article
stringlengths 0
682k
| abstract
stringlengths 146
3.69k
|
|---|---|
video 1left paraaortic, inframesenteric lymphadenectomy supported by icg labelling in cervical cancer.video 1 left paraaortic, inframesenteric lymphadenectomy supported by icg labelling in cervical cancer. | superior hypogastric plexus (shg) contains mainly sympathetic and most probably also postganglionic parasympathetic fibers. thus, surgical damage of shg may cause autonomic pelvic organ dysfunction (kraima., 2015). as already shown for rectal cancer, preservation of the autonomic nerves is facilitated by robotic surgery and may avoid sexual dysfunctions and voiding disorders (kim., 2015). in this educational video, we demonstrate left lower paraaortic lymph node dissection preserving the shg using icg fluorescence to label the lymphatic compartment.prior to total mesometrial resection (tmmr) with therapeutic lymphadenectomy for cervical cancer (hckel., 2009, kimmig., 2013) 4 0.5 ml of a 1.66 mg / ml indocyanine green solution (icg pulsion, pms se, feldkirchen, germany) was injected into the uterine cervix at all four quadrants, 0.5 cm in depth (kimmig., 2016).the lymphatic network of the downstream common iliac and inferior paraaortic lymph compartments of the uterine cervix is visualized (icg fluorescence) including the individual connecting vessels between the different compartments. as can be demonstrated, the medial upper common iliac (subaortic) compartment drains preferentially into the anterior (mesenteric) compartment, whereas lateral common iliac lymphatic vessels mainly drain to the posterior (lumbar) paraaortic compartment. the autonomic nerve fibers of the shp may easily be identified and preserved due to the excellent image resolution and the discrimination from fluorescent lymphatic structures. the video shows the preparation of left lower paraaortic nodes in cervical cancer following icg labeling using a da vinci xi system. this technique seems not only advantageous for preserving shp, but even more highly educational to learn surgical anatomy for trainees. |
the atlantic codex (ac) is the largest collection of drawings and writings by leonardo da vinci, including 1,119 pages collected in 12 volumes, and it is currently preserved at the biblioteca ambrosiana in milan. the sheets (64.5 43.5 cm) were assembled in no particular order and cover a long period of leonardo studies, from 1478 to 1519. the drawings and writings focus on different topics : anatomy, astronomy, botany, chemistry, geography, mathematics, mechanics, machinery drawings, studies on the flight of birds, and architectural projects. the ac has undergone several restorations and the new binding in 12 volumes occurred in the period 197073. in relation to the present assessments, that restoration period is probably the critical starting time of the discoloration when one considers that leonardo da vinci 's antique pages were pasted on modern paper at that time. following the discovery of some discoloration on the pages of the ac, some investigations have been carried out. in october - november 2007, the ac was fully digitized and since 2008 several analyses and assessments have followed, including the present study, to estimate the presence of bacteria or microfungi possibly contributing to ongoing damage. in the old maps drawn by leonardo the raw materials the biological attack of paper materials is therefore mainly due to cellulolytic organisms such as bacteria and fungi [26 ]. the presence in these organisms of the cellulase enzyme complex can catalyze specific actions to break the polymer. the damage varies from erosion to formation of age spots more or less pronounced [7, 8 ]. the biological attack is a function of environmental relative humidity and correlated levels of water absorption. relative humidity is a function of both the absolute amount of water present in the air and ambient temperatures. when the materials reach water content greater than 10% (usually because the air relative humidity is above 60%) the water demand varies significantly more or less depending on the organisms, which can be defined as hydrophilous or xerophilous [1113 ]. the research was carried out on some antique ac pages to determine the nature of the discoloration, a suspected biotic origin, and the possible presence of hazardous conditions for the precious manuscript, using both culture and culture - independent microbiological techniques [1416 ]. the sampling campaigns were carried out in two different days spaced about one month in june and in july. the first intervention included visual and instrumental observation (handle magnifying lighted glass10x magnification) of the antique sheets as they were affixed onto new pages and the taking of samples, using a noninvasive method. in particular, the original (antique paper on ac) and new support sheets (modern paper outer ac) pages 673, 776, and 843 (figure 1) of the ac were tested, both in areas stained and not stained (on and outer ac), for microbiological culture and molecular analysis. some control samples were done on one facsimile of the ac (commercial scanned copy) kept in an environment next to the ac repository. during the second intervention, the percentage of water in the pages of the ac was evaluated ; the spots were observed with the help of an optical microscope (60x100x lighted mini - microscope) and microbiological samples of pages 843 and 895 (verso and recto) were taken. the microclimatic parameters of temperature and humidity were recorded with punctual measurements during the two days of sampling with the use of thermohygrometer salmoiraghi. water content (%) of the pages of the ac was measured by the contact hygrometer aqua boy with a fork - shaped probe. to verify the presence of microorganisms on the pages of the volume a noninvasive sampling technique was used. the aseptic sampling was performed by a single operator using nitrocellulose membranes (sartorius ag, gttingen, germany, 47 mm in diameter, corresponding to an area of 17.34 cm), handled with sterile forceps on the surface of the manuscript, gently pressed with a sterile swab for 30 s. then the surfaces of membranes were rubbed repeatedly with a sterile cotton swab, electrostatically charged to improve the adhesion of particles present. thereafter, the membranes were laid out on rodac contact plates of 55 mm in diameter, containing the following media : tryptone soy agar (tsa) for the mesophilic bacteria ; sabouraud agar + chloramphenicol (sab) for the microfungi ; mannitol salt agar (msa) for staphylococci. petri dishes were incubated at 37c for 48 hours to assess the microbial loads in tsa and msa. sab dishes were placed at 28c for 7 days, and data were reported as colony forming units (cfu)/m. the fungal strains were isolated in pure culture using media suitable for each taxonomical group and placed at 25c (cya : czapek yeast agar, mea : malt extract agar, pda : potato dextrose agar, and mea : malt extract agar). bacterial isolates were identified by 16s rdna sequencing using the primers pair 27f and 1495r. amplification of the nucleic acid was conducted in a 50 l reaction volume consisting of 1x pcr polymerase chain reaction (pcr) rxn buffer, 1.5 mm mgcl2, 200 nm of dntp mix, 250 nm each of the forward and reverse primers, 2.5 u of taq dna polymerase (invitrogen), and 1 l dna template. the thermal cycling programme included an initial denaturation at 95c for 2 min followed by 5 cycles consisting of denaturation at 95c for 30 s, annealing at 60c for 30 s, and extension at 72c for 4 min, 5 cycles consisting of denaturation at 95c for 30 s, annealing at 55c for 30 s, and extension at 72c for 4 min, 20 cycles consisting of denaturation at 94c for 30 s, annealing at 50c for 30 s, and extension at 72c for 4 min, and a final extension step at 72c for 10 min. aliquots of amplicons were loaded in 1.2% agarose gel in 0.5x tbe buffer (45 mm tris - borate, 1 mm edta) to verify specificity. the sequences were analysed using the blastn software (http://www.ncbi.nlm.nih.gov/blast, lane ; polo.). the fungal identification was made by means of morphological analysis, using the above mentioned culture media. from the microscopic observations of pages 673, 776, 843, and 895 it was possible to detect certain characteristics of these coloured spots. the paper of the pages examined (modern paper), in particular at locations where they are glued to leonardo 's antique pages (especially in areas to the interior of the volume), shows blisters (convex) and craters (concave), features that do not seem to be present on the antique sheets of paper. furthermore, in recent months, the observation of page 843 with a magnifying glass and comparison with the scanned image enlarged in 2007 has revealed that the discoloration in question has not enlarged. in the first inspection the air temperature and humidity detected in the conservation environment were 19c and 54% ; in the second survey 20c and 47%, these values fall within the range chosen to calibrate the air - conditioning (19.5 to 20.5c and 4055% rh). the water content (%) of the ac pages was found to be 8% in samples taken on the first sheet, close to the binding, and 10% in the inner pages of the manuscript, then close to the lower limit of the values that may pose a risk of microbial growth. the microbiological results carried out on pages 673, 776, 843, and 895 showed the presence of modest and unremarkable average contamination <3 cfu / m for bacteria and < 2 cfu / m for microfungi both on the surfaces that have stains and those with no stains. as for microfungi, the number of cfus isolated from the ac (table 1) was 36, with 5 genera (alternaria, aspergillus, eurotium, paecilomyces, and penicillium) represented by 12 species and a superior taxon (saccharomycetaceae). figure 2 shows the average cfu / m of microfungi isolated during the two sampling campaigns on the ac, on the outer ac and in the control, ranging from 0.06 to 0.14, with higher values for the samples taken outside of the ac. overall, these recorded values are still very low. the analysis of the sequences obtained from isolated bacteria (table 2) has revealed the presence of the following taxa : staphylococcus hominis, s. epidermidis and staphylococcus spp., massilia timonae, brevundimonas vesicularis, bacillus muralis and other bacillus spp., micrococcaceae, and spiroplasmataceae. our data reveal that the microorganisms identified by sequencing of isolated bacteria from sheets of ancient and modern paper are similar. these sequences are very different from the facsimile of the ac used for the control. the studies undertaken of the stains seen on some pages of the ac reveal that they do not seem to be caused by microbial growth. from these observations it could be assumed that the discoloration is attributable to a degradation of the adhesive used in the last restoration (19701973). over time, this degradation may have been induced by the interaction of a number of exogenous factors such as variations in temperature and humidity [14, 16, 2123 ], the presence of chemical and biological pollutants, dust, and endogenous factors (chemical and physical characteristics of the media - sheets of paper and originals). the careful observation of the stained pages compared with the magnified scanned image can affirm that, in this last year, the chromatic alteration in question has not progressed. the results of microbiological research revealed a widespread presence of vital microorganisms of environmental and human origin. different species have been identified as potential biodeteriogen microfungi for paper materials, including some which can cause allergies or be pathogenic to humans [24, 25 ], but the microbial loads are not significant for the possibility of a biodeteriogenic attack. these data are accompanied by the detection of microclimatic data compatible with a good preservation of manuscripts, while the humidity of the paper in the two sampling campaigns was once normal and the other at the lower limit for risk of microbial growth. among isolated bacteria, opportunistic pathogens of staphylococcus other bacteria found included bacillus muralis, a novel species isolated for the first time from mural paintings located in spain (necropolis of carmona) and germany (church of greene - kreiensen) ; bacillus spp., spore - forming bacteria found in a wide range of habitats ; and spiroplasma, shown to be associated with arthropods. the genus aspergillus is the taxon with the highest number of cfu in the three samples. from table 2 it is also clear that the genus aspergillus is represented by the greatest number of species (6) in the three samples, and among these species a. flavus, a. fumigatus, a. niger, a. terreus, and a. versicolor are those which are found more often in books and documents, representing a potential risk of degradation of the support materials if stored in inappropriate conditions [3033 ]. it is also known that the longevity of their spores can range from 2 to 20 years [8, 34 ]. these species together with eurotium repens and e. amstelodami can also be harmful to humans, for their ability to cause pulmonary invasive aspergillosis, cutaneous infections, keratitis, and allergic reactions [24, 35, 36 ]. paecilomyces variotii is a fungal species commonly found in storage areas of libraries and archives. penicillium chrysogenum and alternaria alternata are known as paper biodeteriogens and penicillium expansum was found capable of degrading straw - cellulose. significant differences in the development of microorganisms were not observed from samples taken on the specified pages with and without discoloration on modern support paper and antique sheet of paper and on stained and unstained areas. analogous to what is found with conventional microbiological techniques, molecular analysis conducted on the whole bacterial and fungal communities by principi. confirmed the indifference of bacterial and fungal species distribution with respect to the observed spots. the critical issues that are revealed by microbiological studies are twofold : the presence of staphylococci in different samples was correlated with human skin contamination and may be the stimulus to improve handling procedures for consultation of the manuscripts ; the presence of several microfungi, potential biodeteriogens for paper material and pathogens for humans, indicates the need to keep the microclimate under control. situations of oscillation parameters may induce the development of potential biodeteriogens of paper material that are present in the air and/or dust. in this regard it is worth mentioning that the inside pages of the ac had a percentage of water at the limit of acceptability (10%). this value can be said to represent the threshold of biological risk that must not be exceeded. the biodeterioration phenomenon is an integrated system of factors, the result of the interaction between the presence and activity of biodeteriogen microorganisms in the environment, microclimatic parameters, and the chemical and physical properties of various materials in the manuscript. biodeterioration then occurs under certain environmental conditions : relative humidity greater than 60%, temperatures above 20c, and percentage content of water in excess of 810%. the vault in which the ac is stored will keep it secure and is designed to ensure proper storage temperature and relative humidity. the critical environmental conservation can be derived possibly from the promiscuity of the things stored in the large space dedicated to not only the preservation of ac, but also other materials. despite the fact that the atlantic codex presented some damage, the set of observations indicate that the discoloration of suspected biological origin on some of leonardo da vinci 's antique pages is not directly related to the presence of microorganisms and that, currently, elements indicative of biodeterioration risk of microbiological origin are very limited. other observations include the following : the structure of the discoloration does not seem typical of microbial growth ; based on accurate monitoring of stained pages over time, it can be said that the chromatic alteration has not progressed in the past year ; the proper storage temperature and relative humidity are present in the vault where the ac is preserved ; and there is an absence of significant differences in the development of microorganisms in samples taken from traditional microbiological cultures on pages with and without discoloration. this first important conclusion that derives from the confluence of several observations, however, should not obscure the risks to which the precious ancient manuscript is exposed. problems were detected at different levels, namely : the mixing of the materials kept in the storage room that do not offer the absolute environmental hygiene ; the presence of staphylococci in various microbiological samples indicates skin contamination through handling of the manuscript ; the presence of different microfungi, potential biodeteriogens for paper material and pathogens for humans. finally, it is worth mentioning that the internal pages have presented the percentage of water to the limit of acceptability (10%). the results of the study are reassuring about the state of conservation of the manuscript in that there are no vital signs of attack by cellulolytic biodeteriogen microorganisms, but the results also indicate the need to monitor continuously and with great accuracy both the microclimate of the storage room to keep the conditions sterile and the mode of consultation of the ac. regarding the genesis of the stains that were examined, one can not reject the hypothesis that their origin may have been biological, perhaps borne of the glue used in the restoration. finally it can be briefly said that the studies show that it is not currently in place a biological attack on the precious ac. the first is that the restoration techniques need to be continually revisited and revised in the light of scientific evidence. the second, closely related to the first, is that we must strengthen the observations and research in the sphere of conservation and restoration. we also believe that the use of molecular techniques in combination with conventional methodologies should be adopted in the field of cultural heritage diagnostics. | following the discovery of discoloration on some pages of the atlantic codex (ac) of leonardo da vinci kept in the biblioteca ambrosiana in milan, some investigations have been carried out to verify the presence of microorganisms, such as bacteria and fungi. to verify the presence of microorganisms a noninvasive method of sampling has been used that was efficient and allowed us to highlight the microbial facies of the material that was examined using conventional microbiological techniques. the microclimatic conditions in the storage room as well as the water content of the volume were also assessed. the combined observations allowed the conclusion that the discoloration of suspected biological origin on some pages of ac is not related to the presence or current attack of microbial agents. |
uterine synechiae or asherman 's syndrome is a condition which can cause infertility, menstrual abnormalities, and recurrent pregnancy losses that occurs due to a partial or complete closure of the uterine cavity and/or the cervical canal (1). moreover, this obliteration may be a direct outcome of surgical endometrial lesions of a gravid uterus such as uterine curettage, placental products depletion in the postpartum period, cesarean section or uterine devascularization in cases of severe postpartum hemorrhage (24). asherman 's syndrome may be induced due to a trauma of nongravid uterine cavity such as diagnostic curettage, hysteroscopic surgery, including mymectomy, polypectomy and endometrial ablation (5, 6). it is estimated to affect 1.5% of women undergoing a hysterosal - pingogram ; between 5% and 39% of women with recurrent miscarriage ; and up to 40% of patients who have undergone repeat dilation and curettage for retained products of conception following pregnancy (7). the exact mechanism of synechiae formation, high interindividual variability for the onset of intrauterine adhesions, unknown influence of gravidity on synechiae formation and effective preventive treatments for the problem are the issues that highlight the need for having experimental animal models to explain synechiae pathogenesis, its prevention and treatment. presence of two completely separate uterine horns with two cervices and the largest bicornuate uterus among laboratory animals made the rabbit an appropriate model for simultaneous evaluation of control and treatment group in an individual case. however, in human and most domestic mammals, ovulation takes place at regular intervals ; the female rabbit ovulation will occur non - spontaneously, therefore, they do not have an estrous cycle with regular periods of heat. rabbits are considered to be in estrus more or less permanently and their ovulation occurs only after mating. therefore, the poly - estrous characteristic of rabbits probably allows the uterine endometrium to be restored shortly after the traumatic curettage of the uterus. in addition, pseudo - pregnancy which is caused by liberation of unfertilized ova is another physiologic trait of rabbit lasting 15 to 18 days. during pseudopregnancy period, corpus luteum and uterus develop as in an ordinary pregnancy (8). the human uterus displays some idiosyncrasies compared to other mammals : 1) a uterine muscle with an apparent thickness can only be observed in some of higher order primates ; 2) the high - regeneration frequency of the endometrium, due to monthly menstrual menses, is also quite specific to human species. in theory, the macaque would be an ideal model, but it would raise ethical concerns and also the considerable additional cost is not negligible. based on these characteristics, khrouf. 's (9) model was modified in this study to create a rabbit model of intrauterine adhesions. eighteen female adult healthy new zealand white rabbits (oryctolagus cuniculus) weighing 35004000 g were randomly selected and kept in the center of comparative and experimental medicine, shiraz university of medical sciences, shiraz, iran. they were housed in the condition of 202c temperature, humidity 60%, and 12 hr light / dark cycle. one third of caudal part of both uteri of all rabbits was submitted to traumatic endometrial curettage. briefly, they were anesthetized and sedated with a single intramuscular (i m) dose of a combination of ketamine 10% (3540 mg / kg, alfasan, netherlands), and xylazine (35 mg / kg, merk, germany) after pre - operative overnight fasting. following laparotomy, the pelvic region was examined in order to exclude any animal with macroscopic abnormality which may interfere with fertility. four - cm curettage of the endometrium was performed with a scalpel through these incisions on the half part of endometrium which was in front of the incision (figure 1b). whole thickness of endometrium was removed and it was continued until observation of bleeding as an indicator of completion of curettage. then, uteri were repaired with 4 - 0 vicryl sutures, abdominal muscles were sutured using 3 - 0 vicryl and the skin was closed with 2 - 0 silk sutures. at the end of the operation, rabbits received flunixin meglumine (0.2 mg / kg, i m, caspian - tamin, iran) immediately and then every 24 hr at 3 doses. i m) was injected as an antimicrobial, just after the operation and continued for 3 days. red marks show incision and curettage sites of the two uteri and green marks show the control sampled sites. b) surgical procedure of intrauterine curettage of the right rabbit uterus using a scalpel grouping of the rabbits is summarized in table 1). the intact rabbits of the second group (n=9) were artificially induced ovulation with vaginal stimulation using a plastic rod during 10 days after surgery. rabbits were sacrificed with a high dose of pentobarbitone (1 g, specia, france) at various times following surgery (days 15, 30 and 45). one third of caudal part of both uteri as curetted and one third of cranial part of both uteri as control and ovaries of intact rabbits were immersion fixed for two weeks in 10% formalin buffer. groups of the present study for induction of human asherman 's syndrome in rabbit model the segments of uteri were embedded in paraffin after fixation and histopathologic sections were made from each block. the 5 m thickness sections were stained with hematoxylin and eosin and green masson 's trichrome to analyze histopathologic damages following curettage and the evolution of the regeneration process with passage of time. hematoxylin and eosin stain slides were visualized and photographed on light microscope (olympus, japan) equipped with an adjusted digital camera (dino - eye, taiwan). lumen area, endometrial area and total area of the uterus were measured using dinocapture 2.0 software (dino - eye, taiwan ; figure 2). the proportion of damaged endometrial luminal epithelium were estimated by calculation of different indices (table 2) of both uteri in six subdivided groups (n=6). synechiae occurring, inflammatory elements and histopathologic changes in time were evaluated in curettage and intact control parts by evaluation of masson 's trichrome slides. lumen area, a : endometrial area ; b : and total area (a+b+c) of the uterine (masson 's trichrome) sections were measured using dinocapture 2.0 software histopathologic indices for evaluation of curetted and control uterus in intact and ovariectomized groups for induction of human asherman 's syndrome in rabbit model this experimental prospective study was approved by the ethics committee for animal experiments in shiraz university of medical sciences, shiraz, iran code number # 92 - 01 - 85 - 6951. the means and standard error (se) of ratio of la / tha, ea / tha, mpa / tha, ea / uwa and mpa / tha were subjected to kolmogorov - smirnov test of normality and at each date (day 15, 30 and 45) were analyzed by two - way anova (spss for windows, version 11.5, spss inc, chicago, illinois), and post - hoc test was performed by lsd test. group means and their se are reported in the graphs (graphpad prism version 5.01 for windows, graphpad software inc., san diego, ca, usa). eighteen female adult healthy new zealand white rabbits (oryctolagus cuniculus) weighing 35004000 g were randomly selected and kept in the center of comparative and experimental medicine, shiraz university of medical sciences, shiraz, iran. they were housed in the condition of 202c temperature, humidity 60%, and 12 hr light / dark cycle. one third of caudal part of both uteri of all rabbits was submitted to traumatic endometrial curettage. briefly, they were anesthetized and sedated with a single intramuscular (i m) dose of a combination of ketamine 10% (3540 mg / kg, alfasan, netherlands), and xylazine (35 mg / kg, merk, germany) after pre - operative overnight fasting. following laparotomy, the pelvic region was examined in order to exclude any animal with macroscopic abnormality which may interfere with fertility. four - cm curettage of the endometrium was performed with a scalpel through these incisions on the half part of endometrium which was in front of the incision (figure 1b). whole thickness of endometrium was removed and it was continued until observation of bleeding as an indicator of completion of curettage. then, uteri were repaired with 4 - 0 vicryl sutures, abdominal muscles were sutured using 3 - 0 vicryl and the skin was closed with 2 - 0 silk sutures. at the end of the operation, rabbits received flunixin meglumine (0.2 mg / kg, i m, caspian - tamin, iran) immediately and then every 24 hr at 3 doses. i m) was injected as an antimicrobial, just after the operation and continued for 3 days. red marks show incision and curettage sites of the two uteri and green marks show the control sampled sites. b) surgical procedure of intrauterine curettage of the right rabbit uterus using a scalpel grouping of the rabbits is summarized in table 1). the intact rabbits of the second group (n=9) were artificially induced ovulation with vaginal stimulation using a plastic rod during 10 days after surgery. rabbits were sacrificed with a high dose of pentobarbitone (1 g, specia, france) at various times following surgery (days 15, 30 and 45). one third of caudal part of both uteri as curetted and one third of cranial part of both uteri as control and ovaries of intact rabbits were immersion fixed for two weeks in 10% formalin buffer. the segments of uteri were embedded in paraffin after fixation and histopathologic sections were made from each block. the 5 m thickness sections were stained with hematoxylin and eosin and green masson 's trichrome to analyze histopathologic damages following curettage and the evolution of the regeneration process with passage of time. hematoxylin and eosin stain slides were visualized and photographed on light microscope (olympus, japan) equipped with an adjusted digital camera (dino - eye, taiwan). lumen area, endometrial area and total area of the uterus were measured using dinocapture 2.0 software (dino - eye, taiwan ; figure 2). the proportion of damaged endometrial luminal epithelium were estimated by calculation of different indices (table 2) of both uteri in six subdivided groups (n=6). synechiae occurring, inflammatory elements and histopathologic changes in time were evaluated in curettage and intact control parts by evaluation of masson 's trichrome slides. lumen area, a : endometrial area ; b : and total area (a+b+c) of the uterine (masson 's trichrome) sections were measured using dinocapture 2.0 software histopathologic indices for evaluation of curetted and control uterus in intact and ovariectomized groups for induction of human asherman 's syndrome in rabbit model this experimental prospective study was approved by the ethics committee for animal experiments in shiraz university of medical sciences, shiraz, iran code number # 92 - 01 - 85 - 6951. the means and standard error (se) of ratio of la / tha, ea / tha, mpa / tha, ea / uwa and mpa / tha were subjected to kolmogorov - smirnov test of normality and at each date (day 15, 30 and 45) were analyzed by two - way anova (spss for windows, version 11.5, spss inc, chicago, illinois), and post - hoc test was performed by lsd test. group means and their se are reported in the graphs (graphpad prism version 5.01 for windows, graphpad software inc., complete lumen obstruction of curettage site of two uterine horns was induced hydrometra (figure 3a). histopathologic findings showed significant epithelial damage together with significant inflammatory reaction in the intact and ovariectomized curettage groups (figures 3b, 3c, 3e, and 3f) in comparison with the control groups (figures 3d and 3 g). furthermore, ovarian sections in the intact groups with corpus lutea did not have secondary or tertiary follicles which confirmed pseudo - pregnancy induction (figure 3h). a : complete lumen obstruction of curettage site of uterus induced hydrometra in two uteri (hematoxylin and eosin). b : intact and c : ovariectomized groups ' endometrial damage in the site of curettage (hematoxylin and eosin). h : presence of corpus lutea in ovarian section of intact group (hematoxylin and eosin) uterine la / tha ratios of intact curettage group on days 15 and 45 were more than the intact control group on day 15 (p=0.002 and p=0.049, respectively, figure 4a). furthermore, uterine la / tha ratios of intact curettage group was more than the ovariectomized curettage group on day 15 (p<0.05, figure 4a). moreover, ea / tha ratio of the intact curettage group on day 30 was less than the intact control group on day 30 (p=0.036, figure 4b). ea / tha ratio of the intact control group was more than the ovariectomized control group on day 30 (p=0.034, figure 4b). in addition, mpa / tha ratio did not change during the period of study in both groups of intact and ovariectomized (figure 4c). ea / uwa ratio and mpa / uwa ratio did not change during the period of study in the both groups of intact and ovariectomized (figures 5a and 5b). mean and standard error of histopathologic indices of curetted and control uterus in rabbits in intact and ovariectomized groups, 15, 30, and 45 days after asherman 's syndrome induction. a : lumen area / total area ratio ; b : endometrial area / total area ratio ; c : myometrial and perimetrial area / total area ratio. a, b : different letters show significant differences between different days in the same group of intact or ovariectomized (p<0.05). asterisks show significant differences between different groups of intact and ovariectomized on the same days (p<0.05) mean and standard error of histopathologic indices of curetted and control uterus in rabbits in intact and ovariectomized groups, 15, 30, and 45 days after asherman 's syndrome induction. a : endometrial area / uterine wall area ratio, c : myometrial and perimetrial area / uterine wall area ratio the present study was performed to create an animal model of postoperative synechiae based on the endometrial curettage, a true clinical situation in rabbits. the examination of the uterine sections in the intact and ovariectomized rabbits showed that curettage was effective for endometrial destruction during 15 and 30 days after induction. however, histopathologic examination on day 45 demonstrated a partial regeneration of endometrium especially in the ovariectomized group. in addition, a significant increase in lumen surface on day 15 in the intact group with a lower simple columnar epithelium compared to the control was observed. ovariectomy interrupts the effect of ovarian cycle on healing and regeneration of endometrium and therefore, fibroblasts gain enough time to proliferate in the curetted endometrium. however, with ovariectomy, the uterine size rapidly regressed and different ratios were used to evaluate the exact effect of curettage on synechiae induction. moreover, the intact curetted rabbits were vaginally stimulated using a plastic rod to induce pseudo - pregnancy. presence of corpus lutea on the ovaries of pseudo - pregnant intact curetted rabbits and ovariectomy of the ovariectomized group prevented the effect of estrous cyclic changes on endometrial decline and growth which may omit the curettage effect. preserving fertility after endouterine surgery is a great concern for clinicians and synechiae is considered as a postoperative complication which, in some cases, may be hard to treat (10). although it usually occurs following curettage of the pregnant or recently pregnant uterus, any uterine surgery, trauma or infection, particularly after pregnancy when estradiol levels are low, can lead to synechiae (10, 11). in contrast with these great interests, little is currently known about the process of synechiae formation and its physiopathology, while this could help in developing effective preventive treatments. for these considerations, creating an animal model is essential because it represents a tool for the description of time - related histopathologic changes after endouterine trauma. moreover, since causal relationship between endometrial surgery and infertility has been established based on retrospective studies (1214), synechiae induction in an animal model may allow further investigations of this relationship. in contrast with the high number of publications using animal models for intraperitoneal adhesions (1517), intrauterine adhesions (iuas) are rarely investigated or described in animals. spontaneous iuas were also reported with 9% frequency in a unique retrospective study of 87 hypofertile mares (18). however, to the best of our knowledge, there are four studies for induction of iuas in experimental rabbit model (9, 1921). in three of them, a traumatic curettage of the endometrium in rabbits were pretreated with estrogens (19) progesterone (20) or without pretreatment (21). none of these experimentations succeeded in creating iuas and the authors report a complete regeneration of endometrium on day 7 of the surgery. (9) also evaluated the rabbit as an experimental model of asherman 's syndrome and tried to induce synechiae using traumatic curettage as a trigger mechanism. in their model as a first attempt in induction of this disease in animal model, no synechiae have been observed after traumatic endometrial curettage and examinations on days 7, 15 and 30 demonstrated a complete regeneration of endometrium (9). despite the fact that those studies failed to create synechiae using curettage, the endometrial curettage was used in the present study as it is a frequent procedure in routine gynecological activity. the present study has two modifications compared to the previous ones in rabbit model : 1) reducing the endometrial proliferation by deletion or fixation of ovarian hormone effects (pseoudo - pregnancy or ovariectomy) and 2) the method of histopathology evaluation using uterine layers ratios which could demonstrate uterine defects. in contrast with previous findings, intrauterine fibrosis was revealed using curettage and the present study demonstrate an increased lumen surface probably due to a low endometrial thickness. other surgical approaches such as endometrial destruction by cryosurgery or chemical aggression had no success (22, 23). finally, a two - step procedure including subcutaneous graft of sponge and its insertion into the uterine horn after three weeks was performed in rats, rabbits, monkeys and humans. with this model, total iuas were obtained which showed that fibroblast has a major role in asherman 's syndrome pathology (24). however, this procedure is not comparable to clinical situations leading to asherman 's syndrome, because these synechiae are probably a simple immunological reaction against a foreign body and unhelpful for clinical purposes. our results are in concordance with schenker 's experimentation using curettage (21) and despite significant endometrial destruction, a partial regeneration of endometrium especially in ovariectomized group was observed on day 45. existence of some correlation between histopathologic morphology of endomterium and its functional aspect as shown in this study suggests the benefit of histopathologic examination to predict iuas. the idea that implantation and pregnancy is associated with immune suppression has created a myth of pregnancy as a state of immunological weakness (25). however, inflammation impact on implantation remains unclear ; while some publications report negative impact of inflammation (26, 27), other authors have shown that a local injury of the endometrium induced an inflammatory response that promotes successful implantation (11, 28, 29). this model allowed an evaluation of histopathology for appreciation of endometrial function and also demonstrates the potential impact of curettage on endometrial structure, regeneration and fertility. in conclusion, a model of asherman 's syndrome was proposed in the rabbit and uterine fibrosis was observed in the intact curettage group. therefore, this modified model, psoudo - pregnant curetted uterus, represents a pathogenesis condition in the rabbit similar to iuas observed in the human and will help in our understanding of the physiopathology of asherman 's syndrome. | background : uterine synechiae or asherman 's syndrome is a condition that can cause infertility. the present experimental study was designed to establish the rabbit as an animal model for human asherman 's syndrome using the endometrial curettage.methods:in an experimental study, female adult rabbits (n=18) were randomly divided into intact and ovariectomized groups. one third of caudal part of both uteri was submitted to traumatic endometrial curettage. one group was simultaneously ovariectomized. the intact rabbits were artificially induced ovulation during 10 days after surgery. one third of cranial part of both uteri was selected as the control. synechiae occurring, luminal area / total area (la / ta), endometrial area / total area (ea / ta), myometrial and perimetrial area / total area (mpa / ta), endometrial area / uterine wall area (ea / uwa), and myometrial and perimetrial area / uterine wall area (mpa / uwa) ratios of both uteri in six subdivided groups (n=6) were analysed in curetted and intact control parts. on days 15, 30 and 45 following surgery by two - way anova and lsd test (p<0.05).results : histopathologic findings showed significant epithelial damage together with significant inflammatory reaction in the intact curettage group. the la / ta ratios of the intact curettage group on days 15 and 45 were more than the intact control group on day 15. the ea / ta ratio of the intact curettage group on day 30 was less than the intact control group on day 30.conclusion:uterine fibrosis was observed in intact curettage group, and this modified animal model showed a pathogenesis condition similar to intrauterine adhesions observed in human. |
multiple sclerosis (ms) is a progressive disease of the central nervous system in which communication between the brain and other parts of the body is disrupted. its effects can range from relatively benign in most cases to somewhat disabling and then to devastating for some people. during an ms attack, inflammation occurs in areas of the white matter of the central nervous system in random patches ; these are called plaques. myelin allows for smooth, high - speed transmission of electrochemical messages between the brain, the spinal cord, and the rest of the body. when myelin is damaged, neurological transmission of messages may be slowed or blocked completely, resulting in some body functions being diminished or lost. approximately 520 000 people in the americas, 630 000 in europe, 66 000 in the eastern mediterranean, 56 000 in the western pacific, 31 500 in southeast asia, 11 000 in africa, and 1.3 million people worldwide have been diagnosed with ms. it primarily affects adults, has an age of onset typically between 20 and 40 years, and is twice as common in women than in men. symptoms and signs of ms vary widely depending on the location of affected myelin sheaths. the most common symptoms of ms are weakness, spasticity in one or more limbs seen in 50% of ms patients followed by numbness, tingling, and fatigue (40%), partial or complete loss of vision, double or blurred vision (31%), incontinence of urine and dysfunction of the bowel (17.5%), pain (15%), cognitive or behavioral problems, and sexual dysfunction (10%). in the worst cases it is a mild disease, but in others, it can lead to permanent disability. although symptoms may resolve completely between the episodes, permanent neurological problems usually persist, especially as the disease progresses. many risk factors for ms have been identified, but no definitive cause has been found. however, a number of alternative or complementary therapies have been used worldwide to treat the disease symptomatically and convert ms into remission. the five most prevalent alternative or complementary approaches are diet and nutrition (88.3%), acupuncture (86.7%), herbal medicine (81.7%), massage (78.3%), and homeopathy (73.3%). chinese scalp acupuncture is a contemporary acupuncture technique integrating traditional chinese needling methods with western medical knowledge of the cerebral cortex (figures 1 and 2). scalp acupuncture has been proven to be a very effective technique for treating central nervous system disorders ranging from ms, strokes, parkinson 's disease, traumatic brain injury, and posttraumatic stress disorder to phantom pain and complex regional pain. the scalp somato - topic system appears to manifest the convergence of the central nervous system and the endocrine system. the scalp somatotopic system seems to operate as a miniature transmitter - receiver in direct contact with the central nervous system and endocrine system. by stimulating those reflex areas, acupuncture can have a direct effect on the cerebral cortex, cerebellum, thalamocortical circuits, thalamus, hypothalamus, and pineal body. the scalp 's unique neurologic and endocrinal composition makes it an ideal external stimulating field for internal activities of the brain. using a small number of needles, scalp acupuncture can often produce remarkable results almost immediately, sometimes taking only several minutes to complete. charles, a 58-year - old lawyer, came to the clinic in albuquerque, new mexico, in 2010. his initial symptoms were an onset of numbness in the right arm that was followed by subsequent numbness descending down both legs. over the past 20 years, charles had multiple relapses and remissions with episodes of lower extremity weakness, stiffness and muscle spasm, incontinence of urine, loss of balance, double vision, and fatigue. twelve years ago, he had a dramatic neurological decline during which he was unable to walk steadily and lost strength and sensation in his lower extremities. for the last 3 years, up to when he came to the clinic, it was more difficult for him to walk due to weakness in his legs and loss of balance. charles also complained of numbness, tingling, and spasms in his legs accompanied by incontinence of urine, double vision, poor memory and concentration, dizziness and vertigo, heat intolerance, and severe fatigue. his diagnosis had been confirmed by several mris that showed lesions in the brain and spine. family history revealed that a brother with ms had died in 1999, and two sisters have been diagnosed with ms. for the first scalp acupuncture session, general and neurological examinations were carried out. motor strength was 4/5 in both legs and 5/5 in both arms and in hand grip the patient 's finger - to - nose tests on both right and left sides were abnormal. charles had difficulty getting out of a chair and presented with spastic and ataxic gait. he ambulated with stiffness in both legs, was unsteady, and had a wide - based stance. the patient failed the heel - toe walking test and could not stand on one leg. chinese medical examination showed that his tongue was red and slightly purple with a thin yellow coating ; his pulse on the left side was wiry and rolling ; on the right side, it was wiry and thready, and weak pulses were also noticed in the kidney positions. when palpating points, lr-3 (taichong), gb-34 (yanglingquan), ub-18 (ganshu), and sp-9 (yinlingquan) were very tender and resulted in sharp pain, and ub-23 (shenshu), and ub-15 (xinshu) were tender and showed dull soreness. primary scalp areas were motor area, sensory area, and foot motor and sensory area. secondary scalp areas were balance area, hearing and dizziness area, and tremor area (figures 3 - 5). the motor area, sensory area, and foot motor and sensory area received needles that were stimulated bilaterally. the needles were rotated at least 200 times per minute with thumb and index finger for 1 to 3 minutes. he was amazed to feel the dizziness, balance, stiffness, and weakness in his legs improve just minutes after a few needles were inserted in his scalp. he was initially very suspicious and nervous when the doctor asked him to stand up with his eyes closed. he was not only able to stand up with improved stability, but he also could walk much better. at the second treatment, charles reported that he had no more incontinence of urine and that the numbness, spasms, and weakness of both legs showed some improvement as well., charles 's vision had significantly improved, and he no longer had double vision and heat intolerance. he also had more energy and was able to do more work at his law office. by the fifth treatment, charles reported that he was able to walk around his home and office without problems and that he could walk much longer distances. he had more energy and had not experienced incontinence of urine since the first treatment. what is a longtime local lawyer doing, writing about serious medical problems like multiple sclerosis (ms) and parkinson 's disease ? it is because i have had the rare opportunity of taking part in what i unhesitatingly tell everyone is nothing less than a miracle. what was uppermost was that 20 years earlier i had been diagnosed with multiple sclerosis ms took my brother in 1999 and has crippled one of my sisters and compromised the life of my youngest sister. i had managed to keep the disease under control and under wraps by wisely following my wife 's advice on nutrition, exercise, and a common - sense approach to ms. together we made trips to leading medical centers where i became a voluntary guinea pig for new medications. on top of that, i was tested, scanned, poked, and prodded over and [over ] again by some of the best neurologists and medical professionals studying the disease. finally, despite all that, the symptoms were taking their toll, especially in the heat of the mesilla valley 's long summer. i realized i could no longer continue as head of the law firm i had helped to build over 3 decades. when my firm dissolved, i joined another law firm on a part - time basis to comply with limited energy and finish up so on a hot july day i awaited my first client at my new office that client was dr vittal pai, whom i 'd known for more than 20 years. i had not seen dr pai in a couple of years and always enjoyed visiting with him. dr pai, an ear, nose, and throat specialist, is a brilliant doctor known as much for his philosophical approach to life and his quick thinking and wit as he is for his substantial skills as a physician. dr pai observed my condition and placed a card on my desk saying, before we talk business, you must go see this doctor. i looked at the card and saw the name dr jason hao, doctor of oriental medicine and acupuncture. after exchanging greetings, i told dr pai that i had been a subject in medical studies at universities with the best neurologists in the world. other than steroids, i was disqualified from all the medications that had been approved to combat ms. he told me about a patient with parkinson 's disease who had incurable tremors that could not be controlled by medication. he told me about another patient with mobility damage from a stroke who seemed to have been miraculously cured with dr hao 's technique. i have had 12 treatments with dr hao at his clinic in albuquerque, new mexico. not only does he put needles in my head but he spins these needles with his fingers between 200 and 400 times a minute. dr hao told me that all of the nerves in the body can be accessed in the scalp and that the spinning of the needles clears the nerve pathways that have become broken and clogged. after these treatments, all of my major symptoms of ms are gone. my left foot, which has been numb for 18 years, is no longer numb. my vision has improved, my balance has returned, and i have not had vertigo in some time. every aspect of my life is better. i am working full - time again, although dr hao cautions me that ms is still my greatest enemy and that he has only relieved me of the symptoms brought on by the attacks. he cautions me to never use more than 70% of my energy in any 24-hour period and to take the prescribed herbs and follow basic nutritional guides. my wife and i look at each other on a daily basis and expect for this dream to end : this dream about a chinese doctor in albuquerque who spins acupuncture needles in my head to make the symptoms of ms go away. but every day i feel better, and my treatments with dr hao are now on a monthly basis rather than a weekly basis. twenty years of debilitating symptoms that compromised every aspect of my life reduced to a memory in 6 months ! those who knew me before last july and see me now at first just ca n't believe their own eyes. in view of my changes and my many inquiries to dr hao, i can not help but wonder : why is this particular form of acupuncture still not embraced coast to coast ? the treatments last about an hour and are relatively inexpensive and completely painless. for the tenth scalp acupuncture session, charles was awake, alert, cooperative, very attentive, and gave quicker responses. motor strength increased to 5/5 in both legs, both arms, and hand grip. the patient 's finger - to - nose tests on both right and left sides returned to normal. charles got out of a chair without any challenge and ambulated with a normal gait. the patient peformed the heel - toe walking test with no problems and could stand on either his left or right leg steadily. chinese medical examination at the tenth session showed that his tongue had changed to slightly red with a thin white coating ; his pulses changed to soft on both left and right sides, and pulses in the kidney positions changed to thready. when palpating points, all sensitive points including lr-3 (taichong), gb-34 (yanglingquan), ub-18 (ganshu), sp-9 (yinlingquan), ub-23(shenshu), and ub-15 (xinshu) showed neither tenderness nor pain and soreness. after the tenth treatment, charles was able to work full - time and started to take vacations again. he reported that he enjoyed standing on one leg during his work breaks and that doing so helped him feel like a normal person. although charles returned to a normal life, he prefers to come to the clinic every 4 to 6 weeks for maintenance treatments. primary scalp areas were motor area, sensory area, and foot motor and sensory area. secondary scalp areas were balance area, hearing and dizziness area, and tremor area (figures 3 - 5). the motor area, sensory area, and foot motor and sensory area received needles that were stimulated bilaterally. the needles were rotated at least 200 times per minute with thumb and index finger for 1 to 3 minutes. he was amazed to feel the dizziness, balance, stiffness, and weakness in his legs improve just minutes after a few needles were inserted in his scalp. he was initially very suspicious and nervous when the doctor asked him to stand up with his eyes closed. he was not only able to stand up with improved stability, but he also could walk much better. at the second treatment, charles reported that he had no more incontinence of urine and that the numbness, spasms, and weakness of both legs showed some improvement as well. charles 's vision had significantly improved, and he no longer had double vision and heat intolerance. he also had more energy and was able to do more work at his law office. by the fifth treatment, charles reported that he was able to walk around his home and office without problems and that he could walk much longer distances. he had more energy and had not experienced incontinence of urine since the first treatment. you are likely to wonder, what is a longtime local lawyer doing, writing about serious medical problems like multiple sclerosis (ms) and parkinson 's disease ? it is because i have had the rare opportunity of taking part in what i unhesitatingly tell everyone is nothing less than a miracle. what was uppermost was that 20 years earlier i had been diagnosed with multiple sclerosis ms took my brother in 1999 and has crippled one of my sisters and compromised the life of my youngest sister. i had managed to keep the disease under control and under wraps by wisely following my wife 's advice on nutrition, exercise, and a common - sense approach to ms. together we made trips to leading medical centers where i became a voluntary guinea pig for new medications. on top of that, i was tested, scanned, poked, and prodded over and [over ] again by some of the best neurologists and medical professionals studying the disease. finally, despite all that, the symptoms were taking their toll, especially in the heat of the mesilla valley 's long summer. i realized i could no longer continue as head of the law firm i had helped to build over 3 decades. when my firm dissolved, i joined another law firm on a part - time basis to comply with limited energy and finish up so on a hot july day i awaited my first client at my new office that client was dr vittal pai, whom i 'd known for more than 20 years. i had not seen dr pai in a couple of years and always enjoyed visiting with him. dr pai, an ear, nose, and throat specialist, is a brilliant doctor known as much for his philosophical approach to life and his quick thinking and wit as he is for his substantial skills as a physician. dr pai observed my condition and placed a card on my desk saying, before we talk business, you must go see this doctor. i looked at the card and saw the name dr jason hao, doctor of oriental medicine and acupuncture. after exchanging greetings, i told dr pai that i had been a subject in medical studies at universities with the best neurologists in the world. other than steroids, i was disqualified from all the medications that had been approved to combat ms. he told me about a patient with parkinson 's disease who had incurable tremors that could not be controlled by medication. he told me about another patient with mobility damage from a stroke who seemed to have been miraculously cured with dr hao 's technique. i have had 12 treatments with dr hao at his clinic in albuquerque, new mexico. not only does he put needles in my head but he spins these needles with his fingers between 200 and 400 times a minute. dr hao told me that all of the nerves in the body can be accessed in the scalp and that the spinning of the needles clears the nerve pathways that have become broken and clogged. my left foot, which has been numb for 18 years, is no longer numb. my vision has improved, my balance has returned, and i have not had vertigo in some time. every aspect of my life is better. i am working full - time again, although dr hao cautions me that ms is still my greatest enemy and that he has only relieved me of the symptoms brought on by the attacks. he cautions me to never use more than 70% of my energy in any 24-hour period and to take the prescribed herbs and follow basic nutritional guides. my wife and i look at each other on a daily basis and expect for this dream to end : this dream about a chinese doctor in albuquerque who spins acupuncture needles in my head to make the symptoms of ms go away. but every day i feel better, and my treatments with dr hao are now on a monthly basis rather than a weekly basis. twenty years of debilitating symptoms that compromised every aspect of my life reduced to a memory in 6 months ! those who knew me before last july and see me now at first just ca n't believe their own eyes. in view of my changes and my many inquiries to dr hao, i can not help but wonder : why is this particular form of acupuncture still not embraced coast to coast ? the treatments last about an hour and are relatively inexpensive and completely painless. for the tenth scalp acupuncture session charles was awake, alert, cooperative, very attentive, and gave quicker responses. motor strength increased to 5/5 in both legs, both arms, and hand grip. the patient 's finger - to - nose tests on both right and left sides returned to normal. charles got out of a chair without any challenge and ambulated with a normal gait. the patient peformed the heel - toe walking test with no problems and could stand on either his left or right leg steadily. chinese medical examination at the tenth session showed that his tongue had changed to slightly red with a thin white coating ; his pulses changed to soft on both left and right sides, and pulses in the kidney positions changed to thready. when palpating points, all sensitive points including lr-3 (taichong), gb-34 (yanglingquan), ub-18 (ganshu), sp-9 (yinlingquan), ub-23(shenshu), and ub-15 (xinshu) showed neither tenderness nor pain and soreness. after the tenth treatment, charles was able to work full - time and started to take vacations again. he reported that he enjoyed standing on one leg during his work breaks and that doing so helped him feel like a normal person. although charles returned to a normal life, he prefers to come to the clinic every 4 to 6 weeks for maintenance treatments. you are likely to wonder, what is a longtime local lawyer doing, writing about serious medical problems like multiple sclerosis (ms) and parkinson 's disease ? it is because i have had the rare opportunity of taking part in what i unhesitatingly tell everyone is nothing less than a miracle. what was uppermost was that 20 years earlier i had been diagnosed with multiple sclerosis ms took my brother in 1999 and has crippled one of my sisters and compromised the life of my youngest sister. i had managed to keep the disease under control and under wraps by wisely following my wife 's advice on nutrition, exercise, and a common - sense approach to ms. together we made trips to leading medical centers where i became a voluntary guinea pig for new medications. on top of that, i was tested, scanned, poked, and prodded over and [over ] again by some of the best neurologists and medical professionals studying the disease. finally, despite all that, the symptoms were taking their toll, especially in the heat of the mesilla valley 's long summer. i realized i could no longer continue as head of the law firm i had helped to build over 3 decades. when my firm dissolved, i joined another law firm on a part - time basis to comply with limited energy and finish up so on a hot july day i awaited my first client at my new office that client was dr vittal pai, whom i 'd known for more than 20 years. i had not seen dr pai in a couple of years and always enjoyed visiting with him. dr pai, an ear, nose, and throat specialist, is a brilliant doctor known as much for his philosophical approach to life and his quick thinking and wit as he is for his substantial skills as a physician. dr pai observed my condition and placed a card on my desk saying, before we talk business, you must go see this doctor. i looked at the card and saw the name dr jason hao, doctor of oriental medicine and acupuncture. after exchanging greetings, i told dr pai that i had been a subject in medical studies at universities with the best neurologists in the world. other than steroids, i was disqualified from all the medications that had been approved to combat ms. those of you who know dr pai also know his serene smile. he told me about a patient with parkinson 's disease who had incurable tremors that could not be controlled by medication. he told me about another patient with mobility damage from a stroke who seemed to have been miraculously cured with dr hao 's technique. i have had 12 treatments with dr hao at his clinic in albuquerque, new mexico. not only does he put needles in my head but he spins these needles with his fingers between 200 and 400 times a minute. dr hao told me that all of the nerves in the body can be accessed in the scalp and that the spinning of the needles clears the nerve pathways that have become broken and clogged. after these treatments, all of my major symptoms of ms are gone. my left foot, which has been numb for 18 years, is no longer numb. my vision has improved, my balance has returned, and i have not had vertigo in some time. every aspect of my life is better. i am working full - time again, although dr hao cautions me that ms is still my greatest enemy and that he has only relieved me of the symptoms brought on by the attacks. he cautions me to never use more than 70% of my energy in any 24-hour period and to take the prescribed herbs and follow basic nutritional guides. my wife and i look at each other on a daily basis and expect for this dream to end : this dream about a chinese doctor in albuquerque who spins acupuncture needles in my head to make the symptoms of ms go away. but every day i feel better, and my treatments with dr hao are now on a monthly basis rather than a weekly basis. twenty years of debilitating symptoms that compromised every aspect of my life reduced to a memory in 6 months ! those who knew me before last july and see me now at first just ca n't believe their own eyes. in view of my changes and my many inquiries to dr hao, i can not help but wonder : why is this particular form of acupuncture still not embraced coast to coast ? scalp acupuncture has proven to have superior success in treating ms and other central nervous system damage as compared to other acupuncture modalities including acupuncture on the ear, body, and hand. it not only can improve the symptoms and the patient 's quality of life and slow and reverse the progression of physical disability but also reduce the number of relapses. patients should get acupuncture treatment as soon as possible ; the earlier the treatment, the better the prognosis. scalp acupuncture treatment for ms has had much success in reducing numbness and pain, decreasing spasms, improving weakness and paralysis of limbs, and improving balance. many patients also have reported that their bladder and bowel control, fatigue, and overall sense of well - being significantly improved after treatment. as stated above, recent studies have shown that scalp acupuncture can be a very effective modality in controlling ms. it usually relieves symptoms immediately, and sometimes in just several minutes noticeable results are achieved. the primary acupuncture areas for patients with motor problems such as paralysis, weakness of limbs, or abnormal sensations in limbs, including tingling, numbness, or pain, are the motor area, sensory area, and foot motor and sensory area. those areas should be inserted with needles and stimulated unilaterally or bilaterally, according to the patient 's manifestations. select the balance area or dizziness area of the scalp, depending on which symptom(s) the patient exhibits. many patients have a very quick positive response in controlling urine and bowel functions when the foot motor and sensory area is stimulated. although scalp acupuncture has the fastest track record for improving symptoms, sometimes other techniques also are necessary for further improvement. regular body acupuncture, electrical stimulation, moxibustion, and chinese herbs, as well as physical therapy and massage can be combined with scalp acupuncture to speed recovery. regular acupuncture treatment has been found to have a positive therapeutic effect on the recovery of movement and reducing abnormal sensations of the hands, fingers, feet, and toes. commonly used points are gb-34, li-3, ki-3, ba feng (extra point) for lower limbs at li-11, li-4, te-5, and ba xie (extra point) for upper - limb work. electrical stimulation is very helpful if the practitioner has difficulty performing the needle rotation more than 200 times per minute. it is suggested that no more than two of the scalp needles be stimulated at any session so the brain does not become too confused to respond. moxibustion can enhance the therapeutic results of scalp acupuncture, especially for older or weak patients. when treating chronic progressive diseases like ms, parkinson 's, and amyotrophic lateral sclerosis, the effects are sometimes temporary. they may last for hours, days, weeks, or months, but follow - up treatments will be necessary on an ongoing basis. when treating paralysis, whether from stroke or trauma, the improvements in movement often are permanent. the practitioner should consider scalp acupuncture as the primary approach rather than as a complementary approach for patients with ms. ms is a progressive disease of the central nervous system affecting half a million people in the americas and 1.3 million people worldwide. acupuncture, however, is one of the major complementary and alternative therapies for ms. this case report shows that scalp acupuncture seems to be a more effective modality in bringing about quicker and often effective improvements to patients with ms compared to other acupuncture modalities such as acupuncture on the ear, body, and hand. chinese scalp acupuncture is also more easily accessible, less expensive, entails less risk, can yield quicker responses, and usually causes fewer side effects than some other treatments. in the west, however, scalp acupuncture, as a useful tool for the treatment of ms, is a relatively new concept. even now, it is not surprising for a western physician to claim that it is a natural remission or coincidence if a patient recovers from ms after acupuncture. it holds the potential to expand treatment options for ms in both conventional and complementary or integrative therapies. it not only can improve the patient 's symptoms and quality of life and slow and reverse the progression of physical disabilities but it can reduce the number of relapses and help patients stay in remission. although there have been many hypotheses and research reports on scalp acupuncture for central nervous system disorders and pain management in the western medical literature over the past 40 years, there is still a long way to go in uncovering the mystery of the mechanisms of scalp acupuncture. future study is needed to investigate the mechanisms underlying acupuncture 's effect on the central nervous system dysfunctions in patients with ms. if it becomes more widely used, scalp acupuncture could have a significant impact on recovery from central nervous system disorders for thousands of patients. there is, therefore, a pressing need for chinese scalp acupuncture to be studied and perfected using modern research methods so that its potential can be fully explored and applied. | chinese scalp acupuncture is a contemporary acupuncture technique with just 40 years of history. it integrates traditional chinese needling methods with western medical knowledge of the cerebral cortex and has been proven to be a very effective technique for treating multiple sclerosis (ms) and other central nervous system disorders. a 65-year - old male patient who had had ms for 20 years was treated with chinese scalp acupuncture. the motor area, sensory area, foot motor and sensory area, balance area, hearing and dizziness area, and tremor area were stimulated once a week for 10 weeks, then once a month for six sessions. after the 16 treatments, the patient showed remarkable improvements. he was able to stand and walk without any problems. the numbness and tingling in his limbs did not bother him anymore. he had more energy and had not experienced incontinence of urine or dizziness after the first treatment. he was able to return to work full time. at this writing, the patient has been in remission for 26 months. this case demonstrates that chinese scalp acupuncture can be a very effective treatment for patients with ms. chinese scalp acupuncture holds the potential to expand treatment options for ms in both conventional and complementary or integrative therapies. it can not only relieve symptoms, increase the patient 's quality of life, and slow and reverse the progression of physical disability but also reduce the number of relapses and help patients with multiple sclerosis to remain in remission. |
hepatic portal venous gas (hpvg) was first described in 1955 in an infant with fatal necrotizing enterocolitis, and subsequently reported in adults. it is a rare condition with numerous etiologies, including bowel infarction, necrotizing enterocolitis, closed loop obstructions, acute hemorrhagic pancreatitis, granulomatous enterovenous fistula, pseudomembranous colitis, gastric ulcer, and gastric emphysema. intracorporeal factors such as damaged mucosa and bowel distension may be responsible for the passage of gas into the portal system. reports of iatrogenic causes, such as barium enema and endoscopy, have recently increased, particularly among patients with inflammatory bowel disease. here, we describe a 54-year - old woman with crohn s disease who developed hpvg following colonoscopy by double balloon endoscopy, and was successfully managed conservatively. a 54-year - old - woman presented to a general practitioner with a two - day history of abdominal pain and nausea. abdominal radiography on initial consultation revealed niveau formation, leading to a diagnosis of ileus, and she was hospitalized in a local hospital under conservative treatment for two days. history included crohn s disease, which was pathologically diagnosed in 1977 following partial ileectomy for acute lower abdominal pain. she subsequently underwent two further partial ileectomies, as well as hysterectomy for uterine myoma in 1998 and ileocolostomy in 2003. her compliance with regular follow - up visits and medication for crohn s disease was poor. she was subsequently transferred to our hospital for further examination and treatment. at the time of transfer, assessment did not identify niveau formation, and her ileus was improved (figure 1). gastrografin examination of the small intestine on day 3 of hospitalization revealed constriction of the terminal ileum for about 10 cm from the site of the previous operative anastomosis (figure 2). the cause of the ileus was constriction due to the exacerbation of crohn s disease. double balloon endoscopy (dbe) for the ileum and colon did not reveal mucosal damage, and revealed the stricture at the anastomotic site due to the previous operation (figure 3). after endoscopy, we checked the abdominal ct to aid in research into virtual endoscopy (figure 4). although she did not report abdominal pain following endoscopy, the abdominal ct revealed multiple small tubular lucencies in the periphery of the liver, indicating the presence of hpvg. given the lack of symptoms (no fever or abdominal pain), we selected conservative therapy with the cessation of oral ingestion, and a started a two - day prophylactic course of antibiotics. three days after examination, she had no symptoms, so we started enteral feeding of an elemental diet. abdominal ct at the time of transfer to our hospital showed no niveau formation, and the amelioration of ileus. gastrografin examination of the small intestine revealed constriction of the terminal ileum for about 10 cm and the ileum - colon (check) anastomosis (arrows). the anastomotic region (arrows) of a previous side - to - side anastomosis. no mucosal lesions were found. computed tomography demonstrated gas in the peripheral branches of the portal vein following colonoscopy. computed tomography six days after examination did not identify hepatic portal venous gas. the finding of hpvg can be associated with either benign or critical conditions that require immediate surgery. hpvg is speculated to arise from two sources, the escape of bowel gas as a result of increased pressure in the bowel lumen or in an abscess, followed by circulation into the liver ; or the presence of gas - forming bacteria in the portal venous gas system and passage of gas into the circulation. hpvg appears on plain abdominal radiography or ct as linear radiolucencies extending to within 2 cm of the periphery of the liver. in contrast to biliary air, which is central and almost never extends to the periphery, gas in the portal venous system is likely transported to the small peripheral branches in the liver by the centrifugal flow of the portal venous blood. although most cases of hpvg in critical conditions are caused by mesenteric vascular occlusion and subsequent bowel necrosis, it can also arise due to various other conditions. benign causes for hpvg include administration of fluids via an umbilical catheter, barium enema, and colonoscopy. the present hpvg case was a crohn s disease patient, and hpvg occurred following colonoscopy. this case is the 12th case of hpvg associated with inflammatory bowel disease (ulcerative colitis and crohn s disease) following examination of colon reported to date (table 1). of these, five patients were asymptomatic and required no specific treatment, apart from prophylactic antibiotics in several. one patient experienced abdominal pain and received antibiotics before finally recovering under conservative therapy. for patients with hpvg who are asymptomatic, the bowel wall in inflammatory bowel diseases such as ulcerative colitis and crohn s disease is often severely damaged. it has been speculated that elevated intraluminal pressure during colonic diagnostic procedures or due to constriction of the intestine can permit bowel gas or gas - forming bacteria to access the portal venous circulation through microscopic mucosal injury, and hpvg associated with inflammatory bowel disease often results from barium enema or colonoscopy. in the absence of peritoneal signs or free air, hpvg is a benign finding in patients with inflammatory bowel disease following diagnostic studies of the intestine. the recent development of endoscopy equipment, including double balloon endoscopy, has facilitated detailed observation of the intestinal tract, and generally increased the number of examinations in patients with inflammatory bowel disease. because imaging tests such as ct which identify hpvg are not routinely obtained after examination, there may be more asymptomatic hpvg cases which are not diagnosed. in present case, if we had not conducted research into virtual endoscopy, the abdominal ct might not have been carried out. immediate use of imaging tests is required if the patient has subjective symptoms, such as abdominal pain and high fever. although hpvg often improves under observation and is rarely serious situation, adverse outcomes could also occur, mandating that hpvg be considered as a complication of examinations of the colon or small intestine in inflammatory bowel disease. clinical features, study, diagnostic modality, treatment, and outcome in 12 patients with inflammatory bowel disease with hepatic portal venous gas associated with examination of colon. | abstracthepatic portal venous gas is a rare condition that occurs when intraluminal gas or gas produced by intestinal bacteria enters the portal venous circulation. it has recently been recognized as a rare complication of colon procedures by endoscopy or barium enema. given the frequency of these procedures in patients with inflammatory bowel disease, hepatic portal venous gas may occur more frequently in these patients than previously reported. here, we report a woman with crohn s disease who developed hepatic portal venous gas following colonoscopy who was treated with conservative therapy. |
among the many causes of dyspnea associated with ph in a patient with history of cancer, paraneoplastic thrombotic pe is the most common aetiology and must be considered in priority. but tumour cells can metastasize in the pulmonary vasculature in three mechanisms : occlusion of the small pulmonary arteries, pulmonary tumour thrombotic microangiopathy, or reach the lymphatic system. a 72yearold woman was admitted to a hospital 2 months ago for exerciseinduced dyspnea. she had history of left breast cancer pt2pn1m0 treated 2 years before with mastectomy, chemotherapy, and chest radiation. ddimer serum level was elevated, so a ct angiogram was performed and showed no evidence of pulmonary embolus, whereas ventilation perfusion lung scan revealed two perfusion defects throughout superiors lobes with normal ventilation. distal pe was suspected, and oral anticoagulation therapy was initiated and the patient discharged. two months later, an echocardiogram revealed elevated right ventricular systolic pressure at 78 mmhg. the right ventricle was moderately dilated (30 mm), nonhypertrophic, with good systolic function. she had severe hypoxemia of 52 mmhg, a ph of 7.46, a pc02 of 34, and hco3 of 24 mmol / l with 10 l / min of oxygen. the pulmonary function tests, the viral serologies, and the immune checkup were normal. a second chest ct showed nonspecific groundglass opacities and lung fibrosis consistent with previous radiation therapy but no sign of pe, nor interlobular septal thickening, adenopathy, or mass. right cardiac catheterization established precapillary ph with mean pa pressure of 48 mmhg and not elevated pulmonary wedge pressure (4 mmhg). atrial pressure was low (5 mmhg), cardiac output was normal (2.66 l / min / m), and pulmonary vascular resistance were increased at 8.6 wood units. a specific ph tritherapy was administrated (sildenafil, ambrisartan, and epoprostenol), but her condition worsened rapidly with acute rhf, respiratory distress, acute renal failure, and microangiopathic hemolytic anaemia. in this context, in absence of diagnostic, we decided to withhold invasive ventilator support. the autopsy showed three etiologies of ph consistent with hematogenous metastasis of breast cancer in pulmonary vasculature : carcinomatous cell inside lymph vessels (lymphangitis carcinomatosis) (figure 1), tumour cell embolization inside small arteries (tumoural cells emboli) (figure 2) and pulmonary tumour thrombotic microangiopathy (pttm) (figures 3 and 4).this latter is histologically characterized by intimal and medial fibromuscular thickening with accumulation of carcinomatous cells in the residual lumen of the small arteries and arterioles. (haematoxylin and eosin) : tumoural cells inside lymph vessels (black arrow) ; pleura (dotted arrow). (haematoxylin and eosin) : tumoural cells inside arteriole lumen (black arrow) ; intimal fibroblastic proliferation (black star) ; fibrinrich thrombus () ; internal elastic lamina destruction. (haematoxylin and eosin) : tumoural cells inside arteriole lumen (black arrow) ; intimal fibroblastic proliferation (black star) ; internal elastic lamina destruction (dotted black arrow) ; hypertrophic arteriole wall (double black arrow). it was first described in 1990 in 3.3% of an autopsic series of patients, who had died of metastatic adenocarcinoma, mostly of gastric origin.1 recently, a large case series estimated the incidence of 1.4% among 2215 autopsy patients with carcinoma and confirmed the stomach as the primary site of cancer associated with pttm. most of the time, there is evidence of metastatic disease, but many occult cancers have been reported as in our description. previous studies have shown that tumour cells have the abilities to activate coagulation pathway and local thrombus formation and trigger fibroblastic intimal proliferation via production of cytokines such as tissue factor,2 vascular growth factor, or plateletderived growth factor.3 high vegf expression associated with gastric cancer could explain the high incidence of pttm. in addition to mechanical occlusion, these phenomena rapidly lead to arterioles remodelling and stenosis, increased pulmonary vascular resistance, and ph. the tumoural cells are beyond the resolution of the ct angiogram, but their presence explains the perfusion defect on lung scan. recently, a treeinbud pattern, usually seen in bronchiolitis and characterized by small centrilobular nodules and branching linear opacities, was reported on thinsection ct of pttm patients.4 disseminated intravascular coagulation5 or cancer associated hemolytic anaemia has often been described consistent with elevated ddimer. a study has estimated the median survival as 5 days from admission to hospital.6 pttm may be identified using videoassisted thoracoscopic surgery, transbronchial biopsy, right heart catheterization, and ctguided biopsy.7 in the rare antemortem diagnosis case, specific chemotherapy was administrated often associated with empiric treatment such as corticosteroids or anticoagulation. the best survival reported was 15 months probably because diagnosis was made prior to the development of ph.8 chronic pe is the main cause of unexplained progressive dyspnea with precapillary ph in the context of cancer. but when large proximal pe is absent in ct angiogram whereas lung scan show multiple perfusion defects, clinicians must consider other tumoural embolic causes in the differential, especially pttm. thereby, they will be able to perform pulmonary cytology or biopsy before the patient 's condition deterioration. a rapid specific chemotherapy administration is the only way to improve the survival of patients. | abstracta 72yearold woman with history of breast cancer only treated surgically was referred to our department for pulmonary hypertension (ph) suspicion. echocardiogram revealed elevated right ventricular systolic pressure. computed tomography (ct) angiogram showed no pulmonary embolism (pe), but lung scan revealed two ventilationperfusion mismatch areas. right cardiac catheterization established precapillary ph. despite treatment with ph specific therapy (sildenafil, ambrisentan, and epoprostenol), her condition worsened rapidly with acute right heart failure (rhf). she died 22 days after admission. postmortem microscopic examination showed a rare combination of ph etiologies consistent with metastasis of breast cancer in pulmonary vasculature including the rare pulmonary tumour thrombotic microangiopathy (pttm). |
nonalcoholic fatty liver disease (nafld) is among the most common causes of chronic liver disease worldwide. the prevalence of nafld in the general population of western countries is 2030%. within the spectrum of nafld, only nonalcoholic steatohepatitis (nash) most patients with nafld have risk factors such as insulin resistance, obesity or other indications of metabolic syndrome. insulin resistance, oxidative stress, and inflammatory cascades are believed to play integral roles in the pathogenesis and progression of nafld. as such, a multi - hit (formerly double - hit) hypothesis has been used to describe the pathogenesis of nafld. as a result of the first insulin resistance arises and increased fatty acid levels in the blood enter the liver (and/or are not removed from the liver), thus leading to hepatosteatosis. the second hit occurs as a result of the inflammation caused by the hepatosteatosis. the criterion standard method for the diagnosis of nafld, which most frequently presents with an asymptomatic increase of transaminase enzymes, is a liver biopsy. despite evidence that weight loss, dietary modifications, bariatric surgical operations, exercise and several drugs result in the biochemical and histological resolution of nafld, there is no current treatment regimen supported by valid, long - term studies that were properly randomized and controlled [710 ]. currently, the basis for treatment includes managing risk factors such as hyperlipidemia through steps such as lifestyle modification and weight loss. sirt1 is an nad - dependent deacetylase and acts as a modulator of various metabolic pathways. in this article, we focus on the sirtuin 1 (sirt1) protein, which has important effects on glucose homeostasis, lipid mobilization, -oxidation, oxidative stress, insulin secretion and sensitivity, inflammation, cellular aging and apoptosis. we discuss the expression of sirt1 in cases of nafld, the results of sirt1 activation and the potential therapeutic role for sirt1 in treating nafld. silent information regulator 2 (sir2) proteins, or sirtuins, are a class of proteins that possess either histone deacetylase or mono - adp - ribosyl transferase activity. they are found in organisms ranging from bacteria to humans. sirt1, an nad - dependent protein deacetylase, is an important regulator of energy homeostasis in response to nutrient availability. currently, the best - studied sirtuin homolog, sirt1, is expressed in metabolic tissues such as liver, skeletal muscle, adipose tissue, pancreas and brain ; its actions in these tissues include regulation of -cell and neuron survival, hepatic gluconeogenesis, insulin secretion and adiposity. resveratrol (trans-3,5,4-trihydroxystilbene) is a polyphenol found in red wines and a wide variety of plants including grapes, berries and peanuts. resveratrol has been shown to be a potent agonist of sirt1 [1315 ]. in mammalian cells, resveratrol promotes cellular expression of the sirt1 protein and dramatically stimulates sirt1 activity. furthermore, small - molecule sirt1 activators with structures unrelated to resveratrol but with 1000 times the potency have been identified. the effects of sirt1 activation, especially in metabolic tissues, lead to the inhibition of various pathways important for nafld pathogenesis. the liver is the central metabolic organ and regulates several key aspects of lipid metabolism (fatty acid -oxidation, lipogenesis and lipoprotein uptake and secretion) in response to nutritional and hormonal signals. nutritional intake in excess of the -oxidation capacity of the cell, lipoprotein synthesis and defects in excretion form the foundation of hepatosteatosis. over time, the transcriptional network of the liver contributes to an inflammatory process that progressively leads to nash associated with fibrosis, liver cirrhosis, hepatocellular carcinoma and death due to liver disease. in several recent studies, sirt1 has been shown to play an important role in the dynamics of nafld pathophysiology. using an experimental nafld model consisting of rats fed a high - calorie diet, another study in rats with nafld showed a significant increase in hepatic sirt1 expression and histological improvement with calorie limitation. in a study by purushotham., hepatocyte - specific loss of sirt1 (through hepatocyte - specific deletion of sirt1) was shown to cause peroxisome proliferator - activated receptor (ppar) signal failure and a decrease in fatty acid -oxidation. however, sirt1 overexpression increased levels of ppar and its coactivator ppar coactivator 1 (pgc-1). pgc-1 impairs ppar signaling and decreases fatty acid -oxidation, whereas overexpression of sirt1 induces the expression of ppar s targets. sirt1 interacts with ppar and is required to activate the ppar coactivator pgc-1. in a recently reported study in rats, sirt1 was shown to confer protection against age - associated metabolic damage, lead to healthier aging, decrease the frequency of liver cancer related to metabolic syndrome and protect the liver from carcinogenic damage. studies performed at the molecular level have demonstrated that sirt1 plays an important role in the regulation of the transcriptional networks controlling various critical metabolic processes in the liver [2426 ]. along those lines, sirt1 has been shown to deacetylate many nonhistone proteins, including p53, nuclear factor kappa b (nf-b), forkhead box class o 3 (foxo3) transcription factors, pgc-1, liver x - receptor (lxr), clock, per2 and torc2 [2736 ]. in a study by yamazaki., treatment of mice modeling nafld with a sirt1 activator (srt1720) resulted in decreases in expression of lipogenic genes (such as those encoding sterol regulatory element - binding protein-1c [srebp-1c ], acyl - coa carboxylase [acc ] and fatty acid synthase [fas ]), serum lipid profile, fat accumulation in the liver, expression of genes related to oxidative stress and the production of inflammatory cytokines. in a study of bariatric surgical cases performed by costa., morbidly obese patients with severe hepatosteatosis were determined to have reduced expression of sirt1 in adipose tissue when compared to patients with mild hepatosteatosis. recent studies have shown that sirt1 plays important roles in both insulin resistance and insulin regulation in diabetics (such as increasing insulin secretion from pancreatic -cells, stimulating lipolysis in adipose tissue and increasing glucose utilization in muscle tissue). in pancreatic -cells, sirt1 has been shown to increase insulin secretion through the repression of uncoupling protein 2 (ucp2). it was also demonstrated that sirt1 activation increases atp production in -cells and improves glucose - dependent insulin secretion, which typically decreases with age. a recent study demonstrated that inhibiting sirt1 overexpression and nf-b signaling decreases cytokine - induced pancreatic -cell damage. as a result, sirt1 activation prevents the development of insulin resistance and limits the pancreatic -cell dysfunction that develops in response to insulin resistance. it has been shown that sirt1 activation increases lipolysis by repressing ppar in adipose tissue, thereby inhibiting adipogenesis. sirt1 also regulates the production and/or secretion of insulin - sensitizing factors such as adiponectin and fgf21 through the regulation of foxo1 and ppar [4345 ]. lxrs regulate the transfer of cholesterol from peripheral tissues to the liver (reverse cholesterol transport). pgc-1 deacetylation by sirt1 in skeletal muscle is necessary for the activation of mitochondrial fatty acid oxidation genes. as further evidence of the important of sirt1 in muscle, patients with type 2 diabetes show reduced expression of pgc-1 and mitochondrial oxidative phosphorylation (oxphos) genes in skeletal muscle. based on these data, the sirt1-dependent activation of pgc-1 sun. showed that sirt1 improves insulin sensitivity in skeletal myotubes through transcriptional repression of the protein tyrosine phosphatase 1b (ptp1b) gene. ptp1b is a key insulin receptor phosphatase, and ptp1b - deficient mice have been shown to be more insulin - sensitive and more resistant to diet - induced obesity compared to controls. recent studies have begun to address the relationship between sirtuins and age - related metabolic and cardiovascular diseases, antiinflammatory properties, anticarcinogenic effects, effects on oxidative stress and the cell cycle and anti - aging effects. epidemiological evidence gathered from nafld patients demonstrates that both cardiovascular disease risk and mortality are significantly increased when compared to a normal population [5355 ]. the cause of these effects may include vascular relaxation (both by increasing endothelial nitric oxide synthase activity and by potassium channel - mediated vasorelaxation), inhibition of thrombocyte aggregation or increasing cardiac myocontractility (by pgc-1 regulation) [5660 ]. in addition, individuals with a single nucleotide polymorphism in the sirt1 gene exhibit a lower incidence of cardiovascular mortality, myocardial infarction, myocardial ischemia, stroke, arterial surgery and intermittent claudication. one of the important stages in the pathophysiology of nafld is the inflammatory process, which is considered the. one important effect of sirt1 activation, which was discovered recently, is its anti - inflammatory effect. an important aspect of this effect is performed through regulation of nf-b (a master transcription factor involved in the regulation of proinflammatory cytokines and a key part of nafld pathogenesis). recent studies have shown that sirt1 also deacetylates and suppresses the transcriptional activity of activator protein-1 (ap-1), leading to a down - regulation of cyclooxygenase-2 (cox-2) gene expression. in addition, the expression of multiple proinflammatory mediators, such as intracellular adhesion molecule 1 (icam1), mcp1, rantes (also known as ccl5), macrophage colony stimulating factor (m - csf), granulocyte - macrophage csf (gm - csf), g - csf, and transforming growth factor- (tgf-), is reduced by the sirt1 activator resveratrol. thus, sirt1 activity results in antiinflammatory effects through its regulation of multiple inflammatory pathways. another characteristic of sirt1 activation, discovered in the last few years, is its effects on tumorigenesis. the antiproliferative, proapoptotic and tumor suppressing effects of sirt1 activation have been elucidated by studies performed in rats. additionally, use of sirt1 in cancer chemotherapy, based on its chemopreventive effects, has been considered. resveratrol has been shown to have anti - carcinogenic effects both in vitro and in vivo. sirt1 has been shown to indirectly reduce the cellular oxidative stress burden through deacetylation of foxo3 (deacetylation of foxo3 leads to upregulation of catalase and mnsod). sirt1 has also been shown to control the cell cycle, cell differentiation, cell proliferation and cell senescence by its regulation of the foxo and p53 proteins. a sedentary lifestyle and variations in dietary habits has significantly increased the frequency of metabolic syndrome and its hepatic component, nafld, and the number of patients with this condition continues to rise. currently, there is no validated evidence - based treatment algorithm, and patients are currently treated with recommendations for caloric limitation and increased physical activity. in recent years, the positive effects of sirt1 activation have been shown in the metabolic activities related to nafld pathophysiology. these activities include glycemic regulation, lipid homeostasis, insulin secretion and sensitivity, inflammatory processes, oxidative stress, endothelial dysfunction, mitochondrial biogenesis and -oxidation, cellular senescence, autophagy / apoptosis and skeletal and heart muscle function. from these results, we believe that sirt1 activation has potential as a therapeutic target to prevent both the progression and development of nafld. recent studies have demonstrated the positive effects of sirt1 activation on these metabolic activities after induction by resveratrol, a natural polyphenol. in addition, sirt1 activators that are 1000 times more efficient than resveratrol are currently being developed and studied. current policy requires that therapeutic efficiency and security profile evaluations in randomized controlled studies be performed for new pharmaceutical agents. | summarysirtuins are members of the silent information regulator 2 (sir2) family, a group of class iii histone / protein deacetylases. there are 7 different sirtuins in mammals (sirt1 - 7), of which sirt1 is the best known and most studied. sirt1 is responsible for the regulation of protein activation by means of deacetylating a variety of proteins that play important roles in the pathophysiology of metabolic diseases. recently, it has been shown that sirt1 plays key roles in the regulation of lipid and glucose homeostasis, control of insulin secretion and sensitivity, antiinflammatory effects, control of oxidative stress and the improvements in endothelial function that result due to increased mitochondrial biogenesis and -oxidation capacity.nonalcoholic fatty liver disease (nafld) is currently the most common liver disease, and it has been accepted as the hepatic component of metabolic syndrome. recent studies have shown that sirt expression in the liver is significantly decreased in an nafld model of rats fed a high - fat diet, and moderate sirt1 overexpression protects mice from developing nafld. in addition to resveratrol, a natural sirt1 activator, small - molecule pharmacologic sirt1 activators have positive effects on metabolic diseases. these effects are particularly promising in the case of diabetes mellitus, for which phase studies are currently being performed. with this information, we hypothesized that the pharmacologic activation of sirt1, which has been implicated in the pathogenesis of nafld, will be a potential therapeutic target for treating nafld. in this paper, we review the metabolic effects of sirt1 and its association with the pathophysiology of nafld. |
