the transmembrane and cytoplasmic domains [20, 24 ]. the two primary mechanisms that give rise to srage are alternative mrna splicing and proteolytic cleavage of fl - rage. alternative splicing at exon 9 results in esrage, a c - truncated form of rage, while proteolytic cleavage of fl - rage at the cell surface gives rise to crage, another soluble isoform of rage [19, 24 ]. srage can act as a decoy receptor that intercepts the interaction of ligands with fl - rage because srage, which occurs in the extracellular space, can bind rage ligands before they interact with fl - rage at the cell surface [3, 25, 26 ]. human rage mrna is subject to alternative splicing, resulting in a variety of splice variants. however, many of these splice sequences are likely to be degraded before they are expressed as proteins because these sequences are potential targets of the nonsense - mediated decay (nmd) pathway. some of the splice sequences might be able to undergo protein expression, but the expressed protein would be destroyed by premature degradation due to the absence of a signal sequence on exon 1. studies have shown that alternative splicing in humans depends on the cell type or tissue. for example, in human lung and aortic smooth muscle cells, fl - rage mrna is the most prevalent form, but in endothelial cells esrage mrna instead of fl - rage mrna is prevalent [20, 27 ]. proteolytic cleavage that releases the extracellular domain of fl - rage as crage is mediated by a membrane metalloproteinase called adam 10 [28, 29 ]. hence, enhancing proteolytic cleavage will result in a rise in the level of srage. recent studies reporting increased expression of rage in a number of acute and chronic inflammatory diseases have suggested participation of rage and its downstream signalling pathways in perpetuating immune and inflammatory responses [30, 31 ]. this idea is further supported by various findings on the molecular mechanism of rage in contributing to the inflammatory response [31, 32 ]. first, rage has been found on numerous immune cells that play key roles in perpetuating the immune response. these cells include neutrophils, t and b lymphocytes, monocytes, macrophages, and also dendritic cells [3335 ]. second, many of the extracellular ligands that trigger rage signalling have been determined to be involved in acute and chronic immune responses [36, 37 ]. third, rage expression has been found on endothelial cells, and this expressed rage can physically interact with the leukocyte 2 integrin mac-1. the rage - mac-1 interaction enables rage to function as an adhesion receptor for leukocytes [3840 ]. fourth, proinflammatory transcription factor nuclear factor kappa b (nf-b) and its downstream target genes are activated following engagement of rage. among these nf-b regulated target genes, some of them are regulators of the adaptive and innate immune systems. interestingly, rage itself is also an nf-b regulated target gene, exhibiting a functional binding site for nf-b in its proximal promoter. fifth, accumulation of rage ligands at sites of tissue injury and inflammation has been found to induce intracellular activation of nf-b. rage - ligand interactions also lead to sustained nf-b signalling via de novo rela (p65) mrna synthesis because the de novo synthesis produces a constantly growing pool of proinflammatory transcriptionally active nf-b. since the signalling between rage and nf-b is interconnected, this ensures maintenance and amplification of the signal and thus sustains the cellular response (figure 2). have extensively discussed and confirmed the role of rage and its ligands including hmgb1, s100 proteins, amyloid - beta peptide, and ages in inflammation. the authors summarized that each of these ligands can distinctly activate rage signaling which in turn can perpetuate the immune and inflammatory responses via the activation of multiple intracellular signaling molecules such as nf-b, adhesion molecules, and map kinases. several immune cell types such as t lymphocytes, b lymphocytes, and macrophages have been found to express high levels of rage. this high expression of rage has been closely linked to the activities of the immune cells as well as to inflammatory responses. the rage - mac-1 interaction has been shown to mediate the adhesion of neutrophils and myelomonocytic cells to immobilized rage or rage - transfected cells [2, 47 ]. rage on t cells is associated with the differentiation of this cell type, as rage activation by its ligands has been determined to participate in the early events that eventually trigger the differentiation of th1 t cells. rage expressed on t cells plays an essential role in the antigen - activated proliferative response. in a study on rage deficient t cells, production of the th2 cytokines il-4 and il-5 was found to increase, while release of il-2, ifn-, and th1 was found to decrease. in addition, several in vivo and in vitro findings have revealed that rage is involved in the recruitment of inflammatory cells by acting as a counter - receptor for leukocyte integrin. the ability of rage to become an endothelial cell adhesive receptor and to attract leukocytes enables rage to directly mediate the recruitment of leukocytes. at the same time, rage - mediated cellular activation and upregulation of proinflammatory factors and adhesion molecules also indirectly increase the recruitment of inflammatory cells. also, manfredi and colleagues have identified that rage expression on maturing dendritic cells is essential in order for this cell type to migrate to draining lymph nodes. although rage has been shown to be implicated in both acute and chronic immune responses, the exact regulatory mechanism of this receptor in inducing acute versus chronic inflammation remains unclear. to date, two possible strategies have been suggested to answer this question. the first hypothesis, proposed by herold and colleagues, has linked the oligomerization status of rage ligands to rage - mediated chronic versus acute inflammatory responses. in their study, it was proposed that oligomeric ligands have higher affinity for rage and thus are capable of inducing persistent signalling which leads to chronic inflammation. in contrast, monomeric ligands with lower affinity to rage can only elicit an acute response. notably, several lines of evidence from a recent study comparing the s100b tetramer with its dimeric counterpart further support the hypothesis mentioned above. the s100b tetramer exhibited higher affinity in binding srage in vitro and improved cell survival more effectively compared with the dimeric form. on the other hand, based on the same rage - ligand affinity concept, the second hypothesis suggests that the origin of the ligands may be a critical determinant in triggering acute versus chronic inflammation [49, 50 ]. it has been proposed that the patterns of the endogenous ligands have higher affinity for rage. hence, the receptor induces chronic inflammation when exposed to the persistent endogenous danger signals [49, 50 ]. in contrast, the patterns of the exogenous ligands have lower affinity to rage and thus trigger acute inflammation [49, 50 ]. tian and colleagues have suggested that rage may work together with toll - like receptors to elicit acute responses and rapid clearance in response to exogenous ligands like invading pathogens. however, more experimental lines of evidence and systematic kinetic studies of rage - ligand interactions are required to resolve these two hypotheses. the multiligand nature of rage provides this receptor the ability to engage a broad range of proinflammatory ligands. binding of these ligands to rage leads to the recruitment of multiple intracellular signalling molecules, including the transcription factor nf-b, map kinases, and adhesion molecules, and eventually activates pathways responsible for acute and chronic inflammation. due to the role of rage as a central player in perpetuating and amplifying inflammatory responses, atherosclerosis is a disease of the arteries characterized by plaque buildup on the inner wall and has been described as a chronic inflammatory disease for years. rage has been linked with this inflammatory disease due to its presence on the surface of a wide variety of cells implicated in atherogenesis and progression of atherosclerosis, such as endothelial cells, lymphocytes, monocyte - derived macrophages, and vascular smooth muscle cells. the involvement of several rage ligands including ages, amphoterin, and s100 proteins in the atherosclerotic process further affirm the relevance of rage involvement in atherosclerosis [5, 6, 53 ]. at sites of vascular injury, engagement of rage by its ligands would create an oxidant milieu by inducing increased generation of intracellular reactive oxygen species (ros) [52, 54 ] via the nad(p)h - oxidase system. these accumulated ros would activate the redox - sensitive transcription factor (nf-b) which in turn results in transcriptional activation of a variety of genes that are highly relevant for inflammation and atherosclerosis, such as tumour necrosis factors (tnf-, tnf-), interleukins (il-1, il-6, il-8), interferon (ifn-), and cell adhesion molecules [5658 ]. hence, this oxidative stress can be said to be the key mediator of atherogenic changes in the vasculature as well as the first and most important pathological consequence of rage - ligand interaction. endothelial dysfunction has been proposed to be a priming event in the initiation of atherosclerosis wherein the endothelium becomes faulty and vulnerable to the invasion of inflammatory cells and lipids a key step in atherosclerotic plaque formation. during the initiation and progression of atherosclerosis, rage is evidently expressed in endothelial cells, ready to transduce the impact of its ligands, which can lead to endothelial dysfunction. when ages bind to rage expressed on endothelium, activation of rage changes the antithrombotic phenotype of the endothelium by reducing thrombomodulin activity and concomitantly inducing expression of tissue factor. this alters the dynamic endothelial properties, transforming the anticoagulant endogenous surface to a surface that is procoagulant to the flowing blood [62, 63 ]. in addition, the interaction of rage and ages enhances the expression of adhesion molecules including e - selectin, intercellular adhesion molecule-1 (icam-1), and vascular adhesion molecule-1 (vcam-1) via nf-b activation. a number of studies have demonstrated induction of vcam-1 expression in a rage - dependent manner when endothelial cells are exposed to ages and also other rage ligands like s100a12 (en - rage) or s100b [6, 56 ]. high expression of adhesion molecules in endothelial cells may promote adhesive interactions of circulating monocytes with the endothelial surface, and this can eventually result in transendothelial migration. besides endothelial cells, mononuclear phagocytes (monocytes / macrophages) are another highly relevant cell type that has been shown to express rage in the context of atherosclerosis. mononuclear infiltration into the subendothelial space along a chemotactic gradient after adhesion of monocytes to endothelial cells has been recognized as characteristic of the development of atherosclerosis. after the transmigration, these monocytes differentiate into intimal macrophages that in turn transform into foam cells and accumulate in the blood vessel wall, speeding up fatty streak formation. engagement of ages to rage on mononuclear phagocytes has been reported to give rise to this phenotype of activated macrophages that is manifested by the induction of some proinflammatory cytokines (il-1 and tnf-), platelet - derived growth factor, and also insulin - like growth factor-1 [66, 67 ]. similar findings were revealed when hofmann and colleagues used s100a12 to bind to rage on cultured murine macrophages called bv2 cells ; they found that il-1 and tnf- were induced in an nf-b - dependent manner. binding of soluble rage ligands such as ages and s100a12 to rage - bearing mononuclear phagocytes prompts chemotaxis and subsequently results in mononuclear infiltration through an intact endothelial monolayer [13, 68 ]. ages have been found to be closely associated with increased expression of various oxidized ldl (oxldl) receptors including macrophage scavenger receptor, cd36 receptor, and lectin - like oxldl receptor 1 on human monocyte - derived macrophages. the increased numbers of oxldl receptors on macrophage membranes consequently enhance the uptake of modified ldl. gene expression of these oxldl receptors is reported to reach its peak in enhanced foam cell transformation. furthermore, ages - rage binding reduces the expression of atp - binding cassette transporter g1 and decreases the efflux of cholesterol to high - density lipoprotein (hdl). hence, the ages - rage interaction has been proposed to contribute to foam cell formation by increasing oxldl receptors as well as decreasing cholesterol efflux to hdl. further development of fatty streak lesions into advanced lesions that can cause thromboembolic events is usually associated with smooth muscle cell accumulation, necrotic core formation, lipid accumulation, and also the formation of a fibrous cap [71, 72 ]. in smooth muscle cells, binding of ages to rage triggers an increase in chemotactic migration and cellular proliferative activity as well as production of fibronectin [71, 72 ]. several rage - mediated signalling pathways such as src kinase, map kinases, jak - stat, and nf-b ages can upregulate a key regulator named transforming growth factor- (tgf-) in order to mediate extracellular matrix generation by smooth muscle cells. in addition to ages, exposure of smooth muscle cells to amphoterin can also induce cellular proliferation, migration, and the secretion of more amphoterin [78, 79 ]. another rage ligand, s100b, has also been found to contribute to the atherogenic process in a rage - dependent manner via increased activation of src kinase, tyrosine phosphorylation of caveolin-1, mapks, nf-b, and stat3, as well as induction of smooth muscle cell migration and superoxide production. taken together, these findings gathered so far unequivocally underscore the fundamental roles of the rage - ligand axis in the pathogenesis of vascular dysfunction and ultimately atherosclerosis. alzheimer 's disease (ad) is a progressive neurodegenerative disorder and the most common cause of dementia in the elderly, hallmarked by a progressive decline in cognitive functions. ad pathology is characterized by the presence of senile plaques and neurofibrillary tangles as well as severe gliosis in both the cerebral cortex and hippocampus. also, increased oxidative stress, amplified inflammatory responses, and dysregulation of calcium homeostasis have been observed in the ad brain. during the development and progression of ad, expression of rage is found to be upregulated in cells surrounding the senile plaques such as microglia, neurons, and endothelial cells [83, 84 ]. the exact role of rage in the pathogenesis of ad is not yet clearly known, but activation of rage by ligands that are closely linked to ad, including beta amyloid peptide (a), ages, and s100 proteins, appears to trigger several signal transduction cascades leading to neuronal loss. binding of ages and a to rage has been reported to stimulate activation of transcription factor nf-b which in turn induces the release of various cytokines such as il-1, il-6, tnf-, endothelin-1, and tissue factor [41, 44, 85 ]. activation of nf-b was found to be involved in neuronal plasticity and the cellular response to neurodegeneration, while prolonged activation of rage can lead to cellular dysfunction. interestingly, activation of nf-b can create a positive loop to amplify the cellular response to external stress by upregulating the expression of rage. moreover, binding of ages to rage stimulates the generation of reactive oxygen species (ros) by activating nadph oxidase (nox), and the ros produced have been implicated in the early toxic events that result in progression of ad [87, 88 ]. increased expression of rage and two of its ligands, a and ages, have been identified in ad hippocampus, particularly in dentate gyrus neurons and ca3 pyramidal neurons. this finding corresponds with the short - term memory loss in ad patients caused by neuronal dysfunction in the hippocampus. recently, two studies have revealed that activation of rage by either ages or a can enhance the expression of bace 1, a key enzyme in promoting the production of a in the brain [87, 90 ]. besides the hippocampus, the entorhinal cortex, which is also an important brain area in memory processing, has been found to be affected early in ad. rage has been demonstrated to be implicated in a-dependent impaired synaptic transmission in the entorhinal cortex, as confirmed by the inhibitory effect of an anti - rage antibody. furthermore, another study has shown that rage contributes to inhibition of synaptic plasticity induced by a in intracortical circuits of the visual cortex. both a and ages have been reported to decrease mitochondrial activity of neuronal cells and induce neurodegeneration via mitochondrial dysfunction [93, 94 ]. in a rage - dependent manner, the uptake of a and a targeting mitochondria in cortical neurons causes the activity of cytochrome c oxidase (cox iv), a key mitochondrial respiratory enzyme, to decrease. the role of rage in a-mediated neurodegeneration was further confirmed when treatment with an anti - rage antibody was seen to diminish a targeting to mitochondria and also the subsequent mitochondrial damage. activated astrocytes and microglia are common in ad brains with chronic inflammation, and the presence of these activated cells can result in chronic oxidative stress. these ages will activate rage, which in turn triggers more oxidative stress, thus creating a positive feedback loop [30, 85 ]. moreover, rage activation by a upregulates macrophage colony stimulating factor (m - csf) expression in neuronal cells, which will then enhance proliferation and release of proinflammatory cytokines in microglia. fang and colleagues found enhanced induction of proinflammatory cytokines (il-1 and tnf-), increased infiltration by microglia and astrocytes, and increased a plaque load in their study on mutant amyloid precursor protein (mapp) transgenic mice. this evidence indicates that rage plays a key role in facilitating activated microglial effects that will ultimately impair neuronal function. in vivo studies show the interaction of rage and a at the luminal membrane of the blood - brain barrier (bbb). this finding proposes that rage can be a transporter protein at the bbb, facilitating the transport of circulating a across the bbb. this is supported by another study in which rage mediated the entry of a1 - 40 and a1 - 42 into the hippocampus and cortex across the bbb. the role of rage as a bbb transporter protein was further confirmed in another study when a transport was inhibited in rage null mice as well as in mice treated with anti - rage antibodies. also, in the same study, deane and colleagues demonstrated that the a-rage interaction at the bbb not only results in neurovascular stress and expression of proinflammatory cytokines (tnf- and il-6) but also leads to decreased cerebral blood flow by enhancing the secretion of endothelin-1 to induce vasoconstriction. transmigration of blood - derived or bone - marrow - derived monocytes along with a depositions have been found in the diseased ad brain. this a-induced monocyte infiltration has been shown to be inhibited by blockade of rage with anti - rage antibodies. taken together, all the evidence obtained from previous studies supports the critical involvement of rage in ad progression. arthritis is a form of joint disorder frequently accompanied by arthralgia and stiffness of the affected joint. among the over 100 types of arthritis identified, osteoarthritis (oa) and rheumatoid arthritis (ra) oa is a wear and tear degenerative joint disease featuring degradation of articular cartilage and subchondral bone accompanied by secondary low - grade inflammation of the synovial tissue. ra, on the other hand, is a chronic autoimmune disease that is hallmarked by prolonged inflammation of synovial tissue, bone erosion, and cartilage degradation. despite the differences in the underlying pathophysiology, both oa and ra eventually result in joint dysfunction and disability. rage has been detected in synovial tissue, macrophages, t cells, and some b cells in the affected joints of both oa and ra patients. as all these cells are implicated in the development of synovial inflammation in ra and oa, this suggests a role for rage in the pathogenesis of both joint diseases, especially ra. interestingly, various studies have reported not only the presence but also upregulation of rage in focal degenerated cartilage of oa, as well as in synovial tissue macrophages and infiltrating lymphocytes of ra. in parallel with the upregulated receptor, several ligands of rage including ages, s100 calgranulins, and hmgb-1 are found to accumulate at sites of oa and ra [108111 ]. the presence of rage and its ligand ages has been confirmed in the synovial lining, sublining, and endothelium of oa patients [105, 108 ], and increased concentrations of the ligands were found in serum, synovial fluid, and urine obtained from oa patients [108, 112 ]. accumulation of ages has been found in oa cartilage collagen, and these accumulated ligands are capable of altering the mechanical properties and metabolism of cartilage via rage signalling [113, 114 ]. studies revealed that an increased level of ages in cartilage significantly increases cartilage stiffness, which may result in failure of the cartilage to resist damage [113, 114 ]. moreover, it has been found that accumulation of ages impairs the synthesis of matrix molecules by articular chondrocytes, resulting in decreased collagen turnover and decline in proteoglycan synthesis rate [115, 116 ]. so, activation of rage on chondrocytes by accumulated ages can cause a stiffer matrix and impair the synthetic capacity of the cells. these may in turn diminish the capacity of articular chondrocytes to maintain matrix integrity after injury and thus increase susceptibility to oa. besides altering chondrocyte activity, activation of rage was also reported to affect synoviocyte activity and thus contribute to the pathogenesis of oa. there was a study proposing that the fibroblast - like synoviocyte (fls) appeared to play an outstanding role in the pathogenesis of oa. another study showed that inflammation and cartilage degradation were inhibited in mice immunized and challenged with collagen type ii (cii) when the mice were treated with srage. also, steenvoorden and colleagues found that activation of rage on chondrocytes and synoviocytes by ages could substantially enhance production of mmp-1, invasiveness, and proteoglycan release by the cells. hence, elevated age levels can alter the activities of both chondrocytes and synoviocytes in oa joints and increase cartilage degradation by inducing catabolic pathways via rage activation. this may be one of the molecular mechanisms that cause tissue degradation in oa to continue. in addition to ages, increased levels of hmgb-1 and several s100 calgranulins such as s100a11, s100a4, and s100b have also been reported in osteoarthritic cartilage [109, 111, 119 ]. binding of s100a11 to rage was found to trigger chondrocyte hypertrophy. on the other hand, hmgb-1, s100a4, and s100b were demonstrated to stimulate articular chondrocytes to produce matrix metalloproteinase 13 (mmp-13), indicating increased cartilage degradation [109, 111 ]. similar to oa, increased levels of rage ligands including ages (pentosidine and n - carboxymethyllysine), s100 calgranulins (s100a4, s100a8, and s100a9), and hmgb-1 have been reported in ra patients [108, 111, 112, 120, 121 ]. previous studies found that the levels of pentosidine and s100a12 correlate with disease activity in ra [122, 123 ], while s100a4 is reported to induce mmp-13 production just like in oa. in addition, hmgb-1 has been shown to induce synovial fluid macrophages to release tnf-, il-1, and il-6 by rage signalling [124, 125 ]. steenvoorden and colleagues have demonstrated that either hmgb-1 or glycated albumin increases the invasiveness of synoviocytes in a rage - dependent manner, as confirmed by the inhibitory effect of anti - rage antibody. all these findings indicate that rage does play an important role in the development and progression of ra. although there are differences between the pathologies of oa and ra, the data gathered so far raise the intriguing hypothesis that rage activation by elevated levels of its ligands contributes to the cartilage degradation seen in both oa and ra. however, lung has been identified as an exception, as rage is constitutively expressed at a high basal level in pulmonary tissue, localized primarily in alveolar type i (ati) pneumocytes. alterations in rage levels and rage - ligand interaction have been suggested to play a relevant role in the pathogenesis of several pulmonary diseases. acute lung injury (ali) and acute respiratory distress syndrome (ards), a more severe manifestation, are syndromes of acute respiratory failure, hallmarked by hypoxemia, disruption of alveolar fluid clearance (afc), deterioration of the alveolar - capillary barrier, and, most importantly, damage to ati pneumocytes [128, 129 ]. increased levels of rage were demonstrated in bronchoalveolar lavage fluid (balf) in various direct models of lung injury induced separately by intratracheal instillation of hydrochloric acid, lipopolysaccharide (lps), or escherichia coli as well as exposure to hyperoxia. notably, rage deletion in mice was reported to exhibit protective effects against hyperoxia - induced mortality and diminish characteristics of hyperoxia - induced ali. rage null mice exposed to hyperoxia survived significantly longer and showed a marked reduction in total balf cells, total protein leakage, and secretion of proinflammatory cytokines in balf. also, increased rage levels in balf, together with inflammation and damage, were found in mice after intratracheal insufflation of il-1 and ifn- cytokines. in a different study, srage levels in balf were reported to elevate in response to lps challenge. further, srage which acted as a decoy receptor and blocked rage signalling to alleviate the inflammatory events was administered into the mice after lps instillation. these srage - treated mice were shown to display a significant reduction in neutrophil infiltration, lung permeability index, and nf-b activity, as well as production of several proinflammatory cytokines including tnf- and macrophage inflammatory protein (mip-1 and mip-1) in balf. rage has been found to be a promising marker of ati cell injury. due to the role of ati cells in epithelial integrity and alveolar fluid clearance, rage is proposed to be a biomarker for the severity of ali / ards clinical outcomes. consistent with these findings, calfee and colleagues showed that higher baseline plasma rage levels are significantly correlated with increased severity of lung injury. besides the receptor, a few ligands of rage have been linked to lung injury. amplified pulmonary s100a12 expression and higher balf concentrations of s100a12 protein have been demonstrated in ards patients. instillation of another rage ligand, hmgb-1, has been found to trigger neutrophil accumulation, development of lung oedema, and elevated pulmonary levels of cytokines such as il-1, tnf-, and mip-2 [137, 138 ]. as the ligands mentioned above primarily act via rage signalling, these findings indicate the role of rage in inducing acute inflammatory lung injury. furthermore, rage has been associated with asthma which is a chronic inflammatory disease of the airway. the hallmarks of this lung disease include airway obstruction, increased airway responsiveness, and airway inflammation which involve various cell types and inflammatory mediators. in asthma, airway inflammatory response usually involves airway neutrophilia which is characterized by ongoing neutrophil influx, uncontrolled neutrophil activation, and impaired neutrophil clearance. neutrophilic airway inflammation has been closely related to severe asthma [141, 142 ] and is found to be implicated in the development of persistent airflow limitation which is one of the hallmarks of severe asthma. these findings are further supported by another study reporting that patients with severe or refractory asthma frequently exhibit neutrophilic airway inflammation. watanabe and colleagues have proposed that one of the important rage ligands, hmgb1 protein, may enhance neutrophilic inflammation and may play a role in neutrophilic asthma. in the same study, higher levels of hmgb1 protein and esrage have been observed in asthmatic sputum, but only increased levels of hmgb1 were found to be associated with severity of asthma. another recent study demonstrated positive correlations between the levels of hmgb1 or rage and the percentage of neutrophils in asthma patients. this study also showed that both hmgbl and rage expressions in the asthma patients were reduced after receiving treatment. hence, the authors have suggested that both hmgb1 and rage may play a role in inflammatory process and pathogenesis of asthma. additionally, patients with neutrophilic asthma were reported to express significantly lower systemic levels of srage, indicating a positive correlation between reduced srage and neutrophilic airway inflammation in asthma. in rodent model of asthma induced by either house dust mite (hdm) or ovalbumin, rage deletion has been demonstrated to protect the mice by eliminating airway remodeling, eosinophilic inflammation, and airway hypersensitivity irrespective of the type of allergens involved. the same study also showed that inhibition of rage in wild type mice can significantly reduce inflammation in asthma. all of these results suggest that rage - ligand axis plays a role in neutrophilic airway inflammation as well as in the pathogenesis of asthma. in addition to ali / ards and asthma, a growing body of evidence supports the involvement of rage in pulmonary fibrosis. significant reductions in the levels of both srage and membrane rage have been observed in a series of animal models of pulmonary fibrosis, in which administrations of bleomycin, asbestos or silica are used to induce lung injury [148150 ]. this deleterious effect on the expression of rage has also been found in ati cells extracted from lung slices of rats exposed to cdcl2 and tgf-1. similarly, reduced rage concentrations have been shown in lung homogenates and balf of idiopathic pulmonary fibrosis (ipf) patients [148, 152 ]. a study on rage null mice has revealed that these mice spontaneously develop fibrosis - like alterations in lungs and develop more severe fibrosis compared to wild - type controls when subjected to a model of pulmonary fibrosis induced by asbestos. all these findings indicate that loss of rage may contribute to the pathogenesis of pulmonary fibrosis. however, conflicting results from studies on mouse models of pulmonary fibrosis and human ipf tissues have been found. an investigation by he and colleagues showed that rage null mice were largely protected from bleomycin - induced lung injury, accompanied by decreased levels of potent rage - inducible profibrotic cytokines tgf-1 and pdgf in balf, and improved survival. moreover, overexpression of rage was observed in reactive pneumocytes, bronchiolar metaplastic epithelium, and endothelium in ipf lungs. this study also found that extensive rage reactivity was more evident in fibroblastic foci where inflammatory cells aggregate. the exact role of rage in the pathogenesis of pulmonary diseases remains unclear due to the conflicting results from different current studies. however, rage undoubtedly plays an important role in both physiological and pathological conditions of the lung. it is characterized by a wide range of systemic and organ function aberrations which subsequently result in tissue injury and organ failure. rage has been proposed to be involved in the pathogenesis of sepsis due to its role in transmitting signals from pathogen substrates to activate cells during the onset and perpetuation of inflammation. studies have demonstrated that ligands of rage, s100 calgranulins, and hmgb-1 are elevated in septic patients, and this further supports the role of rage in the pathogenesis of sepsis [156158 ]. although the exact role of rage in sepsis still remains a puzzle, more and more evidence from animal studies has been documented. in a model of cecal ligation and puncture (clp)-induced sepsis, a significant improvement in survival and higher arterial oxygenation were observed in rage null mice as compared with wild - type controls. decreased activation of nf-b was also noted in rage null mice, thus suggesting that activation of nf-b is probably the mechanism underlying the protective effects of rage deletion. this model of clp - induced sepsis was also used in another study to test the effect of rage blockade with anti - rage antibody. the study showed that administration of a rat anti - murine rage monoclonal antibody significantly increased the survival rate in mice undergoing clp. this significant survival benefit was even observed in mice receiving the anti - rage antibody if it was delayed for 24 hours. noteworthy, the same study tested the effects of rage blockade and rage deletion in a model of systemic listeriosis using listeria monocytogenes infection and found the same protective effects as in the clp model of polymicrobial sepsis. furthermore, van zoelen and colleagues have demonstrated an improved survival in rage null mice and an improved killing capacity of streptococcus pneumonia in rage - deficient macrophages in vitro. the authors suggest that the improved host defence may be the underlying cause for the improved survival in rage null mice during pneumococcal pneumonia. all the evidence from animal models of sepsis underlines that rage is implicated, at least in part, in the pathogenesis of sepsis. however, further research is warranted to confirm the exact role of rage, especially the role of rage in critical organ derangements during sepsis pathogenesis. from all the evidence presented in this review, it is obvious that the rage - ligands axis is closely linked to a broad range of diseases, all of which appear to exhibit upregulation and accumulation of one or more types of rage ligands. rage, expressed in many different cell types, interacts with a number of its ligands to model a complicated biochemical axis linking complex which in turn perpetuates and amplifies inflammatory responses and leads to the pathogenesis of various inflammatory - related diseases. there is a growing body of evidence connecting rage - ligand axis to a number of pathological settings such as cardiovascular disease, neurodegeneration, diabetes mellitus, and immune / inflammatory diseases. this has evoked a focus of attention to the potential of rage as a target of therapeutic intervention. to investigate the effects of rage blockade in pathological conditions, many studies have used soluble form of rage (srage) which can antagonize rage - ligand interaction to competitively inhibit the activation of rage signalling [46, 163165 ]. evidence from these studies has shown that rage blockade protected the experimental animals against various disease challenges. the potential impact of rage deletion has been further studied in homozygous rage deficient mice to investigate the therapeutics possibilities of rage [131, 160, 161, 166 ]. these studies have reported that genetic deletion of rage also provided protection and improved survival in rage null mice during clinical settings. based on the impressive results obtained from animal studies, rage blockade or rage deletion may be proved beneficial in clinical settings [46, 131, 160, 161, 163166 ]. the first is the advantages and disadvantages of such a rage - targeting therapy in humans. future investigations are definitely required to develop a greater understanding of the impact of rage blockage before a promising rage - directed therapeutic strategy can be established. | the receptor for advanced glycation end products (rage) is a transmembrane receptor of the immunoglobulin superfamily, capable of binding a broad repertoire of ligands. rage - ligands interaction induces a series of signal transduction cascades and lead to the activation of transcription factor nf-b as well as increased expression of cytokines, chemokines, and adhesion molecules. these effects endow rage with the role in the signal transduction from pathogen substrates to cell activation during the onset and perpetuation of inflammation. rage signaling and downstream pathways have been implicated in a wide spectrum of inflammatory - related pathologic conditions such as arteriosclerosis, alzheimer 's disease, arthritis, acute respiratory failure, and sepsis. despite the significant progress in other rage studies, the functional importance of the receptor in clinical situations and inflammatory diseases still remains to be fully realized. in this review, we will summarize current understandings and lines of evidence on the molecular mechanisms through which rage signaling contributes to the pathogenesis of the aforementioned inflammation - associated conditions. |
atherosclerosis is a dynamic inflammatory disease [1, 2 ] in which autoantigenes, such as oxidized low - density protein (oxldl), play an essential role. dendritic cells (dcs) are key regulatory antigen - presenting cells (apcs) that induce inflammatory processes. dcs can be detected in the vascular inflammatory environment, from endothelial dysfunction to consecutive plaque formation and rupture [35 ]. dcs are the most potent apcs and are highly specialized to prime naive t - cells. interestingly, mature dc - specific markers, for example, cd83, accumulate during plaque progression. it has been shown previously that the presence of cd83 is more than two fold, higher in symptomatic compared to asymptomatic patients. dcs, after entering the vascular tissue, screen the environment for potential antibodies. after processing the antigens, a maturation process is initiated and immunomodulatory receptors, such as the cd83-receptor (important for t - cell - stimulation), are upregulated. in a previous study, we found a cd83 upregulation on dcs by proatherosclerotic stimuli like oxldl and asymmetric dimethylarginine (adma). beside cd83, dc induces ccr7 expression during maturation, which acts as a receptor for constitutively expressed ccl21 and ccl19 [10, 11 ]. in analogy to dc accumulation and maturation, activated ccr7 expressing t - cells are trapped especially in the plaque shoulders [12, 13 ] where mature dcs are forming clusters with t cells. several studies have demonstrated the important link between dc / t - cell recruitment and ccr7 expression [1214 ]. the increase in ccr7 receptors induces homing of mature dcs and t - cells to the lymph nodes through ccl21/ccl19 expressing lymph vessels [2, 11, 12 ]. high plasma concentrations of oxldl and their appearance in atherosclerotic lesions are of utmost importance in the pathogenesis of atherosclerosis. the present study focuses on the influence of oxldl on the dc - related chemokine receptors ccr7, ccl19, and ccl21. we characterized the dc - specific chemokine - ligand expression in human atherosclerotic carotid artery plaques. furthermore, we investigated the impact of oxldl on the dc receptor ccr7 expression and its ligands ccl-21 on human microvascular endothelial cells (hmecs). all investigations were approved by the institutional review board and the ethics committee of the ludwig - maximilians university of munich. the investigation conforms to the principles outlined in the declaration of helsinki. between september 2006 and may 2008, carotid endarterectomy (cea) the indications for cea were based on carotid duplex sonography : stenosis of the internal carotid artery of more than 70% for symptomatic patients and for comparison, we collected 10 blood samples from healthy age - matched men without clinically manifested atherosclerosis and 14 pieces of aortic tissue with no visible atherosclerotic lesions. 50 pg / tube rna (pbmcs) was used. first - strand cdna synthesis and pcr the two - step quantitative real - time pcr (rt - pcr) system was applied according to the manufacturers ' instructions. the quantitative real - time pcr system provides optimal performance with sybr green primers (qiagen : hilden, germany). rt - pcr was performed in the abi prismtm 7700 system (applied biosystems, germany). data analysis was performed using the delta - delta - ct method as described previously. primer sequences for the amplified fragments were gapdh : 5-cgg agt caa cgg att tgg tcg tat-3/5-agc ctt ctc cat ggt ggt gaa gac-3 ; ccr7 : 5-tgg agg cct tta tca cca tc-3/5-tgt agg gca gct gga aga ct-3 ; ccl19 : 5-ctg tga ccc aga aac cca tc-3/5-gct tca tct tgg ctg agg tc-3 ; ccl21 : 5-ccc agc tat cct gtt ctt gc-3/5-tca gtc ctc ttg cag cct tt-3 ; cd4 : 5-agg aag tga acc tgg tgg tg-3/5-ctc agc aga cac tgc cac at-3. frozen sections (10 m) were prepared from human aorta and plaque material of the internal carotid artery. after fixation in methanol / ethanolic acid for 1.5 min at 20c, the sections were washed immediately 3 times for 3 min in pbs. unspecific binding was blocked with a 2% bsa/0.2% tween 20 solution for 1 h and followed by 3 washing steps in pbs. to visualize nucleoli we used dapi (4, 6diamidino-2phenylindole, merck kgaa, germany) in a final concentration of 1 g / ml. after another washing step the sections were incubated with a fluorescent labelled anti - human ccl21/6ckine antibody (5 g / ml, r&d systems, inc., germany). to determine the localization of the ccl21 expressing structure (ccl21/6ckine antibody 5 g / ml, r&d systems, inc., germany), the sections were also incubated with a cy3-labeled anti - pecam-1 antibody (5 g / ml, abd serotec, germany), which demarcates the endothelia cells in the vessel wall. immunofluorescence analysis of ccl21 expression was investigated by confocal microscopy (lsm 510 meta, zeiss, plan - neofluar 40x/1.30 oil objective, germany) and quantified by lsm image browser 4.2 (zeiss, germany). the sections were incubated with an fitc - labelled anti - human ccr7 antibody (1 : 100 concentration, r&d systems, inc., germany) for 1 h, followed by 3 washing steps in pbs. the sections were incubated with an atto594-labeled anti - cd4 antibody (10 g / ml, abd serotec, germany) or atto594-labelled anti - cd83 (10 g / ml, abd serotec, germany) for 1 h, which represents the t - lymphocytes (cd4) or mature dc (cd83). the immunofluorescence analysis was investigated by confocal microscopy (lsm 510 meta, zeiss, plan - neofluar 40x/1.30 oil objective, germany). oxldl levels were examined by using a cytokine - specific elisa kit according to the manufacturers ' instructions (immundiagnostik, bensheim, germany). before analysis, samples were treated as described above. in brief, after washing with wash buffer several times, standard samples and controls were added and incubated for 4 hours at room temperature on a horizontal mixer. thereafter, a washing conjugate was added and incubated for 1 h as described before. the substrate was added and incubated for 25 minutes in the dark. stop - solution was added and immediately analyzed by an elisa - reader at 450 nm. detection of ccl21 in serum was also performed by a quantitative sandwich enzyme immunoassay technique, according to the manufacturers ' instructions (r&d systems, germany). mononuclear cells were isolated from 100 ml of peripheral blood of a healthy human donor by a ficoll density gradient according to the protocol by boyum. the purity of the monocyte culture was enhanced up to 97% by adhesion on -globulin coated plates. dcs were obtained from the monocyte culture according to the modified protocol by romani. as described in detail in our recent publication [9, 17 ]. all experiments were performed with human microvascular endothelial cells (hmecs-1), generously provided by the center for disease control and prevention and the national center for infectious disease (atlanta, usa). cells were cultured in mcdb-131 (without phenol red ; cc pro, neustadt / w., germany) supplemented with 10% fetal calf serum (fcs ; paa, pasching, austria), 2 mm l - glutamine (biochrom ag, berlin, germany), 1 g / ml hydrocortisone, and 10 ng / ml epidermal growth factor (sigma, taufkirchen, germany). the cells were used at least 10 days after thawing and for no more than 20 passages. ldl (density = 1.019 to 1.063 g / ml) was isolated from human plasma of normolipidemic healthy volunteers by sequential ultracentrifugation as described and stored in pbs containing 2 mmol / l edta. shortly before oxidation, the edta was removed from ldl by passing the lipoprotein through a pd 10 column (pharmacia, austria). this reflects oxldl concentrations in the plaque and has been used in previous studies [5, 22, 23 ]. in addition, several other studies have shown that an oxldl concentration of (10 g / ml) is not toxic to the cultured cells [9, 24, 25 ] for isolation of mrna from hmecs-1 and dcs, the total rna isolation rnaeasy mini kit from qiagen (hilden, germany) was used according to the instructions provided by the manufacturer. 50 pg / tube rna (pbmc) was used. first - strand cdna synthesis and pcr the two - step quantitative rt - pcr system was applied according to the manufacturers ' instructions and as described above. antibodies were matched to iso - type - controls (mouse-2a-(fitc)/-1(pe)-fastimmune ; bd ; usa). to verify the purity of our dc - culture, we used cd3 (bd, usa) and cd20 (bd, usa) to rule out a t - cell and b - cell contamination (< 5%). dcs were characterized by low cd14 expression (bd, usa) and high expression of cd80 (bd, usa), cd86 (bd, usa), and hla - dr (bd, usa), as described previously. at day five, we incubated the dcs with oxldl (10 g / ml) for 24 hours. expression analysis of the chemokine receptor ccr7 (r&d, usa) and cd83 (biolegend, usa) on human dcs were performed using flow - cytometer analysis [16, 17 ]. hmecs-1 were cultivated on chamber slides and stimulated with 10 g / ml oxldl for 48 h. the monoclonal antibody for ccl21/6ckine (r&d, usa) was labeled with alexa 488 using the alexa fluor protein labeling kit (invitrogen, life technologies, usa) according to the manufacturers ' instructions. hmecs-1 were incubated with the labeled antibody (concentration 1 : 20) for 30 minutes. thereafter, vybrant did (invitrogen, life technologies, usa) was used as a marker of the plasma membrane. ccl21-labeled hmecs-1 were investigated by confocal microscopy (zeiss lsm 510 meta, plan - apochromat 63x/1.40 oil objective) and quantified by lsm image browser 4.2 (zeiss, germany). the kolmogorov - smirnov test was used to determine whether or not the data was normally distributed. if the data was normally distributed, the unpaired t - test was used to compare the two groups. differences between means were considered significant with p < 0.05 and highly significant with p < 0.01. all in - vitro experiments were repeated at least eight times with different cells and lipoprotein preparations. carotid plaque tissue and blood samples were collected from 47 patients undergoing cea, of which 77% were male and, on average, 70 8 years of age. serum for the pbmcs in the control group was collected from 10 healthy age - matched patients. none had cerebral ischemic complications or clinical manifest atherosclerosis. concerning the risk - profile, 20% had insulin - dependent diabetes mellitus, 80% hypertension, and 10% were smokers. concerning the medication, 10% took thrombocyte aggregation inhibitors, 80% statins, and 60% had a -blocker (table 1). aortic tissue in the control group was collected from 14 patients who underwent valve replacement and had no sign of aortic atherosclerosis. 