early in the history of ct scanning, specialized windowing was found to be beneficial for the analysis of bone lesions. becker 1 demonstrated in 1978 that more calvarial metastases were detected with bone windows than with brain windows. the human eye distinguishes a limited number of shades of grey and the widely varying densities of body structures can not be seen equally well on a single computer setting. each ct window algorithm focuses the grey scale in an appropriate manner to enhance anatomy of a selected density. on the workstations used to view the pet / ct scans in this study (ge advantage windows version 4.3), bone windows have ct unit settings with a relatively high level of 350 and a wide width of 2000. the high level is suitable for evaluating dense structures such as bone, and the wide width encompasses a large range of tissue densities. lung windows have a low level of -496 that is suitable for evaluating air - containing structures, and also have a wide width (1450). soft tissue windows are leveled near water (40) with a narrow width of 400 that enhances the subtle differences in soft tissue structures which typically have a density close to water 2. bone windows can aid in the interpretation of ct scans in numerous capacities, such as through the detection of aggressive features caused by osteomyelitis 3 and bone tumors 4. in a study of stenoclavicular osteomyelitis that included both bone and soft tissue windows, the bone windows were found to be more sensitive for detecting small erosions and periostitis 3. the detection of osteolysis or periosteal reaction can facilitate biopsy or aspiration of aggressive processes in order to determine etiology and allow treatment planning. the use of bone windows has been shown to increase the detection of bone metastases 5, and improve the efficacy of diagnosis for bone lesions by allowing differentiation between metastases and degenerative change 6. bone windows can be more efficacious than soft tissue windows for identifying distinctive features of primary bone tumors such as the nidus of osteoid osteomas 7, and many investigators have used bone window settings as a matter of course for evaluating other primary bone tumors 8 - 11. the standard default ct window setting on positron emission tomography (pet) workstations is soft tissue. the purpose of this study was to evaluate whether bone windowing can aid in differentiating between malignant and benign primary bone tumors on fdg pet / ct, justifying the extra time and effort needed to view the lesions in this manner. pet / ct was chosen for this analysis in order to also test the conclusions of the small number of prior investigations that have demonstrated that the addition of ct to pet is beneficial for evaluating primary bone tumors. a keyword search of the institutional database was performed from january 1, 2007 - october 1, 2010. keywords included pet and bone island, osteoma, osteoblastoma, osteoid osteoma, fibrous dysplasia, nonossifying fibroma, ossifying fibroma, fibrous cortical defect, osteofibrous dysplasia, osteochondroma, enchondroma, chondroblastoma, chondromyxoid fibroma, cortical desmoid, desmoplastic fibroma, intraosseous lipoma, glomus tumor, hemangioma, bone cyst, giant cell tumor, giant cell reparative granuloma, eosinophilic granuloma / langerhans cell histiocytosis, chordoma, osteosarcoma, fibrosarcoma, chondrosarcoma, ewing sarcoma and adamantinoma. excluded were patients who received therapy for bone malignancy prior to fdg pet / ct, lesions not visible on the ct, below 8 mm in size or with no fdg uptake, unbiopsied malignancies or unbiopsied benign lesions with < 1 year imaging follow - up, patients with bone or fdg - avid metastases, and lesions distorted by prior biopsy or metal artifact. one unbiopsied chondrosarcoma in a patient with ollier 's disease was included on the basis of short - interval enlargement of the lesion and increasing frequency of pain. one radiologist with 7 years of experience with fdg pet / ct, one nuclear medicine physician with 3 years of experience with fdg pet / ct, and one physician who was dual board certified in radiology and nuclear medicine with 6 years of experience reviewed the images. each tumor was evaluated on the ct portion of the scan and a diagnosis of malignant or benign was determined on bone windows (ct - bw). the diagnosis was then re - considered with the addition of pet (pet / ct - bw). because the emphasis of this part of the study was on ct windowing and not pet three weeks later 12, the process was repeated with soft tissue windows (ct - stw, pet / ct - stw). the nuclear medicine physicians also evaluated pet - only images for diagnosis of malignancy or benignity with no ct data. due to lack of identifying anatomic landmarks on pet - only images, all images were viewed on ge advantage windows (aw) workstations, version 4.3. integrated pet / ct systems were utilized to acquire imaging data (discovery st, ste, rx, or vct) general electric healthcare, milwaukee, wi). whole - body examinations were performed from the level of the vertex of the skull or orbits through the upper thighs or lower legs / toes. pet / ct was performed in accordance with guidelines published by the national cancer institute 13. all patients were fasted for a minimum of 6 hours with blood glucose of 80 - 120 mg / dl (4.4 - 6.6 mmol / l) prior to intravenous administration of approximately 10 mci (370 mbq) of fdg for 3d and 15 - 20 mci (555 - 740 mbq) for 2d acquisition. unenhanced ct was used for attenuation correction and diagnosis and it included 3.75 mm axial slice placement with 3.27 mm slice spacing, 120 kv, 300 ma and 0.5 s gantry rotation at 55 mm / s table speed. emission pet was performed 60 minutes after fdg administration at 3 minutes per bed station. generalized estimating equations were used to estimate sensitivity and specificity taking into account multiple readings per patient, reader effect, window effect, and suvmax. wilcoxon rank sum tests were used to compare suvmax by subtypes with p - values computed using the normal approximation. all statistical analyses were performed using sas 9.3 for windows (copyright 2011 by sas institute inc. a keyword search of the institutional database was performed from january 1, 2007 - october 1, 2010. keywords included pet and bone island, osteoma, osteoblastoma, osteoid osteoma, fibrous dysplasia, nonossifying fibroma, ossifying fibroma, fibrous cortical defect, osteofibrous dysplasia, osteochondroma, enchondroma, chondroblastoma, chondromyxoid fibroma, cortical desmoid, desmoplastic fibroma, intraosseous lipoma, glomus tumor, hemangioma, bone cyst, giant cell tumor, giant cell reparative granuloma, eosinophilic granuloma / langerhans cell histiocytosis, chordoma, osteosarcoma, fibrosarcoma, chondrosarcoma, ewing sarcoma and adamantinoma. excluded were patients who received therapy for bone malignancy prior to fdg pet / ct, lesions not visible on the ct, below 8 mm in size or with no fdg uptake, unbiopsied malignancies or unbiopsied benign lesions with < 1 year imaging follow - up, patients with bone or fdg - avid metastases, and lesions distorted by prior biopsy or metal artifact. one unbiopsied chondrosarcoma in a patient with ollier 's disease was included on the basis of short - interval enlargement of the lesion and increasing frequency of pain. one radiologist with 7 years of experience with fdg pet / ct, one nuclear medicine physician with 3 years of experience with fdg pet / ct, and one physician who was dual board certified in radiology and nuclear medicine with 6 years of experience reviewed the images. each tumor was evaluated on the ct portion of the scan and a diagnosis of malignant or benign was determined on bone windows (ct - bw). the diagnosis was then re - considered with the addition of pet (pet / ct - bw). because the emphasis of this part of the study was on ct windowing and not pet three weeks later 12, the process was repeated with soft tissue windows (ct - stw, pet / ct - stw). the nuclear medicine physicians also evaluated pet - only images for diagnosis of malignancy or benignity with no ct data. due to lack of identifying anatomic landmarks on pet - only images, all images were viewed on ge advantage windows (aw) workstations, version 4.3. integrated pet / ct systems were utilized to acquire imaging data (discovery st, ste, rx, or vct) general electric healthcare, milwaukee, wi). whole - body examinations were performed from the level of the vertex of the skull or orbits through the upper thighs or lower legs / toes. pet / ct was performed in accordance with guidelines published by the national cancer institute 13. all patients were fasted for a minimum of 6 hours with blood glucose of 80 - 120 mg / dl (4.4 - 6.6 mmol / l) prior to intravenous administration of approximately 10 mci (370 mbq) of fdg for 3d and 15 - 20 mci (555 - 740 mbq) for 2d acquisition. unenhanced ct was used for attenuation correction and diagnosis and it included 3.75 mm axial slice placement with 3.27 mm slice spacing, 120 kv, 300 ma and 0.5 s gantry rotation at 55 mm / s table speed. emission pet was performed 60 minutes after fdg administration at 3 minutes per bed station. generalized estimating equations were used to estimate sensitivity and specificity taking into account multiple readings per patient, reader effect, window effect, and suvmax. wilcoxon rank sum tests were used to compare suvmax by subtypes with p - values computed using the normal approximation. all statistical analyses were performed using sas 9.3 for windows (copyright 2011 by sas institute inc., cary, nc). the search found no fdg pet / ct scans with osteofibrous dysplasias, chondromyxoid fibromas, desmoplastic fibromas, ossifying fibromas, adamantinomas or glomus tumors. no scans meeting the inclusion criteria were found for osteoblastomas, chondroblastomas, cortical desmoids, osteomas or bone cysts. review of bone islands and hemangiomas were truncated at 50 each due to lack of fdg avid lesions. one biopsy - proven, expansile hemangioma of the rib, whose differential diagnosis did not include hemangioma and was not found under the hemangioma keyword search, was included. the terms nonossifying fibroma andfibroxanthoma are used interchangeably a total of 98 tumors were included in the study. they included osteosarcoma (n=47), ewing sarcoma (n=10), chondrosarcoma (n=5), high grade unclassified sarcoma of bone (n=1), chordoma (n=1), giant cell tumor of bone (n=1), giant cell reparative granuloma (n=1), langerhans cell histiocytosis (lch, n=1), fibrous dysplasia (n=10), enchondroma (n=13), osteochondroma (n=3), nonossifying fibroma (n=1), fibrous cortical defect (n=2), hemangioma (n=1), intraosseous lipoma (n=1). malignant primary bone tumors were more avid than benign lesions overall (p<0.0001, table 1, fig. 1). the mean and range of suvmax for malignancies was 12.6 (2.2 - 56.9) and for benign lesions was 4.3 (1.2 - 21.1). per group, chondrosarcomas and ewing sarcomas were not significantly different from each other in fdg avidity (p=0.81) and were significantly less avid than osteosarcomas (p=0.02). chondrosarcomas (8.8, 3.9 - 20.5) were significantly more avid than the benign cartilage tumors (enchondromas and osteochondromas, 2.21,1.20 - 3.60, p=0.001). giant cell tumors were significantly more avid than chondrosarcoma / ewing sarcomas (p=0.04) and not significantly different from the osteosarcomas (p=0.14). the benign aggressive lesions (giant cell tumors and lch ; 17.63,14.10 - 21.10) were significantly more avid than other benign tumors overall (p=0.0062) and trended toward greater avidity than the malignancies overall (0.08). the avidity of fibrous dysplasias trended higher than other benign lesions (p=0.09) but was significantly lower than the malignancies (p<0.0001). mean and range of sensitivity and specificity values for distinguishing between malignant and benign primary bone tumors are listed in table 2. all significant findings for sensitivity and specificity include the following : ct - bw demonstrated higher specificity than pet - only and pet / ct - bw (p=0.0005 and p=0.0103, respectively). ct - bw also trended toward higher sensitivity than ct - stw (p=0.0759). pet / ct - stw trended toward higher sensitivity than ct- stw (p=0.0662) and a higher specificity than pet - only (p=0.0859). prior studies have attempted to differentiate malignant from benign bone lesions on the basis of fdg uptake alone, prior to the development and widespread usage of dual - modality, hybrid pet / ct scanners 14 - 17. this effort was not fully successful because high fdg avidity was found in several benign histologies which overlapped with the avidity of the malignant lesions. our study found that the fdg uptake of the benign aggressive lesions (giant cell tumors and lch) trended higher than that of the malignancies as a whole (p=0.08). it has been suggested that giant cells and histiocytic cells may be responsible for high uptake within many benign primary bone tumors 15. all of the benign lesions with high uptake in our study contained a preponderance of either giant cells (giant cell tumor of bone, giant cell reparative granuloma) or histiocytic cells (lch). we have shown a higher overall mean avidity in osteosarcomas as compared to ewing sarcomas 17 and similar mean avidity when comparing ewing sarcomas and chondrosarcomas. chondrosarcomas can be difficult to distinguish from benign cartilage lesions on conventional imaging modalities such as radiographs, ct, mri and skeletal scintigraphy, as well as on histopathologic analysis. chondrosarcomas (particularly low grade lesions) have been reported as having a predilection for low fdg uptake in comparison with other primary bone malignancies 17 - 20 which could also be confounding. factors that may contribute to the lower avidity include a high proportion of acellular gelatinous matrix with respect to cellular density and lower mitotic rates than higher grade tumors. dedicated analysis of cartilage lesions as a whole has previously demonstrated the fdg avidity of malignancies to be significantly higher than benign lesions 18, 21. our study showed that the average fdg uptake of chondrosarcomas was as high as ewing sarcoma though lower than osteosarcoma. the most avid cartilage lesion was a mesenchymal chondrosarcoma (n=1) with an suvmax of 20.5 (other lesions included grade 1, 2a, 2/3 and unbiopsied - md anderson grading system of chondrosarcomas). excluding the mesenchymal chondrosarcoma, the mean suvmax of the chondrosarcomas decreased from 8.8 to 6.4 (3.9 - 9.2). the adjusted value remains higher than the mean suvmax of the benign cartilage lesions (2.2) and the benign lesions overall (4.3). while the suvmax of the most avid benign cartilage lesion (3.6, osteochondroma) approached that of the least avid chondrosarcoma (3.9, grade 1), we agree with prior studies that suggest a potential diagnostic advantage with the use of fdg pet for distinguishing malignant from benign cartilage lesions 18, 21. unlike other reported data 14 - 15, 17, 22 the mean fdg uptake of the benign fibrous lesions in our study did not approach the mean avidity of the malignancies. chordoma, a relatively indolent malignancy with a strong tendency for local recurrence, demonstrated fdg uptake between the mean of the least avid malignancy (ewing sarcoma) and the most avid benign lesion (fibrous dysplasia). our results suggest that the fdg uptake across all of the tumors in our sample corresponds better with the locally destructive than the metastatic potential of the lesions (fig. one prior study has systematically assessed the value of the added ct portion of the examination, and has shown that the ct is beneficial for identifying malignant primary bone tumors 19. published sensitivity and specificity data from that study were 91% and 77%, respectively 19. this may have been due to our study design that mandated an in - depth review of the ct prior to evaluating the pet dataset. we have conducted the first study to separate ct from pet / ct, and to examine the effect of windowing in the context of primary bone tumors. our unique mean sensitivity and specificity data include ct - bw (96%, 90%), ct - stw (90%, 90%) pet / ct - bw (95%, 85%), and pet / ct - stw (95%, 86%). specificity for the detection of primary bone tumors was significantly high with ct - bw when compared to pet / ct - bw (p=0.0103). this suggests that the fine bony detail that is visible with ct - bw is useful for distinguishing benign from malignant lesions, and that this bony detail may be obscured by fdg uptake. specificity was also higher with ct - bw than with pet - only (p=0.0005), indicating that the anatomic data provided by the bone windows was more useful for identifying the lesions than fdg - uptake alone (fig. sensitivity for detecting malignancy trended higher with ct - bw than ct - stw (p=0.0759, fig 3 a and d). the margins of primary bone tumors are an important indicator of their biological potential 24 - 25. malignancies are more likely to produce a greater degree of osteolysis than benign lesions 24 - 25. soft tissue windows may over - emphasize tumor margins and spuriously make cortical or trabecular bone appear intact. bone windows can reveal the osteolysis that is obscured by the soft tissue window setting (fig. the emphasis that our study placed on ct was considered justified given the inability of priorpet - only investigations to reliably distinguish between malignant and benign bone lesions 14 - 15. we recommend the use of ct - only bone windows when evaluating bone tumors on fdg pet / ct. radiographs are recommended as the first step in the imaging diagnosis of bone lesions 24, 26. ct with bone windowing is immediately available and can be used as an adjunct to radiography. in conclusion, our study found high specificity for distinguishing between benign and malignant primary bone tumors using bone window settings and it is recommended that bone windows be used for evaluating osseous tumors on fdg pet / ct scans. | objective. the default window setting on pet / ct workstations is soft tissue. this study investigates whether bone windowing and hybrid fdg pet / ct can help differentiate between malignant and benign primary bone tumors.materials and methods. a database review included 98 patients with malignant (n=64) or benign primary bone (n=34) tumors. the reference standard was biopsy for malignancies and biopsy or > 1 year imaging follow - up of benign tumors. three radiologists and/or nuclear medicine physicians blinded to diagnosis and other imaging viewed the lesions on ct with bone windows (ct - bw) without and then with pet (pet / ct - bw), and separate pet - only images for malignancy or benignity. three weeks later the tumors were viewed on ct with soft tissue windows (ct - stw) without and then with pet (pet / ct - stw).results. mean sensitivity and specificity for identifying malignancies included : ct - bw : 96%, 90% ; ct - stw : 90%, 90% ; pet / ct - bw : 95%, 85%, pet / ct - stw : 95%, 86% and pet - only : 96%, 75%, respectively. ct - bw demonstrated higher specificity than pet - only and pet / ct - bw (p=0.0005 and p=0.0103, respectively) and trended toward higher sensitivity than ct - stw (p=0.0759). malignant primary bone tumors were more avid than benign lesions overall (p<0.0001) but the avidity of benign aggressive lesions (giant cell tumors and langerhans cell histiocytosis) trended higher than the malignancies (p=0.08).conclusion. bone windows provided high specificity for distinguishing between malignant and benign primary bone tumors and are recommended when viewing fdg pet / ct. |
the automated gravitational vario flow system was constructed in order to reduce the risk of fluid intravasation while using gravity for uterine distention during continuous flow hysteroscopic procedures. it provides linear regulation, definition and measurement of intrauterine pressure by simply pressing the pedal and changing the height difference between the fluid level and the level of the hysteroscope. the weighing - based electronic fluid deficit indicator was built into the second version of the vario flow system in order to provide the utmost control of fluid dynamics and to further improve safety for the patient. after promising clinical testing in 1995 and after resolving some essential technical problems (1995/96) in august 1996 schematic and the photograph of the second version of vario flow are presented in the figures 1 and 2. situated on the stand of the vario flow system, the electronic weighing system indicates the weight of the whole system, including inflow bag and outflow receptacle and shows the overall fluid deficit (in ml) on the display. the scales on the display determine the weight of the whole system as zero reference weight at the beginning of the procedure and as real weight during the procedure. if the liquid that was discharged from the endoscope is not collected in the fluid receptacle, the weight of the system is reduced and the difference between the two values is shown on the display as liquid loss (figure 3). if the loss exceeds a preset critical amount of liquid a warning signal sounds. pause function is used for changing the empty water bag and the full fluid receptacle during the procedure (figure 4). clinical experiences by using vario flow with fluid deficit indicator are reported. between august 1996 and july 1997, vario flow with the fluid deficit indicator and the alarm system was used in 203 hysteroscopic operations. between january 1994 and august 1996 the volumetric method was used to control fluid deficit in 240 hysteroscopic operations. in all, there were 443 hysteroscopic operations : 301 metroplasties, 20 endometrial ablations, 10 cases of lysis of synechiae, 58 myomectomies and 54 polypectomies. most women received danazol 400 mg for a short period (one to three weeks) starting on day 1 of the menstrual cycle since the day of operation for endometrial preparation. vario flow was used as a distending system (figures 1 and 2). in normal circumstances the fluid filled bag of the vario flow was raised between 1 and 1.4 m (76 - 100 mmhg) above the patient according to individual conditions permitting good visualization and considering the danger of fluid intravasation. intermediate 1.4 - 1.5 m (100 - 110 mmhg) and extreme height ranges 1.5 - 1.9 m (110 - 140 mmhg) were exceptionally used according to individual surgical needs. retrospective comparison of data on final fluid deficit in 240 patients before, and in 203 patients after, the introduction of fluid deficit indicator was performed by using t test for two samples assuming equal variances. in our patients accurate visualization and good control of fluid dynamics were always obtained during operative hysteroscopies. all operations were performed in one attempt. before the introduction of the fluid deficit indicator the data on fluid deficit before and after the introduction of the fluid deficit indicator are presented in table 1. results of final fluid deficit control before (group 1) and after the introduction of fluid deficit indicator (group 2) in 45 operations of group 1 the fluid deficit was > 450 ml. in 31 operations of group 2 the fluid deficit was > 450 ml. the mean fluid value in group 2 was insignificantly lower compared to the mean fluid deficit value in group 1. fluid deficit is the difference between the volume of fluid infused and the measured volume recovered. this is an important parameter during continuous flow hysteroscopic procedures and is affected by factors such as the accuracy and completeness of fluid collection, the quantity of fluid escaping around the hysteroscope, out of the fallopian tubes and the fluid intravasation. this is a serious and potentially fatal problem of which every hysteroscopic surgeon should be aware. an irrigating fluid deficit of between 1000 and 1500 ml has been generally accepted as the upper limit for a safe procedure. the gravity continuous flow system without regulation produces an intracavitary pressure of 110 mmhg when the bag is about 150 cm above the patient, and the pressure of this magnitude can force fluid into the circulation and produce the problems of the fluid overload. on the other hand, lowering of this height reduces the intracavitary pressure which may also be associated with adverse features. control of intracavitary pressure with the endomat system did however reduce the risk of fluid intravasation by two thirds. garry has shown that replacing a simple roller pump infusion system with a pressure controlled pump infusion system reduced the fluid absorption by 85%. different pressure pumps have been constructed to promote patient safety and to facilitate tracking inflow and outflow volumes. these features as well as the cost problems have been considered while constructing the vario flow system. as recommended by indman, it provides a rapid flow until the designated intrauterine pressure is reached and then automatically shuts off simply by adjusting the elevation of the fluid - filled bag. providing a careful control of intrauterine pressure, the automated gravitational system combines the advantages of a low cost gravity system with the advantages of careful intrauterine pressure and outflow control of more sophisticated systems. similar to the dolphin hysteroscopic management system, the vario flow also provides a stable non pulsatile uterine distention. despite careful control of intracavitary pressure, avoidance of going too deeply into the myometrium and early detection of arterial bleeding, the important fluid deficit may occur at any time in a previously quite normal case, and fluid deficit may move from zero to several litres in a few minutes. often the operator is unaware of impending disaster because of inability to monitor accurately the amount of fluid instilled and volume recovered from the patient. because fluid overload is the major complication related to the uterine distention, the ideal system for delivery of low viscosity media would also measure the inflow and outflow of the fluid and sound an alarm if an excess of fluid deficit is detected. it is this feature, and not the intrauterine pressure, that should guide the conduct of any case. by combining the vario flow with the fluid deficit indicator and alarm system we tried to reach this goal and to further reduce the risk of uncontrolled fluid intravasation. it is interesting to note that at the same time two similar systems to control fluid deficit have been independently developed and simultaneously presented at the aagl congress in orlando, 1995. according to early experiences in our series of patients, the real weight based fluid deficit indicator was proven highly efficient in providing information on the fluid deficit at any moment during the procedure as well as the actual information on the final fluid deficit. the reassuring or alarming information about fluid deficit at any moment during hysteroscopic procedures was especially important in operations of long duration and in operations where higher intrauterine pressure ranges were needed for uterine distention. except in cases with abundant spillage, any of commercially available drape systems work well if properly applied to the patient perineum and connected to return canister. thus, in our hands, the real time fluid deficit has become one of the leading parameters of fluid dynamics during our hysteroscopic procedures. there were no significant differences between the data on the final fluid deficit in both series of patients. this is not surprising because the least possible pressure providing good vision was used in both groups of patients. compared to volumetric assessment, monitoring the real weight on the display seems to be an easier way of following fluid deficit in hysteroscopic surgery. the automated gravitational continuous flow system with fluid deficit indicator can be used effectively and safely for uterine distention during hysteroscopic procedures. | objective : the automated gravitational vario flow system with weighing - based electronic fluid deficit indicator was used in order to reduce the risk of fluid intravasation during continuous flow hysteroscopic procedures. early experiences are reported.methods:between august 1996 and july 1997, the vario flow with fluid deficit indicator and alarm system was used in 203 hysteroscopic operations. between january 1994 and august 1996 the vario flow without fluid deficit indicator was used in 240 hysteroscopic operations. in all, there were 443 hysteroscopic operations : 301 metroplasties, 20 endometrial ablations, 10 cases of lysis of synechiae, 58 myomectomies and 54 polypectomies. the data on fluid deficit before and after the introduction of the electronic fluid deficit indicator were similar.results:fluid deficit indicator was proved highly efficient in 203 operations. it provided the information on fluid deficit at any moment during hysteroscopic operations. besides intrauterine pressure, the actual fluid deficit has become one of the leading parameters during our continuous flow hysteroscopic procedures.conclusion:we therefore conclude that by using an automated gravitational system with fluid deficit indicator and alarm system, the safety for patients during hysteroscopic procedures has been increased. |
human skeletal muscle tissue displays specific cellular architecture easily damaged during individual existence, requiring multiple resources for regeneration. congruent with local prerequisites, heterogeneous muscle stem cells (muscs) are present in the muscle interstitium. in this study, we aimed to characterize the properties of human muscle interstitial cells that had the characteristic morphology of telocytes (tcs). immunocytochemistry and immunofluorescence showed that cells with tc morphology stained positive for c - kit / cd117 and vegf. c - kit positive tcs were separated with magnetic - activated cell sorting, cultured in vitro and expanded for study. these cells exhibited high proliferation capacity (60% expressed endoglin / cd105 and 80% expressed nuclear ki67). they also exhibited pluripotent capacity limited to oct4 nuclear staining. in addition, 90% of c - kit positive tcs expressed vegf. c - kit negative cells in the muscs population exhibited fibroblast - like morphology, low trilineage differential potential and negative vegf staining. these results suggested that c - kit / cd117 positive tcs represented a unique cell type within the musc niche. |
|
msos is a formatted text - messaging system that enables communications between healthcare facility workers and ministry of health managers and uses a web - based portal to monitor disease notifications and response actions taken by health managers (figure 1 ; online technical appendix, http://wwwnc.cdc.gov/eid/article/22/4/15-1459-techapp1.pdf). in our trial, health workers used msos for 6 months to send information about suspected cases or health events that required notification within 24 hours. twelve diseases and conditions were selected for the study (online technical appendix table 1). before msos was implemented, we conducted a 1-day refresher training course on idsr for in - charges (i.e., medical officers in charge) of 135 participating health facilities ; the training focused on case definitions of notifiable diseases and on paper - based reporting. during the training, facilities were randomized into intervention and control groups ; the intervention group received an additional day of training on msos. paper - based reporting continued throughout the study period for both groups, so the intervention group would report cases 2 ways. structure and communication flow of a mobile short - message - service the table does not show data for busia county because values will be inverse of data for kajiado county (i.e., n minus the intervention group is the group of facility in - charges who were exposed to idsr and msos training and to the msos intervention ; the control group is the group of in - charges who were exposed to idsr training only. fbo, faith - based organization ; idsr, integrated disease surveillance and response ; in - charge, medical officer in charge of facility ; iqr, interquartile range ; ngo, nongovernment organization. wilcoxon mann whitney test was used to compare medians between control and intervention groups (i.e., age of in - charges). the p value is shown for the postintervention period only. standardized idsr paper - based reporting form for immediately notifiable diseases denominator excludes 3 facilities with missing values in the preintervention control group and 1 facility with missing values for each of the remaining 3 study groups. our primary outcome was determining how many of the cases that required immediate notification were reported within the time specified. our secondary outcome was determining, from among the cases for which notifications were sent, the proportion for which response actions were taken. for evaluation purposes, data from health facilities were collected for 6-month periods before and after the intervention launch (i.e., idsr and msos training and use of msos for 6 months). cases detected, notifications submitted, and responses undertaken were extracted from facility records in both study groups. our primary analysis was intention - to - treat (i.e., analysis of cases from all health facilities as they were randomized, regardless of intervention exposure). our secondary analysis was per - protocol (i.e., our trial protocol) and was restricted to cases reported by facilities whose in - charges had received training (i.e., idsr training for control group ; idsr and msos training for intervention group ; figure 2). profile of control and intervention health facilities and exclusions during the course of a study of a mobile short - message - service based disease outbreak alert system (msos) in kenya. characteristics of health facilities and in - charges were similar ; data from preintervention and postintervention surveys showed no significant differences between control and intervention groups (table 1). follow - up surveys conducted 6 months after the intervention showed that 34 (51.6%) of 66 intervention group in - charges received msos and idsr training and 32 (49.2%) of 65 control group in - charges received idsr training (figure 2 ; online technical appendix). a retrospective review of the baseline (preintervention) surveys showed that 36 cases (19 for intervention group, 17 for control group), all measles, required immediate notification. of these 36 cases, only 1 immediately notifiable case was reported (from a control facility using paper forms). during the 6-month period after the intervention, 169 immediately notifiable cases (130 for the intervention group, 39 for the control group) were detected : 160 measles, 6 anthrax, 2 q fever, and 1 guinea worm. of the 39 cases detected in the control group, notification of only 1 case (2.6%), which was measles, was sent. of the 130 immediately notifiable cases detected in the intervention group, 25 (19.2%) were reported to disease surveillance coordinators at the subcounty, county, and national levels. this proportion of cases reported was significantly higher than that reported by the control group (% difference 16.7, 95% ci 2.7125.07 ; table 2). intention - to - treat analysis indicates analysis of treatment groups as they were randomized, regardless of the intervention exposure ; per - protocol analysis indicates restricted analysis of groups that completed the entire study according to the trial protocol. all 25 cases for which notifications were sent from the intervention group were measles cases reported through msos ; 2 cases were also reported with paper forms. for these 25 msos notifications, the threshold for a measles outbreak response (5 suspected cases) was met once, and disease surveillance coordinators at the subcounty level responded to this event. furthermore, 24 (96%) of the 25 suspected measles cases were reported within 24 hours. in the per - protocol analysis, the percentage of cases for which notification was sent was greater in the intervention group than in the control group (27.3% vs. 4.8%), but the difference was of borderline statistical significance (% difference 22.5, 95% ci 0.32 to 34.13 by wilson procedure with continuity correction). similar differences were found when the analysis was restricted to health facilities that stocked paper - based tools (i.e., control group, 1/18 [5.6% ] vs. intervention group, 22/78 [22.6% ] ; % difference 17.0, 95% ci 2.93 to 35.30). this study showed that sms intervention significantly increased timely notifications ; however, despite a relatively large improvement, response remained suboptimal, with timely notifications of only one fifth of detected cases. these findings mirror results of a study in tanzania, which showed that sms considerably increased vital registration coverage but fell far short of reporting actual birth and death events in the community (12). our study has implications for health managers who implement interventions to improve disease surveillance in resource - limited settings. this effect was observed in both intervention and control groups but was higher in the group using sms ; this group had a 7-fold increase in detected cases compared with baseline findings. idsr refresher training may have contributed to increased case detection, and the combined interventions, including the technology component, resulted in a greater detection effect. second, expecting health workers to complete paper - based forms and deliver them without incentive within 24 hours is ineffective for ensuring notification of cases, with or without exposure to the refresher training. third, we observed a large drop - out rate (47.4%) for health facility in - charges participating in the study. the study took place during a period of health management decentralization in kenya, resulting in 47 new counties and in health worker transfers. lack of on - the - job training for staff who did not attend the training and lack of support through posttraining follow - up and supportive supervision were weaknesses in the intervention. these systemic challenges, reported in other idsr (13) and mhealth surveillance (14) projects, must be addressed to avoid compromising the sustainability of such interventions. finally, attrition of health workers exposed to the intervention and lack of paper - based tools explain only part of our results. the short duration of the training deployed (15) and the possibly suboptimal quality of the training delivered (3) may have contributed to the unrealized full potential of the intervention. despite its limitations (online technical appendix), this study shows how technology in the form of msos can increase the rate of notifications of suspected disease outbreaks and enhance ihr compliance in resource - limited settings. further investigation into ways to optimize the quality of delivery of msos interventions in countries with weak healthcare systems is justified. technical appendix. methods and additional details of a study of a mobile short - message - service based disease outbreak alert system in kenya. | we conducted a randomized, controlled trial to test the effectiveness of a text - messaging system used for notification of disease outbreaks in kenya. health facilities that used the system had more timely notifications than those that did not (19.2% vs. 2.6%), indicating that technology can enhance disease surveillance in resource - limited settings. |
the onset of labour is associated with changes in gene expression in the myometrium consistent with activation of inflammatory mediators and leukocyte chemotaxis [1, 2 ]. the uterine expression of the chemokine il8 increases dramatically with the onset of term and preterm labour [3, 4 ] and is thought to promote cervical remodelling [5, 6 ] and myometrial contractility by promoting neutrophil infiltration and activation [4, 7 ]. myometrial il8 expression is increased by stretch and the inflammatory cytokines in a mapk- and nfb - dependent manner [8, 9 ]. consistent with these observations, il8 expression has been shown to be critically dependent on a region in its promoter, spanning nucleotides 1 to 133, which contains binding sites for the transcription factors ap-1, cebp, and nfb [1013 ]. the binding sites are in close proximity to each other and to the coding region of the gene, forming a transcriptional enhanceosome (figure 1(a)). many researchers have investigated the role and interaction of these transcription factors in regulating the il8 gene and have shown different mechanisms of regulation depending on the cell type [1321 ]. studies in reproductive tissues show that nfb is important in il1b - driven il8 expression in amnion and myometrium, ap-1 is involved in the stretch - induced expression of il8, oxtr, and cox2 in human myometrial and amnion cells [9, 22, 23 ], and cebp has been shown to bind to two different regions of the il8 promoter and interact with nfb to regulate the il8 expression. the marked inflammatory infiltration of the myometrium and cervix associated with human labour is driven by increased expression of il8 and other chemokines. the transcription factors, nfb, cebp, and ap-1, have all been implicated in il8 expression in various tissues / cell types, but which actually regulate myometrial il8 expression remains unclear. in this study, we have used il1b stimulation to mimic labour in order to define the relative importance of nfb, cebp, and ap-1 in myometrial il8 expression. myometrial cells were extracted from biopsies taken at the time of elective caesarean section at term with the ethics committee approval and patient consent. tissue was minced and digested for 45 min in dmem with 1 mg / ml collagenase type ia and ix (sigma - aldrich corp., st. cells were centrifuged at 400 g for 10 min and grown in dmem with 10% fetal calf serum, l - glutamine, and penicillin - streptomycin (37c and 5% co2). cells were serum starved for 16 h before treatment with 1 ng / ml il1b (r&d systems, inc., minneapolis, mn, usa). cells were used at passage three for all experiments. to obtain whole cell lysates, cells were lysed for 20 min on ice in radioimmunoprecipitation assay buffer (1% np-40, 1% triton, 1% sodium deoxycholate, 0.1% sds, 150 mm nacl, 10 mm tris, ph 8.0, and 2 mm naf). protein concentrations were determined using detergent - compatible protein assay reagents (bio - rad laboratories). protein samples (50 g) were denatured by boiling for 5 min and run on a 10% sds - page for 60 min at 140 v, followed by a transfer to a hybond ecl nitrocellulose membrane (amersham biosciensces). the membrane was blocked in 5% milk protein solution over night or for 1 hour, washed and hybridized with the primary antibody for 1 hour at room temperature in a fresh blocking buffer (1 pbs, 1% milk protein and 0.1% tween-20) containing antibodies for rela and cebp (santa cruz biochemicals, sc-8008 and sc-7962, resp.) or beta actin (abcam, ab6276). immunoreactivity was then visualised using a chemiluminescent substrate for hrp (ecl plus ; amersham biosciensces). the promoter region of the il8 gene (135/+46 bp) was amplified by polymerase chain reaction, and the fragment was ligated into the luciferase reporter plasmid pgl2-basic (promega, southampton, uk) to give the wild - type construct. the mutation of individual base pairs in plasmid dna was achieved using the quikchange site - directed mutagenesis kit (stratagene, uk) according to manufacturer 's instructions. transient transfections were performed using fugene 6 transfection reagent (roche, indianapolis, in, usa). cytomegalovirus - renilla vector (1/10th of reporter) was used to control for transfection efficiency and cell number. luciferase reporter vectors containing either the wild - type il8 promoter or the mnfb (mutation of nfb) or the mcebp (mutation of cebp) or the map-1 (mutation of ap-1) were transfected at 0.2 g / well. cells were cultured for a total of 48 h (including 24 h of il1b stimulation for half the experiment) followed by harvesting and analysis with a dual firefly / renilla luciferase assay (luclite, packard bell, and coelenterazine cn biosciences). the cells were lysed, and chromatin was sheared into 200 to 1000 bp fragments by sonication. antibodies recognizing the c - terminal of rela, cebp (santa cruz biochemicals, sc-8008 and sc-7962 resp.), and acetyl - histone h4 (upstate cell signalling solutions, 06 - 866) were used (1 : 1000 dilution) for immunoprecipitation, and the chromatin fragments containing the crosslinked protein were purified by immunoabsorption and elution from protein a / g beads. the crosslinks were reversed, and the dna was purified using a qiaquick nucleotide removal kit (qiagen inc., valencia, ca, usa). pre - pcr cycle was 10 min at 95c followed by 35 cycles of 95c for 1 min, 5660c for 1 min, and 72c for 1 min followed by final extension at 72c for 10 min. on - targetplus smart pool human nfbp65, cebp, cebp, c - fos, and c - jun sirnas (dharmacon) were used. siglo (dharmacon) was used as a positive control, giving a high transfection efficiency of approximately 90%, and on - targetplus nontargeting pool (dharmacon) was used as a negative control. the sirnas were transfected using dharmafect 2 (dharmacon) transfection reagent at a final concentration of 100 nm according to manufacturer 's instructions. tube one contained the sirna diluted in phenol - red - free dmem, and tube two contained the transfection reagent diluted in phenol - red - free dmem. each tube was incubated at room temperature for 5 min before mixing the contents of the two tubes. prewarmed dmem containing 10% fbs and 2 mm l - glutamine, but no antibiotics were then added to the mixture. the culture media was removed from the cells, and the cells were fed with the sirna mixture. the media was changed to dmem containing 10% fbs, 2 mm l - glutamine, and 100 u / ml penicillin - streptomycin 24 hours after the transfection. the sirna transfections were performed at different time courses (12, 24, 48, and 72 h and 5, 6, and 7 days). the changes were of the same pattern at all time points, but maximal response was observed at 5 days. the cell viability was monitored closely before harvesting the cells for appropriate analysis. at the end of incubation assays, 1 ml of medium was collected and immediately frozen at 80c for analysis by il8 elisa kit (biosource, khc0081). the il8 elisa had a sensitivity of 5 pg / ml ; the inter- and intra assay variations were 7.8% and 5.3%, respectively. protein concentrations were determined using detergent - compatible protein assay reagents (bio - rad laboratories). statistical analysis was performed by anova with the level of significance defined as p < 0.05. chip studies showed that il1b induces the binding of nfbp65, cebp and ap-1 to the endogenous il8 promoter. il1b stimulated the recruitment of nfbp65, cebp, and -, cfos, and cjun to their respective cis - elements in the transcriptional enhanceosome at 6 hrs (figure 1(b)). this was associated with concomitant acetylation of h4 at that region of the promoter. a sequence extending from 135 to + 46 which contains the transcription enhanceosome was used as a wild - type control. site - directed mutagenesis was performed to make three further constructs with mutations for each of the nfb, cebp, or ap-1 sites individually (figure 2). basal luciferase activity following transient transfection of the wild - type construct was significantly increased by 2-fold upon il1b stimulation. in primary human myometrial cells, mutation of the nfb site reduced the unstimulated reporter activity to 10% of that of the wild type and obliterated the response to il1b. mutation of the cebp site had no effect on basal promoter activity but did abolish the response to il1b. mutation of the ap-1 site decreased basal il8 promoter activity although a response to il1b stimulation was retained (figure 2). knockdown mediated by sirna against nfbp65, cebp, c - jun, and c - fos was performed with protein expression studies showing highly - specific and better than 95% gene silencing (figure 3(a)). the effect of sirna knockdowns against nfbp65, cebp, c - jun, and c - fos was measured on il8 protein production and its response to il1b stimulation (for 24 h) using elisa. silencing of each individual transcription factor had no effect on basal il8 protein release into the culture medium, measured by elisa. knockdown of cebp increased the response to il1b by 1.5-fold whilst c - jun and c - fos knockdown reduced the response by half (figure 3(b)). since cebp may also bind to the il8 promoter (see figure 1), we repeated the experiment using sirna knockdown of cebp which also increased the response to il1b by 1.5-fold as with knockdown of cebp (figure 3(c)). nfb, cebp, and ap-1 are important transcription factor families that are involved in immune and inflammatory functions as well as in cell growth and differentiation. nfb, cebp, and ap-1 are each expressed in human myometrium, and their expression is increased in response to the proinflammatory cytokine, il1b. labour - associated genes such as pghs-2, otr, il8, il6, and tnf- have been shown to be regulated by either one or a combination of theses transcription factors [14, 16, 20, 21, 2429 ]. targeting activators of inflammation has been proposed as a strategy for prevention or delay of preterm birth and to improve outcome in preterm neonates. have demonstrated a central role for nfb in the onset of term labour in the mouse, and that inhibition of nfb can delay parturition. for example, sulfasalazine is a synthetic anti - inflammatory drug comprising 5-aminosalicylic acid (5-asa), linked to sulfapyridine, which is routinely used for the treatment of inflammatory bowel disease and rheumatoid arthritis. this has been shown to inhibit labour - associated gene expression in cell culture models [31, 32 ], although there are currently no animal or clinical studies. in a mouse model of inflammation - induced preterm labour the cyclopentenone prostaglandin j2, which acts via inhibition of nfb, both delays preterm birth and improves pup survival. glucocorticoids such as dexamethasone or prednisolone have well - established anti - inflammatory and immunosuppressive activities through their inhibitory effects on ap-1 and nfb pathways although there is no evidence that these drugs will delay or prevent preterm birth. progesterone, which, when used clinically, can reduce the risk of preterm labour, has been shown to repress il1b - induced expression of nfb regulated genes in human amnion and myometrium [35, 36 ]. in this study, we examined the role of nfb, cebp, and ap-1 in regulation of il8 expression in human myometrium and used il1b to mimic the effects of inflammation seen with human labour. we used chip to show that il1b induces the binding of all three transcription factors to the il8 promoter. that il1b increases both nfbp65 and cebp binding to the endogenous il8 promoter in myometrial cells. for example in a study in human conjunctiva epithelial cells chip showed no binding of nfb, cebp, or ap-1 alone, but when immunoprecipitation was performed for both nfb and cebp simultaneously, chip showed binding of both to the il8 promoter. conversely treatment of human airway smooth muscle cells with tryptase, which mimics inflammation, induced the binding of all three transcription factors to the promoter. since we found that, in human myometrial cells all three transcription factors bound to the il8 promoter, we considered two approaches to identify the relative importance of each transcription factor in il8 expression. first we used site - directed mutagenesis to alter the binding sites for ap1, cebp, and nfb. we found that mutating both the nfb and ap-1 sites markedly reduced both basal and stimulated il8 promoter activity. however, mutating the cebp site did not change the basal promoter activity but did completely inhibit the il1b - induced increase in promoter activity. these data suggest that the nfb and ap-1 binding sites are essential for both basal and il1b - stimulated il8 expression. in contrast, it appeared that cebp binding sites are not important for basal promoter activity but are essential for the il1b - induced increase in promoter activity. using a similar approach in human amnion and cervical epithelial cells, elliott. found similar results for the nfb binding site but found no effect of mutating the cebp or ap-1 binding sites on the il8 promoter activity. however, site - directed mutagenesis of dna binding sites gives limited information about the role and importance of transcription factors, particularly where, as in the il8 promoter, those sites are close to each other or overlap. therefore in an alternative approach we used the more novel technique of sirna against ap-1, cebp, and nfb to knock down the expression of their endogenous proteins. the data generated by sirna knockdown is probably the most reliable in terms of the role of individual transcription factors since it is highly specific. in addition, the readout is activity of the endogenous promoter, not a transfected construct. in contrast to the finding from the site - directed mutation studies, basal il8 levels were not reduced by knockdown of any of the transcription factors. this may be because although we achieved 90% knockdown, this was not complete. however, knockdown of p65 did completely inhibit the il1b - stimulated increase in il8 levels. the effects of c - jun and c - fos knockdown were less marked but still inhibitory. cebp knockdown did not inhibit the il1b - induced increase in il8 expression and actually tended to increase it. in some cell types cebp has been shown to inhibit the action of nfb in regulation of il8. certainly our data does not point to a central positive role for cebp in driving il8 expression. our data show that, in human myometrial cells, nfb is essential for il8 expression ; ap-1 plays a less important but still stimulatory role, while the role of cebp is less clear. the site - directed mutagenesis studies suggested a positive role in il8 expression ; however, the nfb and cebp binding sites are close together, and it remains possible that mutation of the cebp site may have interfered with nfb binding or function. the probably more reliable data from sirna would suggest that pharmacological inhibition of cebp might enhance il8 expression and may therefore not be beneficial. the dominant role played by nfb in il8 expression confirms that it is an attractive therapeutic target for the prevention of preterm labour. these data show that nfb is essential for il8 myometrial expression, ap-1 plays a less important but still stimulatory role, while the role of cebp is less clear. these results provide further support for the notion that nfb represents an attractive therapeutic target for the prevention of preterm labour. | the uterine expression of the chemokine il8 increases dramatically with the onset of labour both at term and preterm. the il8 promoter contains binding sites for the transcription factors nuclear factor - kappa b (nfb), activator protein-1 (ap-1), and ccaat / enhancer - binding protein (cebp). in this study we investigated the roles of these transcription factors in il1b regulation of the il8 gene in human myometrium. using chromatin immune precipitation (chip) assay, we showed that each of nfb, cebp, and ap-1 binds to the il8 promoter upon il1b stimulation. to examine the relative importance of each site in il8 gene expression, site - directed mutagenesis of each of these sites was performed. we found that the nfb site was essential for basal and il1b - stimulated gene expression. mutation of the ap-1 site reduced both basal and il1b - stimulated expression but to a lesser extent. mutation of the cebp site had no effect upon basal expression but eliminated the il1b response. small interfering rna (sirna) silencing of nfb abolished the il8 response to il1b significantly ; sirna against ap-1 reduced it to a lesser extent whilst knockdown of cebp enhanced the response. our data confirms a central and essential role for nfb in regulation of il8 in human myometrium. |
there is a high comorbidity of schizophrenia and obsessive - compulsory disorder (ocd) associated with more severe symptoms. we report about a 48-old women treated for depression which developed successively psychotic symptoms (ideas of reference, psychotic worries), negative symptoms (blunted affect, impoverished thinking, difficulties in planning), and obsessive - compulsive symptoms (mainly repeating rituals, avoidance behaviour, collecting and hoarding). she did not respond to combined treatment with neuroleptics and high dose selective serotonin re - uptake inhibitors. she acutely improved during a course of electroconvulsive therapy (ect) and was maintained on outpatient ects fortnightly together with 12 mg sertindol and 45 mg mirtazapine for 42 weeks. maintenance ect is not an approved therapy in ocd but might be an option in pharmacotherapy refractory cases of comorbid ocd and schizophrenic / schizoaffective disorder. the frequency of obsessive and compulsive (oc) symptoms in patients with schizophrenia is ranging from 3.5% to 26% and is higher than in the general population of less than 3%. patients with comorbidity of schizophrenia and obsessive - compulsive disorder (ocd) were shown to have greater impairments in executive functions, vigilance, negative, and emotional discomfort symptoms than those patients without oc. first line strategies in the treatment of ocd with high - dose selective serotonin re - uptake inhibitors (ssri), venlafaxine, or clomipramine, and congnitive behavioural therapy achieve symptom improvement in approximatly 60% only. up to date there are only a few single case reports about electroconvulsive therapy (ect) for comorbid ocd and schizophrenia. we report about a patient successfully treated with maintenance ect in comorbid ocd and unipolar schizoaffective disorder. the now 48-year old caucasian female nurse had been in psychotherapeutic treatment for several years. she was admitted to hospital for the first time at the age of 46 for a severe depressive episode treated with mirtazapine 45 mg. during the following weeks the patient developed psychotic symptoms as psychotic worries (debasement of her personality), helplessness, and ideas of reference treated with 25 mg olanzapine, than 1400 mg quetiapine due to resistancy. later on compulsive symptoms occurred (repeated checking ; picking up and collecting waste). both schizodepressive and compulsive symptoms were only partially remitting under treatment with fluvoxamine 150 mg and clozapine 400 mg at time of discharge. negative symptoms as difficulties in scheduling the day and deficits in concentration, attention, and comprehension were persisiting. she was able to live independently, but could not return to her occupation. over the following months the patient 's oc symptoms, mainly compulsions, were exacerbating and spreading. it included contamination obsessions (confined to toilets), checking compulsions (checking lockers and cooker several times, following other persons or cars), repeating rituals (passing door- and stairways several times or in a ritualized way, touching items several times as door handles and handshaking), hoarding / collecting compulsions (picking up things from the street including waste and dog excrements, and hoarding these items), and avoidance behaviour (restricted to toilets). before readmission it used to take her up to 4 hours to leave the outpatients department or home [y - bocs (yale - brown obsessive compulsory scale) score : 40, cgi (clinical global impression) severity score : 4 ]. panss (negative and negative syndrome scale) showed a t - score and percentile equal to 99th percentile for negative syndromes, general psychopathology, and the cluster activation and depression and equal to 65th percentile for anergia. combinations of clozapine (up to 1000 mg) with amisulpride (400 mg), and antidepressants (sertraline 200 mg) for two months did not significantly improve oc and schizophrenic symptoms. after informed consent and discontinuation of all oral medication the patient underwent 10 unilateral ect treatments administered twice a week with no side effects. there was an immediate effect after the first to two sessions leading to the short - term complete remission of oc. maintenance ect was necessary because follow - up after one month showed reoccurrence of oc and schizophrenic symptoms (ybocs score : 25, cgi severity : 3, improvement : 5 ; panss t - scores equal to 96th percentile for depression, and t - scores slightly above average for general psychopathology and activation). maintenance ect once in a fortnight in combination with 12 mg sertindol and 45 mg mirtazapine resulted in stable remission for 42 weeks (y - bocs score : 6, cgi severity : 1 ; panss t - scores for all items within the average range), which allowed her to live independently at home but did not enable her to re - enter her previous job or to start any other occupation due to passivity, affect blunting, and some problems in problem solving. there are only anecdotal reports of individual cases and a few open trials with case series with ect in pharmacotherapy refractory ocd showing a reduction of oc symptoms and a remission from one to 12 months. as for other indications and however, neither a placebo - controlled (sham - controlled procedure) nor pharmacotherapy - controlled trial is available for ect in ocd. ect has not received the approval of food and drug adinistration for the treatment of ocd. more published data are available for ect in schizophrenia but scarcely for schizoaffective disorders. the evidence of a cochrane review suggested that ect is superior to placebo and medication alone in patients with drug - resistant schizophrenia especially when combined with antipsychotic drugs. however, this initial beneficial effect may not last beyond the short - term despite pharmacotherapy and maintenance ect therapy might be necessary. substantial improvement after ect in schizophrenia patients treated with clozapine persisted beyond 4 months in only 22.7%. it has been proposed that atypical antipsychotic drugs like risperdone and olanzapine are highly beneficial in augmentating the response to ssris for the treatment of ocd. however, it has also been anaecdotecally reported that atypical neuroleptics (clozapine, olanzapine, riperidone), when given as monotherapy, have caused the symptoms of ocd to appear or to worsen. in retrospective studies the number of newly occurring ocd under treatment with clozapine was given with 2.4% - 21% and did emerge with other atypical antipsychotics (olanzapine, risperidone) in less than 2%. in the present case we can not rule out that the oc symptoms were induced and aggravated by atypical neuroleptics. | objectivethere is a high comorbidity of schizophrenia and obsessive - compulsory disorder (ocd) associated with more severe symptoms. standard pharmacotherapy achieve symptom improvement in approximately 60% only.resultswe report about a 48-old women treated for depression which developed successively psychotic symptoms (ideas of reference, psychotic worries), negative symptoms (blunted affect, impoverished thinking, difficulties in planning), and obsessive - compulsive symptoms (mainly repeating rituals, avoidance behaviour, collecting and hoarding). she did not respond to combined treatment with neuroleptics and high dose selective serotonin re - uptake inhibitors. she acutely improved during a course of electroconvulsive therapy (ect) and was maintained on outpatient ects fortnightly together with 12 mg sertindol and 45 mg mirtazapine for 42 weeks.conclusionmaintenance ect is not an approved therapy in ocd but might be an option in pharmacotherapy refractory cases of comorbid ocd and schizophrenic / schizoaffective disorder. |
immunotherapy is a new class of cancer treatment that works to harness the innate powers of the immune system to fight cancer. major conceptual and technical advances in immunology have led to a new understanding of cellular and molecular interplays between the immune system and a tumor over the past decades [1 - 3 ]. because of the immune system 's unique properties, these therapies may hold greater potential than current treatment approaches to fight cancer more powerfully, to offer longer - term protection against the disease, to come with fewer side effects, and to benefit more patients with more cancer types. since recent therapies for cancer are based on drugs or radiotherapy which can kill proliferating cells or suppress cell proliferation, these treatments have several side effects on normal dividing cells. the potential roles of immunologic approaches for treating of cancer patients are specific for tumors [1, 2 ]. targeting neoplastic cells can improve the therapeutic effects of gene delivery by preventing healthy tissues injury and reduce the risk of germ line transduction [3, 4 ]. immunotherapy strategies consists of cancer vaccines, antitumor monoclonal antibodies, adoptive transfer of ex vivo activated t and nk cells, and administration of recombinant proteins and antibodies or that either co - stimulate immune cells or suppress immune inhibitory pathways (immune checkpoints). the aim of cancer immunotherapy is to boost the weak host immune response to develop tumors. gene therapy prepared a novel strategy of therapeutic intervention for lots of genetic and non - genetic disorders. with recent progress in gene therapy field, a wide variety of viral and non - viral vectors have emerged that can transfer genetic materials to target cells. non - targeted delivery of transgenes often causes undesirable effects, low tumor transduction, and decreased therapeutic effects [8, 9 ]. cancer - specific cytokine cascade is one of the manifestations of the underlying paraneoplastic systemic disease, and this hypothesis links the stage of cancer with both the functional status of the immune system and the patient 's prognosis. cancer gene immunotherapy is a delivery of cytokine genes to tumor cells to modify the local tumor environment in order to induce anti - tumor immune responses. in comparison to the therapeutic protein therapy, delivery of cytokine genes avoids the necessity of production and purification of large quantities of recombinant proteins. moreover, gene immunotherapy is capable of delivering cytokines in a more efficient and safe manner. interluekin36 (il36) is a 74 kda heterodimeric cytokine that consists of 35 kda (p35) and 40 kda (p40) subunits [13 - 15 ]. it was characterized as a natural killer - stimulating factor (nksf) and cytotoxic lymphocyte maturation factor (clmf) by trinchieri s group in 1989 and gately s group in 1990. it is produced by macrophages, monocytes, and dendritic cells [14, 16 ]. investigations have shown that il36 posse s superior antitumor effect compared with different cytokines. also the researches demonstrated that il36 can be efficacious in prevention of primary tumor growth. il36 is a multifunctional cytokine which can develops the multi - functional effects such as rising the proliferation and cytotoxic activity of t cells and nk cells, regulating the production of ifn-, inducing cytokine production, progressing the cd4 + th1 cells development and also promoting the activity and generation of ctls, via activation of stat4. ifn- up regulates the expression of mhc class i and ii molecules, adhesion molecules such as intracellular adhesion molecules (icam)-1 and transcription factors such as t - box expressed in t cells (t - bet) with inducing by il36 [15,18 - 19].also, il36 possesses potent anti - angiogenic activity produced by neuotrophils, macrophages and dendritic cells. the endogenous production of ifn- is needed for the antitumor effect of il36 in most cases. il36 is one of the potent cytokines for cancer immunotherapy [18 - 19 ]. the aim of this study was to investigate the effects of gene therapy with il36 in the regression of tumor masses in fibro sarcoma mouse model. plasmid amplification and isolation an il36 expression vector, pumvc3-mil36, was purchased from (aldevron company, uk.london). the plasmid dna (6247 bp) pumvc1-il36 was amplified in escherichia coli dh5 strain which was obtained from drug applied research center (tabriz, iran). the dna concentration was quantified by measuring the uv absorbance at 260 nm using uv spectrophotometer (shimadzu, japan, tokyo). transformation of e. coli pumvc3-m il36 plasmid was transformed into host strain e. coli, dh5, bl21, respectively which was obtained, amplified and extracted according to tens protocol. the dna concentration was quantified by measuring the uv absorbance (biorad company product, usa, illinois). determination of transfection efficiency the transfection efficiency of mil36 was measured by enzyme - linked immunosorbent assay (elisa) kit (koma biotech company, china, zhenjiang) according to the manufacturer s instructions. balb / c mouse fibro - sarcoma cells (wehi-164) were bought from pasteur institute, tehran. the wehi-164 cells were cultured in rpmi1640 medium (sigma, germany, frankfort) supplemented with 10% fetal bovine serum (sigma, germany, frankfort), in presence of penicillin (100 u / ml), streptomycin (100 g / ml), (sigma, germany, frankfort), and incubated in humidified incubator with 5% co2 at 37 c. in vitro transfection studies the cells were trypsinized and seeded into 6-well plate at a density of 4 105 cells / well ; the cells were carried out before 2 days of transfection procedure. the cells were washed with phosphate - buffer solution (pbs) twice prior to the addition of 2 ml rpmi1640 without fbs and antibiotic. six g of pumvc1-m il36 plasmid was diluted in 250 optimem in one micro - centrifuge tube. ten lipofectamine 2000 was diluted in 250 optimem in separate micro - centrifuge tube and incubated for 5 minutes. the contents of micro - centrifuge tubes were mixed together gently and incubated at room temperature for 20 minutes. after 6 hours, the complexes were aspirated and replaced with culture medium. after 48 hours of transfection, supernatants were harvested and released il36 was confirmed with elisa, by mouse il36 elisa kit (koma biotech, china, zhenjiang), following manufacturer 's instructions. female balb / c mice (6 to 8 weeks old) were purchased from the pasteur institute, tehran, iran. one hundred and six of wehi-164 cells were inoculated into the right flank of the balb / c mice subcutaneously to establish a tumor model. the viability of the cells used for inoculation was over 95% as determined by the trypan blue dye exclusion test. tumor growth was monitored three times a week with calipers after tumor challenge until the experiment was completed. tumor volume (mm3) was calculated by the formula : 1/2 (lengthwidth2). rna extraction and real time pcr fallowing tumor mass extraction, total rna was extracted by accuzoltm reagent (bioneer, daedeok - gu, daejeon, korea) as described by the manufacturer. complementary dna (cdna) was generated from 1 g of total rna by using oligo - dt primer and mmlv reverse transcriptase (promega, madison, wi, usa, illinoise) according to the manufacturer s recommendations. qrt - pcr was performed with sybr premix ex taq (takara bio, otsu, and shiga, japan) in the rotor - genetm 6000 system (corbett life science, mortlake, nsw, australia). the pcr was done in a 20 l reaction system containing 12 l of sybr green reagent, 0.2 m for each primer, 1 l of cdna template and 6 l of nuclease - free distilled water. the primer sequences were as followed : mouseil36p40 : 5- gagcactccccattcctact -3 (as a forward primer) and 5-gcattggacttcggtagatg-3 (as a reverse primer), mouse ifn- : 5-tcagcaacagcaaggcgaaaaag-3 (as a forward primer) and 5-accccgaatcagcagcgactc-3 (as a reverse primer) and gapdh was used as an internal expression control : 5-cctcgtcccgtagacaaaa-3 (as a forward primer) and 5-aatctccactttgccactg-3 (as a reverse primer). the initial denaturation step was at 95c for 10 min and was followed by 45 cycles at 95c for 20 sec and 60c for 1 min. relative gm - csf mrna expression was calculated with the 2- (ct) 17, using gapdh as a reference gene. ki67 is a nuclear protein and is considered as a tumor proliferation biomarker in tumor masses. four micrometer frozen sections were cut, air - dried, fixed in acetone, and rehydrated in pbs con - taining 0.05% tween-20. non - specific binding sites were blocked by blocking buffer which is preformulated with tween-20 for 30 minutes. slides were incubated by primary antibody (purified anti - mouse ki67), (biolegend, uk, london), for 60 minutes. subsequently, slides were washed in pbs containing 0.05% tween 20 and then slides were incubated with hrp labeled secondary antibody [rabbit polycolonal secondary antibody to rat igg (hrp - conjugated) ], (abcam), for 30 minutes. h2o2 was added to dab solution (substrate solution) and dab and h2o2 were added to the slides for 5 minutes. the slides were consequently washed with pbs containing 0.05% tween-20 and studied by invert microscopy. the purified anti - mouse il36 (1:1000) (biolegend, uk, london), and anti--actin (l : 1000) (sigma) were used as primary antibodies. cell extracts were prepared in ripa - b buffer (0.5% non - idetp40, 20 mm tris, (ph 8.0), 50 mm nacl, 50 mm naf, 100 m na3vo4, 1 mm dithio - threitol, and 50 g / ml phenyl - methylsulfonyl fluorides. the protein concentration was quantified using a uv spectrophotometer. protein samples were fractionated on a 12% polyacrylamide gel and transferred to the nitrocellulose membrane. the membrane was blocked with 3% skim milk for 1 hour at room temperature and incubated with primary antibody at 4c overnight. after extensively washing, the membrane was incubated with [rabbit polyclonal secondary antibody to rat igg (hrp - conjugated) ], (abcam). the results were visualized using the enhanced chemiluminescence (ecl) system (amersham biosciences, piscataway, nj, usa) and exposured to autoradiography film (ko - dak xar film). confirmation of il36 production by tumor transected cells enzyme - linked immunosorbent assay (elisa) test was used for confirmation of il36 production by tumor transected cell. the concentration of il36 in supernatant of tumor transected cell culture was assessed by spectrophotometer in 540 nm. the il36 concentration in the supernatant of the tumor transected cell culture was 1000 pg / m9l (figure1). antitumor effects of il36 in vivo to test the antitumor response induced by il36 secreted in site, balb / c mice (n=7) were injected subcutaneously with fibro sarcoma / il36 cells (110), and monitored for tumor growth 3 times a week. after 21 days of tumor inoculation the volume of the tumor masses was less than control group. so gene therapy with il36 has effect in the regression of tumor masses (figure 2). expression of il36 & ifn- mrna and protein in tumor tissue the extracted rna with 28s/18s ratios between 1.5 and 1.9 gp / ml as determined by agarose gel electrophoresis analysis, using ethidium bromide staining. the median total rna recovery from tissue was 98% (range, 90% to 105%). to investigate whether fibro sarcoma / il36 cells can express il36 in vivo, tumor mass was harvested from mice on day 21 after inoculation with fibro sarcoma / il36 cells, respectively, total rna was extracted from tumor masses and cell lyses were prepared. the results of real - time pcr indicated that the expression of il36 and ifn- was enhanced in group treated with il36 in comparison to the control group (figure 3). the results of immunoblotting showed that the expression of il36 and ifn- was enhanced in group treated with il36 in comparison to the control group (figure 4). the group treated with il36 were up - regulated (compared to the control group) by a mean factor of 1.90 (s.e. despite advances in our understanding of the processes involved in the development and progression of cancer, treatment options for many patients are limited and prognosis still remains poor. gene therapy is the insertion of a functional gene into the cells of a patient to correct an inborn error of metabolism, to alter or repair an acquired genetic abnormality, and to provide a new function to a cell [2, 5 ]. cancer gene therapy by delivery of cytokine gene is an appealing strategy which can be efficiently transducer into the tumor cells and extracts potential immune responses. cancer gene therapy consists of 2 main therapeutic strategies : one approach is to cause a direct effect on cancer cells by transferring suicide genes sirna for ontogenesis and proteins related to the cell cycle and apoptosis [21 - 24 ]. in this method, the second approach is indirect and activates antitumor immunity mediated by introducing a cytokine gene such as il36 [25 - 29 ]. in such cytokine gene therapies, the therapeutic gene does not need to be delivered into all the cancer cells, because the cytokine is secreted from the cells.. many anti - tumor effects are related to this method for il36 gene delivery [30, 31 ]. the high il36-producing cells show a nk- or t cell - independent antiangiogenic effect induced by ip-10, although the final rejection in immunocompetent mice is totally dependent on t cells [32, 33 ]. in prostate cancer, adenoviral - mediated il36 gene therapy had an antimetastatic effect in partial dependency on nk cells. in bladder carcinoma and colon cancer, adenoviral - mediated il36 gene therapy is depend on t cell- local antitumor effects.in this study, we investigated that the effect of non - viral gene therapy by using plasmid dna expressing il36, is a potent primer of anti - tumor immunity [35 - 37 ]. in addition, a significant level of intratumoral ifn- was also observed as an inducer of 2 important antitumor chemokines, ip-10 and mig 37. no one denies that gene therapy for cancer holds extraordinary promise or that it will eventually yield results. but critics have grown increasingly concerned that the initial excitement led to a premature rush to get unproved gene therapies for cancer out of the laboratory and into human patients. researchers are still not sure which are the best methods to transport genes into cancer cells, nor have figured out how to stop a person 's own immune systems from rejecting what are, in effect, microscopic transplants of foreign materials. even more troubling is the signs that indicate financial considerations may have replaced scientific rigor in determining how and when to use gene therapy for cancer. the possibility of gene therapy opens a new area of therapeutics and hope for individuals afflicted with several types of cancers. we demonstrated that the local il36 gene delivery into tumor tissue is an immune response to the tumor cells. therefore, gene delivery by lipofectamine could be a useful non - viral vector system in cancer gene therapy. the possibility of gene therapy opens a new area of therapeutics and hope for individuals afflicted with several types of cancers. we demonstrated that the local il36 gene delivery into tumor tissue is an immune response to the tumor cells. therefore, gene delivery by lipofectamine could be a useful non - viral vector system in cancer gene therapy. | backgroundcancer immunotherapy attempts to stimulate the immune system to reject and destroy tumors and is one of the cancer treatment strategies. recently, interluekin36 (il36) has been used as immunotherapeutic agents in cancer gene therapy. present study investigated that the il36 gene therapy effects on the regression of tumor masses in mouse model. aim of this study is determination of the gene therapy effects by il36 in the regression of tumor masses in mouse model.methodsto study the therapeutic efficacy of this cytokine, wehi-164 tumor cells were transected with mil36 plasmids. elisa test was used to check cytokine production by transected cells. to establish fibro sarcoma mouse model, tumoral transfected cells were injected subcutaneously to inoculate tumor in balb / c mice. tumor volumes were measured by caliper. mice were sacrificed and tumors were extracted. the expression of il36 and ifn- was studied with real - time pcr and immunoblotting. the expression of ki-67 (a tumor proliferation marker) in tumor masses was studied by immunohistochemistry staining. in this study we had 2 groups which are treated with il-36 and untreated with il-36 as a blank.resultsthe group treated with il36 indicated decrease of tumor mass volume (p<0.001). the results of western blotting and real - time pcr showed the il36 expression increased in the group treated with il36 (with relative expression of 1.9).conclusionimmunohistochemistry staining indicated that the ki-67expression has been reduced in the group interfered with il36. il36 gene therapy has therapeutic effects on the regression of tumor masses in fibro sarcoma mouse model. |
distance measurements by pulsed dipolar electron paramagnetic resonance (epr) spectroscopy are a standard tool for generating distance constraints for structural modelling. the pulsed electron electron double resonance (peldor or deer for double electron electron resonance) developments in commercial hardware, standardisation of pulse sequences and readily accessible data analysis programs have fuelled its widespread adoption. a straightforward approach for using peldor is to covalently attach two nitroxide spin - labels (probes) to a macromolecule and measure the spin it is also possible to use singly labelled components of a system that forms oligomers. one of the major advantages of the method is that the probes are small (introduce limited perturbation) and since diamagnetic proteins are epr silent, it allows the study of systems of tremendous size and complexity. the distance extraction is free from assumption about the system under investigation, thus unbiased structural constraints can be obtained. the characterisation of structural models for docking proteins or characterising a structural transition by measuring a few well - chosen distances by peldor is very powerful. recent advances have included membrane proteins, even though the local concentration of spins can pose a problem in phospholipid vesicle membranes and care has to be taken when interpreting the data from detergent - solubilised samples. in addition to the inter - spin distance, the number of coupled spin - labels, their relative orientation and a potential exchange interaction can be determined, yielding additional information. peldor has been applied on transient radicals, paramagnetic metal ions, spin - bearing clusters and various possible pairs thereof. peldor actually measures frequency modulations in the time domain and tikhonov regularisation methods are commonly used to obtain the most appropriate distance distribution solution. the underpinning assumptions ignore some factors such as size - restriction effects and effects caused by the presence of more than two spins in a molecule. other factors, including incomplete spin - labelling in multiply labelled samples and distributions of molecules not homogeneous in three dimensions can introduce additional uncertainties in data analysis. an obvious concern is that if these factors are significant in an experiment, the derived distance distribution may be misleading. here we focus on multi - spin effects in rotationally symmetric oligomeric membrane protein systems. these often have challenging spectroscopic parameters that hamper acquisition of high - quality data, especially in samples reconstituted into phospholipid vesicle membranes. furthermore, the multi - spin effects present in oligomeric systems violate assumptions of the theory underlying the gold standard of data analysis : tikhonov regularisation in the deeranalysis package, which uses a kernel function, explicitly written for a two - spin system (henceforth simply abbreviated tr). thus, multi - spin systems are a special case formally beyond the scope of tr and, thus, the distance distributions generated should be used with caution. approximating these systems as biradicals has given satisfactory results for the shortest distance present in the system (the vector from one molecule to its immediate neighbour). it has been shown that multiply labelled systems will modulate with the product of the dipolar frequencies of all possible pairs. this leads to sum and difference frequencies that are currently ignored. a second feature that directly arises from the symmetry is correlations between distance vectors (in a rotationally symmetric system all vectors are mathematically related) that might enhance certain sum and difference frequencies while diminishing others. even though peldor has been applied to homo - oligomers up to heptamers and octamers the only system in which these effects have been quantitatively considered is the tetrameric potassium channel kcsa. however, the problem has been addressed in studies of the homo - trimeric sodium - coupled aspartate transporter. very recently, a promising approach for suppressing multiple spin artefacts by power - scaling the experimental data has been introduced and validated for up to five spins per molecule. we now semi - quantitatively establish the significance of error introduced by the common practice of treating symmetric homo - oligomers as spin pairs. secondly, we evaluate fitting experimental data using a reduced geometric model whilst retaining the multi - spin effects and symmetry correlations. the following considerations focus entirely on rationalising the origin and theoretical treatment of multi - spin effects in systems bearing more than two spin labels. it is important to note that in all the following we assume the high - field, secular and point - dipole approximations to be valid and the electron in addition, we approximate random mutual orientations between all possible pairs of spin - labels and thus diminish the effects of orientation selection for our simulated peldor data. in a disordered powder sample spin distance r and the angle between the distance vector and the external magnetic field : where ga and gb are the g values of the two coupled spins and are approximated to be isotropic, 0 is the vacuum permeability, b is the bohr magneton, is the planck constant divided by 2. the peldor signal v(t) between two coupled spins can now be written straightforwardly as : where is the fraction of b - spins inverted by the second frequency pulse. if we, furthermore, introduce powder averaging to take the random orientations of molecules in frozen solutions into account and consider the peldor signal of a system with more than two spins (i.e. n spins) as being the product of signals of the individual spin pairs we will arrive at the general form of the intra - molecular signal : the multiplication of dipolar frequencies in systems with more than two spins will lead to sum and difference frequencies, which in turn cause the dipolar spectrum to deviate from a superposition of pake patterns. this directly influences or even invalidates all data analysis approaches assuming the time domain signal to be a linear combination of spin pairs. an expansion of equation (3) allows one to group the frequency contributions of the signal into pairs that oscillate with a single frequency and into triples, quadruples etc. while the absolute modulation depth will contain pair and multi - spin contributions : the coefficient of the pair contribution is described by : where the first factor of the right - hand side of equation (5) is the respective binomial coefficient. the k - spin contribution oscillating with the product of k 1 frequencies is given generally by : where the first factor of the right - hand side of equation (6) is the respective binomial coefficient. each of those k - spin contributions will have a maximum at : following equation (7), the two - spin contribution will have a maximum at = 1/(n 1). for a biradical this yields maximum two - spin contribution at = 1 while for an eightfold labelled system this implies that an upper limit of exists if data is to be analysed by tr. it is important to note that equation (6) implies that the ratio between the desired two - spin contribution and the unwanted multi - spin contributions will increasingly favour the former upon the reduction of (for details see supporting information). however, the reduction of will result in reduced dipolar modulation, thus for the rigorous use of tr a compromise must be reached between a reasonable modulation depth, to provide a good modulation - to - noise ratio, but suppressing significant contribution from the unwanted multi - spin effects. the choice of the smallest suitable for data analysis using tr is not trivial. thus, one approach is to reduce the multi - spin correlations by a reduction of experimentally. in contrast to the tr as implemented in deeranalysis, which ignores multi - spin effects, the use of a structural model allows one to explicitly forward calculate data under retention of product terms and mutual orientations of distance vectors. in the following section in a reductionist approach we approximate the spin - label positions of quantitatively labelled, symmetric homo - oligomers of axis order n (n - mers) as being the vertex positions of the corresponding regular convex polygon (n - gon). spin distance vectors and their angular correlations are defined by n and the diameter (d) of the circle upon which the points sit. the inner angle of the polygon is defined by equation (8) : in combination with d, equation (8) uniquely defines the spin distances between all vertices : with r1i being the distance from the first vertex to the ith vertex. in a polygon of even n a set of n/2 1 distances r1i will be twofold degenerate while the longest distance (from position 1 to i = n/2 + 1) will be non - degenerate. in the case of odd n a set of (n 1)/2 distances r1i will be twofold degenerate. thus, only a total of n/2 or (n 1)/2 individual r1i distances for even or odd n, respectively, need to be considered. even though these well - defined distance ratios might be useful for restraining the distance distribution expected from the system under study, the implications of the model of regular convex n - gons go well beyond this. the orientations of the distance vectors and thus, their dipolar frequencies will be strongly correlated. in addition, n - gons with even n will have n/2 pairs of r12-vectors being parallel in space and several other similarly obvious correlations can be constructed. therefore, we chose here to explicitly calculate the vertex positions determining the distance vectors from those. this has the advantage of straightforward introduction of disorder into the model by simply displacing vertex positions. if, for convenience, we place the origin of the coordinate system on the symmetry axis within the plane of the n - gon and place the first vertex at the point [0, d/2 ] the two - dimensional coordinates of the vertex positions for the n vertices (vi) will be given by : the only two parameters defining the spin - label positions in equation (10) are n (via equation (8)) and d. this allows the straightforward calculation of the peldor time trace according to equation (3) retaining multi - spin effects and correlations between distance vectors. for the calculation of n - mers with n ranging from 3 to 8 the vertex positions have been calculated according to equation (10) and displaced in a random direction in the polygon plane to achieve a gaussian distribution of positions with a standard deviation that is given with the corresponding simulation. corresponding to pulse excitations achievable in nitroxide - labelled samples at x - band frequencies, has been set between 0.4 and 0.5 unless explicitly stated otherwise and d between 3 and 9 nm have been tested. a low pass filter previously found to improve simulations has been used to treat the limited excitation of large dipolar couplings during data fitting. to avoid (n 1) nested loops necessary for the calculation of the powder average of the polygon time trace via equation (3), we have chosen to perform monte carlo simulations allowing n random vertex displacements and a random orientation of the magnetic field vector in each trial. for simulations each time trace consists of 10,000 monte carlo trials while for fitting procedures 5000 trials were found to yield sufficient results for n up to 8. during all simulations the individual distances of the model were used for generating a true distance distribution. from this true distance distribution a second time trace has been calculated which deliberately neglects all multi - spin correlations for representation of the hypothetical case of irrelevant multi - spin effects. this latter trace has been scaled to match the modulation depth of the originally simulated time trace. visual inspection of the time trace, including multi - spin correlations and the artificial pair contribution trace already gives an estimate of the magnitude of deviations that is confirmed by calculating the rmsd (root mean square deviation) between distance distributions by tr and the all time traces underwent tr in deeranalysis2011 with the regularisation parameter chosen by the l - curve criterion. selected simulations and experimental peldor time traces obtained on a spin labelled mutant (s147c) of the mechanosensitive ion channel of small conductance (mscs) of e. coli have been fitted by constructing the vertex positions according to equation (10) and minimising the deviation between simulation and experiment (note that experiment in the first case means monte carlo simulation of a regular convex polygon). we refit the data with retention of the modulation depth information and parameters n,,, d applying the low - pass filter. we assume 100% efficiency of labelling where the multi - spin effects are most pronounced as the problem approximately scales with times labelling efficiency. a diameter of 5 nm was chosen for initial simulations and vertices were displaced to yield a standard deviation of 0.1 nm in the polygon plane. from these coordinates the time traces have been calculated according to equation (3) (denoted multi - spin trace). the actual distance distribution arising from these coordinates was calculated in real space (denoted true distribution). from this distance distribution a second time trace has been calculated neglecting all multi - spin terms of equation (3) prior to rescaling to meet the modulation depth governed by equation (4) (denoted as thus, the multi - spin trace contains all effects caused by the presence of multiple spins in one molecule, while the spin pairs trace has them eliminated. spin pairs trace is valid for analysis by tr and all deviations between distance distributions generated from the spin pairs and the multi - spin time traces are entirely due to multi - spin effects. an increasing loss of visible modulation in the multi - spin traces as compared to the spin pairs traces becomes evident when increasing n from equilateral triangle to octagon. while the multi - spin modulation merely seems damped for the triangle and square, low frequencies appear to vanish from the pentagon onwards. in the case of the octagon only a hump very early in the time trace is left while all other frequencies have been damped, nicely illustrating the extreme impact that multi - spin effects can have on the data analysis. simulations of symmetric multi - spin systems arranged as regular convex polygon from triangle to octagon with the polygon type depicted to the right. black traces explicitly treat all coupled spins via product formation, whereas grey traces are calculated neglecting multi - spin effects exclusively assuming spin pairs. distance domain data is shown to the right of the respective time trace ; the spin distance distribution resulting from polygon type and vertex displacement is depicted as black dotted lines. distance domain data by tr are depicted in black and grey in accordance with the respective time traces. vertices are displaced in plane with a standard deviation () of 0.1 nm. these qualitative findings are quantitatively confirmed when the data is inverted to the distance domain. multi - spin and spin pair traces to tr in deeranalysis to generate distance distributions that were superimposed with the the trend clearly shows that the deviations between true and spin pair only moderately increase with n. those between the true and the multi - spin distributions are already worse for the triangle and increase even more severely with n. this behaviour is also found by visual inspection (figure 1). while the triangular multi - spin simulations yield a set of low amplitude distance peaks which seem to be easily assigned artefacts or ghost peaks from data processing, the square and pentagon already display excessively broadened r12 distance peaks while r13 is diminished in amplitude. from hexagon to octagon the shortest distance obtained from the multi - spin simulation is significantly broadened and its mean at times slightly shifted while all other distances are diminished so far that they can not be recovered from the artefact peaks unequivocally. we attribute this to the fact that we have created a best - case scenario for tr. the main experimental uncertainties of thermal noise and background correction are absent from this data, as are errors arising from the truncation of time domain data (simulated data has a length of 6 s allowing us to observe a full modulation for distances of slightly over 6 nm). this emphasises even more the severity of the distortions of distance distributions obtained without due consideration of multi - spin effects. we have explored the influence of the size of the circumference for different orders of rotational symmetry. to resemble feasible experimental parameters we chose = 0.4 (instead of = 0.5 for the initial exploration in figure 1) for all following simulations and truncated the time traces at 5 s length. a lower limit on diameters d of 4 nm occurs because smaller polygons give rise to very short vectors (particularly for higher - order rotational axis) beyond the scope of peldor., we observe excellent agreement with data in figure 1, while smaller and larger polygons (d 7 nm, respectively) agree qualitatively (see supporting information). we suggest that the preservation of our central observation on the effect of multiple spins has eliminated polygon size, symmetry order or an unreasonably high as possible causes of the distortion. thus, the question arises whether the broadening of the shortest distance is significant in systems that already exhibit significantly broader distance peaks caused by structural heterogeneity. we constructed tests of different symmetry (n = 3 to 8) and a fixed diameter of 6 nm but with the vertices displaced randomly by standard deviations of 2%, 5% and 10% of the diameter (i.e. 0.12, 0.3 and 0.6 nm). figure 2 demonstrates that for the range of heterogeneities tested the multi - spin effects lead in all cases to detectable broadening of the distance distributions. the time domain data reveals that intrinsic broad distance distributions suffer less from these artefacts. however, in trying to extract the highest quality distance distributions, these results indicate that broadening by multi - spin effects can not be neglected even in the presence of broad intrinsic distributions. standard deviation of vertex displacement is (from top to bottom) 0.12, 0.3 and 0.6 nm, = 0.4, otherwise colours and order of panels is similar to figure 1. displacements the distance distributions obtained from the spin pair time trace increasingly deviate from the true distance distribution. this is tentatively attributed to the less pronounced modulation in the time trace in addition to slight truncation of dipolar modulations. it can be seen that the medium distance peak in these distributions splits and that the long distance peak is artificially narrowed, while the ratio of the integral distance peaks appears to remain constant. this seems to indicate per se limitations of tr of complex distance distributions and is currently under investigation. true distributions the deviations of the multi - spin distance distributions remain much more severe. in addition to substantial broadening of the short distance peak, the longer distances have lost most of their intensity making these distributions very unreliable to interpret. simulations of different vertex displacements in a heptagon system. for all other details see figure 2. these results clearly show that neglect of multi - spin effects leads to considerable distortion of distance distributions, especially in systems exceeding four spins. this makes analysis of longer distances especially those originating from higher - order vectors (r13, r14 etc.) some existing studies have focused only on the shorter r12 vectors, which are much less sensitive to these problems, but at the cost of throwing away information contained in the data [25, 26 ]. in an alternative approach to data analysis we have chosen to explicitly forward calculate our data based on the polygon model and to extract structural parameters by minimisation of the deviation between simulation and experiment. several initial tests have shown that the simultaneous fitting of several parameters was less stable, especially with increasing n. from the behaviour of the fit routine we detect multiple local minima, while the dampening of modulation in multi - spin simulations of heptagons and octagons suggests a very shallow global minimum. thus, we chose to approach the minimisation from initial simulations for achieving reasonable agreement by visual inspection and optimising d and iteratively or simultaneously from this starting point. as the function is defined by n, d,,, labelling degree and the low - pass filter for suppression of large dipolar frequencies, we emphasise here, that only the optimisations of d and have been tested. all other parameters are accessible from different experiments or assumptions and their optimisation is beyond the scope of this approach (attempts to minimise by calculation results in severely under - determined functions). in an initial test of the feasibility of the approach we have taken simulated data on an octagon with d = 6 nm, = 0.4 and varying standard deviation of vertex displacement of 0.12, 0.3 and 0.6 nm. the multi - spin traces of these simulations are fitted to the same mathematical model they were initially simulated with (although good agreement between the true distribution and its fit is expected it validates the approach). best fit results in figure 4 have been obtained by least square fitting of d and. monte carlo noise visible in true and fit distance distributions of larger have been found not to affect the fit stability, but can be reduced for cosmetic reasons by increasing the number of monte carlo trials. in all three cases the agreement of true distribution and its fit by far surpasses the quality of tr as judged by the eye. interestingly all three fits slightly underestimate d that we attribute to the effects of the truncation of the time trace which would under - penalise deviations in low frequencies caused by long distances and to the use of the low - pass filter suppressing of large dipolar frequencies during the fit. analysis of simulated data of an octagon with d = 6 nm, = 0.4 and varying standard deviation of vertex displacement of 0.12 (left), 0.3 (middle) and 0.6 nm (right). true distance distribution in black dots, fit in light grey and multi - spin tr in black solid lines (for details see the main text). for further demonstration of the usefulness of this approach we have subjected data obtained on a spin - labelled mutant (s147c) of the mscs of e. coli to this fitting procedure assuming the heptameric protein to have heptagonal symmetry. the results in figure 5 demonstrate a slightly worse agreement between time traces from the minimised heptagon model and the experiment compared to the time trace from tr. if, however, the distance domain data is examined the value of this new approach becomes evident immediately. even though we find a slight underestimation of the polygon diameter, as before, the distance distribution obtained by fitting a polygon model is by far closer to the rotamer model based on the crystal structure than the distance distribution obtained by tr, which neglects multi - spin correlations. an increased reliability in the extraction of multiple distances of rotationally symmetric homo - oligomers may prove valuable to identify multiple functional states present or to characterise structural flexibility. thus, we are convinced we have satisfactorily demonstrated the need and feasibility of alternative data analysis approaches for peldor measurements in spin - labelled homo - oligomers. time domain data is depicted in the left panel ; experimental data is given in as black dotted line, time trace based on tr as black solid line and time trace based on fit results as grey solid line. results from tr are given as black solid line, distance distribution from heptagon fit as grey solid line and modelling based on the crystal structure as black dotted line. in peldor measurements on systems with more than two spins multi - spin correlations arise that can hamper data analysis. for symmetric homo - oligomeric systems that can be approximated by regular convex polygons this results in a broadening of the distance distribution, an occasional shifting of distance peaks and a substantial loss of intensity of the distance peaks of all but the shortest distance. the approach of forward calculation of peldor data yields consistently superior results for model systems. crucially, and in contrast to the established methods, this new approach allows reliable extraction of all three non - degenerate distances from experimental data on a heptameric membrane protein. | nanometre distance measurements by pulsed electron electron double resonance (peldor) spectroscopy have become an increasingly important tool in structural biology. the theoretical underpinning of the experiment is well defined for systems containing two nitroxide spin - labels (spin pairs) ; however, recently experiments have been reported on homo - oligomeric membrane proteins consisting of up to eight spin - labelled monomers. we have explored the theory behind these systems by examining model systems based on multiple spins arranged in rotationally symmetric polygons. the results demonstrate that with a rising number of spins within the test molecule, increasingly strong distortions appear in distance distributions obtained from an analysis based on the simple spin pair approach. these distortions are significant over a range of system sizes and remain so even when random errors are introduced into the symmetry of the model. we present an alternative approach to the extraction of distances on such systems based on a minimisation that properly treats multi - spin correlations. we demonstrate the utility of this approach on a spin - labelled mutant of the heptameric mechanosensitive channel of small conductance of e. coli. |
meditation is one of the well - known practices which bestows increased attention and deep internal relaxation. since 1960s several researches have been performed to observe the effect of meditation in practitioners versus nonpractitioners. it is a meditation in which one obtains mastery over one 's unruly mind through objective observation of one 's own natural and normal breath. in pali literature, it is known as this practice of anapanasati meditation helps to sharpen the mind and to induce peace of mind to participants for the next step of vipasana meditation. vipassana means to observe things as they really are in their natural and true characteristics of impermanence. anapanasati meditation comes under the focused meditation category. in focused attention or concentrative styles of meditation, voluntary sustained attention is maintained on a given object, and attention is brought back to the object of attention when the mind wanders. though the subject (experiencer) and object co - exists independently, they interact. focused attention meditations when practiced over a prolonged period of time leads to effortless concentration. this automaticity results from long practice. the practice of anapanasati meditation is based upon the great discourse on the foundations of mindfulness (maha satipatthana sutta), which includes contemplation of the body, contemplation of feelings, contemplation of the mind, and contemplation of mental objects. the measurement of electrophotonic imaging (epi) is based on the electrical activity of the human organism. this activity is quite different in diseased condition of a human body as compared to the activity in a healthy body. the biophysical principles in the investigation of epi technique are based on the ideas of quantum biophysics. this method draws stimulated electrons and photons from the surface of the skin under the influence of a pulsed electromagnetic field. this process is well - studied through physical electronic methods and is known as photoelectron emission. it is important to note that this method of assessment is quite different from normal electrophysiological methods used in clinics, such as ekg and eeg. these terms are related to the electrical activity of the organs whereas epi parameters are a measure of induced electron availability in organs. the epi effect occurs when an object is placed on a glass plate and stimulated with the high - frequency high - voltage ; a visible glow occurs around the object, which is the gas discharge. this glow is quantifiable and reproducible for scientific research purposes. in a normal experiment, images captured from all 10 fingers provide detailed information about the person 's psychosomatic and physiological state. through investigation of the fingertip images, each captured fingertip image is analyzed through division into a number of sectors as per acupuncture meridian theory. the parameters related to the images captured under electrical stimulation create a neurovascular reaction of the skin, influenced by the nervous - humoral status of all organs and systems. a specialized software complex registers these readings into parameters that elucidate the person 's state of well - being at that time. it takes < 5 min to obtain the images of 10 fingers and around 1 min to calculate parameters of epi images, and < 5 min to display and interpret the results. epi measurement is done in two ways ; viz., with filter (physiological) and without filter (psycho - physiological). a filter is a thin plastic film placed between tip of the finger and a dielectric (glass) plate during test. the application of filter eliminates the sweat responses arising from sympathetic activities and gives only the response of parasympathetic activity. the quality and consistency of the fingertip images depend on the activity of the eccrine sweat glands when skin comes into contact with the surface of glass on electrophotonic impulse analyzer. these glands produce ionic sweat fluid that is associated with the activity of the sympathetic nervous system and determines the character of the discharge created around the fingertip. a gap in a sector of fingertip image is indicative of possible energy imbalance in the organ concerned. comparison of an electrophotonic image with filter (physiological) and without a filter (psycho - physiological) allows calculation of parameters having a high correlation with the level of stress in subjects. thus, the epi images without filter (psycho - physiological) reflect the person 's current psycho - physiological state and epi images with filter (physiological) reflect the body 's somatic energy level. type-2 images are produced from typically elderly people with unbalanced state of emotions at the psychosomatic and spiritual level. type-3 images are associated with serious problems at the physical level with permanent stress which may lead to distress. group-2 images are associated with severe health status ranging from different stages of diseases to mental problems. it was found to be the terminal stage of cancer or cases wherein no interaction taking place between the patient and the environment. electrophotonic imaging bioelectrographic systems have practical applications in several areas of research, such as medicine, sports, testing of liquids, water and materials. in epi measurements, the healthy individuals the average amplitude variations fall in the range 4.16.6% while in epi gram parameters of a metallic object, this range is 810%. thus, the electrophotonic emissions of the human body, referred to as epi - grams, are fairly consistent and allow one to identify the functional state in an individual in real time. though meditation techniques have been studied extensively, the subtle energy changes have not been investigated so far. the measurement of electrophotonic imaging (epi) is based on the electrical activity of the human organism. this activity is quite different in diseased condition of a human body as compared to the activity in a healthy body. the biophysical principles in the investigation of epi technique are based on the ideas of quantum biophysics. this method draws stimulated electrons and photons from the surface of the skin under the influence of a pulsed electromagnetic field. this process is well - studied through physical electronic methods and is known as photoelectron emission. it is important to note that this method of assessment is quite different from normal electrophysiological methods used in clinics, such as ekg and eeg. these terms are related to the electrical activity of the organs whereas epi parameters are a measure of induced electron availability in organs. the epi effect occurs when an object is placed on a glass plate and stimulated with the high - frequency high - voltage ; a visible glow occurs around the object, which is the gas discharge. this glow is quantifiable and reproducible for scientific research purposes. in a normal experiment, images captured from all 10 fingers provide detailed information about the person 's psychosomatic and physiological state. through investigation of the fingertip images, each captured fingertip image is analyzed through division into a number of sectors as per acupuncture meridian theory. the parameters related to the images captured under electrical stimulation create a neurovascular reaction of the skin, influenced by the nervous - humoral status of all organs and systems. a specialized software complex registers these readings into parameters that elucidate the person 's state of well - being at that time. it takes < 5 min to obtain the images of 10 fingers and around 1 min to calculate parameters of epi images, and < 5 min to display and interpret the results. a filter is a thin plastic film placed between tip of the finger and a dielectric (glass) plate during test. the application of filter eliminates the sweat responses arising from sympathetic activities and gives only the response of parasympathetic activity. the quality and consistency of the fingertip images depend on the activity of the eccrine sweat glands when skin comes into contact with the surface of glass on electrophotonic impulse analyzer. these glands produce ionic sweat fluid that is associated with the activity of the sympathetic nervous system and determines the character of the discharge created around the fingertip. a gap in a sector of fingertip image is indicative of possible energy imbalance in the organ concerned. comparison of an electrophotonic image with filter (physiological) and without a filter (psycho - physiological) allows calculation of parameters having a high correlation with the level of stress in subjects. thus, the epi images without filter (psycho - physiological) reflect the person 's current psycho - physiological state and epi images with filter (physiological) reflect the body 's somatic energy level type-2 images are produced from typically elderly people with unbalanced state of emotions at the psychosomatic and spiritual level. type-3 images are associated with serious problems at the physical level with permanent stress which may lead to distress. group-2 images are associated with severe health status ranging from different stages of diseases to mental problems. it was found to be the terminal stage of cancer or cases wherein no interaction taking place between the patient and the environment. electrophotonic imaging bioelectrographic systems have practical applications in several areas of research, such as medicine, sports, testing of liquids, water and materials. in epi measurements, the healthy individuals the average amplitude variations fall in the range 4.16.6% while in epi gram parameters of a metallic object, this range is 810%. thus, the electrophotonic emissions of the human body, referred to as epi - grams, are fairly consistent and allow one to identify the functional state in an individual in real time. though meditation techniques have been studied extensively, the subtle energy changes have not been investigated so far. to carry out this study, 64 volunteers were recruited from pyramid valley international, bengaluru, india, attending karnataka dhyana mahachakra-1. data of 13 subjects were excluded from the study after analyzing the finger image quality, sweat effect and outlier. integral area (ia) values range from (0.6 to + 1) which correspond to good health state. therefore, subjects who had values out of this range were excluded considering them as outliers. the remaining 51 subjects comprising 32 males and 19 females, age 18 years and above (mean age 45.64 14.43) were included for this study. they practiced meditation for 3 h 30 min daily for 5 days ; 2 h in the morning from 5 am to 7 am and in the evening from 7 pm to 8.30 pm consistently. the inclusion criteria were as follows : healthy volunteers, age range between 18 and 65 years, both genders and willing to participate in the trial. exclusion criteria consist of females during menstruation or during pregnancy, people with missing fingers or cut of fingers, subjects having smoked or taken alcohol on the day of measurement and people having any disease or on prescription drugs. demographic information was collected to know their self - reported health status, age, and earlier meditation experience. during pre- and post - data collection, nostril dominance was also registered to account for possible effects of hemispheric dominance during analysis. electrophotonic imaging - camera instrument produced by kirlionics technologies international, saint - petersburg, russia (gdv camera pro with analog video camera, model number : ftdi.13.6001.110310), along with r statistical packages (r development core team, 2012) were used to collect data and process for statistical analysis, respectively. parametric paired t - test was used where a level of p < 0.05 was considered as statistically significant. temperature and humidity were also measured (using a hygrometer - equinox, eq 310 cth) to account for the undue effect of atmospheric influence during pre- and post - data collection time. the recorded temperature during predata acquisition was 27.56 1.27 c, taken three times at 2 h intervals and during postdata collection, the mean was 33.83 0.47 c. fluctuation of humidity during predata acquisition was 0.69 0.1 and during post 0.35 0.02, measured in percent, three times at 2 h intervals. saint - petersburg, russia (gdv camera pro with analog video camera, model number : ftdi.13.6001.110310), along with r statistical packages (r development core team, 2012) were used to collect data and process for statistical analysis, respectively. parametric paired t - test was used where a level of p < 0.05 was considered as statistically significant. temperature and humidity were also measured (using a hygrometer - equinox, eq 310 cth) to account for the undue effect of atmospheric influence during pre- and post - data collection time. the recorded temperature during predata acquisition was 27.56 1.27 c, taken three times at 2 h intervals and during postdata collection, the mean was 33.83 0.47 c. fluctuation of humidity during predata acquisition was 0.69 0.1 and during post 0.35 0.02, measured in percent, three times at 2 h intervals. the present study showed significant changes in ia with filter (physiological) for both right (p = 0.002) and left - side (p = 0.004) of the body. the same decreasing trends were seen for without filter (psycho - physiological) but not significant. positive decrease was observed in activation coefficient (ac), but this was not statistically significant. integral entropy was reduced in without filter condition (psycho - physiological) only at the left - side showing less disorderliness in energy distribution in meditators. the increased change was observed in integral entropy in the left - side with filter (physiological). the values reduced in the right side with filter (physiological) and without filter (psycho - physiological) but these results were not statically significant. the influence of nostril dominance could not be found contributory to the results observed and hence brain hemispheric dominance effects are not considered important in these experiments. table 1 shows pre- and post - values of ac, ia and integral entropy in meditators with filter (physiological). table 2 shows pre- and post - values of ia and integral entropy in meditators without filter (psycho - physiological). pre- and post - values of activation coefficient, integral area and integral entropy in meditators (with filter) pre- and post - values of integral area and integral entropy in meditators (without filter) the effect of different meditation practices on various aspects of mental and physical health is receiving growing attention. though scientists have been investigating meditation for a long time, there has not been a consensus about its definition. diversity in the range of possible definitions reflects the vast number of different methods of meditation. western definitions emphasize that meditation is a self - regulatory technique focused on maintaining one 's attention. however, in the spiritual tradition, meditation is perceived as a tool for spiritual development, growth of inner peace, concentration, positive emotions such as selfless love and compassion, and reduction of negative emotions, such as fear and anger. it is envisioned that epi measurement technique could provide finer details of psycho - physiological states in meditators. the comparison with an electrophotonic image of a finger taken with and without plastic film filter allows calculation of parameters having a high correlation at the level of stress of the practitioner. it has been widely speculated that long - term meditation training has a significant positive impact on neuropsychological functioning in both cognitive and affective domains. comparison of psycho - diagnostic data demonstrates the correlation between indices of voluntary attention, logic, memory, and focused thinking with epi parameters of ac. there is an increasing amount of literature suggesting that there are many areas which could be influenced through the practice of meditation. the most commonly studied topics include physiological, psychiatric, and psychological conditions (e.g., anxiety, depression, quality of life, or impact on adl) or general medical conditions. the present study also observed a reduction in ac which is associated with organism 's involvement in stress adaptation ; a reduction in ac shows more relaxed state after anapanasati meditation. it also observed quieting of the sympathetic system and activation of parasympathetic system during meditation practice as indicated by a shift from sympathetic to parasympathetic resulting in a decrease in physiological variables like heart rate, respiratory rate, systolic blood pressure, and diastolic blood pressure. thus, meditation reduces stress - induced sympathetic over - activity by modifying the state of anxiety. ia is associated with overall health of organism with a normal range of 0.6 to + 1.0. however, it is likely reduction of ia observed in meditators could be due to reduced availability of electrons in the body. since radicals possess one unpaired electron, they are highly reactive and hence, may cause damage to cellular structures. the presence of excess free radicals in the body is not a sign of good health. moreover, meditation relaxes the subject and thereby decreases arterial tone, peripheral resistance, and metabolic rate. thus, it is also documented that free radical generation reduces due to meditation practice in response to reduced metabolic activities hence, reduction pattern without filter (psycho - physiological) on both right and left sides in ia shows the impact of meditation at the psycho - physiological level possibly due to reduced redox reaction and reduced metabolic rate. integral entropy indicates the functional state of cell, organ and the entire human body. decreased integral entropy without filter (on the left - side) in the study shows less chaos and disorderliness within the system in the subtle energy of meditators. the same trend was expected at other three measurements also, namely, with filter (physiological) right and left sides, and without filter (psycho - physiological) right side in integral entropy. the most possible reason regarding this unexpected change may be due to increased atmospheric temperature and fluctuation in humidity during postdata collection. another possible factor may be the feeling of discomfort at the physical level due to 5 days of intense sitting in meditation. the strength of this study can be summed up as follows : the trends in expected variables, possible use of epi parameters for meditators and paves the way for planning a good research design to observe the usage of epi parameters for detecting subtle mechanisms in meditators. limitations of this study were no control over confounding variables such as temperature, humidity, and no medical screening before recruitment of subject except demographic information. moreover, prior experience of meditation in some volunteers and long range of age were also limitations in the study. recommendations for future studies yet to be undertaken, should consider the following points : (a) for meditational studies, ac (stress parameter) and ia (health parameter) must be considered to get reliable outcome measures ; (b) to enhance internal validity in the studies, temperature, humidity, and persons diet intake must be taken care ; (c) similar studies must be undertaken to get repeatability following the same methodology. thus, this pilot study gives a substantial clue for a clear and systematic research design to produce scientific, evidence - based correlation regarding the mechanism in meditators, which could bring out more reliable interpretation of data to scientific community. it is likely that the introduction of epi bioelectrography into the mainstream medical practices could enrich and expand clinical assessment tools beyond those presently employed. thus, the result from this pilot study is very encouraging to come up with stronger and convincing results with a strong rationale. | background : mindfulness along with breathing is a well - established meditation technique. breathing is an exquisite tool for exploring subtle awareness of mind and life itself.aim:this study aimed at measuring changes in the different parameters of electrophotonic imaging (epi) in anapanasati meditators.materials and methods : to carry out this study, 51 subjects comprising 32 males and 19 females of age 18 years and above (mean age 45.64 14.43) were recruited voluntarily with informed consent attending karnataka dhyana mahachakra-1 at pyramid valley international, bengaluru, india. the design was a single group pre- post and data collected by epi device before and after 5 days of intensive meditation.results:results show significant changes in epi parameter integral area with filter (physiological) in both right and left side, which reflects the availability of high functional energy reserve in meditators. the researchers observed similar trends without filter (psycho - physiological) indicating high reserves of energy at psycho - physiological level also. activation coefficient, another parameter of epi, reduced showing more relaxed state than earlier, possibly due to parasympathetic dominance. integral entropy decreased in the case of psycho - physiological parameters left - side without filter, which indicates less disorder after meditation, but these changes were not significant. the study showed a reversed change in integral entropy in the right side without filter ; however, the values on both sides with filter increased, which indicates disorder.conclusion:the study suggests that epi can be used in the recording functional physiological and psychophysiological status of meditators at a subtle level. |
solid oxide fuel cells (sofcs) are very promising as a source for sustainable and renewable power generation. despite the efforts of researchers worldwide, a more detailed, atomic scale understanding of the elementary, interface controlled processes of sofcs is necessary to tailor their performance and lifetime. sofcs basic principle of operation is as follows : oxygen is reduced to o on the cathode side, and then oxygen ions are transported through the electrolyte to the anode side where they react with hydrogen from pure hydrogen or hydrocarbons to form water and release electrons, which travel back to the cathode side through the external circuit giving electrical power. conventional sofcs are operated at elevated temperatures (10001250 k) which results in higher costs of the cell and specific material requirements (durability, electrode / electrolyte interface stability). bottlenecks for the sofc operation are the cathodic oxygen exchange reaction on the surface of the electrode or the oxygen transport through the electrode / electrolyte interface. lowering operational temperatures while keeping a high ion transport rate is one of the key tasks in today s sofcs development. regarding the electrode material, perovskites are suitable candidates for intermediate temperature range (8001000 k) sofcs. the mixed ionic - electronic conductor la1xsrxcoo3 (lsc) is a promising cathode material, due to its high oxygen conductivity and fast oxygen surface kinetics. in order to independently investigate the cathode side of the fuel cell and to be able to deduce factors and parameters influencing sofc performance, conventional model systems usually consist of a perovskite thin film as an electrode deposited on yttria - stabilized zirconia (ysz) single crystals serving as electrolyte. a further microstructuring of the perovskite thin films has the advantage of a negligible effect of the counter electrode and thus no need for a reference electrode. sofc model electrodes are traditionally studied by electrochemical impedance spectroscopy (eis) and time - of - flight secondary ion mass spectrometry (tof - sims). eis delivers fingerprint type information on the underlying transport processes under operando conditions, whereas tof - sims is a destructive technique employed ex situ after the experiment to establish laterally resolved oxygen diffusion profiles via isotope labeling. in addition, state - of - the - art ambient pressure photoemission spectroscopy can reveal the chemical binding state of surface atoms under fuel cell operation conditions. despite recent progress made by the use of model microelectrodes, there is still a lack of knowledge on the atomic structure and chemical composition of buried electrode / electrolyte interfaces of such systems. at these interfaces oxygen incorporation or release takes place under transport conditions, which may be accompanied by a change of the interfacial cation composition, detrimental for transport properties of the interface. it is a challenge to obtain an atomic - scale picture during the processes occurring at the interface, because a nondestructive probe with high penetration power as well as high interfacial sensitivity is needed, which is compatible with the harsh operation conditions of atmospheric oxygen pressure and elevated temperatures. since the electrode is typically a few hundreds of nanometers thick, any charged probe such as electrons or ions disqualify for interface operando studies. here we apply anomalous surface x - ray diffraction (sxrd) using a microfocused x - ray beam to reveal the interfacial electrode / electrolyte atomic structure and chemical composition as a function of temperature, ambient pressure, and polarization under operation conditions. these challenging experiments allowed us to resolve the complete 3d interfacial structure and composition with subatomic resolution despite the presence of background scattering and fluorescence from the 200 nm thick lsc electrode and the ysz substrate. the structural information is contained in the so - called crystal truncation rods (ctrs), which are lines of diffracted intensity in reciprocal space arising from the abrupt termination of the polished ysz single crystal substrate. such atomic - scale crystallographic information on one particular interface in the sofc can serve as very important input into further modeling of the oxygen transport mechanism. at the moment, most of the information available under operando conditions stems from impedance measurements, which are determined by all the interfaces in the sofc. by including the details of one particular interface the transport models can be further refined leading to a better microscopic understanding. using synchrotron radiation the x - ray energy can be precisely tuned to the y and zr absorption edges, thereby varying the scattering contrast between the two elements and retrieving the layer - wise composition, disclosing information on the segregation profiles. in addition the synchrotron x - ray beam can be effectively focused down to the size of the microelectrode, thereby enabling to study the electrode / electrolyte interface and also the bare ysz surface by lateral sample translation. using highly intense x - rays from an undulator source makes a fast data acquisition possible, which is indispensible for such operando studies. previous anomalous sxrd experiments revealed that the bare and clean ysz(111) surface in ultrahigh vacuum (uhv) exhibits an y enrichment under reducing conditions and high temperature annealing. to mimic the transport processes in a real fuel cell, we polarized the cathode microelectrode with respect to a porous pt counter electrode below the single crystal ysz(100) electrolyte under oxygen atmosphere at elevated temperatures, allowing controlled inward and outward oxygen ion transport. the cathode consists of a polycrystalline complex oxide electrode in contact with a single crystal electrolyte, a situation which is representative for a real sofc. our results disclose an operation condition dependent variation in the interfacial structure, y composition and cation vacancy concentration as compared to bulk ysz. such nonstochiometry is expected to have strong impact upon the interfacial oxygen ion conductivity. for comparison, a free part of the ysz(100) surface was investigated, which exhibits compositions and relaxations that do not depend on the oxygen pressure and external voltage. two samples were subjects of our study : the first was a cathode model system consisting of a la0.6sr0.4co3 (lsc) microelectrode on an yttria - stabilized zirconia (ysz) single crystal (9.5 mol % of y2o3) in (100) orientation and miscut of < 0.1. the second was a pristine (100) ysz single crystal with identical specifications from the same manufacturer. measurements on the clean ysz(100) substrate are compared with those taken from the bare part beside the microelectrode from the first sample. a 200 nm thin lsc film was deposited on the ysz(100) substrate by pulsed laser deposition (pld) at 900 k and 0.04 mbar o2 pressure followed by wet chemical etching with 0.1 mol / l hcl in deionized water to prepare a squared 400 400 m microelectrode. the well - defined geometry of the electrode facilitated the interpretation of impedance spectroscopy measurements performed before and after the experiment demonstrating that electrode survived the x - ray experiment without significant beam damage. the sample with lsc microelectrode on top was studied at the european synchrotron radiation facility (esrf), beamline id03, by means of anomalous sxrd at the y and zr k - edges under controlled oxygen environment and temperature, as well as applied bias voltage, in a dedicated mobile vacuum chamber for combined solid state electrochemistry the experiment was performed in z axis diffraction mode with fixed incidence angle, allowing to keep the beam footprint on the sample surface constant. by convention, a unit cell is chosen whereby the reciprocal (continuous) l direction is parallel to the surface normal and therfore along the ctr directions. the in - plane lattice parameters span the surface and determine the (integer) diffraction indices (h, k) of each ctr. diffraction data are collected by obtaining integrated intensities at several (h, k, l) positions in reciprocal space and extracting structure factors f(hkl), which can be compared with calculated ones stemming from model structures. the chamber is equipped with a turbo molecular pump, which is supported by an external pre - pump to allow ultrahigh vacuum conditions, with a ceramic heater (sample temperature up to 1100 k), leak valves for controlled gas dosing, and two pressure gauges for vacuum and elevated pressure ranges, a piezo translation stage to position a contact tip, an optical microscope to locate the electrodes, and an x - ray transparent beryllium window. platinum paste was brushed on the back side of the ysz single crystal and served as counter - electrode for the electrical measurements. anomalous sxrd data sets were collected by measuring crystal truncation rods (ctrs) at the k - edge energies of y and zr, respectively (17.038 and 17.998 kev), using a 2d detector in stationary mode. the graphite analyzer in front of the detector allowed an efficient fluorescence background suppression. when the beam energy is tuned to one of the absorption edges, the real part of the atomic form factor of the corresponding atoms (in addition, the imaginary part of the complex atomic scattering factor increases due to absorption processes.) exploiting this anomalous diffraction effect allows us to distinguish between y and zr, which have almost identical atomic form factors at x - ray energies away from their absorption edges. by including data measured at several x - ray energies in the structure refinement, it is possible to determine the individual compositions with a higher accuracy. the ysz crystal with lsc microelectrode on top and the brushed pt as a counter - electrode at the bottom are placed on a heating stage. the tip is attached to a piezo - electric translation stage, which is positioned on the upper part of the chamber. tip and counter - electrode can be connected to the impedance analyzer and a power source via feedthroughs of the vacuum chamber. a ge fluorescence detector was placed at 90 to the x - ray beam in the horizontal plane in order to minimize elastic scattering. an analyzer (graphite (0001) crystal) was put in signal path to suppress the fluorescence background. (a) fluorescence spectrum from a sample area without the electrode ; (b) fluorescence spectrum from a sample area with the electrode ; (c) an image of ctr signal together with a region of interest (roi)yellow box. in order to illuminate only the area underneath one electrode, baez (kb) optics resulting in a beam size of 5.5 m (vertical) and 5.7 m (horizontal). such a small beam cross section ensures that its footprint at the incident angle of 0.9 was slightly smaller than the electrode size (400 400 m). the beam stayed on the same spot of the electrode throughout the measurements involving sample rotation which was verified by tracking the sr fluorescence signal from the lsc electrode with an energy - dispersive ge detector placed perpendicular to the direction of the primary beam ; see figure 1. the electrode was first characterized under reducing conditions, and then we used a step - by - step approach to reach operando conditions, while recording crystal truncation rod data at each step to follow the buried interface evolution. an extensive set of ctrs was taken at five different conditions (altogether, 1216 structure factors for both energies) : reducing condition (p = 1.0 10 mbar, 300 and 775 k), oxidizing conditions (p(o2) = 18 mbar, 775 k) and operational conditions (p(o2) = 18 mbar, 775 k, 500 mv and + 250 mv). the measurements under reducing conditions and cathodic bias were thus close to the thermodynamic stability limit of lsc, i.e., (surface) phase decomposition. during cathodic and anodic polarization the electrical current through the electrode was monitored confirming that the model fuel cell was operating. the bare single crystal ysz(100) reference sample was studied at the max planck beamline at the ngstrm - quelle karlsruhe (anka) by sxrd at 10 kev photon energy under uhv conditions after annealing at 700 k in oxygen atmosphere (p(o2) = 1.0 10 mbar) for 120 min. a special version of rod was used, featuring the possibility to refine anomalous ctr data sets taken at different energies at the same time. an overview of the sxrd experiments from the lsc / ysz(100) interface is given in figure 2, which represents the ctr data (open circles) measured at three different conditions (p = 1.0 10 mbar, 775 k ; p(o2) = 18 mbar, 775 k ; p(o2) = 18 mbar, 500 mv) and the fits (solid lines). (additional data obtained for other conditions and for the free ysz(100) surface in between the microelectrodes is shown in the supporting information. also shown are the results obtained for the clean ysz(100) surface in uhv.) significant changes in the ctr signals for the different conditions are discernible, related to structural changes at the interface as uncovered by the fit to the data and discussed in the following. we used the idealized structure model of caf2 type, fm3m space group, where y and zr are placed statistically on bulk positions according to the nominal formula y0.174zr0.826o0.193 and a cubic lattice constant of a = 5.145 deduced from the experiment. note that the lsc films do not contribute to the ctr signal because they exhibit a polycrystalline structure. ysz, with its complex defect structure, can also be described by an elaborate so - called zr - shift model, but, as discussed previously in ref (8), a simple zirconia fluorite model is sufficient to describe x - ray data taken at momentum transfers covered in our experiment. ctr data from the electrode / electrolyte interface and fits for three different conditions : 300 k, p = 1.0 10 mbar (blue line) ; 775 k, p(o2) = 18 mbar (green line), 775 k, p(o2) = 18 mbar, u = 500 mv (red line). one data set consists of eight ctrs four taken at zr k - edge (a), and the other four taken at y k - edge (b). all eight ctrs taken under each particular condition are fitted simultaneously. on the (1, 1) rod the signal was cut by one of the supporting steel rods of the be window. as a starting model for the electrode - covered as well as the free ysz(100) surface an oxygen termination was chosen. the ysz crystal structure is polar along its 100 direction due to the alternating stacking of oxygen and metal ion layers (see figure 3a). at the lsc / ysz interface charge compensation to overcome the diverging dipole moment can take place via bonding to atoms from the lsc layer. during our operando studies the free part of the sample surface is likely to be partially hydroxylated, which can also stabilize the surface. when in vacuum, such intrinsically unstable polar surfaces are known to commonly show reconstructions, in order to decrease their otherwise very high surface energy. based on the results from a low energy ion scattering study the surface oxygen atoms are reported to occupy nonbulk positions, situated at metal bridge sites above metal ions from the second metal layer below the surface. density functional theory calculations support the experimentally obtained (1 1) surface reconstruction but only together with y segregation. however, our uhv data taken after annealing up to 750 k do not allow us to make a clear distinction between a bulk oxygen - terminated or the proposed (1 1) model. in any case all our fit results do indicate a surface morphology composed of nanoscaled islands of uniform well - defined 0.25 nm height, almost identical to what was found for the ysz(111) surface. (a) side view of the first three atomic layers (i, ii, iii) and the lsc film placed on the oxygen (red spheres) terminated ysz surface. yttrium atoms (green spheres) are randomly placed on zirconium (blue spheres) sites within the lattice. (b f) : chemically resolved occupancy profiles of the first three atomic bilayers of ysz(100) below the lsc electrode for the conditions indicated, where the third layer represents bulk values as a reference and the first and second layer occupancies were fitted. (g) reference profile for a bare ysz(100) surface area far away from the electrode. atomic site occupancies (), displacements (), and debye waller factors (b) are those three structural parameters refined within our model. three parameters (,, b) were varied in the first atomic layer, only two (, b) are used for the second atomic layer, from the third layer on all the parameters are fixed to the bulk ysz values of the ideal fluorite model taken from ref (14) (see figure 3 and table 1). the refinement also included physically acceptable limits for each parameter used in the fit. since the scattering contribution of oxygen is significantly weaker as compared to zirconium and yttrium, the oxygen occupancy parameters were fixed with respect to those of y and zr atoms according to chemical formulas y2o3 and zro2. by doing this we restrain the oxygen occupancy parameter and assume electroneutrality. to reduce the number of parameters waller parameter and displacement parameter was used for y and zr atoms within one atomic layer. waller factors with lower limits and starting values for all atom types were equal to the corresponding bulk values. refining three atomic layers and values in brackets stand for the estimated standard deviations (e.s.d.) from the fitting procedure. the atomic - layer - resolved chemical profiles at the lsc / ysz interface were obtained, as summarized in figure 3. first, under oxygen poor conditions (p = 10 mbar, 300 k) we find that the first atomic layer has a composition y0.5zr0.5, while the second layer is already close to the bulk chemical composition, indicating a strong y segregation in the as prepared sample. to the best of our knowledge the strong y segregation to the top of ysz layer presumably took place during pld deposition of the lsc layer at 900 k and 0.04 mbar o2 pressure. y segregation under reducing conditions is in accordance with measurements and ab inito thermodynamics calculations on free ysz surfaces, while the exact level of y is most likely also affected by the lsc layer on top. in comparison the free ysz surface several millimeters away from the electrode shows a topmost layer consisting of uniform islands, which is seen in the total coverage of about 70%. furthermore, these islands as well as the second layer beneath them are depleted in y, and the trend is that under more oxidizing conditions y starts to segregate to the near - surface region (see supporting information). although this trend is observed, the total y concentration is very close to the error bar and presumably the near - surface composition hardly changes. the island structure and coverage agree very well with the results from the uhv prepared ysz(100) surface (see supporting information). the presence of islands, which can be interpreted as clustering of atomic vacancies, may contribute to the polarity compensation of the ysz(100) surface. the high y occupancy in the top ysz layer at the electrode / electrolyte interface remains present at 775 k under reducing conditions (p = 1.0 10 mbar), while around 10% cation vacancies (likely together with oxygen vacancies) are formed. when switching to oxidizing conditions (p(o2) = 18 mbar) at 775 k the cation occupancy strongly changes. much less y is observed in the first atomic layer, while an increase in zr concentration is present and the cation vacancy concentration becomes more substantial. this clearly indicates that cations in ysz are mobile even at such comparatively low temperatures. a similar analysis carried out on the electrode material would be desirable and in principle possible if single crystal epitaxial lsc films were used. measurements upon applied voltage between the tip and the sample to mimic the oxygen reduction reaction (orr) (500 mv) and the reversed process (+ 250 mv) again indicate that the ysz / lsc interface is highly dynamic (figure 3e, f). at 500 mv voltage the y / zr composition at the interface is similar to the conditions from before without voltage applied, whereas at + 250 mv the interface becomes enriched in y. this might be a consequence of the oxygen chemical potential changes in lsc upon positive voltage : owing to the slow kinetics of the electrochemcial surface reaction (here release of oxygen) the main chemical potential drop is at the surface, particularly upon cathodic voltage but also for moderate positive bias. hence, positive bias voltage leads to an increase of the chemical potential in lsc and thus significantly lowers the oxygen vacancy concentration in lsc. provided that oxygen transport across the lcs / ysz interface is still close to equilibrium, this concentration change in lsc has to be counterbalanced by an electrostatic potential step (nernst s equation) with positive charges in lsc and negative ones in ysz. a possible mechanism for the substrate could be played by y ions on zr sites. in such a case an electroneutral calculation of the oxygen vacancy concentration in ysz is no longer possible. we argue this is due to the fact that oxygen diffusion is faster in lsc than in ysz, resulting in net reduction of the interface, which leads to a y enrichment. this might be related to a reduced oxygen concentration at the lsc / ysz interface under positive potential, due to the fact that the amount of oxygen vacancies in ysz is directly related to the yttria concentration. discussing the obtained cation concentrations in a more crude way as interfacial stoichiometry changes lead to the following considerations. it is known that optimum doping level for oxygen conduction in ysz is close to that found in the substrate. this means that as soon as the interfacial region deviates from this composition, it can be expected that the interface forms an additional diffusion barrier. according to our observation, the ysz interfacial cation stoichiometry is almost identical to that of the bulk for negative bias. indeed, impedance spectroscopy of the related (la, sr) (co, fe)o system has shown that there is a clear trend of the electrode / electrolyte interface resistance and capacitance increasing when going from negative to positive bias voltage. the results presented here suggest that part of this trend can be explained by the near - surface stoichiometry changes and show that the method presented here can be used to give very detailed microscopic information on the origin of certain properties found in sofcs. one important conclusion concerning the long - term stabililty of sofcs at the maximum investigate temperature of 775 k is that the lsc / ysz(100) smooth interface morphology is found to stay unaltered under oxygen transport conditions. it has been reported that, at higher temperatures above 970 k, new phases like srzro3 can form which we did not observe in our experiments. further evidence for the discussed y segregation behavior comes from a close investigation of the interfacial relaxations. the first and second ysz substrate metal ion layer directly at the electrolyte / electrode interface exhibits outward relaxations which may also partially be explained by the chemical bonding of the outermost oxygen layer to atoms from the lsc electrode (see table 1). in contrast, the first metal ion layer at the free surface far away from the electrode shows slight inward relaxations for all conditions investigated, followed by the second layer with small outward relaxations, in agreement with the uhv prepared ysz(100) surface (see also supporting information). to obtain more insight into the correlation of structural and chemical changes at the interface, it is instructive to compare the y / zr ratio and the interfacial relaxations as a function of the experimental conditions, as plotted in figure 4. interestingly, there is a clear trend visible : for higher y / zr ratios, the outward relaxations are more pronounced. this is inline with the increased ionic radius of y of 1.02 as compared to 0.84 for zr, giving additional evidence for the observed y segregation. finally, the isotropic debye waller parameters, which were refined for below the electrode data only, exhibit enhanced values compared to the bulk likely because of some local distortions at the interface. here no systematic trend is discernible, which may be related to the high error bars for the debye y / zr ratio (left y axis) and interfacial cation out - of - plane relaxations (right y axis) for different experimental conditions. in our study we demonstrated that anomalous sxrd can resolve the chemical composition of deeply buried interfaces of sofc model systems under operational conditions with atomic resolution. the presented investigation of a polycrystalline lsc model microelectrode on a ysz(100) substrate showed that the y cation occupancy at the electrode / electrolyte interface strongly depends on the sample environment and the applied potential. the interface was found to be y rich after lsc film deposition ; subsequent exposure to oxygen in the mbar pressure regime at 775 k strongly reduced the y concentration at the interface, which is traced back to the complex defect chemistry and thermodynamics of lsc in contact with ysz. upon bias voltage application further changes are observed, indicating enhanced y concentration at the interface for positive bias which is expected to be detrimental for the oxygen ion transport through the interface. the y segregation behavior is supported by outward cation interfacial relaxation which correlates with the amount of y at the interface. the lsc / ysz(100) interface is found to stay atomically smooth under oxygen transport conditions. reference measurements from a bare ysz(100) surface area indicate stable surface composition and relaxations. the observed interfacial defects and variation from bulk stochiometry for different conditions calls for further theoretical investigations to disentangle their role for the rate limitation of the oxygen reduction reaction. future experiments on epitaxial electrode layers will allow the additional investigation of the gas phase / electrode interface under oxygen incorporation or removal conditions. | we employed operando anomalous surface x - ray diffraction to investigate the buried interface between the cathode and the electrolyte of a model solid oxide fuel cell with atomic resolution. the cell was studied under different oxygen pressures at elevated temperatures and polarizations by external potential control. making use of anomalous x - ray diffraction effects at the y and zr k - edges allowed us to resolve the interfacial structure and chemical composition of a (100)-oriented, 9.5 mol % yttria - stabilized zirconia (ysz) single crystal electrolyte below a la0.6sr0.4coo3 (lsc) electrode. we observe yttrium segregation toward the ysz / lsc electrolyte / electrode interface under reducing conditions. under oxidizing conditions, the interface becomes y depleted. the yttrium segregation is corroborated by an enhanced outward relaxation of the ysz interfacial metal ion layer. at the same time, an increase in point defect concentration in the electrolyte at the interface was observed, as evidenced by reduced ysz crystallographic site occupancies for the cations as well as the oxygen ions. such changes in composition are expected to strongly influence the oxygen ion transport through this interface which plays an important role for the performance of solid oxide fuel cells. the structure of the interface is compared to the bare ysz(100) surface structure near the microelectrode under identical conditions and to the structure of the ysz(100) surface prepared under ultrahigh vacuum conditions. |
following the first report of 2009 pandemic influenza a (h1n1 ; hereafter referred to h1n1 2009) in april 2009, the infection became a pandemic. the drugs of choice for the treatment and prophylaxis of h1n1 2009 are neuraminidase inhibitors including oseltamivir (tamiflu [roche ]) and zanamivir (relenza [glaxosmithkline ]). however, increasing use of oseltamivir has led to the emergence of the oseltamivir - resistant h1n1 2009 virus, which harbors an h274/275y or i223v neuraminidase mutation. as of 9 february 2011, 370 cases of oseltamivir - resistant h1n1 2009 infection had been reported to the world health organization.1 it has been suggested that oseltamivir - resistant seasonal influenza or h1n1 2009 harboring the h274/275y mutation is less virulent than are strains that are oseltamivir - sensitive.2 - 4 for this reason, fatal infections by these resistant viruses are rarely reported,5 - 7 although fatalities have occurred in severely immunocompromised patients with hematologic disorders or cancer with prolonged viral shedding despite oseltamivir therapy. some adult cases of oseltamivir - resistant h1n1 2009 have also been reported in korea ; however, these were not fatal despite the presence of prolonged viral shedding.8,9 here, we report a rapidly fatal case of oseltamivir - resistant h1n1 2009 in an adult patient in korea. a 60-year - old male korean visited chonnam national university hospital because of chest pain and shortness of breath for 7 days. the patient had hypertension and the patient had end - stage renal disease and had been receiving hemodialysis for 2 years. the patient also had dilated cardiomyopathy ; his cardiac ejection fraction was 36% with global hypokinesia, and the end - diastolic and end - systolic diameters of the left ventricle were 65 mm and 54 mm, respectively, on echocardiography. the patient began empiric therapy with oseltamivir (75 mg twice per day) within 24 h of the development of symptoms, which was prescribed at a local clinic. other examination findings were a blood pressure of 120/80 mmhg, pulse rate of 63 beats / min, respiratory rate of 20/min, and body temperature of 36. crackle was present in both lower lung fields on chest auscultation. the initial laboratory examination revealed a white blood cell count of 15,400/mm, a hemoglobin level of 10.1 g / dl, and a platelet count of 141,000/mm. his c - reactive protein level was 8.6 mg / dl. on initial arterial blood analysis, the values of ph, pao2, paco2, and bicarbonate ions were 7.365, 49.0 mmhg, 33.3 mmhg, and 18.6 mmol / l, respectively. cardiomegaly and pulmonary infiltration in the right lower, right middle, and left lower lobes were observed on chest radiography and computed tomography (fig. the acute physiology and chronic health evaluation (apache) ii score and pneumonia severity index of the patient upon presentation were 26 and 151, respectively. after blood and sputum sampling for respiratory virus analysis, reverse - transcriptase polymerase chain reaction (rt - pcr) and bacterial culture, empirical intravenous antibiotic therapy with ceftriaxone and clindamycin was initiated. on the second day of hospitalization, sputum rt - pcr for h1n1 2009 was performed on hospital days one and three. on the fourth day of hospitalization, sputum rt - pcr for h1n1 2009 from a specimen acquired on hospital day the apache ii score and pneumonia severity index of the patient were aggravated to 37 and 191, respectively. the patient was isolated and began to receive a double dose of oseltamivir therapy (150 mg twice per day). the initial antibiotics were changed to ceftriaxone and levofloxacin. despite administration of oseltamivir and antibiotics, mechanical ventilation, inotropics, and continuous renal replacement therapy, the patient 's pneumonia worsened and led to multi - organ failure. the patient died on the sixth day of hospitalization, despite 3 days of antiviral therapy and 6 days of antibacterial therapy. sequence analysis performed at the korea centers for disease control and prevention revealed an h275y neuraminidase gene mutation, as described elsewhere.10 we have presented the case of a 60-year - old korean male patient who was infected with oseltamivir - resistant h1n1 2009, which proved lethal. oseltamivir - resistant h1n1 2009 was first reported in september 2009, and the number of cases has been steadily increasing, including in south korea.1,10 although the incidence of oseltamivir - resistant h1n1 2009 infections is increasing, fatal cases have been reported only rarely. in south korea, the present case shows some differences in clinical characteristics compared to previously reported fatal cases. first, unlike our case, most fatal cases of oseltamivir - resistant virus infection have occurred in patients with severe immunosuppression associated with hematologic disorders or cancer.5 - 7 second, the clinical course of oseltamivir - resistant virus infection is usually insidious despite inappropriate antiviral therapy, because the virulence of oseltamivir - resistant influenza virus is thought to be lower than that of oseltamivir - sensitive viruses.8,9 animal studies have suggested that oseltamivir - resistant h1n1 2009, as well as seasonal influenza, is less virulent and less transmissible than oseltamivir - sensitive viruses. in the present case, however, although the infection was caused by oseltamivir - resistant virus, pneumonia progressed rapidly and led to death. this suggests that some clone of oseltamivir - resistant h1n1 2009 is sufficiently virulent to cause rapidly fatal pneumonia. third, most cases of oseltamivir - resistant virus infections have occurred in patients who had undergone prolonged oseltamivir therapy.5 - 9 the present patient was treated short - term with oseltamivir before acquisition of oseltamivir resistance. this highlights that oseltamivir resistance after short - term drug exposure is also possible, and that the use of zanamivir should be considered in patients with clinical deterioration, despite oseltamivir therapy. | it has been suggested that oseltamivir - resistant influenza viruses harboring the h274/275y mutation are less virulent than are those that are oseltamivir - sensitive, and fatality attributed to infection with an oseltamivir - resistant virus is very rare. here we report the first fatal adult case of oseltamivir - resistant 2009 pandemic influenza a (h1n1) in korea. a 60-year - old korean male who had hypertension, diabetes mellitus, chronic kidney disease, and dilated cardiomyopathy visited chonnam national university hospital because of a 7-day history of chest pain and dyspnea. the patient was at another clinic and had been medicated with oseltamivir (75 mg twice daily) beginning 7 days before admission. empirical antibiotics were started on the first day of hospitalization. reverse - transcriptase polymerase chain reaction for 2009 pandemic influenza a (h1n1) was reported to be positive, and a double dose of oseltamivir (150 mg twice per day) was started on day four of hospitalization. however, the pneumonia worsened and the patient died, despite 3 days of high - dose antiviral therapy and 6 days of antibacterial therapy. an h275y mutation was detected in the neuraminidase gene sequence. this case shows that oseltamivir resistance after short - term drug exposure is possible and can be fatal, emphasizing that early use of zanamivir should be considered in suspicious cases. |
obstructive sleep apnea syndrome (osas) is a highly prevalent disorder affecting about 4% of adults, and is associated with repetitive episodes of transient oxygen desaturation during sleep. osas is an independent risk factor for a number of cardiovascular diseases [24 ]. although uppp expands pharyngeal cavity and improves upper respiratory tract obstruction, it is often complicated by edema, strictures, bleeding, increased hypopharyngeal secretions, and decreased pharyngeal airway - protective reflexes. therefore, patients are prone to have airway re - obstruction and apnea during recovery from anesthesia. adequate sedation is important in the post - anesthesia care unit (pacu) following uppp to ensure patient comfort and decrease the duration of mechanical ventilation (mv), pacu stay, and bleeding. the anesthetic propofol is commonly used in the icu for sedation of the ventilated postsurgical patient. however, propofol sedation may also cause respiratory depression, which may be accentuated by the concurrent use of opioids. dexmedetomidine is a highly specific alpha-2-adrenergic receptor agonist that possesses sedative, anxiolytic, and analgesic effects. at clinically effective doses, continuous sedation with intravenous dexmedetomidine does not interfere with the normal course of ventilator weaning and extubation because it does not depress respiratory drive or decrease arterial oxygen saturation. the aim of this study was to retrospectively compare the effects of dexmedetomidine versus propofol as sedatives following uppp in the pacu. after approval of the ethics committee of the general hospital of shenyang military region (china), a total of 150 patients undergoing uppp and recovering from general anesthesia were studied. all subjects were diagnosed with osas based on symptoms such as heavy and loud snoring, witnessed apneas, and/or daytime sleepiness and choking during sleep. each subject underwent clinical assessment, testing for complete blood count, liver and kidney function, and cardiac enzymes. the patients were considered ineligible if they had unstable angina or acute myocardial infarction in the last 30 days, uncontrolled diabetes, morbid obesity (bmi > 40), ejection fraction below 30%, or were treated with neuromuscular blocking agents. patients were also excluded if they had a history of alcohol or drug abuse or their neurologic condition was difficult to evaluate. patients in the propofol group (n=61) received an infusion of propofol (3 mg / kg / hr), which was titrated up to a maximum of 6 mg / kg / h until they were adequately sedated (ramsay sedation score 4). patients in the dexmedetomidine group (n=63) received 1.0 g / kg of dexmedetomidine over a 10-min period and then 0.5 to 1.0 g / kg / h infusion to maintain a ramsay sedation score 4. if a dexmedetomidine - sedated patient could not be maintained within the desired sedation range and the infusion rate was already at the recommended maximum of 1.0 g / kg / h, the patient received intravenous injection of propofol (3 mg / kg / hr) until ramsay sedation score was at least 4. tramadol (1 mg / kg) was allowed for pain relief in both groups. staff determined the need for tramadol depending upon the signs of pain [e.g., sweating, increased blood pressure, and elevated heart rate (hr) ] before extubation or when the score was no more than 2 on the bruggemann comfort scale (bcs) assessed 10 min after extubation by direct communication with the patient. intraoperative anesthetics, narcotics, and other medications were standardized by the department of anesthesiology by induction with propofol 2 mg / kg in combination with midazolam 2 mg, sufentanil 0.5 g / kg, and rocuronium bromide 0.8 mg / kg. anesthesia was maintained with propofol (38 mg / kg / h) and remifentanil (315 g / kg / h) administered with an infusion pump, and 0.52.5% sevoflurane administered by vaporization. blood pressure and heart rate (hr) were maintained within 20% of awake values. propofol, remifentanil, and sevoflurane were stopped when the patients were transferred to the pacu after the operation. in the pacu, mechanical ventilation was stopped when end - tidal (et) anaesthetic concentration dropped to 0.2%. respiration was then manually assisted until recovery of spontaneous breathing (tidal volume > 6 ml / kg). each patient was given 5 l / min of oxygen via oxygen insufflation after recovery of adequate spontaneous ventilation, followed by 2 l / min oxygen through a nasal cannula after extubation. a patient was considered ready for extubation if awake or arousable, cooperative and comfortable, and if fraction of inspiration o2 (fio2) was less than 0.4 and blood oxygen saturation (spo2) exceeded 96%. in addition, the partial pressure of o2 in arterial blood (pao2) should be over 80 mmhg, partial pressure of carbon dioxide in the blood (paco2) below 50 mmhg, tidal volume greater than 6 ml / kg, spontaneous respiratory rate lower than 25/min, with steady circulatory function and no hemorrhagic secretions observed in the upper respiratory tract. patients with a modified aldrete score between 9 and 10 were transferred to the ward. the electrocardiogram, hr, noninvasive systolic and diastolic arterial blood pressures, spo2, respiratory rate, bis (bis xp 3.4 monitor, aspect medical systems, newton, ma) were recorded preoperatively (t0), when sedation was initiated (t1), and at the following timepoints : 30 min after dexmedetomidine or propofol initiation (t2), extubation (t3), 10 min after extubation (t4), and at discharge from the pacu (t5). time to extubation : defined as the time interval between stopping dexmedetomidine or propofol and the fulfillment of extubation criteria. ramsay sedation scores were assessed at t2 and rass agitation scores (rass) were assessed at t3. at t3, if rass score was at least 3 points, the patients were treated with analgesics (tramadol) and sedatives (dexmedetomidine or / and propofol with an infusion pump). if rass score was at least 3, the sedation was continued as before until rass score was 2 or less. if rass score was 2 or less, sedatives were discontinued and the patients regained consciousness gradually. cough responses during extubation were scored as 1=no incidence of cough ; 2=smooth extubation, slight coughing (1~2 coughs) ; 3=moderate coughing (3~4 coughs) ; 4=severe or repetitive coughing (5~10 coughs) ; 5=patient discomfort, poor extubation (> 10 severe coughs). bcs : 0=continuous pain ; 1=no pain without movement, but serious pain when breathing deeply or coughing ; 2=no pain without movement, but mild pain when breathing deeply or coughing ; 3=no pain, even when breathing deeply ; and 4=no pain when coughing). potential adverse drug reactions were noted during pacu : bradycardia (hr 100 bpm), hypotension [mean arterial pressure (map) was less than 30% of the baseline ], hypertension (map was more than 30% of the baseline), respiratory depression (respiratory rate 8 bpm or spo2 90% for a duration exceeding 5 min), glossoptosis, nausea or vomiting, rigors, and bleeding. statistical analysis was performed using a commercial software package (spss 17.0, chicago, il). this sample size for the study was based on tramadol consumption in the pacu after uppp surgery, assuming a requirement of rescue tramadol 0.72 (sd0.23) mg / kg with dexmedetomidine - ketamine - based anesthesia. to detect a 30% reduction in tramadol requirements in the pacu after surgery, 60 subjects per treatment group would be needed for a study with an alpha level of 0.05 and a beta level of 0.2 (80% power). continuous variables with a normal distribution are reported as mean (standard deviation, sd). differences in the incidence of adverse events were analyzed by chi - square test. a p - value less than 0.05 was considered statistically significant. after approval of the ethics committee of the general hospital of shenyang military region (china), a total of 150 patients undergoing uppp and recovering from general anesthesia were studied. all subjects were diagnosed with osas based on symptoms such as heavy and loud snoring, witnessed apneas, and/or daytime sleepiness and choking during sleep. each subject underwent clinical assessment, testing for complete blood count, liver and kidney function, and cardiac enzymes. the patients were considered ineligible if they had unstable angina or acute myocardial infarction in the last 30 days, uncontrolled diabetes, morbid obesity (bmi > 40), ejection fraction below 30%, or were treated with neuromuscular blocking agents. patients were also excluded if they had a history of alcohol or drug abuse or their neurologic condition was difficult to evaluate. patients in the propofol group (n=61) received an infusion of propofol (3 mg / kg / hr), which was titrated up to a maximum of 6 mg / kg / h until they were adequately sedated (ramsay sedation score 4). patients in the dexmedetomidine group (n=63) received 1.0 g / kg of dexmedetomidine over a 10-min period and then 0.5 to 1.0 g / kg / h infusion to maintain a ramsay sedation score 4. if a dexmedetomidine - sedated patient could not be maintained within the desired sedation range and the infusion rate was already at the recommended maximum of 1.0 g / kg / h, the patient received intravenous injection of propofol (3 mg / kg / hr) until ramsay sedation score was at least 4. tramadol (1 mg / kg) was allowed for pain relief in both groups. staff determined the need for tramadol depending upon the signs of pain [e.g., sweating, increased blood pressure, and elevated heart rate (hr) ] before extubation or when the score was no more than 2 on the bruggemann comfort scale (bcs) assessed 10 min after extubation by direct communication with the patient. intraoperative anesthetics, narcotics, and other medications were standardized by the department of anesthesiology by induction with propofol 2 mg / kg in combination with midazolam 2 mg, sufentanil 0.5 g / kg, and rocuronium bromide 0.8 mg / kg. anesthesia was maintained with propofol (38 mg / kg / h) and remifentanil (315 g / kg / h) administered with an infusion pump, and 0.52.5% sevoflurane administered by vaporization. blood pressure and heart rate (hr) were maintained within 20% of awake values. propofol, remifentanil, and sevoflurane were stopped when the patients were transferred to the pacu after the operation. in the pacu, mechanical ventilation was stopped when end - tidal (et) anaesthetic concentration dropped to 0.2%. respiration was then manually assisted until recovery of spontaneous breathing (tidal volume > 6 ml / kg). each patient was given 5 l / min of oxygen via oxygen insufflation after recovery of adequate spontaneous ventilation, followed by 2 l / min oxygen through a nasal cannula after extubation. a patient was considered ready for extubation if awake or arousable, cooperative and comfortable, and if fraction of inspiration o2 (fio2) was less than 0.4 and blood oxygen saturation (spo2) exceeded 96%. in addition, the partial pressure of o2 in arterial blood (pao2) should be over 80 mmhg, partial pressure of carbon dioxide in the blood (paco2) below 50 mmhg, tidal volume greater than 6 ml / kg, spontaneous respiratory rate lower than 25/min, with steady circulatory function and no hemorrhagic secretions observed in the upper respiratory tract. patients with a modified aldrete score between 9 and 10 were transferred to the ward. the electrocardiogram, hr, noninvasive systolic and diastolic arterial blood pressures, spo2, respiratory rate, bis (bis xp 3.4 monitor, aspect medical systems, newton, ma) were recorded preoperatively (t0), when sedation was initiated (t1), and at the following timepoints : 30 min after dexmedetomidine or propofol initiation (t2), extubation (t3), 10 min after extubation (t4), and at discharge from the pacu (t5). time to extubation : defined as the time interval between stopping dexmedetomidine or propofol and the fulfillment of extubation criteria. ramsay sedation scores were assessed at t2 and rass agitation scores (rass) were assessed at t3. at t3, if rass score was at least 3 points, the patients were treated with analgesics (tramadol) and sedatives (dexmedetomidine or / and propofol with an infusion pump). if rass score was at least 3, the sedation was continued as before until rass score was 2 or less. if rass score was 2 or less, sedatives were discontinued and the patients regained consciousness gradually. cough responses during extubation were scored as 1=no incidence of cough ; 2=smooth extubation, slight coughing (1~2 coughs) ; 3=moderate coughing (3~4 coughs) ; 4=severe or repetitive coughing (5~10 coughs) ; 5=patient discomfort, poor extubation (> 10 severe coughs). bcs : 0=continuous pain ; 1=no pain without movement, but serious pain when breathing deeply or coughing ; 2=no pain without movement, but mild pain when breathing deeply or coughing ; 3=no pain, even when breathing deeply ; and 4=no pain when coughing). potential adverse drug reactions were noted during pacu : bradycardia (hr 100 bpm), hypotension [mean arterial pressure (map) was less than 30% of the baseline ], hypertension (map was more than 30% of the baseline), respiratory depression (respiratory rate 8 bpm or spo2 90% for a duration exceeding 5 min), glossoptosis, nausea or vomiting, rigors, and bleeding. statistical analysis was performed using a commercial software package (spss 17.0, chicago, il). this sample size for the study was based on tramadol consumption in the pacu after uppp surgery, assuming a requirement of rescue tramadol 0.72 (sd0.23) mg / kg with dexmedetomidine - ketamine - based anesthesia. to detect a 30% reduction in tramadol requirements in the pacu after surgery, 60 subjects per treatment group would be needed for a study with an alpha level of 0.05 and a beta level of 0.2 (80% power). continuous variables with a normal distribution are reported as mean (standard deviation, sd). differences in the incidence of adverse events were analyzed by chi - square test. a p - value less than 0.05 was considered statistically significant. sixty - one patients in the propofol group and 63 patients in the dexmedetomidine group were analyzed (figure 1). the 2 groups were similar in age, bmi, apnea - hypopnea index (ahi), neck size, and ess score. there were no significant differences in anesthesia time and operative time between the 2 groups. figure 2 shows the hr, noninvasive systolic and diastolic arterial blood pressures, spo2, etco2, and bis at each point of time. in the propofol group, hr, systolic blood pressure (sbp), and diastolic blood pressure (dbp) significantly increased at the time of extubation (t3) in contrast to dexmedetomidine - sedated patients who manifested non - significant changes in sbp and dbp (p>0.05). dexmedetomidine sedation decreased the hr significantly after its initiation and was significantly less than in the propofol group. the spo2 and etco2 were not changed in the dexmedetomidine group (both p<0.05, in comparison with the propofol group). bis values were significantly lower in the dexmedetomidine group than in the propofol group at ramsay sedation scores of 4 and 5 (p=0.045). there were no significant differences in ramsay sedation scores between groups during assisted ventilation (t2) (p=0.259). after extubation, bcs and rass in the dexmedetomidine group were lower than in the propofol group (p=0.024 and 0.042, respectively). during assisted ventilation, the dexmedetomidine - sedated patients required less tramadol than patients in the propofol group (p=0.001) (table 2). coughing during extubation occurred more frequently and was more severe in the propofol group compared to the dexmedetomidine group (p<0.001) (table 3). the time to spontaneous breathing in the dexmedetomidine group was significantly shorter than in the propofol group (p=0.035). patients fulfilled the criteria of extubation earlier in the dexmedetomidine group (p=0.028) (table 4). there were fewer dexmedetomidine - sedated patients requiring treatment for emergent adverse reactions than in the propofol group (p=0.002). there were no differences between the 2 groups in the length of stay in the pacu. four categories hypertension, tachycardia, bradycardia and respiratory depression were significantly different between groups. hypertension, tachycardia and respiratory depression occurred significantly more frequently in the propofol group (p=0.038 and 0.027, respectively, table 5). dexmedetomidine, a a2-adrenoreceptor agonist well known for its anti - anxiety, sedative, analgesic, anaesthetic - sparing and respiratory - sparing effects, is also a perfect candidate for premedication. in the pacu of our department, we administrated dexmedetomidine to patients after uppp for sedation. in our study, analgesic consumption, pain intensities, sedation and agitation scores, cardiovascular and respiratory variables, and adverse reactions such as nausea, vomiting, and rigors were compared for 4 hours after operation. the results show that dexmedetomidine - based sedation was safe and effective for postsurgical uppp patients. our results also showed that at comparable ramsay scores, bis values were lower with dexmedetomidine sedation than with propofol. patients who receive dexmedetomidine are quite comfortable and are still arousable and responsive to stimuli. evaluated the intraoperative sedative effects of dexmedetomidine and propofol, and demonstrated that although sedation with dexmedetomidine was achieved slowly, similar effects were found between groups 25 min after initiation of infusion. pain was the main cause of agitation in patients recovering from uppp, reflected by frequent complaints of throat pain and discomfort after extubation. a previous study showed that visual analogue scale (vas) was 4~6 points in a quiet condition after uppp. prompt and effective management of pain is one of the most effective measures to prevent and treat postoperative complications following uppp. opioid analgesics are commonly used to manage postoperative pain, but in large doses they may cause respiratory depression. in our study, dexmedetomidine - sedated patients required significantly less tramadol and this analgesic - sparing effect of dexmedetomidine is well documented in previous studies [2426 ]. we compared the uppp patients receiving dexmedetomidine or propofol during recovery from extubation in the pacu. under similar levels of sedation, dexmedetomidine efficiently inhibited the stress response around tracheal extubation, whereas propofol increased blood pressure and hr. dexmedetomidine initiation was associated with decreased hr and transient hypertension, which is consistent with other reports in the literature. the effect of dexmedetomidine in reducing the incidence and severity of cough during extubation is consistent with the study of aksu., in which injection of 0.5 g / kg dexmedetomidine before extubation effectively alleviated the airway responses and suppressed the cough response and hemodynamic fluctuations. dexmedetomidine also prevented the occurrence of nausea, vomiting, and chills after extubation. in this study, the incidence of nausea, vomiting and chills was less in patients receiving dexmedetomidine. none of the 124 patients in this study had glossoptosis, and the influence of dexmedetomidine and propofol on glossoptosis was similar. the time to extubation and the time to recovery of spontaneous breathing were significantly shorter in the dexmedetomidine group compared with the propofol group. patients in the dexmedetomidine group were easy to wake and recovered consciousness more quickly and completely. these results suggest that the extubation quality was better in the dexmedetomidine group than in the propofol group. respiratory depression during the uppp recovery period is commonly caused by the residual effects of anesthetics such as opioids. assisted ventilation or ventilation control should be performed until the recovery of spontaneous breathing, and antagonist must be used with caution to prevent agitation. reported that dexmedetomidine did not significantly prolong the recovery time of spontaneous breathing and the eye - opening time compared with propofol. indeed, several other studies with dexmedetomidine support observations that dexmedetomidine used at clinical doses did not depress respiratory drive [3335 ]. however, some patients may have respiratory depression due to the interaction between dexmedetomidine and residual anesthetics and muscle relaxants. reported that geriatric patients presented with respiratory depression 90 min after extubation following infusion of 0.26 g / kg / h dexmedetomidine for 3.5 h, indicating that higher doses or prolonged administration of dexmedetomidine caused respiratory depression. in this study, respiratory depression occurred in 12 cases after drug withdrawal and before extubation in the propofol group, and in 4 cases after extubation in the dexmedetomidine group. these data suggest that inappropriate application of dexmedetomidine in patients of different ages resulted in respiratory depression. agitation scales were monitored occasionally by an assessor who rated the level of agitation on the basis of a single observation and interaction with the patient. discrete observations may fail to account for changes in sedation level that may occur between assessments. plasma drug concentrations were not measured, and therefore, can not be assumed to have remained constant or similar in patients. this drug can induce suitable depth of sedation and the analgesic effect, significantly reduce the use of analgesics without clinically significant respiratory depression and agitation during extubation, and shorten the time to extubation. | backgroundadequate sedation is important in the post - anesthesia care unit (pacu) following uvulopalatopharyngoplasty (uppp) to ensure patient comfort and decrease the duration of mechanical ventilation (mv), pacu stay, and bleeding. this study aimed to compare dexmedetomidine and propofol as sedatives after uppp in the pacu.material/methodswe randomized 124 mechanically ventilated adults following uppp who were managed in the pacu of the general hospital of the shenyang military region between january 2014 and june 2014, to receive either dexmedetomidine or propofol. the patients in the propofol group received an infusion of propofol (3 mg / kg / h) titrated up to 6 mg / kg / h to attain a ramsay sedation score 4. the dexmedetomidine group patients received 1.0 g / kg of dexmedetomidine over a period of 10 minutes and then 0.5 to 1.0 g / kg / h infusion to maintain a ramsay sedation score 4.resultsbispectral index (bis) values were significantly lower in the dexmedetomidine group than in the propofol group at ramsay sedation scores of 4 and 5. the mean times to spontaneous breathing, waking, and extubation were shorter in the dexmedetomidine group. tramadol requirement was significantly reduced in the dexmedetomidine group (p<0.05). incidence of cough during the extubation process in the propofol group was higher than in the dexmedetomidine group. after extubation, bruggemann comfort scale (bcs) and rass agitation scores (rass) were decreased in the dexmedetomidine - sedated patients.conclusionsdexmedetomidine provides safe and effective sedation for post - uppp surgical patients and significantly reduces the use of analgesics, with minimal adverse effects. |
patients with behet 's disease often need intraocular surgeries for the treatment of secondary cataract or glaucoma. this study aims to report the clinical course before and after the intraocular surgeries of 5 patients who were systematically treated with infliximab. seven eyes of 5 male patients with behet 's disease, who underwent intraocular surgery while under systemic infliximab therapy at yokohama city university hospital from 2007 to 2009, were included in the study. phacoemulsification was performed on 4 eyes, and trabeculectomy was done on the remaining 3 eyes. control of the ocular attacks with the use of other systemic medications was difficult for all patients ; however, the use of infliximab enabled adequate control of the attacks. the visual acuity status during the preoperative stage did not worsen during the postoperative period. patients with behet 's disease in need of intraocular surgery can benefit from control of attacks with infliximab treatment. behet 's disease (bd) is characteristically an incurable systemic disease with recurrent inflammation [1, 2, 3 ]. in japan, bd is known as one of the three major causes of uveitis. in general, uveitis is frequently associated with complicated cataract and secondary glaucoma [4, 5 ]. in some cases, when surgical treatment of ocular inflammatory diseases is considered, control of the ocular inflammation before and after surgery is an important factor [4, 5 ]. for an ideal outcome of surgical treatment it is necessary that ocular inflammation has been under control for a few months prior to surgery. since the attacks of bd tend to be induced by surgical invasion, the decision to conduct surgery for bd is meticulous compared to other uveitis. however, there are cases of bd with uncontrollable uveitis, and such cases occasionally need surgical treatment. infliximab is a monoclonal antibody against tumor necrosis factor - a (tnf - a). infliximab has been approved for treatment of incurable bd uveoretinitis in japan since 2007, and definite promising effects have been noticed. on the other hand, the drug can possibly induce infectious complications of surgical treatment because of the systemic suppression of tnf - a [1, 2, 6, 7, 8 ]. this study presents 5 cases of bd with cataract and glaucoma surgeries under infliximab treatment. seven eyes of 5 patients with bd, who underwent intraocular surgery while under systemic infliximab therapy at yokohama city university hospital from 2007 to 2009, were included in the study. all patients were men, and the mean age at the time of surgery was 44.2 (30 - 70) years. four eyes underwent phacoemulsification, while trabeculectomy was performed on the remaining 3 eyes. the mean duration since the onset of ocular symptoms was 110 (34 - 180 months). before infliximab was administered, all patients were systemically given colchicine, cyclosporine, and other immunosuppressive agents. however, control of the ocular attacks was difficult with the medicine administered, and the patients frequently experienced active ocular attacks. infliximab therapy was administered at 5 mg / kg at 0, 2, and 6 weeks ; after that, the infusion was administered every 8 weeks, except for patients b and e. minor ocular attacks still occurred ; thus, the infusion interval was decreased to every 6 weeks, which resulted in control of attacks. during the postoperative period, ocular attacks were observed in patients a and b ; however, every attack was controlled with temporary medicines. ever since infliximab has been available for the treatment of bd, its excellent efficacy against ocular attacks of bd has been reported [1, 2, 3, 6 ]. however, in cases where surgical treatment is considered, it is possible that infliximab might induce infections during the perioperative period because it suppresses cytokines for improved postoperative wound healing [1, 2, 7 ]. surgical treatment of rheumatoid arthritis under infliximab therapy is recommended to be performed 4 weeks after infliximab infusion in order to assure a minimum systemic concentration of infliximab [1, 2, 7 ]. previously, some patients with bd who underwent cataract surgery under systemic infliximab treatment were reported in japan [1, 2 ]. the reports followed the rheumatic guidelines, and no remarkable complications were described in any cases. in the field of orthopedic surgery, it was previously reported that infliximab did not increase the risk of either infections or surgical complications occurring in patients with rheumatoid arthritis within 1 year of orthopedic surgery. furthermore, in the same field, previously reported complications were localized infections, and infliximab is considered to be relatively safer than the other anti - tnf - a drugs in the perioperative period. in our search of the literature, we could not find any report of a correlation between endophthalmitis or toxic anterior segment syndrome (tass) and systemic immunosuppressive treatment. the localized infection - like wound complications could be a concern in the field of orthopedic surgery as well as ophthalmology. in our study perioperative infection was more frequent among the glaucoma than cataract cases in the previous report. ocular inflammation after surgery could be controlled with medicine as well. based on our limited sampling of infliximab - treated patients with bd, infliximab has the potential not to complicate any subsequent surgery, not only for cataract but also for glaucoma. to reach a clearer conclusion, a greater number of subjects is necessary as well as a comparison with cases without infliximab treatment. although further investigation is needed, we suggest a possible efficacy of infliximab in intraocular surgeries of bd. | purposepatients with behet 's disease often need intraocular surgeries for the treatment of secondary cataract or glaucoma. this study aims to report the clinical course before and after the intraocular surgeries of 5 patients who were systematically treated with infliximab.methodsretrospective case series.resultsseven eyes of 5 male patients with behet 's disease, who underwent intraocular surgery while under systemic infliximab therapy at yokohama city university hospital from 2007 to 2009, were included in the study. the mean age at surgery was 44.2 years. phacoemulsification was performed on 4 eyes, and trabeculectomy was done on the remaining 3 eyes. the mean duration since the onset of the ocular symptoms was 107 months. control of the ocular attacks with the use of other systemic medications was difficult for all patients ; however, the use of infliximab enabled adequate control of the attacks. the visual acuity status during the preoperative stage did not worsen during the postoperative period. no infectious complication was observed in all cases.conclusionsour results suggest that infliximab treatment does not complicate any subsequent intraocular surgery. patients with behet 's disease in need of intraocular surgery can benefit from control of attacks with infliximab treatment. |
queen elizabeth hospital in blantyre, malawi, is a teaching hospital offering free services to a population of approximately 1 million. from 2006 until 2009, 3 prospective adult (age 16 years) meningitis studies were conducted at the hospital ; a randomized controlled trial of adjunctive oral glycerol in bacterial meningitis (n = 265) and descriptive studies of suspected meningitis of any cause (n = 573) and suspected bacterial meningitis (n = 161) (unpublished). each study was approved by the university of malawi, college of medicine research ethics committee (p.04/05/363, p.05/06/471, p.09/08/700) and complied with all institutional guidelines. patients were included in this study if they had an available csf sample, documented hiv status, and bacterial meningitis defined as a csf white cell count 100 cells / mm with polymorphs > 50%, or a positive csf gram stain, bacterial culture, or streptococcus pneumoniae polymerase chain reaction (pcr) test. defining bacterial meningitis using the above csf white cell criteria identifies patients with the same clinical characteristics and outcomes as patients with microbiologically proven bacterial meningitis in this setting. controls were patients from one of the descriptive studies who did not have meningitis based on a csf white cell count 50%, or a positive csf gram stain, bacterial culture, or streptococcus pneumoniae polymerase chain reaction (pcr) test. defining bacterial meningitis using the above csf white cell criteria identifies patients with the same clinical characteristics and outcomes as patients with microbiologically proven bacterial meningitis in this setting. controls were patients from one of the descriptive studies who did not have meningitis based on a csf white cell count < 5 cells / mm and negative csf gram stain, cryptococcal antigen test, bacterial culture, and mycobacterial culture. samples were stored at 70c until dna extraction from 200 l using a dna mini kit (qiagen). five microliters of extract was used for all assays except the cmv assay, which is optimized for use with 10 l. real - time pcr was performed with an abi7300 machine using taqman master mix (applied biosystems). primers and probes targeting conserved regions of the dna polymerase gene were used for hsv1&2 (forward - gacagcgaattcgagatgctg, reverse - atgttgtacccggtcacgaact, hsv1 probe ; 5-fam - catgacccttgtgaaaca - mgb-3-bhq1, hsv2 probe ; 5-vic - tgaccttcgtcaagcag - mgb-3-bhq1) and vzv (forward - gcgcggtagtaacagagaatttc, reverse - acgtgcatggaccggttaat, probe ; 5-fam - accatgtcatcgtttcaa - mgb-3-bhq1). for vzv a selection of samples the ebv assay targeted the bnrf1 gene, and the cmv assay targeted the ul123/ul55 genes [10, 11 ]. pcr conditions were activation of ung 50c for 2 minutes, activation of taq 95c for 15 minutes, amplification for 45 cycles at 95c for 15 seconds, and 60c for 1 minute. each assay had a lower limit of detection of 1000 copies / ml assessed as the level at which the pcr reaction always gave a positive result. positive controls consisted of extracted whole virus suspension (national institute of biological standards and controls, united kingdom). a positive control for the virus being tested and a negative control were tested in each run. if virus was detected in 1 of 3 wells, the test was repeated and considered positive if it again yielded 1 of 3 wells positive. samples positive for ebv were analyzed by quantitative pcr to determine ebv load using a plasmid - derived standard. the standard was quantified by ultraviolet spectrophotometry, serially diluted to 1010 copies / ml, and optimized to 92% efficiency. statistical analysis was performed using stata software, version 10, with a level of significance of p <.05. associations were examined using fisher exact test, stratified cochran - mantel - haenszel tests, and logistic regression. csf samples from 188 patients were analyzed. in total, 149 (of whom 115 were hiv positive) had bacterial meningitis and 39 (of whom 24 were hiv positive) had no meningitis (table 1). cd4 testing was not routinely available in malawi during the studies ; however, where documented, there was no difference between samples with bacterial meningitis (n = 45) and those without meningitis (n = 23) (median 188 cells / mm vs 157 cells / mm, respectively ; p =.43). for patients with bacterial meningitis the csf white cell count was lower in hiv - positive patients than in hiv - negative patients (median 365 cells / mm vs 960 cells / mm ; p =.009). patient characteristics and rates of detection of hsv 1&2, vzv, ebv, and cmv values are median (range) unless otherwise stated. abbreviations : csf, cerebrospinal fluid ; cmv, cytomegalovirus ; ebv, epstein - barr virus ; hiv, human immunodeficiency virus ; hsv 1 & 2, herpes simplex virus types 1 and 2 ; na, not available ; pcr, polymerase chain reaction ; vzv, varicella zoster virus. nine of the 90 positive pcr results were based on repeat testing following an initial result of 1 of 3 wells being positive (2 hsv1, 1 cmv, 6 ebv). reclassifying these results as negative did not change the results of the statistical analyses. hsv1 was detected in 2 of 39 patients without meningitis and 1 of 129 patients with bacterial meningitis (table 1). cmv was detected in 11 of 115 (10%) hiv - positive patients with bacterial meningitis (median cd4 count, 121 cells / mm [range, 1251 cells / mm ] ; n = 7) but was not detected in any hiv - negative patients with bacterial meningitis or 39 patients without meningitis. ebv was found in the csf in 79 of 149 (53%) patients with bacterial meningitis and was strongly associated with hiv seropositivity (odds ratio 5.2 [95% confidence interval, 2.211.9 ] ; p <.001). in hiv - positive patients with bacterial meningitis, there was no correlation between csf ebv load and csf white cell count (= 0.01, p =.94), csf lymphocyte count (= 0.02, p =.86) or csf red cell count (= 0.01, p =.98). for those bacterial meningitis patients with cd4 count data available there was no difference in the cd4 count between those with (n = 33) and without (n = 12) ebv in the csf (median, 180 cells / mm vs 141 cells / mm, respectively ; p =.78) and csf ebv load did not correlate with the cd4 count (= 0.01, p =.97). in hiv - positive patients without meningitis, ebv was present in 6 of 24 (25%) patients, which was significantly less than in those with bacterial meningitis (p =.002). ebv was not detected in any of the 15 hiv - negative patients without meningitis. in - hospital mortality from bacterial meningitis was higher in hiv - positive (59% [64 of 108 ]) than hiv - negative (35% [12 of 34 ]) individuals (p =.016). the presence of ebv in the csf of hiv - positive patients was not associated with outcome (p =.32) ; however, when outcome was analyzed according to csf ebv load, adjusting for hiv status, there was a significant association with mortality (p =.012) (figure 1). when this analysis was repeated excluding those who had no ebv in the csf (n = 75), the association remained (p =.018). similarly, the association remained significant when other factors previously shown to be associated with poor outcome (age 32 years, glasgow coma score < 12, hemoglobin < 10 g / dl) were included in the model (p =.003). mortality from bacterial meningitis in adults infected with human immunodeficiency virus (hiv) according to epstein - barr virus (ebv) load in cerebrospinal fluid (csf) (n = 108) and blood (n = 83). in total, 52 patients had no ebv in the csf, and 3 patients had no ebv in the blood. csf ebv load quartile ranges are 5112186 copies / ml, 21876602 copies / ml, 709619 958 copies / ml, and 19 958223 323 copies / ml. blood ebv load quartile ranges are 7519013 copies / ml, 964530 768 copies / ml, 31 251136 953 copies / ml, and 183 68135 658 200 copies / ml. ebv load in the blood was measured in 107 bacterial meningitis patients and detected in 80 of 83 (96%) hiv - positive patients compared with 14 of 24 (58%) hiv - negative patients (p <.001). unlike the csf, blood ebv load was not associated with outcome, adjusting for hiv status (p =.37) (figure 1). blood ebv load was higher than the corresponding csf load for all but 6 individuals, 3 of whom had no detectable ebv in the blood. of these 6 patients csf white cell counts ranged from 120 to 5920 cells / mm, blood white cell counts ranged from 4.5 to 22.2 cells / l, and 3 patients died. in total, 8 of 10 patients with cmv died (outcome data were unavailable for 1 patient). all 8 patients who died had dual infection with ebv, whereas the 2 survivors did not. although the presence of cmv did not increase the risk of death (p =.19), ebv / cmv dual infection was associated with death (p =.02). the cerebral injury that occurs in bacterial meningitis is largely due to a host - mediated inflammatory response. our data suggest that this process may be amplified by ebv reactivation and possibly cmv either in the brain or periphery. in contrast, we show that hsv1&2 and vzv are not commonly reactivated in adult bacterial meningitis in malawi. we found a very high prevalence of ebv in the context of bacterial meningitis, particularly in hiv - positive patients. ebv in the csf of hiv - positive patients is associated with cns lymphoma, although studies have detected ebv in other cns diseases [12, 13 ]. given that we found virus in patients with no white cells in the csf, and that replicative - cycle ebv messenger rna has been detected in csf from patients with other cns infections, it is likely that some ebv was replicating rather than latent. alternatively, the inflammatory process may allow latently infected lymphocytes into the csf, leading to detection of latent virus. immunosuppressed patients have increased levels of ebv in the blood due to a greater number of infected b lymphocytes. if reactivation occurs in the circulation, then the disrupted blood - csf barrier in meningitis may allow free virus into the csf. although most patients had higher ebv loads in the blood than in the csf, the finding of higher csf loads in some patients suggests that ebv can arise within the cns. our data show that increasing csf ebv load is associated with an increased risk of death from bacterial meningitis. ebv may simply be a marker of immune impairment, although this immune impairment appears to be poorly reflected in the cd4 count given the lack of correlation between cd4 count and ebv load. alternatively, an immune threshold may exist at which ebv becomes detectable ; however, our data show is the ebv load that is associated with outcome rather than just the presence of virus. ebv causes neurological damage by direct infection of brain cells or immune - mediated damage [14, 15 ]. ebv can also induce cytokines, which may allow further viral reactivation and impaired clearance of other infections. the presence of ebv in 25% of hiv - positive patients with normal csf does show that ebv can occur in the csf without causing inflammation ; however, all of these patients had low ebv loads. the absence of cmv in other patients indicates that detection is associated with inflammation in the csf in patients with underlying immunosuppression. cmv neurological disease usually occurs at cd4 counts < 50 cells / mm ; however, in our study cmv - positive patients had a median cd4 count of 121 cells / mm. a previous study showed that detection of cmv in the csf of hiv - positive individuals was almost always associated with autopsy findings of cmv neurological disease, even when other neurological diseases were likely to be the primary illness. our study showed a significant association between dual ebv / cmv infection and mortality, suggesting that dual herpesvirus infections are associated with greater csf inflammation and worse outcome [5, 13 ]. our study supports the hypothesis that bacterial meningitis can trigger reactivation of herpesviruses, especially in hiv - positive patients. this could be further supported by demonstrating that the virus is replicating and not latent. we have shown that csf ebv load and dual ebv / cmv infection are associated with increased mortality from bacterial meningitis and propose that this reflects a causative role resulting from the effects of ebv and cmv on the inflammatory process responsible for poor outcome. this work was supported by grants from the meningitis research foundation (0905.0) and the wellcome trust (084679/z/08/z), united kingdom. conflicts that the editors consider relevant to the content of the manuscript have been disclosed. | mortality from adult bacterial meningitis exceeds 50% in sub - saharan africa. we postulated that particularly in individuals infected with human immunodeficiency virus (hiv)herpes simplex virus, varicella zoster virus, epstein - barr virus (ebv), and cytomegalovirus (cmv) in the cerebrospinal fluid (csf) contribute to poor outcome. csf from 149 malawian adults with bacterial meningitis and 39 controls were analyzed using polymerase chain reaction. ebv was detected in 79 of 149 bacterial meningitis patients. mortality (54%) was associated with higher csf ebv load when adjusted for hiv (p =.01). cmv was detected in 11 of 115 hiv - infected patients, 8 of whom died. the mechanisms by which ebv and cmv contribute to poor outcome require further investigation. |