71% were of male gender with an average age of 64 5 years. concerning the risk profile, 28% had insulin - dependent diabetes mellitus, 85% hypertension, and 35% were smokers. with respect to medication, 43% took thrombocyte aggregation inhibitors, 78% statins, and 43% had a -blocker. in line with previous investigations, we detected that the median cd83 mrna levels in plaque tissue from cea - group were nearly twice as high as in healthy aortic tissue (p < 0.01), demonstrating the augmented presence of mature dcs in the atherosclerotic tissue [7, 27, 28 ]. in a subgroup analysis, we further found that cd83 levels in men were significantly higher (+ 120% ; p < 0.05) compared to women. cd4 mrna levels were even 23 11 fold higher in healthy aortic tissue (p < 0.01 ; data not shown). ccr7, normally coexpressed on mature dcs and t - cells, was 81% lower in the plaque compared to compared to healthy aortic tissue (p < 0.01) without any gender specific differences. further analysis of ccl19 revealed that its transcripts were downregulated by 99% (p < 0.01). ccl21 was found 90% lower in the plaque (p < 0.01) compared to healthy aortic tissue (figure 1). furthermore ccl21 was also found lower in the symptomatic patients (58% ; p < 0.05) compared to asymptomatic patients from the cea group. to confirm the pcr results on the protein level, we performed a semiquantitative immunofluorescence analysis on histological slides of human aortic and plaque tissue. to analyze the location of ccl21 expressing cells this revealed a colocalization of the ccl21 and the vascular wall of the vasa vasorum (figure 2(a)). in every single healthy aortic tissue slide (n = 6), we could detect higher ccl21 expression via an increased fluorescence signal signal from the binding fluorescent antibody than in the plaque tissue (n = 15). an example is shown (n = 15 ; in figure 2(b)). to further investigate differences of the ccr7 level on t - lymphocytes (cd4 positive) and mature dc (cd83 positive) in human tissue,, we could detect a decreased signal of ccr7 on cd4-positive cells within the plaque tissue (figure 2(c) ; lower panel) compared with control aortic tissue (figure 2(c) ; upper panel). also, cd83-expressing cells within the plaque show a decreased ccr7 signal (figure 2(d) ; lower panel) compared to the aortic tissue which correlates with the pcr results. for oxldl, we found a 52.1% (p < 0.05) higher concentration in the plaque group compared to the control group (table 1). oxldl serum concentrations showed no correlation with ccl21/ccl19 or ccr7 expressions in plaques (table 1). < 0.01) higher serum concentration in the cea group compared to the controls (table 1). after stimulation with oxldl, we found a reduction of the mrna levels of ccr7 (dcs) by 30% using rt - pcr (n = 8 ; p < 0.05). this correlated with a reduction in protein expression by 46% (n = 8 ; 25.7 1.06% versus control 47.6 19.3% positive cells ; p < 0.05 ; figure 3). in contrast, protein expression of cd83 was significantly upregulated by 10 g / ml oxldl, as shown in figure 3 (60%, 46.9 p < 0.05 ; figure 2) by 10 g / ml oxldl (figure 3). for hmecs-1, stimulation with oxldl led to a significant reduction of ccl21 mrna expression (50% ; ct = 0.5 ; p < 0.05, figure 4(a)). these results correspond with the results of the immunofluorescence analysis, where we found a 24% down - regulation of ccl21 receptor expression (n = 9 ; 34.00 8.53 versus control 44.54 6.23 intensity / mm ; p < 0.05 ; figures 4(b) and 4(c). oxldl had no significant impact on protein or mrna expression of ccl19 (figure 4(a)). the main findings obtained from our study are (1) the dc - chemokine receptor ccr7 and its ligands ccl21/ccl19 are significantly downregulated in atherosclerotic plaques ; (2) circulating ccl21 levels are upregulated in serum from atherosclerotic patients ; (3) oxldl impairs ccr7 expression in dcs and ccl21 expression in microvascular ecs. our data support the concept that modulation of chemokine receptors (mediated, e.g., by oxldl) in the plaque may trigger retention of dcs, thereby impeding the vascular innate and adaptive immunity [29, 30 ]. accordingly, angeli. found that oxldl and other lipid mediators are jointly responsible for trapping of dcs in the vascular wall. in our in vivo study, however, ccr7 and ccl21/ccl19 were downregulated in atherosclerotic plaques compared to nonatherosclerotic aortic tissue. this discrepancy may be explained by the fact that oxldl is unstable in serum but accumulates in the subintimal space over time. hereby, it reaches much 70 fold higher subintimal concentrations as compared to serum levels. alongside, ccl21 was downregulated on hmecs-1 after incubation with oxldl, in a concentration which predominates in atherosclerotic plaques. previously demonstrated that phases of hyperlipidemia severely reduce ccr7 mrna and the corresponding protein levels in an apoe - mice model. ccr7 expression was found to be essential for the migration of dcs from atherosclerotic plaque. in atherosclerotic plaques of apoe - mice, this process was accompanied by an upregulation of ccr7 itself. under a high - dose statin therapy, damas. found a significant decrease in ccl19 and ccl21 levels in serum. our data support this observation, showing reduced ccl21 serum protein expression in the control group, characterized by low oxldl levels. our results suggest that dc maturation is triggered by increased oxldl deposits in the subintimal space. at the same time dcs, and even t - cells do not seem to express enough ccr7 receptors in order to migrate. as a consequence, oxldl, dcs and t - cells appear to accumulate, thereby enhancing plaque inflammation processes and possibly plaque rupture. these results complement the former findings that oxldl increased the adhesion and promotes the maturation and differentiation of dcs from monocytes [9, 26 ]. furthermore, oxldl supports the building of foam - cell accumulations and also directly induces chemotaxis of immune cells like t - cells via upregulation of endothelial adhesion molecules. keeping in mind that dcs are responsible for priming naive t - cells to oxldl - specific t - cells [9, 33 ], the interaction of oxldl and dcs must be taken into account as a key factor for the induction and progression of atherosclerosis. oxldl not only seems to have an influence on the expression of ccr7, but also to induce downregulation of ccl21 on ecs in vitro as well as decreased expression of ccl21 and ccl19 in the plaque. comparing ccl19 with ccl21, the latter appears to be affected more directly by local plaque homing factors. in plaque versus normal aortic tissue, we found a much higher response to ccl21 on ecs as opposed to ccl19. typically, the expression of ccl21 on ecs is higher than ccl19, since ccl21 has a c - terminus indicating a strong affinity to glycosaminoglycan. this is crucial for effective presentation of ccl21 on ecs [11, 34 ]. in contrast to our study, other investigators demonstrated an upregulation of ccl21/ccl19 in carotid plaques. in previous studies, 24 coronary or renal vessels from autopsy material were taken as controls. to overcome these limitations, we used 14 age - matched healthy aortic tissue samples taken from valve operations serving as controls, which were immediately frozen after their operative preparation, similar to the procedures of carotid tissue preparation. autolysis and coincidence caused by the small number of controls were therefore ruled out in our experimental setting. a further aspect which points against the renal vessels as controls is the fact, that the vascular - associated lymphoid tissue (including dc and t - cells) has been characterized in human large arteries, including the aorta, carotid, and coronary arteries [35, 36 ] but not in renal vessels. in summary, our results suggest that alterations in the vascular chemokine profile may be responsible for accumulation of mature dcs in plaque, which potentially enhance the risk for plaque rupture. it may be argued that inhibiting dc migration leads to a less robust immune response. indeed, altered priming can be expected in the presence of impaired dc migration. however, if migration is blocked and maturation enabled, the consequence of trapping mature dcs in the direct atherogenic vicinity may induce plaque formation and progression or even rupture. suppression of dc migration and maturation may, therefore, prove a promising future therapeutic target to prevent plaque instability and rupture. | introduction. dendritic cells (dcs) and oxldl play an important role in the atherosclerotic process with dcs accumulating in the plaques during plaque progression. our aim was to investigate the role of oxldl in the modulation of the dc homing - receptor ccr7 and endothelial - ligand ccl21. methods and results. the expression of the dc homing - receptor ccr7 and its endothelial - ligand ccl21 was examined on atherosclerotic carotic plaques of 47 patients via qrt - pcr and immunofluorescence. in vitro, we studied the expression of ccr7 on dcs and ccl21 on human microvascular endothelial cells (hmecs) in response to oxldl. ccl21- and ccr7-mrna levels were significantly downregulated in atherosclerotic plaques versus non - atherosclerotic controls [90% for ccl21 and 81% for ccr7 (p < 0.01) ]. in vitro, oxldl reduced ccr7 mrna levels on dcs by 30% and protein levels by 46%. furthermore, mrna expression of ccl21 was significantly reduced by 50% (p < 0.05) and protein expression by 24% in hmecs by oxldl (p < 0.05). conclusions. the accumulation of dcs in atherosclerotic plaques appears to be related to a downregulation of chemokines and their ligands, which are known to regulate dc migration. oxldl induces an in vitro downregulation of ccr7 and ccl21, which may play a role in the reduction of dc migration from the plaques. |
with the introduction of fast - track surgery protocols and the ongoing shift toward day - case surgery, transversus abdominis plane, ilioinguinal - iliohypogastric, and rectus sheath block (rsb) have all regained popularity for abdominal surgery. first described by schleich in 1899, the aim of the technique is to deposit the local anesthetic (la) in the virtual space between the posterior wall of the rectus abdominis muscle and its sheath. an anesthetic injected into this space is assumed to spread freely cephalad and caudal and to block the terminal branches of the intercostal nerves before they leave the rectus sheath. since the extensive origin of the nerves innervating the abdominal wall pose significant problems in terms of block success and la consumption, a limited operative surgery field involving fewer intercostals nerves (i.e., t9-t11) was found to be more amenable to this technique, and starting from the late 1990s this block was tested mainly in children having periumbilical surgery. the advent of ultrasound (us)-guidance has helped to increase the feasibility and clinical applications for truncal block, allowing easier identification of the target anatomy structures and accurate visualization of the needle and la spread, reopening the way for clinical application, study and refinement of rsb. the anesthetic spread in the space behind the rectus abdominis muscle is the premise for an effective rsb, though strong evidence is lacking, and no studies to date have examined the potential role of rsb as an anesthetic management in umbilical herniorrhaphy. we conducted a prospective study to test the effectiveness for surgical anesthesia of us - guided rsb in adult patients undergoing umbilical hernia repair. the study was conducted as a prospective nonblinded trial after approval by our hospital ethics committee. informed written consent was obtained from 30 patients (american society of anesthesiology classification i - iii ; age range, 18 - 80 years) scheduled for day - case primary, small and medium size (defect width 4 cm) umbilical hernia repair. exclusion criteria were noncooperative patients, known allergy to la agents, history of bleeding or seizure disorders, and previous abdominal surgery. on arrival in the anesthesia room, peripheral intravenous access no premedication was administered. before block placement, the lateral borders of the rectus muscles (linea semilunaris) were identified sonographically (sonosite m - turbo and l38/10 - 5 linear array probe ; sonosite inc., the intersection between linea semilunaris and costal margin was labeled as a t-8 dermatome level. a horizontal line joining the linea semilunaris on either side of the rectus abdominis at the umbilical level was drawn and labeled as a t-10 dermatome level. each linea semilunaris midpoint between t-8 and the t-10 dermatome was joined by a horizontal line which was labeled as the t-9 dermatome. another horizontal line joining each linea semilunaris was traced below the umbilicus at the same distance between t-9 and t-10 ; this line was labeled as the t-11 dermatome [figure 1 ]. the rectus muscle width (distance between the linea semilunaris and the linea alba at t-10) was measured and multiplied by the distance between t-9 and t-11 ; this abdominal surface was considered similar, by extension, to the surface area of the underlying rectus sheath that would be filled with the anesthetic. a - a = linea alba, b - b= linea semilunaris, c = costal margin the abdominal skin was disinfected with a 2% chlorhexidine solution, and the transducer was equipped with a sterile plastic cover and gel. the rectus muscle was visualized with the us probe held in transversus orientation at the t-10 level. the posterior rectus muscle sheath and the fascia transversalis were identified as twin hyperechoic lines ; rectus muscle thickness and posterior sheath depth (midway from each border) were measured with the built - in caliper of the us machine at the t-10 level [figure 2 ]. a 20 g tuohy needle (pajunk geisingen germany) connected to an infusion line was introduced in plane with the us probe in a medial to lateral direction at an angle of approximately 45 to the skin plane. us guidance, the needle was gradually advanced posterior to the rectus muscle and above the underlying rectus sheath toward its lateral edge, approaching the rectus sheath with the blunt side of the bevel, lateral to the deep inferior epigastric artery to avoid damaging it with the needle. following negative aspiration testing, a bolus of 1 ml of 20 ml levobupivacaine solution was slowly injected through the needle. the solution was prepared by mixing 10 ml of levobupivacaine 0.75% (chirocaine, abbvie italy) and 10 ml of saline solution, added with 0.1 mg epinephrine (final concentration levobupivacaine 3.75 mg / ml, epinephrine 5 g / ml). if intramuscular spread of the la occurred, the needle was advanced until the rectus muscle was separated from the posterior rectus sheath by hydrodissection ; the number of attempts to obtain correct hydrodissection was counted. at this point, a = subcutaneous, b = muscle, c = bowel, arrow = posterior rectus sheath and the fascia transversalis tuohy needle introduction local anesthetic (la) injection. a = subcutaneous, b = muscle rectus, c = bowel, = needle, = la, thin arrow = rectus sheath and the fascia transversalis, large arrow = posterior wall of the rectus five minutes after block placement, anesthetic spread at the t-9 and t-11 dermatome levels was sonographically assessed bilaterally and scored as : 0 = no spread, 1 = detectable spread. oxygen 40% was delivered via a ventimask. due to traction - related pain and discomfort on deep structures (hernial sac and omentum are not innervated by intercostals nerves), an intravenous infusion of remifentanil 0.03 g / kg / min was started 5 min before placing the incision to maintain a level of 4 - 5 points of conscious sedation based on the observer 's assessment of alertness / sedation scale. as per protocol, inadequate anesthesia occurring during surgery was supplemented with local injection of 1% mepivacaine ; if this did not alleviate the pain sensation, general anesthesia was planned. umbilical hernia repair was performed through a short horizontal, over - umbilical incision ; the hernia sac was freed by gentle sharp dissection, opened, and excised. a simple suture (defect 1 cm) or an endoperitoneal polypropylene mesh was used to close the defect. postoperative pain was recorded hourly using a numerical rating scale 0 - 10 both at rest and coughing ; patients with a pain score 3 received intravenous paracetamol 1000 mg. patients were eligible for discharge once hemodynamically stable, the pain score at rest and coughing was < 3/10, and were able to walk and drink freely. the primary outcome of this work was the effectiveness of rsb for surgical anesthesia, defined as it produced anesthesia sufficient for surgery without the need for mepivacaine supplementation. the secondary outcome was the anesthetic spread pattern into the rectus sheath and its correlation with anthropometric data. correlation between anesthetic spread, anthropometric, and block characteristic data were assessed by pearson 's analysis. in this analysis, it was assumed that the population distributions were identical to the sample distributions. normally distributed data are expressed as means standard deviation ; nonnormally distributed data are expressed as the median and inter - quartile range (irq). statistical analysis was performed using graphpad prism for windows, version 5.00 (graphpad software, la jolla, california, usa). the block was effective for surgical anesthesia in 16/30 patients (53.3%) (95% confidence interval 95% 17.8). in the remaining patients, anesthesia supplementation was needed at cutaneous incision, whereas manipulation of the muscle and fascial planes did not cause discomfort. demographics and block characteristics spread of the la was contemporaneously bilateral to t-9 and t-11 (echographic spread score = 4) in eight patients (26.6%) [table 1 ] ; in these cases, the block was 75% effective for surgery. the anesthetic spread score correlated negatively with abdominal surface (r = 0.7117), body mass index (bmi) (r = 0.7228) and the number of attempts to obtain correct hydrodissection of the rectus muscle away from the posterior rectus sheath (r = 0.4930). no correlations were found between the anesthetic spread score and the rectus muscle deepness and thickness. correct hydrodissection was attained at the first attempt in 32% of patients (median 2.0 [iqr 2.0 ]). postoperative analgesia was excellent both at rest and coughing ; only one patient required a single rescue dose of paracetamol. we have attempted to examine the feasibility of us - guided rsb as a unique anesthetic technique in adult patients undergoing elective umbilical hernia repair. when performed at the t-10 level with 20 ml of levobupivacaine 0.375% each side, the block was effective for surgical anesthesia in 53% of the patients. umbilical hernia repair is one such surgical procedure in which rsb may be contemplated ; however, to our knowledge, only two cases reported its use as the sole anesthetic technique in a high - risk patient to avoid the complications of both general and spinal anesthesia. the purpose of the block is to give anesthesia to the rectus muscle and overlying skin around the umbilicus by bilaterally blocking the terminal branches of the t9-t11 intercostal nerves which, in theory, need bilateral spread of la to t-9 and t-11 levels (spread score = 4). in the present study, 20 ml of anesthetic solution was transversely injected to the long axis of the rectus at the umbilicus level and the spread occurred bilaterally to t-9 and t-11 (echographic spread score = 4) in only 26.6% of patients. as the rectus sheath is a virtual container, its filling by a fixed dose of fluid was found inversely proportional to its size (the greater the abdominal surface, the lower the spread score ; r = 0.7117) so, while performing rsb the volume of the anesthetic agent should be adjusted to the patient 's bmi, taking into account the maximum dosage permitted. further, as correct hydrodissection of the rectus muscle away from the posterior rectus sheath was successful at the first attempt in only 32% of patients, we noted that each failed attempt in obtaining correct hydrodissection of the rectus muscle from its posterior sheath inevitably resulted in a certain amount of la being injected intramuscularly, thus, reducing the la volume availability for spreading resulting in a poor spread pattern (r = 0.4930). to minimize this factor, interestingly, no correlation was found between the number of attempts to obtain correct hydrodissection and the depth of the posterior rectus sheath. dolan. reported a higher success rate of la placement into the rectus sheath at the time of the first injection under us guidance by trainee anesthesiologists, but differently from our study as these injections were not performed between the rectus wall and its posterior sheath. however, even when the la spreads as advocated (spread score = 4), the block was effective for surgery in not more than 75% of the patients. this stems from the difficulty of blocking the cutaneous branches of the thoracoabdominal nerves, whereas good anesthesia was achieved in the muscular and fascial planes in 100% of the patients. precise details regarding the course and distribution of the thoracolumbar nerves are lacking, and the literature describing these nerves has been contradictory. from a study by courreges., it would seem that in up to 30% of the population the cutaneous branch of the intercostal nerves is formed before the rectus sheath and so does not pierce the posterior wall of the rectus sheath but instead runs anterior to the rectus muscle in the subcutaneous tissue. to capture these aberrant anterior cutaneous branches, the author placed two injections of anesthetic bilaterally at the umbilicus level : one just under the anterior rectus sheath and one in the subcutaneous plane. in an attempt to minimize the importance of such anatomical variations, performed the block between the aponeurosis of the internal oblique and transversus muscles before the 10 intercostal nerves enter the rectus sheath. in contrast, mori. and yap. noted that all intercostal nerves from t-8 to t-11 pierce the rectus sheath at its lateral margin and run posterior to the rectus muscle for about 5 cm before entering the muscle (occasionally entering it at its lateral border). in keeping with this anatomical study, as recently described by gurnaney., we placed the injection of la behind the rectus muscle, with the needle oriented in a medial to lateral direction, in an attempt to deposit the la near the lateral border of the rectus sheath, as close as possible to the nerves before they enter the rectus muscle. our results may either corroborate courreges findings or simply represent a limit of the procedure. taken together, greater division and subdivision of the thoracoabdominal nerve origins, extensive communications between these branches, higher anatomical variation in their approach to the posterior surface of the rectus abdominis, and two - sided variability in the same patient set the stage for difficulty in achieving a full block of their cutaneous branches. first, the assessment of the anesthetic spread was performed only 5 min after block placement, hence we do not know how it progressed ; second, the spread was scored categorically without grading for intermediate levels ; third, we did not assess the spread over the t-9 and t-11 dermatome. when performed at the t-10 level with the aim to achieve surgical anesthesia in adult patients undergoing umbilical hernia repair, the advocated la spread is difficult to manage, and the resulting cutaneous block is not easy to obtain. in contrast, higher bmi, with increased abdominal surface area, was found to be a factor that most negatively influenced la spread so, it may be improved by adjusting the volume of the anesthetic agent to the patient 's anthropometric data and/or modifying the technique (i.e., changing the direction of the injection by placing the needle in the long axis of the muscle instead of the short axis or performing two injections on each side over and under the umbilicus). further comparative studies are needed to confirm these hypotheses. because, achieving full cutaneous sensory block is the main challenge of the procedure, we recommend la supplementation at the incision site before starting surgery. | background and aims : we conducted a prospective study to examine the local anesthetic (la) spread and the effectiveness for surgical anesthesia of ultrasound (us)-guided rectus sheath block (rsb) in adult patients undergoing umbilical hernia repair.material and methods : thirty patients received at t-10 level a bilateral us - guided injection of 20 ml levobupivacaine 0.375% + epinephrine 5 g / ml behind the rectus muscle to detach it from its sheath. anesthetic spread into the rectus sheath was evaluated ultrasonographically at t-9 and t-11 levels and scored from 0 to 4. the rsb was defined effective for surgical anesthesia if it was able to guarantee an anesthetic level sufficient for surgery without any mepivacaine supplementation.results:overall, the block was effective for surgical anesthesia in 53.3% of patients (95% confidence interval, 17.8). in the remaining patients, anesthesia supplementation was needed at cutaneous incision, whereas manipulation of the muscle and fascial planes was painless. no patients required general anesthesia. la spreads as advocated (to t-9 and to t-11 bilaterally = spread score 4) in 8/30 patients (26.6%) ; in these cases, the block was 75% effective for surgery. the anesthetic spread was most negatively influenced by increased body mass index. postoperative analgesia was excellent in 97% of patients.conclusion:use of rsb as an anesthetic management of umbilical herniorrhaphy is recommended only with anesthetic supplementation at the incision site. |
the great smoky mountains study (gsms) is a longitudinal study of the development of psychiatric disorders in rural and urban youth. a representative sample of 3 cohorts of children, aged 9, 11, and 13 years at intake, was recruited from 11 counties in western north carolina using a household equal probability, accelerated cohort design. the externalizing problems subscale of the child behavior checklist was administered to a parent of the first - stage sample (n = 3,896) as a screen. of the families contacted, 95% completed the telephone screen. as in other epidemiologic studies, the gsms used a screening - stratified sampling design to achieve the following 3 goals : to understand the developmental pathways of a large sample of children with a high need for mental health care (case finding) ; to estimate the prevalence of disorders and risk factors in the population (prevalence estimation) ; and to map the identified cases onto the general population (generalizability). a household sample would meet goal 2 but would need to be large (and expensive) to generate enough cases to meet goals 1 and 3. recruiting from service settings might achieve goal 1, but generalizability would be difficult to achieve because of referral bias and the fact that many children are seen in multiple service sectors. the oversampling strategy for gsms involved recruiting all subjects scoring in the top 25% on the screener and 1 in 10 of the remainder. the screening does not bias the sample, however, as each observation is weighted by the inverse of the selection probability. this weighting process also allows us to produce estimates representative of the population from which the sample was drawn. about 8% of the area residents and the sample are african american, and fewer than 1% are hispanic ; american indians make up only about 3% of the study area, but were oversampled to constitute 25% of the sample. of all youths recruited, 80% (n = 1,420) agreed to participate. n = 630). table 1 presents the study design and participation rates at each wave. as it shows, the 3 study cohorts (a, b, and c) spanned the age range from 9 to 13 years when the study started in 1993, and were followed up to ages 19 to 21 years, with an overall participation rate of approximately 80% thereafter. interviews were completed with the child and the child 's primary caregiver at their home or a convenient location until age 16 years, and with only the young adults thereafter. before the interviews began, interviewees signed informed consent forms approved by the duke institutional review board. this article presents data on 8,806 parent child pairs of interviews carried out across the age range of 9 through 21. all data on child and adolescent psychiatric disorders were derived from the child and adolescent psychiatric assessment (capa), which generates dsm - iv diagnoses. parent and child reports were combined using an either / or rule at the symptom level. in young adulthood, outcomes were derived from the young adult psychiatric assessment. the time frame for both interviews was the 3 months preceding the interview unless otherwise stated. we combined 3 depression categories into a single category : dsm - iv major depressive episode, dysthymia, and depression not otherwise specified (nos). we also focused on any anxiety disorder, oppositional defiant disorder (odd), and conduct disorder (cd). we did not follow the dsm rule of overriding a diagnosis of odd in people with cd, and therefore a subject could have both diagnoses. the small number of (hypo-) mania diagnoses in this sample precluded statistical analysis. the dsm - iv stipulates a period of depressed or irritable mood for a diagnosis of depression in youth. we generated subgroups among those who met overall criteria for depression based on the answers to questions in the depression section of the capa that focused on the presence of depressed mood (i.e., feeling unhappy, miserable, blue, low - spirited, being down in the dumps, or dejected ; daily total duration of at least 1 hour) and irritable mood (i.e., irritable mood present in at least 2 activities, with at least 1 instance of snappiness, shouting, or quarrelsomeness, and at least sometimes uncontrollable by child). depending on the answer to these questions, the following 3 groups were constructed among those with a diagnosis of depression : those with depressed mood only ; those with irritable mood only ; and those with both irritable and depressed mood. note that the rating is of a change in the child 's usual liability to be precipitated into anger, and in that sense assesses an episode of change in the child 's irritability, as stipulated by dsm - iv. more information on the assessment of irritable mood in the context of depression the capa can be found under http://devepi.duhs.duke.edu/library/pdf/depressive_disorders.pdf symptom counts of oppositional and conduct problems were generated by adding dsm - iv items. a scale of non - episodic irritability (range, 03) was created by summing the capa items from the odd section : losing temper, touchy or easily annoyed, and angry or resentful, as previously described. self - ratings of pubertal status were made using the tanner stage pictorial assessments of breast and pubic hair development, and menarche was also assessed by self ratings. tanner ratings are considered practical and valid alternatives to direct assessments by a clinician, and correlate well with physical examination based on tanner stages. with parental agreement. each child was provided with sex - appropriate schematic drawings and asked to rate their current status on each dimension ; the mean of the 2 ratings was used as an overall index of morphological development. for analytic purposes, tanner stages were dichotomized as prepuberty (stages i ii) and puberty (stages iii all associations reported in this article were tested using the survey (svy) commands in stata to adjust the standard errors of the parameter estimates for the stratified design effects. disorder status was derived by aggregating observations across 2 periods : adolescence (ages 916) and young adulthood (ages 1921). reported percentages are weighted as appropriate to take account of the sample design. as explained in the first paragraph of the results section, we compared 2 categories in statistical analyses : those participants who met criteria for depression, but did not have episodic irritability (depressed group) ; and those participants who met criteria for depression and experienced depressed as well as episodically irritable mood (depressed and irritable group). odds ratios and standard errors were derived from logistic regression models, with the dichotomous category of depressed versus depressed and irritable as the outcome, and the range of predictors required to test each hypothesis in this article. the great smoky mountains study (gsms) is a longitudinal study of the development of psychiatric disorders in rural and urban youth. a representative sample of 3 cohorts of children, aged 9, 11, and 13 years at intake, was recruited from 11 counties in western north carolina using a household equal probability, accelerated cohort design. the externalizing problems subscale of the child behavior checklist was administered to a parent of the first - stage sample (n = 3,896) as a screen. of the families contacted, 95% completed the telephone screen. as in other epidemiologic studies, the gsms used a screening - stratified sampling design to achieve the following 3 goals : to understand the developmental pathways of a large sample of children with a high need for mental health care (case finding) ; to estimate the prevalence of disorders and risk factors in the population (prevalence estimation) ; and to map the identified cases onto the general population (generalizability). a household sample would meet goal 2 but would need to be large (and expensive) to generate enough cases to meet goals 1 and 3. recruiting from service settings might achieve goal 1, but generalizability would be difficult to achieve because of referral bias and the fact that many children are seen in multiple service sectors. the oversampling strategy for gsms involved recruiting all subjects scoring in the top 25% on the screener and 1 in 10 of the remainder. the screening does not bias the sample, however, as each observation is weighted by the inverse of the selection probability. this weighting process also allows us to produce estimates representative of the population from which the sample was drawn. about 8% of the area residents and the sample are african american, and fewer than 1% are hispanic ; american indians make up only about 3% of the study area, but were oversampled to constitute 25% of the sample. of all youths recruited, 80% (n = 1,420) agreed to participate. n = 630). table 1 presents the study design and participation rates at each wave. as it shows, the 3 study cohorts (a, b, and c) spanned the age range from 9 to 13 years when the study started in 1993, and were followed up to ages 19 to 21 years, with an overall participation rate of approximately 80% thereafter. interviews were completed with the child and the child 's primary caregiver at their home or a convenient location until age 16 years, and with only the young adults thereafter. before the interviews began, interviewees signed informed consent forms approved by the duke institutional review board. this article presents data on 8,806 parent child pairs of interviews carried out across the age range of 9 through 21. all data on child and adolescent psychiatric disorders were derived from the child and adolescent psychiatric assessment (capa), which generates dsm - iv diagnoses. parent and child reports were combined using an either / or rule at the symptom level. in young adulthood, outcomes were derived from the young adult psychiatric assessment. the time frame for both interviews was the 3 months preceding the interview unless otherwise stated. we combined 3 depression categories into a single category : dsm - iv major depressive episode, dysthymia, and depression not otherwise specified (nos). we also focused on any anxiety disorder, oppositional defiant disorder (odd), and conduct disorder (cd). we did not follow the dsm rule of overriding a diagnosis of odd in people with cd, and therefore a subject could have both diagnoses. the small number of (hypo-) mania diagnoses in this sample precluded statistical analysis. the dsm - iv stipulates a period of depressed or irritable mood for a diagnosis of depression in youth. we generated subgroups among those who met overall criteria for depression based on the answers to questions in the depression section of the capa that focused on the presence of depressed mood (i.e., feeling unhappy, miserable, blue, low - spirited, being down in the dumps, or dejected ; daily total duration of at least 1 hour) and irritable mood (i.e., irritable mood present in at least 2 activities, with at least 1 instance of snappiness, shouting, or quarrelsomeness, and at least sometimes uncontrollable by child). depending on the answer to these questions, the following 3 groups were constructed among those with a diagnosis of depression : those with depressed mood only ; those with irritable mood only ; and those with both irritable and depressed mood. note that the rating is of a change in the child 's usual liability to be precipitated into anger, and in that sense assesses an episode of change in the child 's irritability, as stipulated by dsm - iv. more information on the assessment of irritable mood in the context of depression the capa can be found under http://devepi.duhs.duke.edu/library/pdf/depressive_disorders.pdf symptom counts of oppositional and conduct problems were generated by adding dsm - iv items. a scale of non - episodic irritability (range, 03) was created by summing the capa items from the odd section : losing temper, touchy or easily annoyed, and angry or resentful, as previously described. self - ratings of pubertal status were made using the tanner stage pictorial assessments of breast and pubic hair development, and menarche was also assessed by self ratings. tanner ratings are considered practical and valid alternatives to direct assessments by a clinician, and correlate well with physical examination based on tanner stages. with parental agreement. each child was provided with sex - appropriate schematic drawings and asked to rate their current status on each dimension ; the mean of the 2 ratings was used as an overall index of morphological development. for analytic purposes, tanner stages were dichotomized as prepuberty (stages i ii) and puberty (stages iii all associations reported in this article were tested using the survey (svy) commands in stata to adjust the standard errors of the parameter estimates for the stratified design effects. disorder status was derived by aggregating observations across 2 periods : adolescence (ages 916) and young adulthood (ages 1921). reported percentages are weighted as appropriate to take account of the sample design. as explained in the first paragraph of the results section, we compared 2 categories in statistical analyses : those participants who met criteria for depression, but did not have episodic irritability (depressed group) ; and those participants who met criteria for depression and experienced depressed as well as episodically irritable mood (depressed and irritable group). odds ratios and standard errors were derived from logistic regression models, with the dichotomous category of depressed versus depressed and irritable as the outcome, and the range of predictors required to test each hypothesis in this article. between ages 9 and 16 years, there were 179 observations for the 140 individuals who met dsm - iv criteria for depression at any given 3-month period, yielding a 3-month prevalence of 2.2%. among these cases, depressed mood was the most common cardinal mood state (58.7% of all subjects with a diagnosis of depression), followed by mixed depressed and irritable mood (35.6% of all subjects with a diagnosis of depression). only a small minority of participants (5.7% of all subjects with depression) had irritable mood only. therefore, all subsequent analyses in this article concern the distinction is between the depressed and the depressed and irritable group ; for the small irritable group we present descriptive data only. as shown in figure 1, mood state profiles differed markedly by gender : most depressed girls were in the depressed group, whereas most depressed boys were in the depressed and irritable group (or = 4.26, se = 2.32, p =.008). girls made up the majority (78.1%) of the depressed group, whereas boys were the majority in the depressed and irritable group (54.4%) and the irritable group (73%). given these differences, all further analyses tested for gender interaction effects, and any main effects were adjusted for gender. the mean age of participants was not significantly different between the 2 groups (depressed : 14.1 years, se=0.22 versus depressed and irritable : 14.0 years, se = 0.35 ; or = 1.1, se = 0.13, p = 0.48) and there was no gender by age interaction (f1, 132 = 0.84, p =.36). the mean age in the irritable group was 14.0 years (se = 0.57). tanner stage differences between the 2 groups (75.4% pubertal in the depressed versus 82.4% pubertal in the depressed and irritable) were not significant ; however, the age - adjusted odds ratio (or = 3.83, se = 2.99, p =.09) suggested that, if anything, those in the depressed and irritable group may have been more likely to be in puberty. the relationship between the 2 depression types and tanner stage was not moderated by gender (adjusted wald test : f1, 99 = 0.07, p =.79). in the irritable group mean age at menarche was not significantly different between girls in the 2 groups : (depressed : 12.4, se = 0.40 versus depressed and irritable : 11.7, se = 0.43, or = 0.66, se = 0.27, p =.32). age at menarche in the irritable group was 11.6 (se = 0.17). the 2 groups did not differ significantly in mean age at onset of depression (depressed : 13.4 years, se = 0.23, versus depressed and irritable : 12.3 years, se = 0.54, or = 0.85, se = 0.09, p =.16, adjusted for gender) and there was no significant gender - by - age at onset interaction (f1,132 = 0.98 ; p =.32). the mean age at onset of depression in the irritable group was 12.6 years (se = 0.92). there was no significant difference in the total score of dsm - iv depressive symptoms (excluding depressed or irritable mood) (depressed : 2.7 se = 0.13, versus depressed and irritable : 2.9, se = 0.19, or = 1.28, se = 0.28, p =.27 ; adjusted for gender), and there was no significant gender - by - number of depressive symptoms interaction (f1,132 = 0.0 ; p =.99). the mean total score of children with dsm - iv depressive symptoms in the irritable group was 3.1 (se = 0.45). the 2 groups did not differ significantly in the number of depressive episodes experienced (depressed, 1.8, se = 0.19 versus depressed and irritable : 1.5, se = 0.16, or = 0.91, se = 0.22, p =.69, adjusted for gender), and there was no significant gender - by - age at onset interaction (f1,132 = 0.08 ; p =.78). the mean number of depressive episodes in the irritable group was 1.3 (se = 0.20). in terms of symptom patterns, only sleep problems (insomnia or hypersomnia) distinguished between the 2 groups (depressed 10.7% versus depressed and irritable 38.6%, or = 4.6, se = 3.18, p =.029 ; adjusted for gender), but there were no significant gender by sleep problems interaction (f1,132 = 0.96 ; p =.33). there were no other significant differences between the 2 groups or interactions of symptoms by gender for any of the other depression symptoms, including anhedonia and suicidality. the depressed and irritable group showed a higher rate of co - occurrence with disruptive disorders, as shown in table 2. there was a significantly higher proportion of young persons with odd in the depressed and irritable group compared to the depressed group (or = 5.37. se = 3.64, p =.014 ; adjusting for gender) ; the gender - by - odd interaction effect was not significant (f1,132 = 0.21, p =.65). as shown in table 2, the relationship of cd with the 2 depression groups was moderated by gender (f1,132 = 4.66, p =.03). among girls, there was a significantly higher proportion of cd comorbidity in those with depression and irritability compared to those with depression only, but this was not true in boys. rates of comorbid disruptive disorders in the irritable group were high : the majority (79%) met criteria for odd, and 21% for cd. there were no significant differences in the comorbidity between anxiety and depression types, and the gender - by - anxiety interaction effect was not significant (f1, 132 = 0.44, p =.51). in addition, to examining the overlap between the 2 groups, we also sought to establish the differences between the 2 groups using a dimensional approach. we therefore examined differences between the 2 groups with regard to symptom counts of conduct and oppositional problems. as can be seen in figure 2, the depressed and irritable group showed significantly higher counts of oppositional symptoms than the depressed group (or = 1.85, se = 0.27, p <.001 ; adjusted for gender) ; the interaction effect between gender and oppositional symptoms was not significant (f1,132 = 2.39, p =.12). the relationship between the 2 depression groups and conduct symptoms was moderated by gender, similar to the findings for the categorical variable of conduct disorder. as shown in figure 2, girls in the depressed and irritable group had higher scores than girls in the depressed group ; however there was no difference between the 2 groups for boys. the interaction effect between gender and conduct symptoms was significant (f1,132 = 4.46, p =.04). we also examined whether the 2 depression groups differed on a count of chronic irritability symptoms derived from odd. there was no significant difference between the depressed and irritable group and the depressed group (mean = 1.54, se = 0.32, versus mean = 0.81, se = 0.20 ; or = 1.77, se = 0.63, p =.111) ; the interaction effect between chronic irritability and gender was not significant (f1,131 = 0.03 ; p =.87). the mean level of chronic irritability in the irritable group was 1.80 (se = 0.22). longitudinal analyses highlighted continuity in depression sub - types between childhood / adolescence (ages 916 years) and young adulthood (ages 1921 years). of 17 participants in the depressed group at ages 9 to 16 years who also experienced depression at ages 19 to 21, 15 (88%) were also classified in the depressed group at follow - up, and only 2 participants transitioned into the depressed and irritable group. similarly, of the 10 participants from the depressed and irritable at ages 9 to 16 who also experienced depression at ages 19 to 21, 7 (70%) remained in the depressed and irritable group. this stability of type was significant (or = 34.0, se = 45.29, p <.01). in the irritable group, the only participant to experience a depressive episode in the age 1921 group was classified in the depressed group. between ages 9 and 16 years, there were 179 observations for the 140 individuals who met dsm - iv criteria for depression at any given 3-month period, yielding a 3-month prevalence of 2.2%. among these cases, depressed mood was the most common cardinal mood state (58.7% of all subjects with a diagnosis of depression), followed by mixed depressed and irritable mood (35.6% of all subjects with a diagnosis of depression). only a small minority of participants (5.7% of all subjects with depression) had irritable mood only. therefore, all subsequent analyses in this article concern the distinction is between the depressed and the depressed and irritable group ; for the small irritable group we present descriptive data only. as shown in figure 1, mood state profiles differed markedly by gender : most depressed girls were in the depressed group, whereas most depressed boys were in the depressed and irritable group (or = 4.26, se = 2.32, p =.008). girls made up the majority (78.1%) of the depressed group, whereas boys were the majority in the depressed and irritable group (54.4%) and the irritable group (73%). given these differences, all further analyses tested for gender interaction effects, and any main effects were adjusted for gender. the mean age of participants was not significantly different between the 2 groups (depressed : 14.1 years, se=0.22 versus depressed and irritable : 14.0 years, se = 0.35 ; or = 1.1, se = 0.13, p = 0.48) and there was no gender by age interaction (f1, 132 = 0.84, p =.36). the mean age in the irritable group was 14.0 years (se = 0.57). tanner stage differences between the 2 groups (75.4% pubertal in the depressed versus 82.4% pubertal in the depressed and irritable) were not significant ; however, the age - adjusted odds ratio (or = 3.83, se = 2.99, p =.09) suggested that, if anything, those in the depressed and irritable group may have been more likely to be in puberty. the relationship between the 2 depression types and tanner stage was not moderated by gender (adjusted wald test : f1, 99 = 0.07, p =.79). in the irritable group