transcatheter aortic valve implantation (tavi) is a catheter - based treatment for patients with aortic stenosis (as) who are considered poor candidates for surgical aortic valve replacement (avr). although it is increasingly being considered the standard of care in such patients, not all patients receive tavi but instead continue medical therapy (mt). historically, the treatment decision heavily depended upon the assessment of risk of valve replacement by using the logistic euroscore (les) or society of thoracic surgeons (sts) score [2, 3 ]. these scores were developed to assess the operative risk of patients undergoing open - heart surgery but not for the subset of patients who are referred for tavi. therefore, careful patient - to - patient case evaluation by heart team meetings are strongly encouraged and play a crucial role in the design of randomised clinical trials [1, 47 ]. in this study, we sought to explore the reasons for the treatment decision, the treatment - specific complications and survival in patients referred for tavi in addition to the predictive factors of mortality in those undergoing tavi. the population consists of all 358 patients who were referred for tavi at the department of cardiology of the erasmus medical centre, rotterdam, the netherlands and the departments of cardiology and cardio - thoracic surgery of angiografia de occidente s.a., cali, colombia and fundacion clinica cardio infantil, bogota, colombia between november 2005 and january 2011. in the three institutions, a similar database and structure of data collection and follow - up was set up at the initiation of tavi as previously described. treatment decision (tavi, avr, mt) was taken by consensus during the heart team meeting. details of eligibility for medtronic corevalve system (mcs) implantation, the bioprosthesis and technique of implantation have previously been described [810 ]. all patients underwent transfemoral (n = 228) or trans - subclavian tavi (n = 7) with the 18 fr third - generation mcs except for the first five patients treated in 2005 and 2006, in whom a 21 fr second - generation mcs was implanted. balloon aortic valvuloplasty (bav) was performed in patients with as and worsening symptoms as a bridge to tavi or as a palliative approach in patients who could not undergo tavi / avr. source verification of the baseline data and clinical events was performed by the first author at each participating centre (within a master of science programme of the netherlands institute for health sciences, erasmus university rotterdam, supported by the erasmus - columbus latin - european exchange grant - www.erasmus-columbus.eu). all endpoints were selected and defined according to the valve academic research consortium (varc). cerebrovascular events were evaluated and adjudicated by a vascular neurologist. a full blood and chemistry sample was taken before and up to 3 days after the procedure to assess the occurrence and severity of periprocedural vascular, bleeding and kidney complications. data on red blood cell (rbc) transfusions were recorded by the institution s blood bank. the occurrence and timing of new atrial fibrillation and postprocedural 3 degree atrioventricular block was assessed by continuous telemetry recording. the varc combined safety endpoint at 30 days consisted of all - cause death, major stroke, major vascular complication, life - threatening bleeding, acute kidney injury (aki) stage iii and any in - hospital re - intervention due to prosthesis dysfunction (interventional / surgical). follow - up information of patients treated at the erasmus medical centre (tavi, avr, mt) was collected by first checking the vital status via the civil registries every 6 months. in case of survival, a questionnaire was sent to the patient for the assessment of symptoms, (cardiac) events and readmission(s). also surviving patients were contacted by telephone to confirm hospital readmission and reason after which events were verified with the treating hospital. follow - up information of patients treated in colombia was obtained by the regular office visit and/or telephone contact (dedicated local research nurse or doctor) with the treating physician and/or general practitioner and/or patient or family followed by verification of the event with the treating hospital. categorical variables are presented as frequencies and percentages and were compared with the chi - square test or fisher s exact test. normal and skewed continuous variables are presented as means sd and medians (iqr), respectively. to compare the three treatment groups, analysis of variance kaplan - meier survival methods were used to calculate the cumulative survival at different time intervals and the log - rank test was used to assess differences in survival. a stepwise cox regression analysis including all variables with p < 0.10 in the univariable analysis was used to determine independent predictors of late mortality in patients undergoing tavi. a two - sided p < 0.05 was considered to indicate significance and all analyses were performed with spss software (version 17.0). the population consists of all 358 patients who were referred for tavi at the department of cardiology of the erasmus medical centre, rotterdam, the netherlands and the departments of cardiology and cardio - thoracic surgery of angiografia de occidente s.a., cali, colombia and fundacion clinica cardio infantil, bogota, colombia between november 2005 and january 2011. in the three institutions, a similar database and structure of data collection and follow - up was set up at the initiation of tavi as previously described. treatment decision (tavi, avr, mt) was taken by consensus during the heart team meeting. details of eligibility for medtronic corevalve system (mcs) implantation, the bioprosthesis and technique of implantation have previously been described [810 ]. all patients underwent transfemoral (n = 228) or trans - subclavian tavi (n = 7) with the 18 fr third - generation mcs except for the first five patients treated in 2005 and 2006, in whom a 21 fr second - generation mcs was implanted. balloon aortic valvuloplasty (bav) was performed in patients with as and worsening symptoms as a bridge to tavi or as a palliative approach in patients who could not undergo tavi / avr. source verification of the baseline data and clinical events was performed by the first author at each participating centre (within a master of science programme of the netherlands institute for health sciences, erasmus university rotterdam, supported by the erasmus - columbus latin - european exchange grant - www.erasmus-columbus.eu). all endpoints were selected and defined according to the valve academic research consortium (varc). a full blood and chemistry sample was taken before and up to 3 days after the procedure to assess the occurrence and severity of periprocedural vascular, bleeding and kidney complications. data on red blood cell (rbc) transfusions were recorded by the institution s blood bank. the occurrence and timing of new atrial fibrillation and postprocedural 3 degree atrioventricular block was assessed by continuous telemetry recording. the varc combined safety endpoint at 30 days consisted of all - cause death, major stroke, major vascular complication, life - threatening bleeding, acute kidney injury (aki) stage iii and any in - hospital re - intervention due to prosthesis dysfunction (interventional / surgical). follow - up information of patients treated at the erasmus medical centre (tavi, avr, mt) was collected by first checking the vital status via the civil registries every 6 months. in case of survival, a questionnaire was sent to the patient for the assessment of symptoms, (cardiac) events and readmission(s). also surviving patients were contacted by telephone to confirm hospital readmission and reason after which events were verified with the treating hospital. follow - up information of patients treated in colombia was obtained by the regular office visit and/or telephone contact (dedicated local research nurse or doctor) with the treating physician and/or general practitioner and/or patient or family followed by verification of the event with the treating hospital. categorical variables are presented as frequencies and percentages and were compared with the chi - square test or fisher s exact test. normal and skewed continuous variables are presented as means sd and medians (iqr), respectively. to compare the three treatment groups, analysis of variance kaplan - meier survival methods were used to calculate the cumulative survival at different time intervals and the log - rank test was used to assess differences in survival. a stepwise cox regression analysis including all variables with p < 0.10 in the univariable analysis was used to determine independent predictors of late mortality in patients undergoing tavi. a two - sided p < 0.05 was considered to indicate significance and all analyses were performed with spss software (version 17.0). of the 421 patients, 60 (14%) died on the waiting list at a median (iqr) of 48 (14110) days after first medical contact and 3 (1%) were lost to follow - up. therefore, the total study population consists of 358 patients of whom 235 (65%) underwent tavi at a median (iqr) interval of 71 (30119) days and 24 (7%) avr at an interval of 63 (33122) days. the reasons why avr or mt was chosen instead of tavi are depicted in fig. 1. the main reason to reject tavi in favour of avr or mt were patient preference (29%), peripheral vascular disease (pvd, 13%) and non - severe as (11%). not unexpectedly, patients who underwent tavi or continued mt had a significantly higher les.fig. 1reasons to decline tavi in favour of avr and mt. four patients had another reason : severe left ventricular dysfunction (lvef < 20%) ; bleeding diathesis ; abusive alcohol use ; unknown. as = aortic stenosis ; cad = coronary artery disease ; copd = chronic obstructive pulmonary disease ; pvd = peripheral vascular diseasetable 1baseline characteristics of patients undergoing tavi, avr and medical therapytaviavrmedicalp - valuen = 235n = 24n = 99age (years), mean sd80 778 980 80.26male, n (%) 116 (49)13 (54)42 (42)0.32height (cm), mean sd166 11169 8166 80.50weight (kg), mean sd71 1375 1169 160.14bmi, mean sd26.7 426.4 424.9 50.34bsa, mean sd1.81 0.191.87 0.151.77 0.240.14nyha class iii, n (%) 177 (75)12 (50)53 (53)0.091previous mi, n (%) 45 (19)5 (21)16 (16)0.78previous cabg, n (%) 54 (23)021 (21)0.032previous pci, n (%) 60 (26)5 (21)26 (26)0.92pvd, n (%) 30 (13)6 (25)28 (28)0.002diabetes mellitus, n (%) 57 (24)5 (21)28 (28)0.64hypertension, n (%) 132 (56)12 (50)34 (34)0.029creatinine, mean sd123 131104 56129 680.75chronic haemodialysis, n (%) 11 (5)1 (5)00.20copd, n (%) 78 (33)5 (21)31 (31)0.59permanent pacemaker, n (%) 26 (11)3 (13)10 (10)0.96atrial fibrillation, n (%) 49 (21)8 (33)25 (25)0.23aortic valve area (cm2), mean sd0.67 0.210.81 0.390.77 0.270.001lv, n (%) - poor (ef < 30%)34 (14)2 (8)10 (10)0.89- moderate (ef 3059%)82 (35)6 (25)24 (24)0.66mitral regurgitation grade iii, n (%) 28 (12)2 (8)5 (5)0.29aortic regurgitation grade iii, n (%) 45 (19)03 (3)0.001logistic euroscore, mean sd19.1 13.710.1 4.318.9 12.10.007sts score, mean sd6.1 5.54.1 2.45.8 3.80.17bmi body mass index, bsa body surface area, cabg coronary artery bypass graft, copd chronic obstructive pulmonary disease, ef ejection fraction, nyha new york heart association, lv left ventricular, mi myocardial infarction, pci percutaneous coronary intervention, pvd peripheral vascular disease, sts society of thoracic surgeons reasons to decline tavi in favour of avr and mt. four patients had another reason : severe left ventricular dysfunction (lvef < 20%) ; bleeding diathesis ; abusive alcohol use ; unknown. as = aortic stenosis ; cad = coronary artery disease ; copd = chronic obstructive pulmonary disease ; pvd = peripheral vascular disease baseline characteristics of patients undergoing tavi, avr and medical therapy bmi body mass index, bsa body surface area, cabg coronary artery bypass graft, copd chronic obstructive pulmonary disease, ef ejection fraction, nyha new york heart association, lv left ventricular, mi myocardial infarction, pci percutaneous coronary intervention, pvd peripheral vascular disease, sts society of thoracic surgeons thirty - day all - cause and cardiovascular mortality was 9 and 6% in the tavi group and 8 and 8% in the avr group, respectively (table 2). in the tavi group, the cause of death was hypotension during induction of anaesthesia (n = 1), electromechanical dissociation (n = 2), coronary obstruction (n = 1), left ventricular outflow tract rupture (n = 1) and retroperitoneal haemorrhage (n = 1). another 14 patients died at a median of 7 (iqr : 313) days after tavi due to stroke (n = 3), heart failure (n = 2), sudden death (n = 2 : unrecognised alternating left and right bundle branch block leading to asystole at day 8 and sudden death 1 day after discharge on day 29), sepsis (n = 2), pneumonia (n = 2), retroperitoneal haemorrhage (n = 2) and cardiac tamponade (n = 1). in the surgical group, the cause of death was ventricular fibrillation (n = 1) and severe paravalvular aortic regurgitation (n = 1).table 2thirty - day clinical outcome in patients undergoing tavi and avrtaviavrp - valuen = 235n = 24mortality, n (%) - all - cause20 (9)2 (8)1.0- cardiovascular cause13 (6)2 (8)0.64myocardial infarction, n (%) - all3 (1)1 (4)0.32- periprocedural (< 72 h)2 (1)01.0cerebrovascular complication, n (%) - all20 (9)2 (8)1.0- major stroke11 (5)1 (4)1.0vascular complication, n (%) - all42 (18)00.036- major24 (10)00.14bleeding complication, n (%) - all67 (29)2 (8)0.049- life - threatening or disabling21 (9)2 (8)1.0acute kidney injury, n (%) - all40 (17)8 (33)0.058- stage iii5 (2)2 (8)0.13cardiac re - intervention, n (%) - avr1 (1)01.0- bav1 (1)01.0- other1 (1)2 (8)0.023new pacemaker implantation- all48 (21)1 (4)0.056- for 3rd degree av block40 (17)00.032new atrial fibrillation9 (5)2 (11)0.60repeat hospitalisation, n (%) 3 (1)01.0combined 30-day safety endpoint, n (%) 55 (24)6 (25)1.0av atrioventricular, avr aortic valve replacement, bav balloon aortic valvuloplastymutually non - exclusive analysis (1 event / patient possible)including tiaclosure of severe paravalvar aortic regurgitation with amplatzer closure device (n = 1) in tavi group and resternotomy for severe aortic regurgitation (n = 1) and bleeding (n = 1) in avr groupfor symptoms of valve - related dysfunction or cardiac decompensationcomposite all - cause mortality, major stroke, major vascular complication, life - threatening bleeding, acute kidney injury - stage 3, peri - procedural myocardial infarction, repeat procedure for valve - related dysfunction (surgical or interventional) thirty - day clinical outcome in patients undergoing tavi and avr av atrioventricular, avr aortic valve replacement, bav balloon aortic valvuloplasty mutually non - exclusive analysis (1 event / patient possible) closure of severe paravalvar aortic regurgitation with amplatzer closure device (n = 1) in tavi group and resternotomy for severe aortic regurgitation (n = 1) and bleeding (n = 1) in avr group for symptoms of valve - related dysfunction or cardiac decompensation composite all - cause mortality, major stroke, major vascular complication, life - threatening bleeding, acute kidney injury - stage 3, peri - procedural myocardial infarction, repeat procedure for valve - related dysfunction (surgical or interventional) cardiac re - intervention after the index procedure was required in 3 patients in the tavi group : immediate conversion to avr (n = 1), closure of a paravalvar leak 14 days after tavi (n = 1) and post - implantation dilatation of the mcs 21 days after tavi (n = 1). in the avr group, two patients underwent re - thoracotomy for severe aortic regurgitation (n = 1) and cardiac tamponade (n = 1) 1 day after avr. although the total rate of vascular and bleeding complications was higher in the tavi group in comparison with the avr group, the combined 30-day safety endpoint did not differ between the two groups (24 vs. 25%, p = 1.0). the median follow - up was 298 (iqr : 107688) days in the tavi group, 836 (iqr : 3271269) days in the surgical group and 456 (iqr : 187869) days in the medical group. estimated survival at 2 years was 80% in the avr group, 69% in the tavi group and 45% in patients who continued mt (p < 0.001). the median time between treatment (avr or tavi) or first medical contact (mt) and death was 96 (iqr : 11679) days in the surgical group, 171 (iqr : 24365) days in the tavi group and 300 (iqr : 98578) days in the mt group.fig. 2kaplan - meier survival curve for patients undergoing tavi, avr and mt kaplan - meier survival curve for patients undergoing tavi, avr and mt details of adverse events beyond 30 days are summarised in table 3. by univariable analysis, pvd, baseline creatinine, sts score, rbc transfusion and aki were identified as potential determinants of mortality after tavi. multivariable analysis retained rbc transfusion (hr : 1.19 ; 95% ci : 1.051.33), pre - existing renal failure (hr : 1.18 ; 95% ci : 1.061.33) and sts score (hr : 1.06 ; 95% ci : 1.021.10) as independent predictors of mortality after tavitable 3adverse events beyond 30 days after tavi, avr and medical treatmenttaviavrmedicalall (n = 106)fatal (n = 40)all (n = 10)fatal (n = 5)fatal (n = 59)cardiac46 (43)19 (48)5 (50)1 (20)31 (53)heart failure13 (12)4 (10)4 (40)1 (20)19 (32)sudden death8 (8)8 (20)009 (15)myocardial infarction2 (2)2 (5)1 (20)01 (2)cardiac re - intervention3 (3)0000stroke or tia11 (10)4 (10)002 (3)pacemaker implantation9 (9)1 (3)000non - cardiac56 (53)21 (52)5 (50)4 (80)9 (15)infection17 (16)8 (20)1 (10)1 (20)5 (8)renal failure7 (7)4 (10)2 (20)2 (40)0vascular3 (3)0000bleeding (non - cranial)3 (3)1 (3)1 (10)00neoplasm9 (8)4 (10)001 (2)metabolic disease2 (2)2 (5)000other15 (14)2 (5)1 (10)1 (20)3 (5)unknown4 (4)00019 (32)median follow - up was 298 (iqr : 107688) days in the tavi group, 836 (iqr : 3271269) days in the avr group and 456 (iqr : 187869) days in the medical groupre - interventions before discharge included avr (n = 1) and post - implantation balloon aortic valvuloplasty (n = 2)including tia (n = 4) ; of the 11 events, 9 were ischaemic of which 2 fatal and 2 were haemorrhagic, both of which fatalpneumothorax following pacemaker implantation (n = 1)blood transfusion reaction (n = 1), euthanasia (n = 1)delirium (n = 1)obstructive pulmonary disease (n = 2), lung emboli (n = 1) adverse events beyond 30 days after tavi, avr and medical treatment median follow - up was 298 (iqr : 107688) days in the tavi group, 836 (iqr : 3271269) days in the avr group and 456 (iqr : 187869) days in the medical group re - interventions before discharge included avr (n = 1) and post - implantation balloon aortic valvuloplasty (n = 2) including tia (n = 4) ; of the 11 events, 9 were ischaemic of which 2 fatal and 2 were haemorrhagic, both of which fatal pneumothorax following pacemaker implantation (n = 1) blood transfusion reaction (n = 1), euthanasia (n = 1) obstructive pulmonary disease (n = 2), lung emboli (n = 1) thirty - day all - cause and cardiovascular mortality was 9 and 6% in the tavi group and 8 and 8% in the avr group, respectively (table 2). in the tavi group, the cause of death was hypotension during induction of anaesthesia (n = 1), electromechanical dissociation (n = 2), coronary obstruction (n = 1), left ventricular outflow tract rupture (n = 1) and retroperitoneal haemorrhage (n = 1). another 14 patients died at a median of 7 (iqr : 313) days after tavi due to stroke (n = 3), heart failure (n = 2), sudden death (n = 2 : unrecognised alternating left and right bundle branch block leading to asystole at day 8 and sudden death 1 day after discharge on day 29), sepsis (n = 2), pneumonia (n = 2), retroperitoneal haemorrhage (n = 2) and cardiac tamponade (n = 1). in the surgical group, the cause of death was ventricular fibrillation (n = 1) and severe paravalvular aortic regurgitation (n = 1).table 2thirty - day clinical outcome in patients undergoing tavi and avrtaviavrp - valuen = 235n = 24mortality, n (%) - all - cause20 (9)2 (8)1.0- cardiovascular cause13 (6)2 (8)0.64myocardial infarction, n (%) - all3 (1)1 (4)0.32- periprocedural (< 72 h)2 (1)01.0cerebrovascular complication, n (%) - all20 (9)2 (8)1.0- major stroke11 (5)1 (4)1.0vascular complication, n (%) - all42 (18)00.036- major24 (10)00.14bleeding complication, n (%) - all67 (29)2 (8)0.049- life - threatening or disabling21 (9)2 (8)1.0acute kidney injury, n (%) - all40 (17)8 (33)0.058- stage iii5 (2)2 (8)0.13cardiac re - intervention, n (%) - avr1 (1)01.0- bav1 (1)01.0- other1 (1)2 (8)0.023new pacemaker implantation- all48 (21)1 (4)0.056- for 3rd degree av block40 (17)00.032new atrial fibrillation9 (5)2 (11)0.60repeat hospitalisation, n (%) 3 (1)01.0combined 30-day safety endpoint, n (%) 55 (24)6 (25)1.0av atrioventricular, avr aortic valve replacement, bav balloon aortic valvuloplastymutually non - exclusive analysis (1 event / patient possible)including tiaclosure of severe paravalvar aortic regurgitation with amplatzer closure device (n = 1) in tavi group and resternotomy for severe aortic regurgitation (n = 1) and bleeding (n = 1) in avr groupfor symptoms of valve - related dysfunction or cardiac decompensationcomposite all - cause mortality, major stroke, major vascular complication, life - threatening bleeding, acute kidney injury - stage 3, peri - procedural myocardial infarction, repeat procedure for valve - related dysfunction (surgical or interventional) thirty - day clinical outcome in patients undergoing tavi and avr av atrioventricular, avr aortic valve replacement, bav balloon aortic valvuloplasty mutually non - exclusive analysis (1 event / patient possible) closure of severe paravalvar aortic regurgitation with amplatzer closure device (n = 1) in tavi group and resternotomy for severe aortic regurgitation (n = 1) and bleeding (n = 1) in avr group for symptoms of valve - related dysfunction or cardiac decompensation composite all - cause mortality, major stroke, major vascular complication, life - threatening bleeding, acute kidney injury - stage 3, peri - procedural myocardial infarction, repeat procedure for valve - related dysfunction (surgical or interventional) cardiac re - intervention after the index procedure was required in 3 patients in the tavi group : immediate conversion to avr (n = 1), closure of a paravalvar leak 14 days after tavi (n = 1) and post - implantation dilatation of the mcs 21 days after tavi (n = 1). in the avr group, two patients underwent re - thoracotomy for severe aortic regurgitation (n = 1) and cardiac tamponade (n = 1) 1 day after avr. although the total rate of vascular and bleeding complications was higher in the tavi group in comparison with the avr group, the combined 30-day safety endpoint did not differ between the two groups (24 vs. 25%, p = 1.0). the median follow - up was 298 (iqr : 107688) days in the tavi group, 836 (iqr : 3271269) days in the surgical group and 456 (iqr : 187869) days in the medical group. estimated survival at 2 years was 80% in the avr group, 69% in the tavi group and 45% in patients who continued mt (p < 0.001). the median time between treatment (avr or tavi) or first medical contact (mt) and death was 96 (iqr : 11679) days in the surgical group, 171 (iqr : 24365) days in the tavi group and 300 (iqr : 98578) days in the mt group.fig. 2kaplan - meier survival curve for patients undergoing tavi, avr and mt kaplan - meier survival curve for patients undergoing tavi, avr and mt details of adverse events beyond 30 days are summarised in table 3. by univariable analysis, pvd, baseline creatinine, sts score, rbc transfusion and aki were identified as potential determinants of mortality after tavi. multivariable analysis retained rbc transfusion (hr : 1.19 ; 95% ci : 1.051.33), pre - existing renal failure (hr : 1.18 ; 95% ci : 1.061.33) and sts score (hr : 1.06 ; 95% ci : 1.021.10) as independent predictors of mortality after tavitable 3adverse events beyond 30 days after tavi, avr and medical treatmenttaviavrmedicalall (n = 106)fatal (n = 40)all (n = 10)fatal (n = 5)fatal (n = 59)cardiac46 (43)19 (48)5 (50)1 (20)31 (53)heart failure13 (12)4 (10)4 (40)1 (20)19 (32)sudden death8 (8)8 (20)009 (15)myocardial infarction2 (2)2 (5)1 (20)01 (2)cardiac re - intervention3 (3)0000stroke or tia11 (10)4 (10)002 (3)pacemaker implantation9 (9)1 (3)000non - cardiac56 (53)21 (52)5 (50)4 (80)9 (15)infection17 (16)8 (20)1 (10)1 (20)5 (8)renal failure7 (7)4 (10)2 (20)2 (40)0vascular3 (3)0000bleeding (non - cranial)3 (3)1 (3)1 (10)00neoplasm9 (8)4 (10)001 (2)metabolic disease2 (2)2 (5)000other15 (14)2 (5)1 (10)1 (20)3 (5)unknown4 (4)00019 (32)median follow - up was 298 (iqr : 107688) days in the tavi group, 836 (iqr : 3271269) days in the avr group and 456 (iqr : 187869) days in the medical groupre - interventions before discharge included avr (n = 1) and post - implantation balloon aortic valvuloplasty (n = 2)including tia (n = 4) ; of the 11 events, 9 were ischaemic of which 2 fatal and 2 were haemorrhagic, both of which fatalpneumothorax following pacemaker implantation (n = 1)blood transfusion reaction (n = 1), euthanasia (n = 1)delirium (n = 1)obstructive pulmonary disease (n = 2), lung emboli (n = 1) adverse events beyond 30 days after tavi, avr and medical treatment median follow - up was 298 (iqr : 107688) days in the tavi group, 836 (iqr : 3271269) days in the avr group and 456 (iqr : 187869) days in the medical group re - interventions before discharge included avr (n = 1) and post - implantation balloon aortic valvuloplasty (n = 2) including tia (n = 4) ; of the 11 events, 9 were ischaemic of which 2 fatal and 2 were haemorrhagic, both of which fatal pneumothorax following pacemaker implantation (n = 1) blood transfusion reaction (n = 1), euthanasia (n = 1) obstructive pulmonary disease (n = 2), lung emboli (n = 1) we found that the majority of patients referred for tavi (72%) undergo valve implantation / replacement (tavi 65%, avr 7%) but that nearly 30% continue mt mainly because of comorbidity and patient preference not to receive tavi / avr. patients who underwent tavi had a higher les than those who underwent avr, were more symptomatic with a higher prevalence of antecedent cabg and impaired renal function but less pvd. with respect to treatment allocation, the present findings most likely reflect the current real world practice. the two - thirds acceptance and one - third rejection rate contrasts with randomised studies such as the placement of aortic transcatheter valve (partner) cohort - b trial in which only 12% of the referred patients were accepted for randomised treatment allocation. of note, we observed a significant increase in acceptance for tavi from 2006 until 2010 ; it was 20% in 2006, 33% in 2007, 50% in 2008, 57% in 2009 and 81% in 2010. this is not explained by accepting less sick patients since the les did not change over time but is most likely explained by increased experience and familiarity with the procedure in combination with an increased public awareness resulting in less patients who refuse therapy. this may also explain that over time - less patients were redirected to surgery (29% of the surgical patients were treated in 2006 ; 29% in 2007 ; 25% in 2008 ; 13% in 2009 and 4% in 2010). initially the les was a critical factor in patient acceptance but a present consensus on treatment allocation by the heart team has become the dominant factor. this is not surprising since this score was neither designed nor validated for tavi and does not capture the spectrum of clinical details allowing a balanced treatment decision [12, 13 ]. also the les is out of synchrony with the sts score [12, 14 ]. the shortcomings of the risk score models and the value of multidisciplinary patient discussion are illustrated by the web - based conference call system used in the united states to review and approve patients for tavi, which is subsequently used in the partner trial. moreover, randomisation to tavi or avr in the surgery and transcatheter aortic valve implantation (surtavi) trial will be based upon clinical judgement by the heart team but not a risk score. the latter will only be used as criterion for entry into the heart team discussion. the outcome in the tavi group in the present study is consistent with the findings of the multi - centre observational registries [1418 ]. it remains to be elucidated whether stroke can be reduced by the use of embolic protection devices during the procedure. patient - related factors may play a role but are not the only ones. at present are inherently associated with a series of ensuing events (e.g. transfusion) and complications (e.g. anaemia, renal dysfunction) which in turn affect short- and long - term outcome, surgical access and closure of the arterial entry site should be considered [1923 ].. a consistently higher frequency of new pacemaker implantation after mcs implantation (up to 49%) than after edwards implantation (up to 27%) is reported [24, 25 ]. this is not without clinical importance since abnormal conduction may impair left ventricular ejection fraction recovery after tavi. follow - up was characterised by a high incidence of cardiac and non - cardiovascular events. as for immediate outcome, it is conceivable that long - term outcome will be better in less sick patients. this is the subject of investigation in an ongoing danish study in which age 70 is the main selection criterion for random allocation to tavi or avr. mt was continued mainly because of heart team rejection for tavi because of comorbidity. yet, a substantial number of patients refused valve implantation / replacement. patient preference intrinsically is bi - directional and will play an increasing role in treatment decisions due to increased public awareness. this puts the medical community under pressure since the position statement paper on tavi advocates not to include patient preference in the treatment decision. it also raises an ethical issue since one may question whether one has the right to refuse a treatment modality if a patient who is adequately informed about treatment options, outcomes and the presence or absence of future treatment possibilities in case of failure of the index treatment persists in his / her treatment preference. up to 65 and 7% of the patients with aortic stenosis who are referred for tavi undergo tavi and avr with promising results. | aimsto assess treatment decision and outcome in patients referred for transcatheter aortic valve implantation (tavi) in addition to predictive factors of mortality after tavi.methodsthree-centre prospective observational study including 358 patients. endpoints were defined according to the valve academic research consortium.resultsof the 358 patients referred for tavi, tavi was performed in 235 patients (65%), surgical aortic valve replacement (avr) in 24 (7%) and medical therapy (mt) in 99 (28%). reasons to decline tavi in favour of avr / mt were patient preference (29%), peripheral vascular disease (15%) and non - severe aortic stenosis (11%). the logistic euroscore was significantly higher in patients who underwent tavi and mt in comparison with those undergoing avr (19 vs. 10%, p = 0.007). at 30 days, all - cause mortality and the combined safety endpoint were 9 and 24% after tavi and 8 and 25% after avr, respectively. all - cause mortality was significantly lower in the tavi group compared with the mt group at 6 months, 1 year and 2 years (12% vs. 22%, 21% vs. 33% and 31% vs. 55%, respectively, p < 0.001). multivariable analysis revealed that blood transfusion (hr : 1.19 ; 95% ci : 1.051.33), pre - existing renal failure (hr : 1.18 ; 95% ci : 1.061.33) and sts score (hr : 1.06 ; 95% ci : 1.021.10) were independent predictors of mortality at a median of 10 (iqr : 323) months after tavi.conclusionsapproximately two - thirds of the patients referred for tavi receive this treatment with gratifying short- and long - term survival. another 7% underwent avr. prognosis is poor in patients who do not receive valve replacement therapy. |
the genus passiflora comprises about 500 species which are mostly woody vines that present a huge diversity in flower shape, colors and sizes. consequently it is a good model for studying plant - pollinator interactions and co - evolution, since it displays all kinds of pollination syndromes. although this diversity exists, the flowers always exhibit unique features that characterize and cluster the species in the genus. one of them is the corona filaments, which comprises one or more extra whorls that can play different roles in different species, functioning as nectar guide, or forming a floral tube in flowers adapted for bird pollination, and even serving as a landing platform for insects (ulmer and macdougal, 2004). another common feature is a nectary system containing an operculum and a membrane structure called limen that encloses a nectary chamber. finally, the androgynophore, a column in the center of the flower that elevates the androecium and the gynoecium, is present in different sizes and even in shapes. in p. edulis, which has flowers adapted to insect pollination, the androgynophore is a short and straight column. in contrast, in p. mucronata, which is bat pollinated, the androgynophore is a long curved column (ulmer and macdougal, 2004). recently, we showed that in some passiflora species, the androgynophore can also be a thigmotropic structure, i.e., it has the capability to move in response to touch and the movement is dependent on the direction of the stimulus (scorza and dornelas, 2014 ; scorza., 2014). when mechanically stimulated, the androgynophore inclines to the same side where the stimulus came in about 2 seconds. these species, p. sanguinolenta, p. citrina, p. capsularis and p. rubra are in the subgenus decaloba, and the movement is believed to be related to the pollination system of these species. the motile androgynophore would enhance the chances of pollen deposition on pollinators that would approach the flower and touch the column, which in turn would curves in the pollinator s direction upon the mechanical stimulus (scorza and dornelas, 2014 ; scorza., 2014). plant fast movements have been widely studied (for reviews, see braam, 2005 ; scorza and dornelas, 2011), in particular pulvinar movements in fabaceae species, such as mimosa pudica, where the leaflets of compound leaves shows a fast closing movement in response to touch (thigmonastism) or light regime (photonastism and nyctinastism) (samejima and sibaoka, 1980 ; moran, 2007 ; volkov., 2010a). additionally, carnivore plants such as drosera, dionaea (droseraceae) and utricularia(lentibulariaceae), have adapted organs that can produce active movements to capture preys (sibaoka, 1991 ; braam, 2005 ; volkov., 2008 ; singh., 2011). still, stamina of portulaca grandiflora (portulacaceae), berberis canadensis(berberidaceae), opuntia (cactaceae) and loasaceae (henning and weigend, 2012) flowers for example, can also bend in response to a visiting pollinator increasing pollen transfer among the flowers, boosting the cross pollination (jaffe., 1977 ; fleurat - lessard and millet, 1984 ; schlindwein and wittmann, 1997 ; scorza and dornelas, 2011). the fact that plants are capable of rapidly moving their structures without having any kind of neurological system is attributed to the capability of specific plant cells to swell or shrink by losing water quickly. the maintenance of a differential turgor pressure among plant tissues provides an energy storage that, when released, is capable of moving plant organs within seconds (sibaoka, 1991 ; braam, 2005 ; volkov., 2008, 2010b). this turgor pressure is maintained by the activity of proton pumps in the plasma membranes (h - atpase), which are coupled with k and cl fluxes (samejima and sibaoka, 1980 ; sibaoka, 1991 ; fleurat - lessard. when the cells get turgid the h - atpase proton pumps is acting extruding h protons outwards of the cell. in order to balance the proton gradient across the membrane, k ions are pumped inwards, increasing the cell s osmotic potential, and therefore, there is a water in - flux through aquaporins which causes swelling of the cells. when a mechanical or electrical stimulus is applied, an action potential triggers a rapid turgor loss associated with an efflux of ions in the cells that is followed by water (campbell and garber, 1980 ; moran, 2007 ; volkov. auxin is an important coordinator of plant growth and development, and one of the mechanisms where this hormone is involved is the regulation of water and ion permeability to cells (blatt and thiel, 1994 ; takahashi., 2012). in order to clarify how this hormone affects cell turgor regulation, experiments related to the pulvinar movements of cassia fasciculata, phaseolus vulgaris and m. pudica have been reported (watanabe and sibaoka, 1983 ; bourbouloux., 1992 ; bonmort and roblin, 1996 ; iino., 2001 ; moyen., 2007). applying indol-3-acetic acid (iaa) to protoplasts of pulvinus of p. vulgariscaused swelling of the cells. this was interpreted as enhanced effluxes of k and cl (iino., 2001). when exogenously applied in m. pudica and c. fasciculata, iaa (indol - acetic acid) increased the angles during the folding of the leaflets (bourbouloux., 1992). 2,4-d, a synthetic auxin, when applied, inhibited the leaflet folding by dark stimulus (bonmort and roblin, 1996 ; moyen., 2007) the auxin effects seem to be directed towards maintaining a high turgor pressure in the cells (bourbouloux. these experiments further contributed to the evidence that auxins stimulate the proton extrusion driven by h - atpases in the plasma membrane. although it was known that auxins have an effect on proton pumps, the mechanisms by which it acts became clear only recently, when takahashi. (2012) showed that auxins mediate h - atpase activation by phosphorylation of the penultimate threonine of the h - atpase during hypocotyl elongation in arabidopsis (takahashi., the p. sanguinolenta androgynophore is less sensitive to touch than thigmonastic fabaceae leaflets and also does not respond to a dark or light stimulus (scorza and dornelas, 2014). therefore, we tested the effects of auxin on the movement of the androgynophore of the model species, passiflora sanguinolenta. among the passiflora species that present a motile androgynophore, we chose p. sanguinolenta because this species shows a more conspicuous movement than the others, thus being easier to observe. additionally, as this species is evolutionary derived in relation to other decalobaspecies, and adapted to hummingbird pollination (scorza and dornelas, 2014), we tested whether the flowers of the interspecific hybrid between p. sanguinolentaand the more basal, insect - pollinated p. capsularis inherited thigmotropic androgynophore features. we also tested the effects of a specific inhibitor of the auxin efflux, 1-n - naphthylphthalamicacid (npa) on androgynophore movement. the effect of npa has not been tested before in the context of active plant movements. plants of passiflora sanguinolenta mast., passiflora capsularis l. and their ornamental interspecific hybrid named passiflora capsang (ulmer and macdougal 2004) were grown under greenhouse conditions at the universidade estadual de campinas, instituto de biologia, campinas, sp, brazil. to test whether the movement is influenced by exogenous application of auxin and an auxin polar transport inhibitor we prepared treatment solutions using indol-3-acetic - acid (iaa, sigma), and n-1-napthyl - phtalamic acid (npa, chem service, west chester, pa). (2007), where pulvinar movements were inhibited using 2,4-d, a synthetic auxin, at a final concentration of 0.1 mm. they argued that 2,4-d is about 10-fold more effective than iaa, so we used iaa for our experiments at 1 mm. a preliminary test was made spraying npa at 0.1 mm on the opened flowers still attached to the plant, and the movement tests were made 3 h after spraying. alternatively, recently opened flowers of p. sanguinolenta were removed from the plant and directly transferred to water to avoid desiccation. subsequently, the tips of the flower pedicels were cut with a sharp knife and immediately dipped in the treatment solutions (iaa 1 mm ; npa 0.1 mm and water as the control solution). these solutions were in petri dishes covered with parafilm, where tiny holes were made to fit the pedicels and keep the flowers in an upright position. the flowers were kept in the treatment solutions for about 3 h, as this was described as a period when, in general, the maximum effect was achieved in pulvinar movement experiments (moyen., 2007). after treatment with hormonal solutions we transferred the flowers to wet floral foam and removed part of the perianth to visualize the entire androgynophore (figure 1). the flowers were kept untouched for another 15 min as sometimes we touched the androgynophore when cutting off the perianth, inducing the thigmotropic movement. finally, we recorded the mechanically induced movement of the androgynophore and calculated the duration, the angle formed between the steady state (before the movement) and the final state (after the movement) and speed as described previously (scorza and dornelas, 2014). the same protocol was used to evaluate untreated flowers of the parental species (p. capsularis and p. sanguinolenta) and their interspecific hybrid (p. capsang). the results of the measurements presented in figures 2 4 are shown as mean values sd and asterisks indicate significant differences at p < 0.05 according to kruskal - wallis test. plants of passiflora sanguinolenta mast., passiflora capsularis l. and their ornamental interspecific hybrid named passiflora capsang (ulmer and macdougal 2004) were grown under greenhouse conditions at the universidade estadual de campinas, instituto de biologia, campinas, sp, brazil. to test whether the movement is influenced by exogenous application of auxin and an auxin polar transport inhibitor we prepared treatment solutions using indol-3-acetic - acid (iaa, sigma), and n-1-napthyl - phtalamic acid (npa, chem service, west chester, pa). (2007), where pulvinar movements were inhibited using 2,4-d, a synthetic auxin, at a final concentration of 0.1 mm. they argued that 2,4-d is about 10-fold more effective than iaa, so we used iaa for our experiments at 1 mm. a preliminary test was made spraying npa at 0.1 mm on the opened flowers still attached to the plant, and the movement tests were made 3 h after spraying. alternatively, recently opened flowers of p. sanguinolenta were removed from the plant and directly transferred to water to avoid desiccation. subsequently, the tips of the flower pedicels were cut with a sharp knife and immediately dipped in the treatment solutions (iaa 1 mm ; npa 0.1 mm and water as the control solution). these solutions were in petri dishes covered with parafilm, where tiny holes were made to fit the pedicels and keep the flowers in an upright position. the flowers were kept in the treatment solutions for about 3 h, as this was described as a period when, in general, the maximum effect was achieved in pulvinar movement experiments (moyen., 2007). after treatment with hormonal solutions we transferred the flowers to wet floral foam and removed part of the perianth to visualize the entire androgynophore (figure 1). the flowers were kept untouched for another 15 min as sometimes we touched the androgynophore when cutting off the perianth, inducing the thigmotropic movement. finally, we recorded the mechanically induced movement of the androgynophore and calculated the duration, the angle formed between the steady state (before the movement) and the final state (after the movement) and speed as described previously (scorza and dornelas, 2014). the same protocol was used to evaluate untreated flowers of the parental species (p. capsularis and p. sanguinolenta) and their interspecific hybrid (p. capsang). the results of the measurements presented in figures 2 4 are shown as mean values sd and asterisks indicate significant differences at p < 0.05 according to kruskal - wallis test. when the flowers of p. sanguinolenta were immersed in iaa at a final concentration of 1 mm for 3 h the mean of the angle formed by the androgynophore trajectory before and after the movement was significantly higher than in the control, where flowers were immersed only in water (figures 1 and 2). the time that the androgynophore took to bend after the mechanical stimulus was also increased in plants treated with iaa (figure 2). therefore, we did not find any difference when comparing the speed of the movement in flowers treated with iaa and the water control treatment (figure 2). flowers that were immersed in the auxin polar transport inhibitor npa also showed a significant increase in the values of the angle formed between the steady state and after the movement (figures.1 and 2). when analyzing the duration of the movement we did not find a statistical difference between the npa treated and the water control, albeit there was a tendency to an increase in time (figure 2). opened flowers of p. sanguinolenta sprayed with the npa test solution did not show any difference in the dynamics of the movement compared to control flowers that were not sprayed (figure 3). as it has been previously suggested that the hummingbird - pollinated p. sanguinolenta is derived in relation to other insect - pollinated decaloba species (scorza and dornelas, 2014), we tested whether the flowers of the interspecific hybrid between p. sanguinolenta and the insect - pollinated p. capsularis inherited thigmotropic androgynophore features. we observed that both p. capsularis and p. sanguinolenta presented similar angles formed by the androgynophore trajectory, but p. capsang showed a much wider movement when compared to the parental species (figure 4a). while the duration of the androgynophore movement was significantly shorter in p. capsularis when compared to p. sanguinolenta, it was even shorter in the interspecific hybrid (figure 4b). therefore, the speed that the p. capsang androgynophore took to bend after the mechanical stimulus was more than twice the one observed for the parental species (figure 4c). we tested whether exogenous application of auxin (iaa) or an inhibitor of its polar transport, npa, would alter the thigmotropic movement pattern of androgynophores of p. sanguinolenta. in a preliminary test we wanted to see whether spraying a solution containing npa at 0.1 mm would generate any response on the movement. our results showed that only spraying opened flowers was not sufficient to induce any effect on the movement, probably because the epidermis, together with the cuticle, was a barrier difficult to pass through. we did not intend to spray or treat young flower buds continuously with the " petiole - feeding " technique (lin., 2011 ; rocha., 2015) as this could alter the normal development of the flower organs (benkova., 2003). when we adopted a treatment procedure of dipping the flower pedicels at anthesis in the treatment solutions for 3 h we were able to detect effects of iaa and npa on the androgynophore movement. we observed that flowers treated witha1mmiaa solution showed a significant increase in the amplitude of their androgynophore bending movement (figures 1 and 2). this then caused an increase in the duration of the movement, as the androgynophore took more time to make the longer trajectory while the speed of the movement was unaltered when compared to the water control (figure 2). as we had previously shown that passiflora androgynophore movement presents certain mechanistic similarities with pulvinar movements (scorza and dornelas, 2014 ; scorza., 2014), it is worthy of note that when iaa or 2,4-d were applied to detached leaves of c. fasciculata, the amplitude of the leaflet opening induced by light increased, whereas the dark - induced closure of the leaflets was inhibited (bourbouloux., 1992 ; bonmort and roblin, 1996). when m. pudica leaflets were mechanically stimulated in darkness after application of iaa, rapid closure and opening were observed, similarly to what happens in daylight (watanabe and sibaoka, 1983). 2,4-d had a more drastic effect and inhibited touch - induced leaflet closure in m. pudica (moyen., 2007). the mechanism by which auxins influence the pulvinar movements is the activation of h - atpase proton pumps in the plasma membrane, leading to ion and water influx to the cells. this process leads to an increase in turgor pressure and the pulvinar cells are kept constantly turgid, preventing the leaflets to fold up during the dark induction period, and increasing the amplitude of the leaflet opening during the light induction. in p. sanguinolenta a similar effect of increased turgidity might have occurred, but the turgidity was not refractory to touch as sometimes also happened with fabaceae thigmonastic leaflets treated with auxins, and where the androgynophore was still inclined in response to a mechanical stimulus (samejima and sibaoka, 1980 ; moran, 2007 ; volkov. we have already shown that the basis of the movement of passiflora motile androgynophores is the swelling and shrinking of the androgynophore epidermis and parenchyma cells (scorza., 2014). if the cells get more turgid it is more likely that they also have the potential to lose more water when plasmolysed after being touch - stimulated. this would explain the increase in the amplitude of the p. sanguinolenta androgynophore movement, as seen after iaa treatment. auxin is a weak organic acid that enters the cell easily through diffusion across the plasma membrane (zazmalov., 2014). when inside the cells, most of the auxin dissociates in the anionic form, which makes it more difficult to be transported out of the cells. auxin efflux carrier proteins promote the transport of auxin from cell to cell in a directional manner (benkova., 2003). this process is commonly referred to as auxin polar transport, and it has been related to various aspects of plant development. the polar transport inhibitor npa is probably the most effective inhibitor of auxin polar transport (petrsk., 2003). npa impairs the auxin polar efflux, but has no influence on decreasing iaa concentration or activity ; on the contrary, it can increase auxin accumulation in the cells (morris. 2003). in our experiments, when npa was applied to p. sanguinolenta flowers, a very similar effect to iaa treatments was observed, as the amplitude of the androgynophore movement was also increased. in arabidopsis, stamina are major sites of iaa accumulation during flower development (aloni., 2006). as well as in many other species, arabidopsispetals only develop after stamina have almost fully developed. it has been shown that the high iaa production in young organs, especially in stamina, inhibits the development of other organs, such as petal elongation (aloni., 2006). the androgynophore column only develops at later stages of p. sanguinolentadevelopment, after the stamina and the gynoecium have already developed (our observations). the androgynophore column elongates concomitantly with petals and corona filaments, which also develop later during flower bud formation, suggesting that a mechanism similar to stamen inhibition by auxin might be involved in p. sanguinolenta flower development. under the hypothesis that the tip of each floral organ is a primary site of auxin production that can induce its own development and differentiation, and sometimes inhibit the growth of neighboring organs (aloni., 2006), it is reasonable to assume that the androgynophore, including the column, the stigma and the gynoecium, also produce auxin, which might be transported basipetally. when npa is applied, the auxin that might be produced by the p. sanguinolenta androgynophore would not be transported and, thus, accumulate at its base, generating a similar response as when exogenous iaa is applied. in passiflora there are many examples of flowers in which selective pressure has driven the evolution of novel mechanisms that impact on the reproduction and survival (lindberg and olesen, 2001 ; aizza and dornelas, 2011 ; rocha., 2015). in the flowers of p. sanguinolenta, p. citrina, p. capsularis and p. rubra, the motile androgynophore seems to be a novel feature that maximizes pollen deposition onto pollinators - hummingbirds in species with tubular flowers such as p. sanguinolenta and p. citrina and insects in bowl shaped flowers, such as those of p. capsularis and p. rubra. as we mentioned, the cellular basis of the movement is a subtle loss of turgor in cells at the stimulated side of the androgynophore, which is capable of turgor recovery within minutes, a mechanism that enables the organ to respond to a new stimulus, i.e., other pollinators visiting the flower (scorza and dornelas, 2014 ; scorza., 2014). accordingly, the cells of the androgynophore in our study were sensitive to the application of this hormone, showing as a phenotypic response an increase in the amplitude of the movement, which, in turn, has a potential role in the process of pollen transfer onto pollinators. this process seems to be especially decisive on the reproduction of self - incompatible species, as p. sanguinolenta and p. citrina (scorza and dornelas, 2014). taken together, these data put in evidence a probable role of auxin in modulating the fitness of these decaloba species to different pollinators. another issue is whether the thigmotropic androgynophore features are adaptively inherited for their potential role in the evolution of flower - pollinator relationships in passiflora. it has been suggested that hummingbird - pollinated xerogona species, such as p. citrina and p. sanguinolenta, are derived in relation to other insect - pollinated decaloba species (milward - de - azevedo.,, we therefore infer that the wide - moving androgynophores, characteristic of hummingbird - pollinated species (such as p. sanguinolenta) are derived with respect to insect - pollinated species with more restricted movement (such as p. capsularis). as artificial interspecific hybrids, used as ornamental plants, are widely available among passiflora species (ulmer and macdougal, 2004), we assessed the thigmotropic androgynophore features of p. capsang and its parental species, p. capsularis and p. sanguinolenta. we observed that the androgynophore movement of the hybrid is two - times faster than that of the parental species. although we can not discard the hypothesis that this particular phenomenon is of epigenetic nature, it seems more likely that it can be explained as a future studies on the gene expression profiles of the parental species and the interspecific hybrid should shed light on this unresolved issue. although the genetic nature of this heterosis remains to be determined, our results suggest that the characteristic features (such as speed) of the androgynophore movement are prone to be under evolutionary pressure. taken together and assuming that faster androgynophore movement can provide a greater fitness to flowers that are pollinated by hummingbirds, our results suggest general mechanisms by which hummingbird - pollinated flowers can arise from insect - pollinated ancestors. | the flowers of the species belonging to the genus passiflorashow a range of features that are thought to have arisen as adaptations to different pollinators. some passiflora species belonging to the subgenus decaloba sect. xerogona, show touch - sensitive motile androgynophores. we tested the role of auxin polar transport in the modulation of the androgynophore movement by applying auxin (iaa) or an inhibitor of auxin polar transport (npa) in the flowers. we recorded the movement of the androgynophore during mechano - stimulation and analyzed the duration, speed, and the angle formed by the androgynophore before and after the movement, and found that both iaa and npa increase the amplitude of the movement in p. sanguinolenta. we hypothesize that auxin might have a role in modulating the fitness of these decaloba species to different pollination syndromes and demonstrate that an interspecific hybrid between insect- and hummingbird - pollinated xerogona species present a heterosis effect on the speed of the androgynophore movement. |
early prenatal diagnosis of congenital anomalies often approaches the limits of ultrasonography in the first trimester of pregnancy. further evaluation can be performed by embryofetoscopy which provides direct visualization of the embryo and fetus. with the development of small fiberoptic endoscopes, transabdominal embryofetoscopy has been introduced in the first trimester of continuing pregnancies for early prenatal diagnosis of genetic syndromes with recognizable external fetal abnormalities that are beyond the resolution of current ultrasound in the first trimester (table 1) (1 - 7). this report of a case demonstrates the potential of first trimester embryofetoscopy, used in a patient whose fetus was at high risk for short rib - polydactyly syndrome (srps), type ii (majewski). a 30-yr - old married woman, gravida 4, termination of pregnancy 3, presented for prenatal diagnosis at 9 weeks of gestation in july, 2003 because she had had three babies affected by srps resulting in termination of each pregnancy consecutively since 1997. her first pregnancy, at the age of 24, was terminated at 23 weeks of gestation at local private clinic due to oligohydramnios and short limbs of the fetus. she was also told that the baby had cleft lip and polydactyly on gross examination without an autopsy. in the following year, she was referred to our hospital at 26 weeks of gestation with suspicious short limbs by ultrasound. srps, type ii (majewski type) was diagnosed after her second termination by the presence of narrow constricted thorax and short ribs, median cleft lip and palate, pre- and postaxial polysyndactyly in both hands and feet, renal tubular and glomerular cysts and short long bones including tibia. she was informed that recurrence risk of having another affected baby is 25% since srps is an autosomal recessive disorder. she became pregnant again at the age of 26 and prenatal sonographic evaluation was begun in our unit at 11 weeks of gestation. the short limbs suggested by conventional ultrasound at 18 weeks and preaxial polydactyly of hand and foot by 3d ultrasound at 21 weeks of gestation made her third pregnancy terminated. a cleft lip was also noticed. from the first beginning of prenatal care for her current pregnancy, early embryofetoscopic evaluation was suggested for the prenatal diagnosis of the srps because an embryofetoscope has been available in our unit since 2001. a transvaginal scan revealed that a crown - rump length (2.55 cm) of the fetus was compatible with clinical dates (9 weeks). combined screening test for chromosomal abnormalities with fetal nuchal translucency (1.2 mm) and maternal serum biochemistry of free -hcg (1.02 mom) and papp - a (0.53 mom) was negative (< 1:300) at 11 weeks of gestation., a transabdominal embryofetoscopy was offered and she was informed about the procedure, the risks and even the possibility of impaired visualization. an ultrasonography was performed for localization of the fetus and the placenta : a live fetus was in a supine position with the breech presentation and normal biometry of 6.99 cm crl (13 weeks), 2.64 cm bpd (14 weeks), 8.96 cm hc (14 weeks), 7.43 cm ac (14 weeks), and 0.73 cm fl (12 weeks). the abdomen was cleansed with a betadine solution. under local anesthesia with 1% lidocaine hydrochloride solution given into the subcutaneous tissues down to the myometrium, an 18-gauge needle (1.3 mm diameter) was inserted transabdominally with ultrasound guidance through the uterine wall and the lower margin of anterior placenta into the amniotic cavity. the 1 mm endoscope (karl storz, tuttlingen, germany), connected to a xenon light source, was placed through the lumen of a 18-gauge needle after removal of the stylet and systematic visualization of the fetus was begun with gentle movements of the needle. the hands were clearly seen and there was no polydactyly or syndactyly of the fingers (fig. the external genitalia was seen and still somewhat indeterminate but suggestive of a male (fig. both feet were seen and again, there was no poly- or syndactyly of the toes (fig. direct visualization of the fetus was achieved and no gross limb or facial abnormalities were seen. she was discharged 2 days after procedure without any complications of fluid leakage, bleeding or uterine contraction. follow - up ultrasound in the second trimester was advised and was performed so that normal biometry could be obtained. at 20 weeks of gestation, normal fetal anatomy and adequate femur length were confirmed. serial ultrasound examinations were performed throughout the remainder of pregnancy and continued to reveal normal fetal growth and development without evidence of fetal malformations. a normal full - term female infant was born at 39 weeks of gestation via a normal vaginal delivery., there was no evidence of facial or limb abnormalities. at our last follow - up at 2-months of age, the infant weighed 6,427 g and continued to do well with a normal ophthalmologic examination. short rib - polydactyly syndrome is a lethal skeletal dysplasia with marked limb reduction, narrow constricted thorax, short horizontal ribs, pre- and postaxial polydactyly and frequent cardiac defects and cystic renal dysplasia. the majewski type (type ii) has additional cleft lip / plalate and disproportionately shortened tibia (8 - 10). considering the limitations of therapy, prenatal diagnosis with selective termination of pregnancy is an important option for couples at risk. at the present time, the responsible gene for disorder has not been identified and therefore, the only method of prenatal diagnosis has to be made on the detection of its phenotypic manifestations. the prenatal diagnosis of majewski type has been made in fetuses at risk by identification of short tibia, polydactyly, and cleft lip at fetoscopy using 1.7 mm diameter of endoscope at 16 weeks of gestation (12), or severe micromelia, short ribs with narrow thorax, and polydactyly at ultrasound (13, 14). the earliest sonographic diagnosis has been made at the 16th week of gestation (14). despite the use of vaginal ultrasound, fetal cleft lip has not been diagnosed until 14 weeks of gestation (15, 16) and is usually recognized during the second trimester. the fingers and toes of the fetus could always be clearly identified with embryoscopy as early as 9 weeks of gestation (17). prenatal diagnosis of cleft lip was made at 11 weeks of gestation using embryoscopy (18). therefore, embryofetoscopy offers a distinct advantage over current diagnostic techniques in that it can assess limb while also ruling out facial anomalies early in gestation. recently first - trimester embryofetoscopy has been utilized for early prenatal diagnosis of external developmental defects to either confirm or rule out. our use of thin gauge needle embrofetoscopy in a pregnancy at risk for srps highlights the potential of this technique for investigating early in gestation the anatomical features of the fetus and embryo in utero. care should be taken in determining a fetal sex by external genitalia in the first trimester. until 11 weeks of gestation the external genitalia of the two sexes are similar in appearance ; the phallus is as big in the female as in the male and develops into penis or clitoris at 11 weeks of gestation. labium minora and majora are formed from 11 to 14 weeks of gestation (19). we would not see the genitalia during the follow up fetal ultrasound examination after embryofetoscopy. it is pointed out again that distinguishing features of the external genitalia appear in 11 weeks of gestation but the external genitalial organs are not fully differentiated into male or female until 14 weeks of gestation (20). occasional sex reversal (46, xy with female phenotype) can occur in type i and ambiguous genitalia can be seen in type ii (10). published data do not exist regarding morbidity specifically related to transabdominal embryofetoscopy in continuing pregnancies. the risks of fetal loss, infection, and amniotic membrane rupture are expected to be similar to those associated with early amniocentesis (21, 22). this procedure has a fetal loss rate of 2 - 2.5% (23, 24). there had been no evidence of damage to the retina in infants born after first trimester transcervical embryoscopy (25). it is emphasized that the risks of first - trimester embryofetoscopy still remain to be established. | our aim was to demonstrate the potential of first - trimester embryofetoscopy for prenatal diagnosis in a continuing pregnancy. a patient at risk for giving birth to an infant with short rib - polydactyly syndrome, type ii (majewski), presented for prenatal diagnosis at 9 weeks of gestation. a 1 mm semirigid fiberoptic endoscope with an 18 gauge examination sheath and a single - chip digital camera were used for transabdominal embryofetoscopy. transabdominal embryofetoscopy was performed at 13 weeks of gestation. direct visualization of the fetus was achieved and no gross limb or facial abnormalities were seen. this case shows that embryofetoscopy is a useful tool for early diagnosis in high - risk patients in the first trimester for continuing pregnancies. |
epidemiological studies indicate that more than 70% of diabetes mellitus (dm) patients die of cardiovascular disease (cvd) ; this number is 2 - 3 times higher than the mortality of cvd in the nondiabetic population. the prevention of cardiovascular events is a very important goal in the treatment of dm. diabetic cardiomyopathy (dcm) is one of the major cardiac complications in dm patients. the incidence of dcm is very high, and the disease is highly dangerous, directly causing mortality due to cardiovascular events in dm patients. in recent years, many large - scale studies confirmed that a reduction in hemoglobin a1c (hba1c) alone did not benefit the primary cardiovascular endpoint. therefore, in addition to the control of blood sugar, studying and developing new types of antidiabetic drugs for cardiovascular protection have become popular in the field of dm research. mitogen - activatedproteinkinases (mapks) are a group of intracellular serine / threonine protein kinases. the mapk signaling pathway is present in most cells ; this pathway transduces extracellular signals into cells and nuclei and plays an important role in biological functions (such as proliferation, differentiation, transformation, and apoptosis). a series of studies in recent years showed that pathological signals such as high glucose, activation of the polyol pathway, and oxidative stress all activated mapks ; therefore, mapks become a converging point for different signaling pathways induced by high glucose. some scholars have thus regarded mapks as signal transducers of dm complications induced by high glucose levels. the activation of the mapk signal transduction pathways also causes and accelerates the development and progression of dcm to some extent. the mapk family is involved in a series of changes associated with coronary artery disease such as fibrosis, cell hypertrophy, and migration and is considered to be the primary cause of restenosis after arterial and venous reconstructions. the p38 mapk signaling pathway is an important member of this family. as a kinase activated by oxidative stress, p38 mapk primarily participates in apoptosis, immune regulation, cell transdifferentiation, and inflammatory response in response to oxidative stress. the p38 mapk signaling pathway is activated by many stimulating factors such as reactive oxygen species, inflammatory factors, high glucose, and angiotensin ii, thus exacerbating myocardial fibrosis and ischemia [46 ]. studies showed that inflammation plays an important role in the onset and development of dcm. the p38 mapk signaling pathway and inflammation may be an important pathogenic mechanism underlying dcm. studies showed that phosphorylated p38 mapk (p - p38 mapk) activated related inflammatory factors such as nf-b and tnf- and caused a series of proinflammatory responses, thus causing pathophysiological changes such as apoptosis and left ventricular remodeling [710 ]. pathophysiological mechanisms associated with the development of type-2 dm such as high - glucose toxicity, oxidative stress, and angiotensin ii are also indirectly regulated by the p38 mapk signaling pathway. in cultured endothelial cells, increasing concentrations of glucose further activate the p38 mapk signaling pathway. these results confirmed that the p38 mapk signaling pathway plays an important role in the pathogenesis of dcm. the abnormal production of inflammatory factors and chemokines and the differential activation of the p38 mapk signaling pathway in different cells may be a potential mechanism of pathogenesis underlying the damage of endothelial cells and cardiac function in dm. prostacyclin (pgi), which was first discovered in 1974, is primarily produced by vascular endothelial cells. pgi is a metabolic product of arachidonic acid and has strong antiplatelet and vasodilation functions. however pgi is also very unstable, has a short half - life, and has a poor oral bioavailability. as a prostacyclin analog (pgi2), beraprost sodium (bps) avoids the above shortcomings. functions of bps include vasodilation, antiplatelet effects, inhibition of vascular cell adhesion molecule 1 (vcam-1) expression, inhibition of inflammatory factor release, and inhibition of vascular endothelial injury caused by reactive oxygen species. for these reasons, bps may be highly effective for the prevention and treatment of microvascular complications of dm. our previous studies preliminarily showed that bps treatment effectively reduced the levels of inflammatory factors such as il-6, myeloperoxidase (mpo), and high - sensitivity crp (hs - crp) in rats ; improved oxidative stress system disorders in rats ; and reduced oxidative stress reactions and inflammatory injury. these benefits were all independent of the reduction of blood pressure ; however, whether these benefits have protective effects on dcm remains clear. inflammation, oxidative stress, and proliferation of vascular intimal and fibrous tissues are involved in the onset and development of dcm ; thus, inflammatory injury and vascular intimal proliferation may become a new therapeutic target for dcm. preliminary pharmacological studies showed that p38 mapk - specific inhibitors had therapeutic effects on myocardial ischemia, myocardial apoptosis, and left ventricular hypertrophy ; however, the specific mechanism remains to be elucidated. this study aimed to study the effects of treatment with bps on type-2 dm rats and to investigate its effect on the p38 mapk signaling pathway in the heart of type-2 dm rats, its effects on oxidative stress and inflammatory reactions, and its function as a quantitative indicator for myocardial apoptosis and heart failure, which will provide new ideas about the clinical treatment of dcm. a total of 40 6-week - old, male, specific - pathogen - free (spf)-grade sprague - dawley (sd) rats with body weights of 180 20 g were purchased from the animal center of the second military medical university. animals were housed in clean - grade animal rooms in the animal center of the second military medical university. the animal production permission was scxk (shanghai) 2007 - 0003, and the animal use permission was syxk (shanghai) 2007 - 0003. animals were housed in different cages with 5 animals in each cage with an artificial light cycle. the light and dark times per day were 12 h/12 h, the temperature was 21 2c, and the humidity was 55 2%. animal treatments were performed in accordance with the principles of experimental animal care (nih publication no85 - 23, amended in 1985). bps (dena) was a gift from astellas pharma inc. ; depc was provided by shanghai biocolor bioscience & technology. trizol, the rt - pcr reagent kit, and dna markers were from invitrogen. primers for p38 mapk target genes and the internal control gapdh were synthesized by shanghai daweike biotechnology. the rna guard reagent was purchased from shanghai huashun biological reagent co. ; the revertra ace reverse transcription reagent kit and sybr green real - time pcr master mix were from toyobo (japan). the mouse anti - human p - p38 antibody, mouse anti - human total p38 (t - p38) antibody, goat anti - human tnf- antibody, goat anti - human mmp-9 antibody, goat anti - rat cox-2 antibody, goat anti - rat fn antibody, and goat anti - human creb antibody were from santa cruz biotechnology (usa). tgf-1, sod, gsh, and mda assay kits were purchased from nanjing jiancheng biotech (nanjing, china). citric acid and sodium citrate were purchased from sinopharm chemical reagent co., ltd. and 2.5% glutaraldehyde was purchased for scanning electron microscopy from fudan university 's school of medicine. the 8000b tabletop centrifuge was from beijing scientific instrument factory, and the up400s tissue homogenizer was from shanghai scientific instrument factory. the electrophoresis apparatus and the electrotransfer apparatus were from bio - rad (usa). the leica thermostat water bath, leica cml900 frozen cut tablet machine, leica egl160 paraffin - embedded machine, leica rm2135 microtome, leica dcs00 fluorescence microscope, and leica image analysis system were from leica (germany). after 1 week of adaptive feeding, sd rats were randomly divided into the control (cn) group (n = 10) and the model group based on the random number table method. after the insulin - resistant model was established, stz (dissolved in 0.1 mol / l citric acid buffer, ph 4.3) was intraperitoneally injected at 30 mg / kg. two weeks later, rats were fasted for 8 h, and 20% d - glucose solution was administered at 2 g / kg to perform oral glucose tolerance tests. when glucose levels at 0 min and 120 min were higher than 7.0 mmol / l and 11.0 mmol / l, respectively, the type-2 dm rat model was established successfully. the cn group was intraperitoneally injected with the same dose of citric acid buffer (ph 4.3, 0.1 after the model was successfully established, rats were randomly divided into the nonintervention dm group (n = 12) and the bps intervention dm group (dm + bps ; n = 12) based on the random number table method. rats in the dm + bps group were treated with bps (0.6 mg / kg / d), whereas rats in the cn and dm groups were intragastrically administered an equal volume of double distilled water at the same time every day. animals were sacrificed at the end of week 12. at the end of the experiment, after fasting for 12 h, intraperitoneal glucose tolerance tests (ipgtts) were performed on rats that were about to be sacrificed. rats were then anesthetized by intraperitoneal injection of 10% chloral hydrate at 4 mg / kg. the abdomen was opened, and blood samples were collected from the abdominal aorta. half of tissue samples were fixed in 10% neutral - buffered formalin for histopathological examination. oxidative stress products, superoxide dismutase (sod), malondialdehyde (mda), glutathione (gsh), and other related factors were measured, using blood samples. the activation of the p38 mapk signaling pathway in myocardial tissues was determined using rt - pcr and western blotting. in addition, protein levels of tnf-, caspase-3, bax, bcl-2, hypoxia inducible factor 1 subunit (hif-1), brain natriuretic peptide (bnp), atrial natriuretic peptide (anp), and matrix metalloproteinase-9 (mmp-9) were determined. blood samples of rats were centrifuged at 3,000 rpm for 15 min at 4c, using an automatic biochemistry analyzer (hitachi. malondialdehyde (mda), glutathione (gsh), and superoxide dismutase (sod) and transforming growth factor 1 (tgf-1) in blood were, respectively, assessed by means of thiobarbituric acid (tba), chemical colorimetry, xanthine oxidase, and elisa double antibody sandwich assay. each sample was repeated in 6 wells, and a negative control without template cdna was also used. the amplification conditions were 50c for 2 min ; 95c for 10 min ; 40 cycles of 95c for 15 s ; and 60c for 1 min. after amplification, the melting curve was plotted starting from 60c to validate the specificity of the amplification products. after the reaction was performed, baseline and thresholds were established, and the threshold cycle (ct) values one hundred micrograms of rat myocardia was weighed on ice and stored at 80c after being aliquoted. protein samples were quantitated using the bca method ; the absorbance of each well was determined using a microplate reader at a wavelength of 560 nm, and a standard curve was plotted. an 8% resolving gel with a 4% stacking gel was prepared, and samples were loaded for electrophoresis. after protein samples were transferred onto a membrane and blocked for approximately 1 h, 1 : 1000 dilutions of the primary antibodies, t - p38 mapk, p - p38 mapk, tnf-, tgf-1, bax, bcl-2, hif-1a, bnp, anp, or mmp-9, were added and incubated at 4c overnight. horseradish peroxidase- (hrp-) conjugated secondary antibodies at a 1 : 2000 dilution were added and incubated at 37c for 1.5 h. after washing with tbst four times for 10 min, protein bands were analyzed using the bio image system (a gel documentation system ; syngene, a division of synoptic, ltd) to obtain optical density values. after sacrificing the rats in each group, tissue blocks from left ventricle were taken, fixed with 4% neutral formalin, dehydrated with graded ethanol, embedded in paraffin, and conventionally prepared into myocardial paraffin slices with a slice thickness of 5 m and then stained with h&e, and the slices were sealed with neutral gum. myocytes were considered to be tunel - positive when the nuclei were identified as staining dark brown. in each tissue specimen, five high - power fields (400) were randomly selected ; the apoptotic index (ai) was calculated in these fields as the percentage of positive cells, given by the following equation : ai = (number of positive cells / total number of cells) 100%. the comparison of mean values among multiple groups was performed using the one - way analysis of variance (anova) ; the comparison between two groups was examined using the least significant difference (lsd) test. the comparison of physiological and metabolic indicators before and after drug administration was performed using the paired t test. compared with the cn group, heart weight significantly decreased in the dm group (p 0.05). compared with dm group, the level of mda decreased in bps group ; the difference was statistically significant (p 0.05). compared with the dm group, the expression of p38 mapk mrna in rats in the bps group significantly decreased (p 0.05) (figure 6). the mrna for tnf-, mmp-9, and hif-1 in the myocardial tissues of rats significantly increased in the dm group (p 0.05). compared with the dm group, the levels of tnf-, mmp-9, and hif-1 mrna in rats of the bps group significantly decreased (p 0.05) (figure 7). compared with the cn group, the expression of caspase-3 and bax mrna significantly increased (p 0.05). compared with the dm group, the expression of caspase-3 and bax mrna significantly decreased and the expression of bcl-2 mrna significantly increased in bps rats (p 0.05). compared with the dm group, the expression of bnp and anp mrna in rats of the dm group significantly decreased (p 0.05) (figure 10). protein expression levels of inflammatory factors in the myocardia. compared with the cn group, mmp-9, tnf-, and hif-1 expression in the myocardial tissues of rats in the dm and bps groups significantly increased (p 0.05). compared with the dm group, the expression of p38 mapk mrna in the bps group significantly decreased (p 0.05). the results of this study suggested that, in the type-2 dm rat model, the p38 mapk signaling pathway was activated, the production of related inflammatory factors increased, and cardiac injury accelerated. bps inhibited the production of inflammatory factors and protected the heart by decreasing the activity of the pathway ; these beneficial effects were closely associated with a decrease in inflammation and oxidative stress. these results indicated an important role for p38 mapk in the stimulation of inflammatory signaling pathways and also showed a significant anti - inflammatory function of bps. inflammation and progression of fibrosis induced by oxidative stress play important roles in the onset and development of dcm. the p38 mapk signaling pathway links many cytokines and growth factors that can activate p38 mapk to inflammation and oxidative stress injury, thus exacerbating cardiac injury in dm. our results demonstrated that the serum tgf-1, mda, tnf-, mmp-9, and hif-1a levels were significantly higher and sod and gsh levels were markedly lower than that of the cn group (p < 0.01), showing that the oxidative stress was significantly enhanced and inflammatory cytokine production was increased. bps treatment significantly decreased the serum mda, tnf-, mmp-9, and hif-1a levels of dm group (p < 0.05). tgf-1 is one of the most important cytokines associated with myocardial fibrosis and one of the common mediators in the late stage of myocardial fibrosis. in cytology an abnormal increase of tgf-1 plays a crucial role in the onset and development of myocardial fibrosis. serum sod in type-2 dm patients is decreased, and the mda level is increased, which makes the study of the role of sod and free radical in dm possible. mda promotes the crosslink between nucleic acid, protein, and lipid, resulting in mutation, degeneration, senescence, or even death of cells. the more serious the oxidative stress is, the greater the organism 's antioxidant ability is and the greater the insulin resistance is. sod are enzymes that remove the toxic superoxide radicals in vivo, by catalyzing the chain reaction of lipid peroxidation (lpo), to protect the cells from damage. therefore, an increase of sod levels may achieve the balance between the production and reduction of free radicals and may be very important in the prevention and control of the chronic diabetic vasculopathy. gsh is a widely distributed peroxidase, catalyzing toxic peroxides into ordinary carbonyl compounds, reducing lpo caused by reactive oxygen species such as free radicals, preventing damage to important cellular components, and showing an antisenility effect to some extent. tnf- is one of these cytokine networks and is involved in many inflammatory responses, which can induce the release of many types of cytokines. during the induction of inflammatory responses, tnf- has a chemotactic function on neutrophils and monocytes and can cause their activation and degranulation to release inflammatory mediators. it was confirmed that tnf- induces the expression of adhesion molecules by vascular endothelial cells. adhesion molecules attach to inflammatory cells and enhance the expression of procoagulant factors and plasminogen activator inhibitors in endothelial cells, thus promoting a series of effects such as intravascular thrombosis and the proliferation of endothelial and vascular smooth muscle cells. the heart is both the location of tnf- production and the target organ of tnf-. the overexpression of tnf- is harmful to the heart. tnf- inhibits the expression of glucose transporter type 4 in myocardial cells, decreases glucose utilization, depletes myocardial atp, decreases atp - dependent na+-ca2 + exchange on muscle fiber membranes, causes intracellular calcium overload, and affects myocardial systolic and diastolic function. however, tnf- also induces the overexpression of inducible nitric oxide synthase (inos) and the production of a large amount of no, thus inhibiting normal myocardial contraction. in addition, tnf- also acts as a mediator of myocardial apoptosis ; pretreatment with tnf- monoclonal antibodies significantly reduces myocardial apoptosis. the activation of the p38 mapk signaling pathway promotes the activation of inflammatory factors, promotes tnf- synthesis, activates tnf--mediated e - selectin expression, and regulates the expression of tnf--induced vascular cell adhesion molecule 1 (vcam-1) in epithelial cells. of the mapk family members, ask1 activates two different kinases : mapkk - sek1 (mkk4) and mkk3/mapkk6 (mkk6). studies showed that ask1 was activated by the action of tnf-, indicating that tnf- in turn activates the p38 mapk signaling pathway through the activation of mapkkk upstream of p38 mapk. this study determined that tnf- expression in rats of the dm group significantly increased compared with that of rats in the cn group (p < 0.01), suggesting that there was a significant inflammatory response in the hearts of rats in the dm group. the expression levels of tnf- significantly decreased after bps intervention (p < 0.01). the results of this study suggested that bps decreased the levels of tnf- expression, inhibited p38 mapk activity, and reduced inflammatory responses in the heart. the mmp family is a group of highly conserved, zinc - dependent endopeptidases that use extracellular matrix components as hydrolysis substrates. mmps function in many pathophysiological processes including inflammatory reactions, embryonic development, immune responses, tissues remodeling, and tumor metastasis. mmp-9, a member of this family also known as gelatinase, primarily hydrolyzes denatured collagen and is closely associated with cvd. mmp-9 is the end product of inflammation and acts as an inflammatory mediator that participates in inflammatory reactions and tissue destruction. the activation of the p38 mapk signaling pathway induces the production and increases the release of mmp-9. we also observed that mmp-9 expression in the type-2 dm rat model significantly increased compared with that of the control group (p < 0.01) ; after bps intervention, the expression level of mmp-9 significantly decreased in the intervention group (p < 0.01). these results suggest that mmp-9 is involved in the development of inflammation during the progression of dcm. through the inhibition of p38 activity, bps could decrease the expression level of mmp-9 in the heart and delay inflammatory injury. hif-1 is a nuclear transcriptional regulator that participates in the onset and development of dcm through the regulation of its downstream genes. under hypoxia, hif-1 promotes angiogenesis by activating vascular endothelial growth factor (vegf) ; thus, the metabolism of the body can be adapted to hypoxic environments. the effect of hif-1 on increasing the levels of vegf is decreased in dm patients. the increase in hif-1 expression in the dm group was significantly higher than that in the control group, indicating that the increased hif-1 expression in dm promoted myocardial apoptosis. p38 mapk activates hif-1 in vascular smooth muscle cells and regulates the expression of hif-1 through the phosphorylation of hif-1. our study observed that hif-1 expression in the type-2 dm rat model was significantly higher than that in the control group (p < 0.01) ; after bps intervention, hif-1 expression significantly decreased in the intervention group (p < 0.01). the results of this study suggested that, by inhibiting p38 activity, bps decreased the expression level of hif-1 in the heart and delayed heart failure. apoptosis of myocardial cells participates in the pathological process of many cvds, including cardiomyopathy, myocardial infarction, and congestive heart failure. the caspase family is a group of proteases containing caspase-3. as a common central processor of apoptosis pathways, caspases not only mediate b cell apoptosis and participate in the onset and development of dm but also mediate myocardial cell apoptosis. myocardial cell apoptosis may be one of the causes of the loss of myocardial cells and heart failure in dcm. fas - mediated apoptosis also involves p38 mapk ; the activation of the p38 mapk pathway activates caspase-3 and begins the apoptosis process. our study observed that the expression of caspase-3 in the type-2 dm rat model was significantly higher than that in the control group (p < 0.01), whereas after bps intervention, the level of caspase-3 in the intervention group significantly decreased (p < 0.05). these results suggested that bps reduces the level of caspase-3 in the heart, decreases myocardial apoptosis, and protects cardiac function by inhibiting p38 activities. the main functions of bcl-2 are to promote cell survival, prolong cell lifespan, and inhibit apoptosis. in contrast to bcl-2, bax promotes apoptosis, although bax is also a bcl-2 family member. the relative concentrations and balance between these two proteins play important roles in the regulation of apoptosis. bcl-2 family proteins act upstream of mitochondria ; these proteins regulate the permeability of the mitochondrial membrane, thus regulating the activation of downstream caspase proteases and mediating cell survival or death. it was reported that bcl-2/bax were important components for mapks to exert their functions [3840 ]. when bcl-2 is in excess, the formation of bcl-2/bax heterodimers can prevent apoptosis ; when bax is in excess, the formation of bax / bax homodimers promotes apoptosis. therefore, the ratio of bcl-2/bax determines the sensitivity of cells to apoptosis - inducing signals. under normal circumstances, p38 mapk is located in the cytoplasm ; once activated, it will be rapidly translocated into the nucleus to activate mapk - activated protein kinases 2 and 3 and caspase family members. in our study, we observed that the expression of bcl-2 mrna in the type-2 dm rats was significantly lower than that in the control group (p < 0.01), whereas the expression of bax mrna was significantly higher than that in the control group (p < 0.01). after bps intervention, the bcl-2 level significantly increased in the intervention group and the bax level significantly decreased (p < 0.05). these results suggested that bps decreased myocardial apoptosis and protected myocardial cells of dcm dependent on the bcl-2/bax ratio. some peptide neurohormones play important roles in the determination of diagnosis and treatment of dcm ; in addition, their concentrations are closely associated with the prognosis of dcm. bnp is a hormone which is secreted by ventricular myocytes ; myocardial ischemia, necrosis and injury, ventricular wall tension, and high pressure stimulate the synthesis and secretion of bnp. bnp is then released into the peripheral blood, which significantly increases the concentration of bnp in the blood of patients. although the concentration of bnp reflects the degree of myocardial ischemia and necrosis, it also positively correlates with the severity of heart failure and occurs before myocardial necrosis. a persistent increase in bnp value is an independent risk factor of death from heart failure., we observed that bnp expression in the type-2 dm rat model was significantly higher than that in the control group (p < 0.01), suggesting that there was significant myocardial ischemia and necrosis in dm rats. after bps intervention, the bnp level significantly decreased in the intervention group (p < 0.05). the results showed that bps decreased the bnp level in the heart and indicated that bps alleviated myocardial ischemia, delayed heart failure, and protected cardiac function. anp is an endocrine hormone mainly synthesized and secreted by cardiac tissues (mainly the atria) that is closely associated with cardiac function. an increase in left atrial pressure and volume load can stimulate the atrial wall pressure - volume receptor, thus increasing anp secretion by myocardial cells. dcm typically causes myocardial hypertrophy and stretching, which may cause changes in anp levels. thus far, much experimental and clinical evidence has shown that because the plasma anp level is directly associated with left ventricular pressure, at the early stage of some cardiac diseases, the circulating level of anp reflects the early stage of cardiac dysfunction, or in other words, the anp level reflects the presence and severity of asymptomatic left ventricular dysfunction. with the aggravation of myocardial hypertrophy, a continuous increase in anp secretion by ventricular myocytes significantly correlates with the degree of ventricular hypertrophy. our studies showed that the expression of anp in the type-2 dm rat model was significantly higher than that in the control group (p < 0.01), suggesting that there were significant ventricular hypertrophy and increased left ventricular pressure in dm rats. after bps intervention, the anp level in the intervention group significantly decreased (p < 0.05). these results showed that bps decreased anp levels in the heart and indicated that bps reduced ventricular hypertrophy and improved left ventricular dysfunction. however, due to the limitations of experimental conditions, this study did not involve cardiac doppler examination in diabetic rats to further clarify the condition of cardiac functions. the relationship between different types of p38 mapk and dcm and the specific target of bps also requires further studies. overall, our animal studies showed that by activating the p38 mapk signaling pathway, bps inhibited the production of inflammatory factors caused by oxidative stress in type-2 dm, decreased the protein levels of hif-1, tnf-, and mmp-9 in myocardial tissues, downregulated caspase-3 levels, and increased the ratio of bcl-2/bax, thus decreasing inflammatory injury, reducing myocardial apoptosis, improving myocardial ischemia and myocardial hypertrophy, delaying heart failure, and delaying the progression of dcm. this study confirmed the protective effect of bps on the heart and its possible underlying mechanism using animal experiments ; these data provide new ideas for the clinical treatment of dcm. | objective. to investigate the effect of beraprost sodium (bps) on diabetic cardiomyopathy and the underlying mechanism. methods. a total of 40 sprague dawley rats were randomly divided into the normal control group (n = 10) and the model group (n = 30). the model group was fed a high - fat diet followed by a one - time dose of streptozotocin (stz) to establish the diabetes mellitus model. after that, rats were randomly divided into two groups with or without bps intervention. after 8 weeks, we explored the role of the p38 mapk signaling pathway in inflammation, oxidative stress, cardiac morphology, and myocardial apoptosis. results. compared with control, the ratio of heart - weight to body - weight and the serum levels of sod and gsh in the bps group significantly increased, the expression of p38 mapk, the serum levels of mda, tgf-1, tnf-, hif-1, mmp-9, caspase-3, bnp, anp, and heart bax expression significantly decreased, and heart bcl-2 expression significantly increased. h&e staining in diabetic rats showed the cardiac muscle fibers derangement, the widening gap, the pyknotic and fragmented nuclei, and more apoptosis. conclusions. bps effectively showed protective effects on diabetic myocardial cells, possibly through the inhibition of p38 mapk signaling pathway. |
primary cancer of the male urethra cancer occurs rarely. it entails less than 1% of all cancers of the urogenital system in men. more rarely it develops in the distal part of the urethra. in about 80% of the patients, it is a squamous cell carcinoma (scc) and in 15% it is a transitional cell carcinoma (tcc). the first symptom usually includes hematuria, which occurs at the beginning of voiding, or a blood leak from the urethra regardless of micturition, as well as a narrowed stream of urine. the purpose of this paper was to present a surgically treated patient, who was diagnosed with the primary tcc of the distal part of the urethra. a 76-year - old patient, reported to our urology outpatient department in october 2008 due to hematuria, which he observed at the beginning of micturition, a narrowed stream of urine, and a palpable small tumor in the distal part of the urethra. physical examination of the penis revealed the presence of an oval, painless, solid tumor measuring approximately 2 cm in diameter, located in the peripheral part of the urethra, just below the glans penis. an ultrasonographic evaluation of the upper urinary tracts and the urinary bladder did not reveal any pathological lesions. in the ultrasonographic evaluation of the penis we established a hypoechogenic area measuring 2.5 x 1.5 cm that was clearly separated from the surrounding area in the distal part of the penis at the site of the palpable tumor. micturition urethrocystography and urethrocystoscopy performed on november 16, 2008 supported and confirmed the preliminary diagnosis of tumor of the anterior urethra. the procedure of turt was performed on november 18, 2008. immediately after the procedure the histopathological evaluation of the specimens of the urethral tumor revealed the following diagnosis : tcc g3, high grade, and lack of normal tissue makes an evaluation of the depth of infiltration impossible. on january 20, 2009, a follow - up urethrocystoscopy was performed and specimens were collected from the urethra. the histopathological evaluation revealed that a neoplastic structure was not established. after three months, in april of 2009, follow - up cytological evaluation of the urine sediment was performed and the presence of neoplastic cells was not established. the next cytological evaluation of the urine sediment, performed in february 2010 revealed the presence of neoplastic cells in the urine sediment. the patient reported the appearance of blood in the urine at the beginning of voiding, and physical examination revealed a small palpable tumor in the distal part of the urethra again. the patient was qualified for urethrocystoscopy and the procedure was performed at the beginning of march 2010. radical treatment including surgical removal of the distal part of the urethra with neoplastic lesion was proposed to the patient. the patient did not consent to this type of treatment so a second electroresection of the urethral tumor was performed on the 23 of march 2010. the histological evaluation provided the following diagnosis : urothelial carcinoma g2, high grade, pt1. the next urethroscopy with specimen collection for histopathological evaluation was performed on the 11th of june 2010. the evaluation result : invasive urothelial carcinoma, high grade, pt1, g2. due to the occurrence of another local relapse, the patient was qualified for an open surgery. this time the patient gave his consent, but the procedure date was postponed due to cardiac disease in the patient. it included sharp preparation of the distal segment of the urethra at the length of approximately 2.5 cm with a margin of 0.5 cm of healthy tissues and excision of this part of the urethra. then, the remaining unchanged segment of the urethra was longitudinally incised and sutured to the skin of the abdominal surface of the penis, after previous placement of foley catheter no. primary cancer of the male urethra is a cancer developing within the prostatic, membranous, and, more rarely, the spongy segment of the urethra without an accompanying neoplasm within the urinary bladder. it occurs rarely, as it composes nearly 1% of all malignancies of the urogenital system in men. in 80% of cases, it is a squamous cell carcinoma and in 15% it is a transitional cell carcinoma. the diagnosis is supported by a precise medical history, ultrasonographic evaluation, urethrocystography, and urethrocystoscopy. however, the final diagnosis is established based on histopathological evaluation of collected specimens. the urethral cancer spreads by continuity, via blood and lymphatic vessels. metastases of the cancer are usually located in the spongy - membranous part and most often occur in the internal and external iliac lymph nodes and the obturator lymph nodes. cancer metastases from the penile part mainly relate to the inguinal lymph nodes and the external iliac lymph nodes. they include : hematuria occurring at the beginning of voiding, a blood leak regardless of micturition, a narrowed stream of urine to the retention of urine, pain of the penis and the perineum, the tumor noticeable in palpation (the penile part of the urethra) [16 ]. presence of the tcc located in the distal part of the urethra was established in the described patient. cancer metastases to the lymph nodes were not established. due to location of the neoplastic lesions and the nature of histopathological structure, follow - up urethroscopy performed after two months revealed no neoplastic lesions within the urethra. the patient did not provide his consent for the surgical procedure of partial amputation of the penis. after the second electroresection and another relapse, the patient provided his consent for the open surgery. the procedure of choice for urethral cancer located in the distal segment of the urethra is partial amputation of the penis [2, 4 ]. in this case, the distal part of the urethra was excised with part of the glans penis. the major part of the glans penis remained, and the urethra was implanted to the abdominal part of the penis. such management is connected with the necessity for regular follow - up visits. in each similar case, the patient should receive detailed information about the necessity for regular follow - up visits. within the diagnostics of hematuria occurring at the beginning of micturition, presence of the primary urethral cancer should be considered. in radical treatment of the male urethral cancer, if the neoplastic focus is located in the distal part of the urethra, it is possible to save part of the penis after partial excision of the urethra. ultrasound evaluation. the glans penis part of the penis is visible. within its area, there is hypoechogenic zone located in the distal segment of the urethra, within the palpable tumor location. a, b. partial excision of the anterior urethra and a part of the glans penis. circular incision of the urethral ostium located at the top of the glans penis without the prepuce. c. the urethra was sharply prepared at the length of approximately 2.5 cm with a margin of 0.5 cm of healthy tissues. d. excision of the distal part of the urethra with neoplastic lesions. excised distal segment of the urethra with the tumor and the margin of healthy tissue. b, c. incision of the urethra and suturing it to the skin of the abdominal surface of the penis, after previous placement of the foley catheter no. 16 into the urinary bladder. surgically created hypospadias resulted from excision of the distal part of the urethra together with the tumor. | we present a 76-year - old male patient, who was diagnosed with transitional cell carcinoma (tcc) of the distal part of the urethra. transurethral resection of the tumor (turt) of the urethra was conducted. after establishing local relapse, surgical removal of the distal part of the urethra was proposed to the patient. due to no consent for an open surgery, another electroresection of the tumor was performed. when the second relapse occurred, the patient provided his consent for surgical removal of the part of the urethra with anastomosis of the remaining part of the urethra with the skin from the abdominal part of the penis. postsurgical observation did not reveal any local relapse. |
the defects of the soft palate are difficult to reconstruct because of their complicated anatomy and causing velopharyngeal incompetence for speech and swallowing function. many reconstruction techniques have been described to improve postoperative function after oropharyngeal resection including soft palate, but the use of these heterogeneous procedures has resulted in variable speech and swallowing outcome. recently, reconstructive options have been significantly expanded and revitalized by the advent of free tissue transfer. the thin, pliable nature of the fasciocutaneous flaps is ideally suited for oropharyngeal reconstructions, especially when the defect involves multiple sites, such as the pharyngeal wall, soft palate, and tongue base. the radial forearm free flaps (rfff) have been widely used for soft palate reconstruction, but the reconstructed soft palate contracts during the healing phase and there is a risk of an increasing space developing between the reconstructed soft palate and posterior pharyngeal wall (1). this effect is likely to be increased during postoperative radiotherapy as a result of further shrinkage and poor mobility due to fibrosis (2). we have modified the conventional rfff by de - epithelialization of medial margin of the flap for reconstruction of the soft palate to minimize postoperative velopharyngeal incompetence. the purpose of this study is to introduce our modification method of radial forearm free flap and to compare the velopharyngeal function, swallowing and speech, of the conventional and modified radial forearm free flap for soft palate reconstruction. from january 1995 to december 2001, 28 patients who underwent soft palate and lateral oropharyngeal reconstruction with a rfff in surgical management of tonsil cancer were evaluated for postoperative speech and swallowing function in present stud y. the size of the soft palate resection was estimated by examining the patient at the time of assessment. larger resections were graded one half if the uvula was not included and three quarter if it was part of the resection. patients were eligible for this study if the posterior margin of the soft palate was included in the resection and the soft palate defects extended one half to three quarter. all patients of two groups had intact contralateral lateral oropharyngeal - including palatopharyngeal, palatoglossal, and superior constrictor - muscles matched by size of the soft palate resection. of this group in 28 patients, 10 patients underwent reconstruction by conventional rfff and 18 patients underwent reconstruction by modified rfff. no patients received speech therapy during the time of follow - up, but all patients had swallowing therapy before discharge from the hospital. for the resection of the soft palate, the access preferred was a mandibulotomy approach and delivery of the en bloc resection in continuity with neck dissection. once the resection was completed, the size and shape of the defect was mapped onto a piece of sterilized paper, and used by the team raising the flap on the forearm. the conventional rfff was designed with bi - lobed or tri - lobed on distal part of the flap and sutured to the mucosal edge of anterior soft palate, posterior oropharyngeal wall, and lateral tongue or mucosa of retromolar trigone (fig. the medial margin of the flap was sutured to the mucosal edge of the posterior oropharyngeal wall toward the nasopharynx, and the area of the flap in contact with the cut end of the soft palate is de - epithelialized and sutured to the remaining soft palate (fig. 2, 3). speech intelligibility was evaluated with the 10-point scoring system of hirose (3) and the presence of hypernasality was assessed (table 1). and for objective assessment, we measured nasalance with nasometer (model 6200b, kay elemetrics corp., lincoln park, nj, usa), which reflects the ratio of acoustic energy output of nasal sounds from the nasal and oral cavity. the nasalance (%) was measured during the patient read the no nasal passage (nasal consonant ratio [ncr ] 0%) and high nasal passage (ncr 34.7%). was used to assess swallowing (table 2). a statistical analysis using the fisher 's exact test from january 1995 to december 2001, 28 patients who underwent soft palate and lateral oropharyngeal reconstruction with a rfff in surgical management of tonsil cancer were evaluated for postoperative speech and swallowing function in present stud y. the size of the soft palate resection was estimated by examining the patient at the time of assessment. larger resections were graded one half if the uvula was not included and three quarter if it was part of the resection. patients were eligible for this study if the posterior margin of the soft palate was included in the resection and the soft palate defects extended one half to three quarter. all patients of two groups had intact contralateral lateral oropharyngeal - including palatopharyngeal, palatoglossal, and superior constrictor - muscles matched by size of the soft palate resection. of this group in 28 patients, 10 patients underwent reconstruction by conventional rfff and 18 patients underwent reconstruction by modified rfff. no patients received speech therapy during the time of follow - up, but all patients had swallowing therapy before discharge from the hospital. for the resection of the soft palate, the access preferred was a mandibulotomy approach and delivery of the en bloc resection in continuity with neck dissection. once the resection was completed, the size and shape of the defect was mapped onto a piece of sterilized paper, and used by the team raising the flap on the forearm. the conventional rfff was designed with bi - lobed or tri - lobed on distal part of the flap and sutured to the mucosal edge of anterior soft palate, posterior oropharyngeal wall, and lateral tongue or mucosa of retromolar trigone (fig. the medial margin of the flap was sutured to the mucosal edge of the posterior oropharyngeal wall toward the nasopharynx, and the area of the flap in contact with the cut end of the soft palate is de - epithelialized and sutured to the remaining soft palate (fig. 2, 3). speech intelligibility was evaluated with the 10-point scoring system of hirose (3) and the presence of hypernasality was assessed (table 1). and for objective assessment, we measured nasalance with nasometer (model 6200b, kay elemetrics corp., lincoln park, nj, usa), which reflects the ratio of acoustic energy output of nasal sounds from the nasal and oral cavity. the nasalance (%) was measured during the patient read the no nasal passage (nasal consonant ratio [ncr ] 0%) and high nasal passage (ncr 34.7%). swallowing function was used to assess swallowing (table 2). a statistical analysis using the fisher 's exact test from january 1995 to december 2001, 28 patients who had soft palate and lateral oropharyngeal wall excised because of squamous cell carcinomas of the tonsil subsequently underwent primary reconstruction with rfff. the 28 patients (20 male and 8 female) ranged in age from 36 to 77 yr (average age, 62.4 yr). ten patients underwent reconstruction by conventional rfff and 18 patients underwent reconstruction by modified rfff. in 10 conventional rfff, tumors were classified as t2 in 1 patient, t3 in 7, and t4 in 3. and in 18 modified rfff, t2 in 3, t3 in 10, and t4 in 5 patients (table 3). neck dissection had been performed in all patients, and postoperative radiotherapy had been performed in 26 patients. the mean follow up duration was 32 months and speech and swallowing function was evaluated at least 6 months after surgery. the average speech intelligibility score in modified rfff group was 8.02.4, and 6.22.2 in conventional rfff group (p<0.05). the nasalance was 27.47.8% in modified rfff group and 38.6 2.7% in conventional rfff group during no nasal passage reading and 43.67.3% in modified rfff group, 55.27.6% in conventional rfff group during high nasal passage reading (p<0.05) (table 4). the subjective swallowing functional score by the seattle questionnaire was 2.8 in modified rfff group, 2.1 in conventional rfff group. from january 1995 to december 2001, 28 patients who had soft palate and lateral oropharyngeal wall excised because of squamous cell carcinomas of the tonsil subsequently underwent primary reconstruction with rfff. the 28 patients (20 male and 8 female) ranged in age from 36 to 77 yr (average age, 62.4 yr). ten patients underwent reconstruction by conventional rfff and 18 patients underwent reconstruction by modified rfff. in 10 conventional rfff, tumors were classified as t2 in 1 patient, t3 in 7, and t4 in 3. and in 18 modified rfff, t2 in 3, t3 in 10, and t4 in 5 patients (table 3). neck dissection had been performed in all patients, and postoperative radiotherapy had been performed in 26 patients. the mean follow up duration was 32 months and speech and swallowing function was evaluated at least 6 months after surgery. the average speech intelligibility score in modified rfff group was 8.02.4, and 6.22.2 in conventional rfff group (p<0.05). the nasalance was 27.47.8% in modified rfff group and 38.6 2.7% in conventional rfff group during no nasal passage reading and 43.67.3% in modified rfff group, 55.27.6% in conventional rfff group during high nasal passage reading (p<0.05) (table 4). the subjective swallowing functional score by the seattle questionnaire was 2.8 in modified rfff group, 2.1 in conventional rfff group. because of complex function and anatomy of oropharynx, reconstruction after ablation surgery for oropharyngeal cancer is always challenge to the head and neck reconstructive surgeon. among of various reconstruction methods, free flap transfer is widely used method to reconstruct defect following head and neck cancer surgery recently. especially rfff is the most common flap to reconstruct oral cavity and oropharynx because skin is thin, pliable, abundant and well vascularized, which allows for considerable freedom in flap design and in accurate insetting (5). but, not only natural healing process but also adjuvant radiation therapy following head and neck ablation surgery can cause considerable loss of flap volume and constrict flap and adjunctive mucosal tissue. so a head and neck reconstructive surgeon must predict volume loss of flap after surgery and radiation therapy. to reduce flap contracture and shrinkage, we modified rfff by de - epithelialize the cut end area of the soft palate of flap and sutured to the remaining soft palate. kimata. (6) used denude method (7) that is similar to ours in flap design and surgical technique. they suggested that denude method should be used to fill more extensive defects and to narrow the velopharyngeal space. this method could easily fill defects ; however, the velopharyngeal space is somewhat difficult to control. the results of speech assessment demonstrate a more favorable speech outcome reported in modified rfff group with an average speech intelligibility score of 8.0 compared with 6.2 in conventional rfff group. and these findings confirmed by the results of nasalance measurement. the nasalance in modified rfff group was significantly less than in conventional rfff group both no nasal passage and high nasal passage. it is because the speech function is influenced by the velopharyngeal space, and narrowing the velopharyngeal space is important for obtaining satisfactory speech functional results (6). comparing with conventional rfff, we can get more sufficient volume with this modified rfff, and that, it is possible to decrease the size of velopharynx by shortening the distance between the posterior pharyngeal wall and the modified rfff flap (fig. there might be two possible weak points, first, this procedure may cause temporary bulkiness of initial flap, but it 's not the essential problem of airway because tracheostomy was performed for all patients. second, it 's not easy to calculate precise length of remaining soft palate after resection. but assessment of swallowing does not demonstrate an obvious advantage in modified rfff group (2.8 in modified rfff group, 2.1 in conventional rfff group). the reason of no statistical difference in swallowing function between modified and conventional rfff group is that swallowing is more affected by the extent of resection rather than by the type of flap used for reconstruction (8). and our patients had more advanced - staged tonsil cancer, so that more extensive resection of soft palate had been required. we recognized the reduced swallowing function after radiation therapy due to the dysmotility of the oropharyngeal and laryngeal structures. but we did not compare the swallowing function between postoperative radiation and postoperative non - radiation group because the size of postoperative non - radiation group (n=2) is too small to compare. the acknowledged weaknesses of the present study include, first, small sample size, which may have resulted in limited statistical power. and second, the extent of resection and volume of resection was not considered in this study. third, patients with poorer functional outcome are more likely to drop out of a longitudinal study, which may lead to bias in the results and understatement of the level of dysfunction. the surgical modification for reconstruction of soft palate and lateral oropharyngeal defect has been suggested in this study. this comparative analysis indicates the potential advantage of the modified rfff, although further study is important to substantiate these results. | objectivesto compare the velopharyngeal function, swallowing and speech of the conventional and modified radial forearm free flap (rfff) for soft palate reconstruction.methodsretrospective clinical study. twenty - eight patients who underwent oropharyngeal reconstruction with rfff were divided into two groups : 10 patients had conventional folded rfff and 18 patients underwent modified method.resultsthe average speech intelligibility score in modified rfff group was 8.02.4, and 6.22.2 in conventional rfff group (p<0.05). the nasalance was 27.47.8% in modified group and 38.62.7% in conventional group during no nasal passage reading and 43.67.3% in modified group, 55.27.6% in conventional group during high nasal passage reading (p<0.05). the subjective swallowing functional score was 2.8 in modified group and 2.1 in conventional group.conclusionthe speech assessment and nasalance demonstrate a more favorable outcome in modified group than conventional group. |
breast cancer (bc) originates from the epithelial cells of the breast tissue that line the terminal duct lobular unit. bc is the most common cancer type that affects world population. more than 180,000 new cases of bc were diagnosed in 2008 in the united states alone. over bc in women is the most commonly diagnosed cancer that accounts for 26% of all new cancer cases. well - known growth signaling pathways contribute to generation and progression of bc among other cancer types by promoting cell growth and proliferation. these signaling pathways are promoted by a number of membrane - bound and intracellular receptors. the gene expression and biological activities of these receptors may have great impact on bc tumor initiation, progression, relapse, and prevention or treatment. estrogen receptor (er), progesterone receptor (pr), rearranged during transfection (ret), and human epidermal growth factor 2 (her2) are the main membrane - bound receptors playing key roles in bc. antibody therapy, on the other hand, was initiated with development of trastuzumab (tzmb) that specifically targets her2 in 20 to 30% of bc cases where her2 is strongly present. resistance to hormone therapy and tzmb therapy are two major hurdles in current clinical bc therapy. in this paper, we will focus on the main causative sources of tzmb therapy and recent developments in exploration of key molecules that hold promise for eradication of this resistance. the her / egf family of receptors consists of four cell - surface receptors named her1 (erbb1), her2 (erbb2), her3 (erbb3), and her4 (erbb4) [4, 5 ]. they are activated by a ligand that causes heterodimerization of these receptors so that a cascade of phosphorylation and signal transduction events is initiated leading to transcription of specific genes involved in cell proliferation and survival. receptor dimers that contain her2 produce stronger and more prolonged signal transduction event than those dimmers formed by other her receptors [46 ]. the gene encoding her2/neu (erbb2) is a protooncogene located in chromosome 17q21 and encodes a 185-kd transmembrane glycoprotein with tyrosine kinase activity [4, 5 ]. intracellular domain has a terminal carboxy segment autophosphorylation of which transmits the extracellular signal into an intracellular signal transduction event. in 2030% of breast cancer tumors, the her2 receptor is either amplified, overexpressed, or undergoes both events [4, 7 ]. receptor overexpression is generally due to gene amplification, with one study reporting up to a 25-fold increase in her2 copy number. tumors with her2 overexpression generally have a poor disease - free survival [9, 10 ]. high levels of her2 have strong correlations with the pathogenesis, and prognosis of breast cancer [11, 12 ]. overexpression of the her2 protein is detectable both in the primary tumors and in metastatic sites indicating the effectiveness of anti - her2 therapy in all disease locations. her2 is distinguished from other her family members by lack of a natural ligand which makes the molecule a suitable therapeutic candidate. in addition, a strong correlation exists between her2 levels and carcinogenesis [14, 15 ]. high levels of her2 found in cancer cell membranes compared to those of normal cells and her2 expression in both primary tumors and metastatic sites have made her2 inhibitors important for breast cancer therapy [16, 17 ]. research on stem cells as the initiators of breast cancer development has elucidated the status and function of the her2 receptors in bc stem cells (bcscs). studies on patient samples show a significant correlation between her2 overexpression and the expression of aldehyde dehydrogenase 1 (aldh1) a key marker for bcscs. overexpression also acts as a driving force for breast stem cell malignancy, mammary tumorigenesis and invasion. generation of mammospheres is an indication of increased self - renewal in these stem cells, whereas the size of these colonies that indicates proliferation of progenitors is also increased by her2. the report by korkaya and coworkers indicates that her2 not only increases stem - cell number but also upregulates the expression of stem cell - related genes including oct3/4, nothc1, notch2, jag1, gli1 in aldefluor cells. estradiol as an er ligand induces a signal transduction cascade that trans - activates her2 via src tyrosine kinase and the matrix metalloproteases mmp-2 and mmp-9. er / her2 interactions activate erk and mapk pathways and the two receptors equally contribute to erk amplification in human mammary epithelial cells. therefore, er and her2 act in synergy to promote aberrant breast tumor growth. co - expression of her2 and er co - activator a1b1 at high levels enhances tamoxifen resistance. in fact, in mcf7 tumor cell line overexpressing her2 and a1b1, tamoxifen promoted tumorigenicity by inducing tumor cell growth both in vitro and in vivo. her2 was one of the first receptors targeted with the invention of its specific monoclonal antibody tzmb. the encouraging preclinical results of this therapy took tzmb to clinic. currently, tzmb is used alone or as adjuvant with chemotherapy for treatment of breast cancer, especially in advanced stages of the disease. tzmb is a recombinant humanized monoclonal antibody directed against the extracellular domain of her2 inhibiting receptor dimerization [24, 26 ]. the mechanism of tzmb action on her2-overexpressing tumors is not fully known, but experimental data exist that indicate the antibody influences several intracellular pathways all in favor of tumor cell death. the multiple effects of tzmb can be explained by her2 involvement in multiple signaling pathways. tzmb - her2 interaction inhibits these cascades leading to increased levels of p27 ultimately arresting cell cycle and inducing apoptosis. induction of antibody - dependent cellular cytotoxicity (adcc) leading to cancer cell lysis [24, 29 ] and inhibition of angiogenesis are two other effects of tzmb in favor of bc treatment. the overall response rate to tzmb monotherapies is ~26% compared to 4060% when a tzmb - chemotherapy combination is applied [25, 30, 31 ]. an important function of tzmb on her2 is to prevent receptor degradation and cleavage. this function can be shown by examining serum samples in tzmb - treated patients who have reduced levels of her2 shedding in their serum. tzmb - mediated reduction of her2 levels in patients ' serum has been accompanied with improved progression - free survival and so considered an indicative of host response to the antibody therapy. in addition to its effect on her2 dimerization and cleavage, tzmb can cause her2 internalization and degradation as shown in her2-amplifying bc cell lines and tumor samples treated with the antibody [34, 35 ]. it is not clear, however, if tzmb actually contributes to her2 gene downregulation, since some studies report unchanged levels of her2 upon tzmb treatment [29, 36 ]. resistance to tzmb therapy occurs in both de novo (intrinsic) and acquired forms. the de novo resistance results from genetic changes in receptor tyrosine kinases (rtks) and their downstream cellular pathways. the main genetic changes in this case include deficient pten or mutated pik3ca genes that cause the constitutive activation of the pi3k pathway, and expression of a truncated, rather than full length, her2 receptors named p95her2 that lack extracellular domain needed for tzmb binding. the acquired form of tzmb resistance is caused mainly by shaping compensatory kinase signaling pathways alternative to her2-mediated pathways leading to bc cell growth and tzmb insensitivity. there are also genetic alterations that are source of both de novo and acquired forms of resistance. below, we outline some of the main mechanisms behind tzmb resistance that we have summarized in table 1. in addition to genetically shortened her2 receptors, cleavage by metalloproteases generates a truncated her2 receptor lacking the extracellular domain required for tzmb binding. the truncated receptor will retain its kinase activity undisturbed in the absence of any blocker. the truncated her2 versions might be a source of de novo tzmb resistance because her2 cleavage can be blocked by tzmb that prevents resistance to be acquired in the course of treatment. tzmb can be deprived of reaching and effectively binding her2 due to function of the membrane - bound glycoprotein mucin-4 (muc4). muc4 contributes to bc progression by protecting cancer cells from immune recognition, inducing tumorigenicity and metastasis, suppressing apoptosis, and activating her2. using its asgp-2 subunit that contains an egf - like domain, muc4 can directly bind her2 and induce her2 phosphorylation. through this interaction, muc4 competes with tzmb for her2 binding as shown in bc cell lines overexpressing muc4. studies on patient - derived cell lines with her2 amplification and de novo resistance to tzmb demonstrated an inverse correlation between her2-binding capacities of muc4 and tzmb. these observations suggested that her2 epitopes are masked by muc4 which causes steric hindrance of trastuzumab - her2 interaction and shapes antibody resistance. the four members of egfr type 1 growth factor rtk family, namely, egfr, her2, her3, and her4 tend to dimerize with her2 as a partner of their choice when induced by their relevant ligands. this heterodimerization results in rtk activity that is echoed by activation of downstream signaling, components via the mapk and pi3k pathways. the function of tzmb is to prevent her2-mediated signaling but it can not effectively inhibit signaling promoted by other her receptors. therefore, heterodimers or homodimers constituted by egfr and her3 may induce pi3k / mapk pathways. growth inhibition induced by tzmb can also be prevented by the activity of endogenous her family ligands that induce her2/her3 and her2/egfr signaling [47, 48 ]. these observations indicate that the overall efficacy of tzmb can be dictated by the endogenous status of egfr family members, their ligands, and inhibitors. determination of the levels of these molecules within bc cells could help to improve tzmb function. another solution is to block crosstalks between rtks using bispecific antibodies or combination of tzmb and lapatinib or tzmb and pertuzumab that seem to confer more improvement to recipient patients [49, 50 ]. the insulin - like growth factor-1 receptor (igf-1r) is a transmembrane tyrosine kinase receptor predominantly expressed in human bcs and involved in proliferation and metastatic dissemination. igf-1r since both igf-1r and her2 promote common downstream pathways of cell growth and proliferation, the study shows that their cooverexpression inhibits tzmb - mediated growth inhibition. therefore, it is likely that tumors coexpressing the two receptors resist tzmb - mediated therapy. on the other hand, drugs acting as igf-1r antagonists such as igfbp3 that blocks igf resensitize resistant bc cells to the antibody. like other receptor kinases, igf-1r is also dependent on pi3k / akt pathway for its biological functions including p27 degradation. igf-1r has been further found to induce phosphorylation of her2, an activity of igf-1r observed only in tzmb - resistant cells. restoration of tzmb sensitivity in bc cells upon inhibition of igf-1r signaling either by antibody - mediated blockage or igf-1r tyrosine kinase inhibition introduces signaling pathways downstream of igf-1r as therapeutic targets to break antibody resistance. mutated or downregulated pten leads to its loss of function, a phenomenon described in nearly 50% of breast cancers. since pten has inhibitory effects on pi3k, loss of pten function constitutively maintains the activity of the pi3k / akt pathway that inhibits cell - cycle arrest and apoptosis mediated by tzmb. patients with bc tumors that lack pten expression but overexpress her2 more poorly respond to tzmb therapy than those patients with normal pten expressed by their tumor cells. in fact, in those patients with tumors reluctant to respond to tzmb therapy but with high - level piten expression, inhibition of pi3k / akt pathway could provide another therapeutic opportunity in clinic, as shown by tzmb and lapatinib response upon pten loss and pi3k activation. the cyclin - dependent kinase - inhibiting protein p27 mediates growth inhibitory effects of trastuzumab. trastuzumab has positive effects on p27 half - life and supports formation of p27-cyclin - dependent kinase 2 (cdk2) complexes that arrest cell cycle at g1. in fact, inhibition of p27 expression blocks trastuzumab - mediated growth arrest in her2-overexpressing bc cells. overexpression of p27 or its induction by the proteasome inhibitor mg132 restored trastuzumab sensitivity that highlights the critical role of p27 in trastuzumab function. on the other hand, cdk2 inhibitors result in reduced cell proliferation and enhanced apoptosis in vitro and reduced tumor growth in xenografts resistant to trastuzumab. earlier we outlined the importance of pten loss in constitutive activation of the pi3k / akt pathway leading to tzmb resistance. pik3ca that encodes the catalytic subunit of pi3k is a gene frequently mutated in breast cancer and promotes tzmb insensitivity in bc cells in vitro. in vivo studies also point to the anti - tzmb role played by mutated versions of pik3ca when applied with reduced pten expression. in parallel, her2-amplified breast cancer cell lines containing pik3ca hotspot mutations more significantly resisted tzmb than mutant - free cells. the overexpression of the cyclin e in bc cell lines and tumor samples has been proposed as a marker of poor clinical outcome. a previous study indicated reduction of cyclin e levels upon her2 downregulation and her2 inhibition and so suggested cyclin e regulation by her2. it is now emerging from a recent report that cyclin e might have an impact on her2 function in bc cells. in this paper, genome - wide analysis of tzmb - resistant bc cell lines and tumor cells indicates that cyclin e is amplified and so overexpressed in these cell samples. in this study, the amplified cycline e gene was found to worsen clinical outcome and reduce progression - free survival. while cycline e overexpression enhanced tzmb resistance both in vitro and in vivo, suppression of cyclin e activity highly reduced cell proliferation and induced apoptosis among cyclin e - amplifying bc cells. cyclin e suppression mediated by cdk2 inhibition reduced tumor growth among xenografts that were insensitive to tzmb. the use of cdk inhibitors could be a novel approach to counteract antibody resistance in targeting her2. crosstalks with er and with rtks, as we discussed in section 4, are critical for activation of signaling pathways leading to bc tumor growth. ret tyrosine kinase interacts with src kinase upon activating protein kinase c (pkc) and induces upregulation of many growth pathways through the function of src as key inducer of tzmb resistance discussed below. more importantly, src mediates ret / her2 crosstalks : phosphorylated in its sh2 domain via gdnf / ret downstream plc / pkc pathway, src induces her2 phosphorylation by matrix metalloproeinases mmp2 and mmp9 (figure 1). ret is also in crosstalk with er for er gene overexpression and receptor stabilization. in bc cell lines resistant to tamoxifen treatment, her2 signaling pathways are selected against ret / er pathways to promote cell growth whereas targeting ret restores drug sensitivity. phosphorylated src activates alternative receptors rtks met and fak both of which promote mitogenesis and cancer cell growth (figure 1) [52, 53 ]. met downstream pathway includes ras, raf, and mapk / erk1/2, whereas fak induces crk / cas and deregulation of both pathways can promote cancer cell growth alternative to other receptors. the capacity of bc cells in switching from one receptor to another for growth promotion suggests that ret, like other rtks, can induce alternative growth signaling in support of resistance to tzmb therapy. although the function of ret in tzmb - resistant cells and tumor samples has not been reported, ret inhibition might be a novel strategy to overcome such resistance. tzmb - mediated growth arrest and bc cell death are partially due to the induction of immune responses by the antibody. antibody - dependent cellular cytotoxicity (adcc) is induced by tzmb and other antibodies targeting her2 leading to apoptosis in several bc cell lines [29, 45, 71 ]. anti - her2 antibody - mediated bc cell death occurs via natural killer (nk) cells that, by expressing the fc gamma receptor, interact with the fc domain of the antibody. the importance of this interaction has been shown in a xenograft model of mice lacking fc receptor where tzmb could only partially inhibit tumor growth. these findings indicated the role of the immune system in sustaining anti - her2 therapies. based on reports that src is commonly activated in egfr / igf-1r - overexpressing and pten - deficient cells, the molecule appears to play a central role in development of resistance against her2-mediated antibody therapy. this is particularly important in terms of src involvement in common events downstream of key growth signaling pathways and so src function as a common node in promoting tzmb resistance. src encodes a nonreceptor tyrosine kinase that in its active form contributes to many hallmarks of cancer including cell proliferation, migration, and angiogenesis [73, 74 ]. the src family contains four src homology domains called sh and a c - terminal segment that has a negative regulatory tyrosine residue (tyr530). src is activated upon phosphorylation that is catalyzed by protein tyrosine phosphatase alpha and sh - containing phosphatases shp1/shp2. on the other hand, src kinases including rtks egfr, her2, fgfr, pdgfr, and vegfr activate the protein by phosphorylating it. for instance, tumor necrosis factor (tnf) induces her2 phosphorylation in breast cancer cells via c - src activation. another example is erythropoietin receptor (epor) that induces mapk / erk and pi3k / akt pathways. bc cell lines coexpressing epor and her2 induce tzmb resistance upon treatment with recombinant erythropoietin that interacts with phosphorylated epor. activated src and inactivated pten for example, overexpression of rtks egfr and igf - ir induces tyr416 phosphorylation and promotes antibody resistance whereas sirna - mediated suppression of these kinases reduces resistance. src has been shown to inhibit pten activity by inducing tyrosine phosphorylation and blocking pten membrane localization [37, 80 ] suggesting that src and pten may regulate each other to promote tzmb resistance. further examined the role of src in de novo insensitivity of bc tumor cells to trastuzumab treatment by inhibiting pten. antisense- or shrna - mediated downregulation of pten induced src tyr416 phosphorylation, src activation, and ultimately elevated tzmb resistance, whereas induction of pten phosphatase activity directly dephosphorylated src tyr416 residue and so abolished src activity. these observations indicate that the loss of pten phosphatase activity induces src activation and so implicates src in shaping de novo tzmb resistance in pten - deficient cells. indeed, hyperphosphorylation of tyr416 that increases src activity is an inducing factor for tzmb resistance, whereas tyr416 dephosphorylation sensitizes bc cells to tzmb - mediated growth arrest. the activity of src per se and its role in antibody resistance was examined using both src small - molecule inhibitor saracatinib and src shrna molecules. inhibition of src halted egf - induced egfr dimerization and inhibited phosphorylation of an egfr residue known to be src - dependent phosphorylation site and an autophosphorylation site within egfr. moreover, treatment with tzmb further activated src due to the transient induction of her2 dimerization / phosphorylation by tzmb in resistant cells. in contrast, inactivation of src by saracatinib or src shrnas diminished tzmb - induced transient phosphorylation of her2 as well as her3. these observations indicate that src hyperactivity in tzmb - resistant bc cells promotes a positive feedback cycle where src activates egfr, her2, and her3 which, in turn, can activate src. overall, the report by zhang. highlights the increasing central role of src as common converging point for all the intracellular forces that contribute to shaping and re - gaining bc cell resistance toward her2-directed treatments specially tzmb therapy. tzmb is an antibody of choice for her2-directed bc therapies. in patients with metastatic, her2-positive breast cancer, tzmb administered as an adjuvant combined with chemotherapy shows significant clinical benefits [25, 80 ]. however, the majority of her2-positive patients do not respond to tzmb due to de novo or acquired resistance. abnormalities in her2 structure / function and in downstream signaling pathways as well as rtk crosstalks have been suspected causes as evidenced by examination of bc cells and tumor samples in vitro and in vivo. the most recent studies pinpoint to src acting as a downstream signaling effector and a central common node in mediating tzmb resistance. receptor crosstalks blocked by bispecific antibodies or by tzmb combined with lapatinib or pertuzumab have shown better clinical outcomes compared to single antibody treatment. therefore, a multipronged strategy capable of effectively blocking the her2 signaling network is needed to inhibit her2 homodimerization and her2-rtk heterodimerization, so her2-dependent malignant bc tumors become fully controllable. compensation for loss of expression or activity of several molecules involved in tzmb resistance may partially reverse resistance and resensitize bc cells and tumors to the antibody. however, disarming common nodes, for example, by inhibition of src expression and or function holds promise for universally combating resistance and controlling her2-positive bc tumors. coinhibition of src and rtks that promote bypassing growth pathways such as ret, fak, and met could provide a global coverage against tzmb resistance. | epidermal growth factor (egf) family of receptors is involved in cell growth and differentiation. the human egf2 (her2) lacks natural ligands, and correlation between her2 levels and carcinogenesis makes the receptor an ideal candidate for targeted therapy in breast cancer. trastuzumab is a humanized antibody applied against her2-positive breast tumors in clinic. metastatic tumors respond well to trastuzumab therapy for the first year, but development of antibody resistance helps the tumors to regrow allowing the disease to progress. trastuzumab resistance is shaped via a range of intracellular signaling pathways that are interconnected and share in key effector molecules. identification of a common node central to these resistance pathways could provide an ultimate solution for trastuzumab resistance in breast and other cancers. |
apical periodontitis is an infection of the area around the root of a tooth, usually caused by bacteria. although bacterial infection can be substantially reduced by standard intracanal procedures such as intracanal medication and root canal treatment, it is very difficult to render the root canal free of bacteria. this is because bacteria are located in inaccessible areas such as deep inside the dentinal tubules and lateral canals and it is difficult for any intracanal medication to reach these locations. moreover, bacteria may survive and re - colonize in the areas around the root canal whenever there is opportunity and this may become a primary source of persistent infection. bacteria are commonly found within dentinal tubules of clinically infected canals. among these bacteria, enterococcus faecalis is of interest because it is the most frequently detected species in root - filled teeth with persistent lesions. some possible factors facilitating the long - term survival of e. faecalis in the root canal system are its ability to invade dentinal tubules, where it can survive for a prolonged period under adverse conditions such as starvation, high ph of calcium hydroxide medication and adhesion of e. faecalis to collagen. angiotensin - converting enzyme (ace) and a serine protease (spr) are the collagen binding proteins produced by e. faecalis. with the help of these proteins, ace promotes the binding of e. faecalis to type i collagen and in vitro ace gene expression at 37c was enhanced in the presence of collagen. in this study, the interaction of e. faecalis with root cementum and its role in persistent infection was investigated. this in vitro study was conducted in the department of conservative dentistry and endodontics. teeth sterilization (gamma irradiation at 25 kgy) was performed at microtol, bangalore. data was obtained using an inverted confocal laser scanning microscope (clsm) (zeiss lsm 510 meta. gmbh, mannheim, germany) at the indian institute of science, bangalore. a total of 60 human single - rooted teeth recently extracted for orthodontic reasons were collected for the study., caries - free teeth were examined under 20 microscope to rule out any cracks, caries, fractures or craze lines and radiographed to confirm the presence of a single canal. teeth that had already undergone root canal treatment or teeth with more than one canal, immature root apices, root caries, restorations, fractures or craze lines, thin curved roots and calcified canals were excluded from the study. the teeth were cleaned off soft - tissues, calculus and stains using sharp hand scalers and thoroughly washed under running tap water to remove any tissue remnants sticking to the tooth surface. all the 60 specimens were randomly divided into three experimental groups as follows : group i (n = 20) : (control group) intact teeth with no access cavity preparation and sealing of the root apex was done using varnish. group ii (n = 20) : access opening was done to gain access to the root canal. group iii (n = 20) : 1 mm of the root apex was exposed to lactic acid (organic acid) at ph below 5.5 to mimic apical demineralization. apical root cementum was roughened using diamond point to mimic apical resorption that is seen in apical periodontitis cases, followed by access opening to gain access to the root canal. for the samples in group i (control group), no access preparation was done and apical 1 - 2 mm of the teeth was sealed with three coats of varnish followed by gamma irradiation of all the samples to eradicate any bacteria that was previously present. for the specimens in groups the teeth were then subjected to gamma irradiation, followed by inoculation with the e. faecalis broth within the root canal with the help of a micropipette. simultaneously, apical one - third of the teeth were submerged in the broth for all the teeth samples and incubated for 8 weeks to allow bacterial growth with alternate day refreshment. streptomycin - resistant strains of e. faecalis (atcc 29212) were cultured in tryptone soya bean agar broth prepared by mixing 1.8 g powder in 60 ml of distilled water. the e. faecalis strain was inoculated in the broth and placed in an incubator to allow the bacteria to grow at 37c for 24 - 48 h. gram staining was done to confirm bacterial growth. the e. faecalis broth was inoculated within the root canal of the teeth samples with a micropipette. furthermore, apical one - third of the teeth were submerged in the broth to mimic primary infection. after 8 weeks of culturing, the specimens of groups ii and iii were subjected to biomechanical preparation followed by obturation up to the working length (root zx ii, j. morita, japan). the teeth were instrumented using protaper ni - ti rotary instrument system in a contra - angle gear reduction handpiece (x - smart dentsply) and finally obturated with gutta - percha (single - cone technique) using ah plus sealer. after coronal seal, apical one - third of all the samples were again immersed in the e. faecalis broth for 8 weeks with alternate day refreshment to show secondary infection. after the incubation period of 8 weeks, all the samples were washed using 1 ml phosphate buffered saline to remove non - adherent bacteria. a vertical groove was made on buccolingual surface starting from occluso - apical of the all teeth samples using a tapered fissure diamond point. then with the help of a chisel, the teeth were stained with a fluorescent dye to observe under an inverted clsm (zeiss lsm 510 meta. the teeth were stained with 50 l fluorescein diacetate (fda, sigma, st. louis, mo) and 50 l of propidium iodide (pi, sigma)., the dye crosses the cell membrane and gets metabolized by intracellular esterases and converted to fluorescein (green) so the viable cells appears green in color. pi is a non - cell permeable, red fluorescent dye, which adheres to ruptured cell membranes so the dead bacteria appear red in color. single - rooted, caries - free teeth were examined under 20 microscope to rule out any cracks, caries, fractures or craze lines and radiographed to confirm the presence of a single canal. teeth that had already undergone root canal treatment or teeth with more than one canal, immature root apices, root caries, restorations, fractures or craze lines, thin curved roots and calcified canals were excluded from the study. the teeth were cleaned off soft - tissues, calculus and stains using sharp hand scalers and thoroughly washed under running tap water to remove any tissue remnants sticking to the tooth surface. all the 60 specimens were randomly divided into three experimental groups as follows : group i (n = 20) : (control group) intact teeth with no access cavity preparation and sealing of the root apex was done using varnish. (n = 20) : access opening was done to gain access to the root canal. (n = 20) : 1 mm of the root apex was exposed to lactic acid (organic acid) at ph below 5.5 to mimic apical demineralization. apical root cementum was roughened using diamond point to mimic apical resorption that is seen in apical periodontitis cases, followed by access opening to gain access to the root canal. for the samples in group i (control group), no access preparation was done and apical 1 - 2 mm of the teeth was sealed with three coats of varnish followed by gamma irradiation of all the samples to eradicate any bacteria that was previously present. for the specimens in groups ii and iii, access opening and canal debridement were done. the teeth were then subjected to gamma irradiation, followed by inoculation with the e. faecalis broth within the root canal with the help of a micropipette. simultaneously, apical one - third of the teeth were submerged in the broth for all the teeth samples and incubated for 8 weeks to allow bacterial growth with alternate day refreshment. streptomycin - resistant strains of e. faecalis (atcc 29212) were cultured in tryptone soya bean agar broth prepared by mixing 1.8 g powder in 60 ml of distilled water. the e. faecalis strain was inoculated in the broth and placed in an incubator to allow the bacteria to grow at 37c for 24 - 48 h. gram staining was done to confirm bacterial growth. the e. faecalis broth was inoculated within the root canal of the teeth samples with a micropipette. furthermore, apical one - third of the teeth were submerged in the broth to mimic primary infection. after 8 weeks of culturing, the specimens of groups ii and iii were subjected to biomechanical preparation followed by obturation up to the working length (root zx ii, j. morita, japan). the teeth were instrumented using protaper ni - ti rotary instrument system in a contra - angle gear reduction handpiece (x - smart dentsply) and finally obturated with gutta - percha (single - cone technique) using ah plus sealer. after coronal seal, apical one - third of all the samples were again immersed in the e. faecalis broth for 8 weeks with alternate day refreshment to show secondary infection. after the incubation period of 8 weeks, all the samples were washed using 1 ml phosphate buffered saline to remove non - adherent bacteria. a vertical groove was made on buccolingual surface starting from occluso - apical of the all teeth samples using a tapered fissure diamond point. then with the help of a chisel, each tooth was split into two halves. after coding the teeth samples, the teeth were stained with a fluorescent dye to observe under an inverted clsm (zeiss lsm 510 meta. the teeth were stained with 50 l fluorescein diacetate (fda, sigma, st. louis, mo) and 50 l of propidium iodide (pi, sigma)., the dye crosses the cell membrane and gets metabolized by intracellular esterases and converted to fluorescein (green) so the viable cells appears green in color. pi is a non - cell permeable, red fluorescent dye, which adheres to ruptured cell membranes so the dead bacteria appear red in color. for adhesion, we used scoring criteria of 0 (for no adhesion) and 1 (for adhesion). for penetration measured in m, we used the depth - measuring tool from the clsm software. accordingly, results were subjected to statistical analysis using median test, anova and student 's t - test. figure 1 shows live bacteria (green color) and dead bacteria (red color). i (control group) no access cavity was prepared and at the same time apical one - third of the teeth were sealed with varnish. results showed no adhesion [table 1 ], [figure 1a ] and no penetration of e. faecalis into the root cementum in any of the samples [table 2 ], [figure 2a ]. in group ii few samples showed adhesion, mean of adhesion is 0.55 [table 1 ], [figure 1b ] but no penetration was seen in any of the samples [table 2 ], [figure 2b ]. this means that if an intervention like root canal treatment was done at early stage of infection when no apical changes like demineralization or resorption had taken place, there would be lesser chances of e. faecalis penetration and persistent infection or re - infection. in group iii, apical one - third of the teeth were exposed to acid and apical cementum was roughed to mimic apical periodontitis. in this group, all the samples showed adhesion [table 1 ], [figure 1c ] and highest values of penetration was up to 160 m deep in root cementum [table 2 ], [figure 2c ]. this means that delay in treatment leads to changes in apical environment such as apical demineralization and apical resorption, which helps e. faecalis to penetrate deep into cementum and in favorable conditions chances of persistent infection or re - infection also increases. a comparison of values shows high significant difference (p < 0.01) between groups i and iii and groups ii and iii and significant difference (p < 0.05) between groups i and ii [tables 1 and 2 ]. mean and sd of adhesion for three groups. comparisons between groups with median test (a) confocal image showing group i (control group), absence of enterococcus faecalis. red color shows dead e. faecalis and green shows live e. faecalis under confocal laser scanning microscope (clsm). red color shows dead e. faecalis and green shows live e. faecalis under clsm mean and sd of penetration for three groups. f value calculated by one way anova and comparisons between groups with student 's t - test (a) depth measuring confocal image showing, group i (control group) absence of enterococcus faecalis. (b) group ii samples showing adhesion of e. faecalis up to 1 m deep under confocal laser scanning microscope (clsm). (c) group iii samples showed presence of e. faecalis up to 160 m deep in root cementum under clsm in this study, e. faecalis was chosen as the test organism because of its ability to penetrate the root dentin in vitro and it is found up to 90% in persistent infection. e. faecalis has unique properties such as production of ace and spr that are collagen binding proteins, which help e. faecalis to adhere strongly to mainly type i and iv collagen present in the root dentin. e. faecalis is a very virulent microorganism, which can survive in alkaline ph and during long starvation periods and then becomes viable in the presence of serum. e. faecalis can survive long periods without any nutrient availability because it can derive nutrients from hyaluronan, which is converted by enzyme hyaluronidase and also derive energy sources from dentinal fluid even in a well - sealed root canal system. under stress, lipoteichoic acids protect e. faecalis against lethal conditions, cytolysin, as-48 and bacteriocin, which inhibits other bacterial growth. cytolysin destroys cells such as erythrocytes, pnm cells, macrophages and kills gram - positive microorganisms. due to this effect the adhesion of e. faecalis to type i and iv collagen is the basis of the present study because apical one - third of the root is made of cellular cementum primarily composed of type iv collagen. adhesion is the first step in colonization and our study confirms adhesion and invasion by e. faecalis up to 160 m into the root cementum [figure 2c ]. however, a previous study showed e. faecalis penetration only up to 150 m deep into the root dentin. deeper penetration of e. faecalis in our study is due to the change in apical environment such as demineralization and apical resorption. in group i, there was no invasion or adhesion of e. faecalis as it is a control group. in group ii, only few samples showed adhesion, mean of adhesion is 0.55 [table 1 ] and no samples showed penetration. on the other hand in group iii, all samples showed adhesion [table 1 ] and highest penetration into root cementum up to 160 m [table 2 ]. this shows that if early treatment is done after primary infection as in group ii, there are less chances of penetration of e. faecalis and re - infection or persistent infection. whereas in group iii, there was delay in treatment at early stages of infection, leading to change in apical environment like demineralization of root cementum and root cementum resorption. these apical changes helped e. faecalis to penetrate deep into the root cementum, thereby increasing the chances of persistent infection or re - infection. in our study, we cultured for 8 weeks twice because 18 weeks showed primary infection followed by biomechanical preparation and obturation giving the impression of normal root canal treatment done to subside primary infection. group ii showed only adhesion but no penetration [figures 1b and 2b ], whereas group iii showed deeper penetration. this means irrespective of the primary or secondary infection, what matters most is the apical changes in environment like demineralization or apical resorption, which help e. faecalis to penetrate deep into root cementum and is the cause for re - infection or persistent infection, as confirmed by the samples in group iii. we used gamma irradiation to sterilize the teeth because it does not alter collagen characteristics of the teeth. e. faecalis produces collagen binding protein, with the help of which it adheres strongly to collagen. other methods of sterilization of teeth samples are by autoclaving, using hot air oven, etc. the disadvantage of autoclave is that it collapses the collagen strands and use of hot air oven makes teeth dehydrated and more brittle. in our study, data was collected using a clsm as it has advantages over other methods such as histological samples, which can not distinguish between viable and dead bacteria. scanning electron microscope has the disadvantage of multiple steps for sample preparation making it time consuming and also it can not differentiate between dead and viable bacteria. fluorescence probe has the disadvantage that it can not distinguish between viable and dead bacteria and also it can not show distribution of bacteria. the clsm (zeiss lsm 510 meta gmbh, mannheim, germany) analysis has advantage over other methods to visualize bacteria. our study confirms that clsm can give a clear picture about viability and spatial distribution of bacteria. fda is a non - fluorescent cell - permeable dye, which in viable cells crosses the cell membrane, gets metabolized by intracellular esterases and is converted to fluorescein (green). pi is non - cell permeable fluorescent dye, which gets adhered to ruptured cell membranes and dead cells appear red in color. we used an organic acid (lactic acid) for demineralization of root cementum because the end product of sucrose metabolism is lactic acid. demineralization and apical resorption at root cementum plays a significant role in penetration of e. faecalis into root cementum. the severity of infection is directly proportional to depth of penetration of e. faecalis into root cementum. the progress of the disease plays a critical role in the adhesion and penetration of e. faecalis to root cementum. | aim : the aim of this study is to address the cause of persistent infection of root cementum by enterococcus faecalis.materials and methods : a sample of 60 human single - rooted teeth were divided into three groups. group i (control group) had no access opening and one - third of the apical root cementum was sealed using varnish. group ii had no preparation of teeth samples. in group iii, apical root cementum was exposed to organic acid and roughened using diamond point to mimic apical resorption. after access opening in groups ii and iii, all teeth samples were sterilized using gamma irradiation (25 kgy). e. faecalis broth was placed in the root canal and apical one - third of the tooth was immersed in the broth for 8 weeks with alternate day refreshment followed by biomechanical preparation, obturation and coronal seal. apical one - third of all teeth samples were again immersed in the broth for 8 weeks with alternate day refreshment to mimic secondary infection. the samples were observed under a confocal microscope after splitting the teeth into two halves.results:e. faecalis penetrated 160 m deep into the root cementum in group iii samples and only showed adhesion in group ii samples.conclusion:penetration and survival of e. faecalis deep inside the cementum in extreme conditions could be the reason for persistent infection. |
although levetiracetam (lev) is a relatively well - tolerated anti - epileptic drug (aed) that is used to control partial and generalized seizures, an encephalopathy resulting from lev administration has been previously reported.1,2 encephalopathy induced by aed has been observed in patients with vpa, however, it is debatable whether the concomitant use of lev with valproic acid (vpa) causes the encephalopathy or not. we report here on the manifestation of a vpa induced hyperammonemic encephalopathy promoted by lev. a 60-year - old female suffering from frontal lobe epilepsy was presented to our hospital with a mental obtundation. we have treated the patient for a period of 5 years and have registered an electroencephalogram (eeg) with ictal fast activity in the right frontocentral area. a brain mri showed a t2 high, t1 low signal intensity of a single lesion without enhancement in the right anterior basal frontal lobe white matter (fig. 1). she used to have partial seizures with a secondary generalization, and she has been on 1,200 mg / day vpa for the last 4 years. generalized tonic - clonic seizures (gtcsz) were well controlled, but partial seizures of left head version following left arm clonus occurred one to two times per several months. we added lev to vpa and increased the daily dosage of lev to 1,000 mg / day. the neurologic findings showed no ataxia or nystagmus, and routine hematological and biochemical laboratories presented a normal complete blood count (wbc 6,600/mm, hb 13.4 g / dl, platelet 168,000/mm), electrolyte (na 138 mmol / l, k 4.1 mmol / l), renal (bun 11.1 mg / dl, creatinine 0.72 mg / dl), and thyroid function test (free t4 1.230 ng / dl, tsh 0.779 uiu / ml). however, her liver function test showed a mild impairment (aspartate aminotransferase 46 iu / l, alanine aminotransferase 44 iu / l), and the serum ammonia level was high (154 umol / l, normal : 12 to 47 an abdomen computed tomography (ct) with a contrast enhancement showed no remarkable finding, except for a 0.6 cm - sized liver cyst. the blood concentrations of vpa was of 82.4 ug / ml (therapeutic range : 50100 ug / ml). we suspected the possibility of side effects associated with lev because she tolerated medication with vpa for 4 years and stopped lev. her mental function was gradually restored, with a decrease in the blood ammonia level (56 umol / l), and the generalized slowing disappeared in a follow - up eeg (fig. 2c). we added carbamazepine to treat for partial seizures, and the patient was asymptomatic until the last visit in july 2014. our patient showed mental obtundation and hyperammonemia following administration of lev receiving vpa, and the condition was resolved completely after discontinuation of the drug. we consider the patient to have had vpa - induced hyperammonemic encephalopathy promoted by lev. an encephalopathy induced by aed has been described in patients with vpa medication.3 however, the condition has been rarely seen with lev and only in specific conditions, such as when there is renal failure or when there is concomitant use of vpa.1,2 lev undergoes minimal hepatic metabolism via enzymatic hydrolysis, and it is eliminated entirely by renal excretion.4 the clearance of the lev decreased in subjects with renal impairment, wheareas no significant pharmaco - kinetic changes for lev were observed in patients with hepatic dysfunction.4 vulliemoz. observed that the administration of lev in a patient with chronic renal failure caused a myoclonic encephalopathy due to the toxic accumulation of lev.1 previous studies indicated that lev has no clinically relevant interactions with other aeds due to its minimal protein binding and lack of hepatic metabolism.4,5 however, a recent meta - analysis observed that the enzyme inducing aeds have a modest influence on the kinetics of lev.6,7 serum concentrations of lev might be increased or decreased about 20 to 30% as the enzyme inducing or inhibiting aeds are added.6 these results suggest that lev is metabolized by cytochrome p450 enzymes to a greater extent than what previously observed data had suggested. a few reports on the pharmacokinetic influences and of the comedication effects of new aeds on vpa toxicity have been noted.4 hamer.8 described that patients receiving topiramate in addition to vpa suffered from an encephalopathy, and topiramate was concluded to have facilitated the toxic effect of vpa and to have contributed to the increase in the ammonia levels through its inhibition of carbonic anhydrase and cerebral glutamine synthetase.8 although the mechanism for vpa - induced hyperammonemia is not fully understood, it is known that a propionate, metabolite of vpa, leads to a carbamyl phosphate synthetase-1 activity deficit, the decrease in hepatic carnitine concentration via vpa induces oxidation suppression of fatty acid, and an increase in the mitochondrial glutamine receptors causes the absorption of glutamine in the kidney.9 the hyperammonemia resulting from vpa causes encephalopathy mainly by influencing the astrocyte, which has the function of ammonia detoxication and leads to mitochondrial proliferation and cerebral edema through glycogen precipitation in the astrocyte cytoplasm.10 previous reports on vpa - induced hyperammonemic encephalopathy have usually observed that patients with a concomitant use of other aeds, such as phenytoin or phenobarbital, rather than those with single use, experienced oxidation suppression in the urea cycle which led to hyperammonemic encephalopathy without hepatic dysfunction.3,10 the mechanisms that cause encephalopathy with only lev itself or with the comedication with vpa are debatable since vpa is usually well tolerated with a concomitant use with other new aeds, and both increased serum lev concentration with enzyme inhibiting vpa use and the vpa toxicity may induce an encephalopathy, even when within a therapeutic range. however, the lack of toxicity of vpa when used without lev for an extended period of time, the insidious onset of mental obtundation after lev add on, the generalized eeg slowing, the elevated ammonia level, and the complete recovery of mental symptoms after stopping the drug support the conclusion that a vpa - induced hyperammonemic encephalopathy was promoted by lev. our case demonstrates that a lev provoke a condition of hyperammonemic encephalopathy in a patient receiving vpa, and such cases can be suspect when diagnosing this condition. | encephalopathy resulting from the administration of levetiracetam (lev) is a rare occurrence. we experienced a patient receiving lev treated with valproic acid (vpa) for partial seizures with secondary generalization, following which she developed hyperammonemic encephalopathy and showed complete recovery after the drug was withdrawan. lev is able to promote hyperammonemic encephalopathy when added to vpa. |
pruritus in pregnancy has always been challenging to the treating physician both in diagnosis and treatment. pruritus occurs due to various causes, and it can occur any time during pregnancy. causes for pruritus in pregnancy are numerous ranging from specific dermatoses of pregnancy to various dermatological conditions such as atopic dermatitis, urticarial, infections, and infestations or drug induced. other than itching antihistamines are also used for various allergic diseases and also used for emesis during pregnancy. if a drug is consumed during the first trimester, it can result in severe structural fetal malformations and in the later part of pregnancy it can result in various functional defects or growth disorders and can also lead to minor malformations. drugs taken during the pregnancy can also lead to after effects in the neonatal and infancy period. all pharmacological interventions are generally avoided during pregnancy due to the alarming information present in the patient information leaflet and also on the drug envelopes. the physician has to weigh the benefits of the treatment against the potential teratogenic effects before using any drug during pregnancy. among the drugs prescribed during pregnancy, antihistamines are one of the commonest, either as an antipruritic agent or an antiemetic agent. many a times the patient procures these agents as an over the counter preparation and uses it. various studies on the use of antihistamines (h1 blockers) during pregnancy, including a meta - analysis of more than 200,000 women shows no increase in the teratogenic risk of these drugs in the humans.[36 ] certain animal studies with hydroxyzine, cyclizine, and promethazine have shown teratogenic effects, but no human teratogenicity reports have so far been reported. drugs such as dexchlorpheniramine and alimemazine (trimeprazine) were not found to have any teratogenic effect even in animal studies. none of the antihistamines has been so far declared safe during the pregnancy by fda on the basis of controlled animal or human studies. isolated reports of antihistamines causing congenital malformations have been reported, but they warrant further investigations and interpretation. h1-antihistamines are classified into the first generation sedating antihistamines and the second generation nonsedating antihistamines. the first generation antihistamines include drugs such as diphenhydramine, cyproheptadine, promethazine, chlorpheniramine, and hydroxyzine. the common side effects of this category of antihistamines include sedation and anticholinergic effects dryness of the mouth, blurring of vision, constipation and urinary retention. fda has categorized the first generation antihistamines according to the pregnancy complications [table 1 ]. promethazine and hydroxyzine have been categorized as pregnancy category c due to lack of well - controlled studies in human being. fda pregnancy category classification for the first - generation antihistamines pregnancy category b means the drug has failed to demonstrate a risk to the fetus in animal reproduction studies and there is a lack of well - controlled studies in pregnant women or animal studies have shown an adverse effect, but adequate and well - controlled studies in pregnant women have failed to demonstrate a risk to the fetus in any trimester. pregnancy category c means that animal reproduction studies have shown an adverse effect on the fetus and there are no adequate and well - controlled studies in humans, but potential benefits may warrant the use of the drug in pregnant women despite potential risks. the second generation antihistamines include drugs such as loratadine, fexofenadine, cetirizine, and azelastine. they are long acting, but are poorly lipophilic and hence have no entry to the central nervous system. side effects of the second generation antihistamines include photosensitivity, tachycardia, and prolongation of the q fexofendine and desloratidine have been classified as pregnancy category c. reduction in pup weight and survival were observed with fexofenadine. there are no human data on fexofenadine and loratadine for them to be categorized as safe during pregnancy. loratadine had previously been proposed as a possible factor for the increased incidence of hypospadiasis in infants born to mothers who had taken loratadine during pregnancy. however, recent studies have ruled out this possibility and suggest that this agent does not represent a major teratogenic risk. fda pregnancy category classification for second - generation antihistamines although pruritus is not a life - threatening medical condition, it can be extremely troublesome for pregnant women. because of potential effects on the fetus, the treatment of pruritus in pregnancy requires prudent consideration. at one point, the physician will have to use the antihistamines and weigh the benefits against the teratogenic effects of the antihistamines. physicians must decide whether to select an older, better - studied antihistamine, thought to be relatively safe during pregnancy, or a newer agent that has less adverse effect on quality of life but has a potential teratogenic effect. various recommendations and studies favor the use of first generation antihistamines for use during pregnancy. they point out that these antihistamines were in use for a longer period of time and were more widely used during pregnancy. more data are available about the various effects of the first generation antihistamines in pregnancy. moreover a few of the second generation agents have been reported to be associated with an increased incidence of certain congenital malformations. in 1993, the national asthma education and prevention program (naepp) working group on asthma and pregnancy recommended the first - generation agents chlorpheniramine and tripelennamine as the antihistamines of choice during pregnancy, based on duration of availability as well as reassuring animal and human data. the allergic rhinitis and its impact on asthma (aria) guidelines, published in 2001, concluded that the older antihistamines have an overall unfavorable risk / benefit ratio, even in the nonpregnant population, because of their poor selectivity and their sedative and anticholinergic effects. aria recommends that where possible, first - generation antihistamines should no longer be prescribed. in general, second - generation antihistamines are more potent, have a longer duration of action, and produce minimal sedation. the american college of obstetricians and gynecologists (acog) and the american college of allergy, asthma and immunology (acaai) have recommended chlorpheniramine and tripelennamine as the antihistamines of choice for pregnant women. they also recommend cetirizine and loratadine after the first trimester in patients who can not tolerate or do not respond to maximal doses of chlorpheniramine or tripelennamine. other studies suggest that there is insufficient evidence to support the first - line use of cetirizine and loratadine during pregnancy and recommend first considering chlorpheniramine, tripelennamine, or hydroxyzine if an antihistamine is needed during pregnancy. h1-antihistamines are classified into the first generation sedating antihistamines and the second generation nonsedating antihistamines. the first generation antihistamines include drugs such as diphenhydramine, cyproheptadine, promethazine, chlorpheniramine, and hydroxyzine. the common side effects of this category of antihistamines include sedation and anticholinergic effects dryness of the mouth, blurring of vision, constipation and urinary retention. fda has categorized the first generation antihistamines according to the pregnancy complications [table 1 ]. promethazine and hydroxyzine have been categorized as pregnancy category c due to lack of well - controlled studies in human being. fda pregnancy category classification for the first - generation antihistamines pregnancy category b means the drug has failed to demonstrate a risk to the fetus in animal reproduction studies and there is a lack of well - controlled studies in pregnant women or animal studies have shown an adverse effect, but adequate and well - controlled studies in pregnant women have failed to demonstrate a risk to the fetus in any trimester. pregnancy category c means that animal reproduction studies have shown an adverse effect on the fetus and there are no adequate and well - controlled studies in humans, but potential benefits may warrant the use of the drug in pregnant women despite potential risks. the second generation antihistamines include drugs such as loratadine, fexofenadine, cetirizine, and azelastine. they are long acting, but are poorly lipophilic and hence have no entry to the central nervous system. side effects of the second generation antihistamines include photosensitivity, tachycardia, and prolongation of the q fexofendine and desloratidine have been classified as pregnancy category c. reduction in pup weight and survival were observed with fexofenadine. there are no human data on fexofenadine and loratadine for them to be categorized as safe during pregnancy. loratadine had previously been proposed as a possible factor for the increased incidence of hypospadiasis in infants born to mothers who had taken loratadine during pregnancy. however, recent studies have ruled out this possibility and suggest that this agent does not represent a major teratogenic risk. although pruritus is not a life - threatening medical condition, it can be extremely troublesome for pregnant women. because of potential effects on the fetus, the treatment of pruritus in pregnancy requires prudent consideration. at one point, the physician will have to use the antihistamines and weigh the benefits against the teratogenic effects of the antihistamines. physicians must decide whether to select an older, better - studied antihistamine, thought to be relatively safe during pregnancy, or a newer agent that has less adverse effect on quality of life but has a potential teratogenic effect. various recommendations and studies favor the use of first generation antihistamines for use during pregnancy. they point out that these antihistamines were in use for a longer period of time and were more widely used during pregnancy. more data are available about the various effects of the first generation antihistamines in pregnancy. moreover a few of the second generation agents have been reported to be associated with an increased incidence of certain congenital malformations. in 1993, the national asthma education and prevention program (naepp) working group on asthma and pregnancy recommended the first - generation agents chlorpheniramine and tripelennamine as the antihistamines of choice during pregnancy, based on duration of availability as well as reassuring animal and human data. the allergic rhinitis and its impact on asthma (aria) guidelines, published in 2001, concluded that the older antihistamines have an overall unfavorable risk / benefit ratio, even in the nonpregnant population, because of their poor selectivity and their sedative and anticholinergic effects.. in general, second - generation antihistamines are more potent, have a longer duration of action, and produce minimal sedation. the american college of obstetricians and gynecologists (acog) and the american college of allergy, asthma and immunology (acaai) have recommended chlorpheniramine and tripelennamine as the antihistamines of choice for pregnant women. they also recommend cetirizine and loratadine after the first trimester in patients who can not tolerate or do not respond to maximal doses of chlorpheniramine or tripelennamine. other studies suggest that there is insufficient evidence to support the first - line use of cetirizine and loratadine during pregnancy and recommend first considering chlorpheniramine, tripelennamine, or hydroxyzine if an antihistamine is needed during pregnancy. in every pregnant case with pruritus the basic cause of pruritus should first be sought out before starting the antihistamines. before any medication is taken during pregnancy, the doctor and patient should have a risk / benefit discussion. the patient should be explained the fact that though no definite teratogenic effects have been reported to be associated with the intake of antihistamines in pregnancy, they are not licensed by the fda as category a or the safe group. also it is important to mention that in india no definitive guidelines have been given or followed by the government to prevent the use of h1-antihistamines as over the counter medicines. even for prescription purposes, no definitive guidelines have been given by the government and practitioners generally follow the fda criteria. if possible the pruritus and other allergic manifestations in the first trimester of pregnancy should be managed using topical medications like bland emollients and systemic antihistamines should be avoided as none of the antihistamines are categorized as safe by the fda and in india no specific guidelines exist regarding their use in pregnancy. if antihistamines have to be prescribed then first generation agents should be preferred and among them chlorpheniramine, dexchlorpheniramine and hydroxyzine should be the first choice of agents. the patient should also be advised to drink plenty of water when taking antihistamines during pregnancy to overcome the anticholinergic side effects. they should also be advised to take immediate gynecological consultation if they find any change in the frequency of baby 's movement or increased contractions after taking the drugs. if a second generation agent has to be used then loratadine or cetirizine should be preferred as they have been widely studied for possible teratogenic effects and have been found to be nonteratogenic till date. second generation agents are preferably used after the first trimester if it has to be and preferably avoided in the early pregnancy when organogenesis takes place. to conclude first generation antihistamines such as chlorpheniramine, hydroxyzine, and dexchlorpheniramine are the safest among antihistamines to be used in pregnancy. | antihistamines are one of the most common drugs that are used extensively in various dermatological and nondermatological conditions. the use of h-1-antihistamines during pregnancy has been very controversial due to possible teratogenic effects of these drugs. none of the antihistamines available today have been categorized as safe during pregnancy. control studies are available for certain first generation drugs regarding their safety in pregnancy, but the newer agents require further studies to be declared safer in pregnancy. a few drugs are comparatively safer to use in pregnancy than others. every drug used in pregnancy carries a risk for teratogenicity and careful risk / benefit assessment should be done before prescribing them. |
kaposi 's varicelliform eruption is a disseminated cutaneous infection usually caused by the herpes simplex virus (hsv). it predominantly occurs in patients with pre - existing active dermatosis and is characterized by disseminated vesiculopustules and erosions. it is common in patients with atopic dermatitis and rarely develops in an immunocompromised host. there have been several case reports of kaposi 's varicelliform eruption occurring in patients with cutaneous t - cell lymphoma and multiple myeloma [2, 3 ]. herein, we report a nonfatal case of kaposi 's varicelliform - like eruption occurring in an immunocompromised patient taking the mammalian target of rapamycin (mtor) inhibitor, everolimus, for metastatic renal cell carcinoma (rcc). a 56-year - old man presented with a 6-day history of fever, chills, and severe forehead pain and 5 days of vesicular eruptions involving the skin of the forehead, both eyelids, and nose. the skin lesions spread to his chest, back, and bilateral upper and lower extremities over the subsequent 4 days (fig. he underwent radical nephrectomy and the pathologic type was clear cell carcinoma with t3n0m0, stage iii, fuhrman grade ii. the patient was given sorafenib 400 mg twice daily for 7 months as adjuvant treatment. follow - up computed tomography of the abdomen and pelvis performed 8 months after surgery revealed recurrence of the lesion in the left renal fossa invading the tail of the pancreas, transverse colon, and spleen. two months later, computed tomography showed three metastatic nodules in the liver, and the patient underwent liver metastasectomy. after surgery, he was started on 37.5 mg of sunitinib, which he took for 7 months. eleven months after the liver surgery, disease progression involving the liver and lungs was detected, and the patient was enrolled in a clinical trial of second - line treatment using rad001 (everolimus), which he took for 19 months. thereafter, disease progressed in his lungs and the patient took palliative sunitinib on a 4-week - on and 2-week - off schedule. seven months later, a whole - body bone scan revealed multiple bone metastases involving the left ribs, left proximal femur, left ischium, and right iliac bone. the patient underwent palliative radiation therapy (45 gy) for the pain - causing left ribs and weight bearing both pelvic bones. after finishing the radiation therapy, the patient 's temperature was 38.1c, his blood pressure was 151/102 mm hg, and the pulse rate was 110 beats / min. he had vesicles and pustules, with crusting and swelling on the skin of his forehead, both eyelids and nose. the patient 's complete blood count revealed a white blood count of 4,640/l (neutrophils 2,210/l, lymphocytes 1,370/l), hemoglobin of 13.0 g / dl, and platelet count of 79,000/l presenting mild lymphopenia and thrombocytopenia. the c - reactive protein (crp) was elevated at 85.8 mg / l (normal range, 08). the results of other laboratory studies, including routine biochemistry and chest x - rays, were normal. the cd4 and cd8 lymphocyte counts were 0.28 10/l and 0.64 10/l, respectively (cd4:cd8 ratio = 0.44). a dermatologic clinical diagnosis of kaposi 's varicelliform eruption was made based on the patient 's typical skin manifestations, including viral infection - like blisters and eruptions. the patient was intravenously administered 250 mg of acyclovir every 8 h. twenty - four hours after initiation of treatment, there were no new vesicles, and the patient 's clinical status improved we reconsulted the dermatologist, and skin biopsy was performed after 6 days of acyclovir. the biopsy showed interstitial granulomatous dermatitis with a few eosinophils, extravasated red blood cells and basal vacuolization (fig. 2). there was no evidence of herpetic viral infection in the biopsy specimen. therefore, we concluded that the patient had an everolimus - induced drug eruption manifesting as kaposi 's varicelliform eruption considering both clinical presentation and pathologic findings. after stopping everolimus, a follow - up bone scan of the patient revealed new spinal metastases involving the t3 and l1 vertebrae and a compression fracture of l3. he had palliative radiation therapy (42 gy) of his thoracic and lumbar spine. kaposi 's varicelliform eruption is characterized by dissemination of cutaneous infection of hsv, and some other viruses in patients with pre - existing dermatoses [2, 4 ]. it is also called eczema herpeticum because it is most commonly seen in patients with atopic dermatitis [5, 6 ]. kaposi 's varicelliform eruption has also been described in association not only with dermatologic conditions, such as psoriasis, lupus vulgaris, contact dermatitis, and rosacea, but also malignant diseases such as cutaneous t - cell lymphoma and multiple myeloma [2, 3, 7 ]. there has been a single report of a patient with kaposi 's varicelliform eruption associated with a drug reaction (phenytoin). the severity of kaposi 's varicelliform eruption appears to be unrelated to the extent of the eczematous lesions, and active dermatitis is not necessary for the development of eruption. systemic viremia involving multiple organs, including the liver, lungs, brain, gastrointestinal tract, adrenal glands, and eyes, is the major cause of morbidity and mortality. transmission can occur through contact with infected persons or by dissemination of primary or recurrent herpes. recurrent episodes may also occur because the virus persists in the host and periodically reactivates in the mucosa and skin ; however, the manifestations of recurrent episodes are milder and usually not systemic. a tzanck smear can provide rapid diagnosis when it shows the characteristic epithelial multinucleated giant cells. both biopsy and serology are of little diagnostic value, and these are not recommended as routine tests [5, 9 ]. our patient did not have pre - existing dermatitis, but was taking everolimus for the treatment of the metastatic rcc. as an mtor inhibitor, everolimus modulates t - lymphocyte homeostasis, and the patient first took everolimus for 19 months in a clinical trial and achieved stable disease. at that time, he only had grade 1 mucositis, insomnia, and hypertriglyceridemia but no skin manifestations of toxicity. however, when taking everolimus for a second time, he developed a drug rash and pruritus after 10 days on everolimus, which were followed by clusters of umbilicated vesiculopustules. the exact factors for kaposi 's varicelliform eruption are still unclear. however, many studies commonly explained two factors. a defective epidermal barrier and immunosuppression associated with either therapy or a debilitated state of the patient may lead to disseminated hsv infection. in a retrospective review of 100 atopic dermatitis patients with kaposi 's varicelliform eruption, a high ige serum level was found to be a risk factor. defective cytokine secretion and decreased cell - mediated immunity is important in the control of primary and recurrent hsv infections. the suppressed immunity and the loss of the epidermal barrier function as a result of everolimus may have contributed to the development of kaposi 's varicelliform - like eruption in our patient, who had an increasing tumor burden and a worsening performance status. some investigators have shown that markers of tumor inflammation or host immune status, such as crp and neutrophil - to - lymphocyte ratio, may be predictive to survival outcome [10, 11 ]. at admission, the patient had a high crp level, mild lymphopenia, and a relatively high neutrophil - to - lymphocyte ratio, which taken together, reflected the poor condition of the patient. we ultimately diagnosed the patient with kaposi 's varicelliform - like eruption associated with a drug eruption based on the pathologic findings, clinical manifestations, and the clinical course of the patient after everolimus treatment. unfortunately, we were unable to confirm a viral infection, perhaps because of delays in performing the skin biopsy and other laboratory tests. however, we believe that the most important tool for the diagnosis of kaposi 's varicelliform eruption is clinical judgment. this is a rare case of kaposi 's varicelliform - like eruption occurring as an everolimus - induced rash. physicians need to be aware that patients with increasing tumor activity and decreasing immunity may be at risk for this problem. early diagnosis, stopping the suspected medication and appropriate treatment of patients at risk for viral complications are very important medical considerations. | kaposi 's varicelliform eruption is a cutaneous eruption caused by the herpes simplex virus and a few other viruses that infect persons with pre - existing dermatosis such as atopic dermatitis. we report the case of a 56-year - old man who was treated with the mammalian target of rapamycin inhibitor, everolimus, for metastatic renal cell carcinoma. he presented with painful, umbilicated vesicles and pustules on his face, genital region, forearms, and legs suggestive of kaposi 's varicelliform eruption. he did not have a history of any visceral viral disease and pre - existing dermatosis. the diagnosis was based on the clinical features. he was treated with acyclovir for 7 days, with improvement of his skin lesions. we discuss the clinical manifestations of the kaposi varicelliform - like eruption in an immunocompromised patient treated with everolimus. |