mean age at menarche was not significantly different between girls in the 2 groups : (depressed : 12.4, se = 0.40 versus depressed and irritable : 11.7, se = 0.43, or = 0.66, se = 0.27, p =.32). age at menarche in the irritable group was 11.6 (se = 0.17). the 2 groups did not differ significantly in mean age at onset of depression (depressed : 13.4 years, se = 0.23, versus depressed and irritable : 12.3 years, se = 0.54, or = 0.85, se = 0.09, p =.16, adjusted for gender) and there was no significant gender - by - age at onset interaction (f1,132 = 0.98 ; p =.32). the mean age at onset of depression in the irritable group was 12.6 years (se = 0.92). there was no significant difference in the total score of dsm - iv depressive symptoms (excluding depressed or irritable mood) (depressed : 2.7 se = 0.13, versus depressed and irritable : 2.9, se = 0.19, or = 1.28, se = 0.28, p =.27 ; adjusted for gender), and there was no significant gender - by - number of depressive symptoms interaction (f1,132 = 0.0 ; p =.99). the mean total score of children with dsm - iv depressive symptoms in the irritable group was 3.1 (se = 0.45). the 2 groups did not differ significantly in the number of depressive episodes experienced (depressed, 1.8, se = 0.19 versus depressed and irritable : 1.5, se = 0.16, or = 0.91, se = 0.22, p =.69, adjusted for gender), and there was no significant gender - by - age at onset interaction (f1,132 = 0.08 ; p =.78). the mean number of depressive episodes in the irritable group was 1.3 (se = 0.20). in terms of symptom patterns, only sleep problems (insomnia or hypersomnia) distinguished between the 2 groups (depressed 10.7% versus depressed and irritable 38.6%, or = 4.6, se = 3.18, p =.029 ; adjusted for gender), but there were no significant gender by sleep problems interaction (f1,132 = 0.96 ; p =.33). there were no other significant differences between the 2 groups or interactions of symptoms by gender for any of the other depression symptoms, including anhedonia and suicidality. the depressed and irritable group showed a higher rate of co - occurrence with disruptive disorders, as shown in table 2. there was a significantly higher proportion of young persons with odd in the depressed and irritable group compared to the depressed group (or = 5.37. se = 3.64, p =.014 ; adjusting for gender) ; the gender - by - odd interaction effect was not significant (f1,132 = 0.21, p =.65). as shown in table 2, the relationship of cd with the 2 depression groups was moderated by gender (f1,132 = 4.66, p =.03). among girls, there was a significantly higher proportion of cd comorbidity in those with depression and irritability compared to those with depression only, but this was not true in boys. rates of comorbid disruptive disorders in the irritable group were high : the majority (79%) met criteria for odd, and 21% for cd. there were no significant differences in the comorbidity between anxiety and depression types, and the gender - by - anxiety interaction effect was not significant (f1, 132 = 0.44, p =.51). in addition, to examining the overlap between the 2 groups, we also sought to establish the differences between the 2 groups using a dimensional approach. we therefore examined differences between the 2 groups with regard to symptom counts of conduct and oppositional problems. as can be seen in figure 2, the depressed and irritable group showed significantly higher counts of oppositional symptoms than the depressed group (or = 1.85, se = 0.27, p <.001 ; adjusted for gender) ; the interaction effect between gender and oppositional symptoms was not significant (f1,132 = 2.39, p =.12). the relationship between the 2 depression groups and conduct symptoms was moderated by gender, similar to the findings for the categorical variable of conduct disorder. as shown in figure 2, girls in the depressed and irritable group had higher scores than girls in the depressed group ; however there was no difference between the 2 groups for boys. the interaction effect between gender and conduct symptoms was significant (f1,132 = 4.46, p =.04). we also examined whether the 2 depression groups differed on a count of chronic irritability symptoms derived from odd. there was no significant difference between the depressed and irritable group and the depressed group (mean = 1.54, se = 0.32, versus mean = 0.81, se = 0.20 ; or = 1.77, se = 0.63, p =.111) ; the interaction effect between chronic irritability and gender was not significant (f1,131 = 0.03 ; p =.87). the mean level of chronic irritability in the irritable group was 1.80 (se = 0.22). longitudinal analyses highlighted continuity in depression sub - types between childhood / adolescence (ages 916 years) and young adulthood (ages 1921 years). of 17 participants in the depressed group at ages 9 to 16 years who also experienced depression at ages 19 to 21, 15 (88%) were also classified in the depressed group at follow - up, and only 2 participants transitioned into the depressed and irritable group. similarly, of the 10 participants from the depressed and irritable at ages 9 to 16 who also experienced depression at ages 19 to 21, 7 (70%) remained in the depressed and irritable group. this stability of type was significant (or = 34.0, se = 45.29, p <.01). in the irritable group, the only participant to experience a depressive episode in the age 1921 group was classified in the depressed group. irritability has long been recognized as a concomitant mood state in people with depression, and the dsm - iv and dsm-5 grant episodic irritability the same status as depressed mood as a cardinal mood symptom in the diagnosis of depression in youth. to our knowledge, however, this is the first study to provide empirical data from a general population sample on the prevalence and correlates of irritability in depressed youth, and on how it may influence clinical course. the first aim of this study was to estimate the prevalence of irritability in community - ascertained cases of depression, and to examine its basic demographic and developmental correlates. our data show that irritability is common in depression, occurring in more than one - third of cases, in keeping with reported rates from an adult community sample. our data also show, however, that irritability rarely occurs in the absence of low mood, also in keeping with results from a community sample in adults. this suggests that very few late - childhood and adolescent cases of depression would be lost to ascertainment if irritability were not allowed as a cardinal symptom of depression. a further implication of this pattern was that the irritable group was too small to analyze statistically. in the discussion below, we thus focus primarily on comparisons between the depressed and the depressed and irritable groups, and highlight the most notable findings from the irritable group as appropriate. depressed boys were significantly more likely to present with irritability than depressed girls, and boys were the majority of the depression with irritability group, whereas girls were more likely to present with depression without irritability. also, in contrast to what one would be led to expect by the stipulation of the dsm - iv and dsm-5, children in the depressed and irritable group were at a similar developmental stage compared with those in the depressed group : if anything, the results suggested that those in the depressed and irritable group were at a more advanced developmental stage. our second aim was to test a set of hypotheses, based on previous findings in adults, that children with depression and irritability experience a more severe form of the illness that starts earlier in life and shows higher rates of comorbidities with other disorders, particularly externalizing disorders. the 2 groups did not differ in overall depression severity, as measured by total number of symptoms. also, the pattern of depressive symptoms was similar for the 2 groups ; only the symptom of sleep problems was significantly more common in the depressed and irritable compared to the depressed group. although this finding will require replication, it may be relevant that sleep problems have been suggested to lead to or aggravate irritability and externalizing behaviors in children. there were also no differences in age at onset of depression between the 2 groups. consistent with our hypothesis, however, we found that children with depression and irritability were more likely to experience comorbid disruptive disorders : in particular, odd was significantly more common in the depressed and irritable group, compared to the depressed group. similarly, there was a very high rate (79%) of comorbidity with odd in the irritable group. the pattern of association of cd with the 2 depression groups was significantly moderated by gender, in that, among girls, there was a significantly higher proportion of cd comorbidity in the depressed and irritable group compared to those in the depressed group, but this was not true in boys. a similar pattern of results was obtained when symptom scores instead of diagnoses were used to compare the 2 groups. the main clinical implication of this finding is that young persons presenting with depression and irritability are at high risk for disruptive disorders. gender paradox effect in the comorbidity between depression and conduct problems. according to this notion, girls high on conduct problems would be more likely to have comorbid depressive problems. our data suggest that high comorbidity levels with conduct problems are specific to those in the depressed and irritable group. this finding also has potential implications for the recognition of depression : clinicians may miss cases of depression if they do not look out for other mood disorder symptoms in patients who present with irritability. we found that chronic irritability, as ascertained through odd symptoms, was significantly more common in boys, but not girls, in the depressed and irritable group, compared to the depressed group. clearly, although the 2 irritability constructs are related, they tap meaningfully different dimensions. future research should examine the commonalities and distinctions between these 2 forms of irritability, as part of a more general question concerning the classification of mood according to its duration. it is notable that the 2 groups did not differ in their comorbidity with anxiety. this is in contrast to findings from the analysis of the sequenced treatment alternatives to relieve depression (stard) in adults, in which those presenting with irritability were significantly more likely also to experience comorbid anxiety. we must await further studies to determine whether this discrepancy is attributable to the different ascertainment of the 2 samples (epidemiological versus treatment - seeking), the differing age groups involved (916 versus 1875 years), or other factors. our third aim was to examine the longitudinal course of depression with and without irritability in youth. we tested the hypothesis that depression and irritability would show homotypic continuity : that is, if they showed depression later in development, depressed children with irritability would be more likely to continue to show we found that each group showed homotypic continuity : those with depression and irritability at time 1 (ages 916 years) were significantly more likely to continue with depression and irritability at time 2 (ages 1921 years), whereas those with pure depression were more likely to continue with pure depression. the first question is whether it is justified to retain irritability as a cardinal mood in young people 's depression. our data suggest that very few cases of depression would be missed because of presenting with irritability (rather than depressed mood) as the only cardinal mood symptom. moreover, the vast majority of individuals in the irritable group experienced odd comorbidity, suggesting that they would be unlikely to remain undiagnosed. from the perspective of case ascertainment, there is therefore no compelling reason to retain irritability as an alternative cardinal mood symptom. our data also show that children in the depressed and irritable group were at a similar developmental stage to those in the depressed group, arguing against the notion that irritable mood should be regarded an early manifestation of depression. indeed, the overall picture that has emerged is that the relationship between irritability and depression in youth is very similar to that seen in adulthood, so there seems to be little reason why there should be a the second nosologic question prompted by these findings is whether irritability may indicate a distinct subtype of depression. several suggestions have been made in the past about depression subtypes (e.g., endogenous or melancholic depression), but the evidence for the distinctiveness of such subtypes has been mixed. moreover, debates about what constitute distinct nosologic types or subtypes depends on a number of factors, including conceptual, statistical (whether one considers continua or categorical cut - offs), and practical considerations. we found no evidence of a distinctive symptom profile or of a difference in severity (symptom load) in those individuals with irritability compared to those without. however, as noted above, there were significantly more boys in those with irritability, and both boys and girls in this group showed higher rates of externalizing disorders. moreover, there was evidence for some continuity of subtype, in that individuals with depression and irritability were more likely to continue experiencing depression with irritability. there may, however, be conceptual reasons to do so. clinical observation and first - person experience (the experience of one 's own mood) suggests that irritability is a mood distinct from depression, although the 2 have long been known to co - occur in the same individuals. this close yet ambiguous relationship between the 2 phenotypes is also reflected in much of the psychological literature about personality : the dimension of negative affectivity is often used to denote a spectrum of so - called aversive emotions that includes both anger (the hallmark of irritability) and sadness (the hallmark of depression). however, another related strand of psychological literature distinguishes between irritability on the one hand and sadness on the other along a dimension of approach withdrawal. this distinction resonates with clinical observations about the possible consequences of an irritable state of mind (e.g., fighting with others) as opposed to those of depressed mood (e.g., reduced activity and motivation). it is possible that distinguishing between specific mood states may help to optimize treatment ; although there is also evidence that existing treatments may work for both sad as well as irritable mood. in epidemiologic studies, non - episodic irritability in youth is a predictor of new - onset depression even into adulthood. in twin studies, depression and non - episodic irritability have been shown to share a significant proportion of genetic risks but to differ with respect to unique (i.e., nonshared) environments. the extent to which these findings also apply to the distinction between the 2 groups presented in this article should be further examined. this is particularly relevant, given the introduction into the dsm-5 of disruptive mood dysregulation disorder, a new category to capture severe irritability. the third nosologic question arising as a result of these data is whether irritability should be retained as a symptom criterion of depression at all : should future classifications perhaps drop episodic irritability from the list of symptoms in depression ? we have shown that the symptom of episodic irritability is an indicator of depression in boys and of disruptive behavior comorbidity, information that could be useful to clinicians. these results would argue for keeping irritability as a symptom criterion, at least until a more satisfactory solution to the classification of irritable mood has been reached. first, the available numbers were small, and some of the analyses may have therefore been underpowered. second, the youngest children in this study were 9 years old, and it is possible that irritability is more common and a more characteristic mood state of depression in younger children. further studies that include younger children, including preschoolers, are required to clarify this. third, from a life - course perspective, our sample consists entirely of early - onset cases, limiting the inferences that this study can draw about later - onset depression. fourth, the ascertainment period for depressive episodes was the past 3 months at any given time point of the study. this means that we may have underestimated the total number of depressive episodes overall, although it is unlikely to have biased the comparison between the 2 groups. finally, this study used an in - depth assessment of depressive symptoms according to dsm - iv, but not an exhaustive list of items potentially important to characterize the multivariate structure of depression. this study also has several strengths, including a community sample, in - depth assessment of psychiatric diagnoses, and developmental information in a longitudinal design. in conclusion, our study is, to our knowledge, the first to test the dsm notion that irritability should be treated as a cardinal mood criterion in youth. we found very little support for granting irritability the same status as low mood in the diagnosis of depression ; however, our findings also emphasize the clinical and possible etiological significance of recognizing its presence in depressed youth.clinical guidancedsm - iv and dsm-5 grant episodic irritability an equal status to low mood as a cardinal criterion for the diagnosis of depression in youth ; however, evidence for irritability as a major criterion of depression in youth is lacking.in our community sample of 9- to 16-year - olds, the vast majority of depressed young people with episodic irritability also had low mood. moreover, irritability was no more common in younger than in older depressed youth.depressed boys were significantly more likely to present with episodic irritability than depressed girls, and irritability identified a group of depressed youth at particularly high risk for disruptive behavior disorders.these findings argue in favor of retaining episodic irritability as a symptom criterion, but not as a cardinal mood, in youth depression. the presence of episodic irritability should alert clinicians to the possibility of depression, particularly in boys and it is an indicator of comorbidity with conduct and oppositional problems. dsm - iv and dsm-5 grant episodic irritability an equal status to low mood as a cardinal criterion for the diagnosis of depression in youth ; however, evidence for irritability as a major criterion of depression in youth is lacking.in our community sample of 9- to 16-year - olds, the vast majority of depressed young people with episodic irritability also had low mood. moreover, irritability was no more common in younger than in older depressed youth.depressed boys were significantly more likely to present with episodic irritability than depressed girls, and irritability identified a group of depressed youth at particularly high risk for disruptive behavior disorders.these findings argue in favor of retaining episodic irritability as a symptom criterion, but not as a cardinal mood, in youth depression. the presence of episodic irritability should alert clinicians to the possibility of depression, particularly in boys and it is an indicator of comorbidity with conduct and oppositional problems. dsm - iv and dsm-5 grant episodic irritability an equal status to low mood as a cardinal criterion for the diagnosis of depression in youth ; however, evidence for irritability as a major criterion of depression in youth is lacking. in our community sample of 9- to 16-year - olds, the vast majority of depressed young people with episodic irritability also had low mood. moreover, irritability was no more common in younger than in older depressed youth. depressed boys were significantly more likely to present with episodic irritability than depressed girls, and irritability identified a group of depressed youth at particularly high risk for disruptive behavior disorders. these findings argue in favor of retaining episodic irritability as a symptom criterion, but not as a cardinal mood, in youth depression. the presence of episodic irritability should alert clinicians to the possibility of depression, particularly in boys and it is an indicator of comorbidity with conduct and oppositional problems. | objectivedsm - iv grants episodic irritability an equal status to low mood as a cardinal criterion for the diagnosis of depression in youth, yet not in adults ; however, evidence for irritability as a major criterion of depression in youth is lacking. this article examines the prevalence, developmental characteristics, associations with psychopathology, and longitudinal stability of irritable mood in childhood and adolescent depression.methoddata from the prospective population - based great smoky mountains study (n = 1,420) were used. we divided observations on 9- to 16-year - olds who met criteria for a diagnosis of depression into 3 groups : those with depressed mood and no irritability, those with irritability and no depressed mood, and those with both depressed and irritable mood. we compared these groups using robust regression models on adolescent characteristics and early adult (ages 1921 years) depression outcomes.resultsdepressed mood was the most common cardinal mood in youth meeting criteria for depression (58.7%), followed by the co - occurrence of depressed and irritable mood (35.6%) ; irritable mood alone was rare (5.7%). youth with depressed and irritable mood were similar in age and developmental stage to those with depression, but had significantly higher rates of disruptive disorders. the co - occurrence of depressed and irritable mood was associated with higher risk for comorbid conduct disorder in girls (gender - by - group interaction, f1,132 = 4.66, p =.03).conclusionsour study findings do not support the use of irritability as a cardinal mood criterion for depression. however, the occurrence of irritability in youth depression is associated with increased risk of disruptive behaviors, especially in girls. |
in an ageing society there are substantial regional variations in terms of the number of elderly people in relation to people of working age. this has led to a concern about potential future support rates on local and regional level. alongside the uneven geographical distribution of the elderly versus younger individuals, there are also regional variations to the access of local family networks among the elderly when comparing urban and rural areas. the need for formal care is potentially higher if there is less informal care, and in regions where few elderly have a local family network, pressure increases on the public sector to provide support. sweden is known to be a strong welfare state, but the ageing population is putting a strain on public sector provision of care. it has been claimed that elderly care is in a process of re - familisation where families need to step in when the tax - paid elderly care is declining (sundstrm. the issue of local family networks is not only relevant in relation to elderly care, but are a potential resource for both older and younger generations (hjlm 2011 ; mulder and van der meer 2009). this study focuses on the regional differences of proximity between family members and the demographic processes that produce geographic variation in access to local family networks among the elderly. it pays special attention to how this pattern is shaped by migration and non - migration. thereby this study adds to the literature on how family geographies evolve as an outcome of mobility (duncan and smith 2002 ; smith 2011). in this case, the family landscape described includes family members outside of the household, across generations. the geographical distance between family members is the result of accumulated migration and non - migration for all generations throughout the lifespan, a consequence of family members staying close, moving away or moving closer to one another. young people are more mobile than older people and the highly educated are also more migratory. the migration pattern on an aggregated level makes an imprint on family structures on the regional level. for instance, the typical pattern for urbanization involves older generations staying in rural areas while the younger generations start their families in an urban area. for the next generation, those born in the urban areas changes in population settlement patterns influence what we can expect from the future density of local family networks, and hence access to family support networks. the empirical study in this paper is based on swedish register data, covering the total population, where it is possible to identify family networks in their geographical context on various geographic scales, down to neighbourhood level. in the data it is possible to identify the residential location of parents, children and siblings, including in - laws in terms of partner s parents and siblings. the aim of this study is to describe regional disparities in the access to local family networks, through studying a snapshot of the extended family networks of 60-year olds in sweden.. additionally, this paper aims to analyse this pattern as an outcome of long - distance migration processes. this paper poses the following research questions : what access do people have to local family networks in rural and urban regions in sweden ? the informal support that families provide is important for the well - being of both the older and younger generations (bengtson 2001). the local family network should be seen as a resource for all ages in which the elderly members make a significant contribution. studies in sweden and in europe have shown that the older generation provides more financial and functional support to the younger generation, rather than the other way around (albertini. although sweden is known to have a strong welfare state, informal support is an important addition to the formal support provided by the welfare state in terms of the care provided to the elderly, the sick, and towards the care of children (sundstrm,. geographical proximity is an important factor for the frequency of family contact and support (rainer and siedler 2012 ; scharf 2001). intergenerational exchanges are not necessarily extensive in one cross section of life, but rather in a life course perspective. parents and children are sensitive to each other s needs and will help when those needs arise, such as during important instances like divorce, widowhood, and sickness (chan and ermisch 2011). help is often temporary but could be very important during a specific passage in life. chan and ermish emphasise that the latent family support should not be neglected and that geographic proximity is crucial. the family network changes over the life - course, individuals are not only affected by their own life - course events but also events in the family. it is therefore valuable to adopt what elder calls afamily life - course perspective where the linked lives of family members are taken into consideration (elder 1994). households are formed and in - laws become new additions to families, and in some cases households and extended families are dissolved by separation and divorce. in addition to these transformations in the family network, the geography of the network can be modified by migration when family members move closer or further apart. despite all these potential adjustments, which can be fundamental and dramatic events for the individual the focus for this paper is an age group in a phase of life with relatively modest changes in their family networks, especially when considering geographical proximity (svensson., family life course and the timing of women s retirement - a sequence analysis approach. population, space and place, (forthcoming)). several studies have explored the geographical distances between the elderly and their adult children, (fors and lennartsson 2008 ; hank 2007 ; malmberg and pettersson 2008 ; michielin and mulder 2007 ; van der pers and mulder 2013). there is also now growing literature on the role of siblings (blaauboer. although siblings often do nt have daily contact, they are life long, permanent members of each other s family networks and can potentially step in as an important source for support and companionship in various phases of the life course. giving and receiving support from siblings can reduce loneliness in middle and old age (de jong gierveld and dykstra 2013). however, there are also findings that suggest that people who have experienced more severe life events such as abuse, mental problems or addiction have less contact and exchanges with their siblings (voorpostel,. 2012). besides studies on the divergent demographic structures in rural and urban regions in an ageing population (eg. walford and kurek 2008), there are also studies on how the experience of growing old varies between living conditions in different geographic contexts. these often have a focus on health and health care provision for the elderly in rural and urban contexts (eg. with regards to the elderly and their families in rural areas, there are (at least) two contradictory views. on the one hand is what wenger (2001) calls a myth about a strong traditional family bond in rural areas, where the elderly are expected to have a more intimate relationship to their family members in rural areas compared to more individualistic life in urban areas. on the other hand there is a discussion about the elderly left behinds in rural areas, whose local family network is weakened by the migration of the younger generation. studies of elderly left behinds are often situated in the developing world, where children have migrated as part of a national urbanization process or an international migration process (he and ye 2013 ; knodel and saengtienchai 2007 ; vullnetari and king 2008). wenger did not (2001) find evidence that networks are stronger in rural areas in the uk, and according to scharf (2001), intergenerational relations are characterised by frequent contact in both rural and urban regions in germany. migration patterns are reflected in the configuration of family networks and shape structural and regional differences in the family landscape. for example, the typical urbanization process is when the younger generation moves into cities while the older generation remains in the countryside. this study, however, covers different spatial contexts since family networks are not only important in rural areas s mulder and van der meer (2009) point out, family support is important for people in both urban and rural areas. therefore there is interest in investigating the urban context and the extent to which people that were born in cities live close to their family. van der pers and mulder (2013) found that parents living in urban areas are more likely to live close to their adult children compared to parents in more rural areas in the netherlands. similar results have has been found in sweden by malmberg and pettersson (2008) suggesting that it is more common for elderly people living in rural areas to live far from their children while elderly city dwellers are more likely to have children living in the same region. however, when parents and children live in the same region, those in rural areas will live closer to each other when compared to urbanites (ibid.). malmberg and pettersson also shows how urbanization has made a long - term imprint on the intergenerational distances between cohorts, where urbanization generation ends up far away from their parents while younger generations are living with a shorter distance to their parents. thus, this study further develops malmberg and petterson s study by including a larger family network that includes siblings and the partner s family. the current study could thereby contribute to an increased knowledgebase of the geographical contexts of family networks and the characteristics of regions with dense and less dense family networks. migration research recognises that family members can serve as attractions for migration. compared to other european countries, the welfare system in the nordic countries makes individuals less dependent on family for care and support. there are studies that suggest that location decisions and care giving choices are less associated with family structure in the nordic countries as compared to other countries in europe (rainer and siedler 2012). there are, however surveys indicating that moving closer to family and friends is a frequent motive for internal migration in sweden (lundholm. adult children tend to move closer to their parents when they themselves have children (pettersson and malmberg 2009). this can be seen as an example of family networks that have an important function for young families and serve as a resource. geographic proximity of family networks evolves, however, not through migration but through non - migration (hjlm 2011). it can be an active choice to live near your family because you highly value the proximity to your family or you are dependent on the support provided by family. staying close to family can also be something you feel compelled to do because of loyalty or expectations from family members. staying close may also be less of an active choice and more a result of circumstances. adult children may have never had reason to move, for example, after school they got a job right in the local community. moving always involves a cost and a risk, so it may be more rational to stay. one factor that prevents migration is insider advantages which develop in one s hometown through local knowledge and social networks (fischer and malmberg 2001). although the shaping of the family landscape is mainly the result of migration at a young age, such as the relocation that the current 60-year - olds did thirty or forty years ago, it also includes the migration that their children did at young ages, and the proximity of family members could also be a product of mobility at a later stages. however, the elderly are less likely to move home compared to younger people, and also for moving partly because of other reasons. a key motive for migration in this age group is to live closer to kin (bell and rutherford 2013 ; pettersson and malmberg 2009). retirees are an example of a group that have a higher propensity to choose rural areas as compared to others (friedrich and warnes 2000 ; stockdale 2006). migration which involves moving back to one s birthplace is also a recognised type of migration for this age group (lundholm 2012a, b). the data used in the empirical study are swedish register data from statistics sweden available through the linnaeus database located at the centre for population studies at ume university. it includes all 60-year - olds residing in sweden in the years 20052009 (cohorts born 19451949). register it is possible to link the individuals to adult children, partners, parents and siblings if they are residing in sweden during the year of study. the linkage is very reliable for all persons born after 1932 in sweden (95100 %), including both biological and adopted children. linkage of foreign born persons depends on age at immigration and if the families arrived together. parents and children are linked if children were under age 19 at the time of immigration (statistics sweden 2010). via this link the localization of the relatives can be used to calculate the distance between the 60-year olds and their relatives. in the database, the threshold of 50 km euclidian distance was chosen as a cut - off as it can be regarded as a distance that allows for daily interaction. the age of 60 has been chosen because by that age most of the children are in their late twenties and thirties and have left their most mobile period. after 30, migration propensity decreases significantly (lundholm 2007). at the same time, it is still common for 60 year - olds to have a living parent and siblings. in order to capture the intergenerational characteristics of local networks, two indicators of presence for parents first, the location of any living parent (or parent in - law) of the sixty - year old., secondly the location of the parent the year of their passing going back 7 years in order to see if the present location of the 60 year old is the location where the parent lived at the time of their passing. this study is designed to capture family network proximity over three generations : i) own generation including siblings and partner s siblings, ii) older generation, including parents and partners parents and, iii) younger generation including adult children. the study of density of family networks in these three dimensions could be related to general patterns of urbanization and counter - urbanization. in line with the purpose of the study : to explore how family geographies evolve as an outcome of mobility with special attention to how this pattern is shaped by migration and non - migration, the following classification is developed and used:[dense ] dense local network in older and younger generations, children and parents and/or siblings[left behinds ] dense local network in own and/or older generation but children far away[settlers ] no local family network in own and/or parents generation but close to children[solitary ] no local family network (children far away)[childless / solitary ] no children, no local family network[childless / dense ] no children, local family network in own and/or older generation [dense ] dense local network in older and younger generations, children and parents and/or siblings [left behinds ] dense local network in own and/or older generation but children far away [settlers ] no local family network in own and/or parents generation but close to children [solitary ] no local family network (children far away) [childless / solitary ] no children, no local family network [childless / dense ] no children, local family network in own and/or older generation the distribution of 60-year olds in these categories was aggregated to municipalities (n = 290). the municipalities are divided into ten categories according to the definition by the swedish association of local authorities, based on structural parameters such as population density, commuting patterns and economic structure. the density of family networks differs considerably across sweden (fig. 1). there is a clear tendency that the local networks are denser (including kin in both older / own generation and younger) in the metropolitan regions while local family networks are much sparser in the depopulated regions in the north west. there are also pockets of localities where a smaller proportion of the 60-year - olds have a dense family network. these are both regions that have suffered from depopulation such as the inner parts of southern sweden or the manufacturing areas of mid - sweden. also, amenity - rich locations on the islands of land and gotland and eastern part of skne in the south are areas where a significant proportion of the 60-year olds lack a local family network, supposedly because they have moved to the region, away from their kin.fig. 1density map of family networks for 60-year olds in sweden density map of family networks for 60-year olds in sweden notably there are also significant variations on a much smaller scale, down to the neighbourhood level (fig. 2). in the stockholm area we see neighbourhoods where almost all 60-year olds have family members in younger and older generations within 50 km, while a neighbouring area is inhabited by 60 year olds where the majority does not have such dense networks. some areas with less dense family networks include suburbs with a high share of immigrants. there is a strong correlation between share of immigrants in the neighbourhoods1 and share of persons with dense networks (r = 0.19). this could be explain the lack of family listed in the registers but also reflects a real lack of local family networks. the reason why fewer immigrants have dense family networks in both older and younger generations is mainly an effect of absent parents and siblings, while the difference when it comes to proximity to adult children is much smaller between swedish born and immigrants (74 % compared to 71 %). in the wealthiest suburbs, like tby, danderyd and liding, inhabitants tend to be rich, not only in terms of economic capital, but also in term of access to dense local family networks.fig. 2density map of family networks for 60-year olds in stockholm density map of family networks for 60-year olds in stockholm figure 3 illustrates that 60-year olds who are in different categories of local family networks differ considerably in different types of municipalities. metropolitan areas have the highest share of childless adults in this age group : one out of five do not have adult children. this category is twice as common in metropolitan municipalities as compared to suburban municipalities. in the childless category, about half although metropolitan areas have the highest share of childless 60-year olds, those who do have adult children are very likely to live within the same region. the densest local family networks are found in the suburban municipalities of the metropolitan areas. the categories with absent adult children (solitary and left behinds) are uncommon among 60-year olds in these parts of the country and constitute only six percent when combined.fig. 3distribution of family network category in different types of municipalities distribution of family network category in different types of municipalities in the typical tourism and amenity municipalities and the sparsely populated municipalities, we find the lowest share of dense local family networks. here we find the highest share of solitary 60-year olds who have no local family network, and also a relatively large share of left behinds. in these municipalities, one out of four 60-year olds belong to either of these categories (fig. 4type of local family network and education level type of local family network and education level recent migration among the 60-year - olds was defined as living in another functional region (fa - regions) compared to age 55. since this is a sedentary age category, only 3 % of the individuals were recent migrants. it was, however, not surprising to find that the share of people who changed region is considerably higher in the solitary category, meaning those parents living far from both children and parents / siblings. in the solitary category, as many people as 14 % had moved over the past 5 years. people with lower educational attainment are more likely to have a dense local family network in all municipality types except metropolitan areas where there is no significant difference when considering education levels. in all regions outside the metropolitan areas, those with higher education are more likely to have a less dense local family networks i.e., being left behinds, settlers or solitary. the differences between education levels are generally very small in all categories for metropolitan regions. although this empirical study is merely a snapshot, the interpretation of the results implies a life course perspective which shows that events in life have long - term effects on conditions later in life. the landscape of local family networks is shaped by migration events throughout the life course, both their own migration and the migration undertaken by other family members. therefore it is important not only to consider the individual life course but also to apply a family life course perspective. the long - term spatial outcome of internal and international migration produces diverse preconditions for care and support from family members in older age in different regional contexts. the classification of the local family networks developed in this paper ; including dense networks, settlers, left behinds and solitaires, is an attempt not only to describe the different groups but also to emphasise the underlying migration processes. in general, the most common state is living in a dense family network with family members both in their own and/or parental generation and adult children within a day s travel (50 km). there are, however, regional variations and these patterns are important in understanding future care burdens in different regions as well as the living conditions for both older and younger generations. urban families in sweden are more concentrated and have better geographic preconditions to encourage interaction. the access to local family networks not only varies on a broad rural urban scale but also locally, such between neighbourhoods within metropolitan areas. in some urban localities (especially in some suburban parts) it seems that almost all parents in this age group have a dense local family network while nearby neighbourhoods are characterised by large groups of 60-year olds lacking local family networks. mobility generates these patterns and since we know that people with higher educational achievements are more mobile and that their children are more likely to enrol in higher education and thereby move away, we expect the family networks of people with higher education to be more dispersed. one conclusion from this study is that this is not true in all geographical contexts. among 60-year olds in metropolitan areas, the highly educated are just as likely as people with lower educational achievements to have a dense family network. families in metropolitan areas are the most concentrated geographically, and parents who grow old in metropolitan areas seems to have better preconditions for relying on informal care and assistance in later life. however, in terms of access to family networks, there is a vulnerable group that is larger in the metropolitan areas compared to other regions and that is the childless. this group constitutes 20 % in metropolitan areas, of which half does not have a local family network at all. another vulnerable group is immigrants who often lack horizontal ties to siblings and vertical links to parents in sweden. further research is needed to scrutinise these two groups weak position when it comes to access to family networks. the left behind parent, embedded in a local network in their own and older generation, is a small category in urban areas but quite common in some rural municipalities. a high concentration of solitary elderly people with a geographically dispersed family over all generations is concentrated in some typical amenity and tourism municipalities. this illustrates how mobility processes in a life course perspective shape the geography of families, in this case migration later in life. in this category this study can only identify the preconditions for interaction between family members in terms of distance. the quality of the relationship and the frequency of contact can not be ascertained through register data. we can not tell whether family bonds are stronger in rural areas compared to urban, but what we can tell that elderly people in rural areas are more likely to find themselves in a situation where their family members live at a distance that prohibits day to day physical interaction and face - to - face contact. since geographic distance hinders daily interaction, in these cases there is no latent local family network that can step in if assistance is required. it is important to acknowledge geographical aspects for the demographic process of ageing. as a population ages, it puts strain on the welfare state, therefore, families might become the most important providers of care and support for the elderly. it is crucial to bear in mind that access to this care is restrained by geographical distance, and this pertains more so for certain groups and in some regions rather than others. in conclusion, internal and international migration processes have a long - term impact on the availability of care and support in an ageing population. | regional variations in access to local family networks has implications for future care burdens in different regions as well as the living conditions for both older and younger generations. the geographical distance between family members is a long - term consequence of accumulated migration and non - migration undertaken by the individual as well as other family members. this study contributes to this subject through offering a description of regional disparities in the access to local family networks among 60-year olds in sweden. additionally, this paper aims to analyse this pattern as an outcome of long - distance migration processes. the empirical study is based on swedish register data, with a focus on 60-year olds in sweden, linking them to their adult children, siblings and parents as well as in - laws. the dataset includes total population, where it is possible to identify family networks in their geographical context on various geographic scales, down to a neighbourhood level. as expected, results indicate that families in metropolitan areas are the most concentrated geographically while the left behind parent, embedded in a local network in their own and older generation, is a small category in urban areas but quite common in some rural municipalities. it is also shown that access to local family networks not only varies on a broad rural urban scale but also locally, between neighbourhoods within metropolitan areas. |
acute appendicitis is the most common cause of surgical abdominal disease globally, with a lifetime risk of 6%. the technique of open appendectomy (oa), which was initially described by mcburney in 1894 and which had subsequently been the treatment of choice for acute appendicitis for more than a century, has recently taken a back seat with the advent of minimally invasive surgery. the arrival of laparoscopy has led to the evolution of laparoscopic appendectomy (la) which is being progressively accepted as the operation of choice in patients with suspected or confirmed acute appendicitis, with reported advantages such as smaller incisions, better cosmesis, shorter hospital stay, earlier return to normal activity and lower rates of wound infection.[57 ] the recent trend is to develop procedures that are even more minimally invasive. single - incision laparoscopic appendectomy (sila) is a relatively new procedure with benefits similar to that of standard la but with the advantage of having no visible scar, as the procedure is done through a single incision which remains hidden within the umbilicus.[810 ] the first report of single - incision laparoscopic surgery (sils) was in 1992 by pelosi. who performed a la, and in 1997 by navarra., who performed a sils cholecystectomy several surgeons have come up with innovative and novel approaches to perform single - incision laparoscopic surgeries, by obviating the need for special ports and roticulating instruments. this article reports a single surgeon 's early experience with sils appendectomy and suggests the feasibility and highlights certain technical advantages of sils in dealing with appendix located in abnormal positions. this article also reports a case of appendicitis due to an appendix located behind the stomach, that is a sub - gastric or retro - gastric appendix in an adult, which was successfully managed with sils, making this probably the first article in literature to report such as case. this study includes a retrospective analysis of the first 10 consecutive cases of single - incision laparoscopy performed by a single surgeon at the mosc medical college (kolenchery, india), for patients with suspected acute appendicitis based on data collected from patient records regarding clinical features, laboratory investigations and abdominal ultrasonography findings and also for patients undergoing elective interval appendectomy. the patients selected were adults, who did not have major co - morbidities and who had not undergone a previous laparotomy. the operation was performed using sils port (covidien, norwalk, ct, usa). the umbilicus was everted using a non - traumatic forceps and a vertical incision was made to include the entire length of the umbilicus and deepened to incise the sub - umbilical fascia in the same line and subsequently open the peritoneum under direct vision. following this, the hand instruments used were one straight and one curved grasper (roticulator endo grasp, auto suture, norwalk, ct, usa). an initial diagnostic survey was always done prior to removal of the infected or abnormal appendix. in all patients the appendix was routinely ligated between three endoloops (ethicon, somerville, nj, usa) and then divided using a straight endoscissors. the distal ileum was routinely examined for presence of meckels diverticulum. at the end of the procedure, fascia was closed with continuous absorbable suture, and the skin was closed with non - absorbable sutures or skin clips. three patients had appendixes in abnormal locations including one patient with the caecum and appendix deep in the pelvis. the patient was a 19-year - old female who presented with right lower abdominal pain of 2 days duration. laboratory investigations revealed leucocytosis and ultrasonography was inconclusive except for probe tenderness in the right lower abdomen. upon diagnostic sils, the right iliac fossa appeared empty, the caecum and appendix could not be visualized initially. hence, the small bowel was traced and this was easily done by just rotating the sils port, until the caecum with the appendix was found lying behind the stomach along the greater curvature close to the splenic hilum. the caecum was grasped with the roticulating grasper tool and the appendix could be brought to a position below the stomach where the appendectomy could be done with considerable ease. appendectomy was carried out in all the cases. out of this, two of the cases (both females) underwent interval appendectomy for acute appendicitis treated conservatively earlier. in one case the mean age of the patients was 30.6 (range 1852) years, mean bmi was 22.7 (range 1728) kg / m and the mean operative time was 85.5 (range 45150) min. the commonest position of the appendix was retro - caecal (50%) followed by pelvic (30%). in three cases, the appendix was found to be in abnormal locations, namely, sub - gastric [figure 1 ], sub - hepatic [figure 2a ] and one appendix with the caecum located deep in the pelvis close to the rectum and urinary bladder [figure 2b ]. all these cases could be managed with sils without any conversions. postoperative complication was seen in one patient who developed minimal sub - umbilical serous collection which was easily drained upon removing a skin stitch. various types of appendicitis from uncomplicated to appendicitis with perforation and local peritonitis and those in certain ectopic locations were encountered in this series. the sub - gastric appendix the caecum with the appendix (black arrow) lying below the stomach (white arrow). the appendix was lying under cover of the stomach which was brought into view after pulling the caecum (a) a sub - hepatic appendix. (gb = gall bladder). also note the direction of the roticulator coming from the centre. the appendix (black arrow) and caecum is seen in close proximity to the urinary bladder (white arrows) the conventional (multi - port / multi - site) laparoscopic surgeries routinely performed today utilize multiple ports that require multiple incisions to be made. the location of the trocar in a la varies depending on the surgeon 's preference. routinely, conventional la requires three trocars which mean three incisions are necessary in the conventional la, or three port laparoscopic appendectomy (tpla). in sila there is only one incision which is hidden in the umbilicus and there is no visible scar and this is advantageous from a cosmetic point of view. virtually scarless effect, the claimed benefits include less postoperative pain, lesser hospital stay and earlier return to work. another advantage is the ability to convert to standard multiport laparoscopic surgery if needed without depriving the patient of the advantages of minimal access surgery. however, presently available studies for sils are mostly case reports or series, with lack of high - quality evidence. various advanced surgeries have been reported using sils such as colectomy, hysterectomy, nephrectomy and sleeve gastrectomy. various surgeons have developed innovative and novel approaches to perform single - incision laparoscopic surgeries, by obviating the need for special trocars and roticulating instruments. the indigenous technique of transumbilical single - port laparoscopic appendectomy (tuspla) described by hong. utilizes a surgical glove as the special port to perform sils. bhatia. have reported the use of the single - incision multi - port laparoscopic appendectomy (simpla) technique which utilizes conventional laparoscopic instruments and trocars. from a technical point of view sils some of the technical difficulties associated with sils have been highlighted by chow. eye coordination because his right hand will be operating the left - sided instrument and vice versa, which will also have to be accurately co - ordinated on the screen and is more demanding than in standard laparoscopy. in addition, it may not be possible for the surgeon to replicate the basic principles of triangulation and ergonomics of instrumentation as in conventional laparoscopy and this makes the surgery more challenging. another issue is the clashing or criss - crossing of instruments associated with the sils approach, as all instruments pass through the same incision. appendicitis in abnormal locations usually creates a tricky situation and the surgery is never straightforward.[2123 ] from our limited experience with sils, we found that it was easier than expected, to tackle appendix which were located in abnormal quadrants of the abdomen. in the open technique, it would require either the extension of an incision or making a new incision after finding that the appendix is in an abnormal position. while with the standard laparoscopy we would probably need to add additional ports or introduce the ports in positions, the surgeon is not familiar operating with and thereby increase the operating time. this is probably due to the advantage of a combined centralized visual and tactile access offered by virtue of location of the port in the region of the umbilicus which forms the central summit of the gas - filled abdomen. the camera along with the instruments are centrally placed and by mere rotation around this central point all the quadrants can be accessed with equal ease obviating the need for additional ports [figure 3 ]. thus, almost the same instrument length is presented to all the quadrants from the central pivotal point. the roticulating instrument compensates to some extent for the loss of the ability to triangulate the instruments around the target. moreover, the surgeon and the camera assistant can stand on the same side to access the opposite three quadrants. thus, once the surgeon has become used to the sils port and its configuration, he can perform the procedure in an alignment with which he is already habituated to and comfortable with, regardless of the position of the appendix with respect to the abdominal quadrant. the central location of the camera enables equal access to all quadrants ; similar is the case when the instruments are placed along with the camera from the central sils port in the standard laparoscopic approach, the port positions need to be tailored in each individual case according to the position of the abnormally located appendix. there are no standard port positions in these situations and the surgeon has to modify the port placements, adhering to the basic principles of laparoscopy triangulation and ergonomy and this is basically a trial and error method. for example, in the case of a sub - hepatic appendix, the surgeon may have to introduce additional port / ports at another site with the best guess of obtaining the perfect triangulation and evidently he may not be accustomed to the new orientation which may make the surgery difficult. however with sils, the position of the surgeon with respect to the ports remains the same and he does not have to adapt to an entirely new arrangement. in other words, the surgeon, the camera, the instruments, the monitor and the target tissue (in this case the appendix) always maintain the same alignment even though the quadrants keep changing [figure 4 ]. therefore, in sils, the port position remains the same for all locations of appendix and therefore all quadrants can be accessed with almost equal ease from a single central point. this we feel is definitely an advantage and works in favor of the surgeon and the camera assistant. (a) the alignment between the operating instruments, the sils port, the surgeon and the appendix remain the same even though the quadrants keep changing for different locations of the appendix. (b) the different quadrants are more or less equidistant from the centre so almost the same instrument length is presented in different quadrants for a given target tissue (appendix) initially, technical difficulties too were encountered in this series. this clashing can occur on either side of the central port, i.e. within the peritoneal cavity and also outside it. this can be compared to eating food with chopsticks which might initially seem impossible for a novice, but later one can definitely master the skill with practice. with the subsequent cases, some of these issues could be smoothened out. adjusting the relative positions of the ports to one another with respect to the target organ (this can be done by rotating the sils port) and by adjusting heights of the individual trocars relative to one another at the sils port and thereby trying to obtain a comfortable azimuth angle, the clashing of instruments can be overcome to a certain extent. another noteworthy advantage observed in this study while using sils was ease of operation on the pelvic appendix. here, it was felt that appendectomy for a pelvic appendix could be more easily performed with sils when compared to the routine port placement as for conventional tpla, where obtaining the optimum triangulation was tricky, making the handling of instruments awkward, with the surgeon operating from the side of the operating table with one arm stretched over the patient, often in extreme abduction. but with sils, the structures in the pelvis could be directly accessed and dealt with considerable ease. thus, examination of pelvic viscera such as uterus, ovaries and adjacent structures can probably be more easily accomplished with the sils configuration. in this study of these three patients had appendixes in abnormal locations, namely, sub - gastric, sub - hepatic and deep pelvic (appendix with the caecum located deep in the pelvis close to the rectum and urinary bladder hence para - vesical or para - rectal), all of which were successfully operated using the sils technique. the appendix has the reputation of being the only organ in the body that has no constant position. there are only a few reports in the literature regarding surgery for rare types of appendicitis. about one - third of patients with acute appendicitis have pain localized outside of the right lower quadrant because of the various positions of the appendix. the various positions commonly encountered are retro - caecal (65.3%), pelvic (31%), subcaecal (2.3%), pre - ileal (1%) and post - ileal (0.4%). the rarer types include sub - hepatic, lateral pouch, left - sided, intra - herniary and lumbar appendicitis. left - sided acute appendicitis (lsaa) usually occurs due to two main anatomic abnormalities, the first being situs viscerum inversus and the second, less common abnormality, is midgut malrotation.[2328 ] in a review of 95 published cases between 1893 and july 2010 for lsaa, akbulut., found only seven cases of appendicitis with pain localized to the left upper quadrant. in the present case although the appendix was located in the left upper quadrant below the stomach, the pain and tenderness were present in the right lower abdomen. to the best of our knowledge, there is only another article published in 1963 which describes right lower abdominal pain for left upper quadrant appendicitis. as with the present case, the exact reason for this is uncertain and could probably be attributed to certain attributes of bowel innervation associated with malrotation. the sub - hepatic appendix usually occurs due to arrested caecal descent where the caecum comes to lies in the sub - hepatic position but does not descend to the right iliac fossa. the reason for sub - gastric position of the appendix in this study could be probably due to malrotation and arrested caecal descent giving rise to an ectopic caecum and appendix. have described the advantages of standard laparoscopy over conventional surgery for appendixes in unusual locations. the present case is probably the first report of sils appendectomy for left - sided appendix and a sub - hepatic appendix. this is also probably the first report on sub - gastric or retro - gastric appendicitis. this is the initial experience of a single surgeon with sila and even though this series precludes any meaningful statistical analysis owing to the small cohort size, it does demonstrate that the sils approach may be feasible and technically advantageous for dealing with unusual locations of the appendix. to conclude, it would therefore possibly make sense to suggest that sils appendectomy for appendix in rare anatomical positions is probably a better option than oa and conventional la. it has the advantages of conventional laparoscopy, along with the added benefit of a single incision and a virtually scarless outcome. the operating surgeon too can operate in a configuration he is already accustomed to and access different abdominal quadrants with equal ease. further research is needed in this field and the true potential of the technique remains to be shown by randomized controlled trials. | background : single - incision laparoscopic surgery is considered as a more technically demanding procedure than the standard laparoscopic surgery. based on an initial and early experience, single - incision laparoscopic appendectomy (la) was found to be technically advantageous for dealing with appendicitis in unusual anatomical locations. this study aims to highlight the technical advantages of single - incision laparoscopic surgery in dealing with the abnormally located appendixes and furthermore report a case of acute appendicitis occurring in a sub - gastric position, which is probably the first such case to be reported in english literature.materials and methods : a retrospective analysis of the first 10 cases of single - incision la which were performed by a single surgeon is presented here.results:there were seven females and three males. the mean age of the patients was 30.6 (range 1852) years, mean bmi was 22.7 (range 1728) kg / m2 and the mean operative time was 85.5 (range 45150) min. the mean postoperative stay was 3.6 (range 17) days. the commonest position of the appendix was retro - caecal (50%) followed by pelvic (30%). in three cases the appendix was found to be in abnormal locations namely sub - hepatic, sub - gastric and deep pelvic or para - vesical or para - rectal. all these cases could be managed with this technique without any conversionsconclusion : single - incision laparoscopic surgery appears to be a feasible and safe technique for dealing with appendicitis in rare anatomical locations. appendectomy may be a suitable procedure for the initial training in single - incision laparoscopic surgery. |
hypertension and cardiovascular disease (cvd) are global health problems [1, 2 ]. high blood pressure (bp) has a direct relationship with increased body weight and risk of cardiac incidents and is also prevalent in professional and collegiate football players [35 ]. it is assumed that the increased physical activity the athletes perform leads to improved cardiac health, but studies report increases in cvd risk. studies have found that division i football players have high body fat, metabolic disease, and high resting bp levels and that bp increases over competitive seasons [68 ]. separate research has shown that division ii athletes have high bp, increased body mass index (bmi), and low high density lipoprotein (hdl) levels. there are over 70,000 ncaa football players and nearly 450 division iii schools sponsor football programs, yet research is lacking in health of division iii football players, and there is a paucity of research in vascular health of athletes overall [69 ]. vascular health is related to cvd and can be assessed through a number of clinical modalities, including flow - mediated dilation (fmd) and carotid artery intima - media thickness (imt). fmd is a noninvasive test, an index of no - mediated endothelial - dependent function in humans [11, 12 ]. measuring carotid artery imt assesses vascular remodeling by quantifying thickness of the smooth muscle layer [13, 14 ]. previously we have reported that brachial artery fmd increased and carotid artery imt decreased with a six - month aerobic exercise program, suggesting improvements in vascular health. lower fmd has been measured in professional athletes in one study, while another study found no difference in fmd between division i football players and controls [8, 16 ]. increased arterial stiffness was found in division i football players compared to controls. other research has found that professional football players have similar carotid artery imt values to matched controls. to the best of our knowledge the purpose of this study was to compare vascular health between football players and controls and to examine changes in cardiovascular health over a season, providing for the first time a cardiovascular health profile in division iii football players. football players were recruited from ursinus college ncaa division iii football team and were tested before and after season. a control group composed of nonathlete males was recruited and matched to the football players by age and by prior physical activity level (number of times reported exercise per week). the control group was tested at one point during the middle of the football season. all preseason exercise testing was completed before the football training camp, and fasting studies were completed in the first week of camp. all postseason testing was completed within two weeks of the end of the football season. vascular studies and 24-hour ambulatory blood pressure (abp) measures were collected once during the middle of the season. only players who completed both pre- and postseason testing were included in this analysis. for a subanalysis, players were stratified into two groups based on playing position : lineman (lm) and nonlineman (nlm). specific criteria for inclusion for all participants were as follows : being nondiabetic, nonsmoking, no medications that affect cardiovascular hemodynamics, no more than one antihypertensive medication, and no evidence or history of cvd, hypercholesterolemia, or renal disease. the protocol was approved by the ursinus college institutional review board, and all procedures were in accordance with the ethical standards of the helsinki declaration. clinic bp measurements were obtained in accordance with jnc-7 guidelines on three separate visits in a quiet (5 min rest), temperature controlled room, using an aneroid sphygmomanometer (medline industries, mundelein, il). for accurate readings, proper size bp cuff was used for measurements, based on the arm size of participant. bp measurements were performed in triplicate with the average of the three values used as the representative bp for that visit. the mean systolic bp and diastolic bp across the three visits are reported as the clinic bp. twenty - four - hour abp monitoring was completed using a noninvasive portable bp monitor (spacelabs, redmond, wa), as previously described. bp measures were obtained at 30 min intervals during the day and 60 min intervals at night. the following morning, each participant was asked to list their awake hours (daytime bp) and sleep hours (nighttime bp). participant data was included in final analysis if more than 80% of the measurements were collected. mean values were calculated for 24-hour average, for daytime, and for nighttime time - frames. fasting plasma glucose and cholesterol levels were measured using the alere cholestech ldx lipid profile system (san diego, ca). blood was obtained by fingerstick using a 35 l lithium heparin - coated capillary tube and tested immediately. lipid profile cassettes were inserted into the cholestech to analyze blood samples. previously, fingerstick lipid profile values were correlated (r > 0.95) with venous plasma values measured in clinical diagnostic laboratories (alere), and this meets the national cholesterol education program criteria for agreement between methods. body composition was measured by whole - body bioelectrical impedance (bia) using the single frequency impedance instrument (impedimed df50, san diego, ca) following an overnight fast in a quiet, temperature controlled room. participants were asked to refrain from salty foods, exercise, medication, alcohol, and caffeine for at least 10 hours prior to the test. bia was measured in accordance with the manufacturer 's instructions at 50 khz on the right side of the body. two electrodes were placed on the dorsal right hand and foot while the athletes were lying in a supine position. three measurements were taken, and the mean values of impedance, phase, resistance, and reactance were used for calculations of total fat and fat - free mass. the bruce protocol was performed with continuous measurement of breath - by - breath gas sampling to measure oxygen consumption (vo2) using a calibrated metabolic cart (trueone 2400, parvomedics, sandy, ut). brachial artery diameter measurements using flow - mediated dilation (fmd) were collected following an overnight fast in a quiet, temperature controlled room. each participant underwent an acclimation phase (20 min) to obtain a hemodynamic steady state. heart rate was continuously monitored using a 3-lead ecg, and bp measurements were taken in the left arm to confirm a steady state. a 5 84 cm automatic cuff (e-20 rapid cuff inflator ; d.e. hokanson bellevue, wa) was placed around the right forearm distal to the olecranon process following established guidelines for assessing fmd. baseline images were obtained longitudinally 2 to 10 cm above the antecubital fossa by 2d high resolution ultrasound system, using a 5 to 12 mhz multifrequency linear array transducer. once a satisfactory image was obtained, the right arm was secured, the position was marked, and the transducer was stabilized using a clamp. doppler velocity was measured via ultrasound, doppler flow signals were corrected at an insonation angle of 60, and measurements were performed with the sample volume placed mid - artery. measurements were recorded for 30 seconds at baseline ; then the automatic forearm cuff was then inflated to 250 mmhg and maintained for 5 minutes. diameter and velocity recordings resumed before cuff deflation and continued for 2 minutes thereafter, while postischemia images were collected. ultrasound fmd videos were recorded using the ge logiq e (ge medical systems, chicago, il) and downloaded to a separate computer using movavi video editor (movavi, st louis, mo). arterial diameters were analyzed using the brachial analyzer for research (medical imaging applications, coralville, ia). velocity and diameter measurements were converted to local shear stress using the following equation : shear stress = 8 vh / dbl, where is blood viscosity, assumed to be 0.035 dyne seconds / cm, vh is the peak posthyperemia velocity, and dbl represents the baseline diameter. fmd reported is the percent increase in diameter from baseline and is calculated as fmd = (peak hyperemic diameter the same operator performed all fmd measurements. on the same day as fmd measurements, images were obtained and measurements made using the ge logiq e ultrasound system and automated calculation software (auto - imt software option, ge medical systems, chicago, il). three measures were collected of the posterior wall of the common carotid artery, as per established guidelines. pre- and postseason values were compared using the paired samples t - test or the paired samples wilcoxon signed - rank test. independent t - tests were used to compare differences between football players and controls and between lm and nlm. pearson correlation was used to determine if there were relationships between the variables and was further examined by linear regression analysis. twenty - seven football players were recruited from the ursinus college ncaa division iii football team. due to injuries or scheduling issues, thus 23 athletes (12 lm and 11 nlm) were included in this analysis. they were matched to the football players by age (20.8 2.0 yrs control, 19.8 1.0 yrs football players) and by physical activity level (4.9 1.5 times exercise / week control, 5.6 0.9 times exercise / week football players). table 1 shows the comparison of vascular and cardiovascular health measures between football players and matched controls. football players had thicker carotid artery imt compared to the control group (0.496 0.06 mm versus 0.462 0.07 mm, p < 0.05). football players also had larger baseline diameter (4.3 0.5 mm versus 3.7 0.6 mm, p < 0.05) and peak brachial diameter during fmd (4.7 0.6 mm versus 4.1 0.7 mm, p < 0.05), but percent change in fmd was similar between groups (8.5 4.5% versus 9.9 3.3%, football players also had higher fasting glucose levels (91.6 6.5 mg / dl versus 86.6 5.8 mg / dl, p < 0.05), higher body fat percentage (29.2 7.9% versus 23.2 7.0%, p < 0.05), and lower fasting hdl levels (36.5 11.2 mg / dl versus 47.1 14.8 mg / dl, p < 0.05) compared to controls. all of these markers indicate a worse vascular and cardiovascular health profile in football players compared to controls. isolated systolic bp is associated with pathophysiology, is the most common form of hypertension, and is the focus of risk stratification. for every measurement, figure 1 shows that systolic bp was higher in football players at rest, during a full 24-hour period, at night, during all submaximal exercise stages, and at maximum exercise (all p < 0.05). there was no difference between the groups in any measure for diastolic bp levels. table 2 displays changes in cardiovascular health for the football players following a collegiate season. in the entire group, only hdl increased over the season (36.5 11.2 to 42.4 10.8 mg / dl, p < 0.01). when compared by position, at both pre- and postseason testing, lm had higher body weight, higher body fat percent, lower hdl levels, and lower vo2 max levels, all suggesting an inferior cardiovascular profile. after completion of the season, the lm group had an increase in hdl (32.2 9.5 to 39.0 9.0 mg / dl, p < 0.01) and triglyceride levels (107.6 69 to 126.3 83.2 mg / dl, p < 0.05), and the nlm group had a decrease in body weight (84.5 4.9 to 83.2 4.6 kg, p < 0.05) and fasting glucose levels (89.7 6.0 to 86.7 6.9 mg / dl, p < 0.05). this is the first report of cardiovascular health, vascular function, and 24-hour abp levels in a group of division iii athletes. we found thicker carotid artery imt levels, higher systolic bp at all measurement points, higher body fat, and lower vo2 max levels in football players when compared to controls. when football players were compared by position, we found that no difference exists in percent fmd or in carotid artery imt. finally, we confirm for the first time in division iii football players, what other studies [24, 25 ] have shown, lm are heavier and less fit compared to nlm. limited research evaluates the effect of fitness on common carotid imt in athletes, and to the best of our knowledge no study has reported imt measures in division iii football players. it has been shown that otherwise healthy adults with lower cardiorespiratory fitness have higher imt values, suggesting subclinical atherosclerosis. we found similar results in our study in both lm and nlm, suggesting that football players, regardless of position, may have increased risk for atherosclerosis. one study reported that carotid artery imt was higher in young professional football players compared to controls and concluded that the increased imt in athletes may be the result of intermittent exposure to elevated arterial pressures during exercise, leading to elevated carotid wall stress. however, a separate study reported no significant differences in carotid artery imt levels between professional football players and inactive controls. the varied findings related to fitness and imt in athletes could be related to differences in training programs ; thus further studies are needed. on the other hand, the effect of bp on carotid artery imt is established, and it is known that increased bp is related to higher common carotid imt values. we are the first to confirm this in division iii football players. in our study, there was no difference between the groups in fmd or fmd / shear levels. traditionally, a diminished fmd response has been associated with reduced physical activity and increased risk of cvd. compared cvd risk factors, cardiovascular structure, and function between division i football players (stratified by position) and controls. dobrosielski. reported no significant difference in fmd between lm, nlm, and controls. research reports 19.2% prevalence of hypertension and 61.9% prevalence of prehypertension in collegiate football players. according to the aha, preparticipation screening exams should identify cardiovascular risk related to physical activity. these exams include measures of heart rate, height, weight, and a clinic bp ; yet, this data is not enough to protect athletes from cardiac incidents. current recommendations for accurate assessment of bp - related cardiovascular risk include 24-hour abp as an adjunct to clinic bp measures, yet many athletic programs do not screen athletes with abp monitoring. we are the first to report 24-hour abp levels in a group of collegiate athletes. we found that 24-hour average, daytime, and nighttime systolic bp was higher in football players compared to the control group, which could be related to increased cvd risk. a recent study in professional football players also found a reduced nighttime drop in bp in many of the players. other studies have found that bp increases over a season in division i players. when examining changes over the collegiate season, we found no change in clinic bp from pre- to postseason testing. future studies should further examine abp and how clinic bp levels change in collegiate football players of all divisions. other future studies should examine vascular health in division iii athletes to confirm our findings. finally, given the large difference in body weight between positions, potential for metabolic syndrome should be considered and examined. although we matched the control population to the athletes by number of exercise sessions per week, the participants may not accurately represent a comparable control for the football players, considering the type of exercise that football players undergo. the study sample size overall was small, but this was due to time restraints to player testing done in a set time - frame. also, the sample was derived from one small division iii college, which may not be representative of all football athletes. these limitations emphasize the need for a further, larger study that assesses surrogate markers of vascular health and cardiovascular risk along with other cardiovascular outcomes in collegiate athletes. in conclusion, collegiate football players may be at increased risk for impaired cardiovascular or vascular health, and division iii athletes are a large collegiate population of athletes who remain understudied. this is the first report of vascular function, cardiovascular health, and 24-hour abp levels in a group of division iii football players. compared to active controls, football players have thicker carotid artery imt levels, higher systolic bp at all measurement points, higher body fat, and lower vo2 max levels in football players when compared to controls. also, we confirm for the first time in division iii football players, what other studies have shown in professional football players and collegiate division i players, lm are heavier and less fit compared to fitness matched controls. | studies report that football players have high blood pressure (bp) and increased cardiovascular risk. there are over 70,000 ncaa football players and 450 division iii schools sponsor football programs, yet limited research exists on vascular health of athletes. this study aimed to compare vascular and cardiovascular health measures between football players and nonathlete controls. twenty - three athletes and 19 nonathletes participated. vascular health measures included flow - mediated dilation (fmd) and carotid artery intima - media thickness (imt). cardiovascular measures included clinic and 24 hr bp levels, body composition, vo2 max, and fasting glucose / cholesterol levels. compared to controls, football players had a worse vascular and cardiovascular profile. football players had thicker carotid artery imt (0.49 0.06 mm versus 0.46 0.07 mm) and larger brachial artery diameter during fmd (4.3 0.5 mm versus 3.7 0.6 mm), but no difference in percent fmd. systolic bp was significantly higher in football players at all measurements : resting (128.2 6.4 mmhg versus 122.4 6.8 mmhg), submaximal exercise (150.4 18.8 mmhg versus 137.3 9.5 mmhg), maximal exercise (211.3 25.9 mmhg versus 191.4 19.2 mmhg), and 24-hour bp (124.9 6.3 mmhg versus 109.8 3.7 mmhg). football players also had higher fasting glucose (91.6 6.5 mg / dl versus 86.6 5.8 mg / dl), lower hdl (36.5 11.2 mg / dl versus 47.1 14.8 mg / dl), and higher body fat percentage (29.2 7.9% versus 23.2 7.0%). division iii collegiate football players remain an understudied population and may be at increased cardiovascular risk. |
arterial hypertension is the primary and most common risk factor for cardiovascular disease, stroke, end - stage renal disease, and peripheral vascular disease. it has been identified as the leading cause of mortality and the third most common cause of disability - adjusted life - years worldwide. it has been estimated that the worldwide prevalence of hypertension will increase from 26.4% in 2000 to 29.2% in 2025. identifying and characterizing modifiable risk factors of hypertension is of high importance for public health and clinical medicine. the results of previous epidemiological studies have suggested that there is an association between greater risk of hypertension and lower physical activity, more marked adiposity, dyslipidemia, and a diet rich in saturated fatty acids. correspondingly, lifestyle modification has been shown to lower arterial blood pressure (bp) and to reduce the risk of hypertension ; therefore, it maybe an essential component of early interventions in high - risk individuals. in 2010, the american heart association defined seven factors (smoking status, body mass index [bmi ], physical activity, healthy dietary score, total cholesterol, bp, and fasting blood glucose) as metrics of cardiovascular health (cvh). subsequent studies have revealed that ideal cvh metrics have distinctly protective effects against stroke, cardiovascular disease, cancer, and overall mortality. given that many of these studies involved the nonpopulation - based recruitment of participants, there was a risk of bias due to a referral - based selection artefact. additionally, the association between the risk of developing hypertension and cvh metrics was not explored. moreover, as many of the studies were cross - sectional in nature, a change in the cvh metrics during follow - up and its influence on the incidence of hypertension could not be examined. consequently, recent studies, such as the framingham heart study, have shown that assessment of the duration and grade of cvh metrics as a measure of cumulative exposure was more accurate than a cross - sectional analysis in examining the relationship between cvh metrics and diseases. in the framingham heart study, cumulative exposure to hyperlipidemia in young adulthood increased the subsequent risk of coronary heart disease. the multi - ethnic study of atherosclerosis reported that cumulative exposure to elevated systolic bp (sbp) was correlated with an increase in the spot urine albumin - to - creatinine ratio among adults without diabetes. as the relationship between the cvh metrics and the development of hypertension has not been explored, given that most previous studies were cross - sectional and not population - based and due to the fact that relevant information on the chinese population is scarce, we conducted this study to investigate the relationship between cumulative exposure to cvh metrics (except for bp metrics) and incident hypertension in a chinese population. the kailuan study was a prospective cohort study conducted in the community of kailuan in the industrial city of tangshan (china). the study was approved by the ethics committees of kailuan general hospital and followed the guidelines outlined in the declaration of helsinki. the kailuan study included employees and retirees of the kailuan group company, a large coal - mining company located in tangshan. between june 2006 and october 2007, a total of 101,510 individuals (81,110 men) aged 18 to 98 years were recruited to participate in the study. the present study included those individuals from the original study population who had not been diagnosed with hypertension at baseline examination and who underwent follow - up examinations in the years 2008 to 2009, 2010 to 2011, or 2012 to 2013. the study participants were re - examined every 2 years. at baseline and 2-year follow - up examinations, information about smoking, physical activity, and salt intake never smoking was defined as the ideal health behavior (with respect to smoking). former smoking was identified as the intermediate health behavior, whereas current smoking was considered to be the poor health behavior. with respect to physical activity, ideal health behavior, intermediate health behavior, and poor health behavior were defined as 80, 1 to 79, and 0 minutes of moderate or vigorous activity per week, respectively. since detailed information on diet (eg, intake of fruits, vegetables, or meat) was lacking, we used information on salt intake as a surrogate for information on diet in general. as part of the standardized questionnaire, we asked how much salt participants used when they cooked. low salt intake was defined as the ideal diet behavior, whereas medium and high salt intake were defined as the intermediate and poor diet behaviors, respectively. bmi was calculated as body weight (kg) divided by the square of body height (kg / m). three readings of sbp and diastolic bp (dbp) were taken at 5-minute intervals after participants had rested in a chair for at least 5 minutes. a 10-second 12-lead electrocardiography was used to measure their resting heart rate after they had rested in the supine position for 5 minutes. high - density lipoprotein cholesterol (hdl - c) and low - density lipoprotein cholesterol (ldl - c) levels were determined using a direct test method (interassay coefficient of variation 120/80 mm hg). fasting blood glucose was classified as ideal (< 5.6 mmol / l and untreated), intermediate (5.66.9 mmol / l or treated to < 5.6 total cholesterol status was rated as ideal (< 200 mg / dl and untreated), intermediate (200239 mg / dl or treated to < 200 mg / dl), or poor (240 mg / dl or treated to 200 mg / dl). to examine cumulative exposure of 6 cvh metrics (except the bp metric), we created a dichotomized variable for each component of the health metrics : ideal was coded as 2, intermediate was coded as 1, and the total ideal cvh score of each individual was the sum score of the 6 ideal cvh metrics, ranging from 0 to 12. the cumulative cvh (cumcvh) score was defined as the summed cvh score for each examination (baseline or follow - up) multiplied by the time between the 2 consecutive visits in years : cvh1 time12 cvh2 time23 cvh3 time34, where cvh1, cvh2, and cvh3 indicate cvh at examinations # 1 (baseline), # 2, and # 3, respectively, and time12, time23, and time34 indicate the participant - specific time interval between the consecutive examinations # 1 to # 3 in years. cumcvh was categorized as < 44 points, 44 to 48 points, 49 to 54 points, 55 to 59 points, and 60 points. information on demographic and clinical characteristics (age, sex, alcohol consumption, personal monthly income, level of education, and history of diseases) was collected via questionnaires. according to their age at baseline, study participants were classified into 3 categories : < 40 years, 40 to 59 years, and 60 years. previous history of diseases, including myocardial infarction, stroke, and cancer, was assessed as self - reported. the use of antihypertensive, cholesterol - lowering, and glucose - lowering medications within the past 2 weeks before the baseline interview was also investigated. incident hypertension was diagnosed in study participants with an sbp of less than 140 mm hg ; a dbp less than 90 mm hg ; no history of hypertension and no use of antihypertensive drugs at examinations # 1 through # 3 who had an sbp of at least 140 mm hg ; a dbp of at least 90 mm hg ; and/or use of antihypertensive drugs at examination # 4 performed from 2012 to 2013. statistical analyses were performed using commercially available software (sas 9.3 ; sas institute ; cary, nc). continuous variables were described as the mean standard deviation (sd) and were compared by analysis of variance (anova) or the kruskal categorical variables were described as percentages and were compared using the chi - square test. a logistic regression model was used to estimate the risk of hypertension associated with cumcvh metrics. model 3 further adjusted for hs - crp, ua concentration, resting heart rate, parental history of hypertension at baseline, and medication usage before the fourth follow - up examination. because 11 hospitals were responsible for laboratory tests in this study, we used a random - effects model for each hospital to account for potential measurement bias. the interactions between cumcvh and both sex and age on the risk of hypertension were analyzed using multivariate logistic regression. all statistical tests were 2-sided, and the significance level was set at p < 0.05. of the 101,510 individuals who participated in the baseline examination, 86,496 were excluded due to a diagnosis of hypertension before the examination in the period from 2012 to 2013 (61,144 participants, with 44,653 having a diagnosis of hypertension before the period from 2006 to 2007, 11,607 developing hypertension between 2007 and 2009, and 4884 developing hypertension between 2009 and 2011) ; a missed follow - up examination during the re - examination period of 2008 to 2009, 2010 to 2011, or 2012 to 2013 (22,699 participants) ; or incomplete cvh metrics data (2653 participants). the remaining 15,014 participants (33.5% women) were included in the present study (fig. 1). selection of kailuan study participants. compared with the excluded subjects, the individuals included in the present study were significantly younger (43.7 11.1 vs 50.5 13.4 years ; p < 0.001), had a higher level of education (30.9% vs 24.0% ; p < 0.001), and had a lower bmi, sbp, dbp, fasting blood glucose, total cholesterol, hs - crp concentration, ua concentration, and resting heart rate (table 1). comparison of demographic and other characteristics of participants and nonparticipants. after comparing the baseline characteristics (data obtained in 2006) across the 5 groups of study participants, it was revealed that the higher cumcvh score was significantly (p < 0.001) associated with older age, the female sex, a higher level of education, a higher income, lower alcohol consumption, a lower resting heart rate, lower ua concentration, and lower hs - crp concentration (table 2). characteristics of study participants after stratification by cumulative cardiovascular health factor index. in a multivariate regression analysis, with cumcvh score as the dependent variable and the aforementioned variables that were significantly associated with cumcvh score in the univariate analysis as the independent variables, it was found that cumcvh score was significantly correlated with older age (p < 