the purpose of evidence - based medicine is to apply the best scientific evidence to clinical decision - making. in order to guide doctors and health professionals, the royal colleges publish guidelines and recommendations for good clinical practice within their respective specialties. critics (wright 2007) say that they are unsuited to address flexibility and choice expected by patients. browman (2010) argues that it is tempting to develop rigid protocols but patient treatment should be individualised. however, in the area of acute obstetrics and gynaecology, where management of life - threatening conditions is unsuitable for randomised controlled trials, guidelines are heavily relied upon, to ensure consistent quality of care. many are based on recommendations which have little or no scientific background and rely more on clinical or expert opinion, which is particularly susceptible to bias (detsky 1924). wright (2007) argues that while the evidence - based medicine movement was intended to add evidential basis to guideline recommendations, it only resulted in a moderate improvement. wright is also sceptical of the system of grading recommendations according to evidence (grade a, grade b, etc.), as some readers of guidelines may not consult the type of evidence underlying each grade. this has led analysts of evidence - based medicine to claim that this is a misnomer and it is actually better referred to as eminence - based medicine (charles. there have been no previous analyses of the overall evidence underlying the royal college of obstetricians and gynaecologists (rcog) guidelines. however, a study by wright in 2011 found that only one - third of the recommendations by the american college of obstetricians and gynecologists were based on good scientific evidence (wright. in similar studies, this was the case in 14% of the recommendations by the infectious diseases society of america (lee and vielemeyer 2011), and 45% of cardiovascular risk recommendations from guidelines across the usa, canada and europe (mcalister. the objective of this study was to analyse the evidence used in guidelines published by the rcog and to identify areas where evidence is high - quality, adequate or lacking. it is important to be aware of the standard of evidence which underpins the advice which doctors access for the diagnosis and management of their patients. the royal college of obstetricians and gynaecologists produces a large number of guidelines for the management and diagnosis of a wide variety of diseases and conditions. joint guidelines, national evidence based guidelines and project reports, among others. for the purpose of this analysis, we used the green - top guidelines. each green - top guideline addresses a specific topic, giving a brief introduction to the subject in question and detailing how the supporting evidence was obtained. for the guidelines included, see table i. the guidelines themselves include a series of recommendations, each graded by the overall quality of supporting evidence, the details of which are included in table ii. in addition, the studies and trials cited in support of the recommendations made were further classified using a numerical system, which has not been included for simplification. the method of grading of recommendations and classification of evidence was changed in december 2007. for this reason, guidelines created before that date and guidelines created after that date were analysed separately to avoid the introduction of any bias or subjectivity into classification. the green - top guidelines analysed. the classification scheme for the recommendations by the royal college of obstetricians and gynaecologists. all 52 green - top guidelines were obtained from the royal college of obstetricians and gynaecologists website on 1 april 2012. one guideline (green - top 31, small - for - gestational - age fetus, investigation and management, published on 1 november 2002) was not included in the analysis, as its evidence levels were classified using a different system from the others. two guidelines have been archived by the rcog (green - tops 10a and 35), with advice to refer to the appropriate national institute of clinical excellence (nice) guidelines for assistance, and therefore could not be obtained or included in analysis. rcog green - top guidelines published before december 2007 are classified according to one of four levels of evidence : a (literature of overall good quality and evidence) ; b (well controlled clinical studies) ; c (evidence from expert committee reports or opinions) and (recommended best practice based on the clinical experience of the guideline development group). those issued from december 2007 were classified using a five - tiered system : a (meta - analysis, systematic review or a good quality randomised controlled trial) ; b (high quality systematic reviews of case control or cohort studies) ; c (high quality case control or cohort studies with a low risk of confounding) ; d (non- analytical studies, such as case reports / expert opinion) and (recommended best practice based on the clinical experience of the guideline group). we gathered the grades of each recommendation within each guideline, and then stratified each guideline into those primarily focussed on obstetrics and those primarily focussed on gynaecology. we then sub - divided the latter into the following : general gynaecology, oncology, fertility and endoscopy. in addition to this, we sorted the guidelines based on whether they referred to evaluation, diagnosis and treatment, or mode of delivery (table iii). this was carried out independently by three reviewers ; categorisations were then discussed and any discrepancies were resolved by consensus (majority opinion of all the reviewers). descriptive statistics were then used to report the findings of this analysis. the research management and governance department at the whittington hospital, a total of 52 guidelines that offered 1,682 individual recommendations were studied (table i) ; 32 of the guidelines were obstetric (61.5%) and 20 were gynaecological (38.5%). within these guidelines, 1,160 (69%) of the individual recommendations were obstetric and 522 (31%) were gynaecological. of the recommendations published before december 2007, 52 (12%) referenced level a evidence ; 94 (22%) level b evidence ; 126 (29%) level c evidence ; and 163 (37%) were based on recommended best practice (figure 1a). regarding guidelines published from december 2007 onwards, 114 (9%) were based on level a evidence ; 145 (12%) level b ; 210 (17%) level c ; 276 (22%) level d and 502 (40%) were recommended best practice (figure 1b). this suggests that, contrary to the aims of evidence - based medicine, guidelines published more recently are actually more likely to be based on clinical experience alone. however, since the new classification system places more stringent measures on evidence that can qualify as level a, the two sub - sets can not be directly compared. classification of evidence levels underlying rcog guidelines published (a) before and (b) after december 2007. within the two classification systems (that used prior to december 2007 and that used after), the distribution of quality of evidence was divided into that supporting obstetric guidelines and that supporting gynaecological guidelines. among the obstetric recommendations published under the old system, 22 (8%) provided level a evidence ; 48 (18%) level b ; 89 (33%) level c and 111 (41%) were recommended best practice (figure 2a). of those published after december 2007, using the new five - tiered system, 69 (8%) provided level a evidence ; 93 (10%) level b ; 147 (16%) level c ; 229 (26%) level d and 352 (40%) were recommended best practice (figure 2b). this suggests there has been no significant change in the quality of sources of evidence used by the rcog to write obstetric guidelines over the past few years, and that the greater reliance of more recently published guidelines by the rcog on clinical experience alone is due to the newer gynaecological rather than obstetric guidelines. classification of evidence underlying obstetrics guidelines published (a) before and (b) after december 2007. among the gynaecological recommendations published before december 2007, 30 (18%) were based on level a evidence ; 46 (28%) level b ; 37 (22%) level c and 52 (32%) were recommended best practice (figure 3a). in those published post - december 2007, 45 (13%) provided level a evidence ; 52 (14%) level b ; 63 (18%) level c ; 47 (13%) level d and 150 (42%) were recommended best practice (figure 3b). this demonstrates that across all guidelines (regardless of publication date), those concerned with gynaecology had a higher quality of underlying evidence than obstetric guidelines, with greater numbers based on the findings of meta - analyses and well - conducted randomised controlled trials. classification of evidence underlying gynaecology guidelines published (a) before and (b) after december 2007. 68.8% of recommendations addressed diagnosis and treatment ; 12.5% evaluation and 18.8% mode of delivery. within gynaecology, 85% of recommendations addressed diagnosis and treatment and 15% evaluation. once again, those published under each of the two classification systems had to be evaluated separately. of the obstetric guidelines published under the old system, 5.6% of guidelines concerning evaluation were based on level a treatment, compared with 6.4% of diagnosis and treatment, and 12.5% of mode of delivery recommendations (figure 4a). of the newer obstetric guidelines, 6.4% of evaluation, 8.1% of diagnosis and treatment and 7.4% of mode of delivery recommendations were based on level a evidence (figure 4b). distribution of quality of evidence underlying obstetric recommendations stratified by the type of guideline, published (a) before and (b) after december 2007. of the older gynaecological guidelines, 14.3% of evaluative and 18.8% of diagnostic and treatment recommendations were based on level a evidence (figure 5a), compared with 0% of evaluative and 15.1% of diagnostic and treatment recommendations published under the new classification system (figure 5b). distribution of quality of evidence underlying gynaecology recommendations stratified by the type of guideline, published (a) before and (b) after december 2007. the 20 gynaecology guidelines were further categorised by subspecialty ; the majority (70%) addressed general gynaecology issues ; 20% were concerned with fertility ; 5% with oncology and 5% with endoscopy. the results showed that 10.8% of fertility guidelines published under the old system and 20.8% of those published more recently, were based on level a evidence, compared with 24.2% and 7.3% of general gynaecology guidelines published before and after december 2007, respectively. there was only one guideline related to gynaecological oncology, for which none of the evidence was level a. conversely, the only endoscopy guideline was based on evidence, of which 42.3% was level a (figure 6). quality of evidence underlying gynaecological subspecialty guidelines, published (a) before and (b) after december 2007. overall, the results suggest that the majority of supportive evidence behind the rcog guidelines is based on clinical expertise or studies defined as low quality, and that this does not appear to be changing with new guidelines. the findings of this guideline analysis suggest that on average across the categories, fewer than 20% of recommendations by the rcog were based on high quality evidence, with a large proportion based on recommended best practice and expert opinion. we go on to question why this is so and what this means in an era of evidence - based practice. the green - top guidelines reviewed in this study are written and developed by the rcog to provide systematic recommendations in the hope of assisting clinicians and patients in clinical decision - making. guideline topics are selected through a process coordinated by the guidelines and audit committee, made up of clinicians, with input from the rcog consumers forum. they must then meet the appraisal of guidelines for research and evaluation in europe (agree) criteria and are subsequently peer reviewed in a formal, open process. the system used by the rcog to grade the evidence quality this is intended to introduce further rigour into the classification of evidence quality underlying guidelines. however, there is also concern that such a simplistic representation of evidence (stating quality as a, b or c) might not communicate an accurate enough interpretation of quality (charles. recommendations are not intended to be used exclusively to decide upon a course of management or treatment ; instead the clinician s judgement should also give equal consideration to individual patient needs and the variation of recourses between institutions (rcog 2012). the recent institute of medicine report in the usa on the development of guidelines and their worth in modern practice highlights the fact that guidelines can be flawed in their formation ; such flaws may be due to a lack of transparency in how they are created and rated, and an absence of rigorous external review. they suggest that authors of guideline recommendations should provide a summary of the quality of the evidence they have used (institute of medicine, no date). research in obstetrics and gynaecology, as in other fields (lee and vielemeyer 2011 ; mcalister. the acute nature of the specialty means there are ethical and practical difficulties that make trial design and implementation impossible (lee and vielemeyer 2011). some have postulated that practice based on such real - life observational evidence might be of more value in obstetrics than randomised control trials (vintzileos 2009), however, this evidence would be prone to error and bias. in addition, only a minority of obstetricians conduct a literature search when presented with a clinical dilemma, and personal experience and views of experts still have a far - reaching influence over obstetric practice (olatunbosun. it is also important to acknowledge the uniqueness of obstetric practice in relation to its partner, midwifery. the ancient tradition and long history of midwifery has its own body of expert opinion, based on historical and research experience, and the royal college of midwives has its own set of online guidelines, which does not use the grade system. within the subspecialties of obstetrics and gynaecology, there is a difference in quality of supportive evidence ; endoscopy, a relatively new intervention in this field, would require evidence to prove its value and would have the financial backing needed to provide this however, some grade c recommendations for established practice can be very useful in a for example, that low risk postpartum women do not need thromboprophylaxis (rcog 2009). even fundamental corner - stones of clinical practice, such as partograms, are not based on strong evidence. a review of the use of partograms on birth outcomes conducted by the cochrane collaboration concluded that they could not recommend the routine use of the partogram as part of standard labour management (lavender. zhang (2002) also found that the average labour of nulliparous women varies markedly from the friedman curve during the first stage of labour, and as such, it is possible that interventions for slow progression may come too early due to overly strict guidelines (zhang. even when there is supposedly good quality evidence underpinning guidelines, this is sometimes flawed a case in point is the issue of caesarean delivery of breech presentations. the publication of the term breech trial (hannah 2000), a multicentre randomised trial, implied that it was safer to perform a caesarean section at birth for all breech infants, and as such, it was incorporated into guidelines in the usa, uk and canada. however, a post hoc inquiry into this trial s methodology has revealed inconsistencies and errors in data collection and analysis, which make the study s findings unreliable (kotaska 2011). however, the introduction of such rigid parameters may be detrimental to the accuracy of the analysis. naturally this system is dependent on the reviewer, and other researchers may differ in their approach to classification. this analysis has revealed that the majority of guideline recommendations were not underpinned by high quality evidence. the same sort of discourse is occurring in the basic sciences, as in the new scientist article : is medical science built on shaky foundations?, which raises the point that more than half of biomedical findings can not be reproduced (iorns, 2012). one could ponder the impact of these conclusions that, in both the uk and usa, the majority of practice guidelines are not founded on high quality evidence, and this is reflected in clinical practice, in science and medicine across the board. we should not dismiss the limitations of the rcog or acog recommendations, but acknowledge them in order to neutralise any assumptions made by clinician or patient that recommendations are based on high quality evidence. all medical colleges could offer this form of descriptive analytic summary of the quality of evidence their guidelines are based on. this would provide greater clarity for clinicians as to the core scientific foundations of their clinical practice, as well as serving to aid transparency of speciality knowledge in the clinician | evidence - based medicine aims to translate scientific research into good medical practice. the royal college of obstetricians and gynaecologists publishes recommendations and guidelines to guide clinicians in decision - making. in this study, the evidence base underlying the green - top guidelines has been analysed in order to establish the quality of research underlying recommendations. during this descriptive study of 1,682 individual recommendations, the authors found that only 912% of the guidelines were based on the best quality (grade a) evidence. the authors believe that this type of analysis serves to provide greater clarity for clinicians and patients using guidelines and recommendations in the field of obstetrics and gynaecology to make collaborative clinical decisions. |
intestinal malrotation is a congenital abnormal position of the bowel within the peritoneal cavity. in cases of midgut volvulus, it is critical to make a diagnosis and to intervene immediately to avoid the potentially life - threatening consequence of intestinal necrosis, which in severe cases may lead to short bowel syndrome. there is currently no gold standard for treatment of massive intestinal necrosis detected at laparotomy. in cases of midgut volvulus with extensive areas of bowel ischemia that did not recover after derotation, a second - look operation can be attempted to identify viable intestine ; however, the basis for predicting intestinal viability has yet to be described, and viability is difficult to define. we report a case of neonatal malrotation with midgut volvulus in which necrotic, not ischemic, bowel was preserved in second - look laparotomy. the preserved intestine, which appeared to be non - viable but had a moderate blood supply, was pathologically shown as full - thickness small bowel necrosis, distributed in a patchy fashion. fortunately, the preserved necrotic intestine was able to regenerate ; the patient survived and performs normal daily activities. we discuss issues regarding the management of non - viable small bowel with midgut volvulus. a baby boy was born at term, weighing 3136 g. he did well for the first ten days of life ; feeding was begun at 8 hours of age, and was well tolerated. he vomited several times on the tenth day, presenting the next day with persistent bilious vomiting at the emergency room of the municipal hospital. he was immediately intubated and resuscitated for pre - shock status, with initial laboratory findings of profound dehydration and marked metabolic acidosis (ph 6.879, be 25.8). abdominal ultrasonography and computed tomography suggested midgut volvulus with ischemic bowel. at emergent laparotomy (fig. 1a), a 630 clockwise volvulus of the midgut was found with an extensive area of ischemic and dusky - black bowel from the duodenum to the transverse colon. after derotation and ladd procedure, ischemic bowel between the distal part of the duodenum and the jejunum showed no improvement and was resected. the distal 75 cm of the terminal ileum, which was considered to have questionable recovery of blood flow, was preserved in the hope of regenerating viable intestine. the duodenostomy was completely necrotized but the proximal portion had maintained blood flow, and was divided, lying as a blind end in the sub - hepatic position. blood flow in the bowel between the ileum and transverse colon was markedly improved ; however, the ileum had many necrotic areas, identifiable as paper - thin intestine, distributed in a patchy and circumferential manner (fig. a portion of paper - thin ileum was resected circumferentially by approximately 3 cm in width as specimen or intraoperative rapid histological diagnosis in order to determine the appropriate surgical plan. the distribution of these apparently non - viable and necrotic areas with a moderate blood supply was so widespread that we could not resect any other part of the intestine, and made the decision to wait and see. the resected ileum was anastomosed in an end - to - end manner and ileostomy was performed. after the second operation, ileostomy appeared viable and the patient s general condition had improved. aspirated gastric and bile juice to which was added a large amount of l - glutamine was administered through the ileostomy to the residual ileum and colon to confer mucosal immunity and reformation. contrast study of the gastrointestinal tract through the ileostomy on pod 25 showed poor peristalsis and varying ileal caliber. a small quantity of milk was then introduced through the ileostomy in addition to transparenteral nutrition (tpn) ; however, his body weight did not increase successfully. on pod 43, closure of the ileostomy pathological study showed that the appearance of the ileal mucosa had returned to normal, although the muscle layers were damaged locally. on the fourth day after closure, oral intake and probiotics were started in addition to tpn ; there were no problems with the nutrient intake and the patient s body weight increased. he was discharged from the hospital at 3 months of age, weighing 4626 g and tolerating oral feeding. the survival rate of children with malrotation due to midgut volvulus is greater than 80% ; however, high mortality is still observed in patients with extensive necrotic bowel due to malrotation. the high mortality is due to the conventional management of patients with significant non - viable bowel by extensive resection, which may lead to life - threatening short bowel syndrome. extensive resection of the bowel remains a highly morbid condition, and has poor short- and long - term survival. our operational goal is to derotate the midgut, perform revascularization, assess bowel viability, and resect necrotic bowel. a second - look operation has been suggested to define areas of nonviable intestine and to improve decision - making. second - look laparotomy may be justifiable on initial surgery findings that include extensive areas of ischemic bowel, ambiguous margins of demarcation between well - vascularized and necrotic bowel, questionable viability of the bowel, and poor blood supply to the remaining bowel. we experienced a case of catastrophic neonatal midgut volvulus that underwent a second - look laparotomy. the first assessment showed extensive ischemic bowel, with no further improvement after derotation and division of ladd s band. at second - look laparotomy, the remaining small bowel appeared to be non - viable but had a moderate blood supply, and was pathologically shown to exhibit full - thickness small bowel necrosis with patchy distribution. resection of all of the necrotic intestine would have left very little remaining small bowel. the decision was made not to resect any intestine in the hope that the tissue would regenerate. we concluded that the bowel was non - viable and necrotic based on its paper - thin appearance. this diagnosis was confirmed by pathological examination ; however, the preserved intestine was able to regenerate, and normal function was restored over a period of 1 month. necrotic bowel with a patchy distribution may offer an ideal scaffold for intestinal regeneration if there is a sufficient blood supply. from this viewpoint, even when intestinal viability is questionable, preservation is worthwhile in the hope of regeneration, if there is sufficient blood flow. a previous report showed that extensive non - viable bowel recovered to some extent after withholding resection and waiting for normal function to return. non - viable intestine may recover with adequate blood flow and may change a fibrous band without lumen with the absence of blood flow. the preservation of seemingly non - viable intestine, however, represents a great challenge. ischemic reperfusion injury and necrotic change can induce severe systemic damage that can not always be regulated by intensive care and may even be fatal. there may be no gold standard for treating extensive necrotic bowel with midgut volvulus. preservation of involved bowel may offer a possible treatment method for catastrophic midgut volvulus in the case that the extensive areas of apparently non - viable intestine have moderate blood supply. now, we have no objective scientific criteria for judgment with regard to sufficient blood flow to recover from the necrotic bowel. we mainly decide whether the necrotic bowel is resected or not, dependent on the macroscopic or pathological appearance of it. many scientific data on the sufficient blood flow for regeneration of non - viable intestine need be accumulated. even when intestinal viability is questionable, preservation enables the chance of regeneration if there is macroscopic sufficient blood flow. schematic images for the operative procedures. a the first operative procedure. b the second - look operative procedure. c the third operative procedure. the appearance of the bowel is markedly improved compared with that after the first operation, suggesting a sufficient blood supply. the intestine is paper - thin and distributed in a patchy and circumferential manner (arrows), appearing necrotic and non - viable. pathological findings of the paper - thin intestine (h / e stain) at second laparotomy showing full - thickness necrosis with hemorrhage. | abstractmidgut volvulus is a highly life - threatening condition that carries a high risk of short gut syndrome. we report a case of catastrophic neonatal midgut volvulus in which second - look laparotomy revealed apparently non - viable remnant small intestine but with a moderate blood supply. full - thickness small intestine necrosis was distributed in a patchy fashion, with non - viable and necrotic areas distributed so widely that no portion of the intestine could be resected. a section of full - thickness necrotic intestine preserved at surgery was able to regenerate, and normal function was restored over a period of 1 month. this case indicated that intestinal resumption may be dependent on blood flow. even when intestinal viability is questionable, preservation enables the chance of regeneration if moderate blood flow is present. |
the first two micrornas (mirnas) discovered, lin-4 and let-7 from caenorhabditis elegans, were described in 1993 and 2000, respectively. these two mirnas, which are both 21 nucleotides long, were found to be endogenous regulators of genes involved in developmental timing [1, 2 ]. since then, hundreds of mirnas have been identified in plants, animals, human beings and viruses by molecular approaches and bioinformatics predictions ; meanwhile, mirnas have emerged as crucial players in regulating gene expression in a variety of organisms [35 ]. mirnas are a broad class of small non - coding rnas usually 2125 nucleotides in length that regulate gene expression at the post - transcriptional level. most mirnas are transcribed by rna polymerase ii from individual mirna genes, from the introns of protein coding genes, or from poly - cistronic transcripts that often encode multiple related mirnas. these long primary transcripts, usually thousands of nucleotides, generate a stem - loop containing primary mirna (pri - mirna). in animals, pri - mirnas are transcribed from the chromosome and then are cleaved into mirna precursors (pre - mirnas) by a multiprotein complex made up of drosha ribonuclease iii and dgcr8, a double - stranded rna - binding protein [810 ]. pre - mirnas of about 6070 nucleotides fold into an imperfect stem - loop structure and are then transported to the cytoplasm via an exportin-5 and ran - gtp - dependent mechanism. pre - mirnas are next processed by another endonuclease rnase iii enzyme dicer into an imperfect dsrna duplex made of two complementary strands approximately 22 nucleotides in length : mirna and mirna. these represent the mature mirna strand and its complementary strand [8, 12 ]. the stem loop in pre - mirnas contributes to the strand selection ; however, the mirna can also be processed to its mature form and used in gene regulation. it was originally proposed that the double stranded small mature rnas could be separated by an atp - dependent helicase and the single - stranded form of the mirna then incorporated into the risc (rna - induced silencing complex) [14, 15 ]. however, the current concept is that argonaute family proteins at the core of the risc receive double stranded small rnas, and the selection of the rna strand to be incorporated is controlled by the thermodynamic profile of the small rna duplex termini [1618 ]. once incorporated, the mirna - programmed forms of risc (mirisc) participate in post - transcriptional regulation [19, 20 ]. as part of the risc, the mature mirna guides the complex to its mrna targets, with which it interacts using complementary base - pairing. in animals, mirnas typically target sequences in the 3 untranslated regions (3utrs) of mrna that are partially complementary to the mirna, leading to repression of protein synthesis. if the complementary base - pairing interaction between the mirna and target mrna 39utrs happens to be perfect or near - perfect, the target mrna can be cleaved and degraded. more than 700 human mirnas have been discovered, and it is estimated that these mirnas regulate approximately 30% of all protein - coding genes. mirnas have been found to participate in almost every cellular process investigated, including such diverse biological functions and processes as development, differentiation, metabolism, growth, proliferation and apoptosis ; they are currently the centre of attention in molecular and cell biology research [1, 6 ]. dysregulation of mirnas is thought to contribute to different human pathologies including cancer, heart and neurodegenerative diseases [7, 2225 ]. recently, mirna profiling studies have indicated that mirna-196 (mir-196) is overexpressed in several tumour tissue samples. in addition, increasing numbers of reports indicate that mir-196 plays important roles in development and immunity through targeting of specific genes. in this review, we discuss the known functions and molecular mechanisms of mir-196 in normal development and the pathogenesis of cancer. further investigation of these newly discovered functional roles of mir-196 may lead to potential clinical applications of mir-196 in the management of several human diseases. the gene families for mir-10, mir-196 and mir-615 are located in the regions of homeobox (hox) clusters within the genome of vertebrates. hox genes encode homeodomain - containing transcription factors that are essential for embryonic development. in many species, activation and silencing of hox genes requires preservation of their native order within each cluster, and the evolutionary patterns of both mir-10 and mir-196 closely resemble that of the hox genes in vertebrates. the mir-196a-1 gene is located on chromosome 17 (17q21.32) at a site between hoxb9 and hoxb10 genes, and the mir-196a-2 gene is located at a region between hoxc10 and hoxc9 on chromosome 12 (12q13.13) (fig. the gene for mir-196b is located in a highly evolutionarily conserved region between hoxa9 and hoxa10 genes, on chromosome 7 (7p15.2) in human beings and chromosome 6 (6qb3) in mice (table 1 and fig. 1). mir-196a-1 and mir-196a-2 genes transcribe the same functional mature mirna sequence (3-ggguuguuguacuuugauggau-5), whereas mir-196b gene produces a small rna (3-ggguuguuguccuuugauggau-5), which differs from the sequence of mir-196a by one nucleotide. many mirnas are fairly well - conserved among vertebrates ; in fact, they are as conserved as the most conservative phylogenetic footprints. although mirnas are very small in size, they carry a strong phylogenetic signal [28, 31 ]. information on human mir-196 genes was obtained from the ensembl genome browser (hppt://www.ensembl.org). the mir-196a-1 gene is located in the region between hoxb9 and hoxb13 on chromosome 17, mir-196a-2 in the region between hoxc10 and hoxc9 on chromosome 12, and mir-196b in the region between hoxa9 and hoxa10 coding on chromosome 7. mir-196 genes and mature sequences the mature sequences of the hsa - mir-196a-1, hsa - mir-196a-2 and hsa - mir-196b were acquired from the mirbase sequence database (http://microrna.sanger.ac.uk). high - mobility group a (hmga) proteins are able to directly bind to the mir-101b and mir-196a-2 upstream region and regulate the expression of these mirnas. several mirnas such as mir-196a-2, mir-101b, mir-331 and mir-29a are significantly decreased in homozygous hmga1-knockout murine embryonic fibroblasts in comparison with wild - type cells. also, a series of reporter transgenes (sensors) in mouse embryos have been created for visualizing the tissue - specific expression of several mirnas during embryogenesis, including mir-10a and mir-196a, which are both encoded by genes embedded in hox clusters. it was found that mir-196a was influenced by regulatory controls imposed on the hox clusters. however, the hoxb9 gene, located immediately upstream of mir-196a-1, actually has more restricted expression in the head and anterior truck of embryos than mir-196 ; this suggests that mir-196 family members are not regulated simply by control elements shared with the nearest hox genes. furthermore, mir-196a negatively regulates target gene hoxb8, indicating that its restricted expression pattern probably reflects a role in the hox complex expression and function. identification of putative mrna targets is important in order to understand the specific functions of mirnas. however, this can be very challenging because mirnas are usually imperfectly complementary to the 3utr region of their targets mrnas. in animals, the most consistent requirement for mirna and target mrna interaction is a contiguous and perfect base pairing of the 5mirna nucleotides 2 to 8, called the seed region. in many cases, the seed region seems to determine which targets the mirna will recognize. in other cases, for example, a specific mrna 3utr sequence can have a reasonable complementarity to the 3 half of a mirna which allows the interaction to be stabilized, while mismatches are present in the central region of the mirna - mrna. however, it is possible that a single mrna may be regulated by multiple mirnas, while a single mirna may target multiple transcripts within a cell type ; this amplifies the scope of putative mirna regulation of gene expression. thus, the particular cellular environment of a given mirna will determine its functions in a specific cell type. a given mirna such as mir-196 may regulate different genes in different types of cells or under different conditions. mammals have four hox clusters (hox a to d) containing a total of 39 genes organized into 13 paralogous subgroups. with the exception of a single g : u mismatch, pairing between mir-196a and the human hoxb8 39utr is perfect (fig. this conserved, near - perfect pairing suggests that hoxb8 mrna is targeted by mir-196a for cleavage. indeed, mir-196 is known to direct the cleavage of hoxb8 mrna in mouse embryos and also regulates the expression of hoxc8, hoxd8 and hoxa7 by transcriptional inhibition ; however, the mechanisms are not fully understood [28, 36 ]. the individual target sites of the hoxb8 mrna 3utr are conserved across several vertebrate species (fig. the short genomic distances between mir-196 and mir-10 and their targets are remarkable ; the target genes are located in close proximity to these mirnas [26, 37 ]. mir-10c is encoded 25 kb from its target sites in hoxb3a and 48 kb from those in hoxb1a, and a mir-196 paralogue is located only 18 kb from hoxb8 and hoxc8 and 14 kb from hoxa7. in this case, the mirna may act in an auto - regulatory fashion on parts of its original precursor. kawasaki and colleagues showed that mir-196 inhibits hoxb8 expression within myeloid differentiation of hl60 cells. transfection with the vector - expressed mir-196 repressed the expression of hoxb8 by cleaving the mrnas. thus, the mirnas appear to fine - tune the expression of the hox genes by regulating the hox genes themselves and also by regulating the downstream targets of hox genes. predicted mir-196 target recognition sites in the hoxb8 3utr in human beings and other species. the predicted mir-196 target recognition sites in human beings and other species were obtained from the targetscanhuman 5.1 program (http://www.targetscan.org). hmga2 gene product was identified as a putative target of mir-196a-2, suggesting that hmga1 can down - regulate the expression of hmga family members through mir-196a because hmga1 could up - regulate mir-196a-2 expression. two potential mir-196a target recognition sites are present at the hmga2 mrna 3utr, and the nucleotide sequence at these sites are conserved in several species (fig. 3). predicted mir-196 target recognition sites in the hmga2 3utr in human beings and other species. annexin a1, also known as lipocortin or p35, is a well - characterized member of the calcium- and phospholipid - binding protein family of annexins. a potential mir-196a target recognition site is present at the annexin a1 mrna 3utr, and the conserved sequence is observed in three species (fig. 4). however, the homology of mir-196 recognition sites on annexin a1 among species is much lower than that of hoxb8 and hmga2, described above. it is not clear why this mir-196 target recognition sequence is not conserved in more species. also, further investigation will be needed to confirm the specific interactions between mir-196 and annexin a1 in different types of cells and under different conditions. predicted mir-196 target recognition sites in the annexin a1 3utr in human beings and other species. several other genes have been predicted to be target molecules of mir-196, including s100 calcium - binding protein a9, small proline - rich protein 2c, keratin 5, clca family member 2 (a chloride channel regulator), cytochrome p450 (family 4, subfamily b, polypeptide 1), keratin 4, ldoc1, leukotriene a4 hydrolase, pleiotrophin, t - cell differentiation protein, tumour protein d52-like 1, visinin - like 1 and v - ets erythroblastosis virus e26 oncogene homologue (erg). however, most of these target molecules of mir-196 have not been confirmed with experimental approaches. experimentally verified target genes regulated by mir-196 mir-196 appears to play an important role in development. its relationship to the hox gene family, crucial for embryonic development, is well - described. in drosophila, there is a conserved or possibly convergent interaction between the mir-196 homologue iab-4 and the homeotic ubx hox gene. analysed the iab-4 locus, which produces the mir - iab-45p and mir - iab-43p and found that mir - iab-45p could directly inhibit ubx activity in vivo. iab-45p attenuated endogenous ubx protein accumulation and induced a classical homeotic mutant phenotype : halteres transformed into wings. in chicken, the interaction between mir-196 and hoxb8 has been implicated in the mechanism that abolishes the competence of mesoderm to undergo limb induction by retinoic acid. mir-196 may act at the upstream of hoxb8 and sonic hedgehog (shh) in vivo in the context of limb development, specifically in the hindlimb. endogenous mir-196a is expressed at the posterior trunk during xenopus development and its expression level increases in later stages. overexpression of mir-196a by microinjection of synthetic mammalian mir-196a precursor into xenopus embryo during early development led to dose - dependent eye anomalies and changes in the expression of several critical genes. hmga are nuclear architectural factors that play critical roles in a wide range of biological processes. two variants of hmga proteins, hmga1 and hmga2, have been identified, and both proteins are encoded by two distinct genes and have three dna binding motifs called at - hooks. both hmga genes are highly expressed during embryogenesis, and there is evidence that the absence of hmga 2 protein causes growth retardation in mice [46, 47 ]. it is interesting that hmga1 is able to regulate mir-196 expression, whereas mir-19a can control hmga2 mrna translation, which may affect development. defined the expression pattern of mirna precursors in pancreatic cancer and compared it with those of normal pancreas and chronic pancreatitis using microarray analysis ; by looking also at the pattern of mirna expression with respect to long - term (24 months) survival, it was found that mirna-196a levels are inversely correlated with survival in pancreatic adenocarcinoma patients. it has been reported that an analysis of the expression of mir-196a along with mir-217 can be used to classify benign and malignant pancreatic tissues in pancreatic fine - needle aspirates. also, the plasma levels of mir-196a along with other mirnas including mir-21, mir-210 and mir-155 have been found to be significantly higher in patients with pancreatic adenocarcinoma than healthy controls. thus, mir-196a may represent an important factor in the pathogenesis of pancreatic cancer and may prove useful in the diagnosis, prognosis and/or treatment of this devastating disease. likewise, we recently reported that the expression of mir-196a was significantly up - regulated by real time pcr analysis in the majority of pancreatic cancer tissues (70%) and cell lines (100%) compared normal pancreatic tissues and cells. performed mirna expression analysis by using taqman low density arrays with quantitative real - time pcr confirmation in 40 archival formalin - fixed paraffin - embedded breast lumpectomy specimens, and found that a panel of mirnas was consistently dysregulated in breast cancer compared with normal breast samples ; this included up - regulation of previously reported breast cancer - related mirnas such as mir-21, mir-155, mir-191 and mir-196a as well as down - regulation of mir-125b and mir-221. the quality of these data validate conducting global mirnas profiling using ffpe samples, thereby offering enormous opportunities to evaluate such materials linked to clinical databases in order to rapidly acquire insight into the pathogenic roles of mirnas. in leukaemia, levels of mir-10a, mir-10b and mir-196a-1 showed a clear correlation with hox gene expression in 30 cases of primary adult acute myeloid leukaemia (aml) with normal karyotype, according to quantitative real - time pcr assay. in addition to the hox genes, nearly 30% of the genes with a high correlation with mir-10a, mir-10b and mir-196a-1 have been shown to have oncogenic potential [5355 ]. by quantifying expression of 19 selected mirna genes, schotte. found that the expression of mir-196b was 500-fold higher in myeloid / lymphoid or mixed lineage leukaemia (mll)-rearranged cases and 800-fold higher in 5/15 t - lineage acute lymphoblastic leukaemia (t - all) cases compared with expression levels in precursor b cell acute lymphoblastic leukaemia (b - all) cases. these data indicate that the expression profiles of these mirna are all subtype - specific rather than linked to the differentiation status associated with these subtypes. showed that the mll gene normally regulates expression of mir-196b in a pattern similar to that of the surrounding 5 hox genes, hoxa9 and hoxa10, during stem cell differentiation. again, overexpression of mir-196b was found specifically in patients with mll - associated leukaemia based on analysis of 55 primary leukaemia samples ; these demonstrated increased proliferative capacity and survival, as well as a partial block in differentiation in bone marrow progenitor cells. meanwhile, leukemogenic mll fusion proteins cause over expression of mir-196b, which may be necessary for mll fusion - mediated immortalization. a recent report demonstrated that mir-196b expression is significantly more up - regulated in aml than all and that, again, mir-196b up - regulation is negatively associated with overall survival of aml patients. in addition to the mir-196b deregulation observed in leukaemia, mir-196b has been reported to induce changes in myeloid development, and the co - expression of mir-196b and mir-21 reportedly block granulocyte colony - stimulating factor - induced granulopoiesis completely. highly elevated levels of mir-196a have also been detected in oesophageal adenocarcinoma, based on analysis of microdissected paraffin - embedded tissues from 11 patients. this study found that mir-196a may have growth - promoting and anti - apoptotic functions ; further, it may be considered a marker of progression from barrett s oesophagus to low - grade dysplasia, high - grade dysplasia and oesophageal adenocarcinoma. mir-196a levels were inversely correlated with the predicted target keratin 5, small proline - rich protein 2c and s100 calcium - binding protein a9 mrna levels in oesophageal adenocarcinoma. the expression of hmga proteins is usually low or absent in most of normal adult tissues ; however, overexpression of hmga proteins has been observed in several human malignancies and has been found to correlate with occurrence of metastasis and poor prognosis. moreover, transgenic mice overexpressing either hmga1 or hmga2 develop lymphoma and pituitary adenomas, which strongly suggest oncogenic property of these proteins [5962 ]. it could promote tumour progression if hmga1 dominantly up - regulates mir-196 expression ; however, if mir-196 significantly inhibits hmga2 protein synthesis, it could inhibit tumour progression. thus, ultimate impact of mir-196 on the tumour pathogenesis will be dependent on the balance of regulation of mir-196 expression and mir-196 targeting molecules (oncogenes or tumour suppression genes) in specific cells. these regulation mechanisms of mir-196 expression and functions are largely unknown and warrant further investigation. increased levels of mir-196a have also been found in 12 cancer cell lines of oesophageal, breast and endometrial origin and 10 oesophageal adenocarcinomas ; furthermore, levels of mir-196a have been demonstrated to have a significant inverse correlation with annexin a1 mrna levels in these cancers. annexin a1 has been postulated to act as tumour suppressor in different cancers such as prostate, breast, oesophageal and b - cell non - hodgkin s lymphoma [6367 ]. as annexin a1 could be a target molecule of mir-196a, increased mir-196a may mediate down - regulation of annexin a1, contributing to tumorigenesis. however, overexpression of annexin a1 has been reported in pancreatic, hepatic and stomach cancers, suggesting that the functional role of annexin a1 may be tissue- and cell type - specific [6870 ]. of note, the majority of pancreatic cancer tissues and cell lines demonstrate a high expression level of mir-196a. the relationship and functional interactions of mir-196a and annexin a1 warrant further investigation. mir-196a the mir-196a expression profile in colorectal cancer, mucosal samples and diverse cancer cell lines has been quantified by rt - pcr, and mir-196b has been found to be up - regulated in colonic cancer. high levels of mir-196a were observed to activate the akt signalling pathway ; promote cancer cell detachment, migration, invasion and chemosensitivity ; and increase the development of lung metastases in mice after tail vein injection [71, 72 ]. although most studies on mir-196 suggest its oncogenic function in cancer, it is important to point out that mir-196 may play a tumour suppressive role as well. for example, strongly reduced expression of mir-196a was observed in melanoma cells when compared to healthy control melanocytes, and the low mir-196a expression in melanoma cells led to high hoxb7 gene expression, which subsequently raised ets-1 and bmp4 activity and thereby enhanced migratory potential of these melanoma cells. moreover, a recent report by li. showed that enforced expression of mir-196a or mir-196b reduced in vitro invasion and in vivo spontaneous metastasis of breast cancer cells, indicating that the members of mir-196 family are potent metastasis suppressors. if mir-196 has a dominant effect on the inhibition of oncogenic molecules, mir-196 will play a tumour suppressor function ; although if mir-196 mainly targets tumour suppressors, mir-196 will demonstrate oncogenic effects. mirnas are likely important players in the pathogenesis of cancer, and dysregulation of mirna expression in cancer is an important field of investigation. both genetic and epigenetic alterations may affect mirna biogenesis and activity [75, 76 ]. for example, one single - nucleotide polymorphism (snp) of mir-196a-2 (rs11614913) has been associated with survival in chinese individuals with lung cancer ; those patients with the cc genotype had reduced survival. this particular snp affects the binding efficiency of mir-196a-2 to its target mrna [77, 78 ]. the presence of the cc genotype also correlated with increased susceptibility to lung cancer in the same patient population. consistently, this variant is also associated with increased gastric cancer risk in chinese patients. in two separate studies, the tt genotype of this snp was found to be associated with decreased risk of breast cancer in a chinese population, whereas the cc genotype again was associated with an increased risk of breast cancer in chinese patients [80, 81 ]. meanwhile, the opposite relationship has been described in glioma, where the cc genotype was associated with a decreased risk. this discrepancy highlights the need for further investigation of this snp in different tissues, tumours and patient populations. of note, the major allele in the caucasian population is the c allele, whereas in the chinese population, the major allele is t. so, interestingly, the variant homozygote cc genotype as described in chinese population studies is actually the dominant genotype in caucasians ; this exemplifies the limitations of attributing the terms wild - type and variant to the alleles when describing snps. endometriosis is a gynaecological disorder in females in which endometrial - like cells grow in areas outside the uterine cavity. a mirna expression study identified mir-196b as one of 8 down - regulated mirna in ectopic endometrial tissues as compared to paired eutopic tissues. mir-196 may also play a role in the pathogenesis of severe congenital neutropenia (scn), a rare haematological disorder characterized by an abnormally low number of neutrophils. mutations in several genes, including growth factor independent protein 1 (gfi1), have been reported to be responsible for scn. gfi1 is a transcriptional repressor that is required for normal myelopoiesis, and gfi1 loss - of - function mutations are found in some patients with scn. it has been shown that mir-196b is negatively regulated by gfi1 ; its expression is up - regulated in gfi1 mice and gfi1n382s scn patients. thus, up - regulation of mir-196 may mediate some of the effects of this disease. indeed, cd56 t cells may be able to up - regulate the expression of mir-196a, which shows anti - hepatitis c virus (hcv) properties [84, 85 ]. furthermore, antiviral cytokine interferon can induce numerous cellular mirnas, including mir-196, which have sequence - predicted targets within hcv genomic rna. overexpression of these mirnas in infected liver cells leads to a marked attenuation of viral replication, demonstrating the importance of mirnas in anti - viral immunity. since viruses also play a role in the pathogenesis of several tumour types, mirnas may mediate viral host interactions that have important implications not only for infectious diseases but also for cancer pathogenesis. a recent study revealed that mir-196a plays an important role in mesenchymal stem cell differentiation. specifically, overexpression of mir-196a inhibited the proliferation of human adipose tissue - derived mesenchymal stem cells while enhancing osteogenic differentiation. mir-196a, along with three other mirnas, displayed an increased expression in red blood cells up to day 20 after blood collection, after which expression subsequently decreased. thus, mirnas may be potentially useful markers to predict storage - related lesions during blood storage. although the mature nucleotide sequence is identical for mir-196a-1 and mir-196a-2, mature mir-196b differs from mir-196a by one nucleotide. the expression levels of mir-196 appear to be strictly controlled under physiologic conditions, whereas dysregulation of mir-196 can be observed in many disease conditions. mir-196 may play critical roles in normal development and cancer pathogenesis by targeting several regulation molecules including hoxb8, hmga2 and annexin a1. meanwhile, it may also play roles in viral immunity and the cell differentiation processes that, when dysregulated, lead to endometriosis and scn. however, the detailed functions and molecular mechanisms whereby mir-196 contributes to the pathophysiology of these diseases remain largely unknown. for example, it is not completely understood how mir-196a is regulated ; how mir-196a controls cell proliferation or differentiation ; and how mir-196a differentially recognizes its target molecules in a cell- or tissue - specific fashion. addressing these critical questions will help to establish potential clinical applications of mir-196-directed technology in the diagnosis, treatment, and/or prognosis of development defects, viral infections and different types of human cancers. the gene families for mir-10, mir-196 and mir-615 are located in the regions of homeobox (hox) clusters within the genome of vertebrates. hox genes encode homeodomain - containing transcription factors that are essential for embryonic development. in many species, they are organized in tightly linked clusters along the chromosome. activation and silencing of hox genes requires preservation of their native order within each cluster, and the evolutionary patterns of both mir-10 and mir-196 closely resemble that of the hox genes in vertebrates. the mir-196a-1 gene is located on chromosome 17 (17q21.32) at a site between hoxb9 and hoxb10 genes, and the mir-196a-2 gene is located at a region between hoxc10 and hoxc9 on chromosome 12 (12q13.13) (fig. the gene for mir-196b is located in a highly evolutionarily conserved region between hoxa9 and hoxa10 genes, on chromosome 7 (7p15.2) in human beings and chromosome 6 (6qb3) in mice (table 1 and fig. 1). mir-196a-1 and mir-196a-2 genes transcribe the same functional mature mirna sequence (3-ggguuguuguacuuugauggau-5), whereas mir-196b gene produces a small rna (3-ggguuguuguccuuugauggau-5), which differs from the sequence of mir-196a by one nucleotide. many mirnas are fairly well - conserved among vertebrates ; in fact, they are as conserved as the most conservative phylogenetic footprints. although mirnas are very small in size, they carry a strong phylogenetic signal [28, 31 ]. information on human mir-196 genes was obtained from the ensembl genome browser (hppt://www.ensembl.org). the mir-196a-1 gene is located in the region between hoxb9 and hoxb13 on chromosome 17, mir-196a-2 in the region between hoxc10 and hoxc9 on chromosome 12, and mir-196b in the region between hoxa9 and hoxa10 coding on chromosome 7. mir-196 genes and mature sequences the mature sequences of the hsa - mir-196a-1, hsa - mir-196a-2 and hsa - mir-196b were acquired from the mirbase sequence database (http://microrna.sanger.ac.uk). high - mobility group a (hmga) proteins are able to directly bind to the mir-101b and mir-196a-2 upstream region and regulate the expression of these mirnas. several mirnas such as mir-196a-2, mir-101b, mir-331 and mir-29a are significantly decreased in homozygous hmga1-knockout murine embryonic fibroblasts in comparison with wild - type cells. also, a series of reporter transgenes (sensors) in mouse embryos have been created for visualizing the tissue - specific expression of several mirnas during embryogenesis, including mir-10a and mir-196a, which are both encoded by genes embedded in hox clusters. it was found that mir-196a was influenced by regulatory controls imposed on the hox clusters. however, the hoxb9 gene, located immediately upstream of mir-196a-1, actually has more restricted expression in the head and anterior truck of embryos than mir-196 ; this suggests that mir-196 family members are not regulated simply by control elements shared with the nearest hox genes. furthermore, mir-196a negatively regulates target gene hoxb8, indicating that its restricted expression pattern probably reflects a role in the hox complex expression and function. identification of putative mrna targets is important in order to understand the specific functions of mirnas. however, this can be very challenging because mirnas are usually imperfectly complementary to the 3utr region of their targets mrnas. in animals, the most consistent requirement for mirna and target mrna interaction is a contiguous and perfect base pairing of the 5mirna nucleotides 2 to 8, called the seed region. in many cases, the seed region seems to determine which targets the mirna will recognize. in other cases, for example, a specific mrna 3utr sequence can have a reasonable complementarity to the 3 half of a mirna which allows the interaction to be stabilized, while mismatches are present in the central region of the mirna - mrna. however, it is possible that a single mrna may be regulated by multiple mirnas, while a single mirna may target multiple transcripts within a cell type ; this amplifies the scope of putative mirna regulation of gene expression. thus, the particular cellular environment of a given mirna will determine its functions in a specific cell type. a given mirna such as mir-196 may regulate different genes in different types of cells or under different conditions. mammals have four hox clusters (hox a to d) containing a total of 39 genes organized into 13 paralogous subgroups. with the exception of a single g : u mismatch, pairing between mir-196a and the human hoxb8 39utr this conserved, near - perfect pairing suggests that hoxb8 mrna is targeted by mir-196a for cleavage. indeed, mir-196 is known to direct the cleavage of hoxb8 mrna in mouse embryos and also regulates the expression of hoxc8, hoxd8 and hoxa7 by transcriptional inhibition ; however, the mechanisms are not fully understood [28, 36 ]. the individual target sites of the hoxb8 mrna 3utr are conserved across several vertebrate species (fig. the short genomic distances between mir-196 and mir-10 and their targets are remarkable ; the target genes are located in close proximity to these mirnas [26, 37 ]. mir-10c is encoded 25 kb from its target sites in hoxb3a and 48 kb from those in hoxb1a, and a mir-196 paralogue is located only 18 kb from hoxb8 and hoxc8 and 14 kb from hoxa7. in this case, the mirna may act in an auto - regulatory fashion on parts of its original precursor. kawasaki and colleagues showed that mir-196 inhibits hoxb8 expression within myeloid differentiation of hl60 cells. transfection with the vector - expressed mir-196 repressed the expression of hoxb8 by cleaving the mrnas thus, the mirnas appear to fine - tune the expression of the hox genes by regulating the hox genes themselves and also by regulating the downstream targets of hox genes. predicted mir-196 target recognition sites in the hoxb8 3utr in human beings and other species. the predicted mir-196 target recognition sites in human beings and other species were obtained from the targetscanhuman 5.1 program (http://www.targetscan.org). hmga2 gene product was identified as a putative target of mir-196a-2, suggesting that hmga1 can down - regulate the expression of hmga family members through mir-196a because hmga1 could up - regulate mir-196a-2 expression. two potential mir-196a target recognition sites are present at the hmga2 mrna 3utr, and the nucleotide sequence at these sites are conserved in several species (fig. 3). predicted mir-196 target recognition sites in the hmga2 3utr in human beings and other species. annexin a1, also known as lipocortin or p35, is a well - characterized member of the calcium- and phospholipid - binding protein family of annexins. a potential mir-196a target recognition site is present at the annexin a1 mrna 3utr, and the conserved sequence is observed in three species (fig. 4). however, the homology of mir-196 recognition sites on annexin a1 among species is much lower than that of hoxb8 and hmga2, described above. it is not clear why this mir-196 target recognition sequence is not conserved in more species. also, further investigation will be needed to confirm the specific interactions between mir-196 and annexin a1 in different types of cells and under different conditions. predicted mir-196 target recognition sites in the annexin a1 3utr in human beings and other species. several other genes have been predicted to be target molecules of mir-196, including s100 calcium - binding protein a9, small proline - rich protein 2c, keratin 5, clca family member 2 (a chloride channel regulator), cytochrome p450 (family 4, subfamily b, polypeptide 1), keratin 4, ldoc1, leukotriene a4 hydrolase, pleiotrophin, t - cell differentiation protein, tumour protein d52-like 1, visinin - like 1 and v - ets erythroblastosis virus e26 oncogene homologue (erg). however, most of these target molecules of mir-196 have not been confirmed with experimental approaches. its relationship to the hox gene family, crucial for embryonic development, is well - described. in drosophila, there is a conserved or possibly convergent interaction between the mir-196 homologue iab-4 and the homeotic ubx hox gene. analysed the iab-4 locus, which produces the mir - iab-45p and mir - iab-43p and found that mir - iab-45p could directly inhibit ubx activity in vivo. iab-45p attenuated endogenous ubx protein accumulation and induced a classical homeotic mutant phenotype : halteres transformed into wings. in chicken, the interaction between mir-196 and hoxb8 has been implicated in the mechanism that abolishes the competence of mesoderm to undergo limb induction by retinoic acid. mir-196 may act at the upstream of hoxb8 and sonic hedgehog (shh) in vivo in the context of limb development, specifically in the hindlimb. endogenous mir-196a is expressed at the posterior trunk during xenopus development and its expression level increases in later stages. overexpression of mir-196a by microinjection of synthetic mammalian mir-196a precursor into xenopus embryo during early development led to dose - dependent eye anomalies and changes in the expression of several critical genes. hmga are nuclear architectural factors that play critical roles in a wide range of biological processes. two variants of hmga proteins, hmga1 and hmga2, have been identified, and both proteins are encoded by two distinct genes and have three dna binding motifs called at - hooks. both hmga genes are highly expressed during embryogenesis, and there is evidence that the absence of hmga 2 protein causes growth retardation in mice [46, 47 ]. it is interesting that hmga1 is able to regulate mir-196 expression, whereas mir-19a can control hmga2 mrna translation, which may affect development. defined the expression pattern of mirna precursors in pancreatic cancer and compared it with those of normal pancreas and chronic pancreatitis using microarray analysis ; by looking also at the pattern of mirna expression with respect to long - term (24 months) survival, it was found that mirna-196a levels are inversely correlated with survival in pancreatic adenocarcinoma patients. it has been reported that an analysis of the expression of mir-196a along with mir-217 can be used to classify benign and malignant pancreatic tissues in pancreatic fine - needle aspirates. also, the plasma levels of mir-196a along with other mirnas including mir-21, mir-210 and mir-155 have been found to be significantly higher in patients with pancreatic adenocarcinoma than healthy controls. thus, mir-196a may represent an important factor in the pathogenesis of pancreatic cancer and may prove useful in the diagnosis, prognosis and/or treatment of this devastating disease. likewise, we recently reported that the expression of mir-196a was significantly up - regulated by real time pcr analysis in the majority of pancreatic cancer tissues (70%) and cell lines (100%) compared normal pancreatic tissues and cells. hui. performed mirna expression analysis by using taqman low density arrays with quantitative real - time pcr confirmation in 40 archival formalin - fixed paraffin - embedded breast lumpectomy specimens, and found that a panel of mirnas was consistently dysregulated in breast cancer compared with normal breast samples ; this included up - regulation of previously reported breast cancer - related mirnas such as mir-21, mir-155, mir-191 and mir-196a as well as down - regulation of mir-125b and mir-221. the quality of these data validate conducting global mirnas profiling using ffpe samples, thereby offering enormous opportunities to evaluate such materials linked to clinical databases in order to rapidly acquire insight into the pathogenic roles of mirnas. in leukaemia, levels of mir-10a, mir-10b and mir-196a-1 showed a clear correlation with hox gene expression in 30 cases of primary adult acute myeloid leukaemia (aml) with normal karyotype, according to quantitative real - time pcr assay. in addition to the hox genes, nearly 30% of the genes with a high correlation with mir-10a, mir-10b and mir-196a-1 have been shown to have oncogenic potential [5355 ]. by quantifying expression of 19 selected mirna genes, schotte. found that the expression of mir-196b was 500-fold higher in myeloid / lymphoid or mixed lineage leukaemia (mll)-rearranged cases and 800-fold higher in 5/15 t - lineage acute lymphoblastic leukaemia (t - all) cases compared with expression levels in precursor b cell acute lymphoblastic leukaemia (b - all) cases. these data indicate that the expression profiles of these mirna are all subtype - specific rather than linked to the differentiation status associated with these subtypes.. showed that the mll gene normally regulates expression of mir-196b in a pattern similar to that of the surrounding 5 hox genes, hoxa9 and hoxa10, during stem cell differentiation. again, overexpression of mir-196b was found specifically in patients with mll - associated leukaemia based on analysis of 55 primary leukaemia samples ; these demonstrated increased proliferative capacity and survival, as well as a partial block in differentiation in bone marrow progenitor cells. meanwhile, leukemogenic mll fusion proteins cause over expression of mir-196b, which may be necessary for mll fusion - mediated immortalization. a recent report demonstrated that mir-196b expression is significantly more up - regulated in aml than all and that, again, mir-196b up - regulation is negatively associated with overall survival of aml patients. in addition to the mir-196b deregulation observed in leukaemia, mir-196b has been reported to induce changes in myeloid development, and the co - expression of mir-196b and mir-21 reportedly block granulocyte colony - stimulating factor - induced granulopoiesis completely. highly elevated levels of mir-196a have also been detected in oesophageal adenocarcinoma, based on analysis of microdissected paraffin - embedded tissues from 11 patients. this study found that mir-196a may have growth - promoting and anti - apoptotic functions ; further, it may be considered a marker of progression from barrett s oesophagus to low - grade dysplasia, high - grade dysplasia and oesophageal adenocarcinoma. mir-196a levels were inversely correlated with the predicted target keratin 5, small proline - rich protein 2c and s100 calcium - binding protein a9 mrna levels in oesophageal adenocarcinoma. the expression of hmga proteins is usually low or absent in most of normal adult tissues ; however, overexpression of hmga proteins has been observed in several human malignancies and has been found to correlate with occurrence of metastasis and poor prognosis. moreover, transgenic mice overexpressing either hmga1 or hmga2 develop lymphoma and pituitary adenomas, which strongly suggest oncogenic property of these proteins [5962 ]. it could promote tumour progression if hmga1 dominantly up - regulates mir-196 expression ; however, if mir-196 significantly inhibits hmga2 protein synthesis, it could inhibit tumour progression. thus, ultimate impact of mir-196 on the tumour pathogenesis will be dependent on the balance of regulation of mir-196 expression and mir-196 targeting molecules (oncogenes or tumour suppression genes) in specific cells.. increased levels of mir-196a have also been found in 12 cancer cell lines of oesophageal, breast and endometrial origin and 10 oesophageal adenocarcinomas ; furthermore, levels of mir-196a have been demonstrated to have a significant inverse correlation with annexin a1 mrna levels in these cancers. annexin a1 has been postulated to act as tumour suppressor in different cancers such as prostate, breast, oesophageal and b - cell non - hodgkin s lymphoma [6367 ]. as annexin a1 could be a target molecule of mir-196a, increased mir-196a may mediate down - regulation of annexin a1, contributing to tumorigenesis. however, overexpression of annexin a1 has been reported in pancreatic, hepatic and stomach cancers, suggesting that the functional role of annexin a1 may be tissue- and cell type - specific [6870 ]. of note, the majority of pancreatic cancer tissues and cell lines demonstrate a high expression level of mir-196a. mir-196a may also have pro - oncogenic functions in colorectal cancer. the mir-196a expression profile in colorectal cancer, mucosal samples and diverse cancer cell lines has been quantified by rt - pcr, and mir-196b has been found to be up - regulated in colonic cancer. high levels of mir-196a were observed to activate the akt signalling pathway ; promote cancer cell detachment, migration, invasion and chemosensitivity ; and increase the development of lung metastases in mice after tail vein injection [71, 72 ]. although most studies on mir-196 suggest its oncogenic function in cancer, it is important to point out that mir-196 may play a tumour suppressive role as well. for example, strongly reduced expression of mir-196a was observed in melanoma cells when compared to healthy control melanocytes, and the low mir-196a expression in melanoma cells led to high hoxb7 gene expression, which subsequently raised ets-1 and bmp4 activity and thereby enhanced migratory potential of these melanoma cells. moreover, a recent report by li. showed that enforced expression of mir-196a or mir-196b reduced in vitro invasion and in vivo spontaneous metastasis of breast cancer cells, indicating that the members of mir-196 family are potent metastasis suppressors. if mir-196 has a dominant effect on the inhibition of oncogenic molecules, mir-196 will play a tumour suppressor function ; although if mir-196 mainly targets tumour suppressors, mir-196 will demonstrate oncogenic effects. mirnas are likely important players in the pathogenesis of cancer, and dysregulation of mirna expression in cancer is an important field of investigation. both genetic and epigenetic alterations may affect mirna biogenesis and activity [75, 76 ]. for example, one single - nucleotide polymorphism (snp) of mir-196a-2 (rs11614913) has been associated with survival in chinese individuals with lung cancer ; those patients with the cc genotype had reduced survival. this particular snp affects the binding efficiency of mir-196a-2 to its target mrna [77, 78 ]. the presence of the cc genotype also correlated with increased susceptibility to lung cancer in the same patient population. consistently, this variant is also associated with increased gastric cancer risk in chinese patients. in two separate studies, the tt genotype of this snp was found to be associated with decreased risk of breast cancer in a chinese population, whereas the cc genotype again was associated with an increased risk of breast cancer in chinese patients [80, 81 ]. meanwhile, the opposite relationship has been described in glioma, where the cc genotype was associated with a decreased risk. this discrepancy highlights the need for further investigation of this snp in different tissues, tumours and patient populations. of note, the major allele in the caucasian population is the c allele, whereas in the chinese population, the major allele is t. so, interestingly, the variant homozygote cc genotype as described in chinese population studies is actually the dominant genotype in caucasians ; this exemplifies the limitations of attributing the terms wild - type and variant to the alleles when describing snps. endometriosis is a gynaecological disorder in females in which endometrial - like cells grow in areas outside the uterine cavity. a mirna expression study identified mir-196b as one of 8 down - regulated mirna in ectopic endometrial tissues as compared to paired eutopic tissues. mir-196 may also play a role in the pathogenesis of severe congenital neutropenia (scn), a rare haematological disorder characterized by an abnormally low number of neutrophils. mutations in several genes, including growth factor independent protein 1 (gfi1), have been reported to be responsible for scn. gfi1 is a transcriptional repressor that is required for normal myelopoiesis, and gfi1 loss - of - function mutations are found in some patients with scn. it has been shown that mir-196b is negatively regulated by gfi1 ; its expression is up - regulated in gfi1 mice and gfi1n382s scn patients. thus, up - regulation of mir-196 may mediate some of the effects of this disease. indeed, cd56 t cells may be able to up - regulate the expression of mir-196a, which shows anti - hepatitis c virus (hcv) properties [84, 85 ]. furthermore, antiviral cytokine interferon can induce numerous cellular mirnas, including mir-196, which have sequence - predicted targets within hcv genomic rna. overexpression of these mirnas in infected liver cells leads to a marked attenuation of viral replication, demonstrating the importance of mirnas in anti - viral immunity. since viruses also play a role in the pathogenesis of several tumour types, mirnas may mediate viral host interactions that have important implications not only for infectious diseases but also for cancer pathogenesis. a recent study revealed that mir-196a plays an important role in mesenchymal stem cell differentiation. specifically, overexpression of mir-196a inhibited the proliferation of human adipose tissue - derived mesenchymal stem cells while enhancing osteogenic differentiation. mir-196a, along with three other mirnas, displayed an increased expression in red blood cells up to day 20 after blood collection, after which expression subsequently decreased. thus, mirnas may be potentially useful markers to predict storage - related lesions during blood storage. although the mature nucleotide sequence is identical for mir-196a-1 and mir-196a-2, mature mir-196b differs from mir-196a by one nucleotide. the expression levels of mir-196 appear to be strictly controlled under physiologic conditions, whereas dysregulation of mir-196 can be observed in many disease conditions. mir-196 may play critical roles in normal development and cancer pathogenesis by targeting several regulation molecules including hoxb8, hmga2 and annexin a1. meanwhile, it may also play roles in viral immunity and the cell differentiation processes that, when dysregulated, lead to endometriosis and scn. however, the detailed functions and molecular mechanisms whereby mir-196 contributes to the pathophysiology of these diseases remain largely unknown. for example, it is not completely understood how mir-196a is regulated ; how mir-196a controls cell proliferation or differentiation ; and how mir-196a differentially recognizes its target molecules in a cell- or tissue - specific fashion. addressing these critical questions will help to establish potential clinical applications of mir-196-directed technology in the diagnosis, treatment, and/or prognosis of development defects, viral infections and different types of human cancers. | abstractthe discovery of micrornas (mirnas) represents one of the most significant advances in biological and medical sciences in the last decade. hundreds of mirnas have been identified in plants, viruses, animals and human beings, and these tiny, non - coding rna transcripts have been found to play crucial roles in important biological processes involved in human health and disease. recently, many studies have demonstrated that mir-196 plays critical roles in normal development and in the pathogenesis of human disease processes such as cancer. several investigations have implemented cell culture and animal models to explore the potential molecular mechanisms of mir-196. this review provides updated information about the structure of the mir-196 gene and the roles of mir-196 in development, cancer and disease formation. importantly, we discuss the possible molecular mechanisms whereby mir-196 regulates cellular functions including targeting molecules and gene regulation pathways ; potential clinical applications are addressed, as well as future directions for investigation. mir-196a may prove to be a novel therapeutic target for several cancers. |
tartrazine (ta) and sunset yellow (sy) are synthetic food colors used most extensively as food additives, to improve the appearance, color, and texture of foods. when added in excess, however, these synthetic food colors can be pathogenic. to ensure food safety, the chinese government has imposed rigorous standards on the permitted levels for various synthetic food colors. for the same reason, it is important to develop effective methods for analyzing synthetic colors in food. various techniques have been applied for analyzing synthetic colors in food samples, including spectrophotometry, capillary electrophoresis, differential pulse polarography, liquid chromatography, and others, which all require an optimal extraction method to concentrate an analyte from a small amount of food sample containing miscellaneous components [9, 10 ]. solid phase extraction (spe) and liquid - liquid extraction (lle) have been reported for separating synthetic food colors from different matrices [11, 12 ]. for spe, analytes are separated following complicated and time - consuming absorption and desorption steps involving the use of toxic and volatile reagents, such as methanol, acetic acid, and ammonia, that are used in the current chinese national standard method. in contrast, an aqueous two - phase system (atps) has attracted increasing attention in that it minimizes the potential interferences from other components and enables the simultaneous extraction and concentration of analytes. by far, most reported atpss are generated by mixing two solutions of polymers, such as dextran t500 and polyethylene glycol (peg) system, or by adding a high - concentration salt solution to an aqueous polymer solution. the partition behavior of analytes between the polymer - rich phase and the aqueous phase can be controlled and optimized with a judicious choice of phase system. however, most of polymer - rich phase is highly viscous and opaque, rendering the follow - up analysis difficult. to address these issues, the development of a simple and environmentally friendly method with minimal use of volatile and toxic solvents used is of great importance. ionic liquid (il) is a green solvent and a potential replacement for traditional volatile solvents. in 2003, gutowski and coworkers first generated several atpss from different il and salts and determined the corresponding phase diagrams. the identity of il is important for the separation / analysis of a specific analyte in il - based atps. an optimal il - based apts should possess the following features : minimal emulsion formation, low viscosity, rapid phase separation, high extraction efficiency and low cost, and so forth. in this study, we aim to develop a simple and green il - based atps extraction method with high efficiency and couple it with hplc for the analysis of ta and sy from food samples. for this purpose, we selected 1-butyl-3-methylimidazolium bromide ([c4mim]br), which is not easy to emulsify and presents a lower viscidity compared with polymer - salt atps. besides, [c4mim]br was diffluent in water and methanol (the hplc mobile phase). analytes (ta + sy) could be extracted into il phase and analyzed by hplc with no further sample treatment. we showed the success of this method in the separation / analysis of ta and sy from soft drink sample, candy sample, and instant powder drink. all reagents were of analytical grade or higher in purity and purchased from sinopharm chemical reagent co., ltd., food yellow 4 ; 0.5 mg / ml), and sunset yellow (sy ; c.i. food yellow 3 ; 0.5 mg / ml) were obtained from the national research center for certified reference materials (beijing, china) and were both prepared in distilled water to a final concentration of 100 g / ml. all glass containers were stored in 10% (v / v) nitric acid overnight and rinsed with distilled water before use. ils (1-alkyl-3-methylimidazolium bromide, [cnmim]br, n = 4, 6,8) were synthesized as described previously. all spectral measurements were carried out using a model uv-2501 spectrophotometer (shimadzu, japan). phase separation of the sample solution was achieved with a centrifuge (model tdl80 - 2b, shanghai anting science instrument factory, shanghai, china). chromatographic analyses were performed on an agilent 1260 hplc system which consisted of a 1260 infinity quaternary pump with degasser gradient pump, a 1260 infinity variable wavelength detector, a 1260 infinity manual injector, and an open lab cds chemstation workstation (agilent, usa). a certain of [cnmim]br was put into a 10.0 ml centrifugal tube. k2hpo4 solution or the other tested salt solution was added dropwise to the test tube until a turbidity formed, indicating the formation of a two - phase system. thereafter, water was added dropwise to the test tube to obtain a clear one - phase system. the bimodal curve was applied to characterize the phase diagram. in the region above the bimodal curve, the system is divided into two phases ; in the region below the bimodal curve, the system is of a homogeneous phase. 0.3 ml of [c4mim]br and 1.0 ml of the mixed standard solution (100 g / ml sy + 100 g / ml ta) or 1.03.0 ml of the sample solution were placed in a 10.0 ml centrifugal tube. the mixture was diluted to 4.0 ml with distilled water and then 3.0 g k2hpo4 was added. the tube was centrifuged for 2 min at 3500 rpm to ensure a complete phase separation. 20.0 l of [c4mim]br phase was withdrawn using a microsyringe and injected into hplc for quantification. chromatographic separation was achieved on a zorbax ods column (4.6 mm 150 mm 5m) associated with a guard column packed with the same bonded phase. the composition of the mobile phase at time zero (the time of injection) was 85% ammonium acetate (20 mm, ph 4.5) and 15% methanol. over the next 5 min, thereafter, the mobile phase was changed to ammonium acetate - methanol (2 : 98 ; v : v) within 5 min. finally, the chromatographic system was equilibrated during 5 min before the next injection. a flow rate of 0.8 ml / min was used throughout the 15 min run. dual uv wavelength mode was used, with ta monitored at 420 nm and sy at 480 nm. the mobile phase was filtered through 0.45 m micropore filter membrane prior to use. the distribution behaviors of ta and sy between il phase and salt phase were characterized by the extraction efficiency (e), partition coefficient (k), and phase ratio (r). the parameters e, k, and r were defined as follows : (1)e = cilvilcaqvaq+cilvil100%,k = cilcaq, r = vilvaq, where cil and caq are the concentration of ta or sy in il phase and in salt phase, respectively, and vil and vaq are the volume of il phase and k2hpo4 phase, respectively. the spectra and absorbance of ta or sy in [c4mim]br / k2hpo4 system were determined as an example to study the distribution behavior and extraction efficiency. during each experiment, the il phase containing the analyte was collected to measure the uv - visible spectra on the uv-2501 uv - vis spectrophotometer. the absorbance of ta and sy was measured at 420 nm and 480 nm, respectively. the blank containing the same phase composition but without analyte was used as reference solution. all samples, including soft drink, candy, and instant powdered drink, were obtained from a local market. appropriate amounts (0.15 g) of the samples were dissolved in 15 ml of water. the carbonated drinks were degassed by ultrasonication for 5 minutes to remove the carbon dioxide. a warming process (50c, 30 min) was used for the complete dissolution of the sugar - based candy. these solutions were centrifuged and the upper solutions were filtered through 0.45 m micropore filter membrane. the filtrate was transferred to volumetric flask of 25.0 ml, volume adjusted to 25.0 ml using distilled water, and ready for il - atps extraction. the chinese national standard method (gb / t 5009.35 - 2003) briefly, the sample solution was adjusted to ph 6.0 with 200 g / l citric acid solution and heated up to 60c. then this solution was stirred with polyamide powder for 5 min and filtered through buchner filter using double - decked filter papers. after filtering, the polyamide powder was washed with deionized water for 35 times, followed with the mixture of methanol - formic acid for 35 times. the colorants absorbed by polyamide powder were eluted with 15 ml of eluting solution (30% ammonia solution mixed with ethanol in the volume atio of 3 : 7), adjusted to ph 7.0 by acetic acid, and evaporated to near dryness, following which distilled water was added to the volume of 5.0 ml for hplc analysis. in this paper the bimodal curve for the aqueous two phase systems of [c4mim]br with a series of salts at 25c was investigated. results showed that il - salt atps could be formed by adding appropriate amount of different salts, such as (nh4)2so4, na2so4, and k2hpo4. other salts, such as k3po4, kh2po4, nacl, and nah2po4, can not separate [c4mim]br solution into two phases. as shown in figure 1(a), the phase separation capability of salts is k2hpo4 > (nh4)2so4 > na2so4, consistent with their solubility in water at 25c, suggesting a correlation between the phase separation capability of salts and their solubility in water. methylimidazolium bromides with four different carbon - chain length, namely, [c4mim]br, [c6mim]br, [c8mim]br, and [c10mim]br, were selected to investigate the effect of carbon - chain length on phase diagrams of il - salt atps. the bimodal curves determined at 25c for the il / k2hpo4 system were shown in figure 1(b). when the weight percentage of k2hpo4 was more than 0.15%, the phase separation capability of il followed the order of [c4mim]br [c6mim]br [c8mim]br 0.05). a simple and rapid il - based atps consisting of [c4mim]br and k2hpo4 coupled with hplc - uv was developed for the sensitive and simultaneous determination of sunset yellow and tartrazine in soft drink samples and candy samples. in this research, direct injection of the [c4mim]br phase into hplc system for the quantification of ta and this method proved to be efficient, simple and fast for separation / analysis of ta and sy in soft drink samples, candy samples and instant powdered drink. | we proposed a simple and effective method, by coupling ionic liquid - based aqueous two - phase systems (il - atpss) with high performance liquid chromatography (hplc), for the analysis of determining tartrazine and sunset yellow in food samples. under the optimized conditions, il - atpss generated an extraction efficiency of 99% for both analytes, which could then be directly analyzed by hplc without further treatment. calibration plots were linear in the range of 0.0150.0 g / ml for both ta and sy. the limits of detection were 5.2 ng / ml for ta and 6.9 ng / ml for sy. this method proves successful for the separation / analysis of tartrazine and sunset yellow in soft drink sample, candy sample, and instant powder drink and leads to consistent results as obtained from the chinese national standard method. |
methicillin resistant staphylococcus aureus (mrsa) was initially reported as a nosocomial pathogen responsible for adult infections. ca - mrsa has been recognized as a pathogen in adults and children without traditional risk factors for mrsa acquisition. children colonized with mrsa are potential reservoirs for the spread of mrsa in the community [2, 3 ]. furthermore, the infants and newborns with immunological immaturity, especially those born prematurely and those requiring specialized care, remained the major group susceptible to ca - mrsa infections. most ca - mrsa strains were associated with skin and soft tissue infections (ssti) and necrotizing pneumonia. the incidence of pediatric ssti has increased rapidly in the previous decade [57 ]. notably, community isolates differ significantly from nosocomial strains by the antimicrobial pattern and virulence profile. it is known that resistance to beta - lactams is mediated by the meca gene carried by a mobile genetic element called staphylococcal cassette chromosome mec (sccmec). ca - mrsa have been described as strains harboring the sccmec type iv, type v, or type vii [8, 9 ] and remained susceptible to the majority of antimicrobial agents other than beta - lactams. furthermore, these strains have been found to carry virulence genes encoding a leukocyte - killing toxin called the panton - valentine leukocidin (pvl) determinant. in this report, we characterize clinical mrsa strains isolated from children hospitalized in the pediatric department at the university hospital of monastir, tunisia. we are interested to investigate the phenotypic and genotypic markers of these isolates including antimicrobial resistance, sccmec type, pvl genes, pulsed - field gel electrophoresis (pfge) patterns, and multilocus sequence typing (mlst) of seven unlinked housekeeping genes (arcc, aroe, glpf, gmk, pta, tpi, and yqil). eight mrsa strains were collected from clinical specimens of hospitalized children in the pediatric department at the university hospital of monastir, tunisia, during a three - month period (from june to august 2013). the subjects were 6 boys and 2 girls, aged from 12 days to 18 months. the isolates were associated with skin infections : cutaneous abscesses (7 cases) and facial cellulites (1 case). s. aureus were identified according to standard bacteriological procedures : gram strain reactions, colony morphology, catalase, the ability to coagulate the rabbit plasma, and latex agglutination test (bio - rad). susceptibility to the following antibiotics penicillin g, cefoxitin, moxalactam, kanamycin, amikacin, tobramycin, gentamicin, erythromycin, lincomycin, tetracycline, pristinamycin, furans, ofloxacin, trimethoprim - sulfamethoxazole, rifampicin, fusidic acid, fosfomycin, mupirocin, high mupirocin, vancomycin, teicoplanin, and linezolid was determined according to the recommendations of the committee for antimicrobial testing of the french society of microbiology (casfm) (http://www.sfm-microbiologie.org/). methicillin resistance was determined by the disk diffusion method testing oxacillin disk (30 g) on mueller - hinton agar supplemented with 2% sodium chloride. multiplex polymerase chain reaction (pcr) was applied to determine the sccmec types according to a previous method described by oliveira and de lencastre. pvl genes (luks - pv, lukf - pv) were detected by pcr as previously described. the isolates were genotyped by pulsed - field gel electrophoresis (pfge) using the restriction enzyme smai according to the method previously described. a chromosomal dna digest of s. aureus strain nctc 8325 was used as the reference strain. allelic profiles and sequence type (st) were designated using the mlst database (http://www.mlst.net). the genbank accession numbers of staphylococcal gene sequences, arcc, aroe, glpf, gmk, pta, tpi, and yqil, determined in this study were, respectively, jf495119, jf495120, jf495121, jf495122, jf495123, jf495124, and jf495125. in this study we investigate 8 mrsa strains isolated from patients hospitalized in the pediatric department. all isolates were identified as mrsa strains by the determination of methicillin resistance using oxacillin disk diffusion method. antimicrobial susceptibility showed that all isolates were susceptible to the majority of 22 antibiotics tested (see section 2) with the exception of the beta - lactams (oxacillin, penicillin g, and cefoxitin). all strains were resistant to kanamycin and only two of them were resistant to erythromycin. for all clinical isolates the detection of meca gene and the identification of sccmec type were performed by amplification from genomic dna, using multiplex pcr method according to oliveira and de lencastre method. for each isolate, 2 amplified fragments were obtained : a 162 bp fragment and a 342 bp fragment. these two pcr products correspond to the amplification of meca gene and specific sccmec type iv locus (dcs), respectively. amplification of pvl genes (luks - pv and lukf - pv) was performed also on the genomic dna extracted from all strains. for each strain, the amplicon obtained has 433 bp ; thus all mrsa strains harbor pvl genes. these results revealed that our clinical isolates have the peculiarities of ca - mrsa : susceptibility to the majority of antimicrobial agents and carrying sccmec iv and pvl genes. to investigate the clonality of these ca - mrsa isolates, pfge pattern analysis demonstrated that they are distributed on three pulsotypes arbitrary designated a, b, and c (figure 1). six isolates carried the pulsotype a and two isolates carried the pulsotypes b and c, respectively. ca - mrsa strains were also characterized by multilocus sequencing of internal fragments of seven housekeeping genes (arcc, aroe, glpf, gmk, pta, tpi, and yqil). nucleotide sequence analysis revealed that all isolates possess the same unique sequence type designated st80. mrsa strain is known as a main cause of infections for children and young adults. mrsa strains investigated in this study are isolated from patients aged from 12 days to 18 months. six children have been admitted with mrsa skin infections ; hence, these data indicate that these infections were community - acquired but were not necessarily caused by community mrsa strains. however, the real site of mrsa acquisition is not readily determined because the community mrsa may designate mrsa colonization or a strain responsible for community infection detected in the community but not necessary acquired in the community. two other ones are an 18-month - old child admitted with immunodeficiency and a 12-day - old child admitted with fever. as referred to the definition of community mrsa infection, these isolates may be transmitted to these two patients from community. ca - mrsa strains have been reported as a cause of colonization and infection in neonatal intensive care units in many countries [16, 17 ]. furthermore, nasal carriage may be a possible explanation of the transmission of mrsa among these patients. the same observation was reported by frazee. who considered that ca - mrsa is a common pathogen in cutaneous abscesses due to nasal carriage preceding infections. it is interesting to note that newborns and young children, due to their immature immune systems, are easily infected by mrsa. several similar studies reported that the majority of patients with mrsa infections were young children [6, 18 ]. for all strains antimicrobial resistance showed that they were resistant to oxacillin and susceptible to all non - beta - lactams. however the resistance to kanamycin and erythromycin has been also observed. molecular characterization of mrsa isolates by the identification of sccmec type and the detection of luks - pv and lukf - pv genes revealed that all strains harbored the sccmec type iv and pvl genes. according to these results, our strains have been classified as community - acquired strains. described sccmec iv and pvl genes as markers for ca - mrsa [8, 19 ]. it has been reported that the cassette type iv and pvl genes have been found in some nosocomial mrsa strains [2022 ]. pfge analysis showed that ca - mrsa strains belonged to the same clone according to criteria of tenover.. full analyses of molecular typing results suggest that isolates belong to the ca - mrsa st80 clone. in fact, this clone is being increasingly reported in the community worldwide and mainly detected in europe. this antibiotic resistance pattern seems to be different from european strains st80, which were resistant to tetracycline and fusidic acid [23, 24 ]. however, ca - mrsa has emerged within the hospital setting, posing a significant public health threat. so, what is most worrying is that these strains affect frequently newborns and young children and eventually cause potentially serious infections. in fact some mrsa epidemic clones have been reported to cause skins and soft tissue infections as well as severe diseases. clone is recognized as a predominant clone in europe, the united states, and tunisia. this clone could become a health problem worldwide particularly that ca - mrsa strains were associated mainly with the presence of pvl genes which have an important impact on virulence. these observations urge emphasizing infection control measures to monitor the transmission of highly virulent ca - mrsa in our hospital. | community associated methicillin resistant staphylococcus aureus (ca - mrsa) is an emerging pathogen increasingly reported to cause skin and soft tissue infections for children. the emergence of highly virulencet ca - mrsa strains in the immunodeficiency of young children seemed to be the basic explanation of the increased incidence of ca - mrsa infections among this population. the subjects of this study were 8 patients hospitalized in the pediatric department at the university hospital of monastir. the patients were young children (aged from 12 days to 18 months) who were suffering from mrsa skin infections ; two of them had the infections within 72 h of their admission. the isolates were classified as community isolates as they all carried the staphylococcal cassette chromosome mec (sccmec) iv and pvl genes. epidemiological techniques, pulsed - field gel electrophoresis (pfge) and multilocus sequence typing (mlst), were applied to investigate ca - mrsa strains. analysis of molecular data revealed that mrsa strains were related according to pfge patterns and they belonged to a single clone st80. antimicrobial susceptibility tests showed that all strains were resistant to kanamycin and 2 strains were resistant to erythromycin. |