0.001), the female sex (p < 0.001), level of education (p < 0.001), and level of hs - crp concentration (p < 0.001) the incidence of new - onset hypertension ranged from 16.76% in the lowest cumcvh category to 11.52% in the highest cumcvh category (table 3). compared with participants in the lowest cumcvh category (< 44 points), after adjusting for age, sex, education level, income level, hs - crp concentration, ua concentration, resting heart rate, parental history of hypertension at baseline, and medication usage before the third follow - up examination, participants in the highest cumcvh category (60 points) had a significantly reduced risk of hypertension (adjusted or 0.60, 95% ci 0.500.71). for every increase in cumcvh score category, the risk of hypertension decreased by approximately 2% (or 0.98, 95% ci 0.970.98). significant inverse associations were found in 2 age groups (p < 0.001), both for men (p - trend < 0.001) and for women (p - trend there were significant interactions between cumcvh score and both age (p - interaction < 0.001) and sex (p - interaction = 0.013). associations between incident arterial hypertension and other factors (multivariate analysis ; odds ratios, and 95% confidence intervals) in the study participants after stratification by cumulative cardiovascular health factor index. to examine the influence of individual cvh metrics on the association between cumcvh score and incident hypertension, a sensitivity analysis was performed after excluding each of the 6 metrics from the total cumcvh score 1 at a time. odds ratios and 95% confident intervals associated with hypertension risk in relation to a 1-score increase in cumulative exposure to cardiovascular health (cvh) factors, after removing each one of the 6 cvh metrics separately. for the models adjusted for age, sex, education level, income level, alcohol consumption, high - sensitivity c - reactive protein concentration, uric acid concentration, resting heart rate, parental history of hypertension at baseline examination, and medication usage before the third follow - up examination. because follow - up time might influence cumcvh score (eg, participants might have a higher cumcvh score at 4-year follow - up than those at 3-year follow - up), we used a time - weighted cumcvh (calculated as [cvh1 time12 + cvh2 time23 + cvh3 time34]/[time12 + time23 + time34 ]) model to examine the robustness of our findings. the results revealed that higher time - weighted cumcvh score was significantly associated with a lower risk of incident hypertension (table 4). associations between incident arterial hypertension and other factors (multivariate analysis, odds ratios, and 95% confidence intervals) in the study participants after stratification by time - weighted cumulative cardiovascular health factor index. in this prospective kailuan study, a higher cumcvh score significantly reduced the risk of incident hypertension. this association remained significant when the total study population was stratified by sex and age, and after adjusting for potentially confounding factors, such as education level, income level, alcohol consumption, parental history of hypertension at baseline, and medication usage before the third follow - up examination. these findings suggest that optimal cvh status is helpful to reduce the risk of incident hypertension. the framingham heart study investigators were among the first to develop a hypertension risk prediction model that included age, sex, sbp, dbp, bmi, cigarette smoking, and parental history of hypertension. results of a meta - analysis of 13 prospective cohort studies showed an inverse dose - response association between level of recreational physical activity and risk of hypertension. the strong heart study found that increasing abdominal obesity and an abnormal lipid profile were major predictors of arterial hypertension development in adults who initially had optimal bp. in addition, dietary fat was an important modifiable risk factor of hypertension in previous studies. a limitation of the studies mentioned above was that the behavioral factors were measured at a single time point without taking into account their change in cvh metrics over time. they neglected any behavioral factors and indexes, including cvh metric changes due to environmental change and aging. given the variability in the behavioral factors, we investigated the association between cumulative exposure to behavioral factors (ideal cvh metrics) and hypertension prospectively. the results remained unchanged when the population was stratified by sex and age, both of which were associated with other risk factors, such as smoking. in addition, the relationship between cumcvh exposure and incident hypertension decreased in statistical strength, but persisted when 1 of the 6 cvh metrics was removed from the total cumcvh score. it suggested that each of the cvh metrics was influential in reducing the risk of incident hypertension. furthermore, each of these individual risk factors appeared to be associated with similar hypertension risk, as the correlation between cumcvh exposure and incident hypertension was attenuated to a comparable extent after their individual removal from the model (fig. these findings also imply that preventative efforts to reduce the development of arterial hypertension that encompass strategies promoting a more holistic approach to optimal vascular health (eg, smoking cessation, weight loss, increased physical activity, and low - fat diet) may yield greater benefits than would be expected by targeting individual health behaviors independently. the association between higher cumcvh score and lower incidence of hypertension in the follow - up examinations aligns with and may be caused by the known relationships among a low degree of physical activity, a high bmi, smoking, and increased bp. since we did not include factors, such as socioeconomic background, in the statistical analysis in our study, we could not assess their influence on the relationship between cvh and the incidence of arterial hypertension. based on previous studies on social inequalities and health and mortality, however, there may be little doubt that individuals with lower socioeconomic status, including a lower level of education, have a lower cvh score, and, therefore, a higher risk of having arterial hypertension at follow - up. future studies may address the question regarding whether socioeconomic factors had a direct influence on the development of hypertension or whether there was an indirect influence of lifestyle factors, such as diet and amount of physical activity. first, we used self - reported information on salt intake as a surrogate of diet information without measuring the natriuresis for 24 hours. for a subgroup of the study population, however, we compared the self - reported assessment of salt intake with the measurement of 24-hour natriuresis and found a significant correlation (r = 0.78). this finding may indicate that the self - reported data on salt intake provided some information about salt intake. second, all participants came from the city of tangshan and were employees or family members or employees of the kailuan group company ; consequently, the study population was not representative of the total chinese population. therefore, the findings of our study can not be generalized to other chinese populations with a different lifestyle and a different average education level. the strengths of our study included the sample size and the prospective examination of the participants. third, we included in the study only individuals who were free of arterial hypertension at 3 baseline examinations over a period of 6 years. that is, individuals who were free of arterial hypertension at the first baseline examination, but developed arterial hypertension by the second or third baseline examination were excluded from the study. as an alternative to the selected study design, we could have included these individuals as incident hypertensive patients in the study. nevertheless, given that bp measurement performed at a single examination or at two examinations could yield a false - negative diagnosis of arterial hypertension, we chose the design involving 3 negative measurements as baseline for our longitudinal investigation. this research decision may only have strengthened the quality of our study design because it prevented the inclusion of patients, who were inaccurately determined to be normotensive, but who actually had arterial hypertension, into our study population. in conclusion, a healthy lifestyle as indicated by cumcvh score was related to a reduced risk of having arterial hypertension. | abstractideal cardiovascular health (cvh) has been defined by the american heart association as the absence of disease and presence of 7 key health factors. since it is unknown whether cumulative exposure to cvh reduces the risk of developing arterial hypertension, we prospectively examined the potential association between cumulative cvh (cumcvh) score (except for blood pressure metrics) and incident hypertension.of the 101,510 participants with an age range of 18 to 98 years in this longitudinal community - based kailuan study, our cohort included those 15,014 participants without hypertension at baseline and who had follow - up examinations 2, 4, and 6 years later. cumcvh was calculated as the summed cvh score for each examination multiplied by the time between the 2 examinations (points year). based on the cumcvh score, the study population was stratified into groups of < 44 points, 44 to 48 points, 49 to 54 points, 55 to 59 points, and 60 points.incidence of hypertension ranged from 16.76% in the lowest cumcvh category to 11.52% in the highest cumcvh category. after adjusting for age, sex, education level, income level, high - sensitivity c - reactive protein concentration, uric acid concentration, resting heart rate, parental history of hypertension at baseline, and medication usage before the third follow - up examination, participants in the highest cumcvh category had a significantly reduced risk of incident hypertension compared with those in the lowest cumcvh category (adjusted odds ratio 0.60, 95% confidence interval 0.500.71). for every increase in category based on the cumcvh score, the risk of hypertension decreased by approximately 2% (odds ratio 0.98, 95% confidence interval 0.970.98). the effect was consistent across sex and age groups.a higher cumcvh score is associated with a lower risk of incident hypertension. |
the rapid rise in the global prevalence of diabetes lends urgency to the need for investigations beyond the walls of traditional factors such as poor nutrition, obesity, and sedentary behaviour. in 2013, diabetes was reported in 382 million people worldwide, a figure projected to increase by 55% to 592 million in 2035. type 2 diabetes mellitus (t2 dm) is the most prevalent form affecting 90% of adults with diabetes and is increasingly being diagnosed in younger age groups. while biochemical and clinical research is important, grassroots level sociocultural research is needed to understand the underlying sociodemographic and cultural environment which influences the self - efficacy of patients to perform the daily tasks of self - managing their chronic condition. for example, among migrants to many developed countries like australia, acculturation to host culture, language and cultural barriers, and socioeconomic factors contribute to an increased incidence of lifestyle diseases, approximating that of the receiving country. migrants encounter many personal and systemic barriers in managing chronic conditions like diabetes [5, 6 ], which adds to the complexity of implementing self - management interventions in this population. understanding how these factors interrelate and influence self - management is important to provide person - centred strategies to enhance the health of people living with diabetes. diabetes self - management (dsm) is considered an essential cornerstone of good diabetes control. it is reported to reduce the level of glycated haemoglobin level (hba1c), a clinical measure of adequate control, by as much as 37%. having a lower hba1c value (7% or 53 mmol / mol) reduces the likelihood of developing micro- and macrovascular complications over time. despite the increasing evidence that supports the benefits of dsm, uptake remains low, especially in culturally diverse populations [10, 11 ]. among people with t2 dm, knowledge deficit and understanding about diabetes and its complications have been found to be low in those with low health literacy, posing a barrier to dsm. given this association, improving health literacy, defined as the capacity to look for, process and understand health information to make informed decisions seems an important priority to empower patients to self - manage their diabetes. paasche - orlow and wolf postulated that the mechanisms contributing to poorer outcomes among those with low health literacy include low self - efficacy, lack of access to and utilisation of resources and services, and language and cultural issues in clinical encounters. it is important, however, to acknowledge that socioeconomic and demographic factors such as age, educational level, ethnocultural background, and having conditions that require complex care are underscoring limited health literacy [6, 10, 16 ]. low levels of health literacy have been found to be common among patients who are from lower socioeconomic backgrounds and among migrants with limited english language proficiency, the elderly, and those with chronic diseases. while some studies have found that low health literacy is associated with poor diabetes self - management, poor control, and more complications, the evidence regarding this association is inconsistent. this could be due to other psychosocial and demographic factors that may affect health literacy and/or differences in measuring this construct. adding to the complications of suboptimal self - management is reduced psychological well - being. for example, psychological comorbidity, like depression, contributes to lower self - care, which in turn leads to poorer health status leading to more depression and comorbidities which further reduce dsm. the aim of the study was to examine the relationships between sociodemographic, clinical, and psychological factors and health literacy and its relationship with dsm within a culturally diverse urban population with t2 dm. specifically, we sought to investigate the relationship between health literacy and other factors influencing dsm. the hypotheses in this study were as follows:(1)self - management in patients with t2 dm is associated with sociodemographic factors (age, gender, educational level, marital status, and country of birth), clinical factors (self - rated general health, hba1c), and psychological factors (depression, confidence, knowledge, and health literacy).(2)health literacy in patients with t2 dm is associated with sociodemographic factors (age, gender, educational level, marital status, and country of birth), clinical factors (self - rated general health, hba1c), and psychological factors (depression, confidence, and knowledge). self - management in patients with t2 dm is associated with sociodemographic factors (age, gender, educational level, marital status, and country of birth), clinical factors (self - rated general health, hba1c), and psychological factors (depression, confidence, knowledge, and health literacy). health literacy in patients with t2 dm is associated with sociodemographic factors (age, gender, educational level, marital status, and country of birth), clinical factors (self - rated general health, hba1c), and psychological factors (depression, confidence, and knowledge). we used a cross - sectional design, patients with t2 dm attending the diabetes outpatient clinics at two centres in south western sydney australia. the study setting is a culturally diverse region with 52% of its population born overseas. of these, 59% speak a language other than english at home and 13% are new arrivals, settling in australia within the last five years. southwest sydney is also one of the largest and most rapidly growing districts within the sydney metropolitan area with approximately 21% of the population in the low socioeconomic stratum and only about 30% of its population completing secondary school. unemployment rates are high, with a mean rate of 8% (range 5%31%), ranking some of these suburbs (10 out of 38) among the most disadvantaged areas in australia. using convenience sampling, participants were recruited between may and december 2015 from the outpatient diabetes clinics of two large centres in the south western sydney local health district (swslhd). eligibility criteria included (1) age of 18 years and above ; (2) being diagnosed with t2 dm ; (3) having hba1c test in the last two years recorded in their clinical file. patients attending the outpatient clinics for their regular appointment with the diabetes educator, specialists, or dietician were identified and referred to the research team by the clinicians. one of the researchers then explained the purpose of study and sought consent from potential participants. consent included access to participants ' hospital records to retrieve their latest recorded clinical data including hba1c, height, and weight. researchers measured height and weight of participants to compute for their body mass index (bmi) after they have completed the questionnaire if this was not available in their clinical records. the initial questionnaire consisted of 63 questions including items from five validated instruments : the english language acculturation scale, phq-2 depression scale, diabetes knowledge, diabetes self - efficacy, and diabetes self - management. results of the pilot testing indicated that participants found the questionnaire to be too complex and lengthy, including those whose first language was english. following discussion with the research team, a consensus was reached to simplify the questionnaire and reduce the survey to only include 34 items. these were items related to demographic and clinical characteristics, three brief validated measures, namely, the (a) 3-item health literacy scale ; (b) 2-item phq-2 to assess depressed mood and anhedonia ; and (c) 16-item diabetes self - management scale. as single item questions have been found to be as valid and reliable as multiple - item scales, particularly when constructs that are being measured are fairly homogenous [32, 33 ] the two standardised scales that measured diabetes self - efficacy and diabetes knowledge were replaced with two single items ; namely, in a scale of 1 to 10 (1 being not confident to 10 being very confident), how confident are you that you will be able to manage your diabetes ? and in a scale of 1 to 10 (1 being very poor to 10 being excellent), how do you rate your knowledge about diabetes ? subjective assessment of perceived overall health was likewise assessed with a single question : in general, how would you describe your general health ? with a five - point likert scale response, excellent, very good, good, fair, and poor. this is a measure of the extent to which the items in the questionnaire consistently assess the same idea or concept. the internal consistency is expressed as a numerical value between 0 and 1 with scores between 0.70 and 0.90 indicating good correlation among items in the questionnaire. health literacy was evaluated using the 3-item health literacy scale and included the following : (1) how often do you have problems learning about your medical condition because of difficulty understanding written information ? and (2) how confident are you filling out forms by yourself ? and (3) how often do you have someone help you read hospital materials ? each item was rated with a 5-point likert scale with lower scores indicating lower health literacy. the 2-item patient health questionnaire (phq-2) was used to assess anhedonia and depressed mood over a 2-week period. this 4-point likert scale has been used extensively to determine the presence of depression, with higher scores indicating the presence of depression. a cut - off aggregate score of 2 has been found to have high sensitivity in detecting major depressive disorder (92.7%) and any depressive disorder (80.4%), with specificity of 73.7% and 80.4%, respectively. the 16-item diabetes self - management questionnaire (dsmq-16) was used in this study because of its brevity relative to other related scales. more importantly it had significantly stronger correlation with hba1c which is an important measure of diabetes control. the glycated haemoglobin level or hba1c is recommended in the monitoring of glucose control as it reflects the average blood glucose level over three months and has a good correlation with diabetes complications. a cut - off value of 7% has been recommended to indicate good control [37, 38 ]. sample size calculation for the outcome variable was based on low dsm rate of 50%. taking into account the 11 sociodemographic, clinical, knowledge, and psychological predictor variables as listed in the hypothesis and using the sample size calculation based on peduzzi. of n = 10k / p (where n is the minimum number of cases needed, k is the number of predictor variables, and p is the proportion of low dsm rate), the minimum sample size required was 220. frequencies and percentages were computed for categorical variables, and mean, median, and standard deviation and interquartile range were computed for continuous variables. as none of the continuous variables were normally distributed, age, duration of diabetes diagnosis, bmi, medical comorbidities, confidence, knowledge, health literacy, and dsmq-16 scores were dichotomised at the median. however, the phq-2 score was dichotomised at 2 to represent not depressed (0 - 1) and depressed (26) to be consistent with the high sensitivity of this cut - off shown in previous studies. while dichotomisation of variables may have the disadvantage of loss of analytical power and some important information, it has the benefits of reducing the variability in a skewed data and consequently the random error, making the results more accurate. in addition, it simplifies the results and thus presents findings that are easily understandable to a wide range of audience. furthermore, corrective logarithmic transformation calculations performed did not produce findings dissimilar to the dichotomised results obtained. the chi - square test was used to assess relationships between two categorical variables, and logistic regression analysis (forward conditional method, with listwise deletion of cases with missing data) was used to identify predictors of depression and predictors of dsm. the variables included in these regression analyses were demographic, clinical, and psychological characteristics of participants as previously described in the hypotheses. 11 refused to participate and 40 were excluded from the final analysis as they were not able to complete the questionnaire and/or they did not have a recorded hba1c in the last two years. cronbach 's alpha for the following instruments used in the study showed good item correlation and internal consistency : brief health literacy scale (= 0.83) ; depression scale (phq-2) (= 0.88) ; and the diabetes self - management scale (dsm-16) (= 0.79). the demographic profile of our sample approximated the statistical profile of the study setting. of the 224 participants included in the final analysis, 56% were born overseas and 7% were newly arrived migrants (less than 5-year duration of stay in australia) with 40% speaking a language other than english at home. table 1 shows the clinical, knowledge, and psychological characteristics of participants. although the overall health literacy score was high (median : 10 ; range : 012), the overall diabetes knowledge score was lower (median : 7, range : 0 to 10). while the overall dsm-16 score was high (median : 35, range : 7 to 47), 61% of the sample were obese (bmi : 30 kgm), and 81% had an hba1c over 7% with 30% having more than two comorbidities. forty - seven percent (47%) of the participants rated their general health as fair to poor. fifty percent of the participants had a score of 2 or more in the phq-2 suggesting the presence of depressed mood or anhedonia [27, 36 ]. those who had phq-2 score more than 2 were also found to have longer duration of diabetes diagnosis (more than 10 years), more comorbidities (more than 2), lower confidence, and less dsm behaviours. using the median score of 10 as the cut - off for the brief health literacy scale, group comparisons of sociodemographic, clinical, and knowledge and psychological factors were computed using the chi - square test. as shown in table 2, those who were older, had up to primary schooling, were overseas - born, were less confident about diabetes management, and had phq-2 score 2, had low health literacy. > 7%, indicating poor control, were more likely to have high health literacy (p = 0.047). using forward stepwise logistic regression analysis, four variables emerged as independent and significant predictors of low health literacy : (i) education ; (ii) country of birth ; (iii) glucose control as measured by hba1c ; and (iv) depression. in relation to educational attainment, those with up to primary schooling were more likely to have low health literacy (aor : 3.12, 95% ci : 1.17 to 8.30) ; conversely, those with postsecondary school were less likely to have low health literacy (aor : 0.35, 95% ci : 0.16 to 0.74). table 3 also shows that those born overseas were over two times (aor : 2.17, 95% ci : 1.21 to 3.91) more likely to have low health literacy ; similarly, those who were depressed were also over two times (aor : 2.01, 95% ci : 1.12 to 3.59) more likely to have low health literacy. unexpectedly, those with good glucose control, as indicated by hba1c of up to 7%, had low health literacy (aor : 0.41, 95% ci : 0.29 to 0.90). these four variables explained approximately 19% of the variance (nagelkerke r = 0.191), and hosmer - lemeshow goodness - of - fit statistics was not significant (chi - square = 2.937, df = 7, and p = 0.891), indicating good model fit. forward stepwise logistic regression analysis was likewise used to determine predictors of dsm, using the median of up to 35 as the cut - off score. four variables emerged as independent and significant predictors of low dsm : (i) younger age group (60 years) ; (ii) having postsecondary schooling ; (iii) low diabetes management knowledge score (7), and (iv) being depressed (phq-2 : 2). the magnitude of the adjusted odds ratios was similar for all four predictor variables, ranging from 2.30 to 2.58, explaining approximately 17% of the variance (nagelkerke r = 0.166). the hosmer - lemeshow goodness - of - fit statistics was not significant (11.635, df = 7, p = 0.113), indicating good model fit (table 4). in the current study, those with only primary school education, migrants, and those who reported depressed mood were more likely to have low health literacy. the relationship between education and health literacy has previously been reported ; while this was not an unexpected finding it was encouraging to find that participants with secondary schooling and above reported adequate health literacy. further analysis of those with primary school education revealed that they were also more likely to be older (79%) and overseas - born (70%), which has important implications for targeting this group considering the demographic profile of the current study setting and its being a major area for immigrant settlement in australia. this is particularly important given that migrants have a disproportionately high prevalence of diabetes and face a number of barriers such as limited english language proficiency, access issues, cultural beliefs, and socioeconomic factors that could have direct and indirect effects on health literacy and dsm [5, 4547 ]. compared with australian - born participants, migrants in this study had significantly lower confidence in their ability to manage their diabetes (p = 0.019). culturally tailored resources and lifestyle interventions addressing these barriers including fostering problem - solving skills, cultivating motivation by setting appropriate goals, and consistent follow - up could be important tools to build confidence for self - managing diabetes in this population. depression has been found to affect diabetes control through both physiological pathways, effects of treatment, and/or increasing demand for psychological and behavioural tasks involved in dsm. our study confirmed the finding that depressed mood and anhedonia are associated with low self - efficacy in carrying out dsm. the phq-2 is sensitive, quick, and easily administered in a busy clinic setting which could allow for referral for psychological support. given the negative influence of depression on diabetes control through several mechanisms, an important recommendation from this study would be that clinicians consider screening all patients who attend diabetes clinics for depression using the phq-2. an unexpected outcome of our study was that poorer glucose control, as demonstrated by high hba1c, was correlated with higher health literacy. this may be explained by two factors : the health literacy scale used in this study measured general health literacy rather than health literacy specific to diabetes and therefore may not be suitable for the sample in this study. for example, one of the questions in this tool how often do you have someone help you read hospital materials ? was answered by a number of participants with never, because there was never anybody there to help me, i had to read them by myself, which reflected lack of support rather than a high level of health literacy. secondly, having high health literacy may not necessarily translate into self - management actions that could result in better biochemical diabetes control. this contention is supported by the findings in this study that those who were highly educated had high health literacy but reported low dsm however ; those who had higher diabetes knowledge score had higher dsm. a study on english - speaking adults with type 2 diabetes likewise found that health literacy (measured using s - tofhla) was not associated with hba1c or with the presence of diabetes complications. in contrast, schillinger. found an association between low health literacy, poor diabetes control, and retinopathy in an ethnically diverse population. older participants in this study practiced more dsm although they had lower health literacy, perhaps because of heightened awareness of mortality whereby health becomes a main concern. it could also be that older participants spent more time engaging in dsm tasks as they had less external competing priorities compared with younger and more educated participants who, presumably, had job demands and family concerns which took priority over dsm. this study found no significant correlation between health literacy and dsm ; however, it was lack of knowledge about diabetes specifically that predicted lower dsm. a number of variables measured in this study were self - assessed constructs that were useful in illuminating the perceptions of participants regarding their resources in effecting dsm. for example, despite more than half of the participants ' rating their health as good (53%) and reporting adequate self - management (54%), objective measurements of bmi and hba1c showed that a high number (61% and 81%, resp.) this discordance between what participants perceived as good dsm and clinical parameters of good control is also consistent with previous studies of people with diabetes and other chronic conditions. for example, in a sample of rural taiwanese residents huang. found that those who had hba1c 7%, indicating a poor level of control, assessed their health as good. large population - based studies have also demonstrated a disconnect between perceived and actual health in approximately one out of five individuals, with younger age, ethnicity (non - hispanic blacks), and higher socioeconomic status predicting this disconnect. this discrepancy between self - perceived health status and objective measures of diabetes control is likely to have clinical implications for dsm education as improving the convergence between perceived and actual health may help promote self - management and, ultimately, improve health outcomes. it is therefore important for health professionals to stress the importance of maintaining a healthy weight and achieving optimal hba1c in patient diabetes education programs. the participants were sampled from a cohort that is already accessing the diabetes clinics of two major centres in the region. this may not be representative of the general population with type 2 diabetes. secondly, the study was cross - sectional and, given the chronicity of diabetes, a longitudinal study may have been more useful in assessing the effect of the variables under examination in relation to self - management over a period of time. thirdly, the use of chew 's brief measure of health literacy may not accurately have reflected the level of health literacy in our participants. another limitation of the study was the lack of recent (within the last three months) hba1c level, as some of the hba1c results used in this study were taken within the last two years (20142016) and, therefore, may not have been contemporaneous with data collection. finally, as with all studies that collect data using self - report measures, social desirability bias may have impacted on these findings and, given the discrepancy between self - reported health and hba1c, this seems possible. notwithstanding these limitations, this study presented findings that refute the relationship between health literacy and dsm in a culturally diverse urban population. sociocultural research exploring the factors affecting dsm is important to determine areas that may be amenable to implementing cost - effective interventions. in culturally diverse populations with t2 dm, while sociocultural factors are determinants of health literacy, this study has demonstrated that it was not health literacy per se but having knowledge specific to diabetes that was more important in predicting the practice of dsm behaviours. addressing the discordance in perception of health and objective measures of diabetes control in dsm education may improve patient compliance and monitoring. importantly, the finding that depression was a significant predictor of both low health literacy and low dsm underscores the need for clinicians to screen for depression to ensure that people with t2 dm are provided with appropriate support which in turn may enable them to engage in self - managing their condition. | despite an increasing focus on health literacy in the clinical setting and in the literature, there is still ongoing debate about its influence on diabetes self - management. the aim of the study was to examine the relationships of sociodemographic, clinical, and psychological factors on health literacy and diabetes self - management. a cross - sectional survey was undertaken on 224 patients with type 2 diabetes at two diabetes centres in sydney, australia. findings showed that people with low health literacy were more likely to (a) have lower educational attainment ; (b) be migrants ; and (c) have depressed mood. unexpectedly, those who met hba1c threshold of good glucose control were more likely to have low health literacy. predictors of low diabetes self - management included (a) younger age group (aor : 2.58, 95% ci : 1.244.64) ; (b) having postsecondary education (aor : 2.30, 95% ci : 1.055.01) ; (c) low knowledge of diabetes management (aor : 2.29, 95% ci : 1.254.20) ; and (d) having depressed mood (aor : 2.30, 95% ci : 1.304.06). the finding that depressed mood predicted both low health literacy and low diabetes self - management stresses the importance of screening for depression. increasing people 's understanding of diabetes self - management and supporting those with depression are crucial to enhance participation in diabetes self - management. |
deficits of motor and sensory functions after stroke on the side contralateral to the damaged hemisphere are often evident1, whereas the ipsilateral side may be primarily regarded as normal or unaffected. however, there is increasing evidence of the presence of subtle motor deficits in motor performance on the ipsilateral side as well2, 3. ipsilateral motor deficits emerge during the acute phase and demonstrate chronic persistence3,4,5 ; the reasons for ipsilateral motor deficits are still unclear. clinical assessment tools may not be sufficient for differentiating ipsilateral motor deficits ; however, deficits in dexterous motor and coordination function on the ipsilateral side have been identified in laboratory testing2, 6,7,8. however, kinematic deficits in the ipsilateral upper limb in performance of various specific motor tasks requiring dexterity and coordination, such as a tracking task, a goal - direction movement, and a tapping task, have been found in recent studies2, 6, 8, 11. on the basis of these observations, several possible mechanisms for ipsilateral motor deficits have been suggested, such as disrupted counterbalance of each hemisphere, dysfunction of the uncrossed corticospinal track, or the different roles of both sides in hemispheric functions6, 7, 11,12,13,14,15. as mentioned above, patients with brain damage suffer from ipsilateral motor deficits in performance of the ipsilateral upper limb. until now, most studies of ipsilateral deficits in stroke patients have concentrated on the motor, rather than sensory deficits. therefore, the purpose of the current study was to investigate the presence of motor and sensory deficits in the ipsilateral upper limb, and to examine the correlation between the two variables in patients with stroke using a tracking and reposition sense test. fifty hemiparetic stroke patients (25 patients with right brain injury and 25 patients with left brain injury) referred to a local rehabilitation hospital were consecutively recruited in the order of their registration. the inclusion criteria were ; first ever stroke confirmed by medical history and brain mri ; right handed individual verified by the edinburg handedness inventory ; no symptoms of unilateral neglect or hemianopsia ; no cognitive problem (mini - mental state examination>24 points) ; no apraxic behavior (ideomotor apraxia score developed by ambosoni. (> 11 points)16 ; and no musculoskeletal dysfunction in the unaffected upper limb. we recruited 40 sex- and age - matched normal control subjects. to control the known effects of hand asymmetry, the accuracy and proprioceptive tests were performed by the 20 control subjects using their dominant right hand, and the remaining subjects used their non - dominant left hand. all subjects gave their written informed consent prior to participation, and this study was approved by the local ethics committee. tracking and joint position sense tests were conducted for the hand ipsilateral to the damaged hemisphere of the patients, and with the corresponding hand of the same side of the control subjects. all subjects were seated in front of a table, with the forearm comfortably supported and the elbow flexed at 90. a plastic frame with an embedded potentiometer was used to measure the accuracy of movement and proprioceptive sense in the metacarpophalangeal (mp) joints. the potentiometer detected flexion / extension motion of the mp joint, and transmitted the analog signal to a computer with analog - to - digital data acquisition software, that sampled the signal at a frequency of 200 hz. in the tracking task, the subject was instructed to track the red target sine wave displayed for 15 seconds on the computer screen as accurately as possible. the response sine wave made by the subject was displayed as a black solid line, which tracked up as the mp joint was extended, and tracked down as the mp joint was flexed. accuracy of the motor performance was analyzed by an accuracy index (ai), which was normalized to the range of motion of the mp joint of each individual subject, and takes into account the differences between subjects in the excursion of the target and response waves17.ai = 100(p e)/p where e is the root mean square (rms) error between the target line and the response line, and p is the size of the subject s target pattern, calculated as the rms difference between the sine wave and the midline dividing the upper and lower phases of the sine wave. the degree of p is determined by the scale of the vertical axis of the range of subject s mp joint motion. prior to the evaluation, three practice trials were provided after one demonstration, using sine waves which were different from the sine waves used in the actual test to prevent a learning effect. the joint position sense was evaluated on the mp joint ipsilateral to the damaged brain hemisphere of the patients, and the joint on the corresponding side of the control subjects. in addition, the same experimental apparatus and environment used for the performance of the tracking task were used. the subjects were instructed to actively reproduce the position of the mp joint which was passively positioned by the examiner. three different passively - positioned angles were randomly presented, in terms of 50%, 70%, and 90% flexion of the total range of motion of the mp joint. the mean value of three trials of the joint reposition errors between the passively - positioned angles and the actively - positioned angles was calculated. the test was performed to analyze the differences in sex distribution between the patient and control groups. the independent t - test was performed to determine the significance of differences in age and accuracy of the tracking task / joint position sense. in addition, correlation between the ai and joint position sense was investigated using pearson s correlation coefficient. chicago, il, usa) was used for the statistical analysis of all data, and statistical significance was accepted for p values < 0.05. no significant differences were observed between the two groups in terms of distribution of sex and age. the meanssd of the accuracy index and reposition error score of both groups are shown in table 2. in terms of motor function, the stroke group showed a lower accuracy index in the mp joint than the control group. a higher score of reposition errors in the joint reposition test in relation to sensory function was observed in the stroke group, compared to the control group. the results of the statistical analysis indicate that both measures in the stroke group were significantly different from the control group (p<0.05). ipsilateral sensory deficits showed significant correlation with motor deficits (r= 0.549) (p<0.001) (table 2). in the current study, we attempted to assess motor function using a tracking task for visuomotor coordination, and proprioceptive sense using a joint reposition test for the ipsilateral upper limb. our findings reveal a lower accuracy index in the tracking task, and higher error scores in the joint reposition test in the stroke group, compared to sex- and age - matched normal subjects. in addition, there was a negative correlation between the motor and sensory deficits, indicating stroke patients would have difficulty in performing complicated motor tasks requiring delicate sensoriomotor functions using pure integrity of movement accuracy and proprioceptive sense. our present results are in accordance with those of several previous studies2, 8, suggesting the presence of motor deficits in upper limbs ipsilateral to the damaged hemisphere in the visuomotor tracking task. a possible mechanism for the motor dysfunction in the ipsilateral hemisphere of stroke patients has been suggested by previous studies, which reported bilateral hemisphere activation when normal subjects executed a unilateral upper limb task18,19,20,21. if functional integrity of both the right and left brain cortex is necessary for normal motor control of the upper limb, it is expected that the ipsilateral upper limb would be affected after stroke. in the present study, ipsilateral sensory deficits related to proprioceptive sense were also observed. according to our findings, ipsilateral sensory deficits may be connected with bilateral hemisphere activation during performance of motor tasks. the primary sensory cortex (s1) conveys efferent projection to the posterior parietal cortex (brodmann s area 5 and 7), which is connected bilaterally through the corpus callsosum. therefore, as suggested by our results, it is possible that disturbance of transcallosal transfer after unilateral brain damage may lead to ipsilateral sensory deficits. in addition, there is a close relationship between sensory and motor function, because the posterior parietal cortex is connected with the frontal motor areas. thus, the posterior parietal cortex would have an effect on the initial movement and sensory feedback during performance of a complex motor task22. on this basis, the correlation shown in our study between ipsilateral motor deficits and sensory deficits can be explained. these findings imply that interest in the ipsilateral side of stroke patients should focus on ipsilateral sensory deficits as well as ipsilateral motor deficits. motor deficits of the ipsilateral limbs of individuals with stroke have been reported in many studies ; besides, our study showed sensory deficits related to proprioceptive sense. on the basis of these results, we think that the difficultly stroke patients experience in task performance using the ipsilateral upper limb may be affected by both motor and sensory deficits. studies on recovery of motor deficits on the ipsilateral side after stroke are in progress. jung.14 reported that motor deficits in the ipsilateral upper limb show maximal recovery within one month after onset of stroke, but the deficits do not completely recover. thus, it will be necessary to study the recovery of ipsilateral sensory deficits after stroke onset, and we will be investigating this. we acknowledge that our study had some limitations, in that the effects of specific lesion location and the extent of the damage were not identified. therefore, future studies will be required in order to determine more detailed mechanisms of other movement and sensory deficits, other than proprioceptive sense, in the ipsilateral upper limb of patients with unilateral brain injury. | [purpose ] previous studies have reported on motor deficits in the ipsilateral upper limbs (ul) of a damaged brain hemisphere in motor tasks. however, little is known about sensory deficits on the ipsilateral side. therefore, we investigated whether both motor and sensory function of the ipsilateral ul are affected in patients with stroke. [subjects and methods ] fifty patients with unilateral stroke and 40 age- and sex- matched normal subjects participated in this study. subjects were evaluated on performance of a tracking task for motor function, and by the joint reposition test for integrity of proprioceptive sense in the ipsilateral ul. [result ] the comparison of the stroke group and the control group showed significant differences in performance of the tracking task and the joint reposition test. the accuracy index for the tracking task showed significant correlation with the error score for the joint reposition test in the stroke group. [conclusion ] these results suggest that the ipsilateral ul of stroke patients has impairment in sensory function which is related to proprioceptive sense, along with motor deficits. therefore, we think that the difficulty stroke patients experience with motor tasks for the ipsilateral ul is induced by diminished integrity of sensorimotor function due to both sensory and motor deficits. |
fusion genes play important roles in tumorigenesis and cancer progression (1). perhaps, the best - characterized case, bcr - abl1 fusion is the cause of the chronic myelogenous leukemia and the target of the anticancer drug, gleevec (imatinib) (2). identification of fusion genes thus can lead to the discovery of diagnostic biomarkers and therapeutic targets as well as understanding the molecular basis of tumorigenesis. initial studies have concentrated on the hematological cancer in large part due to the sample availability (1,3). over the last few years, however, there has been significant progress in fusion gene identification in solid tumors. importantly, chinnaiyan and colleagues (47) reported several cases of gene fusion in prostate cancer identified via integrative analysis of microarray data (tmprss2 and ets transcription factors) and transcriptome resequencing. (8) identified the transforming eml4-alk fusion gene in nonsmall cell lung cancer (nsclc) using a function - based screening procedure. a proteomic study of phosphotyrosine kinases also revealed the ros - alk fusion in nsclc cell lines (9). these cases clearly indicate that gene fusions play an important role in cancer development in solid tumors. recent progress in next - generation sequencing (ngs) techniques provides a tremendous opportunity for fusion gene discovery. notably, paired - end sequencing, now a frequent if not standard procedure, compensates for the short read length of ngs techniques (10). sequencing and analyzing whole genome or transcriptome lead to identification of many chromosomal aberrations including translocations, amplifications and deletions. short read sequencing strategies were successfully applied to find fusion genes in prostate, lung and breast cancer cell lines (5,1113). the mitelman s database and the sanger cancer genome project (cgp) are the notable examples of collecting fusion genes from literature reports (1,3). the cosmic and cancergenes database include other types of chromosomal aberrations such as mutations, amplifications and deletions (14,15). currently, the mitelman s database and the sanger cgp collection include 150 and 270 gene pairs, respectively, involved in gene fusion events. bioinformatics analysis of public transcriptome sequences in the genbank also provides ample cases of fusion transcript candidates. the former results from fusion between two different chromosomes i.e. translocation and the latter originates from single chromosomes due to deletion, inversion or amplification of large dna segments. romani. (16) analyzed the mrna sequences and hahn. (17) analyzed the mrna and est sequences to identify fusion transcripts between different chromosomes. similar data - mining approaches were adopted to construct databases of fusion genes such as chimerdb (18), hybriddb (19) and ticdb (20) although computational details vary considerably. chimerdb is designed to be a knowledgebase of fusion genes that encompass the fusion transcripts identified from bioinformatics analysis of transcript sequences in the genbank and various public resources such as the sanger cgp (3), omim (21), mitelman s database (1) and pubmed. the updated version, chimerdb 2.0, features (i) algorithm modifications for increased sensitivity, (ii) extensive coverage of recent publications and relevant databases, (iii) analysis of ngs data in the ncbi s short read archives (sra) and (iv) the enhanced user interface and the novel alignment viewer to support diverse types of search. chimerdb 2.0 would be the most extensive catalog of fusion genes and transcripts publically available to date. the basic strategy is virtually identical to the procedure used in chimerdb 1.0 where the genomic alignments of transcript sequences were analyzed to identify the fusion transcripts. we will describe the major differences and modifications here with more details provided in the supplementary data and in the web site documentation. the most important change is relieving the boundary conditions based on our observation that many reported cases did not satisfy the strict condition that the fusion boundary of the transcript should match the exon boundary. we consider the alignment with multiple exons or single exon with matching boundaries as features of reliability. entry to class a requires that both head and tail transcripts consist of multiple exons or of single exons with matching boundaries, thus being the most reliable cases. only one or neither of the head and tail genes satisfying this condition would put a given transcript in class b or c, respectively. for example, we removed the entries whose genomic alignments have many hits of comparable qualities in different genomic regions even though these genomic regions are not marked as repeat sequences. this step was necessary to avoid possible complications arising from gene duplication, pseudo - genes and retroposon sequences. in addition, the number of exons was estimated by using the exonerate program rather than the blat alignments (22,23). the computational pipeline for 454 sequences from the sra is identical with the est processing since the sequence length is comparable. solexa reads are generally too short and we used them just as supporting evidence for the existence of fusion transcripts. solexa transcriptome reads were aligned using the bwa program (24) against the fusion transcripts to determine if multiple reads cover the fusion point. the head and tails genes, not being adjacent, should be separated by > 1 mb. we exclude the fusion cases between adjacent genes, which we named co - transcription and intergenic splicing, in order to limit our focus to genuine fusion genes originating from chromosomal aberrations. we also downloaded ngs transcriptome sequences in the sra that included 1.2 million 454 sequences and 762 million solexa reads. the human genome map used for transcriptome analysis was the ncbi build 36.1 (hg18 in the ucsc genome browser database) (25). pubmed articles related to fusion genes were retrieved by using the entrez query of chromosomal translocation or fusion gene and the mesh terms on human cancers. abstracts of 3618 articles were manually examined to obtain information on the fusion gene pairs. omim records retrieved by the query of translocation or fusion (may 2009) were also manually examined to find fusion gene pairs. as for the sanger cgp data, the cancer gene census list released on december 2008 was downloaded from the web site. mitelman s database was obtained from the web site for the recurrent chromosome aberrations in cancer (http://cgap.nci.nih.gov/chromosomes/recurrentaberrations) as of april 2009. entries with specific gene symbols for both head and tail genes were retained as part of our literature - related data. the basic strategy is virtually identical to the procedure used in chimerdb 1.0 where the genomic alignments of transcript sequences were analyzed to identify the fusion transcripts. we will describe the major differences and modifications here with more details provided in the supplementary data and in the web site documentation. the most important change is relieving the boundary conditions based on our observation that many reported cases did not satisfy the strict condition that the fusion boundary of the transcript should match the exon boundary. we consider the alignment with multiple exons or single exon with matching boundaries as features of reliability. entry to class a requires that both head and tail transcripts consist of multiple exons or of single exons with matching boundaries, thus being the most reliable cases. only one or neither of the head and tail genes satisfying this condition would put a given transcript in class b or c, respectively. for example, we removed the entries whose genomic alignments have many hits of comparable qualities in different genomic regions even though these genomic regions are not marked as repeat sequences. this step was necessary to avoid possible complications arising from gene duplication, pseudo - genes and retroposon sequences. in addition, the number of exons was estimated by using the exonerate program rather than the blat alignments (22,23). the computational pipeline for 454 sequences from the sra is identical with the est processing since the sequence length is comparable. solexa reads are generally too short and we used them just as supporting evidence for the existence of fusion transcripts. solexa transcriptome reads were aligned using the bwa program (24) against the fusion transcripts to determine if multiple reads cover the fusion point. the head and tails genes, not being adjacent, should be separated by > 1 mb. we exclude the fusion cases between adjacent genes, which we named co - transcription and intergenic splicing, in order to limit our focus to genuine fusion genes originating from chromosomal aberrations. we also downloaded ngs transcriptome sequences in the sra that included 1.2 million 454 sequences and 762 million solexa reads. the human genome map used for transcriptome analysis was the ncbi build 36.1 (hg18 in the ucsc genome browser database) (25). pubmed articles related to fusion genes were retrieved by using the entrez query of chromosomal translocation or fusion gene and the mesh terms on human cancers. abstracts of 3618 articles were manually examined to obtain information on the fusion gene pairs. omim records retrieved by the query of translocation or fusion (may 2009) were also manually examined to find fusion gene pairs. as for the sanger cgp data, the cancer gene census list released on december 2008 was downloaded from the web site. mitelman s database was obtained from the web site for the recurrent chromosome aberrations in cancer (http://cgap.nci.nih.gov/chromosomes/recurrentaberrations) as of april 2009. entries with specific gene symbols for both head and tail genes were retained as part of our literature - related data. chimerdb 2.0 includes 9358 genes, 117 47 fusion gene pairs and 9358 fusion transcripts. figure 1a shows the number of fusion gene pairs according to the information source, counting just the class a candidates for the transcriptome analysis. as expected, transcriptome analysis is the most ample source of fusion gene pairs and includes 2699 candidates, compared with 300 candidates with the original version. only 96 cases of those have the literature evidence from other resources, implying that the majority of candidates remain to be verified experimentally. figure 1.the number of gene pairs in the chimerdb 2.0 according to the information source. comparison between databases for just the literature - based cases is also revealing (figure 1b). the overlaps between sanger cgp, omim, mitelman s database and our own pubmed collections are much smaller than expected, and 327 cases out of 556 fusion gene pairs are found only in one of the literature databases. this reveals the incomplete coverage of manual efforts and the necessity for integration of various databases. chimerdb 2.0 includes 537 genes and 556 fusion gene pairs from literature publications, which is a significant increase than other single database. we found 1046, 6178 and 2674 fusion transcripts from mrna, est and 454 sequences, respectively. in sum, table 1.statistics of transcriptome analysis in chimerdb 2.0classinterchromosomalintrachromosomalaa + ba + b + caa + ba + b + cno. of transcripts1900607388335158871065 mrna479855900110143146 est124739725397396677781 ngs17412462536967138no. of genes (9358 in total)28556976871070312761543no. of gene pairs22097362106394909091108 with multiple transcripts2788071137144220246 with solexa evidence141415656767 statistics of transcriptome analysis in chimerdb 2.0 a significant proportion of gene pairs (422) in the class a features multiple fusion transcripts, thus indicating an even higher chance of representing genuine fusion. we also searched the short reads from the solexa transcriptome sequences in the sra that span the fusion boundary of our candidates. one of these fusions, crtc1-maml2, has been reported to be a frequent feature of mucoepidermoid carcinoma (26). a close look reveals that a major portion consists of genes belonging to the same family or of pseudogenes. it remains to be seen whether they are from alignment ambiguity or genuine fusion events. most importantly, we support diverse types of search targeting transcripts, genes, gene pairs, cytobands and tissues. as for the fusion transcripts, users may choose the reliability class, number of exons, boundary types for the head and tail genes. search result page shows the gene pairs and the disease - related information in omim, sanger cgp and mitelman s database with the title and journal name of pubmed articles. more info link shows the detailed information on fusion genes and transcripts as seen in the bottom panel. alignment view shows the hypothetical fusion gene (head gene in blue, tail gene in red) and the candidate fusion transcript (in magenta) along with the ucsc - annotated genes (exons in black, utrs in grey). the repeat regions and the pfam domains are indicated in green and orange colors, respectively. search result page shows the gene pairs and the disease - related information in omim, sanger cgp and mitelman s database with the title and journal name of pubmed articles. more info link shows the detailed information on fusion genes and transcripts as seen in the bottom panel. alignment view shows the hypothetical fusion gene (head gene in blue, tail gene in red) and the candidate fusion transcript (in magenta) along with the ucsc - annotated genes (exons in black, utrs in grey). the repeat regions and the pfam domains are indicated in green and orange colors, respectively. the result page includes the gene pairs, disease information, pubmed articles and linkouts to diverse resources. pubmed articles are displayed with the title and journal name for user convenience. except for the few cases without the fusion sequence available, we show the alignment picture that includes the gene structure, domains and repeat sequences. we also provide information on tissue and pathology type from the genbank records and cgap (cancer genome anatomy project) library data. links to the ucsc genome browser are provided to allow users to examine the detailed gene structure and alignment. most importantly, we support diverse types of search targeting transcripts, genes, gene pairs, cytobands and tissues. as for the fusion transcripts, users may choose the reliability class, number of exons, boundary types for the head and tail genes. search result page shows the gene pairs and the disease - related information in omim, sanger cgp and mitelman s database with the title and journal name of pubmed articles. more info link shows the detailed information on fusion genes and transcripts as seen in the bottom panel. alignment view shows the hypothetical fusion gene (head gene in blue, tail gene in red) and the candidate fusion transcript (in magenta) along with the ucsc - annotated genes (exons in black, utrs in grey). the repeat regions and the pfam domains are indicated in green and orange colors, respectively. search result page shows the gene pairs and the disease - related information in omim, sanger cgp and mitelman s database with the title and journal name of pubmed articles. more info link shows the detailed information on fusion genes and transcripts as seen in the bottom panel. alignment view shows the hypothetical fusion gene (head gene in blue, tail gene in red) and the candidate fusion transcript (in magenta) along with the ucsc - annotated genes (exons in black, utrs in grey). the repeat regions and the pfam domains are indicated in green and orange colors, respectively. the result page includes the gene pairs, disease information, pubmed articles and linkouts to diverse resources. pubmed articles are displayed with the title and journal name for user convenience. except for the few cases without the fusion sequence available, we show the alignment picture that includes the gene structure, domains and repeat sequences. we also provide information on tissue and pathology type from the genbank records and cgap (cancer genome anatomy project) library data. links to the ucsc genome browser are provided to allow users to examine the detailed gene structure and alignment. korea science and engineering foundation (kosef) funded by the korea government (mest) (r01 - 2008 - 000 - 20818 - 0 and 2007 - 03983) ; grant from biogreen 21 program of the korean rural development administration (20070401034010) ; systems biology infrastructure establishment grant provided by gwangju institute of science and technology in 2009 through ewha research center for systems biology (ercsb) ; grant from the national core research center (ncrc) program (r15 - 2006 - 020) of the kosef funded by the mest. funding for open access charge : korea science and engineering foundation (r01 - 2008 - 000 - 20818 - 0). | chromosome translocations and gene fusions are frequent events in the human genome and have been found to cause diverse types of tumor. chimerdb is a knowledgebase of fusion genes identified from bioinformatics analysis of transcript sequences in the genbank and various other public resources such as the sanger cancer genome project (cgp), omim, pubmed and the mitelman s database. in this updated version, we significantly modified the algorithm of identifying fusion transcripts. specifically, the new algorithm is more sensitive and has detected 2699 fusion transcripts with high confidence. furthermore, it can identify interchromosomal translocations as well as the intrachromosomal deletions or inversions of large dna segments. importantly, results from the analysis of next - generation sequencing data in the short read archives are incorporated as well. we updated and integrated all contents (genbank, sanger cgp, omim, pubmed publications and the mitelman s database), and the user - interface has been improved to support diverse types of searches and to enhance the user convenience especially in browsing pubmed articles. we also developed a new alignment viewer that should facilitate examining reliability of fusion transcripts and inferring functional significance. we expect chimerdb 2.0, available at http://ercsb.ewha.ac.kr/fusiongene, to be a valuable tool in identifying biomarkers and drug targets. |
human papillomaviruses (hpvs) are small epitheliotropic viruses belonging to the papillomaviridae family and consist of 8 kb double stranded circular dna surrounded by a nonenveloped capsid. the involvement of hpv infection in a malignant transformation was first discovered by zur hausen, who identified a subgroup of hpvs as etiological agents of cervical cancer [13 ]. more than 120 types of hpv have been identified and about one - third of them infect the genital tract [4, 5 ]. these sexually transmitted viruses are classified either as low - risk, or nononcogenic hpv - type (e.g., hpv-6 and -11), or as high - risk, or oncogenic (e.g., hpv-16 and hpv-18) [4, 5 ], and recently they have also been associated with nongenital cancers, particularly head and neck tumours [7, 8 ]. hpv e6 and e7 are the main transforming viral proteins that work together to immortalize infected cells [9, 10 ]. e7 oncoprotein targets the retinoblastoma protein (prb) for degradation causing a release of e2f transcription factor and the constitutive expression of e2f - responsive genes with premature activation of s - phase. normally, this condition leads to p53-dependent apoptosis, but hpv has evolved to inhibit the tumour suppressor p53 functions, indirectly by inducing its ubiquitylation and proteasomal degradation or directly by binding p53 interfering with its transcriptional activity. moreover, hpv oncoproteins contribute to the progressive expansion of tumours by stimulating proangiogenic cytokines, especially vegf (vascular endothelial growth factor), responsible for the recruitment of new blood vessel capillaries from preexisting mature vessels [1113 ]. besides those, several other e7 and e6 transforming activities (reviewed in [9, 10 ]), probably assisted by hpv e5, contribute to maintaining a high proliferative and inhibited apoptosis state that leads to the accumulation of mutations and genomic instability in persistently infected cells, which results in full malignant progression and cancer development. to date several studies have investigated the role of hpv in prostate carcinogenesis with very contradictory and not fully conclusive results. in the most recent literature, some studies suggest a positive association between hpv infection and prostate cancer risk [1417 ], whereas others do not reveal any correlation [1824 ]. in this study, we investigated the prevalence of hpv infection and the prognostic impact for overall survival in a cohort of patients with primary prostate cancer. detailed histopathological and clinical data were retrospectively collected for 150 patients, who were diagnosed with primary prostate cancer in a single institution of the northeastern area of italy from january 1992 to december 1994. inclusion criteria were (i) the diagnosis of prostate cancer and (ii) the availability of formalin - fixed and paraffin - embedded tissues for immunohistochemical staining and molecular analyses. no fine needle biopsies were used for this study, and consequently patients with solely fine needle biopsies were excluded. in detail, following the abovementioned criteria, cases refer to patients diagnosed in the university hospital of trieste from 1 january 1992 to 31 december 1994. the use of formalin - fixed and paraffin - embedded prostate cancer tissues and the related clinical information were approved by the ethical committee of the university of trieste (report 23 ; 5.10.2009) before the beginning of the study. each patient 's haematoxylin & eosin (h&e) slides were reviewed by an expert pathologist (rb), who marked the representative tumour areas to be analysed. tissue microarrays (tmas) were constructed by the use of the entire cohort 's ffpe tissues using galileo tma ck3500 (integrated systems engineering, milano, italy), as previously described. one section from each tma block was stained with h&e to confirm the presence of carcinoma. immunohistochemical staining (ihc) was performed on 4 m thick tissue sections of the tma block following the standard procedures. to detect hpv e7 protein, cervimax ihc kit (valdospan gmbh, austria) immunostaining was performed manually with the vectastain universal elite abc kit (vector laboratories, burlingame, ca, usa). in short, after deparaffinisation, alcohol washings, and endogenous peroxidase blocking, tmas were treated with 3% bsa for aspecific sites blocking and subsequently incubated with e7 mab (1 : 200 dilution) for 1 hour at room temperature. for the visualization of reaction dab substrate kit for peroxidase (vector laboratories, burlingame, ca, usa) was used. positive and negative control slides were used in each ihc assay. for evaluation of the immunostaining, the positively stained cells were counted across 3 high - power fields at 40x magnification ; cytoplasmatic and nuclear staining were recorded separately. for ihc, the specificity of hpv e7 signal was assessed with a preabsorption test performed on a prostate cancer. two aliquots of the working dilutions of mab e7 were used : one was mixed with the immunizing peptide (kindly provided by valdospan gmbh, austria) in a stoichiometrical ratio of 1 : 5 and the other was used undiluted. twenty - two cancer cases, 19 positive and 3 negative for hpv e7 immunodetection, were submitted to dna extraction using a homemade protocol. in short, dewaxed tissues sections were incubated overnight at 55c with proteinase k. crude extracts were purified by phenol / chloroform and concentrated by ethanol precipitation. to check the availability and quality of the dna, extracts were submitted to multiplex pcr using the specimens control size dna ladder (in vivo scribe technologies), which enables amplifying 100, 200, 300, 400, and 600 bp dna fragments. dna extracts were tested for the presence and type of hpv with a pcr - based system by using the gp5+/6 + consensus primers set (5-tttgttactgtggtagatactac-3 and 5-gaaaaataaactgtaaatcatattc-3), which targets conserved sequences in the l1 gene and enables amplifying a wide spectrum of hpv types. pcr was run for 45 cycles, and then products were run on a 2% metaphor agarose gel and 14 samples were purified by the use of qiaquick pcr purification kit (qiagen) following the manufacturer 's instruction. after this step, purified amplicons were submitted to sanger sequencing for genotyping (bmr genomics, padua, italy). reamplification of purified pcr products and nested pcr were avoided because of the higher probability of pcr contamination. overall survival (os), defined as the time between the date of diagnosis and the date of death or the last follow - up (fu) observation, was the end point evaluated in this study. the kaplan - meier method was used to generate cancer - specific survival curves and differences between groups were analysed using the log - rank test. a multivariate cox proportional hazards analysis was used to evaluate the association of os with each prognostic factor. a test was applied to determine whether age at diagnosis was equally distributed between dichotomized groups for each variable used for os analysis. college station, tx : statacorp lp) and a value of p 0.05 was considered statistically significant. table 1 summarizes the baseline characteristics of the 150 patients included in the study. the median age at diagnosis was 72.18 years (range : 50.57 to 91.13 years) and the median fu time was 5 years (range : 0.1 to 18.85 years). nuclear e7 staining, which is a marker of hpv infection, was positive in 112 (74.67%) patients at the time of diagnosis. one hundred thirty - two (88%) patients died at the end of the observation period and those patients who were still alive were censored for survival analyses. considering the elevated median age at diagnosis and the high mortality rate of our cohort, we performed a test that demonstrated that there were no significant differences in distribution of age at diagnosis in the nuclear grade (= 1.51, degree of freedom (df) = 2, p = 0.47), capsule infiltration (= 0.046, df = 1, p = 0.83), gleason score (= 3.64, df = 1, p = 0.06), and nuclear e7 expression (= 0.87, df = 1, p = 0.35) groups for os analysis. the specificity of the e7 mab signal detected by ihc was assessed by the pre - absorption test. as reported in figure 1, the staining pattern was completely eliminated after incubation of the antibody with the immunizing peptide. diffuse or granular immunostaining was observed. in some cases, a combination of both was detected. cells characterised by a diffuse or focal staining pattern were considered positive. a representative staining of e7 hpv e7 positivity prevailed at the nuclear level with intensity varying from 1 to 3. although nuclear immunostaining was the most represented one, cases presenting with cytoplasmatic positivity were also observed (data not shown). specimen control size was successful in all prostate cancer tissues ; in detail in 19 out of 22 samples 300 bp fragments were detectable and in 3 out of 22 cases 200 bases fragments were visualized. hpv pcr amplification resulted positively in 18 out of 19 specimens positive for hpv e7 immunodetection with variable intensities (figure 1(c)). variability and failure of pcr amplification in some samples could be due to the low dna quality in some formalin fixed - paraffin embedded tissues. it is well known, indeed, that degradation of nucleic acids represents a limit in the detection of hpv by extractive methods in formalin fixed - paraffin embedded biopsies [32, 33 ]. all purified amplification products were submitted to sequencing ; in 9 out of 14 specimens sequencing was successful and showed that in those cases the hpv genotype was 16 ; in the remaining ones the sequence was not readable because of the inadequate amount of pcr products submitted to sanger reaction (data not shown). typical results of sequencing were as follows : atgtgctgcatatctacttcagaaactacatataaaaatactaactttaaggagtacctacgacatggggaggaatatgatttacagtttatttttca, which gave 98 - 99% of identity with human papillomavirus type 16. association of each factor with survival time was calculated by the kaplan - meier method and survival differences were evaluated by the log - rank test. univariate survival analyses showed that the age at diagnosis (p < 0.001), gleason score (p < 0.001), nuclear grade (p < 0.001), capsule infiltration (p = 0.0159), and nuclear e7 expression (p = 0.0381) were strongly related to os (table 1). interestingly, hpv - positive cancer patients showed worse os (median 4.59 years) compared to those who were hpv negative (median 8.24 years, p = 0.0381 ; figure 3). thus, these results demonstrate that hpv infection significantly affects survival time of prostate cancer patients in our cohort. prognostic factors associated with survival time in the univariate analysis were evaluated in a cox multivariate regression model. capsule infiltration was eliminated from the multivariate model because of association with gleason score (= 13.28, df = 1, p < 0.001) and nuclear grade (= 11.29, df = 2, p = 0.004). in this analysis the age at diagnosis, gleason score, nuclear grade, and hpv status were statistically independent predictors for os with, respectively, hrs of 2.15 (95% ci, 1.513.06 ; p < 0.001), 2.53 (95% ci, 1.703.75 ; p < 0.001), 2.76 (95% ci, 1.435.31 ; p = 0.002), and 1.57 (95% ci, 1.032.39 ; p = 0.034) (table 1). current literature on the role of hpv infection in the carcinogenesis of prostate cancer remains controversial. recently, martinez - fierro. evaluated the presence of viral hpv dna in 55 prostatic cancer tissues and 75 controls and found a significant positive association between hpv and risk of prostate cancer. in the same year, sutcliffe. did not find any association in a prospective study on serum samples collected from 612 patients with prostate cancer and 612 controls. no positive correlation has been reported in subsequent serologic or viral dna - based [19, 21, 23 ] or mixed laboratory technique [20, 24 ] studies. more recently, whitaker. observed a ubiquitous distribution of hpv in normal, benign, and cancerous prostate tissues supporting the innocuity of hpv-18 ; however, they concluded an oncogenic potential role of hpv-18 in prostate cancer, since they detected hpv-18 in koilocytes of prostatic tissues. even about the most representative hpv types, there is great discordance. if whitaker and colleagues reported the potential involvement of hpv-18 in prostate cancer, lin. found a prevalence of hpv-16 with respect to hpv-18 in a meta - analysis, whereas adami. observed a positive association between prostate cancer and hpv-33 and no oncogenic role for hpv-16 and -18. therefore, these mixed results are consistent with the present controversial landscape on the role of hpv infection in prostate carcinogenesis. in this study we found that overall survival was significantly associated with the nuclear expression of e7 protein and other clinical - pathological factors, such as age higher than 72 years, high nuclear grade, capsule infiltration, and high gleason score at diagnosis. the statistical independence of each of these prognostic factors was assessed in a multivariate analysis, which identified age, nuclear grade, gleason score, and hpv e7 expression as significantly independent prognostic factors for survival of patients with primary prostate cancer. furthermore, analysis of dna extracted from all the analysed samples of our cohort confirmed hpv infection and showed the presence of hpv16 genotype. this result is consistent with other studies on prostate cancer [15, 17 ] and further reinforces the high carcinogenicity of hpv16, which has already been shown as the most carcinogenic hpv genotype for cervical [6, 35 ] and neck and head cancers. although our data do not provide supportive proof for a causal relation between hpv and prostate cancer, they demonstrate a potential association between hpv infection and adverse prognosis in our patient cohort. moreover, they sustain a possible role of hpv as an independent prognostic factor for os of primary prostate cancer patients. we believe that our data, which analyse the prognostic impact of hpv infection in prostate cancer from a clinical point of view, confirm the absolute need to investigate and validate the prevalence of hpv infection in a controlled prospective study and its role in prostate carcinogenesis. this study is increasingly important as we have hpv vaccines able to guarantee excellent prevention and control of this viral infection and its consequences in terms of tumour development. moreover, the correlation between hpv infection and angiogenesis [1113 ] offers a good rationale to treat a specific subgroup of prostate cancer patients selected on the basis of the hpv status by using antiangiogenic agents, whose efficacy has recently been reported for the treatment of advanced cervical cancer. this study provides evidence for the correlation between hpv infection and prostate cancer survival in our patient cohort and sustains the need for additional studies to clarify the possible role of hpv in prostate carcinogenesis. further studies are required because vaccines and novel therapeutic drugs are now available and may be used to prevent hpv infection and treat more effectively hpv - associated prostate cancer. | the role of human papillomavirus (hpv) in prostate carcinogenesis is highly controversial : some studies suggest a positive association between hpv infection and an increased risk of prostate cancer (pca), whereas others do not reveal any correlation. in this study, we investigated the prognostic impact of hpv infection on survival in 150 primary pca patients. one hundred twelve (74.67%) patients had positive expression of hpv e7 protein, which was evaluated in tumour tissue by immunohistochemistry. dna analysis on a subset of cases confirmed hpv infection and revealed the presence of genotype 16. in kaplan - meier analysis, hpv - positive cancer patients showed worse overall survival (os) (median 4.59 years) compared to hpv - negative (median 8.24 years, p = 0.0381). in multivariate analysis age (p < 0.001), gleason score (p < 0.001), nuclear grading (p = 0.002), and hpv status (p = 0.034) were independent prognostic factors for os. in our cohort, we observed high prevalence of hpv nuclear e7 oncoprotein and an association between hpv infection and pca survival. in the debate about the oncogenic activity of hpv in pca, our results further confirm the need for additional studies to clarify the possible role of hpv in prostate carcinogenesis. |
sentinel lymph node (sln) biopsy is the current standard of care for t1 t2 breast cancers with no clinically palpable axillary lymph nodes. based on the principle of sequential directional lymphatic drainage from the breast, the sln is hypothetically the first axillary node to receive lymphatic drainage from the breast. it, therefore, follows that if the sln is free of metastatic tumour deposits, the rest of the axillary nodes are not expected to be involved either. this obliterates the need for full axillary lymph node dissection (alnd) when the sln is negative for metastases. alnd, involving the removal of the level i and ii axillary nodes, is now reserved for instances where the sln is positive for metastases or where sln biopsy is contraindicated. this has resulted in more than 50% of patients with t1 and t2 tumours being spared the arm morbidity of alnd because of the less extensive dissection [1, 2 ]. however, it is known that up to 60% of patients with a positive sln do not have additional nodal involvement, suggesting that these patients are overtreated by the current practice of alnd whenever the sln is positive [3, 4 ]. the removal of uninvolved nodes serves neither to aid prognostication nor to guide adjuvant therapy, yet exposes the patient to the risk of lymphedema and its associated complications. this has led to some questioning the need for alnd in all instances of sln positivity. the american college of surgeons oncology group z0011 trial is the latest to show that women with t1 and t2 tumours who undergo lumpectomy derive little additional benefit from alnd since any residual disease in the level i and ii nodes appear to be effectively eradicated by postoperative irradiation and chemotherapy [6, 7 ]. the reluctance of most surgeons to leave behind residual disease in the axilla, a reliable means of predicting the likelihood of non - sln involvement will be a step towards refining the indication for alnd. to date, there are 4 nomograms (memorial sloan - kettering cancer centre [mskcc ] nomogram, mayo nomogram, cambridge nomogram and the stanford nomogram), 3 scoring systems (the tenon score, the md anderson cancer centre score and the score developed by saidi.) and 2 recursive partitioning tools developed by kohrt.. in a direct comparison of these models, the mskcc nomogram and the tenon score performed best and were the only 2 models with an area under the curve (auc) of more than 0.75. in our practice, the decision for alnd is made intraoperatively based on frozen section analysis of the sln. apart from guiding the decision to proceed with alnd during surgery, a reliable means of predicting the status of the non - sln nodes will also reduce patient recall rates should the initial frozen section analysis be false negative. we, therefore, aim to determine the incidence of non - sln involvement in our patients, and to identify factors that may predict for this. in addition, we aim to validate the mskcc nomogram and the tenon score in our local population. a retrospective review was performed of 110 consecutive patients with a positive sln who underwent alnd from 1st january 2001 to 31st december 2008 in our department. this study has ethics committee approval (dsrb d/10/029). in our department, the majority of sln biopsy is performed with blue dye alone. two ml of undiluted patent v blue dye is injected into the subareolar plexus after the patient is put under general anaesthesia, followed by 5 minutes of manual massage. the sln is identified as a blue - coloured node with a blue lymphatic channel leading up to it. beginning from the year 2006, all slns were routinely submitted for intraoperative frozen section analysis (a total of 64 patients). this involves the documentation of the number and size of slns submitted for analysis, followed by histological examination of serial sections stained with haematoxylin and eosin (h&e). each sln is serially sliced at 2 to 3 mm gross intervals, and all slices (the entire node) are snap frozen in liquid nitrogen and then placed in frozen section embedding medium on a cryostat object disk. each slice is then further sectioned at intervals of 40 m to obtain at least 3 sections, which are stained in h&e and examined using routine light microscopy. the presence or absence of metastatic deposits is noted and communicated to the surgeon immediately. if the sln is positive for macro- or micrometastasis, alnd is immediately proceeded with ; if negative, no further axillary dissection is performed. the entire sln is then formalin fixed and paraffin embedded to obtain permanent sections for final analysis, where an additional 1 to 6 levels of each slice of the sln are examined. it is not routine in our practice to perform immunohistochemistry or quantitative real - time polymerase chain reactions on h&e - negative sections. for the 46 patients who underwent surgery prior to 2006, only serial h&e analysis of the permanent sections of the sln was performed (without frozen section analysis). the presence of metastatic deposits in the sln and non - slns was correlated with standard clinicopathological parameters including histology of the primary tumour, tumour size, tumour grade, presence of lymphovascular invasion, and hormone and human epidermal growth factor receptor 2 (her2) receptor status. note was also made of whether the metastatic deposit was classified as a macrometastasis or micrometastasis. macrometastases are defined as cell clusters that are more than 2 mm in diameter ; micrometastatic deposits are defined as cell clusters that are between 0.2 mm and 2 mm in diameter (denoted as n1mic according to the 6th ajcc classification). correlation analyses were performed using either the chi square test or fisher 's exact test where appropriate. the cox proportional hazard regression model was used to identify independent risk factors for non - sln involvement. this was carried out using the stata package release 8.1 (stata corporation, 4905 lakeway drive, college station, texas 77845, usa). a full model was first created to include all potentially important explanatory variables. at each step, the variable with the smallest contribution to the model was removed, until a final backward stepwise model was obtained. a 2-tailed p value test was used in all analyses and a p value of less than 0.05 was considered statistically significant. the probability of non - sln involvement was calculated based on the mskcc nomogram and tenon score. the mskcc nomogram is based on tumour histology and grade, pathological tumour size, multifocality, lymphovascular invasion, oestrogen receptor (er) status, the number of positive and negative slns, and the mode of detection (in our study, sln biopsy cases prior to 2006 were performed with serial h&e examination of the permanent sections, and those from 2006 onwards were assessed with intraoperative frozen section analysis). the combined score of each variable is translated into a predicted probability of non - sln involvement. the nomogram is available as an electronic calculator on the mskcc website (http://www.mskcc.org/mskcc/html/15938.cfm). the tenon score is calculated based on three variables : the ratio of positive sln to the total number of sln removed, the presence of micrometastasis in the sln, and the primary tumour size, combined to give a score from 0 to 7. receiver operating characteristic (roc) curves based on both models were generated and the area under roc curve (auc) calculated using stata package release 8.1. auc ranged from 0 to 1, where 1 indicates perfect concordance, 0.5 indicates no better concordance than chance, and 0 indicates perfect disconcordance. from 1st january 2001 to 31st december 2008, a total of 551 patients underwent slnb in our centre ; of these, 110 patients underwent completion alnd after a positive sln was found. all patients were diagnosed with invasive carcinoma ; 88% (97 of 110) were classified as invasive ductal carcinoma, 10% as invasive lobular carcinoma. median pathological tumour size was 21 mm (4 mm to 80 mm), and median tumour grade was 2. seventy percent of patients had oestrogen receptor (er) positive tumours, and 47% had progesterone receptor (pr) positive tumours. all except 9 sln biopsies were performed using blue dye alone, 6 were performed using dual blue dye and radiocolloid, and 3 were performed with radiocolloid alone. median number of axillary lymph nodes harvested (including slns) was 22 (ranging from 7 to 58). the sln was the only positive axillary node in 60 of 110 patients (55%). the likelihood of non - sln involvement correlated positively with pathological tumour size (p = 0.03) ; median tumour size was 24.5 mm in cases of non - sln involvement compared to 20 mm in those where only the sln was involved. non - sln involvement was also inversely correlated with the ratio of positive slns to the total number of slns harvested (p = 0.01) (table 1). those with a ratio of 0.5 or more were 3 times more likely to have non - sln involvement (p = 0.04, or 2.63, 95% ci 1.04 to 6.64), implying that additional non - sln involvement became less likely when more harvested slns were negative. the size of the metastatic deposits also correlated with the likelihood of non - sln involvement, with macrometastasis (rather than micrometastasis) being associated with involvement of the non - slns (p = 0.01, or = 14.9, 95% ci 0.01 to 0.53) (table 1). non - sln involvement did not correlate with tumour histology, tumour grade, lymphovascular invasion, or hormone receptor status (p > 0.05) (table 1). on multivariate analysis, the number of positive slns, total number of slns harvested, presence of micrometastasis, and the total number of axillary nodes harvested during alnd independently predicted for non - sln involvement (p < 0.05) (table 2). interestingly, tumour size did not remain significant (p = 0.14) (table 2). based on the mskcc nomogram, the median calculated probability in the group with sln involvement alone was 19.5%, significantly lower than the calculated probability of 41.0% in the group with additional non - sln involvement (p < 0.001) (table 1). the discriminatory ability, as calculated from the area under the receiver operating curve (roc) (auc), was 0.69 (figure 1). similarly, the tenon score also differentiated the group with sln involvement alone from the group with additional non - sln involvement (median score of 5.0 and 5.75 resp., p < 0.001), with an auc of 0.71 (figure 2). median tumour size was 20 mm (12 mm to 40 mm), median tumour grade was 2, and lymphovascular invasion was present in 10 patients (66.7%). thirteen tumours were classified as invasive ductal carcinoma, 1 as invasive lobular carcinoma, and 1 as mucinous carcinoma. calculated median tenon score was 3.5 (1.5 to 5.0), and median predicted probability based on the mskcc nomogram was 18% (7 to 51%). only 1 patient (with a 25 mm invasive lobular carcinoma) had additional non - sln involvement ; calculated tenon score was 5.0, and mskcc predicted probability of non - sln involvement was 18%. involvement of the sln raises the possibility of tumour spread to the rest of the axillary nodes. current guidelines therefore recommend alnd whenever the sln is involved by tumour, including by micrometastasis. the rationale for this is implied from previous experience with breast conserving surgery where it was shown that optimal postoperative irradiation did not reduce the risk of local recurrence if the surgical margins were inadequate, implying that residual disease may not be completely eradicated by adjuvant treatment. this study found no increase in recurrence nor any survival disadvantage in women with a positive sln who did not undergo completion alnd, suggesting that any residual disease in the non - slns nodes may be effectively eradicated by adjuvant radiation and chemotherapy [6, 7 ]. it should, however, be noted that subjects included in the z0011 study were a highly selected group, having only limited nodal disease, postoperative chemotherapy and chest wall irradiation which included the level i and ii nodal basins. it is, therefore, too premature to conclude that it is safe to omit alnd in all patients with a positive sln. alnd is theoretically unnecessary when there is no additional involvement of the non - sln nodes. in our study, 55% of patients with a positive sln had no involvement of additional non - slns, in agreement with reports in the literature. although several models have been developed to predict the likelihood of non - sln involvement, none have gained acceptance into routine practice. we have chosen to validate the mskcc nomogram and the tenon score as they were found to outperform other available models. both models are easy to use, the tenon score being based on the sum of 3 variables to give a total score of 7, and an online calculator being available for the mskcc nomogram. both the mskcc nomogram and tenon score performed more poorly in our study population as compared to previous reports in western populations, with an auc of 0.69 and 0.71 respectively [8, 9, 1719 ]. although patients with sln involvement alone had a significantly lower tenon score as compared to those with additional non - sln involvement, the median score of 5.0 was higher than the proposed threshold. barranger and colleagues proposed a threshold of 3.5 since scores of 3.5 or less were associated with a 97.3% likelihood of having no additional non - sln metastases. if this threshold had been applied, only 24 patients in our study population would have avoided alnd. similarly, if the proposed threshold of 10% was taken, only 15 patients would have avoided alnd. these findings suggest that a higher threshold may be necessary for asian patients and may explain why both models performed more poorly in our study population. on the other hand, only 1 of the 11 patients who underwent a second surgery for alnd after metastatic deposits were found on the examination of the permanent sections had additional non - sln involvement. this patient had a tenon score of 5.0 and a predicted probability of 18% on the mskcc nomogram. although higher than the respective proposed thresholds for both models, both scores still fall within the median scores of those with sln involvement alone in our study. further studies in a larger study population will be needed to define an appropriate threshold for our population. in our current practice, the decision alnd is made intraoperatively based on results of frozen section analysis of the sln. this limits the types of variables that can be used to predict non - sln involvement. currently available models, including the mskcc nomogram and tenon score, include variables which require analysis of the permanent formalin - fixed paraffin - embedded sections and can only be calculated postoperatively. the ratio of positive slns in relation to the total number of slns harvested has emerged as an independent predictor of non - sln involvement in our study. this ratio was also found to be significant in both the mskcc and tenon models. in our study, 57% of patients with a positive sln to total sln ratio of 1 were found to have additional non - sln metastases, as compared to 28% of those with a ratio of less than 0.5. the reliability of this ratio depends largely on the accuracy of sln identification and intraoperative frozen section analysis. in our practice, our results (sln nonidentification rate of 2.6% and a false negative rate of 4.5%) are comparable to accepted standards (unpublished manuscript) [2, 4 ]. however, the median number of slns harvested per patient in our study was similar to that harvested in the study population from which the tenon score was derived, where both blue dye and radiocolloid were used in combination. although we found the total number of slns harvested to be inversely correlated with the likelihood of non - sln involvement, we failed to define an optimal number of slns that should be harvested. the median number of slns harvested in our patients was 2, occurring in 68 patients (62%). although non - sln involvement appeared more likely in patients when less than 2 slns were harvested, this did not reach statistical significance. some studies have suggested that 3 is the optimal number of slns that should be harvested ; fewer slns carry the risk of understaging, while the examination of more than 3 nodes does not increase sensitivity [20, 21 ]. our sample size is likely too small for a significant correlation with the total number of slns harvested to be observed. we routinely perform intraoperative frozen section sln analysis, with a false negative rate of 16%, often resulting from micrometastasis being found in deeper layers of the permanent sections (unpublished manuscript). current guidelines recommend alnd when the sln is involved by micrometastasis since the possibility of non - sln involvement can not be ignored. on the other hand, we have observed that micrometastasis alone predict for a low likelihood of additional non - sln involvement ; only 1 of the 15 patients was found to have non - sln involvement. several authors have proposed that a subgroup of patients with micrometastasis have such a negligible risk of non - sln involvement that completion alnd may not be necessary ; this group includes patients with tumour size of less than 10 mm, or less than 20 mm if of tubular, colloid, or medullary histology and micrometastatic deposits less than 1 mm in size [3, 2225 ]. of note is that more than 70% (11 of 15) of the patients with micrometastasis in our study had a tenon score of 3.5 or less, suggesting that they might have avoided alnd if the threshold of 3.5 had been applied. it would seem that the tenon score performs better, although both models have been reported to perform equally well in patients with micrometastasis [15, 26 ]. however, our study population is too small to allow us to draw any firm conclusions. although both the mskcc nomogram and tenon score differentiated between patients with sln involvement only and those with non - sln involvement, they performed less well than previously reported. it is possible that the proposed threshold for both models may need to be adjusted for asian populations. the number of positive slns, the total number of slns harvested, and the size of the tumour deposits within the sln were found to be independent predictors of non - sln involvement. these variables are particularly relevant to our current practice where the decision for alnd is based on intraoperative frozen section sln analysis. further studies to evaluate the predictive potential of these factors will no doubt be useful in reducing the rate of unnecessary alnd in those with a negligible likelihood of non - sln involvement. | background. up to 60% of patients with a positive sentinel lymph node (sln) have no additional nodal involvement and do not benefit from completion axillary lymph node dissection (alnd). we aim to identify factors predicting for non - sln involvement and to validate the mskcc nomogram and tenon score in our population. methods. retrospective review was performed of 110 consecutive patients with positive slns who underwent alnd over an 8-year period. results. fifty patients (45%) had non - sln involvement. non - sln involvement correlated positively with the number of positive slns (p = 0.04), macrometastasis (p = 0.01), and inversely with the total number of slns harvested (p = 0.03). the mskcc nomogram and tenon score both failed to perform as previously reported. conclusions. the mskcc nomogram and tenon score have limited value in our practice. instead, we identified three independent predictors, which are more relevant in guiding the intraoperative decision for alnd. |