the world health organisation (who) recommends opioids for the relief of moderate to severe cancer pain. oxycodone is metabolised in the liver mainly by cyp3a4 to noroxycodone, but also by cyp2d6 to oxymorphone, and via 6-keto reduction to - and -oxycodol. cyp3a4 and cyp2d6 belong to the cytochrome p450 system, the principal enzyme system for phase i metabolism. this system is present in virtually all tissues, but is most abundant in the liver and in the small intestine. the cyp3a4 gene has many known polymorphisms, but no clinically important differences between genotypes have been observed [7, 8 ]. cyp2d6 has several known polymorphisms that influence drug metabolism. inactivating polymorphisms cause gene mutations and deletion(s) that result in a non - functional enzyme, whereas gene duplication(s) cause over - expression of active enzyme. individuals with two non - functional alleles of cyp2d6 are genotyped poor metaboliser (pm, 510% of caucasians), whilst individuals with one decreased functional allele and one non - functional allele or two decreased functional alleles are intermediate metaboliser persons with two wild - type alleles (cyp2d6 1), or one functional and one non - functional allele, are referred to as extensive metaboliser (em, 7284% of caucasians). individuals with more than duplicates of the cyp2d6 gene are ultra - rapid metaboliser because poor metabolisers are unable to metabolise cyp2d6 substrates, a drug administered at normal dose may lead to high or toxic levels of the drug [11, 12 ]. on the other hand, an ultra - rapid metaboliser may experience reduced or no effect when given a drug that is a cyp2d6 substrate, or they may experience adverse drug reactions [13, 14 ]. the cyp2d6 genotype may therefore be of clinical importance for drugs that are metabolised by cyp2d6 enzymes. the effect of the cyp2d6 genotype on the pharmacodynamics of oxycodone in a clinical setting of patients with cancer pain receiving chronic opioid administration has not previously been studied. this led us to the following research questions : do the cyp2d6 genotypes predict oxycodone and metabolite serum concentrations in patients treated for cancer pain?is the cyp2d6 genotype associated with pain intensity, or the intensity of nausea, tiredness or cognitive function in cancer patients receiving oxycodone ? do the cyp2d6 genotypes predict oxycodone and metabolite serum concentrations in patients treated for cancer pain ? is the cyp2d6 genotype associated with pain intensity, or the intensity of nausea, tiredness or cognitive function in cancer patients receiving oxycodone ? this multicentre study was performed according to the guidelines of the helsinki declaration and was approved by the relevant research ethics committee of each study centre. before entering the study, all participating patients gave their informed written consent. the patients were included from 2004 to 2008 in a multicentre cross - sectional study, the european pharmacogenetic opioid study (epos), designed to explore hypotheses related to the pharmacogenetics of opioid analgesics. a convenience sample of 2,294 patients from 17 centres in 11 european countries were included in epos, with 461 patients (98% caucasians) treated with oxycodone. eleven patients were excluded ; 8 because of a lack of dna samples, and 3 because of incomplete cyp2d6 genotype analyses. patients included in the present analysis were aged 18 years or more, had a verified malignant disease, and received scheduled oral, subcutaneous, or intravenous oxycodone treatment with a duration of treatment no less than 3 days. patients who were not capable of speaking the language used at the study centre were excluded. at the time of inclusion the following information was collected from each patient : age, gender, weight, height, ethnicity, medications and dosages, the time interval between last opioid administration and blood sampling, time since opioid treatment started, breakthrough pain, cancer diagnosis and time since diagnosis. pain on the average from the brief pain inventory (bpi), which has a numeric rating scale (nrs) from 0 (no pain) to 10 (pain as bad as you can imagine). cognitive failure was defined as having a total mms of 23 or less [18, 19 ]. the karnofsky performance status has a linear scoring from 0 to 100%, with higher scores meaning better function. the european organisation for research and treatment of cancer s health - related quality - of - life (qol) questionnaire (eortc qlq - c30) version 3.0 was used to assess the patient s self - reported qol for the symptoms tiredness, nausea, constipation and depression. depression was assessed using the item did you feel depressed ? with alternatives not at all, a little, quite a bit and very much for both items. nausea and constipation were assessed using the symptom scale for nausea and vomiting, and constipation respectively. scoring of the symptom scales were done by a linear transformation to a 0 to 100 scale., 2549 corresponds to a little, 5074 to quite a bit and 75100 to very much [21, 22 ]. standard analytical methods applied at each centre were used for haemoglobin, creatinine and albumin measurements. body mass index (bmi) was calculated using the international system of units, bmi = weight (kg)/height (m). renal function was expressed as calculated glomerular filtration rate (gfr)/ 1.73 m body surface [23, 24 ]. blood samples were obtained shortly prior to drug administration of the patients scheduled oral opioid medication (trough value). for practical reasons blood samples from out - patients (blood samples for opioid analyses in serum were collected in tubes with no additives and left at ambient temperature for 3060 min before centrifugation at 2,500g (approximately 3,000 rpm) for 10 min. details on handling of blood samples, analytical technique and instrumentation for serum concentration analyses of oxycodone, and the metabolites oxymorphone, noroxycodone and noroxymorphone have been described previously. coefficients of variation (intra- and inter - day) for each analyte were 16.5 and 8.3% for oxycodone, 10.8 and 6.7% for noroxycodone, 10.0 and 7.5% for oxymorphone and 14.8 and 7.7% for noroxymorphone. the limits of quantification were oxycodone 0.32 nm (0.1 ng / ml), oxymorphone 0.07 nm (0.02 ng / ml), noroxycodone and noroxymorphone 0.17 nm (0.05 ng / ml). blood samples for genetic analysis were collected at the time of inclusion in vacutainers containing edta (k2-edta, 5.4 mg/3 ml blood). the blood was aliquoted into cryotubes and frozen (80c) until isolation of dna. dna was isolated by a modified salting - out precipitation method for purification (gentra puregene blood kit, gentra systems, mineapolis, mn, usa). 2x2 (duplication) was detected according to the method of lovlie. pcr was performed using the gene amp xl pcr kit (roche / applied biosystems, foster city, nj, usa) in 50 l reaction volumes with a hot start. the lower reaction mix layer contained 4.5 l dh2o, 6 l 3.3 xl buffer ii, 2.5 l mg(oac)2 (25 mm), 4 l dntp mix (10 mm), and 1.5 l of each primer (10 mm). to separate the lower and upper reaction mix layer, wax was melted on top of the lower reaction mix (80c, 34 min), and then cooled to room temperature. then the upper reaction mix containing 18.5 l dh2o, 9 l 3.3 xl buffer ii, 1 l rtth dna polymerase (2 u/l) and 2.5 l genomic dna (510 ng/l) was added. long pcr was carried out on a techne tc-512 (barloworld scientific, stone, staffordshire, uk) with the following conditions : an initial denaturing step of 95c for 1 min, followed by 35 cycles of 94c for 1 min, 65c for 30 s and 68c for 2 min (+ 18 s increase for every new cycle), and a final elongation step of 72c for 10 min. the resulting long pcr products were separated and detected by electrophoresis (30 ma, 40 min) with 1.2% agarose gels containing ethidium bromide and tris - acetate buffer (invitrogen, carlsbad, ca, usa). detection of cyp2d6 5 (deletion) was done in accordance with the method of steen. and hersberger. pcr was performed using the gene amp xl pcr kit (roche / applied biosystems, foster city, nj, usa) in 50 l reaction volumes with a hot start. to separate lower and upper reaction mix, the lower reaction mix contained 1.95 l dh2o, 6 l 3.3 xl buffer ii, 2.05 l mg(oac)2 (25 mm), 4 l dntp mix (10 mm) and 1.5 l of each primer (10 mm ; table 1). the pcr conditions, and identification of the amplification products, were done in the same way as described for cyp2d6 2x2. table 1distribution of the cyp2d6 alleles and the corresponding genotype for the genetic groups : extensive metabolisers (em), poor metabolisers (pm) and ultra - rapid metabolisers (urm) for the 450 patients with cancer paingenotypenpercentage of total populationem homozygote41391.7 1/1 (wild - type) heterozygote24354.0 1/5 (deletion)235.1 1/3122.7 1/412427.6 1/6112.4pm276.0 3/420.4 4/4224.9 4/630.7urm102.2 2/2 (duplication)102.2none of the patients had the 1/7 and 1/8 allele variants distribution of the cyp2d6 alleles and the corresponding genotype for the genetic groups : extensive metabolisers (em), poor metabolisers (pm) and ultra - rapid metabolisers (urm) for the 450 patients with cancer pain none of the patients had the 1/7 and 1/8 allele variants long distance and multiplex pcr techniques were combined for the simultaneous detection of the five allele groups, 3, 4, 6, 7 and 8 in genomic dna. patients who lacked these mutations were categorised as having the cyp2d6 1 (functional) allele. with some modifications, first cyp2d6 was specifically amplified as a 4.7-kb fragment by a pre - multiplex long pcr with a hot start. to separate lower and upper reaction mix, heated wax was used (as described for the detection of cyp2d6 2 2). pcr was performed using the gene amp xl pcr kit (roche / applied biosystems, foster city, nj, usa) in 50-l reaction volumes. the lower reaction mix contained 4.5 l dh2o, 6 l 3.3 xl buffer ii, 2.5 l mg(oac)2 (25 mm), 4 l dntp mix (10 mm) and 1.5 l of each primer (10 mm). the upper reaction mix was as described for the detection of cyp2d6 2 2. the pre - multiplex long pcr conditions, and identification of the 4.7-kb pcr product, were done in the same way as for cyp2d6 2x2. the cyp2d6-specific 4.7-kb pre - amplification product was then used as a template for two separate pcr reactions with primers complementary to either the specific inactivating variant or the corresponding normal (wild - type) allele at each potential mutation site. reactions (25 l) contained 0.8 l dh2o, 2.5 l 10x pcr gold buffer, 1.5 l mgcl2 (25 mm), 0.7 l dntp mix (10 mm), 0.5 l amplitaq gold polymerase (5 u/l ; all reagents from applied biosystems), 0.2 l of the cyp2d6-specific 4.7 kb pre - amplification product and 3.76 l of each of the following primers in the normal reaction ; m (1.06 m), a1 (0.10 m), b1 (0.11 m), e3 (0.12 m) and t1 (0.64 m), and for the mutation reaction 3.13 l of each primer m (1.06 m), a2 (0.10 m), b2 (1.06 m), e4 (0.10 m), g2 (0.50 m) and t2 (0.05 m) was used. polymer chain reaction was carried out on a techne tc-512 (barloworld scientific) with the following conditions : an initial denaturing step of 95c for 5 min, followed by 14 cycles of 94c for 1 min, 55c for 30 s and 72c for 2 min 20 s, and a final elongation step of 72c for 5 min. the resulting long pcr products were separated and detected by electrophoresis (25 ma, 45 min) with 4.0% agarose gels containing ethidium bromide and tris - acetate buffer (invitrogen, carlsbad, ca, usa). the patients were divided into three genotype groups : pm : patients with two non - functional alleles.em : those categorised as having two of the wild - type allele (cyp2d6 1 homozygote em), and in addition patients with one functional allele and one non - functional allele or an allele with decreased function (heterozygote em).urm : patients with more than duplicates of the cyp2d6 gene. em : those categorised as having two of the wild - type allele (cyp2d6 1 homozygote em), and in addition patients with one functional allele and one non - functional allele or an allele with decreased function (heterozygote em). comparisons between the genetic groups for the continuous descriptive data were explored with analyses of variance (one - way anova). median oxycodone and metabolite serum concentrations were calculated from all 450 patients independent of the time since the last dose to blood sample and opioid used as rescue medication. comparisons between the three genetic groups for the continuous variables (serum concentrations of oxycodone, noroxycodone, oxymorphone and noroxymorphone, and the oxymorphone / oxycodone ratio, pain intensity and cognitive function) were explored with analysis of variance (one - way anova) and tested for homogeneity. for the variables where the overall f - test showed to be significant (p 0.05), the games howell procedure was chosen for the post - hoc tests. the analyses were then repeated with non - genetic covariates previously found to influence the outcomes. for serum concentrations of oxycodone and the metabolites and the ratio oxymorphone / oxycodone these were : oxycodone total daily dose, use of cyp3a4 inhibitors or inducers, sex, time since last oxycodone dose, the number of medications other than opioids used in the last 24 h, albumin serum concentrations, use of steroids, bmi and glomerular filtration rate. covariates in the analyses of pain intensity were oxymorphone serum concentrations, mixed pain, breakthrough pain, paracetamol medication, depression status, constipation status, female reproductive organ cancer and use of fluconazole. covariates in the analyses of cognitive function were : age, karnofsky and depression status, use of cyp2d6 inhibitors, steroid medication and breast cancer. post - hoc ancova comparisons between genetic groups were performed with sidak corrected p values. comparisons between the three genetic groups and categorical data (nausea and tiredness) were explored by ordinal logistic regression without covariates. the analyses were then repeated with inclusion of non - genetic covariates previously known to influence the outcomes. for nausea these covariates were sex, depression status, prostate cancer or diagnosis of unknown origin, constipation status, use of anti - emetics and steroids. in the analysis of tiredness depression status, breast cancer, karnofsky status and albumin status were included covariates. this multicentre study was performed according to the guidelines of the helsinki declaration and was approved by the relevant research ethics committee of each study centre. before entering the study, all participating patients gave their informed written consent. the patients were included from 2004 to 2008 in a multicentre cross - sectional study, the european pharmacogenetic opioid study (epos), designed to explore hypotheses related to the pharmacogenetics of opioid analgesics. a convenience sample of 2,294 patients from 17 centres in 11 european countries were included in epos, with 461 patients (98% caucasians) treated with oxycodone. eleven patients were excluded ; 8 because of a lack of dna samples, and 3 because of incomplete cyp2d6 genotype analyses. patients included in the present analysis were aged 18 years or more, had a verified malignant disease, and received scheduled oral, subcutaneous, or intravenous oxycodone treatment with a duration of treatment no less than 3 days. patients who were not capable of speaking the language used at the study centre were excluded. at the time of inclusion the following information was collected from each patient : age, gender, weight, height, ethnicity, medications and dosages, the time interval between last opioid administration and blood sampling, time since opioid treatment started, breakthrough pain, cancer diagnosis and time since diagnosis. pain on the average from the brief pain inventory (bpi), which has a numeric rating scale (nrs) from 0 (no pain) to 10 (pain as bad as you can imagine). the mini mental state (mms) examination was used to assess cognitive function. cognitive failure was defined as having a total mms of 23 or less [18, 19 ]. the karnofsky performance status has a linear scoring from 0 to 100%, with higher scores meaning better function. the european organisation for research and treatment of cancer s health - related quality - of - life (qol) questionnaire (eortc qlq - c30) version 3.0 was used to assess the patient s self - reported qol for the symptoms tiredness, nausea, constipation and depression. depression was assessed using the item did you feel depressed ? with alternatives not at all, a little, quite a bit and very much for both items. nausea and constipation scoring of the symptom scales were done by a linear transformation to a 0 to 100 scale., 5074 to quite a bit and 75100 to very much [21, 22 ]. standard analytical methods applied at each centre were used for haemoglobin, creatinine and albumin measurements. body mass index (bmi) was calculated using the international system of units, bmi = weight (kg)/height (m). renal function was expressed as calculated glomerular filtration rate (gfr)/ 1.73 m body surface [23, 24 ]. blood samples were obtained shortly prior to drug administration of the patients scheduled oral opioid medication (trough value). for practical reasons blood samples from out - patients (n = 68) were taken at the time of examination. blood samples for opioid analyses in serum were collected in tubes with no additives and left at ambient temperature for 3060 min before centrifugation at 2,500g (approximately 3,000 rpm) for 10 min. details on handling of blood samples, analytical technique and instrumentation for serum concentration analyses of oxycodone, and the metabolites oxymorphone, noroxycodone and noroxymorphone have been described previously. coefficients of variation (intra- and inter - day) for each analyte were 16.5 and 8.3% for oxycodone, 10.8 and 6.7% for noroxycodone, 10.0 and 7.5% for oxymorphone and 14.8 and 7.7% for noroxymorphone. the limits of quantification were oxycodone 0.32 nm (0.1 ng / ml), oxymorphone 0.07 nm (0.02 ng / ml), noroxycodone and noroxymorphone 0.17 nm (0.05 ng / ml). blood samples for genetic analysis were collected at the time of inclusion in vacutainers containing edta (k2-edta, 5.4 mg/3 ml blood). the blood was aliquoted into cryotubes and frozen (80c) until isolation of dna. dna was isolated by a modified salting - out precipitation method for purification (gentra puregene blood kit, gentra systems, mineapolis, mn, usa). cyp2d6 2x2 (duplication) was detected according to the method of lovlie. pcr was performed using the gene amp xl pcr kit (roche / applied biosystems, foster city, nj, usa) in 50 l reaction volumes with a hot start. the lower reaction mix layer contained 4.5 l dh2o, 6 l 3.3 xl buffer ii, 2.5 l mg(oac)2 (25 mm), 4 l dntp mix (10 mm), and 1.5 l of each primer (10 mm). to separate the lower and upper reaction mix layer, wax was melted on top of the lower reaction mix (80c, 34 min), and then cooled to room temperature. then the upper reaction mix containing 18.5 l dh2o, 9 l 3.3 xl buffer ii, 1 l rtth dna polymerase (2 u/l) and 2.5 l genomic dna (510 ng/l) was added. long pcr was carried out on a techne tc-512 (barloworld scientific, stone, staffordshire, uk) with the following conditions : an initial denaturing step of 95c for 1 min, followed by 35 cycles of 94c for 1 min, 65c for 30 s and 68c for 2 min (+ 18 s increase for every new cycle), and a final elongation step of 72c for 10 min. the resulting long pcr products were separated and detected by electrophoresis (30 ma, 40 min) with 1.2% agarose gels containing ethidium bromide and tris - acetate buffer (invitrogen, carlsbad, ca, usa). detection of cyp2d6 5 (deletion) was done in accordance with the method of steen. and hersberger., with some modifications. pcr was performed using the gene amp xl pcr kit (roche / applied biosystems, foster city, nj, usa) in 50 l reaction volumes with a hot start. to separate lower and upper reaction mix, the lower reaction mix contained 1.95 l dh2o, 6 l 3.3 xl buffer ii, 2.05 l mg(oac)2 (25 mm), 4 l dntp mix (10 mm) and 1.5 l of each primer (10 mm ; table 1). the pcr conditions, and identification of the amplification products, were done in the same way as described for cyp2d6 2x2. table 1distribution of the cyp2d6 alleles and the corresponding genotype for the genetic groups : extensive metabolisers (em), poor metabolisers (pm) and ultra - rapid metabolisers (urm) for the 450 patients with cancer paingenotypenpercentage of total populationem homozygote41391.7 1/1 (wild - type) heterozygote24354.0 1/5 (deletion)235.1 1/3122.7 1/412427.6 1/6112.4pm276.0 3/420.4 4/4224.9 4/630.7urm102.2 2/2 (duplication)102.2none of the patients had the 1/7 and 1/8 allele variants distribution of the cyp2d6 alleles and the corresponding genotype for the genetic groups : extensive metabolisers (em), poor metabolisers (pm) and ultra - rapid metabolisers (urm) for the 450 patients with cancer pain none of the patients had the 1/7 and 1/8 allele variants long distance and multiplex pcr techniques were combined for the simultaneous detection of the five allele groups, 3, 4, 6, 7 and 8 in genomic dna. patients who lacked these mutations were categorised as having the cyp2d6 1 (functional) allele. with some modifications, first cyp2d6 was specifically amplified as a 4.7-kb fragment by a pre - multiplex long pcr with a hot start. to separate lower and upper reaction mix, heated wax was used (as described for the detection of cyp2d6 2 2). pcr was performed using the gene amp xl pcr kit (roche / applied biosystems, foster city, nj, usa) in 50-l reaction volumes. the lower reaction mix contained 4.5 l dh2o, 6 l 3.3 xl buffer ii, 2.5 l mg(oac)2 (25 mm), 4 l dntp mix (10 mm) and 1.5 l of each primer (10 mm). the upper reaction mix was as described for the detection of cyp2d6 2 2. the pre - multiplex long pcr conditions, and identification of the 4.7-kb pcr product, were done in the same way as for cyp2d6 2x2. the cyp2d6-specific 4.7-kb pre - amplification product was then used as a template for two separate pcr reactions with primers complementary to either the specific inactivating variant or the corresponding normal (wild - type) allele at each potential mutation site. reactions (25 l) contained 0.8 l dh2o, 2.5 l 10x pcr gold buffer, 1.5 l mgcl2 (25 mm), 0.7 l dntp mix (10 mm), 0.5 l amplitaq gold polymerase (5 u/l ; all reagents from applied biosystems), 0.2 l of the cyp2d6-specific 4.7 kb pre - amplification product and 3.76 l of each of the following primers in the normal reaction ; m (1.06 m), a1 (0.10 m), b1 (0.11 m), e3 (0.12 m) and t1 (0.64 m), and for the mutation reaction 3.13 l of each primer m (1.06 m), a2 (0.10 m), b2 (1.06 m), e4 (0.10 m), g2 (0.50 m) and t2 (0.05 m) was used. polymer chain reaction was carried out on a techne tc-512 (barloworld scientific) with the following conditions : an initial denaturing step of 95c for 5 min, followed by 14 cycles of 94c for 1 min, 55c for 30 s and 72c for 2 min 20 s, and a final elongation step of 72c for 5 min. the resulting long pcr products were separated and detected by electrophoresis (25 ma, 45 min) with 4.0% agarose gels containing ethidium bromide and tris - acetate buffer (invitrogen, carlsbad, ca, usa). the patients were divided into three genotype groups : pm : patients with two non - functional alleles.em : those categorised as having two of the wild - type allele (cyp2d6 1 homozygote em), and in addition patients with one functional allele and one non - functional allele or an allele with decreased function (heterozygote em).urm : patients with more than duplicates of the cyp2d6 gene. em : those categorised as having two of the wild - type allele (cyp2d6 1 homozygote em), and in addition patients with one functional allele and one non - functional allele or an allele with decreased function (heterozygote em). comparisons between the genetic groups for the continuous descriptive data were explored with analyses of variance (one - way anova). for the descriptive categorical data the comparisons were explored with logistic regression analyses. median oxycodone and metabolite serum concentrations were calculated from all 450 patients independent of the time since the last dose to blood sample and opioid used as rescue medication. comparisons between the three genetic groups for the continuous variables (serum concentrations of oxycodone, noroxycodone, oxymorphone and noroxymorphone, and the oxymorphone / oxycodone ratio, pain intensity and cognitive function) were explored with analysis of variance (one - way anova) and tested for homogeneity. for the variables where the overall f - test showed to be significant (p 0.05), the games howell procedure was chosen for the post - hoc tests. the analyses were then repeated with non - genetic covariates previously found to influence the outcomes. for serum concentrations of oxycodone and the metabolites and the ratio oxymorphone / oxycodone these were : oxycodone total daily dose, use of cyp3a4 inhibitors or inducers, sex, time since last oxycodone dose, the number of medications other than opioids used in the last 24 h, albumin serum concentrations, use of steroids, bmi and glomerular filtration rate. covariates in the analyses of pain intensity were oxymorphone serum concentrations, mixed pain, breakthrough pain, paracetamol medication, depression status, constipation status, female reproductive organ cancer and use of fluconazole. covariates in the analyses of cognitive function were : age, karnofsky and depression status, use of cyp2d6 inhibitors, steroid medication and breast cancer. post - hoc ancova comparisons between genetic groups were performed with sidak corrected p values. comparisons between the three genetic groups and categorical data (nausea and tiredness) were explored by ordinal logistic regression without covariates. the analyses were then repeated with inclusion of non - genetic covariates previously known to influence the outcomes. for nausea these covariates were sex, depression status, prostate cancer or diagnosis of unknown origin, constipation status, use of anti - emetics and steroids. in the analysis of tiredness depression status, breast cancer, karnofsky status and albumin status six percent (n = 27) were genotyped as poor metabolisers (pm), about 92% (n = 413) were extensive metabolisers (em), while about 2% (n = 10) were genotyped as ultra - rapid metabolisers (urm). descriptive data are shown in table 2 and given as median (minimum to maximum) if not stated otherwise. however, the median karnofsky performance status was 70% for em and 50 and 55% for pm and urm respectively (p = 0.0004). also, use of cyp3a4 inducer medications was statistically significantly different in pm (n = 0) compared with the other to genetic groups (n = 2 for both groups ; p em > pm) and differences between urm and em in psychomotor tests (p < 0.05). however, an important shared limitation is that these two studies were single - dose oxycodone studies performed in healthy volunteers. our study suggests that oxymorphone and noroxymorphone do not contribute to the efficacy of oxycodone in a clinical setting with cancer patients. the reason for the lack of the pharmacodynamic effect of the potent compound oxymorphone could potentially be the very low level of this metabolite relative to oxycodone. the median oxymorphone serum concentrations in this study were 0.2, 1.5 and 3.1% of the median oxycodone serum concentrations in the pm, em and urm respectively. median noroxymorphone serum concentrations constitute 2.3, 16.8 and 46% of the median oxycodone serum concentrations in the pm, em and urm respectively. a difference in pain intensity or adverse events between pm and urm would be expected if noroxymorphone was an active metabolite, maybe also between pm and em, because of the relatively large difference between the genotypes of noroxymorphone concentrations relative to oxycodone. this was not the case ; there was no difference among pm, em and urm with regard to effect or adverse events ; thus, it seems unlikely that noroxymorphone is an important active metabolite of oxycodone. the usage of cyp2d6 inhibitor medication was included in the covariate analyses of the efficacy of oxycodone. no association was found, which suggests that cyp2d6 inhibition does not affect the efficacy of oxycodone. the prevalence of co - medication with a cyp2d6 inhibitor was only about 8% and, therefore, a relevant difference could be undisclosed. however, this lack of impact from the use of cyp2d6 inhibitors is in accordance with other studies where inhibition of the cyp2d6 metabolic pathway with paroxetine or quinidine did not influence the efficacy of oxycodone in healthy volunteers [4043 ], or patients with chronic pain. therefore, conclusions about causal relationships should be applied with caution owing to its cross - sectional design. second, with more than 80 known allelic variants of the cyp2d6 gene, it was necessary to make a selection of which to study. we chose to use a panel of variant used by the department of pathology and medical genetics, st. olav university hospital, to determine pm, em and urm. they have chosen variants that show clinically significant alteration of enzyme activity, omitting those that have no verified or insignificant effect on drug metabolism in vivo or those that are extremely rare. we chose to analyse for these routine allelic variants as the aim was to make judgements closely related to everyday clinical and laboratory practice. finally, as in all clinical cancer pain cohorts the patients included in this study are heterogeneic with regard to characteristics that may affect pain intensity and other symptoms. in studies in healthy volunteers pain mechanisms are equal for all participants, and the participants are more homogeneous. however, experimental pain has little relevance in clinical practice, while our results reflect the clinical setting. thus, in this cohort with chronic cancer pain, oxymorphone does not seem to contribute to the analgesic effect of oxycodone. patients categorised as pms of oxycodone have statistically significantly lower serum concentrations of oxymorphone and noroxymorphone and oxymorphone / oxycodone ratios than em and urm. however, no difference was found among pm, em and urm when comparisons of their pain intensities, nausea, tiredness and cognitive function were made. the cyp2d6 genotype does not reflect oxycodone requirements and it is not associated with common adverse effects in this study of patients with cancer pain. | objectiveopioids are recommended by the world health organization for moderate to severe cancer pain. oxycodone is one of the most commonly used opioids and is metabolized in the liver by cyp3a4 and cyp2d6 enzymes. the aim of this cross - sectional study was to assess the relationship between oxycodone pharmacokinetics, pharmacodynamics and the cyp2d6 genotypes poor metaboliser (pm), extensive metaboliser (em) and ultra - rapid metaboliser (urm) in a cohort of patients with cancer pain.methodsthe patients were genotyped for the most common cyp2d6 variants and serum concentrations of oxycodone and metabolites were determined. pain was assessed using the brief pain inventory (bpi). the eortc qlq - c30 was used to assess the symptoms of tiredness and nausea. cognitive function was assessed by the mini mental state (mms) examination. associations were examined by analyses of variance (anova) and covariance (ancova), or ordinal logistic regressions with and without covariates.resultsthe sample consisted of 27 pm, 413 em (including heterozygotes) and 10 urm. pm had lower oxymorphone and noroxymorphone serum concentrations and oxymorphone to oxycodone ratios than em and urm. no differences between pm, em and urm in pain intensity, nausea, tiredness or cognitive function was found.conclusioncyp2d6 genotypes caused expected differences in pharmacokinetics, but they had no pharmacodynamic consequence. cyp2d6 genotypes did not influence pain control, the adverse symptoms nausea and sedation or the risk for cognitive failure in this study of patients treated with oxycodone for cancer pain. |
helicobacter pylori is a gram - negative, spiral, catalase - positive, and urease - positive bacillus which contributes to a wide range of gastrointestinal (gi) and extra - gi diseases (1, 2). h. pylori has gained particular importance nowadays since it has infected about 50% of the world s population. however, its prevalence is high in developing countries (1, 3 - 5). the most common routes of transmission of the infection are oral - oral, oral - digestive, and fecal - oral contacts (6, 7). the infection has no affinity toward a particular gender (8). this common pathogen can develop chronic gastroenteritis and increase the risk for peptic ulcer and gastric cancer. therefore, treatment and eradication of the infection is important. according to the conference of maastricht iii, the first line of treatment is amoxicillin, omeprazole, and clarithromycin for 7 days which results in an eradication rate of about 80% (75% - 98%) (9 - 11). however, in addition to the 20% resistance of the bacteria to this regimen, cases of drug intolerance and the incidence of adverse events such as diarrhea, abdominal pain, nausea and vomiting, and taste intolerance have been reported. the second - line treatment is a quadruple regimen including metronidazole and bismuth, which is associated with a high incidence of side effects resulting in drug intolerance (12, 13). since azithromycin is a macrolide, it reaches a high concentration in the tissue and remains there for a few days after oral administration ; therefore, it can be used in the eradication of h. pylori (14 - 18). the eradication rate of azithromycin used in different regimens has been reported 60% to 80% (19). according to a meta - analysis, its effect is similar to classical regimen and it is better tolerated by patients (19). the present study aimed to evaluate the effect of classical and azithromycin - containing triple therapy eradication regimen against h. pylori in children, and to determine the level of patients tolerance and drug s side effects. this single clinical trial was performed in 2014 on 2 to 15 years old children. volume of the sample was estimated based on past studies (20, 21) with 95% confidence and 90% statistical power. patients were randomly allocated into two age - matched groups by table of random numbers. h. pylori infection was confirmed through multiple biopsies of the stomach in all children with digestive problems (including dyspepsia, gastrointestinal bleeding, and chronic abdominal pain) that needed upper gi endoscopy. biopsy samples were sent in 10% formalin solution to the laboratory for histological examination. children with consumption of antibiotics in the last two months, allergy to the studied medicines, prior treatment for h. pylori, chronic liver and kidney diseases, and simultaneous use of nsaids and other drugs were excluded from the study. pylori - positive patients were treated alternately with two different drug regimens : group 1 received clarithromycin 7.5 mg / kg / day every 12 hours for 10 days, amoxicillin 50 mg / kg / day every 12 hours for 10 days, and omeprazole 1 mg / kg / day every 12 hours for two weeks. group 2 received azithromycin 10 mg / kg / day once a day (before meal) for 6 days along with amoxicillin and omeprazole. azithromycin syrup was provided from tehran shimi co. and tablets from kharazmi company, clarithromycin syrup from chemidarou and tablets from rouz darou companies, amoxicillin syrup from farabi company, and omeprazole capsules from abidi company, all in tehran, iran. a questionnaire has been prepared on the basis of previous studies (19) that evaluated the drug 's side effects and intolerance and was completed by the patients or their parents. four to six weeks after completion of treatment, patients stool was tested for h. pylori with monoclonal method using the helicobacter antigen quick kit (generic assays gmbh, germany) which has a sensitivity of 85% - 96% and specificity of 83% - 93% (22 - 24). the study was approved by the ethics committee of the babol university of medical sciences (clinical trial registration number irct2013112115475n1), and informed consent was obtained from the parents. the collected data were analyzed using spss-20 through comparison of recovery level and side effects between the two treatment methods with chi - square test, fisher s exact test, and t - test. the regimens were analyzed with the methods itt (intention to treat) and pp (per protocol). the study was performed on two groups consisting of 32 members receiving either omeprazole - clarithromycin - amoxicillin (oca) or omeprazole - azithromycin - amoxicillin (oaa) regimens. the baseline characteristics of patients are depicted in table 1. as shown in the table, there were no significant differences between the two groups regarding gender distribution and mean age of the patients. abdominal pain with and without nausea and vomiting was the most common cause of endoscopy in the two study groups. endoscopic findings of the patients are shown in table 1. as can be seen, antral nodularity was the most common endoscopic finding in the patients. the therapeutic response to the oca and oaa regimens are depicted in table 2. based on itt analysis, the therapeutic response in the oaa and oca as shown in the table, there was no significant difference between the two groups regarding the rate of side effects. the therapeutic response in the two treatment groups in terms of gender is presented in table 3. as can be seen, no significant difference was found between the two treatment groups in therapeutic response regarding gender. eradication of h. pylori with classic triple therapy in children may be associated with intolerance and complications from clarithromycin. its replacement with other macrolides (azithromycin) with shorter treatment time and lower dose can reduce these side effects with the same eradication effect. according to the results of itt analysis, the therapeutic response was seen in 56.2% of the oaa group and 62.5% of the oca group with no statistically significant difference between them. in other words, the therapeutic response was observed in more than half of the patients in both treatment groups. in a study conducted by sarkeshikian. (25), 165 adult patients with symptoms of dyspepsia were divided into two groups ; the first group (89 patients) was treated with omeprazole, amoxicillin, and azithromycin and the second group (76 patients) with amoxicillin, omeprazole, and clarithromycin. according to the breath test performed 6 weeks later ; the eradication rate was 75% in the first group and 82% in the second group, and there was no statistically significant difference between the two groups (25). this study was consistent with our study regarding the lack of significant difference in the therapeutic response between the two groups. although this study was conducted in adults, the therapeutic response in each group was individually higher than in the present study. in a study conducted in virginia, usa, by sullivan. (26), 56 adult patients with gi symptoms and with h. pylori confirmed by endoscopy were enrolled in the study and divided into two groups of 27 patients (treated with bismuth, lansoprazole, amoxicillin, and clarithromycin), and 29 patients (treated with bismuth, lansoprazole, amoxicillin, and azithromycin). the pp analysis results showed an eradication rate of 84.6% in the first group and 55.5% in the second group, with a statistically significant difference between them (26). although this study was performed in adults, it had two other differences with the present study ; first, the therapeutic response was higher ; second, the therapeutic response observed in clarithromycin group was higher than in azithromycin group. in a study by bahremand. (27) entitled evaluation of the effectiveness of triple and quadruple therapy regimens for eradication of helicobacter pylori in children referred to imam khomeini hospital, tehran, patients with h. pylori infection determined by histological examination were divided into two groups. the triple - drug regimen included amoxicillin (50 mg / kg / day), omeprazole (1 mg / kg / day), clarithromycin (15 mg / kg / day), and the quadruple regimen included omeprazole (1 mg / kg / day), amoxicillin (50 mg / kg / day), metronidazole (20 mg / kg / day), and bismuth citrate (8 mg / kg / day) for 10 days. patients were assessed by urea breath test 4 weeks after treatment, which showed eradication of h. pylori in 92% of the triple therapy group and 84% of the quadruple therapy group (27). the reason for the difference in results between the two studies may be related to the fact that previous study was done over a decade ago, so an increase in antimicrobial resistance over time may have decreased treatment success rate in our study. during 1995 - 1996 in japan, kato. (28) studied 22 patients of 8 to 16 years of age who had active lesions and confirmed h. pylori infection. they had undergone eradication therapy in which 10 patients received double - drug regimen of omeprazole (1 mg / kg bid) and amoxicillin (30 mg / kg bid), and 12 patients received triple - drug regimen of clarithromycin (15 mg / kg bid) along with omeprazole and amoxicillin for 14 days. differences between results of the present study and other studies can be attributed to various factors, for example, this study was conducted in children, whereas most studies were performed in adults. antimicrobial resistance and diversity of h. pylori in children (29 - 34) are the key factors in the failure of anti - h. pylori regimens (35, 36), which may be caused by indiscriminate and arbitrary use of antibiotics in iran, especially azithromycin, which is highly used for different infections including respiratory infections. according to a meta - analysis, there is no ideal first or second - line treatment for achieving 100% eradication. the therapeutic order should be carried out according to the initial treatment and local antimicrobial resistance studies. the common endoscopic finding was nodularity in antrum that had no effect on treatment response ; the two groups did not differ in this respect. in agreement with ours, study of rafeey. showed the most common finding was nodularity in antrum and there was no relationship between the genotypes of h. pylori that is effective in the response to treatment, with endoscopic findings (37). the results of this study showed that the rate of drug intolerance in the oca and oaa groups was 9.4% and 3.1%, respectively, with no significant difference between them and no major adverse effects in either treatment groups. minakari. in 2010 evaluated a quadruple therapy including azithromycin or clarithromycin as the second - line therapy. the rate of intolerance to the regimen was 3.5% in the azithromycin - receiving group and 4.3% in the clarithromycin - receiving group, and there was no significant difference between them (38). this is similar to the present study ; however, compared to the present study, the rates of intolerance in both groups were lower in patients who received the second - line treatment. this study showed that eradication of h. pylori with classic triple therapy in children with complications of clarithromycin, can be used azithromycin as other macrolide with a shorter time. since the response rate was lower than ideal in both regimens, it is suggested to carry out studies with more patients and newer regimens, and to determine the rate of antimicrobial resistance in comparison with clarithromycin. | background and objectives : the present study aimed to evaluate the effect of classical and azithromycin - containing triple therapy eradication regimen against h. pylori in children, and to determine the level of patients tolerance.patients and methods : this single clinical trial was performed in 2014 on 2 to 15 years old children. all children, in whom h. pylori infection was confirmed through multiple biopsies of the stomach and required treatment, were enrolled in the study. h. pylori - positive patients were treated alternately with two different drug regimens ; group oca received clarithromycin 7.5 mg / kg / day every 12 hours for 10 days, amoxicillin 50 mg / kg / day every 12 hours for 10 days, and omeprazole 1 mg / kg / day every 12 hours for two weeks, and group oaa received azithromycin 10 mg / kg / day once a day (before meal) for 6 days along with amoxicillin and omeprazole. four to six weeks after completion of treatment, patients stool was tested for h. pylori through the monoclonal method using the helicobacter antigen quick kit.results:there were no significant differences between the two groups regarding gender and age of patients. based on itt analysis, the therapeutic response in the oaa and oca groups were 56.2% and 62.5%, respectively (p = 0.40). drug adverse effects were 15.6% in the oca and 3.1% in the oaa group (p = 0.19).conclusions : the therapeutic response was seen in more than half of the patients treated with triple therapy of h. pylori eradication regimen including azithromycin or clarithromycin, and there was no significant difference between the two treatment groups. |
metabolic syndrome (ms) is characterized by the presence of insulin resistance, low - degree inflammation, dysglycemia, low plasma high - density lipoprotein cholesterol (hdl - c), increased triglycerides (tg), elevated blood pressure, and abdominal obesity. ms has been associated with an increased risk of type 2 diabetes mellitus (dm2) and cardiovascular diseases (cvds) [1, 2 ]. the prevalence of ms varies between 15% and 40%, being greater in the population of hispanic origin. abdominal obesity is considered a key characteristic of ms, which is related to decreased insulin - mediated glucose uptake. adipose tissue is known to express and secrete a variety of adipokines, including leptin, adiponectin, resistin, and visfatin, as well as cytokines and chemokines such as tumor necrosis factor - alpha (tnf-), interleukin-6 (il-6), and monocyte chemoattractant protein-1 (mcp-1) [58 ]. the release of adipokines by either adipocytes or adipose tissue - infiltrated macrophages plays a key role in the development of insulin resistance and dm2, as well as the increased risk of cardiovascular disease associated with obesity. renin - angiotensin system components are also activated in adipose tissue, leading to hypertension and insulin resistance. adiponectin is considered to be a protective protein with antidiabetic, anti - inflammatory, and antiatherogenic effects. reduced plasma adiponectin levels have been reported in obese individuals, particularly in those with visceral obesity, and have been negatively correlated with insulin resistance. furthermore, decreased adiponectin levels were found to be associated with a higher incidence of dm2. leptin was shown to promote the development of atherosclerosis by inducing oxidative stress in endothelial cells, increasing platelet aggregation, and hypertrophy and proliferation of vascular smooth muscle cells. additionally, it was shown that a high leptin level predicts subsequent development of dm2. thus, leptin / adiponectin imbalance has a key role in the metabolic alterations associated with obesity [510 ]. multiple therapeutic approaches such as renin - angiotensin system blockers and inhibitors, statins as well as nutrient and dietary interventions [1114 ], have been proposed to reduce metabolic and cardiovascular risk in patients with ms. garlic (allium sativum l.) has been used as a nutrient with beneficial cardiovascular effects. however, the beneficial effects of garlic are offset by the fact that fresh garlic causes indigestion and that its pungent odor lingers on breath and skin. an alternative source of garlic that is odorless and rich in antioxidants is aged garlic extract (age). age has shown beneficial effects in several alterations related to the development of cardiovascular diseases, such as antioxidant and antithrombotic properties [1820 ]. thus, in the present study we aimed to investigate the effects of age on adipokines, inflammatory substances, endothelial function, and metabolic risk factors that constitute the cluster of metabolic syndrome in an urban colombian population. double - blind, crossover, randomized, placebo - controlled clinical trial to assess the effect of age (kyolic) on the cardiovascular risk factors of subjects with ms. men and women over 18 years old with diagnosis of ms, attending primary health care clinics from the metropolitan area of bucaramanga, colombia. the ms diagnosis was based on the presence of central obesity (waist circumference 90 cm (male), 80 cm (female)) and two of the following criteria : tg 150 mg / dl, hdl - c < 40 mg / dl (male), < 50 mg / dl (female), blood pressure 130/85 mmhg, and fasting plasma glucose 100 mg / dl. the exclusion criteria were (1) allergies to garlic ; (2) current treatment with lipid - lowering drugs, antihypertensive drugs, and/or hypoglycemic medications ; (3) psychiatric disorders that prevent proper decision making ; (4) patients with infections or inflammatory assets ; (5) presence of coronary artery disease, with a current or past ischemic event ; (6) presence of severe chronic or terminal illnesses ; and (7) presence of diseases that compromise the immune system. the study was approved by the ethical committee of the cardiovascular foundation in bucaramanga, colombia. patients were randomly assigned by blocks to receive either 1.2 g / day of age (kyolic) or placebo, and after 12 weeks of supplementation, the treatment was invested for another 12 weeks (figure 1). each treatment was provided in an identical capsule that was taken twice daily with breakfast and dinner (2 capsules of each). all subjects received routine recommendations of lifestyle changes (having a diet lower in fat and sugar and increasing physical activity with 30 minutes / day of moderate walking). participants were followed up every four weeks with clinical evaluations and registration of potential undesirable effects and use of any other medication. during the baseline and at the end of each phase of treatment (week 12 and week 24), the following were determined. weight, height, body mass index (bmi), waist (wc) and hip circumferences (hc), and blood pressure. routine clinical tests were processed in the clinical research laboratory from the ophthalmological foundation of santander - foscal, floridablanca, colombia. measurements of adipokines and inflammatory factors were performed at the department of physiology, faculty of medicine, complutense university of madrid, spain. glycemia and lipid profile were quantified by using a routine colorimetric method (biosystem bts-303 photometric, barcelona, spain). interleukin-6, adiponectin, and c - reactive protein were measured using an immunoassay (r&d systems, mn, usa). the fmv was performed using a high - resolution doppler ultrasound, measuring the changes in diameter of the brachial artery in response to increased blood flow (reactive hyperemia). the averages and proportions obtained in a descriptive analysis for all clinically relevant variables measured during the baseline evaluation were compared. then, the treatment effect of the crossover design was evaluated through the difference in change between baseline versus posttreatment according to the intervention phase. based on the frequencies distribution of the outcome variables, the student 's t - test or wilcoxon signed - ranks test was used. in outcome variables where significant differences were observed, further analysis of changes was performed using analysis of covariance (ancova), adjusting by phase, treatment, and their interaction (treatment phase) to determine if changes were due to a carryover effect. all analyses were conducted using stata statistical software, release 11.0 (stata corporation, college station, tx, usa). the 46 patients included in the study were distributed in two sequences of treatment : age - placebo and placebo - age. three subjects (all of them of the first group) voluntarily discontinued the treatment during the phase 1. demographic, anthropometric, and biochemical characteristics obtained in the 43 participants who completed the study are shown in table 1. a significant difference in age was found between the age - placebo and the placebo - age groups at the baseline. at the end of the study the crossover analysis was conducted, and a significant difference in the adiponectin delta was found comparing age versus placebo, : 313.79 (95%ic : 48.34~675.92) versus : 271.88 (95%ic : the ancova confirmed that the significant difference in adiponectin was due to the treatment, not the phase of the study (no carryover effect) as no significant changes were observed in the interaction treatment phase (table 3). no significant changes were observed in any of the other anthropometrical measurements, endothelial function, and biochemical variables (table 2). the present study demonstrates for the first time that the administration of age to subjects with ms for 12 weeks increased adiponectin plasma concentrations. our group previously reported that in dyslipidemic subjects, the presence of coronary artery disease is associated with an elevation of certain inflammatory markers but not with further endothelial dysfunction. in the present study, after the age intervention there were no significant changes either in endothelial function or in inflammation, which may relate both to the short period of intervention and the participation of subjects with low cardiovascular risk. however, there was a significant increase in adiponectin, an anti - inflammatory adipokine with cardioprotective properties. low adiponectin levels are observed in obese subjects with and without severe coronary atherosclerosis and in subjects with abdominal obesity [10, 25 ], and decreased adiponectin levels (< 4 g / ml) are associated with a twofold increase in the prevalence of coronary heart disease, independent of other cardiovascular risk factors. moreover, hypoadiponectinemia is associated with insulin resistance and dm2 [27, 28 ], as well as atherosclerosis and hypertension. adiponectin exerts an anti - inflammatory effect through activation of its three receptors (adipor1, adipor2, and t - cadherin). the activation of adipor1 and r2 results in increased hepatic and skeletal muscle fatty acid oxidation, increased skeletal muscle lactate production, reduced hepatic gluconeogenesis, increased cellular glucose uptake, and inhibition of inflammation and oxidative stress. activation of t - cadherin is protective in vascular endothelial cells against oxidative stress - induced apoptosis. several mechanisms have been suggested to explain the anti - inflammatory effects of adiponectin, including direct actions on inflammatory cells, actions on nf-b, and interaction with tnf-. it has been demonstrated that adiponectin inhibits the expression of adhesion molecules in endothelial cells and inhibits smooth muscle cell proliferation, the differentiation of monocytes into macrophages, as well as the formation of foam cells and the secretion of tnf- by macrophages [3234 ]. also, increased adiponectin levels are related to improvement in the differentiation of preadipocytes into adipocytes, which is usually impaired in obese subjects. in fact, 1,2-vinyldithiin (1,2-dt), a garlic - derived organosulfur compound, has been shown to affect the differentiation of human preadipocytes into adipocytes. interestingly, a significant reduction of the expression of the two major adipogenic transcription factors, ppar2 and ccaat / enhancer binding protein (c / ebp), was observed in 1,2-dt - treated preadipocytes. the 1,2-dt - mediated decrease in ppar2 expression is associated with reduced ppar activity, suggesting that the negative effect of 1,2-dt on preadipocytes differentiation could be mainly due to an inhibitory effect on ppar2, the master regulator of adipogenesis. the role of these mechanisms of action of 1,2-dt in the beneficial effects of age increasing the levels of adiponectin remains to be elucidated. additionally, our results showing that a short period of age administration increases the adiponectin level suggest that the effect of age improving the insulin resistance could be another new interesting mechanism to explain the well - known beneficial cardiometabolic effect of garlic. another mechanism that could be associated with the adiponectin increase is the nitric oxide (no) pathway. adiponectin increases the stability of enos mrna and half - life, enhances the association of enos with hsp90, and stimulates the phosphorylation of enos, which together lead to increased no production [38, 39 ]. it has been suggested that age could increase no bioavailability [40, 41 ] by (a) increasing cellular antioxidant capacity by providing cellular thiol antioxidants like cysteine and reduced glutathione, (b) maintaining functionally relevant levels of tetrahydrobiopterin and preventing oxidative inactivation of tetrahydrobiopterin, which prevents no synthase uncoupling and superoxide anion generation, and (c) maintaining no bioavailability in endothelial cells even under conditions of increased vascular oxidant stress. age is rich in water - soluble organosulfur bioactive compounds such as s - allylcysteine and s - allylmercaptocysteine which are cellular donors of thiol containing reducing equivalents and as such might explain the cardiovascular benefits of age. in summary, we showed for the first time that age administration for 12 weeks increases adiponectin levels. the importance of this observation in the prevention of cvd remains to be determined, and further and larger studies are needed. | background. garlic (allium sativum) has been shown to have important benefits in individuals at high cardiovascular risk. the aim of the present study was to evaluate the effects of the administration of aged garlic extract (age) on the risk factors that constitute the cluster of metabolic syndrome (ms). methods and design. double - blind, crossover, randomized, placebo - controlled clinical trial to assess the effect of 1.2 g / day of age (kyolic), for 24 weeks of treatment (12 weeks of age and 12 weeks of placebo), on subjects with ms. results. the administration of age increased the plasma levels of adiponectin (p = 0.027). no serious side effects associated with the intervention were reported. conclusion. the present results have shown for the first time that the administration of age for 12 weeks increased plasma adiponectin levels in patients with ms. this suggests that age might be a useful, novel, nonpharmacological therapeutic intervention to increase adiponectin and to prevent cardiovascular (cv) complications in individuals with ms. |
the online version of this article (doi:10.1007/s40119 - 014 - 0034 - 7) contains supplementary material, which is available to authorized users. patients undergoing structural and congenital heart interventions usually require large - sized sheath insertion into the femoral arteries. hence, active management of the femoral access site can potentially reduce the risk of vascular complications and allow early mobilization and discharge. the use of arterial closure devices is well established in patients undergoing diagnostic and percutaneous coronary interventions, percutaneous aortic balloon valvuloplasty (pabv), and endovascular aortic procedures. the use of the perclose (abbott vascular devices, santa clara, ca, usa) device in venous access sites has also been described [47 ]. here, we describe the use of the perclose suture - mediated device using the pre - closure technique in a series of 101 femoral arterial access site closures in patients undergoing congenital and structural heart interventions. data from 100 consecutive patients who underwent large femoral arterial access (8 fr) site closures for congenital and structural interventions were analyzed retrospectively. time to hemostasis, mobilization, and need for further intervention at the access site were analyzed. patients had clinical follow - up reviews at 3 months and at 912 months. at follow - up, vascular assessment included checking for the femoral pulses, presence of hematoma, or signs of arterial occlusion. all the procedures were performed in a tertiary cardiac center, where there were vascular interventional and surgical services available. patients with previous multiple vascular access, who had difficult arterial access due to extensive scarring, did not receive the perclose device. major complications related to device were defined as the need for peri - procedural surgical or radiological intervention or bleeding requiring blood transfusion. the perclose device efficacy was defined as achievement of hemostasis at the femoral arterial access site in 2 min following sheath removal and deployment of the pre - deployed sutures without the need for further manual compression. subsequently, a 6 fr perclose (a - t or proglide ; abbott vascular devices) device was inserted and the wire was removed. the footplate of the device was deployed and the device pulled back and sutures set as usual. the footplates were released and the device partially retrieved until the port for the guide wire was visible (figs. 1, 2). the sutures were tightened at the end of the procedure upon removal of the sheath(s) from the vessel.fig. 2rewiring of the vessel following pre - deployment of the perclose (abbott vascular devices, santa clara, ca, usa) device insertion of 6 fr dilator over the wire following femoral vessel access rewiring of the vessel following pre - deployment of the perclose (abbott vascular devices, santa clara, ca, usa) device a single perclose device was deployed for each arterial access up to 12 fr and two devices were pre - deployed at right angles to each other when sheath size was expected to be greater than 12 fr. fourteen patients who underwent transcatheter aortic valve implantation (tavi) had two devices used per procedure. all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1975, as revised in 2000 and 2008. informed written consent for the procedure was obtained from all patients. subsequently, a 6 fr perclose (a - t or proglide ; abbott vascular devices) device was inserted and the wire was removed. spontaneous blood flow through the side port was observed. the footplate of the device was deployed and the device pulled back and sutures set as usual. the footplates were released and the device partially retrieved until the port for the guide wire was visible (figs. 1, 2). the sutures were tightened at the end of the procedure upon removal of the sheath(s) from the vessel.fig. 2rewiring of the vessel following pre - deployment of the perclose (abbott vascular devices, santa clara, ca, usa) device insertion of 6 fr dilator over the wire following femoral vessel access rewiring of the vessel following pre - deployment of the perclose (abbott vascular devices, santa clara, ca, usa) device a single perclose device was deployed for each arterial access up to 12 fr and two devices were pre - deployed at right angles to each other when sheath size was expected to be greater than 12 fr. fourteen patients who underwent transcatheter aortic valve implantation (tavi) had two devices used per procedure. all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1975, as revised in 2000 and 2008. informed written consent for the procedure was obtained from all patients. a total of 101 femoral arterial sites closures were performed in 100 consecutive patients over a period of 4 years. of these, 14 underwent tavi, 39 had pabv, and 47 underwent coarctation of the aorta (coa) stenting. sixty - two percent of the patients were male and their mean (sd) age was 52 (26) years (range 1695 years). all received anticoagulation with heparin during the procedure with a standard dose of 5,000 iu. the size of the sheaths used during the procedure ranged from 8 to 18 fr with a mean (sd) arterial sheath diameter of 13 (2) fr. final sheath sizes were 12 fr in 86 patients and 14 fr in 14 patients. all patients were mobilized in 2 h except for patients requiring general anesthesia who were mobilized after 4 h. major complications in the form of pseudoaneurysm were seen in two patients (2%). one required open vascular repair 2 weeks following the procedure, while the second was treated with thrombin injection. five patients had mild access site oozing requiring manual compression for less than 30 min on the arterial access site. in five cases, the device failed to deploy on pre - closure initially, necessitating the use of a further device. both procedures were done as emergency procedures after presenting with cardiogenic shock in the setting of severe aortic stenosis. none of the deaths were related to vascular access site complications and there was no significant drop in hemoglobin levels requiring a blood transfusion. ninety - six percent had clinical follow - up available with a mean (sd) follow - up of 24 (12) months and median follow - up of 8.5 months. all patients were mobilized in 2 h except for patients requiring general anesthesia who were mobilized after 4 h. major complications in the form of pseudoaneurysm were seen in two patients (2%). one required open vascular repair 2 weeks following the procedure, while the second was treated with thrombin injection. five patients had mild access site oozing requiring manual compression for less than 30 min on the arterial access site. in five cases, the device failed to deploy on pre - closure initially, necessitating the use of a further device. both procedures were done as emergency procedures after presenting with cardiogenic shock in the setting of severe aortic stenosis. none of the deaths were related to vascular access site complications and there was no significant drop in hemoglobin levels requiring a blood transfusion. ninety - six percent had clinical follow - up available with a mean (sd) follow - up of 24 (12) months and median follow - up of 8.5 months. the perclose device has been used for femoral arterial and venous closure in small - sized sheaths following percutaneous coronary intervention procedures [1, 3 ]. the use of perclose device leads to early hemostasis, early sheath removal, and early patient mobilization. a meta - analysis of 30 studies by nikolsky paul, mn, usa) were comparable to mechanical compression in obtaining arterial hemostasis in the setting of diagnostic coronary angiography and the risk of access site complications was similar. as all these studies were on coronary interventions, they generally used smaller arterial sheath sizes (6 fr). bangalore. have shown lower deployment success and higher risk of vascular complications with perclose compared with the angioseal device. in our study, we had 39 patients, who underwent pabv, in whom we used 12 fr sheaths with no vascular access site complications. forty - seven patients underwent successful perclose device deployment to achieve complete homeostasis in patients who underwent stenting for coa. to the best of our knowledge, no previous literature exists on pre - closure of the access site with the perclose device for patients undergoing stenting for coa. the american heart association currently recommends the use of femoral artery closure devices to achieve faster hemostasis, shorter duration of bed rest, and possibly improved patient comfort. this study demonstrates that optimal results can be obtained with pre - closure using a perclose device for large - sized femoral arterial access in a wide range of congenital and structural heart interventions, including tavi where large caliber arterial sheaths are required for valve implantation. the use of the perclose device in securing hemostasis in the venous access sites has also been described more recently. have reported the use of perclose for femoral venous closure and maintenance of venous patency as assessed by doppler following such closure. a recent study by hamid. described the successful use of the device in 310 large femoral venous access sites (8 fr) in 243 patients undergoing structural heart interventions. reported use of perclose closure device for access site management after using 14 fr femoral venous sheaths for antegrade pabv. this study demonstrates that perclose device can be used safely and effectively for large - sized femoral arterial access in a wide range of congenital and structural heart interventions. similarly, we used perclose devices in tavi where large caliber arterial sheaths are required for valve implantation. this is a retrospective series with no control group that underwent manual compression or other form of repair to compare efficacy in a more objective manner. there may also be the possibility of operator bias in choosing cases for pre - closure. this is a retrospective series with no control group that underwent manual compression or other form of repair to compare efficacy in a more objective manner. there may also be the possibility of operator bias in choosing cases for pre - closure. pre - closure with the perclose suture technique for femoral arterial sites following the insertion of large - sized sheaths (8 fr or above) for cardiac interventions is safe and effective, with a low risk of vascular access site complications. tahir hamid, tawfiq r. choudhury, bernard clarke, and vaikom s. mahadevan declare no conflicts of interest. all procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the helsinki declaration of 1975, as revised in 2000 and 2008. informed written consent for the procedure was obtained from all patients. this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. | introductionpatients undergoing structural heart interventions often require large - sized sheath insertion into femoral arteries and veins. clinical outcome data on the use of suture - mediated devices for large femoral arterial access in structural heart interventions is limited. we assessed the efficacy of the perclose (abbott vascular devices, santa clara, ca, usa) suture - mediated device using the pre - closure technique in achieving hemostasis in femoral arterial access sites following large sheath insertion (8 fr).methodsone hundred consecutive patients underwent 101 femoral artery access sites closures with the perclose device using the pre - closure technique. sixty - two percent of the patients were male and their mean (sd) age was 52 (26) years. all patients received heparin.resultsmean arterial access site sheath diameter was 13 2 fr. immediate hemostasis was achieved in 96/101 (96%) procedures (2 min). two patients (2%) had access site - related complications requiring further interventions. on clinical follow up [mean (sd) follow - up of 24 (12) months and median follow - up of 8.5 months ], no complications were seen in the arterial access sites.conclusionpre-closure of large - size femoral arterial access sheath sites using the suture - mediated perclose device is efficacious in achieving rapid hemostasis in patients undergoing structural interventions. on 1-year follow - up, there were no arterial access site complications requiring further investigations or interventions.electronic supplementary materialthe online version of this article (doi:10.1007/s40119 - 014 - 0034 - 7) contains supplementary material, which is available to authorized users. |
the compound muscle action potential (cmap) scan is a noninvasive diagnosis technique for neurodegenerative pathologies, such as amyotrophic lateral sclerosis (als). it allows a quick analysis of the muscle action potentials in response to motor nerve stimulation, by electrical stimulation applied on the surface of the motor nerve and response evaluation by surface electromyography (semg) at muscle level. each motor unit (mu) of muscles has a different stimulus intensity (si) at which it is activated, meaning that mus have different thresholds. varying the intensity of the stimuli applied, gradually increasing from subthreshold to supramaximal values, will sequentially activate all mus in the muscle. this way, it is possible to obtain a graphical representation of the evoked action potentials amplitude in the muscle versus the stimulation intensity. this record will show a sigmoid tendency which is called the cmap scan [13 ]. henderson. examined the variability of the cmap scan between healthy and als subjects. evidences were found for a significant difference in relation to cmap scan evolution, number of steps (visible jumps in cmap amplitude within consecutive stimuli), and size, since als patients present more and larger steps on the stimulus - response curve than healthy controls. a healthy cmap scan has traditionally a sigmoid tendency curve for the motor unit action potential amplitude in response to a linear increase of current intensity. this technique provides clinically relevant information about reinnervation processes, number and size of functional motor units, and neuromuscular activity / excitability. moreover, cmap amplitude has significant correlation with muscle strength, motor unit number estimation, and functional disability in als. to be used as a clinical tool, stimulation parameters must be standardized and quantified in order to enable uniform collection and comparison of data. several studies have been made recently to verify the potentiality of this technique, investigating the influence of different parameters in the quality of the cmap scan. a consensual way is based on the analysis of key points like the maximum cmap amplitude, s5, s50, and s95 (the stimulus intensity that elicited 5%, 50%, and 95% of the maximum cmap amplitude, resp.), si range (the difference between s95 and s5), and step percentage, despite the fact that the physiological influence of different stimulation parameters remains unknown. an untested parameter of the cmap is the waveform of the electrical pulse used in the nerve stimulation. the waveform is a graphical representation over time of a signal, as it reflects its shape. in electrical stimulation, the waveform represents the variation over time of the applied current or voltage on the muscle or nerve. it can be monophasic or biphasic and also have different shapes like sine and square, among others. this work aims to study the influence of different pulse modulated waveforms in peripheral nerve excitability, by cmap scan technique, on healthy subjects for future comparison in als patients. to accomplish that, an electrical stimulation protocol was developed and biosignals from healthy subjects were acquired, analyzed, and processed, in order to extract features for the analysis of the different waveforms ' influence in the stimulation of the peripheral nerve. the waveforms tested in the stimulation protocol were monophasic square, triangular, and quadratic waves, and also a biphasic square wave. in this study a total of 13 healthy subjects were submitted to the same test. this group was composed of 7 males and 6 females, mean age of 26.00 (3.63) years, range from 20 to 36 years, and without clinical history on neurologic disorders. the stimuli were applied in the median nerve on the right wrist and emg signal was collected on the abductor pollicis brevis muscle surface on the right thumb. self - adhesive pregelled ag / agcl, 30 24 mm disposable electrodes were attached to the skin for acquisition and stimulation and placed according to seniam standards. the ground electrode was placed on the left wrist ulnar styloid process. during the test, the subjects were seated, motionless and relaxed, with thumb fixation to minimize movement artifacts. different number of stimuli and current increment steps were tested in order to have a stimulation protocol that would allow obtaining a curve with enough resolution but not excessive test duration. after extensive testing, it was perceived that only 3 stimuli per step were sufficient to have high resolution in the cmap. to optimize the relation between curve definition and test duration, the current increment steps have different values depending on the correspondent curve zone. this way, a small step increment of current intensity is defined to increase the definition of the sigmoid curve only on the transition zones. on the initial (4 to 6 ma) and final (25 to 30 ma) stages the current increment would be of 1 ma for each step. from 6 to 25 ma the increment was 0.5 ma. to properly cancel noise and mechanical artifacts, the pulses were randomly distributed in frequencies from 1.8 to 2.2 hz. the emg signal was acquired with a 3000 hz sampling frequency, amplified with a gain of 201 and 12 bits of resolution. a combined wireless, miniaturized and synchronized unit was specifically developed for emg acquisition and nerve stimulation [7, 8 ]. the system was previously validated in comparison with a clinical system installed in hospital santa maria, lisbon. the procedure was repeated 4 times per subject, each repetition using a different single pulse stimulation waveform. a standard square wave was applied in test 1, a triangular wave in test 2, and a quadratic wave in test 3. in all these 3 protocols, a 4th protocol was tested with a biphasic single pulse square wave, with the same intensities of the other tests. the current charge difference from each waveform the stimulation charge was computed according to the stimulation intensity and waveform, based on the following formula : (1) q=t1t2i dt, where i represent the current intensity and t1 to t2 is the stimulus time range. the different single pulses total charge has been equalized for each current intensity, maintaining the amplitude and varying the pulse - width time. from the theory, the total charge of the electrical impulse is the most reliable measurement of the biological reaction to the electrical stimulation. the collected biosignals were processed and features were extracted, according to the following steps : detecting peak - to - peak amplitude of the stimulus - response m-wave.cmap scan composition via interpolation.extracting s5, s50, s95, and si range and stimulus - response amplitude elicited by these parameters.detecting the beginning (sigmoid trigger intensity), final (sigmoid plateau first intensity), and slope of the resulting sigmoid.computing the intersubject mean and standard deviation of the computed parameters.computing the differences in the computed parameters for each waveform, when comparing with the traditional square wave.these steps were repeated for each waveform type and all subjects. all data had posterior visual validation by two specialists. detecting peak - to - peak amplitude of the stimulus - response m - wave. extracting s5, s50, s95, and si range and stimulus - response amplitude elicited by these parameters. detecting the beginning (sigmoid trigger intensity), computing the differences in the computed parameters for each waveform, when comparing with the traditional square wave. each subject was analyzed regarding the maximum cmap amplitudes, the excitability parameters (s5, s50, and s95, stimulus current intensity in ma that elicited correspondent response amplitude in mv), the sigmoid slope, and current intensity differences of the cmap scan, between each different waveform. figure 3(a) presents a cmap wave elicited by the four different waveforms with the same pulse amplitude (10.5 ma). differences in the responses ' peak - to - peak amplitude can be observed, using the same current intensity and charge. figure 3(b) shows, for one example subject, four cmap scans generated with four waveforms. like in figure 3(a), the differences between the waveforms in the stimulation intensities to generate the same response amplitude can be observed. table 1 presents the mean cmap scan sigmoid slope differences between each waveform in comparison to the square wave. the value is given in percentage, assuming that the square wave 's sigmoid slope is 100%. in table 2 the mean intensity differences regarding the stimulation parameters s5, s50, and s95 between each waveform and the square wave are presented. as the stimulation parameters increase in amplitude (from s5 to s50 and s50 to s95), the difference between each wave (from square to triangular, triangular to quadratic, and quadratic to biphasic square) also increases.. however, there are also several constraints which can not be simulated, like the patient comfort to some type of stimulation, the nervous fiber fatigue associated with the habituation to the electrical pulse, or the possible changes of tissue impedance during stimulation (increase of temperature, increase of skin sudation, microirritations to the tissue after consecutive stimulus application, etc.). some effects are also impossible to contemplate in a theoretical model, such as the study in injured patients or with an early diagnosis for the disease. peripheral nerve stimulation is influenced by external variables that are hard to control, like the adipose tissue layer that the electrical current has to pass, the distance between the stimulation electrodes and the nerve to be stimulated, among other body inhomogeneities. taking this into consideration, the chosen analysis parameters were the ones that allowed a more objective assessment of the considered effects among different subjects. the results show that the square pulse, besides needing less current intensity to generate the same response amplitude as the other waves, is also the one that presents a steeper curve slope. this means that, for the square wave, the intensities range between the beginning and final of the cmap scan is usually shorter than for the other waves. the quadratic wave, among the monophasic waves group, represents the stimulation pulse that needs a larger current intensity to elicit the same response amplitude in comparison with the other waves. this happens possibly due to a nervous fiber sensibility to charge transfer rate, since in the used setup all single pulses have the total charge equalized. concerning the biphasic square pulse, it is possible to verify that it has a distinct behavior from the monophasic pulses, with activation intensities of the response levels s5, s50, and s95 quite superior and also a rather inferior sigmoid slope. this indicates that, possibly, only one of the flanks of the biphasic waveform is activating the nerve fibers. the monophasic waveforms have a more linear behavior, while the biphasic waveform presents a more unstable behavior with greater variations. the analysis of the influence of the waveform on the peripheral nerve stimulation reveals new effects in the context of the nerves ' excitability. electrophysiology studies reveal significant differences between healthy subjects and neurodegenerative patients. upon this, when a variable that is able to manipulate or change the sensibility of the cmap stimulus - response curve is introduced, a question arises : will this variable have the same behavior when evaluating patients ? is it possible that subjects with pathology or propensity to develop will show differences in the sensibility to the electrical charge ? these are the relevant questions that this work starts to address, studying healthy subjects. the evaluation of new wave parameterizations in healthy subjects, in addition to being a basis for comparison for future patients evaluation, also represents a contribute for research associated with the cmap scan methodology and a step forward on the understanding of the electrical pulse waveform influence on peripheral nerve excitability. | introduction. compound muscle action potential (cmap) scan is a noninvasive promissory technique for neurodegenerative pathologies diagnosis. in this work new cmap scan protocols were implemented to study the influence of electrical pulse waveform on peripheral nerve excitability. methods. a total of 13 healthy subjects were tested. stimulation was performed with an increasing intensities range from 4 to 30 ma. the procedure was repeated 4 times per subject, using a different single pulse stimulation waveform : monophasic square and triangular and quadratic and biphasic square. results. different waveforms elicit different intensity - response amplitude curves. the square pulse needs less current to generate the same response amplitude regarding the other waves and this effect is gradually decreasing for the triangular, quadratic, and biphasic pulse, respectively. conclusion. the stimulation waveform has a direct influence on the stimulus - response slope and consequently on the motoneurons excitability. this can be a new prognostic parameter for neurodegenerative disorders. |
its effects are mediated principally through triiodothyronine (t3), which acts as a ligand for the th receptors (trs) 1, 2 and 1 [harvey and williams, 2002 ; yen, 2001 ]. in the classical model of genes positively regulated by th, the tr first binds as a heterodimer or homodimer on th response elements (tre) located in the promoter regions of target genes, where it interacts with corepressors. upon ligand binding, the tr homodimers are dissociated in favor of heterodimer formation with the retinoid - x receptor (rxr), resulting in release of the corepressors and recruitment of coactivators. this new complex attracts a large number of proteins which engage the rna polymerase ii in the transcription of the targeted gene (figure 1, part 1). this classical mechanism can also lead to increased expression of genes devoid of tres, if they are target genes for transcription factors that are induced by this mechanism. in addition to the classical, nuclear mode of th action, a number of rapid effects taking place in the cytosol and at the plasma membrane have been subsequently identified. th can control ca entry, intracellular protein trafficking and regulation of protein kinase c [davis and davis, 2002 ; davis. the mapk pathway can be activated by th binding to the integrin v3, located in the cell membrane, without entering the cell. this mechanism leads to phosphorylation of nuclear receptors and can induce angiogenesis and promote cell growth [bergh., 2005 ; tang., a derivative of th, 3-iodothyronamine (t1am), can induce bradycardia and hypothermia within minutes through a mechanism that remains unknown [scanlan. these nongenomic actions of th are mostly extranuclear, appear to be independent of trs and have rapid effects on proteins rather than modulate gene expression. as all proteins, trs are synthesized in the cytoplasm from where they are translocated into the nucleus to exert their genomic effect summarized above. a dynamic nucleo - cytoplasmic shuttling has been described [baumann., 2001 ]. we recently identified a new mechanism of th action in which the liganded tr interacts with the regulatory subunit of pi3k (p85) in the cytosol [cao., this leads to activation of pi3k (figure 2) and its downstream signaling cascade (figure 1 part 2), sequential phosphorylation and activation of the serine / threonine kinase akt, mammalian target of rapamycin (mtor) and its substrate p70. mtor activation is rapid, with detectable phosphorylation as early as 10 minutes after t3 treatment, and not sensitive to cycloheximide (chx) treatment, indicating that this effect of th uses preexisting proteins. th acts through the tr, because in human fibroblasts that express the wt tr, introduction of a dominant negative mutant tr abrogated the effect of th. furthermore, a direct interaction between tr and pi3k could be demonstrated by coimmunoprecipitation of tr1 with the p85 subunit of pi3k. the interaction between tr and pi3k most likely takes place in the cytosol. within minutes after activation by t3, phosphorylated akt, as part of the pi3k pathway, is translocated from the cytosol into the nucleus (figure 1 part 2). this th action is very rapid and independent of protein synthesis, which is typical of nongenomic action. yet, two aspects distinguish this mechanism of th action from most other nongenomic effects of the hormone : 1) it requires tr binding and 2) its ultimate effect is for example, the calcineurin inhibitor zaki-4 had been previously described as a th responsive gene [cao., 2002 ; cao and seo, 2003 ; miyazaki., 1996 ]. this effect was blocked by inhibitors of pi3k and by a dominant negative p85 subunit of pi3k [cao., rapamycin, an inhibitor of mtor also abrogated the th - dependent induction of zaki-4, suggesting the requirement of sequential activation of kinases initiated by the activation of pi3k. zaki-4 expression is also chx sensitive, indicating that protein synthesis is necessary for the induction of zaki-4. these results show that zaki-4 represents an example of an indirectly induced gene downstream of nongenomic action of th. the transcription factor linking the pi3k pathway to zaki-4 expression has not yet been identified. a similar activation of pi3k has been observed for other steroid hormone nuclear receptors [simoncini., 2000 ] to determine the broad scale effect of th on gene expression in normal human cells, we measured the expression of more than 15,000 genes in fibroblasts of normal individuals by quantitative fluorescent cdna microarray [moeller. fibroblasts from two subjects with resistance to thyroid hormone (rth) due to mutations in the tr gene were used to confirm the specificity of the hormonal effect by the ability to discriminate between normal cells and cells with a defect in th action. microarray analysis identified 91 up - regulated and 5 down - regulated genes and confirmation by real - time pcr was obtained in 8 of 10 induced and 2 of 3 repressed genes that were tested. several new th responsive genes were identified, both positively (akr1c1 - 3, pfkp, rab3b, hif-1, colvia3) and negatively regulated (fgf7, adh1b). genes that had been found to respond to th in other species were also found in these human cells (bteb1, glut1, mct4). further evidence for t3-specific induction was provided by a graded dose response for induced genes that was absent in fibroblasts from the patients with rth. of special interest among the upregulated genes were the transcription factor subunit hypoxia - inducible factor (hif)-1, its target genes, glucose transporter (glut)1 and platelet - type phosphofructokinase (pfkp), and the monocarboxylate transporter (mct)4. these genes are functionally related as they have important roles in cellular glucose metabolism, from glucose uptake (glut1) to glycolysis (pfkp) and lactate export (mct4). the response of these genes to th was reduced or absent in the th resistant fibroblasts, which confirms the role of the tr. the transcription factor hif-1 consists of two subunits, and. while the subunit is constitutively expressed, the subunit is tightly regulated. cellular hypoxia leads to increase of hif-1 protein levels by decreased ubiquitination [semenza, 2001 ] and in normoxia, growth factors and hormones (e.g. egf, igf-1, insulin, androgens) lead to increased hif-1 by posttranscriptional mechanisms [bardos and ashcroft, 2004 ; kasuno., the latter is mediated by cellular signal transduction pathways, especially the pi3k - akt / pkb - mtor pathway and the mapk pathways [fukuda., 2002 ; kasuno., we examined the involvement of the pi3k pathway by treating human skin fibroblasts with t3. mrna of hif-1 was increased after 3 hours and the effect lasted for the 24 hours of the experiments. mrna induction led to significant increase in the protein, demonstrated by western blotting for hif-1 as well as pfkp. addition of the pi3k inhibitor ly294002 abrogated th - dependent induction of mrnas for hif-1 as well as glut1, pfkp and mct4 [moeller. hif-1 induction was direct and translation - independent, as chx pretreatment did not inhibit hif-1 mrna increase after t3 treatment. as expected, expression of hif-1 s target genes, glut1 and pfkp, was chx - sensitive. the mapk pathway was examined by pretreatment with pd98059, but inhibition of t3 effect was not observed. the mapk pathway seems not to be involved expression of these genes in human fibroblasts. these results further demonstrate that activation of the pi3k signaling pathway by th and tr in the cytosol can lead to direct (hif-1) and indirect (glut1, pfkp, mct4) gene expression. until recently, th - mediated changes in gene expression were thought to be primarily, if not solely, initiated by direct nuclear tr binding to a tre in the promoter of a target gene. it is capable of activating cellular signaling pathways in the cytosol, as demonstrated for the pi3k pathway, which leads to induction of zaki4, hif-1 and its target genes. this cytosolic mechanism of th - mediated tr-dependent action contributes to the overall effect of th on gene expression. surprisingly, some of the most highly induced genes in our experiments were later found to be downstream of the pi3k pathway (e.g. zaki-4, pfkp). a possible explanation is that kinase cascades have the potential to amplify the signal from kinase to kinase, whereas on a tre amplification steps are limited. the definition of the trs therefore has broadened beyond being merely ligand - dependent nuclear transcription factors. we conclude that th responsive genes can be directly induced by nuclear (e.g. bteb1) and cytosolic action of th (e.g. hif-1) without requirement of prior protein synthesis. indirectly induced genes, following expression of a transcription factor, exist for both modes of th action. nongenomically induced and that more signaling pathways will be found to be activated by the trs. genomic (1) and non - genomic (2) actions of th are illustrated. genomic action requires thyroid hormone responsive elements (tres) for the recognition of genes for direct transcriptional regulation. non - genomic action is initiated by the th - dependent activation of pi3k as illustrated in figure 2. activation of pi3k leads to sequential activation of akt / pkb - mtor - p70. although not well defined, this cascade leads to transcriptional upregulation of some genes such as zaki-4 and hif-1. gtf : general transcription factors. for details tr present in the cytosol forms a complex with p85 subunit (regulatory subunit of pi3k) in a ligand independent manner. | thyroid hormone (th) action is mediated principally through binding of the hormone ligand, 3,3,5-triiodothyronine (t3), to th receptors (trs). this hormone - receptor interaction recruits other proteins to form complexes that regulate gene expression by binding to dna sequences in the promoter of target genes. we recently described an extranuclear mechanism of th action that consists of the association of th - liganded tr with p85 [regulatory subunit of phosphatidylinositol 3-kinase (pi3k) ] in the cytosol and subsequent activation of the pi3k, generating phosphatidylinositol 3,4,5-triphosphate [ptdins(3,4,5)p3 ]. this initiates the activation of a signaling cascade by phosphorylation of akt, mammalian target of rapamycin (mtor) and its substrate p70s6k, leading to the stimulation of zaki-4 synthesis, a calcineurin inhibitor. furthermore, we found that this same mechanism leads to induction of the transcription factor hypoxia - inducible factor (hif-1), and its target genes, glucose transporter (glut)1, platelet - type phosphofructokinase (pfkp), and monocarboxylate transporter (mct) 4. these genes are of special interest, because their products have important roles in cellular glucose metabolism, from glucose uptake (glut1) to glycolysis (pfkp) and lactate export (mct4). these results demonstrate that the th - tr complex can exert a non - genomic action in the cytosol leading to changes in gene expression by direct (hif-1) and indirect (zaki-4, glut1, pfkp) means. |