myocardial infarction (mi) in young adults is rare and only accounts for 3% of coronary heart disease cases ; classification falls under atheromatous, nonatheromatous, substance abuse, and hypercoagulable states.1 there are documented cases of early mi from atherosclerosis secondary to dyslipidemia, obesity, diabetes, smoking, and hyperhomocysteinemia ; however, these cases generally occur in patients in their mid-30s at the earliest.2 alternatively, perhaps there is a nonatheromatous process occurring. the patient could have some coronary dissection or compression from previous trauma to the chest in light of a high - impact sport such as football. this has been documented in patients involved in motor vehicle accidents with blunt trauma to the chest.35 perhaps there is a bridging of coronary vessels within actual myocardial tissue that becomes compressed during activity. maybe there is an anomalous origin of the coronary arteries, resulting in chronic intermittent ischemia and leading to scarring and death with typical chest pain symptoms. certainly, intense activity such as weight lifting may exacerbate such a condition.6 moreover, drug use and septic embolism, cocaine, amphetamines, tetrahydrocannabinol (thc), and binge drinking are known to precipitate these events via vasospasm, arrhythmia, and vessel rupture.7 this is one of the more common causes of mi in young adults engaging in risky behaviors that include drug abuse. the final category, hypercoagulable state, is a feature of this case and will be discussed subsequently.810 a healthy 21-year - old male african american college football player, with a body mass index (bmi) of 39 and no additional risk factors for coronary artery disease, was admitted to the emergency department. the patient was complaining of a single episode of unrelenting sharp chest pain immediately after he had finished powerlifting 400 lbs in a bench press lift. the chest pain was largely typical : substernal, associated with shortness of breath, exertional, constant, and not musculoskeletal in nature. he had no chronic medical problems and both parents were alive without chronic medical problems. there was no history of deep venous thrombosis (dvt), pulmonary embolism, or coronary heart disease in the family. imaging results obtained included chest radiography that only showed cardiomegaly, consistent with an athletic heart. an electrocardiogram showed a sinus rhythm with a right bundle branch block (rbbb) (figure 1). blood tests showed elevated serum levels of cardiac enzymes, with troponin at a level of 0.53, which peaked at 10.43 the next day (table 1). non - st elevation myocardial infarction was diagnosed and the patient received medical treatment as per acute coronary syndrome protocol, which includes aspirin, a statin, a high intensity intravenous heparin protocol, an angiotensin converting enzyme (ace) inhibitor, and a beta blocker. a computerized tomography (ct) angiogram of the chest was negative for aortic dissection. a transesophageal echocardiogram (tee) showed a very minor patent foramen ovale (pfo) only with a valsalva maneuver and was not apparent on a doppler view (figure 2a). during the valsalva maneuver a coronary angiography showed a thrombus in the proximal to mid left anterior descending artery (lad) in otherwise normal coronary arteries (figure 3). intravascular ultrasound showed evidence of thrombotic material in the mid lad in addition to mild plaque disease, and no evidence of dissection in the left main, proximal, or mid lad (figure 4). one week after the onset of chest pain, another coronary angiography showed resolution of the lad thrombus (figure 3). the patient was then discharged with aspirin (81 mg daily), clopidogrel (75 mg daily), and atorvastatin (80 mg daily), with advice to avoid strenuous activities such as heavy weight lifting. the patient received six sessions in the cardiopulmonary rehabilitation program before volitional discontinuation. five months later, the patient had another episode of chest pain after heavy weight lifting. this episode was similar to the last, but had less intense, substernal nonradiating pressure without shortness of breath or lightheadedness. he admitted not taking his medication for several days to a week before this episode of chest pain. cardiac enzymes were elevated, with electrocardiography showing marked sinus bradycardia with pac and existing t wave inversions in the inferior leads (table 1 and figure 5). a thrombus was again found in the mid lad, but was longer than the thrombus found 5 months previously. it was thought that this site had provided a nidus for thrombus formation via recurrent plaque rupture and previous vessel injury. hence, a bare metal stent was placed on this occasion, as the patient had a previous thrombus that had recurred at the same location. results of laboratory studies showed elevated factor viii activity at 205% (table 2). a decision to put the patient on anticoagulation therapy he was discharged home with aspirin (81 mg daily), prasugrel (10 mg daily), atorvastatin (80 mg daily), and warfarin (5 mg daily with enoxaparin bridging). the ace inhibitor was temporarily held because of mild acute kidney injury that was more likely a falsely elevated creatinine secondary to increased muscle mass. deficiency of factor viii results in a condition named hemophilia a that affects 1/5,000 males. the opposite condition, where there is too much factor viii available, results in increased risk for thrombosis. hemophilia a is inherited as an x - linked recessive disease expressed in males, with females as asymptomatic carriers. factor viii serves as a cofactor to enzyme 9a in the activation of factor x. factor viii must be activated before it can support factor ixa as an effective cofactor. the factor viii protein contains over 2,300 amino acids and is approximately 330 kda, preceded by a 19 residue hydrophobic signal peptide that is important for secretion.11 just as there is a genetic basis to the absence of factor viii, there is also a genetic component to having increased activity and levels. one study was able to localize high factor viii levels to genes found on chromosome 5 and chromosome 11.12 another quantitative trait locus was discovered on chromosome 18.13 factor viii is often found in a complex with von willebrand factor (vwf) in the body. hence, high factor viii levels may also be caused by a rise in vwf levels ; this could be from either increased synthesis or decreased clearance of vwf.14 as further investigation continues, it will become interesting to determine if these chromosomal locations are involved in the regulation of vwf as well. the genetic basis for increased factor viii levels is also greatly contingent on blood group types, as blood group non - o has higher levels of vwf and factor viii than those with group o.15 our patient has not pursued these genetic tests as he has other risk factors that can elevate factor viii levels. in addition, there are several acquired reasons for having high factor viii levels, and some can be modified by lifestyle. studies have found that a higher bmi positively correlated with higher factor viii levels, as well as african descent that is associated with a 15%18% increase of factor viii levels above those of caucasian descent.16 our patient had a bmi of 39 and is of african descent ; hence this is likely to increase his risk. moreover, factor viii levels increase with age, with an average rise of 56 iu / dl per decade. exercise can transiently increase factor viii levels, which are thought to be related to adrenalin and 2 adrenoreceptor stimulation.17 factor viii levels are known to increase up to 300% in normal individuals during certain exercise.18 the weight lifting with extreme loads probably transiently increased the patient s factor viii levels above his already high baseline. however, it is unclear whether the intensity of the exercise is correlated to the degree of factor viii released. a rise in factor viii can be seen in pregnancy, surgery, chronic inflammation, malignancy, liver disease, hyperthyroidism, intravascular hemolysis, and renal disease.19 females generally have higher factor viii levels for unknown reasons.20 higher factor viii levels were found in postmenopausal women compared to premenopausal.21 furthermore, vasopressin enhances plasma factor viii levels indirectly or directly via the v2 receptor.22 thus, it is likely a good idea for postmenopausal women to remain euvolemic. one study examined how factor viii influences risk for mi among young mexican patients with acute mi. it was again noted that younger patients < 45 years accounted for only 5%10% of acute mi cases. twenty - five percent of patients had increased factor viii compared with 8.8% of control subjects. mean levels for patients and controls were 134 mg / dl versus 118 mg / dl.23 hence, even slightly elevated factor viii levels contribute to mi, whereas higher levels are found in the more rare cases of young individuals having coronary events. another report describes a 27-year - old female that had an mi and was found to have elevated factor viii without any other hypercoagulability. there was a 90% stenosis of the proximal lad the level of her factor viii was 3.03 iu / ml ; the normal range is 0.451.58 iu / ml.24 the previously considered idiopathic cases of venous thromboembolism are now having correlations with elevated factor viii levels. there was a dose - response relationship between subjects with factor viii levels above 150% (150 iu / dl) and an adjusted odds ratio for venous thromboembolism of 4.8.13 it is also known that there is a 33% prevalence of factor viii activity above 175% (90th percentile) in recurrent venous thromboembolism and is dose - related.25 those above the 90th percentile for factor viii had a 6.7-fold relative risk of recurrent events compared with lower levels.25 it is known that factor viii levels above the normal 150 iu / dl can be found in 11% of the adult population.26 it is also concerning that there are additive effects to factor viii and other hypercoagulable states. for instance, oral contraceptives in women with high factor viii levels increased the risk of venous thromboembolism (vte) greater than in women taking oral contraceptives alone.10 pfo is a common congenital cardiac anomaly that is estimated to be present in more than 25% of the general population.27 it is an independent risk factor for cerebrovascular events among young adults with cryptogenic stroke.28 embolic events occurring through the pfo can affect all regions including the brain, extremities, and coronary circulation, depending on which branch of the aorta or sinus a thrombus may enter. paradoxical coronary artery embolism causing mi with factor v leiden thrombophilia in a young woman has been documented.9 there have also been associations with pfos and mi for patients in hypercoagulable states, such as peripartum women.29 a girl as young as 8 years had a pfo combined with a heritable thrombophilia that resulted in mi.8 it is unclear where the initial thrombus in our patient developed whether in the arterial circulation or the venous circulation with a translocation via a pfo. however, the venous doppler of lower extremities was negative for dvt. rbbb quite frequently occurs with pfo in healthy people and can even be used as a marker for pfo.30 pfo can be a problem for other recreational sports as well, such as recreational diving, which is becoming more and more popular, and also requires a valsalva maneuver. counseling should be provided to adults and adolescents with rbbb when they start high - risk sports or during qualifications for some types of employment. one last point, we would like to make is that instrumentation poses its own risks to the development of atherosclerosis and plaque rupture, and that further investigation should be performed into preventing this remodeling effect. in previous experiments, substances such as the antioxidant hydrogen sulfide we must never discount the cause of chest pain being mi in young adults as there are distinctive mechanisms by which these rare events can and do occur. strenuous exercise may possibly be a risk factor for coronary thrombosis because of transiently elevated factor viii levels. it may be important to further risk stratify patients for physical activity using such factors as bmi, sex, descent, comorbidities, and hypercoagulability studies. as our genetic testing for hypercoagulability becomes both cheaper and more sensitive, it may be reasonable to put into action regular screening against these thrombotic disorders as a means of primary prevention before events occur. in light of the great prevalence of pfo and risks associated with fixing these genetic defects, fixing them should be discussed on an individual basis. due to these existing limitations, an event tends to occur before this kind of extensive investigation is performed. | myocardial infarction (mi) due to coronary atherosclerosis in young adults is uncommon ; rare causes such as cocaine abuse, arterial dissection, and thromboembolism should be considered. a 21-year - old football player, and otherwise healthy african american man, developed chest pain during exercise while bench - pressing 400 lbs. acute mi was diagnosed based on physical examination, electrocardiography findings, and elevated cardiac enzymes. coronary arteriography showed a thrombus occluding the proximal left anterior descending artery (lad). aggressive antiplatelet therapy with aspirin, clopidogrel, and eptifibatide was pursued, in addition to standard post - mi care. this led to the successful resolution of symptoms and dissolution of the thrombus, demonstrated by repeat coronary arteriography. five months later, he presented with similar symptoms during exercise after lifting heavy weights, and was found to have another acute mi. coronary arteriography again showed a thrombus occluding the lad. no evidence of coronary artery dissection or vasospasm was found. only mild atherosclerotic plaque burden was observed on both occasions by intravascular ultrasound. a bare metal stent was placed at the site as it was thought this site had acted as a nidus for small plaque rupture and thrombus formation. elevated serum factor viii activity at 205% (reference range 60%140%) was found, a rare cause of hypercoagulability. further workup revealed a patent foramen ovale during a valsalva maneuver by transesophageal echocardiography. both events occurred during weight lifting, which can transiently increase right heart pressure in a similar way to the valsalva maneuver. in light of all the findings, we concluded that an exercise - related increase in factor viii activity led to coronary arterial thrombosis in the presence of a small ruptured plaque. alternatively, venous clots may have traversed the patent foramen ovale and occluded the lad. in addition to continuing aggressive risk factor modification, anticoagulation therapy with warfarin was initiated with close follow - up. |
primary peritoneal cancer (ppc) arises in the tissue that lines the abdominal cavity and pelvic cavity. it is an uncommon disease that shares many histopathologic and clinical characteristics with epithelial ovarian cancer (eoc), but ppc is distinguished by the absence of a malignant / invasive ovarian mass. the incidence of ppc is considerably lower than that of eoc (6.78 cases per million vs. 120.5 cases per million, respectively), but ppc incidence has increased at a faster rate than ovarian cancer over the past three decades [3, 4 ]. however, it is not clear whether this change is due to diagnostic changes or a true increase. it is uncertain whether ppc is a distinct disease from eoc or if they share common origins. features shared by both ppc and eoc include the preponderance of serous histology, the advanced stage at diagnosis for the majority of women and similar responsiveness to platinum / taxane chemotherapy. the similarities of these cancers as well as cancers of the fallopian tubes have led to the suggestion that each of these cancer types develops from a common cell lineage, the embryonic mllerian system. evidence supporting this argument is the observation that destruction of portions of the mllerian duct by tubal ligation or hysterectomy reduces the risk of ovarian cancer. a recent study from australia reported many similarities in risk factors for ppc and eoc, but also reported that parous women are at increased risk of ppc. this same study found that obesity was associated with risk of ppc but not eoc. it has been reported that brca1 and brca2 mutation carriers, including those who have undergone prophylactic bilateral oophorectomy, are at increased risk of ppc [9, 10 ]. the observed differences in relationships with certain risk factors are suggestive that ppc and eoc may be distinct disease entities, but further data from other studies are needed. in this paper, we present results of an analysis that compared clinical characteristics and risk factors for eoc and ppc of invasive serous histology in a population - based, case control study in north carolina. the subjects in this study are from the north carolina ovarian cancer study (ncocs), a population - based, case control study of eoc conducted in a 48-county region of north carolina between 1999 and 2007. identification and recruitment of eoc and controls has been described in detail in other reports [1113 ]. briefly, newly diagnosed cases of primary peritoneal and epithelial ovarian cancer were identified through the north carolina central cancer registry using a rapid case ascertainment system. pathology reports for eligible cases were sent to the study office at duke university medical center, and consent to contact the women was requested from the treating physicians. eligible eoc and ppc cases were aged 2074 years at diagnosis, had no prior history of ovarian cancer, resided in the study area and were cognitively able to give consent and complete an interview in english. all cases underwent centralized histopathologic review by the study pathologist (rcb) to confirm the diagnosis. cases were classified by the study pathologist as ppc if they met the gynecologic oncology group criteria : (1) ovaries are normal in size or enlarged by a benign process ; (2) the extraovarian sites of carcinoma are of significantly greater volume than the tumor present on either ovary ; (3) the ovarian tumor component is nonexistent, confined to the ovarian surface with or without stromal invasion measuring in aggregate less than 5 5 mm, or within the ovarian substance and measuring less than 5 5 mm ; and (4) the histologic characteristics indicate serous carcinoma of any grade. control women were frequency - matched by age (5 year age categories) and race (black or other) to both invasive and low malignant potential eoc cases who resided in the same 48-county region as the eoc cases using list - assisted random digit dialing. in the present analysis, the age distribution of the cases is somewhat older than that of the controls because we excluded the low malignant potential cases that have a younger age at diagnosis than the invasive cases. the response rate among the epithelial eoc cases was 66.2%, with nonparticipation due to subject refusal (11.6%), death (4.1%), debilitating illness (2.6%), physician refusal (4.7%) and inability to locate (10.8%). the response rate for ppc cases was 72.8%, with nonparticipation due to subject refusal (7.0%), death (8.8%), debilitating disease (3.5%), physician refusal (1.8%) and inability to locate (6.1%). seventy - three percent of potential controls who passed the eligibility screening agreed to be sent information about the study, and 62% of those consented to be in the study. nonparticipation was due to subject refusal (28%) and inability to contact (10%). the study protocol was approved by the duke university medical center institutional review board and the human subjects committees at the north carolina central cancer registry and each hospital where cases were identified. for all study subjects, nurse - interviewers conducted in - person visits where they obtained written informed consent, administered a 90-minute standardized questionnaire, drew a blood sample and performed anthropometric measurements (height, weight and waist and hip circumferences). information obtained with the questionnaire included established and suspected ovarian cancer risk factors including family history of cancer, menstrual characteristics, reproductive history, hormone and contraceptive use, and lifestyle characteristics such as smoking, alcohol consumption and physical activity. a life - events calendar, which marked milestones such as marriages and births, was used to aid recall of reproductive history and hormone use. pictures of oral contraceptives (ocs), menopausal hormones and certain other medications were also used to assist with recall. chi - square analyses were used to compare clinical and histologic characteristics between ppc and eoc cases. unconditional logistic regression analyses were used to calculate age- and race - adjusted and multivariable - adjusted odds ratios (ors) and 95% confidence intervals (cis) separately for each disease (ppc or eoc) versus controls. to assess the possibility of residual confounding due to age, we determined whether the addition of the quadratic or cubic terms for age at diagnosis / interview improved the fit of the model. for most variables, there was no evidence that the cubic age terms improved the fit for any of the analyses in table 2. inclusion of both the linear and quadratic terms for age improved the fit of the model for age at last pregnancy, and therefore, the results for this analysis were age - adjusted by including both terms in the model. case control analyses for both ppc cases and eoc cases were restricted to invasive cancers of the serous histologic subtype since this was the largest category for all cancers. variables examined included number of pregnancies (0, 12, 34, 5 +) ; ever been pregnant (yes or no) ; age at last pregnancy (ages 1424, 2529, 3034, 35 +) ; ever breast fed (yes or no), age at menarche (age 0=1250(80.6)370(74.7)867(79.8)0.90(0.46, 1.73)0.72(0.55, 0.93)missing.53menopausal statuspostmenopausal55(88.7)365(73.7)702(64.6)1.00(referent)1.00(referent)premenopausal7(11.3)122(24.6)378(34.8)0.53(0.18, 1.54)0.86(0.60, 1.24)missing.86tubal ligationno41(66.1)353(71.3)686(63.2)1.00(referent)1.00(referent)yes21(33.9)140(28.3)399(36.7)1.10(0.63, 1.93)0.72(0.57, 0.91)missing.21hysterectomy 1 year prior to diagnosis / interviewno36(58.1)345(69.7)834(76.8)1.00(referent)1.00(referent)yes26(41.9)148(29.9)251(23.1)1.98(1.16, 3.37)1.29(1.01, 1.65)missing.21oc / patch use yearsnever26(41.9)169(34.1)308(28.4)1.00(referent)1.00(referent)0 35 (see table 2). however, to address the possibility of confounding between duration of oral contraceptive / patch use, the number of pregnancies and bmi, we simultaneously included all of these factors in an age- and race - adjusted logistic regression model. we did not observe substantial differences in the point estimates, as shown in table 2, for any of these three factors. our results of the case control analyses suggest that there were differences in some risk factors for invasive serous ppc and eoc cases including a woman s age at last pregnancy, tubal ligation and family history of breast cancer. among women who were ever pregnant, those whose age at last pregnancy was greater than 35 years had increased risk of invasive serous ppc while this risk factor was found to be protective against invasive serous eoc. additionally, no association between the risk of invasive serous ppc and a family history of breast cancer and tubal ligation was detected, while women with a family history of breast cancer were at an increased risk of invasive serous eoc and women who had a tubal ligation were at decreased risk of invasive serous eoc. the number of pregnancies was associated with a decreased risk in both ppc and eoc in the current study. our results were not consistent with an australian case control study published by jordan., where serous cancers of the peritoneum were found associated with increased risks among parous women (or = 1.8, an analysis by eltabbakh. showed no difference between primary peritoneal and epithelial ovarian cancer cases in women with high numbers of children, although case control associations were not measured. in the current study, we observed the novel finding of a linear relationship between risk of invasive serous ppc and age at last pregnancy, with over a twofold increase in risk at 35 years at last pregnancy, while this risk factor was protective in invasive serous eoc cases in the current study. the association between a woman s age at last pregnancy and increased risk of invasive serous ppc in the current study is also inconsistent with the inverse relationship with ovarian cancer in previous studies. our results showing an increasing risk of invasive serous ppc with older age at last pregnancy suggest differences in cancer development between peritoneal and ovarian carcinomas. the development of peritoneal cancer may not be linked to the protective apoptotic effect resulting in the clearing of mutated cells due to elevated progesterone during pregnancy as hypothesized for ovarian cancer. the contrasting results for risk of ppc and eoc are suggestive of etiological differences in these diseases or tissue origins. if confirmed, this novel finding will need further study to more fully understand the biological basis for why age at last pregnancy would differentially affect the risk of ppc and eoc. the associations between several other ovarian cancer risk factors and invasive serous ppc are not consistent with that of previous reports. for example, our results of no association of risk with family history of breast cancer were also not consistent with the australian study that found a family history of breast cancer was associated with an increased risk of ppc. the lack of association with risk of ppc in women with tubal ligation in the current study is also in contrast to the protective effect observed for ppc in a larger, previous case, we did not observe significant association between age at menarche and invasive serous ppc, although the or was less than 1.0 for age at menarche > 12 years of age. these results were not consistent with the study by eltabbakh., which showed that women with serous ppcs had later age at menarche when compared to those with eoc (13.3 years vs. 12.8 years ; p = 0.02). however, a small study by halperin. reported that women with serous ppc (n = 28) had a significantly earlier age at menarche compared to controls. our findings are also inconsistent with that of the australian study that reported obese women with a bmi > 30 had double the risk of ppc (or = 2.1 ; 95% ci = 1.33.4). in addition, our results showed that women who had a hysterectomy had an increased risk of both ppc and eoc. the study in australia by jordan the results in the australian study were attributed to a lower age - standardized rate of hysterectomies in the study controls compared to respondents in the 2001 australian national health survey. the prevalence of hysterectomy of 23.1% in the controls of the ncocs is similar to that in the general population of north carolina of 24.6% as shown in the 2008 north carolina behavioral risk factor surveillance study statistics. although the prevalence of hysterectomy in our control group is a little lower than in the north carolina population, this difference would not explain the entire increase in cases that was observed. therefore, the association with hysterectomy and both eoc and ppc cases in the ncocs may need further study to determine whether bias or chance explains our unexpected findings.. also showed that perineal talc use had no effect on the risk of peritoneal cancer. a second study of ppc, however, reported fewer women with ppc used perineal talc than women with ovarian cancer, 26.0 and 48.1%, respectively (p = 0.003). although chance due to small sample sizes and misclassification bias may play a role in the inconsistent results, this study differed from the current study as well as the australian study by not restricting the ovarian cancer cases to those of the serous histologic subtype. strengths of this study are that it is population - based and only incident cases of ppc and eoc were included. due to the large size of the ncocs, we were able to restrict the eoc cases to invasive serous cancers, thus achieving a more homogenous group of ovarian cancers with the same histology of the ppc cases. the small sample size for ppc may have also contributed to our inability to detect significant associations in some instances as well as some chance findings. nonetheless, the results of the current study provide evidence that suggests etiologic differences between invasive serous ppc and invasive serous eoc, underscoring the need for further research in this area. uncovering such differences will improve the ability to intervene in the risk of developing invasive serous ppc. in conclusion, we found similar risk of invasive serous ppc and invasive serous eoc for some but not all ovarian cancer risk factors. notably, we observed differences when examining risk factors associated with age at last birth, tubal ligation and family history of breast cancer. studies with larger sample sizes and population diversity are needed to establish risk factors associated with pathophysiology of serous carcinomas. | we performed case control analyses using data from the north carolina ovarian cancer study to determine risk factors that distinguish primary peritoneal cancer (ppc) from epithelial ovarian cancer (eoc). our risk factor analyses were restricted to invasive serous cancers including 495 eoc cases, 62 ppc cases and 1,086 control women. logistic regression analyses were used to calculate adjusted odds ratios and 95% confidence intervals for risk factor associations. although many case control associations for the invasive serous ppc cases were similar to those of the invasive serous eoc cases, some differences were observed including a twofold increase in risk of invasive serous ppc in women who were 35 years at last pregnancy, whereas a decreased risk was observed for invasive serous eoc risk. we could not confirm a previous report of an association between tubal ligation and ppc, a factor consistently associated with a decreased risk of eoc. the difference in the risk factor associations between invasive serous ppc and eoc cancers suggests divergent molecular development of peritoneal and ovarian cancers. a larger study to determine risk factors for invasive serous ppc is warranted. |
in september 2011, a 65-year - old caucasian man was admitted to our hospital after a 1-month history of epigastric pain, dyspepsia, and anorexia. he had a history of type 2 diabetes mellitus, arterial hypertension, and dyslipidemia. at physical examination, intense abdominal pain in the upper abdominal quadrants laboratory tests showed elevated aspartate transaminase 107 u / l (reference range 1040 u / l), alanine transaminase 89 u / l (reference range 1040 u / l), gamma - glutamyl transpeptidase 627 u / l (reference range 1040 u / l) and alkaline phosphatase 309 u / l (reference range 40130 u / l) ; total bilirubin was 1.07 mg / dl (reference range 0.31.0 mg / dl). ultrasonography showed a remarkable and irregular enlargement of the liver with multiple and diffuse nodules in the right hepatic lobe (the largest measured 5 cm in diameter) and a unique large mass (15 9 cm) in the left lobe. abdomen computer tomography scans showed multiple nodules in the liver, suspected to be metastatic lesions, portal vein thrombosis, multiple adenopathies along the lesser curvature of the stomach, the mesenteric root and the lombo - aortic region as well as a thickening of the gastric lesser curvature wall (fig. tumor markers were : alpha - fetoprotein (afp) 209093 u / ml (reference range 010 u / ml), ca 19.9 170,5 u / ml (reference range 039 u / ml), and ca 125 52,2 u / ml (reference range 035 u / ml) ; other markers were found to be in a normal range, in particular cea and ca 72.4. markers for hepatitis b and c were negative (hbsag, hbv - dna and hcv igg). an esophagogastroduodenoscopy showed a 4 cm ulcer on the lesser curvature of the stomach (fig. the biopsy of one of the hepatic nodules showed a poorly differentiated adenocarcinoma, similar to that of a gastric biopsy. immunohistochemical findings showed a positivity for cam 5.2, cdx 2 ck 20 and a negativity for cd10, ttf1, sinaptophysin and chromogranin a, therefore supporting a diagnosis of metastasis of gastric adenocarcinoma (fig. one week later, the patient 's condition quickly worsened (performance status 3 in accordance with the european cooperative oncology group scale). he presented jaundice, abdominal pain and, at palpation, the appearance of a solid mass in the left upper quadrant of the abdomen and liver enlargement. levels of transaminases, gamma - glutamyl transpeptidase and alkaline - phosphatase increased ; total bilirubin was 19.6 mg / dl and the conjugated one was 12.8 mg / dl. abdominal ultrasonography showed, with respect to the previous one, an increased number and size of the hepatic nodules as well as a biliary tract dilatation. tumor markers were found to be increased further : afp 470396 u / ml, ca 19.9 354.0 u / ml, and ca 125 113.7 u / ml. a chemotherapeutic approach was excluded due to the patient 's poor condition, his performance status and the altered liver function tests. gastric adenocarcinoma is a neoplasm with a frequent association to various tumor markers such as ca 72.4, cea and ca 19.9. in our case report, elevated serum afp levels were present in a patient with gastric adenocarcinoma and liver metastases. afp is a well - known embryonic serum protein, produced by fetal liver cells, yolk sac cells and some fetal gastrointestinal cells. the elevation of serum afp, in conjunction with the hepatic lesions, may be associated with hepatocellular carcinoma or germ - cell tumors. however, afp can be produced exceptionally by gastrointestinal tract organs, the lung, the bladder and by renal cancers. for diseases such as chronic hepatitis, liver cirrhosis and hepatocellular carcinoma, the level of afp is a good predictor of disease progression and outcome, as it is directly correlated to disease progression [5, 6 ]. gastric cancer with the capability of releasing afp is called afp - producing gastric carcinoma, first described by boureille. in 1970. only a few cases have been reported with an incidence rate of 2.78.0% of all gastric malignant tumors. our case is one of the few european cases of afp - producing gastric carcinomas. however, the serum afp level does not necessarily correlate with tumor size, stage or prognosis [6, 8, 10 ]. in our case, elevated serum levels of afp and his quick increase were associated with a rapid disease progression and a fatal outcome. cases of afp - producing gastric cancers are characterized by a poor prognosis, a high incidence of venous invasion, by lymph node and liver metastases and even t1 tumors (according to the tnm staging system). possible causes of liver metastases have been hypothesized in the hepatic capability to develop a suitable environment for the cancer cells growth and to promote an early vascular invasion. afp - producing gastric cancers are a small subgroup of gastric cancers, with a high likelihood of rapid hepatic metastasization. we think that further studies, especially on a cellular and molecular level, are necessary to explain the highly aggressive biological behavior of afp - producing gastric cancers in order to develop an effective multimodal and targeted therapy. the authors declare that there are no conflicts of interest regarding the publication of this paper. | a 65-year - old man presented to our hospital with abdominal pain, dyspepsia and anorexia. laboratory tests showed an altered liver function and abdomen ultrasonography revealed multiple liver nodules, suspected to be metastatic lesions. serous tumor markers were elevated and a very high level of alpha - fetoprotein was found. computer tomography confirmed the hepatic lesions and disclosed a thickening of the lesser curvature of the gastric wall. a subsequent endoscopy showed an ulcer on the lesser curvature. biopsies taken from the gastric ulcer and the liver nodule revealed an adenocarcinoma, both of gastric origin. shortly after the diagnosis, the patient 's condition worsened and he died only 15 days later. this case report illustrates how alpha - fetoprotein - producing gastric adenocarcinomas have a high incidence of venous and lymphatic invasion and a rapid hepatic spread with a very poor prognosis. |
elbow fractures are among the most common traumatic injuries in the paediatric population, consisting of 15% of all paediatric fractures [1, 2 ]. humeral medial epicondyle fractures, in the paediatric population, account for up to 20% of elbow fractures, 60% of which are associated with an elbow dislocation. the chance of median and ulnar nerve injuries, an incarcerated fragment in the joint, as well as other complications, further increases when a fracture is associated with a dislocation. we present the case of a child who sustained a medial epicondyle fracture of the elbow, with a complete ulnar nerve palsy but without a joint dislocation, who was found intraoperatively to have ulnar nerve entrapment in the ulnohumeral joint. the rare occurrence of complications relating to both acute and late ulnar nerve entrapments have been reported before in literature including following supracondylar fractures, medial epicondyle fractures with elbow dislocations, forearm fractures and galeazzi fracture dislocations. however, there have been no reports describing an ulnar nerve intra - articular entrapment, with a medial epicondyle fracture but without an elbow dislocation. a 9-year - old girl presented to the emergency department with right elbow pain and swelling, after falling from a monkey bar onto her right elbow. she had no history or clinical signs of an elbow dislocation, but she had a complete ulnar nerve palsy [with the absence of sensation and increased 2-point discrimination, medical research council (mrc) sensation grading s0 ; mrc power grading 0/5 of intrinsic muscles of the hand, the little finger flexor digitorum profundus (fdp) and flexor carpi ulnaris (fcu) ; froment 's sign was positive), but there was no evidence of vascular compromise. a plain radiograph showed that the medial epicondylar apophysis had been avulsed into the ulna humeral joint space, but there was no other fracture or dislocation seen (fig. figure 1:plain radiographs of the injured right elbow : (a) anteroposterior view and (b) lateral view. plain radiographs of the injured right elbow : (a) anteroposterior view and (b) lateral view. she was taken directly to the operating theatre for emergency surgery, and an examination under anaesthesia revealed no elbow joint instability. the ulnar nerve was not found in the anatomical position, so further exploration was undertaken. the ulnar nerve was subsequently found to be trapped between the trochlea and proximal ulna, intra - articularly (fig. 2). the medial epicondyle was also found avulsed from the humerus, with an incarcerated medial epicondylar fragment in the elbow joint. the medial epicondyle was reduced to its anatomical position and fixed with a single cortical screw. figure 2:intraoperative image showing the intra - articular entrapment of the ulnar nerve highlighted by the arrow. intraoperative image showing the intra - articular entrapment of the ulnar nerve highlighted by the arrow. a few hours post - operatively the sensation over the ulnar territory started to improve (mrc grading s2), fcu and fdp had partially recovered (power improving to mrc grading 3/5), but there was still mrc grading 1/5 of the intrinsic muscles of the hand. on the first post - operative day, the fcu and fdp were fully recovered with a mrc grading of 5/5, but the intrinsic muscles of the hand remained weak. at 2 weeks follow - up, the wound had healed well and the plaster was changed to an above elbow cylinder cast. neurological examination of her hand revealed some still reduced sensation over the ulnar nerve territory, normal fcu and fdp function, with some further recovery of the intrinsic muscles of the hand (mrc grading 3/5). at 5 weeks follow - up, the plaster cast was removed and the patient had a good range of motion of the elbow, with no signs of instability. she had a mrc grading of 5/5 of all the muscles, including the intrinsic muscles of the hand, and froment 's sign was negative, but there was still some reduced sensation (mrc grading s3). follow - up, the patient had full range of movement of the stable elbow with completely recovered ulna nerve function. figure 3:plain radiographs showing the healed fracture of the right elbow at 5 months : (a) anteroposterior view and (b) lateral view. plain radiographs showing the healed fracture of the right elbow at 5 months : (a) anteroposterior view and (b) lateral view. the contribution of the soft tissue structures around the elbow is of great importance in the stabilization of the elbow. knowledge of the anatomy and biomechanics of the elbow, particularly the soft tissue and bony constraints, is of paramount importance in the diagnosis, management and long - term sequelae of injuries. in children, as the bony constraints of the elbow are not well developed, the stability of the elbow depends mainly on the soft tissue structures. therefore, elbow dislocations in children will result in signs of damage of the soft tissue structures of the elbow. however, open reduction with internal fixation of the epicondyle fragment is clearly indicated in cases of intra - articular entrapment of the fragment, on suspicion of entrapment of the ulnar nerve, or in cases of marked instability of the elbow. a medial epicondyle fracture associated with elbow dislocation, in children, may not be easily diagnosed on conventional radiographs because of the small size of the fragment, its hidden position behind the distal humerus and the fact that it can be mistaken for the trochlear ossification centre. in the case presented, complete ulnar nerve palsy was present without any evidence of elbow dislocation in the history and with there being no signs of elbow instability intra - operatively. prompt clinical assessment and surgical treatment confirmed the intra - articular ulna nerve position and avoided that a simple reversible neurapraxia further developed into an irreversible devastating nerve lesion. | elbow fractures are not uncommon in children, and some are associated with neurovascular injuries. having a nerve injury in an elbow fracture without dislocation is rare and was not described in the literature. here, we have reported probably the first case of an ulnar nerve injury in an elbow fracture without dislocation. a 9-year - old female presented to the emergency department after falling off a monkey bar. she had a painful, swollen and tender right elbow with no history or clinical signs of an elbow dislocation but had complete ulnar nerve palsy. she was managed initially with analgesia and plaster application and was taken directly to the operating theatre. examination under anaesthesia revealed no elbow joint instability. the ulnar nerve was found entrapped between the trochlea and proximal ulna, intra - articularly. the medial epicondyle was also found avulsed from the humerus, with an incarcerated medial epicondylar fragment in the elbow joint. |
asthma is an allergic disease characterized by airway inflammation, mucin hypersecretion, and airway hyperresponsiveness (ahr). infiltration of cd4 t cells, eosinophils, mast cells, and b cells and their interaction with airway resident cells contribute to airway inflammation. il-17-producing (th17) numerous studies have shown an increase of th17 cells in inflammatory airway [5, 6 ]. therefore, suppressing th17 response may be a novel therapeutic strategy for treating asthma. notch signaling pathway is evolutionarily conserved. in mammalian, there are four notch receptors (notch1, notch2, notch3, and notch4) and five notch ligands (jagged1, jagged2, delta - like ligand (dll)1, dll3, and dll4). notch plays a crucial role in a broad spectrum of cellular activities such as proliferation, differentiation, and regulation of cell function. a series of enzymatic reactions lead to the cleavage of the notch receptor intracellular domain (nicd) which is translocated to the nucleus, where it binds with csl / rbp - jk to recruit mastermind - like 1 protein. previously, we showed that notch signal pathway regulates the proliferation and differentiation of cd4 t lymphocytes in a mouse model of asthma, indicating that notch may be a potential target for treating asthma. others have reported that pharmacologic inhibitor of notch signaling can reduce allergic pulmonary inflammation by modulating th1 and th2 responses [10, 11 ]. the present study aims to test whether gsi has therapeutic effects on the development of asthma through regulating th17 mediated immune response. male balb / c mice, 4 to 6 weeks old, weighing 2022 g, were purchased from shanghai laboratory animal center (shanghai, china) and bred in pathogen - free environment in the animal center of wenzhou medical university. animal experimental protocol was approved by institutional animal care and use committee (iacuc) of wenzhou medical university. experimental animals were divided into three groups : sham group, ova + dmso (vehicle) group, and ova + gsi (0.3 mg / kg) group. injection of 10 g ovalbumin (ova) (sigma, usa) emulsified in 20 mg al (oh)3 gel in 0.1 ml normal saline (ns) on days 1 and 13. they were then challenged with ova (1 mg / ml) aerosol for 30 min daily for eight consecutive days from day 25 by jet nebulizer (pari is-2 jet nebulizer ; pari respiratory equipment). gsi l685,458 (calbiochem, ca) was administered intranasally 30 minutes before each ova challenge at 0.3 mg / kg as previously described. the sham mice were sensitized and challenged with normal saline (ns) and treatment with dimethylsulfoxide (dmso) as a control for gsi. mice were sacrificed within 24 h after the last allergen challenge. at the time of sacrifice, the left lung tissue was first fixed with 4% paraformaldehyde for 4 h. it was then dehydrated in ethylic alcohol, embedded with paraffin, sectioned in 4 m, and stained with haematoxylin and eosin (he). tissue slices were evaluated through light microscope (nikon) by trained technician in a blind fashion. the degree of allergic airway inflammation was scored according to the following histologic grading system (scored 04) : absence of peribronchial inflammatory cells ; a few scattered peribronchial inflammatory cells involving less than 25% of the circumference of the bronchus ; focal peribronchial inflammatory cells infiltration not completely surrounding a bronchus (i.e., involving approximately 25%75% of the circumference of the bronchus) ; one definite layer of peribronchial inflammatory cells completely surrounding a bronchus ; 2 or more layers of peribronchial inflammatory cells completely surrounding a bronchus. in each lung section the mean peribronchial inflammatory score was determined by the sum of scores of all individual bronchioles in the section divided by the number of bronchioles. the spleen tissue was fragmented into small pieces that were then pressed against nylon mesh with a plunger of a disposable syringe. cd4 t cells from splenic single - cell suspension were isolated by magnetic cell sorting by positive selection method using mouse cd4 t cell isolation kit (macs, miltenyi biotec, germany) according to the manufacturers ' instruction. the purity of the cells was 92.04 5.18%, as confirmed by flow cytometry analysis. fitc - labeled anti - mouse cd4 and pe - labeled anti - mouse il-17a were used to detect th17 cells. for th17 cell analysis, cd4 t cells (1 10/ml) from the spleen tissue were stimulated for 4.5 hr with phorbol myristate acetate (pma) at 100 ng / ml and ionomycin at 1 g / ml in the presence of 1.6 g / ml monensin (all from beyotime, china). cells were collected, washed, and surface - stained with fitc - labeled anti - cd4 antibody at 4c for 20 min in the dark and resuspended in fix / perm solution according to the manufacturer 's instruction (invitrogen, usa). after washing, cells were resuspended in fixation solution and subjected to facscalibur flow cytometer (bd facscanto ii, usa) analysis. lung tissue was fragmented and lysed in ripa buffer with protease inhibitor mixture (beyotime, china). a total protein of 20 g was loaded into each well of a sds - page gel for separation by electrophoresis and then transferred onto nitrocellulose membrane. the resulting blots were blocked for 1 h with tbs tween 20 containing 5% powder skim milk and then probed overnight at 4c with anti - nicd (abcam, uk). blots were then washed three times and probed for 1 h with anti - rabbit hrp - conjugated antibody. rna was extracted from lung tissue using trizol (invitrogen, usa) according to the manufacturer 's instruction. the quantitative real - time rt - pcr was performed using an abi step one plus system (applied biosystems, usa) with quantifast sybr green pcr kit (qiagen, germany). primers used were as follows : gapdh, 5-tggccttccgtgttcctac-3 (forward) and 5-gagttgctgttgaagtcgca-3 (reverse) ; notch1, 5-tgccacaatgagatcggctc-3 (forward) and 5-gagttgctgttgaagtcgca-3 (reverse). delta - delta ct method was used to express the fold induction of target mrna after gapdh normalization. the concentration of cytokines il-17 in serum was assessed by standardized sandwich elisa according to the manufacturer 's protocol. the il-17 kit was purchased from ebioscience, san diego, usa. all data were expressed as mean sem. differences between groups were analyzed for statistical significance by one - way analysis of variance using spss 13.0 software (spss inc., to explore the effect of gsi on ova - induced asthma, babl / c mice were sensitized and challenged with ova (or ns for sham mice). those mice received gsi, a highly selective inhibitor of -secretase or vehicle (dmso), during the challenge phase. mice were sacrificed within 24 h after the last allergen challenge and lung tissue was fixed, embedded, and sectioned for he staining. the degree of airway inflammation of he - stained lung tissue was scored as described in materials and methods. as shown in figure 2(a), ova + dmso group demonstrated significant infiltration of eosinophils and lymphocytes with marked thickening of airway wall and epithelial goblet cell metaplasia, as compared with the sham group. ova - challenged mice showed an inflammation score of 3.25 0.46 as compared to sham control (0.38 0.52). gsi treated group showed a score of 1.88 0.64 that is significantly lower than ova - dmso group (figure 2(b), p < 0.01). to investigate the blockage effects of gsi on notch signaling, mrna expression of notch1, a receptor of notch signaling, was examined. as shown in figure 3(a), ova - challenged mice revealed enhanced notch1 mrna expression, as compared with the sham group (1.31 0.13 versus 0.84 0.13, p < 0.01). on the other hand, gsi treatment led to the reduction of notch1 mrna expression (0.92 0.088 p < 0.01 comparing to ova group). consistent with this observation, ova - challenged mice revealed increased nicd generation as compared to sham group (0.18 0.02 versus 0.09 0.01, p < 0.01). gsi treatment decreased nicd generation (0.06 0.03) comparing to ova group (figure 3(b), p < 0.01). results presented here suggest that gsi can effectively block notch signaling. to evaluate the effect of gsi treatment on th17 cell expansion, splenic cd4 t cells were isolated by magnetic cell sorting. sham group expressed a baseline th17 cell frequency of 0.30 0.16% of total splenic cd4 t cells. ova - induced asthma mice revealed a significant increase of th17 cells (2.43 0.69%, p < 0.01, comparing to sham group). gsi treatment reduced th17 cell frequency to 1.26 0.85% which is statistically significant from ova group (p < 0.05, figure 4). th17 cells are the main source of il-17. to further examine the function of such th17 cells, serum levels of il-17 were measured from ova - induced asthma mice. as illustrated in figure 5, sham group expressed a baseline level of il-17 in serum at 48.07 5.73 the il-17 level was significantly elevated in ova - induced asthma mice (120.09 5.73 pg / ml, p < 0.01). gsi administration during challenge phase significantly reduced the il-17 level to 81.82 8.95 pg / ml, p < 0.01. the notch signaling pathway is involved in many aspects of organ formation and cell function. the effect of notch signaling inhibition on the development of asthma has been addressed in several recent studies. jin and colleagues reported that inhibition of notch signal pathway by gsi alleviated the airway inflammation in ova - induced asthma model and it was through the regulation of th1 and th2 responses. knockdown of the notch l gene by small interfering rna led to overproduction of il-4 and ifn-, which played an important role in the pathogenesis of asthma. however, the exact underlying mechanism is yet to be fully elucidated. in the present study, we used gsi to block notch signaling in a mouse model of asthma and demonstrated that in vivo administration of gsi effectively attenuated eosinophilic and lymphocyte infiltration in the airways and decreased goblet cell metaplasia. furthermore, notch inhibition by gsi reduced the frequency of th17 cells in spleen and the serum levels of il-17. taken together, these findings demonstrate the effectiveness of gsi in animal models and strongly suggest that inhibition of notch signaling could be an effective strategy for the treatment of asthma. t helper 17 (th17) cells play a critical role in adaptive immune responses through the production of cytokines, namely, il-17a, il-17f, and il-22. recent studies indicate that th17 cells are active players in acute airway inflammation of allergic asthma. marked elevation of il-17a li. suggested that the ratio of th17 cells / cd3 t cells in peripheral blood was significantly increased in asthma patients compared with nonasthma individuals. similar change was found in the present study ; that is, the proportion of th17 cells in isolated spleen cd4 t cells was significantly increased in ova - induced asthma mice compared to the sham group. reported that adaptive transferring of th17 cells to an asthma mouse led to neutrophils infiltration and airway hyperresponsiveness, which is resistant to corticosteroid therapy. consistent with these findings, our investigation revealed that treatment with gsi markedly reduced serum il-17 levels of asthma mice. of note, doe. found that il-17a was elevated in mild to moderate human asthma compared with healthy control, while it was not increased in severe asthma. therefore, further research is needed to characterize the exact relationship between il-17 and the severity of asthma. notch can directly regulate retinoic acid - related orphan receptor t, an important transcription factor for th17 differentiation. inhibition of notch signaling by notch3 antibody attenuates th17-type responses, while treatment with notch ligand delta - like 1 promotes th17 response. in vitro knockdown of notch and in vivo administration of gsis result in reduced il-17 production and gsis have been actively tested in clinical trials for alzheimer disease for their potential in blocking the generation of a peptide. mrk003, a -secretase inhibitor, exhibits promising in vitro preclinical activity in multiple myeloma and non - hodgkin 's lymphoma. after blocking notch signaling in our mouse asthma model, we noticed decreased level of nicd, ameliorated airway inflammation, reduced serum il-17 level, and improved clinical signs. our data strongly suggest that inhibition of notch signaling could be considered as an effective therapy for asthma. of course, further preclinical and clinical research is needed to address such potential. in conclusion, the current study proves that gsi administration inhibits th17 differentiation, decreases il-17 production, and alleviates airway inflammation in ova - sensitized and ova - challenged balb / c mice. these results support the idea of considering gsi as a novel, effective antiasthma agent. | t helper 17 (th17) cells play an important role in the pathogenesis of allergic asthma. th17 cell differentiation requires notch signaling. -secretase inhibitor (gsi) blocks notch signaling ; thus, it may be considered as a potential treatment for allergic asthma. the aim of this study was to evaluate the effect of gsi on th17 cell differentiation in a mouse model of allergic asthma. ova was used to induce mouse asthma model in the presence and absence of gsi. gsi ameliorated the development of ova - induced asthma, including suppressing airway inflammation responses and reducing the severity of clinical signs. gsi also significantly suppressed th17-cell responses in spleen and reduced il-17 levels in serum. these findings suggest that gsi directly regulates th17 responses through a notch signaling - dependent pathway in mouse model of allergic asthma, supporting the notion that gsi is a potential therapeutic agent for the treatment of allergic asthma. |
in cases where the court finds in favor of patients in medical malpractice lawsuits, the amount of monetary damage initially claimed by patients often significantly differs from that finally awarded by the courts. the application of the " fair share of damage, " which is commonly accepted as the basic principle of the damage compensation, may explain such a difference. the principle rests on the logic that the liability of compensation imposed on defendants who caused damages should be restricted to injuries aroused as a result of his or her act of omission or negligence and that awarding monetary damages for injuries not reasonably related to defendants ' act of omission or negligence is not in accordance with the principle of equity., the principle of law relevant to the limitation of liability refers to judicial precedents in which the courts compensate patients with a partial reduction of the damages caused by illegal acts, even when there is no negligence on the part of patients in order to practice the philosophy of the equitable share of damages in the damage compensation act. since plastic surgery has gained popularity, legal disputes related to its adverse effects have greatly increased. according to a report based on the damage relief data of the korea consumer agency, the recompense data of the mutual aid association of the korean medical association, and the recompense data of liability insurance for medical accidents, the total compensation amount for 5,110 cases in medicine, dentistry, oriental medicine, and pharmacy between 2008 and 2010 was about 58.7 billion korean won (krw), it thus accounted for 7.27% of the total compensation and 377 cases, placing it in third place, following orthopedics and internal medicine (1). although plastic surgery is designed to improve the appearance of the body, individual medical practices are composed of invasive treatments, which can lead to unexpected complications or adverse reactions. recent judicial precedents indicate that if plastic surgeries were performed at the request of patients for cosmetic purposes, hospitals were not held responsible for 100% of the damages, irrespective of the severity of adverse reactions, excluding exceptional cases, such as operations by non - specialists or fatal incidents of malpractice. the precedents are based on the ideas that 1) commanding plastic surgeons to compensate for all the damages of bad outcomes in medical malpractice lawsuits could adversely affect their future medical activities ; 2) medical practices have a lifesaving nature and medical malpractice is not intentional ; and 3) certain inevitable outcomes might occur due to the constitutional predispositions of patients and the limitations of the modern clinical medicine. therefore, it is considered desirable for the damages to be shared appropriately by plastic surgeons and patients (23). in this case, the main issue is the ' range of liability ' of plastic surgeons. in general, since the recognition of the limitation of liability and its ratio are dependent on the discretion of judges with authority over fact - finding proceedings, it is difficult for litigants to estimate the amount of monetary damages ; predictability is significantly low, even though the discretion of judges greatly affects decisions on the amounts of damage. considering that the principle of law on the limitation of liability seeks equitable share of damages, it seems impossible to present a standard applicable to every case. this study, however, attempts to propose some predictable factors of limitation of liability in the plastic surgery malpractice lawsuits. this study may serve as a useful resource, based on which litigants may predict the amount of damages. therefore, the study also recognizes the number of cases where the courts ' limited liability in the course of reviewing judicial precedents on plastic surgery in court trial courts and typological classifications of the reasons for limitation of liability. this study deals with cases where medical persons were found liable for medical malpractice. to be more specific, this study will analyze civil judgments on malpractice related to cosmetic surgery performed by plastic surgeons in the district courts in korea between 2000 and 2013. this study, however exclude cases of general physicians, plaintiff claims dismissal, mediation, and data recognition.. this study will analyze the difference between the amount claimed and the amount awarded and the reasons for the limitation of liability recognized in such judicial precedents based on the data. of the judicial precedents on the matter of malpractice in plastic surgery in trial courts that were reviewed, the least liability ratio of defendants was 100% (plaintiffs found liable for 0% of the damages), and the highest ratio of limitation of liability was 30% (plaintiffs found liable for 70% of the damage) (fig. the reasons for limiting defendants ' liability in the court rulings on the matter of medical malpractice can be divided into the patient reason and those with plastic surgeons. in addition, patient reasons were subdivided into no - fault and fault reasons (table 1). in detail, the court reduced the amount of damages based on the following no - fault reasons on the part of patients : first, adverse reactions generally occurred in patients with ' specific constitutions ' ; second, although a patient suffered from adverse reactions in surgery, his or her symptoms improved, compared to those before surgery (partially attaining the goal of cosmetic surgery), or could be corrected or improved with future treatments. the reduced the amount of damages based on the following reasons attributable to patients : first, after the occurrence of symptoms, patients ignored them and did not seek proper immediate treatment ; second, patients received multiple plastic surgeries simultaneously in a short period of time ; third, the previous surgeries that patients received were presumed to affect a present surgery, causing adverse reactions. however, in the reasons of the plastic surgeon, the court found that medical staffs were not fully liable for damages, even in cases when they actively attempted to resolve the problem, such as offering free fee reoperations and when adverse reactions occurred in a patient who received a free fee operation without a formal contract (table 1). judicial precedents that recognized 100% malpractice in plastic surgeons without limitation of liability were those with obvious malpractice and negligence. such cases include infection caused by the lack of antibiotics, adverse reactions that led to irreversible permanent functional disorders even with future treatments (deficits in sensory and motor functions), and morphologic abnormalities (scars, deformities, effacements, depressions, and so on) (table 2). in the cases where the plaintiff was not able to establish clear causation between the malpractice of plastic surgeons and injuries on their part, it seems more likely that the courts limited liabilities of the dependent in cases where liability was imposed on medical staffs by the application of presumption of risk, rather than in cases without its application. since it is very difficult for patients to understand the technicalities of medical practice and to prove its occurrence scientifically and rigorously or to establish causation between the acts of the dependent and the damages in medical malpractice lawsuits, the court applies the established precedent theory to ease the burden of proof on patients. in other words, if medical malpractice is proven and if there is no other causes that account for bad outcomes, based on the common sense of ordinary people, the court may find plastic surgeons liable for such damages with the presumption of causal relationships between medical malpractice and outcomes (4). as such, since establishing illegal acts such as medical malpractice, injuries on the part of plaintiffs and causal relationships between the two may determine the outcome of lawsuits, primary attention has been paid to the issue of establishing the causation in medical malpractice lawsuits, and it has been continuously discussed. once the causal relationships between malpractice by medical staffs and injuries are established, the calculation of detailed damage claim amounts becomes the next issue (5). in general, in civil cases when damage is caused or made worse not only by a medical malpractice but also by patient 's acts of omission or negligence, the plaintiff is deemed responsible for a portion of damage and the court reduces the amount of compensatory damages of the defendant, out of respect for the fair share of damages, and is called " comparative negligence. " korean civil law section 396 stipulates that when liability and the amounts of damages are decided, plaintiff 's acts of omission or negligence shall be considered (6). therefore, the court decides the range of compensation in consideration of the plaintiff 's acts of omission or negligence and the establishment of causal relationships ; the amounts are reduced according to comparative negligence, and damages for non - mental injuries, such as solatium, are added (7). although there is also an adjustment step of damage claim amounts in medical malpractice lawsuits, the precedents applied " the principle of law of limitation of liability, " not comparative negligence, so that patients, the defendants, were compensated after the partial reduction of damages. comparative negligence presumes that patients have the duty to mitigate damages and not to cause and expand them ; thus, it reduces damage claim amounts when such duty is violated. in contrast, the principle of law on the limitation of liability is one in which the court discretionarily reduces damage claim amounts, after considering the medical histories or specific constitutions of patients, even when they are without fault, as in the violation of liability, which is fundamentally different from comparative malpractice (89). in medical malpractice lawsuits, even when patients commit no intentional act of omission, the liability of medical staffs may be reduced. the loss compensation function of patients of illegal acts is partially limited in light of the legitimacy or relevance of each case (1011), and a study has suggested that this approach should be restrained due to the absence of a substantive legal basis (12). according to precedents, however, " overwhelming (inevitable) negative outcomes often occurred due to previous illnesses or incompleteness of medicine itself, and the causes of those outcomes were often unclear in medical lawsuits, so that individual plastic surgeons can not be held to be liable for the incompleteness of medicine itself, and these factors need to be considered within the range of liability. " in addition, when patients ' constitutional predispositions or the intervention of contingency affected negative outcomes, despite the absence of patient negligence, it is unfair to impose the full compensation for damages that were caused by patients themselves on plastic surgeons. it is therefore reasonable to reduce them by a certain amount, within a sensible range, based on the principle of equity (1011). just as the reasons for comparative malpractice and the ratio are determined by the full authority of fact - finding proceedings, the recognition of the limitation of liability and the determination of its ratio also depend on the full authority of fact - finding proceedings. according to the precedents of trial courts, the factors affecting the limitation of liability were not consistently applied with a reasonable standard. there were cases in which the recognition of limitation of liability differed in the appellate trial from that of the first trial. a patient who received reduction mammoplasty, face lifting, blepharoplasty and genioplasty sued a plastic surgeon for post - operative scars in the breast and on the face, ectropion, and lagophthalmus. in the first trial, the court found 100% malpractice, without limitation of the defendant 's liability, whereas in the second trial, it limited the liability ratio to 70%, in consideration of prior chin and in the upper and lower eye lid surgery of the plaintiff and the plaintiff 's attempts to receive multiple plastic surgeries within a short period of time (10). in another case, the court ruled the full liability of the defendant in the first trial of a damage suit for a deformity of the nose after rhinoplasty, deciding that this deformity was caused by the surgical malpractice of the defendant. however, the court in the second trial focused on the following facts : the plaintiff went to the defendant because of fee ; the deformity of the nose of the plaintiff was not obvious. although highly advanced, considering the uncertainty of medicine, medical practices, particularly surgeries, are necessarily accompanied by risks, and patients should have also assumed the risks of such operations. the surgical outcomes of cosmetic surgeries are likely to be different from the subjective expectations of patients, which make them dissimilar to those of general medical practices. the court judged that it was against the principle of equity to impose all damages on the plastic surgeon, even though the deformity of the plaintiff 's nose was caused by the corresponding surgery, and it limited the range of defendant 's liability as 70% (11). the recognition of the limitation of liability and deciding its ratio fall under the authority of fact - finding proceedings, and it is difficult to find a predictable and logical standard. according to the precedents, it was not particularly necessary to judge all medical history, even though it was recognized, and the precedents assumed that reasonable judgments could be made by considering various factors, including the severity of previous disease, the areas and degrees of damages, correlations between medical histories and all damage, progress of treatments and the ages, jobs, and health conditions of patients (9). in this case, an excessive right of discretion may be conferred to judges, who may not be able to resolve detailed matters appropriately. therefore, a study has proposed rejecting the present principle of law on the limitation of liability (6). however, it is clear that since this principle considers the accompanying risks of surgery, it is difficult to deny its necessity. logically, since the factors related to damages are in a proportional causal relationship with damages, a proportional decision should be made in deciding the range of compensation, based on objective evidence. however, cases exist in which this is impossible or in which the cost is too high, even though it is possible through scientific analyses. therefore, these cases should be considered in limitation of liability, and the discretion of the court shall be accepted to some degree in order to secure their detailed relevance, even if objective evidence is not clear. instead, the amounts should be reduced within a reasonable range, according to the principle of equity (10). of course, multiple studies have attempted to classify the factors on the limitation of liability that have been applied in medical malpractice lawsuits. since these studies, however, were performed in certain clinical departments with different characteristics, it is inappropriate to apply them directly to the plastic surgery field, which has different characteristics. therefore, this study secured the full texts of written judgments, after the selection of medical malpractice lawsuits that were related to plastic surgery field and identified the following criteria in dealing with the issue of limitation of liability. if a plastic surgeon 's malpractice partially contributed to adverse reactions, the defendants ' damage compensations by the limitation of liability were determined by the following : 1) surgeons fully explained the risks to patients before surgery ; 2) in the case of purely cosmetic surgery, a patient assumes side effects to some extent ; 3) unlike general medical practice, the results of the surgery and the subjective expectations of the patients can vary ; 4) they took preventive measures against adverse reactions ; 5) they attempted to resolve the adverse reactions when they occurred ; 6) surgery fees were pre - paid ; 7) finally, patients can chose a kind of surgery and hospital after being fully informed about surgery. in addition, it is necessary to realize that the limitation of liability also considered the usual differences between surgical outcomes and patients ' subjective expectations in cosmetic surgery. however, although the reasons for the limitation of liability were same, the ratios were decided differently, depending on the issue, and ratio of the limitation of liability was dependent on specific factors. since the court must judge each case based on special reasons with specific relevance, it will be impossible to expect the court to apply uniformly the limitation of liability and its ratio. finally, the relevant explanations of surgery must be pre - operationally given by plastic surgeons to limit liability, despite medical malpractice. it is practically impossible for patients to exert their rights of self - determination in the selection of or the decision about various medical practices without professional medical knowledge. therefore, although patient contributions to adverse outcomes are acknowledged, it is improper to use it as a reason to limit the liability of defendants, if an appropriate explanation is not given. the precedents have also clarified that a proper explanation from the medical staff has to be given in advance. thus, despite the recognition of negligence by patients, proper explanations by medical staff are considered in judging this negligence as a reason for the limitation of liability, so that plastic surgeons should always keep this in mind (1112). in conclusion, plaintiffs are greatly interested both in " obtaining monetary damage compensations " as well as " the amount of damage. " on the issue of " amount of damage compensation, " this study attempted to present the reasons for the limitation of liability. the reasons were classified into factors related to patients, such as patient specific conditions, surgical histories, neglecting symptoms and the probability of improvement after reoperation as well as a factor not related to patients, such as free fee operation. however, since each reason is not equally applied in legal disputes, but reevaluated in detail by judges, obtaining relevance in surgeries based on common sense, even in cases of complications, may be a way in which plastic surgeons can limit their liability in medical malpractice cases. | this study intended to review the precedents on plastic surgery medical malpractice lawsuits in lower - court trials, classify the reasons of ' limitation of liability ' by type, and suggest a standard in the acknowledgement of limitation of liability ratio. the 30 lower - court 's rulings on the cases bearing the medical negligence of the defendants acknowledged the liability ratio of the defendants between 30% and 100%. ten cases ruled that the defendants were wholly responsible for the negligence or malpractice, while 20 cases acknowledged the limitation of liability principle. in the determination of damage compensation amount, the court considered the cause of the victim side, which contributed in the occurrence of the damage. the court also believed that it is against the idea of fairness to have the assailant pay the whole compensation, even there is no victim - side cause such as previous illness or physical constitution of the patient, and applies the legal doctrine on limitation of liability, which is an independent damage compensation adjustment system. most of the rulings also limited the ratio of responsibility to certain extent. when considering that the legal doctrine on limitation of liability which supports concrete validity for the fair sharing of damage, the tangible classification of causes of limitation of liability suggested in this study would be a useful tool in forecasting the ruling of a plastic surgery medical malpractice lawsuit. |
the production of reactive oxygen species on addition of hexavalent chromium (potassium dichromate, k2cr2o7) to lung cells in culture was studied using flow cytometer analysis. a coulter epics profile ii flow cytometer was used to detect the formation of reactive oxygen species after k2cr2o7 was added to a549 cells grown to confluence. the cells were loaded with the dye, 2',7'-dichlorofluorescein diacetate, after which cellular esterases removed the acetate groups and the dye was trapped intracellularly. reactive oxygen species oxidized the dye, with resultant fluorescence. increased doses of cr(vi) caused increasing fluorescence (10-fold higher than background at 200 microm). addition of cr(iii) compounds, as the picolinate or chloride, caused no increased fluorescence. electron paramagnetic resonance (epr) spectroscopic studies indicated that three (as yet unidentified) spectral " signals " of the free radical type were formed on addition of 20, 50, 100, and 200 microm cr(vi) to the a549 cells in suspension. two other epr " signals " with the characteristics of cr(v) entities were seen at field values lower than the standard free radical value. liver microsomes from male sprague - dawley rats treated intraperitoneally with k2cr2o7 (130 mumole / kg every 48 hr for six treatments) had decreased activity of cytochromes p4503a1 and/or 3a2, and 2c11. hepatic microsomes from treated female sprague - dawley rats, in contrast, had increased activities of these isozymes. lung microsomes from male sprague - dawley rats had increased activity of p4502c11.imagesfigure 4.figure 6. |
|
intracranial pial arteriovenous fistula (avfs) are rare cerebrovascular lesions of the brain that have recently been recognized as a distinct pathological entity, differing from the cerebral arteriovenous malformations (avms) in that they lack a true nidus. according to a series reported by halbach. (1), intracranial pial avfs account for 1.6% of all intracranial vascular malformations. however, congenital avfs draining into the cavernous sinus in infants are very rare. here we present the first case of a congenital pial avf between the temporal branch of the left posterior cerebral artery (pca) and the left cavernous sinus through the sphenoparietal sinus, successfully treated by a vertebrobasilar approach with the use of two detachable micro - coils. a 4-month - old infant was admitted to the department of ophthalmology in our hospital with progressive proptosis and redness of his left eye since birth. he was uneventfully delivered at full term, weighing 3.1 kg, and from a healthy mother. there were no signs of irritability, fever or disturbance of swallowing, and weight gain was good. however, the physical examination revealed engorged conjunctiva, tortuous episcleral vessels, and swollen left eyelids. a slight intermittent systolic bruit was heard over the left global, whose rhythm was consistent with the heartbeat. the ophthalmologist strongly suspected cerebrovascular pathology, so the baby was transferred to the department of neurosurgery. an mri examination revealed orbital edema, proptosis, enlargement and tortuosity of the superior ophthalmic vein, prominence of the left cavernous sinus and enlargement of the extraocular muscles (fig. 1a). digital subtraction angiography (dsa) confirmed the diagnosis, classifying the fistula, and delineating the venous pathways. a left single hole fistula was confirmed at the temporal branch of the pca draining directly to cavernous sinus (fig. after multidisciplinary consultation and consent of their families, endovascular treatment was proposed for this infant. the endovascular treatment was performed under general anesthesia and under full intravenous heparinization. via a right percutaneous femoral access, a 4 fr guiding catheter (evoy, cordis, johnson & johnson co., washington dc, usa) was place in the left vertebral artery. the micro - catheter was inserted into the cavernous sinus through the temporal branch of pca under the guidance of road mapping. then micro - coils were deployed in the cavernous sinus through the micro - catheter. cerebral angiography was repeated sequentially after a coil was filled while checking for occlusion of the fistula (fig. finally, the fistula was filled with two detachable micro - coils (5 mm 15 cm, 4 mm 8 cm) that completed occluded the fistula (fig. the systolic blood pressure was kept at approximately 80% of the basal blood pressure for 72 hours after the embolization. intracranial pial avfs are rare cerebrovascular lesions, representing only 1.6% of all brain avms in larger reported series (1). they have recently been recognized as a distinct pathological entity from other intracranial avms. unlike the cerebral avms and dural avfs, pial avfs are comprised of one or more arterial connections to a single venous channel without any intervening nidus of vessels or capillaries. congenital pial avfs are very rare, and little is known regarding their pathophysiological mechanisms. abnormal angiogenesis, cytokines and associated vascular growth factors may play a role in the formation of congenital pial avfs, and it is possible that an embryological misstep could produce these lesions (2). this case is a congenital pial avf between the temporal branch of the left posterior cerebral artery and the left cavernous sinus through the sphenoparietal sinus. anatomically, temporal poles can drain into the sphenoparietal sinus and cavernous sinus (3). thus, this type of avf can occur, although no case like this has been reported. similar to the carotid cavernous fistulas, a congenital pial arteriovenous fistula draining into cavernous sinus can cause bruit, proptosis, conjunctiva chemosis and symptoms referable to the optic and trigeminal nerves. fistulas in newborns and infants manifest as enlarged head circumference, heart failure, seizures or intracranial hemorrhage (4 - 7). in our case, the infant presented only with progressive proptosis and redness of his left eye, so he was admitted to the department of ophthalmology initially. if this infant was continually misdiagnosed as an eye disease, the outcome may have been intracranial hemorrhage or heart failure. little research concerning the natural history of these lesions has been published because they are so rare. there are a few reports regarding spontaneous resolution of a congenital pial avf draining into the cavernous sinus (2, 8). according to one report (9), conservative management of pial avf was associated with mortality in five (63%) of eight patients, so spontaneous closure of pial avfs is not expected. in our case, the infant had a high - flow, single hole fistula, and the clinical manifestations gradually worsened day by day. active treatment was necessarily implemented once diagnosed clearly to prevent fatal cerebral hemorrhage and worst neurocognitive prognosis. endovascular embolization has been proven more efficacious and safe than open surgery in the treatment of cerebral avfs. a number of different embolization materials options for cerebral avfs are currently available, such as detachable balloons, detachable micro - coils and onyx. probably the detachable balloon and the onyx are the first choice for traumatic carotid cavernous fitulas and dural cerebral avfs (2, 9, 10). however, micro - coils were used in our case instead of detachable balloon and onyx. there were two reasons : the femoral artery of the infant was too small to allow the placement of the 8 fr catheter sheath, and the balloon could not pass through the 4 fr guiding catheter, while the branch of the pca was very close to the fistula, and onyx may reflux into the pca (11). though the fistula was a high flow, it was successfully occluded only with two micro - coils, and angiogram by fluoroscope revealed that the fistula was completely occluded with loose packing. to prevent fistula recanalization, the main danger is post - operation cerebral hemorrhage of the feeding arteries, which must be controlled by strict blood pressure monitoring while maintaining the systolic blood pressure at approximately 80% of the basal blood pressure for 72 hours after embolization. the stable occlusion of the fistula has been demonstrated by mri examination at 9 months. | this report concerns a 4-month - old infant with progressive prominent and redness of his left eye since birth. this report concerns a 4-month - old infant with progressive prominent redness of his left eye since birth. angiography revealed a congenital pial arteriovenous fistula between the temporal branch of the left posterior cerebral artery and left cavernous sinus through the sphenoparietal sinus, a condition not reported in the literature. the fistula was successfully occluded with two micro - coils by vertebrobasilar approach. |
eosinophilic esophagitis (eoe) is a commonly recognized pediatric condition that has emerged as a disorder increasingly affecting adults. although eoe has been documented in all ages, races and genders, the typical eoe patient is an adult male with prior history of atopy. eoe is characterized by chronic, immune / antigen - mediated esophageal dysfunction with eosinophil - predominant inflammation. incidence rates of eoe have increased over the past decade beyond what would be expected by increased recognition alone [1, 2 ]. food impaction, chest pain, upper abdominal pain, symptoms of gastroesophageal reflux disease (gerd) and globus have also been reported in some adults with eoe [5, 6 ]. new consensus recommendations released in 2011 established a minimum peak value of 15 eosinophils / hpf as a requirement for a diagnosis of eoe with few exceptions. additionally, due to an increasing prevalence of proton pump inhibitor - responsive esophageal eosinophilia, therapeutic trials of proton pump inhibitor or ph monitoring were recommended to aid in distinguishing eoe from gerd. studies have demonstrated both clinical and histologic response to (1) strict elemental diet, (2) diet restriction based on allergy testing, and (3) diet restriction based on eliminating the more common food allergens. corticosteroids have also been proven to be effective in treating eoe, however clinical and histologic features are known to return with discontinuation of therapy. here we report the case of a 24-year - old female who was diagnosed with eoe with an atypical presentation. a 24-year - old woman was referred to our care in march 2011 with a 3-year history of persistent hiccups and mild, intermittent dyspepsia. her symptoms began with episodic mild chest discomfort lasting one minute followed by bouts of hiccups. over time, the hiccups progressed to up to 10 episodes per day. she had no prior medical history other than one admission for renal calculi, and her only prescription was birth control pills. she had no history of allergy and no known family history of illness as she was adopted. six months before our evaluation she was treated empirically with ranitidine with no relief of her symptoms. she underwent esophagogastroduodenoscopy (egd), which demonstrated trachealization of the esophagus, and biopsies from the distal esophagus showed significant eosinophilic infiltration. she was subsequently placed on a 6-week course of high - dose omeprazole (40 mg twice daily), with minimal relief of her symptoms. a follow - up egd showed persistent trachealization and esophageal eosinophilia (peak eosinophil count of 23/hpf) consistent with a diagnosis of eoe (fig. her symptoms improved substantially within 1 week, with hiccups occurring fewer than 2 times per week. a repeat egd while on treatment demonstrated resolution of trachealization, and biopsies showed histologic remission of eoe (peak eosinophil count of 5/hpf). fluticasone was subsequently discontinued, but the patient developed recurrent hiccups within a few days. they are an involuntary spasmodic contraction of the diaphragm and intercostal muscles, resulting in sudden inspiration and closure of the glottis. multiple causes of hiccups have been described, including gastric or esophageal distention due to overeating or carbonated beverages, phrenic nerve irritation, central nervous system disorders, metabolic, postoperative and psychogenic disorders, medication side effects and reflux esophagitis. the pathogenesis is unclear, but one proposed mechanism suggests that esophageal receptors send impulses via the vagal nerve to respiratory motor neurons, resulting in hiccups. eoe is a chronic, immune / antigen - mediated esophageal disease characterized histologically by eosinophil - predominant inflammation and clinically by symptoms related to esophageal dysfunction. due to overlapping clinical features, the diagnosis of eoe requires distinction from gerd with a trial of a proton pump inhibitor or with ph monitoring. esophageal eosinophilia led to the initial suspicion of gerd and the initiation of acid - modifying therapy. our patient achieved minimal relief with an h2 blocker or proton pump inhibitor, suggesting that hiccups were unlikely related solely to gerd. by contrast, the patient 's clinical, endoscopic and histologic response to topical steroid therapy supports an association between hiccups and eoe and suggests that eoe be considered in the differential diagnosis of patients with refractory hiccups. the international gastrointestinal eosinophil researchers (tigers) concept award (support to p.a.b. and j.l.). | eosinophilic esophagitis (eoe) is a chronic esophageal disease increasingly recognized in adults for its gastrointestinal manifestations. this paper discusses a young woman with eoe who presented with persistent hiccups and intermittent dyspepsia. the patient was initially treated with trials of both h2 blocker and proton pump inhibitor. however, her hiccups resolved only after treatment with topical fluticasone. a repeat upper endoscopy while on steroid treatment demonstrated both histologic remission of eoe and resolution of esophageal trachealization. our patient 's clinical course supports an association between hiccups and eoe, suggesting that eoe be considered in the differential diagnosis of patients with refractory hiccups. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.