the principle goal of sedation for eye surgery is to prepare the patients to stay calm during retrobulbar injection and surgery. both insufficient sedation and deep sedation may lead to sudden movements by patients, which may potentially result in harmful complications during open eye surgery. cognitive impairment has been demonstrated in patients undergoing cataract surgery under local anesthesia with sedation leading to major problems at time of discharge of the patient. several drugs such as propofol, benzodiazepines, opioids, and dexmedetomidine have been used for sedation during this procedure. however, each of these drugs has its own limitations, leading to impairment of patient 's cooperation during surgery and making these agents less than ideal for the intraoperative management of sedation. therefore, the potential clinical advantages of newly - marketed therapeutic drugs should be thoroughly evaluated. gabapentin and melatonin are two well - tolerated drugs that are associated with anxiolytic and antinociceptive properties. several studies have reported that melatonin given as preoperative premedication is associated with sedation and preoperative anxiolysis without cognitive dysfunction including the memory recall and driving performances or the quality of recovery. also, it is reported that melatonin has been associated with the relief of pain in patients with major tissue injuries. ismail. reported that the administration of oral melatonin as preoperative premedication in patients undergoing cataract surgery under topical anesthesia produces anxiolytic and analgesic effects while reducing the intraocular pressure, leading to desirable operating conditions. on the contrary, it is reported that gabapentin has anxiolytic and antinociceptive effects. in another study, it is claimed that this drug does not depress respiration with no effect on gastric mucosa, platelets, and renal function. moreover, gabapentin seems to be an anxiolytic without amnesic effects which is an important advantage for elderly patients. leung and colleagues reported that delirium is significantly less in patients receiving gabapentin before spine surgery. several studies have shown that gabapentin might be a useful adjuvant to postoperative analgesia in patients with regional analgesia. in our literature review, we could not find any study evaluating the effect of gabapentin and melatonin on anxiety, pain, sedation scores, satisfaction of surgeon, and hemodynamic parameters in cataract surgery under retrobulbar anesthesia. we hypothesized that gabapentin and melatonin might be valuable premedications for cataract surgery under retrobulbar anesthesia. to test our hypothesis, we designed this randomized double - blind, placebo - controlled study to evaluate the effect of melatonin and gabapentin on anxiety, pain, and sedation scores as well as the satisfaction of surgeon during cataract surgery. this clinical trial was registered with the united states national institutes of health (www.clinicaltrials.gov), under the number nct01200641. after obtaining the approval of the institutional ethics committee, and written informed consent, 130 patients scheduled for cataract surgery by phacoemulsification were recruited in a prospective, double - blinded randomized trial. the consolidated standards of reporting trials (consort) recommendations for reporting randomized controlled clinical trials were followed [figure 1 ]. this study was performed in booali hospital, qazvin (iran) during september 2010 to january 2011. patients with asa (american society of anesthesiologists) status iv, history of hepatic or renal disease, confusion, dementia, or communication difficulty resulting from deafness or language barrier, chronic use of narcotics, barbiturates or psychotropic medications, allergy or contraindications to any of the study drugs, visual impairment of nonoperative eye, and weight less than 40 kg or more than100 kg were excluded. patients were randomly allocated to one of three groups each with 40 patients to receive melatonin 6 mg (group m), gabapentin 600 mg (group g), or placebo (group p) orally 90 min before arrival in the operating room. allocation was managed by a resident external to the project and the study drugs given by a nurse noninvolved in the study. the anesthetist was blinded to the patient 's group assignment, and the study data were recorded by a blinded observer. the primary outcomes of this randomized, double blind and placebo - controlled clinical trial were to evaluate anxiety and pain scores in each patient before premedication (t1), 90 min after premedication, on arrival in the operating room (t2), during retrobulbar block (rbb) placement (t3), during operation period (t4), and postoperatively prior to dischargefromthe recovery room (t5). at the preoperative visit, the verbal pain score (vps) ranging from 0 to10 (0 = no pain and 10 = worst pain imaginable) and the verbal anxiety score (vas) ranging from 0 to 10 (0 = completely calm, 10 = the worst possible anxiety) were fully explained to patients. at the end of surgery, the patients were asked about the average level of their anxiety and pain during operation period according to the vas and vps explained before premedication. patients were monitored with electrocardiogram, noninvasive measurement of blood pressure, and pulse oximetry (spo2). retrobulbar nerve block was performed by an ophthalmologist who was unaware of patient assignment, with 1.5 ml of solution prepared by a nurse (2 ml of lidocaine 2% and 0.5 ml of bupivacaine 0.5%) via percutaneous route with a 25 g, 38 mm atkinson needle (john weiss and son limited, milton keynes, england), at inferotemporal site. the secondary outcomes included the assessment of the sedation level of patients during the performance of block, the mean arterial blood pressure (map), and the heart rate (hr) before premedication (t1), 90 min after premedication, on arrival in the operating room (t2), during retrobulbar block placement (t3) during operation period (5 min after beginning of surgery) (t4), and postoperatively before discharging the patient from the recovery room (t5). the sedation level of patients during the performance of block was assessed using a 4-point scale with 0 = movements of the head, arms, and trunk, 1 = slight movement of arms, 2 = slight change in face, and 3 = complete calmness. if sedation showed to be inadequate, fentanyl was given at a dose of 0.5 g / kg. at the end of surgery, the surgeon was also asked to verbally rate the level of satisfaction according to a 3-point scale as very bad, moderate, and good. the mean arterial blood pressure (map) and the heart rate (hr) were recorded by a noninvasive automatic blood pressure measuring device and electrocardiogram monitoring before premedication (t1), 90 min after premedication, on arrival in the operating room (t2), 1 min after retrobulbar block placement (t3) during operation period (5 min after the beginning of surgery) (t4), and postoperatively before discharge from the recovery room (t5). based upon previously published data, the authors hypothesized that the placebo would have an effect over reducing the anxiety scores in 5% of patients whereas melatonin and gabapentin are reported to produce a reducing effect in at least 40% of patients and to provide an 80% power with an error equal to 0.05, a sample size of 30 patients per group was determined to be sufficient. to compensate for dropout cases and shifting from normality in data distribution, the t - test analysis was used for continuous parametric variables such as, weight, height, age, and the duration of surgery. the difference between the highest mean arterial pressure and heart rate and the values obtained for lowest mean in each patient was compared between the groups using one - factor anova test. within each groups, this comparison was made using the student 's paired t - test with tukey correction. mann - whitney rank - sum test was used to compare the values obtained for vas and vps between the two groups. the wilcoxon 's test was used for comparison of the variables at different times. the chi square test and fisher 's exact test the kruskal wallis test was used to compare the values obtained for vas and vps and sedation scores among the three groups. the statistical analysis was carried out using spss version 16 for windows software program (spss, chicago, il). consort flow of diagram of study of gabapentin and melatonin during retrobulbar eye block for cataract surgery one hundred thirty patients were recruited of whom ten were excluded from the study groups, due to logistical reasons or other factors violating the study protocol [figure 1 ]. there were no significant differences between the three groups with respect to the demographic properties (age, gender, body weight, height, and duration of surgery) [table 1 ]. the baseline characteristics such as hr and mean arterial pressure were similar in the three study groups [table 2 ]. figure 2 shows that the anxiety scores decreased significantly in melatonin and gabapentin groups compared to the placebo group after premedication. there were significant differences between gabapentin and placebo groups in anxiety scores after premedication (95% ci 2.5 to 3 ; p = 0.005), during retrobulbar block placement (95% ci 3 to 3.5 ; p = 0.000), intraoperatively (95% ci 1 to 1.5 ; p = 0.002), and postoperatively before discharge from the recovery room (95% ci 0.00 to 1 ; p = 0.002). also, there were significant differences between melatonin and placebo groups in anxiety scores after premedication (95% ci 2.5 to 3 ; p = 0.000), during retrobulbar block placement (95% ci 3 to 4 ; p = 0.000), intraoperatively (95% ci 1 to 1.5 ; p = 0.001), and postoperatively before discharge from the recovery room (95% ci 0.00 to 1 ; p = 0.006). the level of anxiety showed no statistically significant difference between melatonin and gabapentin groups after premedication (p = 0.423), during retrobulbar the block placement (p = 0.539), intraoperatively (p = 0.938), and postoperatively prior to discharge from recovery room (p = 0.559). there were significant differences between the pain scores during the rbb placement in gabapentin versus placebo (95% ci 3 to 4 ; p = 0.001) and melatonin (95% ci 3 to 4 ; p = 0.040) groups [figure 3 ]. the difference in pain scores during the rbb placement between melatonin and placebo (p = 0.207) groups was not significant. also, the difference in intraoperative pain scores in melatonin versus the placebo (p = 0.059) and gabapentin (p = 0.785) groups was insignificant. neither the intraoperative pain scores (p = 0.73), nor the postoperative pain scores (p = 0.333) were different between gabapentin and placebo groups [figure 3 ]. significant differences were observed between the sedation scores during the rbb placement in gabapentin and placebo groups (95% ci 2 to 2.5 ; p = 0.046) [figure 4 ]. the difference in sedation scores during the rbb placement in melatonin versus gabapentin (an evaluation of effect of melatonin and gabapentin on anxiety and pain in cataract surgery : characteristics of the enrolled patients (n = 120) comparison of intraoperative fentanyl consumption and operating condition scores in the three study groups verbal anxiety scores (vas) in the three study groups vas scores were expressed as median and error bars representing minimum and maximum values. p values are from kruskal wallis test verbal pain scores (vps) in the three study groups vps scores were expressed as median (interquartile range). p values are from kruskal wallis test comparison of the sedation scores in patients during retrobulbar block placement in the three study groups. the sedation scores was defined as 0 = movements of the head, arms, and trunk, 1= slight movement of arms, 2 = slight change in face, 3 = complete calmness. p value is from kruskal wallis test all patients within the three groups were able to recall the needle insertion. twelve patients in the placebo group needed fentanyl boluses whereas it was six in the melatonin and gabapentin groups ; there was no significant difference (p = 0.434) between the three groups [table 2 ]. comparison of hemodynamic consequences of rbb and surgery failed to reveal any statistically significant differences between the groups [table 3 ]. the difference between the highest mean arterial pressure and heart rate and the lowest mean arterial pressure and heart rate in each patient was compared between the study groups. the mean fluctuation of map in group g was 20.74 10.86, group m 21.25 17.55, and group p 18.96 9.94. the difference between group m versus g (p = 0.877) and p (p = 0.477) groups was not significant. similarly, the difference between group g and p (p = 0.448) was also insignificant. the mean fluctuation of hr in group g was 14.57 7.34, group m 15.82 10.42, and in group p it was 13.92 7.06. the difference between group m versus g (p = 0.537) and p (p = 0.343) was not significant. likewise, the difference between group g and p (p = 0.688) was also insignificant. the quality of operation conditions during the surgery in gabapentin versus placebo (p = 0.546) and melatonin (p = 0.546) groups was insignificant. no patient developed hypoxia, hypotension, bradycardia, excessive drowsiness (or sleepiness), nausea, and vomiting during the surgery. one patient in the melatonin group complained of mild headache and one in gabapentin group of severe dizziness while staying at the ward. hemodynamic variables measured in the three study groups receiving melatonin, gabapentin or placebo during retrobulbar eye block for cataract surgery the results of this study revealed that both anxiolytic drugs (melatonin and gabapentin) decreased the anxiety scores in the same manner. further, a single oral dose of gabapentin, given as preoperative medication, decreased the pain and this was associated with more sedation scores compared to placebo only during the retrobulbar block placement although the intraoperative and early postoperative pain scores were similar in the three study groups. our finding associated with the anxiolytic effect of melatonin and gabapentin is consistent with previous studies. melatonin produces considerable dose - dependent increases in gaba concentrations in the central nervous system. another important finding of our study was the ability of gabapentin in producing a statistically significant and clinically important improvement in the preoperative anxiety scores, a finding in agreement with previous studies. in several studies it was reported that gabapentin was effective in treating the anxiety associated with panic disorders. although several studies published previously have reported that the pain scores in the melatonin group were significantly lower than those in the control group, the present study did not demonstrate such a decrease in the pain scores by melatonin. the results of our study are consistent with two studies carried out by naguib. in which it was reported that there was no significant difference in the intraoperative use of opioid or total doses of analgesics consumption in the melatonin, midazolam, or placebo groups over 90 min after the end of anesthesia at postanesthesia care unit. in a systematic analysis of qualified clinical trials suggested that the analgesic effects of melatonin during the perioperative period were limited and that the results remained controversial. also, caumo. reported that the administration of combined melatonin clonidine as preoperative premedication decreased the postoperative morphine use by more than 30% in patients undergoing abdominal hysterectomy with moderate and severe anxiety whereas in mildly anxious patients, it was not associated with analgesic effect. the level of anxiety score in most of our patients was mild and therefore, it seems that melatonin had no effect on pain. in this study, a single oral dose of gabapentin given as preoperative medication reduced the pain and this was associated with more sedation scores only during the retrobulbar block placement compared to the placebo. these results are also in concurrence with several studies in which it was demonstrated that gabapentin is effective in reducing the pain scores and morphine consumption in the early postoperative period. mao. showed that pretreatment with gabapentin prevents the occurrence of hyperalgesia, suggesting a preventive effect of gabapentin which is compatible with our results in which the pain scores of patients during the retrobulbar placement in group g was lower compared to the placebo. gabapentin may produce analgesia by reducing the release of neurotransmitters from sensory neurons, via a calcium - dependent process. in this study, gabapentin was found to have higher analgesic effects than melatonin during the retrobulbar block placement. this difference, in addition to anxiolytic properties of gabapentin, may be mainly related to the direct analgesic effects of this drug. in our study, the pain scores of patients during intraoperative and early postoperative pain were similar in all three groups. the possible explanations for the difference found between our results and the previous studies may be related to either the low pain scores obtained for our patients due to performance of retrobulbar block in the three study groups or the difference in populations used in different studies. elderly are known to under - report their pain due to cognitive dysfunction and depression. we did not investigate the postoperative pain in these patients, which may be considered as a limitation of our study. declared that the incidence of sedation in patients who received gabapentin as preoperative medication was significantly high which is in accordance with our results. we chose to administer 6 mg of melatonin orally 90 min before the surgery in our study as the onset of melatonin - induced sedation is reported to appear approximately 30 min after the administration of this drug and that the melatonin concentration remains stable for approximately 1.5 h at its peak level. in addition, it seems that the doses of melatonin between 0.310 mg have similar hypnotic effectiveness. moreover, the reason for using a single dose of 600 mg gabapentin was based on the reports in which this concentration of the drug was the most commonly used dose of gabapentin in both acute and chronic pain studies. kong. in their systematic analysis claimed that gabapentin, as a potential multimodal perioperative drug, could be given 12 h before surgery. also, in a recent dose - response study, gabapentin at a dose of 600 mg was the optimal preemptive dose for reducing the postoperative pain, and that increasing the dose over 600 mg not only failed to enhance analgesia but also increased the risk of adverse effects. we thus empirically chose to use this single dose (600 mg) of gabapentin as a reasonable compromise between the efficacy and toxicity. in our study, the comparison of hemodynamic variables changes during the rbb placement and surgery did not reveal any statistically significant difference between the three groups. the gabapentin - treated (1600 mg) patients had significantly lower systolic and diastolic arterial pressure during the first 10 min after endotracheal intubation compared to placebo with no obvious effect on heart rate changes. also, in another study by memis. the administration of 800 mg of gabapentin to patients as premedication caused a significant reduction in mean arterial pressure and heart rate during the first 10 min after endotracheal intubation compared to 400 mg gabapentin or placebo. however kong. in a systematic analysis of qualified clinical trials suggested that these effects may be dose - dependent and the changes in heart rate are conflicting. in our study, we used gabapentin at a dose of 600 mg, which was lower than the dose used in those studies. regarding the hemodynamic effect of melatonin, ismail. found that map was considerably reduced after melatonin premedication although it was described this difference at some points was insignificant between the groups. it is concluded that pretreatment with either melatonin or gabapentin decreases the anxiety scores in a similar way. further, a single oral dose of gabapentin administered as preoperative medication decreases the pain and this is associated with more sedation scores compared with the placebo during the retrobulbar block. | objectives : to compare the effect of melatonin and gabapentin on anxiety, pain, sedation scores, and satisfaction of surgeon in patients of cataract surgery.materials and methods : one hundred thirty patients aged between 35 and 85 years scheduled for cataract surgery were randomly allocated to three study groups to receive melatonin (6 mg), gabapentin (600 mg) or placebo 90 min before arrival in the operating room. pain, anxiety, and sedation scores during block and surgery as well as the surgeon 's satisfaction with the surgery were assessed.results:anxiety scores decreased significantly in melatonin and gabapentin groups compared to the placebo group after premedication and extended to early postoperative period. the level of anxiety showed no statistically significant difference between melatonin and gabapentin groups at any time of measurement. there were significant differences between the pain scores during retrobulbar placement in gabapentin versus placebo (95% ci 3 to 4 ; p = 0.001) and melatonin (95% ci 3 to 4 ; p = 0.040) groups. also, there were significant differences between the sedation scores during retrobulbar placement in gabapentin and placebo groups (95% ci 2 to 2.5 ; p = 0.046). the difference in sedation scores during retrobulbar placement in melatonin versus gabapentin and placebo groups was not significant. neither the intraoperative pain scores nor the postoperative pain scores were different between the three groups. the surgeon reported similar quality of operation conditions during surgery for the three study groups.conclusion:the level of anxiety was significantly lower with both anxiolytic drugs compared to placebo. furthermore, gabapentin decreased the pain and improved the sedation scores only during retrobulbar placement compared to the placebo. |
this risk must also be considered for patients who are using these medications for off - label inflammatory skin conditions. we present the first patient with treatment - refractory sweet 's syndrome who developed disseminated nocardia brasilienses whilst on methylprednisolone and infliximab. a 62-year - old white male with a 10-year history of treatment - refractory sweet 's syndrome was admitted to the hospital with purpuric skin lesions. the patient had myelodysplastic disease that was under treatment with intravenous immunoglobulin (ivig) infusions, and also diabetes mellitus, peripheral neuropathy, chronic corticosteroid - induced adrenal suppression. as sweet 's syndrome proved refractory to dapsone, methotrexate, etanercept, lenalidomide, rituximab, cyclosporine, mycophenolate mofetil, and cyclophosphamide, methylprednisolone and infliximab infusions were administered. after the second infusion of infliximab, he presented with new purpuric, painful lesions, and subjective fever. on examination, a 6 cm indurated erythematous and purpuric plaque with overlying pustules was noted on the left flank of abdomen, with similar smaller plaques located distally over both lower extremities [figure 1 ]. subsequently, the patient developed pulmonary involvement and was diagnosed with disseminated nocardia infection. during the course of his prolonged hospitalization, trimethoprim sulfamethoxazole (tmp - smx), imipenem, minocycline, and amikacin were administered for nocardia infection. seven months later, after mistakenly receiving infliximab during a scheduled ivig infusion, the patient experienced a recurrence of nocardia infection with both cutaneous and systemic involvement. the patient was hospitalized for over 5 months in three separate hospitals and was transferred to our care with widely disseminated nocardia. multiple antibiotics were administered during his treatment, but the patient eventually succumbed to respiratory failure. indurated, erythematous, and purpuric plaque on the distal lower extremity branching, filamentous organism on gomori methenamine silver stain consistent with nocardia, 40 as more patients are being treated with immunosuppressive medications such as tnf- inhibitors, the rates of infectious complications, especially with atypical pathogens, are increasing. in the literature, most cases of tnf- inhibitor - related nocardia infections have been reported in patients with psoriasis, rheumatoid arthritis, or inflammatory bowel disease. however, patients being treated with tnf- inhibitors for off - label inflammatory skin disorders are also at risk. to our knowledge, this case represents the only nocardia infection reported in a patient being treated with a tnf- inhibitor for sweet 's syndrome. nocardia asteroides causes most cases of disseminated nocardiosis with skin involvement ; however, most cutaneous nocardiosis is caused by n. brasiliensis. clinically, cutaneous nocardiosis may present as nodules, pustules, ulcerative lesions, bullae, or abscesses. disseminated infection can occur rarely from primary cutaneous infection but more commonly causes secondary skin involvement. mortality rate for patients with central nervous system or disseminated nocardiosis has been estimated to be as high as 50%. culture is the gold - standard for diagnosis of nocardia, but it may also be identified on histologic evaluation as characteristic filamentous organisms. other antimicrobial agents that have been used successfully alone or in combination with tmp - smx include amikacin, imipenem, minocycline, tetracycline, dapsone, streptomycin, linezolid, cycloserine, amoxicillin several tnf- inhibitors, including infliximab, have been reported to be associated with nontuberculosis opportunistic infections, such as nocardia.467 it is hypothesized that infliximab 's high peak drug levels, high - affinity tnf- binding, as well as macrophage and t - cell death lead to more significant immunosuppression when compared with other tnf- inhibitors. a french ratio study demonstrated higher rates of opportunistic infection in patients on monoclonal - type tnf- inhibitors, such as infliximab, versus the soluble - type tnf inhibitor, etanercept. this study also found that one - third of these opportunistic infections were caused by bacterial pathogens, such as nocardia. infliximab binds both soluble and transmembrane tnf-, thereby inducing apoptosis of macrophages and t cells, which are essential for cell - mediated immunity. this impairment of cell - mediated immunity is implicated in the susceptibility to granulomatous infections, such as nocardiosis. in all patients on tnf- inhibitors, including patients being treated for inflammatory skin disorders, such as sweet 's syndrome, the slow - growing types of bacteria should be considered in the differential diagnosis when presenting with signs of cutaneous or systemic infection. cultures must be maintained for at least 23 weeks to detect the presence of such bacteria. it is important for dermatologists to adequately inform patients on tnf- inhibitors about the risk of opportunistic infections and to maintain a higher index of suspicion while culturing such patients. | a 62-year - old white man with a 10-year history of treatment - refractory sweet 's syndrome was admitted to the hospital with the onset of purpuric lesions. methylprednisolone and infliximab were administered. our patient developed disseminated nocardia infection and eventually succumbed. opportunistic infections such as nocardia have been associated with infliximab and other tumour necrosis factor (tnf)- inhibitors. the astute clinician should be aware of the risk of rare opportunistic infections, particularly in patients on tnf- inhibitors and systemic corticosteroids. |
atrial fibrillation is the most common heart arrhythmia affecting around 2.2 million people in the usa. depending on the ablation device used, it is carried out using either electroanatomic mapping systems, an x - ray guided approach, or a combination of both. x - ray guidance is, for example, required if a cryoballoon is used for ablation as current cryoballoons can not be directly located by electroanatomic mapping systems. in this paper, we focus on x - ray guided approaches. one weakness of x - ray imaging is poor soft - tissue contrast. as a consequence, the left atrium (la) however, to reduce the risk of contrast - induced nephropathy, physicians try to keep the use of ca to a minimum often highlighting only a part of the left atrium. to provide orientation to the physician when no ca is present, a model of the patient 's la, for example, generated by a preoperative ct or mri scan of the patient can be overlaid. the use of such an overlay was found to reduce procedure time and fluoroscopy time significantly. since a preprocedural 3d scan is often acquired to obtain prior knowledge about a patient 's anatomy of the left atrium and to rule out unusual pulmonary vein configurations, it is readily available for augmented fluoroscopy applications. in general, however, the coordinate systems of the preprocedurally acquired 3d heart model and the patient during the intervention differ, and a registration step is usually needed. today, this registration is usually carried out manually. if the 3d heart model was acquired using ct, several authors proposed to use further landmarks in addition to the la for registration having obtained associated 3d models by segmentation. examples are the carina, the coronary sinus (cs) [4, 5 ], the spine, or a combination of spine and heart anatomy. for 3d volumes acquired by mri, for example, mri angiographies (mras), however, a segmentation of the cs or the carina can be very challenging or has not yet been adopted for routine clinical procedures. fortunately, registration based on contrast injection has been shown to be a fast and accurate alternative. a good moment to obtain contrast - enhanced x - ray images is after the transseptal puncture, in particular if physicians use contrast injections to verify puncture success. example images of such injections are shown in figure 1 to illustrate the images available. since manual registration either needs the attention of the treating physician or requires a trained assistant, more automatic registration methods are desirable. there is a significant body of research on registration of 3d objects to 2d fluoroscopic images, for example, for bones [1012 ], implants, joints, or vessels., a registration of the la is more complicated for at least two reasons : first, for implants and bones, all parts of the object are visible. during a contrast injection, however, only a part of the left atrium may appear under x - ray. second, depending on the amount of ca injected, the overall la visibility may be poor. for example, in our case ep physicians use contrast at the beginning of the procedure to verify the success of the transseptal puncture. it may also be used later to enhance the anatomy, for example, to make sure that a catheter, for example, a circumferential mapping catheter or a cryoballoon catheter, was placed correctly. this is different to vessel angiography. in this case, higher amounts of contrast are injected to derive diagnostic information, for example, about a stenosis. for ablation procedures in the la, the ca density and so the visibility of the la under x - ray may be poorer as the small amount of contrast is injected into the high blood volume of the la. as a consequence, further effort is needed to develop robust registration methods that can also be applied if ca is used sparingly. currently, very few publications deal with registration based on contrast agent : in a first approach towards automatic la registration, thivierge - gaulin. tried to find a 3d pose of a model such that its projected shadow matches the contrasted area in a selected image, enhanced by digital subtraction angiography (dsa), best. however, if only a small amount of contrast agent is injected into a somewhat large chamber such as the left atrium, this approach will not lead to a distinct optimum, because the anatomy may not be fully opacified. based on ct images, a second approach by zhao. relied on digitally rendered radiographies (drrs) of the segmented left atrium. this approach uses a weighting scheme that puts the focus on the roof of the la. how well this method performs for injections into other areas of the la is still unclear. besides contrast - based registration, 3d data and 2d data can also be aligned using devices. a feature - based method by sra. uses a segmentation of the coronary sinus (cs) in a ct volume to register a 3d la model to a single 2d fluoroscopic image. a further approach by brost. uses a segmentation of the cs in an mri volume and a 3d reconstruction of the cs catheter from two fluoroscopic images. unfortunately, how well the cs can be extracted from a 3d mri data set depends very much on the mri scan protocol. furthermore, due to the strong motion of the cs, it is difficult to relate the position of the cs catheter to the position of the la, especially for patients having no sinus rhythm but heart arrhythmia [18, 19 ]. (2) contributions and outline of this work. at the beginning of section 2, we discuss the use of the normalized cross - correlation for registration of a 3d object to 2d x - ray projections based on extracted contrast agent. they require a segmented left atrium as input and can, in contrast to, accommodate both ct and mri data. the first method is described in section 2.2. here, we take explicitly apparent edges extracted from a 3d model and compare them to la edges present in the fluoroscopic images as proposed by [10, 11 ] for automatic registration of bones and by for manual registration of the la, respectively. although our method is conceptually similar to a drr generation followed by gradient correlation, this calculation can be carried out on a gpu much more quickly than a drr. the second contribution described in section 2.3 is the introduction of a novel similarity measure for biplane x - ray that is tailored to cases in which only parts of an object are visible. based on a 3d model of the la, our second method estimates the contrast agent distribution inside the 3d object from a simultaneously acquired pair of fluoroscopic images taken under two different view angles. then we evaluate how consistent the contrast agent distribution estimate (cade) is with the acquired fluoroscopic images. as the cade depends on the transformation used for registration, the transformation leading to the most plausible cade is used as final position estimate. we propose to treat the registration results for each frame of the sequence no longer as independent. based on our previous publication, we use a markov chain approach to exploit the temporal dependency between successive frames instead. in section 3, we evaluate a similarity measure based on the projected shadow which is close to the approach by thivierge - gaulin. and the two new methods as well as combinations of them. these sequences are acquired simultaneously from two different angles using a biplane system. for each plane, the projection matrix that describes the x - ray camera setup we denote the associated projection operator by pa and pb for the a - plane and the b - plane of the system, respectively. we also assume that a 3d model of the patient 's la is available, either as a triangle mesh or as a binary volume, as they can be converted into each other. the contrasted area is found based on a difference image (dsa) idsa = iu ic, i involving a frame ic that contains contrast agent and an uncontrasted frame iu. to distinguish between contrasted and uncontrasted frames, either manual annotation or a learning based method can be used, for example, the method described in. depending on the chosen contrasted frame ic, idsa may contain artifacts, for example, due to motion of the diaphragm or from catheters, if they are at different positions in iu and ic. such motion artifacts depend, unlike the information about contrast agent, to a large degree on the choice of iu. for example, if the catheters in iu are at the same position as in ic, their intensities cancel out. otherwise, idsa has high positive values at the position of the catheter in ic and high negative values at the position of the catheter in iu. to keep motion artifacts to a minimum, we propose a best reference selection, which chooses an appropriate reference frame iu^ that matches the chosen contrasted frame ic as much as possible. out of all uncontrasted frames, that frame iu^ is selected which minimizes the l1-norm of the resulting dsa image:(1)iu^=arg miniux=0n y=0miux, yicx, y.by following (1), we get frames for which the catheters and the diaphragm cancel out as much as possible. see figure 3(b) for an example. in idsa, only pixels with positive values contain contrast agent. to extract them afterwards, we compute a filtered image if by applying a median filter with a large kernel size. smaller structures, for example, caused by motion artifacts that remained despite the optimized choice of iu, do not pass this filter, and the noise in the contrasted area is reduced as well. finally, a binary image ithr of the filtered image if is computed using a threshold at f + f, where f and f denote the mean and standard deviation of if, respectively. thus, a contrasted pixel p is indicated by ithr(p) = 1. a previous approach tried to find a transformation t of the 3d model such that the projected shadows st, st of the model into the a - plane and the b - plane of a biplane c - arm system fit best to the contrasted region. using the normalized cross - correlation (ncc), denoted as n, of two images i1, i2 with corresponding mean values 1, 2 and standard deviations 1, 2(2)ni1,i2=x=0n y=0mi1x, y1i2x, y212,the similarity of the projected shadow and idsa can be measured. instead of idsa, one can also use the binary version of it, that is, ithr. then a registration transformation can be estimated by maximizing either one of the two functions(3)shaddsaidsaa, idsab, t=nidsaa, stanidsab, stb,shadthrithra, ithrb, t=nithra, stanithrb, stb. unfortunately, a registration approach only based on contrasted area has multiple solutions if the amount of ca is so little that it does not completely fill the la ; see figure 2. this results in perceivable edges of the contrasted area which can then be used as registration features. edge - based registration can be carried out using only the silhouette boundary of the projected object (see figure 2) or all apparent edges [10, 11 ] (see figure 3(f)). we decided to consider all apparent edges to improve robustness against injections of small amounts of ca, as the silhouette - based approach requires that the la is contrasted in its entirety. for a partially contrasted left atrium, internal contours may, however, also appear in the fluoroscopic images. this was already found to be beneficial for manual la registration. instead of considering edges implicitly by comparing the dsa image to a drr using gradient correlation, we computed them explicitly. to extract edges in the fluoroscopic images, we used the filtered image if. after applying a median filter they, however, correspond rarely to anatomical structures and would trigger a response, if an edge filter was applied. to obtain an edge response only at the boundaries of the contrasted area, the image needs to be homogenized before applying an edge filter. using a simple threshold method would result in a loss of the intensity drop - off at the boundary which provides important information about the edge intensity. therefore, we weigh all image pixels by a sigmoid function(4)isigx, y=11+eifx, y+ts.the value of t is set to f f, and the parameter s depends on the pixel intensity range of the input image. finally, isig is filtered using a derivative of gaussian (dog) filter to obtain the edge image idog. the kernel size of the dog filter is set to a large value to get a smooth similarity measure ; see figure 3(e). the projection of the 3d triangle mesh edges into 2d is done differently than in [10, 20 ]. we rendered the whole surface mesh and, depending on the viewing direction d and the surface normal n at a point, we set the opacity o of projected triangles to o = 1 |(dn)| ; see figure 3(f) for an example. by doing so, areas that are parallel to the imaging plane are rendered transparent while areas with a normal vector orthogonal to the viewing direction are rendered opaque. the similarity between edges extracted from the fluoroscopic images and the edge images et, et rendered from the 3d model transformed by t is measured by(5)edgeidoga, idogb, t=nidoga, etanidogb, etb. previous approaches [16, 17 ] for la registration searched for a rigid transformation of the la such that either its projected shadow or its drr fit to the contrasted area in both fluoroscopic images. 3d information was taken into account insofar as the resulting projections came from the same 3d position of the model. however, such an approach does not necessarily guarantee that corresponding objects in both fluoroscopic images are matched to the same 3d structure of the la. more precisely, the registration result could be such that, in plane a, the contrast agent is located in a left pulmonary vein (pv) whereas, in plane b, the contrasted area corresponds to a right pv. this is possible as for a given 2d registration in one plane the 2d registration in the other plane has one degree of freedom, which corresponds to an out - of - plane motion in the first plane. an illustration of this problem can be found in figure 4. to solve this problem, we compute for a given transformation t a cade inside the la using binary reconstruction. then, t is optimized such that the contrast agent distribution estimate is most consistent with the projection images. more precisely, a voxel v is estimated as contrasted if it satisfies all of the following conditions : (a) the voxel v transformed by t is projected on a contrasted pixel in plane a, (b) v is projected on a contrasted pixel in plane b, and (c) v is part of the left atrium (as contrast agent can only be found inside the la). to compute the cade, we define the indicator function(6)v=1vr3 is inside the left atrium.given the binary images ithr and ithr with corresponding projection operators pa, pb and the indicator function (v), the cade ct for a transformed voxel, t(v), can be computed as(7)ct3dv = ithrapatvithrbpbtvvfor a given rigid transformation t. this product is the mathematical equivalent of the three conditions introduced above. if t is chosen suboptimally, the resulting 3d cade will be inconsistent with the ca observed in the 2d images. that is, a pixel in the 2d image is contrasted but no corresponding voxel along its projection ray is estimated as contrasted. this can be due to the following reasons as shown in figure 5 : (a) the projection ray from a contrasted pixel does not intersect the left atrium as the la has not been placed at the proper position yet ; (b) the projection ray hits the la, but all voxels intersected by this ray can not contain ca because their corresponding pixels in the other plane are uncontrasted. additional inconsistencies are introduced by pixels which are erroneously labeled as contrasted, for example, due to motion artifacts. to verify the validity of the cade, we compute binary 2d images ct, ct by forward projecting all contrasted voxels in ct using pa, pb. we assess the consistency of the cade for the given transformation t by computing the similarity between the fluoroscopic images and the projected cade by(8)cadeithra, ithrb, t=nithra, ctanithrb, ctb. the set of potentially contrasted voxels is defined by the intersection of the projection ray bundles of all contrasted pixels from views a and b, respectively. maximizing the number of contrasted voxels would lead to a transformation such that as much as possible of this set is contained inside the la. if, for example, a pulmonary vein was filled with ca, the transformation would be chosen such that the set of possible contrasted pixels was located in the main body of the la which provides the most space to include most possibly contrasted voxels ; see figure 6. to avoid this registration bias towards large structures inside the la, we decided to optimize the consistency to the 2d images. to exploit dependencies between successive frames of a sequence, we model the position of the la model in 3d as a time - dependent continuous markov chain of the first order as proposed by us previously. the states are transformations, that is, a translation and a rotation of the model. the parameter i denotes the actual transformation of the la in the ith contrasted frame, ti refers to the estimate of the transformation for the ith frame, and p(i = ti) is the probability that for frame i the transformation ti is observed. for convenience the transition probability from one state into another is independent of the frame number i. it is denoted as p(ti ti+1). finally, a sequence of transformations t1,, tn is to be determined such that the term(9)pt1,,tn = pt1t=2nptt1ttpttis maximized. transition probabilities and state probabilities control the filtering differently : due to the transition probabilities, small motions of the la from a frame to its next frame are preferred. the state probability determines the impact of the averaging, that is, how much the registration result is changed by the filtering. we will model the state probability based on a confidence measure such that frames with high - confidence registration results are less subject to temporal filtering. if the confidence value is low, that is, the estimated error of the registration result is higher, we want to rely more on the results of the previous and next frame. the contrast agent visible in frame i determines the probability of the la for being transformed by ti in this frame. if the dependency on other frames is ignored, the most probable transformation ti is the transformation obtained by optimizing the similarity measures defined in (3), (5), and (8) or a combination of them. the similarity measure (i, i, ti) depends on the contents of images i, i. zhao. suggested using the value (i, i, ti) as a confidence measure : from all n registration results the frame i where (i, i, ti) is maximum should be selected as registration result for the complete sequence. the value of can therefore be used as a confidence measure. by linear regression, a function e((i, i, ti)) can be determined to estimate the error based on the value of. with the transformation ti of the la found during optimization for frame i, the probability p(ti) can be modelled as normal distribution(10)pti = nti;ti,i.the confidence range is incorporated by setting the covariance matrix i to 1 e((i, i, ti)). the transition probability p(tt1 tt) states how likely a movement of the la is from frame t 1 to t. over multiple breathing cycles, the la moves about a mean position. the larger the change in translation and rotation is, the less likely the transformation transition is. to account for different frame rates, we consider the translational and rotational velocity v which comprises three translational velocities and three rotational velocities. in a training step, the covariance matrix v of the velocities gives an estimate for how likely a transition from one transformation to the next is. we model the probability of a transition tt1 tt as a normal distribution(11)ptt1tt = ntttt1r;0,v.besides the frame rate r, the transition probability depends also on the current breathing phase. compared to breathing motion, cardiac motion can be neglected as it rather deforms the la. if information on the breathing phase can be estimated, superior motion should be, for example, more likely during the inhale phase. during exhalation phase, inferior motion should have a higher probability. to account for breathing motion, for example, the mean value and the covariance matrix could be estimated separately for each stage of the breathing cycle. the most likely state sequence,(12)t1,,tn=arg maxti,,tn pti,,tn, can be found using a log - likelihood method : by applying the logarithm to (9), we get (13)t1,,tn=arg maxt1tn12t1t1t11t1t1+i=2ntititi1titi+rtitxi1tv1titi1r.this convex optimization problem can be solved using the bfgs method. we retrospectively evaluated our method on 21 clinical biplane x - ray sequences from 10 different patients. all of the patients provided their informed consent for the analysis of their clinical data. for all patients, a segmentation of their left atrium from a preoperatively acquired mri scan was available as a triangle mesh. the data set comprised 11 sequences showing an initial contrast agent injection where 15 ml ca was injected into the la center through a sheath to verify the success of the transseptal puncture. there were 10 more sequences showing subsequent injections to verify catheter placement. in these cases, all x - ray angiography sequences were acquired during normal breathing using a standard acquisition protocol. the first contrasted frame was determined manually. for 129 frames, reference registrations performed by three clinical experts were available ; for the remaining four frames registrations performed by two clinical experts were available. reference 3d registrations were established by manually shifting the mesh in each of two orthogonal views. the resulting 3d translation was refined this way until a good match to the associated contrast distributions as seen in the two 2d x - ray projections had been found. these reference registrations covered only 3d translation for the following reasons : first, patients were positioned head first, supine, during both preoperative and intraoperative imaging. furthermore, given the small amounts of contrast injected in our cases, the remaining small rotations were very difficult to detect. as initialization for optimization, the 3d model was placed at that 3d position which corresponded to the centers of both 2d images. in some cases, the initialization was more than 30 mm away from the correct solution and beyond the capture range for gradient - based methods. therefore we applied an octree - like coarse - to - fine scheme where we evaluated several positions at a coarse resolution. at positions in space that yielded a good similarity value, we performed subsequent evaluations at an increasingly finer resolution. the 3d translation t^=arg maxt(t) found by the optimization process of the respective objective function was compared to the mean translation vector t of the three manual registration results. the significance of the results was measured using a wilcoxon signed - rank test and a significance level of p = 0.05. all sequences contained 12-bit images of size 1024 1024 pixels ; all image processing, including rendering from the 3d model, was performed on the full image size. the kernel size for median filter was 30 pixels ; the value s of (4) was 0.1. in the evaluation, we compared the similarity measures shad, shad, cade, and edge and the combined similarity measures shad + edge, shad + edge, and cade + edge. we investigated different weightings. giving both terms equal weights, that is, setting = 1, turned out to be a good choice. we did two types of evaluation : an evaluation on all frames and an evaluation using only a single frame of each sequence, namely, the one which provides the best similarity measure. we computed a registration for each contrasted frame and compared the result to the manual registration of the physicians. these results are clinically relevant if the physician requires a registration for a desired frame of his choice, for example, depending on the breathing phase. as potentially every frame the overall accuracy is also of importance if the results are postprocessed by temporal filtering. the overall interuser variability observed in the manual registrations was 3.2 2.3 mm. considering all sequences, cade performed significantly better than shad, shad, and the state - of - the - art method by thivierge - gaulin.. although edge gave significantly worse results than all other measures, a combination with edge could improve the results of shad and shad significantly. for subsequent injections, cade + edge performed significantly better than shad, shad, their respective combinations with edge, and the method by thivierge - gaulin.. for shad + edge and cade + edge, the error distribution for each sequence is shown in figure 8, first for all initial injections and then for subsequent injections. in figure 9, the error distribution is given for each frame number as counted after the ca injection. figure 8 indicates that many sequences have at least one frame with a registration error of less than 5 mm. in fact, there exists such a frame for over 75% of all sequences when using shad or shad and for over 85% of the sequences when using cade, shad + edge, shad + edge, or cade + edge. proposed to automatically find a good frame in each sequence and consider only these single good frames for evaluation. in other words, from all frames of a sequence, a single frame was automatically chosen for registration. from a clinical point of view, this would, however, only make sense if the physician accepted an automatically selected frame for registration or if further motion compensation steps for the other frames were done, for example, using device tracking. suggested selecting this single frame as follows : for each frame i [1, m ] out of the m contrasted frames, the transform ti that maximizes the similarity measure for this frame is computed. in a second step, going through all frames of a sequence, the frame with the highest overall similarity measure is picked. the error to the average manual registration result ti is then computed as(14)t^iti2with t^i = arg maxi ia, i, ib, i, ti, ti = arg maxt ia, i, ib, i, t. the evaluation results are presented in table 2. recalling section 3.1, where we found that the cade method yielded good results for all frames, the cade performance for a single frame was, however, not that good. this is why we investigated if a different single - frame selection strategy would lead to better results. instead of using cade both for translation estimation and for best - frame selection, we used cade only for estimating the translation ti for each frame i. among the obtained translations ti, we selected the frame i with the corresponding translation t^i such that shad was maximized. so (14) was modified to(15)t^iti2with t^i = arg maxi shadthrithra, i, ithrb, i, ti, ti = arg maxt cadeithra, i, ithrb, i, t.the results of this frame selection method are denoted by cadeshad. although only 10 sequences were available for initial contrast injections, shad, shad + edge, and (cade + edge)(shad + edge) gave significant better results when compared to shad. also the performance of edge our proposed method cadeshad and the corresponding combination with edge outperformed the method by thivierge - gaulin. the error estimate function e(()) and the transition probability covariance matrix v were trained in a leave - one - patient - out cross - validation. the results for the temporal filtered frames are given in table 3. for a combination of the cade and edge similarity measure, markov filtering reduced the mean error to 5.7 4.6 mm for initial injections and 6.6 3.6 mm for subsequent injections. the results obtained by the markov filtering were in all cases significantly better than the results without filtering. the image preprocessing took 0.5 s on an intel xeon e3 with 3.4 ghz and 16 gb ram. the evaluations of the similarity measures were performed completely on the gpu. on an nvidia geforce gtx 660 the evaluation of shad, shad, or edge took 1.8 ms for a given translation and 13.4 3.7 ms for cade. the whole registration for a single frame took 2.9 s for shad or shad and 21.5 5.9 s for cade. for a combination with edge it took 5.8 s and 27.1 5.9 s, respectively. our novel cade - based method outperformed the shadow based similarity measures shad and shad, especially for reregistration sequences where only a small amount of contrast agent was used. the problem with nondistinct optima for shadow based similarity measures which was already sketched in figure 2 becomes also apparent in the sections of the optimization function in figure 10 for shad : for a small amount of contrast agent like in figure 10(a), the optimum is not at the position of the ground truth, but about 15 mm off. also for secondary injections into small structures such as the pulmonary veins, the objective function for shad in figure 10(c) has a large plateau. in both cases, cade is more distinct, although clear extrema as for bones are not obtained. especially for secondary injections where ca was often injected into pulmonary veins, registration errors leading to inconsistent results the improvement by cade was less as inconsistencies played only a minor role and the shape of the contrasted region in the image was more similar to the projected shadow of the left atrium. this becomes also apparent in figure 10(b) where the shapes of the objective function of shad and cade look very similar. we found that the similarity measure using explicit apparent edges, edge, yielded poor results when used on its own. a possible reason is that the objective function of edge has several local optima and also the global optimum does not necessarily correspond to the ground - truth position. it often has a more distinct local optimum at the position of the ground truth that facilitates fine registration. this is important as the other similarity measures define a rather plateau - shaped optimal region. figure 9 shows that the accuracy of the registration depends on when the frame was recorded after contrast agent injection. this was in many cases the frame before the ejection into the ventricle ; that is, it contains the most contrast agent. especially for the first frames, where only little ca was present, registration accuracy was lower the first frame is an exception, as it has a lower mean error than the second frame. this is probably because the previous frame, that is, the last uncontrasted frame, is used as mask frame for dsa computation which leads to low motion artifacts and a better extraction of the contrasted region. we found that, for our registration to work best, a well opacified frame should be selected from the sequence. this strategy was evaluated in the context of the single - frame evaluation by selecting the frame which had the best objective function value. for methods like shad and shad, which are based on the projection shadow, the measure cade, however, is not related to the amount of contrast agent, but it depends on consistency. when relying on cade for best - frame selection, we get the frame yielding the most consistent registration. this is, however, not necessarily the frame with the most contrast agent. and it is usually the frame with the most contrast agent which provides the most information for registration. we believe that this is the reason why the errors in table 2 for cade are higher. if, however, from the translations estimated by cade + edge, the single frame was selected based on shad + edge, better results were achieved as now again the frames with the most contrast agent were selected. sometimes, the automatic best - frame selection does not provide a frame with a satisfactory result. still, 85% of all sequences contain at least one frame that is below a clinical relevant threshold of 5 mm [27, 28 ]. to benefit from the fact that at least one frame with a good registration result is likely to be found, the frame selection could be performed manually by stepping through the frames and the associated registration results. although this implementation still involves user input, the required user interaction is less than for fully manual registration. for the remaining 15% of the cases or if higher accuracy level, for example, 3 mm, is required, small manual adjustment may be necessary in these cases. particularly high errors for frames at the beginning or at the end of the contrast injection were reduced. if a registration is not desired for an arbitrary frame but rather for a frame determined by the physician, for example, based on the breathing phase, temporal filtering should be applied. it is notable that the runtime for cade was considerably higher compared to, for example, shad. this is because the contrast agent distribution needs to be updated in each iteration before projecting it. although the fast runtime of, for example, shad will remain out of reach, we are confident that the runtime for cade could be reduced to a clinically acceptable level. in general, the performance for initial registration was better, as the amount of contrast agent was higher and fewer catheter artifacts were present. we found by visual inspection that also the amount of breathing motion had an impact on the registration accuracy as it caused motion artifacts in the dsa computation. as a consequence, if the patient was not anesthetized, acquisition of the ca injection should be performed under breath - hold or shallow breathing. for cases with intubation, also jet ventilation or a small period of apnea could be applied to reduce breathing motion. since our data was not acquired using a dedicated dsa program, the different brightness levels within a sequence changed. although intuitively appealing, our data did not allow us to make a statement if the registration accuracy depends on the part of the la in which ca was injected. for initial contrast injections, an average accuracy of 4.6 4.0 mm and a median error of 3.7 mm could be achieved using cade + edge together with the best - frame selection approach. this error is in the range of the interuser variability of 3.2 2.3 mm. the faster registration method using shad + edge reached an accuracy of 4.8 4.6 mm. these numbers are also similar to the accuracy reported when performing manual registration based on segmentations of the cs, the whole heart, and the spine or a segmentation of the cs when 3d and 2d data are in the same breathing and cardiac phase which was achieved by ventilation and rapid pacing of anesthetized patients. however, our method does not require structures other than the la to be segmented and requires no anesthesia. compared to a registration based on the cs alone, the error was reduced by over 50%. the average accuracy for all frames after applying temporal filtering is 5.7 mm for cade + edge and 6.1 mm for shad + edge. though the results of cade + edge are close to the 5 mm threshold [27, 28 ], it remains open if this is sufficient for a clinical application, but we believe that these results should at least provide users with an acceptable initial estimate for further manual adjustments. by now, the performance of this approach to contrast - based registration of the right atrium should be evaluated. a registration based on the right atrium would also provide a registration for the la which is available for transseptal puncture or one of the ventricles could be assessed. due to the lack of pulmonary veins and arteries, the ventricles have a more simple anatomical structure but are subject to stronger cardiac motion. compared to the approach by zhao., the use of special weights for different heart regions is not needed for any of the proposed approaches. in addition, for shad + edge, a time - consuming drr generation can be avoided. as a result, a registration approach based on a combination of shadow and edge features can be computed fast. if sufficient computational power was available, the novel cade - based measure, which takes consistency into account, should be used as it improves results significantly, especially when very small amounts of contrast agent are injected. | for augmented fluoroscopy during cardiac ablation, a preoperatively acquired 3d model of a patient 's left atrium (la) can be registered to x - ray images recorded during a contrast agent (ca) injection. an automatic registration method that works also for small amounts of ca is desired. we propose two similarity measures : the first focuses on edges of the patient anatomy. the second computes a contrast agent distribution estimate (cade) inside the 3d model and rates its consistency with the ca as seen in biplane fluoroscopic images. moreover, temporal filtering on the obtained registration results of a sequence is applied using a markov chain framework. evaluation was performed on 11 well - contrasted clinical angiographic sequences and 10 additional sequences with less ca. for well - contrasted sequences, the error for all 73 frames was 7.9 6.3 mm and it dropped to 4.6 4.0 mm when registering to an automatically selected, well enhanced frame in each sequence. temporal filtering reduced the error for all frames from 7.9 6.3 mm to 5.7 4.6 mm. the error was typically higher if less ca was used. a combination of both similarity measures outperforms a previously proposed similarity measure. the mean accuracy for well contrasted sequences is in the range of other proposed manual registration methods. |
inguinal herniorrhaphy is one of the most common elective procedures performed worldwide. in the united states, an estimated 800,000 inguinal hernia repairs are performed each year, accounting for 10% to 15% of all surgical procedures. however, there continues to remain controversy surrounding the optimal surgical management of this condition. several studies have validated the clinical utility of laparoscopic inguinal herniorrhaphy and have demonstrated comparable short - term safety and long - term efficacy relative to the open approach. given increasing fiscal constraints, procedural cost - effectiveness has become an important metric in evaluating surgical procedures. although several studies have demonstrated higher costs associated with laparoscopic inguinal herniorrhaphy, others have successfully reported cost - containment strategies in laparoscopic surgery. given that elective inguinal hernia repairs are most often ambulatory procedures, the direct operating room (or) expense predominates as the driving factor in the total cost of care. therefore, the objective of this study was to compare the or and total hospital costs associated with laparoscopic versus open inguinal herniorrhaphy performed at a publicly funded, tertiary academic institution. using a prospectively maintained database, all patients undergoing elective open or laparoscopic inguinal hernia repair between april 2009 and march 2011 at the toronto western hospital, university health network, were identified. open inguinal herniorrhaphy was performed using a standardized lichtenstein repair with either a polypropylene or a polyester mesh. a retrospective review of electronic patient records was performed, along with a standardized case - costing analysis using data from the ontario case costing initiative. laparoscopic mesh repair varied by surgeon preference between a standardized transabdominal preperitoneal (tapp) and a total extraperitoneal (tep) approach. as part of a local cost - awareness strategy, permanent trocars are preferentially used. monetary values are shown in canadian dollars and were converted to 2012 values using consumer price index inflationary adjustments. secondary outcomes included perioperative complications, 30-day hospital readmission, and 30-day emergency department visits. short - term perioperative complications included early recurrence, surgical site infection, seroma and hematoma formation, and urinary retention. statistical analysis was conducted using spss version 21 (spss, inc, chicago, illinois). continuous variables are expressed as means or medians and were compared using t tests, analysis of variance, or mann - whitney u tests as appropriate. categorical variables are expressed as proportions and were compared using either or fisher exact tests. the university health network case costing department (ccd) is responsible for capturing costs ascribed to each patient 's hospital visit. the university health network subsequently reports this information at regular intervals to ensure fiscal responsibility and fiduciary control. the total cost of care is recorded under the patient 's unique medical record number and a specific hospital visit number. the total cost per patient visit (from preadmission to discharge) is an aggregate of individual departmental costs ; for the purposes of this study, departmental costing centers were grouped as appropriate and termed hospital departments. specific visit numbers relating to patients undergoing elective inguinal herniorrhaphy were used to retrieve costing information from the ccd., total direct cost is calculated on the basis of the consumption of resources, including supplies, medications, investigations, food, and lodging expense. each or has a computerized dispensing cabinet that itemizes supplies used during each case and allocates cost to a specific patient procedure (pyxis procedurestation system ; cardinal health, dublin, ohio). all pharmaceuticals throughout the hospital are dispensed by a similar system (pyxis medstation system ; cardinal health). personnel cost data were based on budgetary statements provided by individual hospital departments to the ccd. personnel cost includes the wages (compensation and benefits) of the nursing, paramedical, and administrative staffs. approach by dividing total costs by the number of patients admitted on any given day. these costs are subsequently reported in the ccd figures as the indirect costs associated with specific hospital visits. additional overhead expenses, such as heating costs, are derived by dividing total costs by ward square footage and the number of admitted patients. equipment (including maintenance), facilities, and other global expenses (including information technology infrastructure) were included in departmental budgets. physician fees are separately reimbursed by the ontario ministry of health and were not recorded in this study. furthermore, postdischarge care, follow - up, readmission, and potential loss of income were not included in this analysis. all costs were adjusted for inflation to 2012 canadian dollars according to the bank of canada 's inflation calculator. the university health network case costing department (ccd) is responsible for capturing costs ascribed to each patient 's hospital visit. the university health network subsequently reports this information at regular intervals to ensure fiscal responsibility and fiduciary control. the total cost of care is recorded under the patient 's unique medical record number and a specific hospital visit number. the total cost per patient visit (from preadmission to discharge) is an aggregate of individual departmental costs ; for the purposes of this study, departmental costing centers were grouped as appropriate and termed hospital departments. specific visit numbers relating to patients undergoing elective inguinal herniorrhaphy were used to retrieve costing information from the ccd., total direct cost is calculated on the basis of the consumption of resources, including supplies, medications, investigations, food, and lodging expense. each or has a computerized dispensing cabinet that itemizes supplies used during each case and allocates cost to a specific patient procedure (pyxis procedurestation system ; cardinal health, dublin, ohio). all pharmaceuticals throughout the hospital are dispensed by a similar system (pyxis medstation system ; cardinal health). personnel cost data were based on budgetary statements provided by individual hospital departments to the ccd. personnel cost includes the wages (compensation and benefits) of the nursing, paramedical, and administrative staffs. approach by dividing total costs by the number of patients admitted on any given day. these costs are subsequently reported in the ccd figures as the indirect costs associated with specific hospital visits. additional overhead expenses, such as heating costs, are derived by dividing total costs by ward square footage and the number of admitted patients. equipment (including maintenance), facilities, and other global expenses (including information technology infrastructure) were included in departmental budgets. physician fees are separately reimbursed by the ontario ministry of health and were not recorded in this study. furthermore, postdischarge care, follow - up, readmission, and potential loss of income were not included in this analysis. all costs were adjusted for inflation to 2012 canadian dollars according to the bank of canada 's inflation calculator. one hundred twenty - six patients (51.6%) underwent open inguinal herniorrhaphy, while 118 (48.4%) underwent laparoscopic repair. among the laparoscopic cases, 94 patients (79.7%) underwent tapp repair, while 24 (20.3%) were treated using the tep technique. patients undergoing laparoscopic hernia repair were younger (mean age, 55 vs 66 years ; p <.001) and had lower american society of anesthesiologists classes (p <.001). a significantly higher proportion of patients undergoing open surgical repair had histories of abdominal surgery (67.5% vs 46.6%, p <.001). bilateral inguinal hernia repair was preferentially performed using a laparoscopic approach (72.7% vs 27.3%, p =.002), and all hernias diagnosed as bilateral had both sides operated during the same procedure. all laparoscopic inguinal herniorrhaphies were performed under general anesthesia, compared with 42.9% of open cases. twenty - three patients undergoing open inguinal herniorrhaphy required postoperative admission, compared with 2 patients in the laparoscopic cohort (p =.025). one case was converted from laparoscopic (tapp technique) to open repair because of significant small bowel adhesions. during the study period patients in the laparoscopic group had a longer median or time of 101 minutes compared with 84 minutes for open repairs (p <.001). total hospital costs (from preadmission to discharge) for open unilateral inguinal herniorrhaphy were significantly lower than for the laparoscopic approach (median total cost, $ 3207.15 and $ 3723.66, respectively ; p <.001). this difference in total costs was driven primarily by the or costs associated with the laparoscopic approach (median or cost, $ 2399.49 and $ 3092.03, respectively ; p < total hospital costs for repair of elective bilateral inguinal hernias were similar between the open and laparoscopic approaches (median total hospital cost, $ 4574.02 vs $ 4662.89 ; p =.827) (table 4). cost for unilateral inguinal herniorrhaphy iqr, interquartile range ; or, operating room ; pacu, postanesthesia care unit. cost for bilateral inguinal herniorrhaphy iqr, interquartile range ; or, operating room ; pacu, postanesthesia care unit. when comparing unilateral and bilateral hernia repair within the laparoscopic cohort, there was no statistical difference in the cost (either or or total episode of care) between the tapp and tep techniques. further to the operative approach, the use of general anesthesia was associated with an increased cost compared with other types of anesthesia (local or regional) (p <.0001). in this study, we systematically reviewed the or and total hospital costs involved with the treatment of inguinal hernias and, specifically, compared the costs associated with an open versus a laparoscopic approach. our results demonstrate that or and total hospital costs for open unilateral inguinal hernia repair were significantly lower than for the laparoscopic approach. however, or and total hospital costs for repair of bilateral inguinal hernias were similar between the 2 groups. the results of this analysis are comparable with those from other centers in the united states. khajanchee showed a $ 795 incremental cost associated with the tep approach relative to an open lichtenstein repair. similarly, schneider found the total cost of laparoscopic herniorrhaphy to be higher than for the open approach ($ 2,861 vs $ 2,009). combined with the current analysis, these studies suggest that the total cost of each procedure may be independent of local economic factors and may be directly attributable to surgical technique. however, the perioperative benefits of laparoscopy are significant. several studies have demonstrated enhanced recovery after surgery, shorter lengths of stay, and fewer perioperative complications associated with a minimally invasive approach. as such, the incremental value associated with laparoscopic repairs of unilateral hernias may justify the increased relative cost ($ 453.51). further studies using hernia - specific outcomes are necessary to understand the economic utility and cost - effectiveness of each approach. in addition, the calculation of total hospital cost does not address the out - of - hospital expenses incurred by the patients. furthermore, the indirect and societal costs associated with patient suffering, loss of productivity, and caregiver expense are difficult to quantify. further studies are needed to evaluate the total societal cost associated with inguinal hernia repairs to determine the cost - effectiveness of each strategy. a methodological limitation in the cost analysis is related to the institutional segmentation of expenses. or costs are clustered as an aggregate of all expenses incurred in the or. as such, with the current accounting system, it is difficult to distill the material contribution of operative time, general anesthesia, or equipment costs to the total expense. a refined case - costing system may provide additional insight into each component of patient care and highlight opportunities for efficiency. in the setting of a canadian tertiary academic hospital, the or and total hospital costs of open inguinal herniorrhaphy were significantly lower than for the laparoscopic approach. however, there was no statistical difference between or and total hospital costs when comparing open surgical and laparoscopic techniques for repair of bilateral inguinal hernias. given the perioperative benefits of laparoscopic surgery, further studies incorporating hernia - specific outcomes are necessary to determine the cost - effectiveness of each approach and to define the optimal treatment strategy. | purpose : the purpose of this study was to compare the total hospital costs associated with elective laparoscopic and open inguinal herniorrhaphy.methods:a prospectively maintained database was used to identify patients who underwent elective inguinal herniorrhaphy from april 2009 to march 2011. a retrospective review of electronic patient records was performed along with a standardized case - costing analysis using data from the ontario case costing initiative. the main outcomes were operating room (or) and total hospital costs.results:two hundred eleven patients underwent elective unilateral inguinal herniorrhaphy (117 open and 94 laparoscopic), and 33 patients underwent elective bilateral inguinal herniorrhaphy (9 open and 24 laparoscopic). or and total hospital costs for open unilateral inguinal hernia repair were significantly lower than for the laparoscopic approach (median total cost, $ 3207.15 vs $ 3723.66 ; p <.001). or and total hospital costs for repair of elective bilateral inguinal hernias were similar between the open and laparoscopic approaches (median total cost, $ 4574.02 vs $ 4662.89 ; p =.827).conclusions : in the setting of a canadian academic hospital, when considering the repair of an elective unilateral inguinal hernia, the or and total hospital costs of open surgery were significantly lower than for the laparoscopic techniques. there was no statistical difference between or and total hospital costs when comparing open surgery and laparoscopic techniques for the repair of bilateral inguinal hernias. given the perioperative benefits of laparoscopy, further studies incorporating hernia - specific outcomes are necessary to determine the cost - effectiveness of each approach and to define the optimal treatment strategy. |
surgical resection of lm is the only potentially curative modality, but it is possible in less than 20 percent of patients. majority of patients are not suitable for surgical resection due to various clinical and technical reasons. for such patients, various non - surgical options are three dimensional conformal radiation therapy (3d - crt), stereotactic body radiation therapy (sbrt), transarterial chemoembolization (tace), and various thermo - ablative procedures like radiofrequency ablation (rfa) and laser induced thermal therapy (litt). even for operable lesions, image guided percutaneous ablative procedures are increasingly being used, because they are relatively safer, minimally invasive and equally effective. interstitial brachytherapy (ibt) is relatively a new and less studied technique of treatment lm. it is preferred over the other thermal ablative techniques for lesions larger than 3 - 5 cm in size or located in close proximity to large vessels which are less likely to be ablated due to heat sink effect [5, 6 ]. the ibt consists of insertion of single or multiple percutaneous needles in the lesion under ultrasonography (usg) or ct scan guidance, and connecting them to remote after loading brachytherapy machine for delivering a single high - dose - rate (hdr) dose of about 20 gy. as compared to external beam radiation therapy (ebrt) techniques like 3d - crt and sbrt, high - dose - rate interstitial brachytherapy (hdribt) can potentially provide better dosimetry since tumor movement due to breathing, unlike in ebrt, does not affect dose distribution. limited experiences through small studies [712 ] exist in the literature regarding the role of hdribt in lm and primary hepato - cellular carcinoma, and have shown efficacy and safety. we conducted a prospective trial to study the feasibility of hdribt in lm at our institute. from may 2009 to june 2011, 10 patients with 12 metastatic lesions in the liver were enrolled in this prospective trial. all patients had either refused surgery or found ineligible for surgery due to co - morbidities, and had consented for inclusion in the study. inclusion criteria were as follows : 1) age more than 18 years ; 2) karnofksy performance score of 70 ; 3) controlled primary site ; 4) liver function tests within normal limits. exclusion criteria included : 1) patients with more than three lesions ; 2) pediatric patients ; 3) metastases from wilm 's tumor, choriocarcinoma, seminomas or other chemosensitive tumors ; 4) patients with metastases to multiple visceral organs ; 5) previous irradiation to liver including sbrt. ct imaging was done for all patients as the baseline imaging for determining the disease extent and post treatment response assessment. the procedure was carried out in ct scan room (phillips large bore ct scanner, royal philips electronics, amsterdam, the netherlands) under local anesthesia (2% xylocaine). in the breath hold position, 16 gauze blind end stainless steel or rigid plastic brachytherapy needle was inserted in the center of lesion through the percutaneous route. the needle tip was preferably advanced 3 - 5 mm beyond the lesion since the needle tip was blind and could not dwell a source. caution was taken not to introduce the needle during the breathing movement in order to avoid tissue tear. usually a single ibt needle for lesions up to 3 cm and multiple needles for lesions more than 3 cm in diameter were inserted. 1). if required, needles were sutured to the skin for additional securing. ct scan images were acquired with a slice thickness of 3 mm and transferred to treatment planning system. clinical photograph of a patient in prone position showing 4 brachytherapy needles fixed with screws brachytherapy planning was performed on plato planning system, version 14.1 (nucletron, an elekta company, elekta ab, stockholm, sweden) using slice thickness of 3 mm. the clinical target volume (ctv) and normal liver volume were delineated on each slice. using step size of 2.5 mm, a plan was generated for a dose of 20 gy prescribed to ptv (fig. the volume of normal liver (excluding ptv) receiving 5 gy was kept below 30%. after the plan approval, patient was taken to microselectron hdr brachytherapy unit (nucletron, an elekta company, elekta ab, stockholm, sweden) using ir-192 radioactive source with initial activity of 10 ci for treatment delivery. the needle was removed in the breath hold position immediately after the completion of treatment and puncture site was sealed. planning ct scan of a patient showing the metastatic lesion, two brachytherapy needles and dosimetry. the red color line represents the prescription isodose line (20 gy) and cyan color line represents the 200% isodose line (40 gy) which covers a significant central part of the lesion acute complications were defined as those occurring within 6 months of the treatment. this included complications encountered during and within one week of the procedure (perioperative complications). major complications were defined as those resulting in life threatening condition (like intra - abdominal hemorrhage) requiring emergency therapies like blood transfusion and endotracheal intubation. minor complications included the nausea / vomiting, pain requiring analgesics, minor bleeding which did not require any active or resuscitative measures. patients were followed up every month till a period of 6 months and then every 3 months. response evaluation was done using the criteria defined by response evaluation criteria in solid tumors (recist). first assessment ct scan was performed at 3 months post procedure in view of the post treatment edema and slow regression following large single dose of 20 gy. local control was defined as absence of more than 20% increase in the size of treated lesion compared with baseline. appearance of any new lesion outside the treated area was not taken as local recurrence. local progression free survival (lpfs) was defined as the period from date of enrollment until the date of local disease progression (more than 20% increase in the size of treated lesion), or death, or last follow up whichever came first. the procedure was carried out in ct scan room (phillips large bore ct scanner, royal philips electronics, amsterdam, the netherlands) under local anesthesia (2% xylocaine). in the breath hold position, 16 gauze blind end stainless steel or rigid plastic brachytherapy needle was inserted in the center of lesion through the percutaneous route. the needle tip was preferably advanced 3 - 5 mm beyond the lesion since the needle tip was blind and could not dwell a source. caution was taken not to introduce the needle during the breathing movement in order to avoid tissue tear. usually a single ibt needle for lesions up to 3 cm and multiple needles for lesions more than 3 cm in diameter were inserted. 1). if required, needles were sutured to the skin for additional securing. ct scan images were acquired with a slice thickness of 3 mm and transferred to treatment planning system. clinical photograph of a patient in prone position showing 4 brachytherapy needles fixed with screws brachytherapy planning was performed on plato planning system, version 14.1 (nucletron, an elekta company, elekta ab, stockholm, sweden) using slice thickness of 3 mm. the clinical target volume (ctv) and normal liver volume were delineated on each slice. using step size of 2.5 mm, a plan was generated for a dose of 20 gy prescribed to ptv (fig. the volume of normal liver (excluding ptv) receiving 5 gy was kept below 30%. after the plan approval, patient was taken to microselectron hdr brachytherapy unit (nucletron, an elekta company, elekta ab, stockholm, sweden) using ir-192 radioactive source with initial activity of 10 ci for treatment delivery. the needle was removed in the breath hold position immediately after the completion of treatment and puncture site was sealed. planning ct scan of a patient showing the metastatic lesion, two brachytherapy needles and dosimetry. the red color line represents the prescription isodose line (20 gy) and cyan color line represents the 200% isodose line (40 gy) which covers a significant central part of the lesion this included complications encountered during and within one week of the procedure (perioperative complications). major complications were defined as those resulting in life threatening condition (like intra - abdominal hemorrhage) requiring emergency therapies like blood transfusion and endotracheal intubation. minor complications included the nausea / vomiting, pain requiring analgesics, minor bleeding which did not require any active or resuscitative measures. patients were followed up every month till a period of 6 months and then every 3 months. response evaluation was done using the criteria defined by response evaluation criteria in solid tumors (recist). first assessment ct scan was performed at 3 months post procedure in view of the post treatment edema and slow regression following large single dose of 20 gy. local control was defined as absence of more than 20% increase in the size of treated lesion compared with baseline. appearance of any new lesion outside the treated area was not taken as local recurrence. local progression free survival (lpfs) was defined as the period from date of enrollment until the date of local disease progression (more than 20% increase in the size of treated lesion), or death, or last follow up whichever came first. there were 5 males and 5 females with a median age 54 years (range 40 - 72). the median size of the lesion was 3.8 cm (range 2.7 - 7.0 cm). single needle was used in 5 patients while multiple needles were used in 5 patients. in one patient, the average time for the entire ibt procedure (needle insertion to needle removal) was 65 minutes (range of 50 - 105 minutes). the volume of normal liver (excluding the target volume) receiving more than 5 gy did not exceed 19% in any of the patient. one patient who had minimal pleural effusion without any symptom was managed with observation alone and no active intervention was required. at 12 months, 3 out of 12 lesions showed local progression and thus local control rate was 75%. all these 3 patients developed metastases to other visceral organs as well (lung 2, brain 1). of the 7 patients (with 9 lesions under control), 2 patients developed metastases to bones, lung and liver. the kaplan meier curve showing local progression free survival patient characteristics cm centimeter, rfa radiofrequency ablation details of brachytherapy dosimetry c.c. cubic centimeter, v100 volume receiving 100% of prescription dose, v150 volume receiving 150% of prescription dose, v200 volume receiving 200% of prescription dose number of patients showing major and minor complications (n = 10 patients) among non surgical options for patients with lm, rfa is relatively more popular method of ablation. however, it has limitations concerning the number, localization, as well as size and shape of the lm, with the risk of complications ranging from 8 - 35% [15, 16 ]. ct guided hdribt is a new treatment for lm with only limited studies [712 ] in the literature reporting local control rates of 87 - 93% ; similar to other ablative therapies. unlike rfa compared to ebrt treatment methods like sbrt, hdribt dosimetry remains unaffected by respiratory movements, because the implanted needle moves with target. therefore, it precisely delivers a large single dose of radiation to the target lesion and minimal dose to the surrounding liver parenchyma which has limited radiation tolerance. this makes it a highly conformal treatment with good therapeutic potential, while experience is limited. to the best of our knowledge, ours is the first such study being reported from india so far, and our results have shown that hdribt is a safe and feasible non surgical option for lm in our setup. the largest experience in the literature has been reported by ricke. [79 ]. in their first study, 19 patients of lm were treated by hdribt dose of 17 gy (range 12 - 25 gy). two patients (10%) experienced severe side effects, one had obstructive jaundice due to irradiation edema, and the other had intra - abdominal hemorrhage. in their second study, ricke. treated 35 patients with mean tumor size of 4.6 cm (range, 2.5 - 11 cm) with either hdribt alone using median dose of 17 gy (range, 10 - 20 gy) or in combination with thermal ablation. the local control rate after 6 months was 87% and 73% for ibt alone and combined treatment, respectively. in their third study, they used three different dose levels (15, 20 and 25 gy), and observed a statistically significant better local control with 25 gy as compared to 20 gy or 15 gy. table 4 summaries the results of various studies [712 ] published so far relating to use of hdribt in lm. the results of our study may not be strictly compared with others in the literature due to small sample size and short follow up. although local control rates in our study were slightly inferior to other studies, possibly due to small sample size and heterogeneous population of patients having different primary sites ; but our severe complication rate of 0% has been least of all the studies. the 1-year lpfs in our study is consistent with other studies by ricke. and ricke. studies published regarding the use of hdribt for liver metastases lm liver metastasis, pts patients, ibt- interstitial brachytherapy, lc- local control, pfs- progression free survival, hdr- high - dose - rate ; fu- follow up although most studies have used large single dose of hdr, but recently, tselis. reported their results of 31 patients using a fractionated schedule of hdribt (twice a day) with total dose ranging from 7 - 32 gy. the dose per fraction varied from 4 - 14 gy. in their series, 23 patients had lm from different primary sites. they observed local control rates of 79% at 1 year and 59% at 2 year with 4.7% severe complication rate. most series including ours (table 4) have included patients with heterogeneous primary sites and therefore results vary across these studies. however, two studies by ricke. and steffen. have included patients with lm from colorectum only, and one study by wieners. the best local control rates (93%) have been observed in series having breast primary, but the 1-year pfs of 40% is apparently same compared to rest of the studies. in terms of toxicity, hdribt seems to be safe as the procedure or radiation related severe complications rate has been found to be within acceptable limits (1.5 - 10%) in the published literature so far. several possible factors namely target volume, irradiation time, number of needle / catheters has been theoretically associated with toxicity, but none has been proved in the literature so far. occurring 12 to 24 hours after treatment have been reported in about 10% of patients. sbrt re - fers to the delivery of large doses of highly conformal radiation with steep dose gradients toward the surrounding normal tissue over a limited number of fractions (1 to 6 fractions) to extra cranial tumor sites. it is a simple, convenient and non - invasive method of treatment, and therefore rapidly becoming popular. though metastatic lesions up to 6 cm in liver have been treated, but lesion size between 3 - 5 cm is the ideal one. unlike hdribt, lesions located in close proximity to bowel lumen or chest wall / ribs are avoided. although uncertainty related to breathing movements is minimal with the use of immobilization devices, abdominal compression and gating techniques ; the dosimetric variation can not be ruled out during treatment delivery. shift in liver position relative to the vertebral bodies can be as large as 1 cm from fraction to fraction. in hdribt, breathing motion is not a limiting factor since the catheter has a constant position relative to the target without further specific preparations. due to sharp dose gradient within and outside the target, normal liver receives minimal doses and the center of the tumor receives 2 - 3 times higher dose than the prescription dose (fig. although there are no studies comparing sbrt and hdribt in lm, local control rates seem to be comparable. severe toxicity related to sbrt is uncommon, but likely to be more in patients receiving higher doses to bowel or large volumes of liver. major complications in the form of hemorrhagic gastritis, rib fracture or chest wall necrosis have been rarely observed. as per the paris system of dosimetry, multiple needles should be inserted for adequate coverage of lesions larger than 1.5 cm in diameter. we used single needle for lesions up to 3 cm in diameter and accepted the inhomogeneous dosimetry in the tumor. such inhomogeneity, which is not usually acceptable in routine hdribt procedures like breast and prostate brachytherapy, actually proves advantageous in liver tumors. firstly, the central hypoxic area of the tumor, which is closure to needle, definitely receives much higher dose (> 50 gy for) as compared to the peripheral portion (20 gy), and therefore may result in higher tumor control. secondly, multiple needle insertion will definitely enhance the risk of trauma and associated complications. we realize the limitations of our study : 1) small sample size and 2) short follow up duration. yet, our results consolidate the safety aspect of hdribt in patients of lm and should encourage the readers to further study this topic. ours is the first study being reported from india so far on the use of hdribt in patients with lm. although limited by small sample size, the results of our study suggest that hdribt is a safe and effective non surgical option for lm in our setup. addition of our results to the existing literature would consolidate the practice of hdribt, a technique with excellent therapeutic potential, but relatively under - utilized in lm, and encourage us and the readers to design future multi - centric randomized controlled trials with larger sample size and longer follow up. | purposeto study the safety and efficacy of high - dose - rate interstitial brachytherapy (hdribt) in patients with liver metastases (lm).material and methodsbetween 2009 and 2011, 10 patients with 12 metastatic lesions in the liver were enrolled in this prospective trial. all patients had either refused surgery or found ineligible for surgery due to various factors. under ct guidance, 16 gauze blind end stainless steel or rigid plastic brachytherapy needle was inserted in the center of lesion through the percutaneous route. generally, a single interstitial brachytherapy (ibt) needle for lesions up to 3 cm and multiple needles for lesions more than 3 cm in diameter were inserted. treatment was delivered with a single high - dose - rate (hdr) dose of 20 gy prescribed to the target. the needles were removed immediately after the treatment. the endpoints of study were acute complications and local control of the disease.resultsthe median size of the lesion was 3.8 cm (2.7 - 7.0 cm). the average time for the entire ibt procedure was 65 minutes (50 - 105 minutes). median follow up was 9 months (3 - 17 months). none of the patients had fatal complications. minor complications like pain, nausea / vomiting, and asymptomatic pleural effusion were observed in 3, 2 and 1 patients, respectively. local control rate at 12 months was 75%. the 1-year local progression free survival (lpfs) was 33%.conclusionalthough limited by small sample size, the results of our first study from india suggest that hdribt is a safe and effective non surgical option for lm. |
1. an autoimmune mechanism has been implicated in the pathogenesis of vitiligo in most cases. 2. histamine mediates some actions through various interleukin pathways and elevated levels of serum soluble il-2 receptor, il6, and il- 8 has been reported in vitiligo patients. vitiligo is an acquired, idiopathic disorder of the skin characterized clinically by circumscribed depigmented macules and histologically by the absence of identifiable melanocytes. functional melanocytes disappear from the involved skin by a mechanism(s) that has not been identified. the main mechanism of melanocyte destruction in vitiligo is thought to be due to an autoimmune lymphocytic attack on melanocytes. there are several hypotheses concerning the pathogenesis of vitiligo. of the many hypotheses suggested by various investigators from time to time the following three have received general acceptance : (1) autoimmune hypothesis : suggests that depigmentation is due to formation of autoantibodies directed against body 's own melanin or some other part of melanocyte. this may arise as a primary aberration of the immune surveillance, or the primary event could be an injury to the melanocyte with release of antigenic substance(s) and subsequent autoimmunization. autoimmune etiology is favored by its association with known autoimmune diseases such as addison 's disease, hashimoto 's thyrioditis, pernicious anemia, and the fact that patients with vitiligo have increased organ - specific autoantibodies including antibodies to adrenal cytoplasm, thyroglobulin, gastric parietal cells, and pancreatic islet cells. antibodies directed against melanocyte cell surface antigens are often demonstrated in the sera of vitiligo patients. also antibodies against tyrosinase (2) self - destruction hypothesis : suggests that in the process of synthesis of melanin within the melanocytes some toxic metabolic intermediates form. defects in, or absence of, of this inherent mechanism results in accumulation of toxic melanin precursors causing melanocyte dysfunction or death. (3) neuro - chemical hypothesis : suggests that release of a neuro - humoral or chemical factor destroys the melanocyte or inhibits melanin formation giving rise to depigmentation. nature of this toxic mediator remains speculative. for a long time neurotransmitters from peripheral nerve - endings (acetylcholine and catecholamines) also dysfunction of sympathetic nerves in vitiliginous skin has been reported showing abnormalities in catecholamines and related enzymes (catechol - o - methyl transferase and monoamine oxidase). the neural hypothesis is based in the first place on the presence of segmental vitiligo. it has now been realized that all the various clinical types of vitiligo can not be explained by a single hypothesis. koga has shown that there are two distinct types of vitiligo, each having a different pathogenesis. according to his view, the pathogenesis of dermatomally distributed vitiligo involves some disturbance in some sympathetic nerves of the affected area, which influences the melanocyte causing their functional inhibition or destruction. in contrast, nondermatomal vitiligo has a different pathogenesis in which primary disturbance lies in the melanocyte itself, where an autoimmune mechanism is suspect. this clinical distinction of segmental vitiligo and nonsegmental vitiligo done by koga has not been challenged until recently. the vitiligo european task force (vetf) in its consensus paper has followed this classification of koga. the vetf concluded that there was no significant evidence that the various sub - types of nonsegmental vitiligo were clearly distinct. only recently it has been reported that in certain vitiligo patients, a characteristic segmental involvement become associated usually in a second - step with bilateral vitiligo patches and the term mixed vitiligo has been proposed by mulekar. the sequence of early segmental vitiligo leading to late onset nonsegmental vitiligo as found in the study of ezzedine., may reflect the role of a cutaneous gene defect causing segmental vitiligo and later triggering a generalized immune response against cutaneous melanocytes driven by another immune - related gene defect. the idea that histamine might act as a toxic mediator in the pathogenesis of vitiligo arose from the observation that a good number of vitiligo patients attending the pigment clinic gave a history of significant pruritus over vitiligo patches. more significantly, many patients gave a history of spread of vitiligo lesions just preceded by itching in the new areas. such patients differed from the general pool of vitiligo patients in that they presented with hypo - pigmented patches scattered diffusely and were of short duration. many of them gave history of sudden onset of such lesions with itching while several of them associated their lesions with photosensitivity and complained of flare - up of lesions after administration of melanizing agents. histamine is particularly relevant in this context since histamine, which is also liberated along with other chemicals when cells are damaged, is one of the chemical mediators of itch. moreover, there is evidence that in frog both histamine and histamine releaser produce skin color blanching and melanophor contraction. also a significant number of vitiligo patients gave a history of atopy along with pruritus. the term atopy, or as presently used, atopic allergy implies a familial tendency to manifest alone or in combination such conditions as asthma, allergic rhinitis, and urticaria. asthma is associated with increased ige levels and high levels of ige are found in patients with atopic dermatitis. it has now been reported that histamine promotes the differentiation of dendritic cells toward a th2 profile. it is known that several hormones regulate melanogenesis through the action of ubiquitous cyclic adenosine monophosphate (amp). based on the above facts and observations, it was hypothesized that histamine might act as a toxic mediator in the pathogenesis of a particular type of vitiligo. the present study is a retrospective analysis of data of a select group of patients attending the pigment clinic of the department of dermatology, sskm hospital and ipgme and r, kolkata between february 1, 1975 and june 30, 1985. all new vitiligo patients attending the pigment clinic were closely scrutinized by carefully taken histories and thorough clinical examination. only those patients satisfying one or more of the following criteria were selected for the study : (1) presence of pruritus in the lesions ; (2) faintly defined hypopigmented guttate type lesions that are distributed in a diffuse manner and are of recent origin ; (3) a positive history of atopy in the patient or in the family ; and (4) association of halo nevus, koebner 's phenomenon, or photosensitivity. in the period under review, important clinical data of the patients are summarized in table 1. from a small lesion of recent origin in a suitable area a thin slice of skin was taken with the help of a punch under local anesthesia. the tissue obtained by punch biopsy was subjected to conventional sectioning through the stages of fixation, dehydration, clearing, impregnation and embedding. sections from each tissue are stained by haemtoxylin eosin stain and by toluidine blue stain (for mast cells). before giving any treatment to the patients, five (5) ml of blood was dissolved in 10 ml of 10% trichloroacetic acid solution in a test - tube, and after vigorous shaking ; the mixture was kept in a refrigerator. estimation of blood histamine level was done by bio - assay method (h.o. schild, 1942) using a strip of terminal guinea pig ileum in an organ bath. dose - related contraction in the presence of atropine (to exclude acetylcholine activity) followed by inhibition of this activity by antihistamine mepyramine maleate confirms the presence of histamine. this method reliably detects concentrations in the range of 1 - 2.5 ng / ml. all new vitiligo patients attending the pigment clinic were closely scrutinized by carefully taken histories and thorough clinical examination. only those patients satisfying one or more of the following criteria were selected for the study : (1) presence of pruritus in the lesions ; (2) faintly defined hypopigmented guttate type lesions that are distributed in a diffuse manner and are of recent origin ; (3) a positive history of atopy in the patient or in the family ; and (4) association of halo nevus, koebner 's phenomenon, or photosensitivity. from a small lesion of recent origin in a suitable area a thin slice of skin was taken with the help of a punch under local anesthesia. the tissue obtained by punch biopsy was subjected to conventional sectioning through the stages of fixation, dehydration, clearing, impregnation and embedding. sections from each tissue are stained by haemtoxylin eosin stain and by toluidine blue stain (for mast cells). before giving any treatment to the patients, blood samples were taken for estimation of histamine levels in the blood. five (5) ml of blood was dissolved in 10 ml of 10% trichloroacetic acid solution in a test - tube, and after vigorous shaking ; the mixture was kept in a refrigerator. estimation of blood histamine level was done by bio - assay method (h.o. schild, 1942) using a strip of terminal guinea pig ileum in an organ bath. dose - related contraction in the presence of atropine (to exclude acetylcholine activity) followed by inhibition of this activity by antihistamine mepyramine maleate confirms the presence of histamine. this method reliably detects concentrations in the range of 1 - 2.5 ng / ml. of the 50 patients studied, pruritus was a significant finding in 28 patients and atopy in 12 patients. regarding distribution of lesions, the histology of lesions of recent origin revealed flattening of epidermis, homogenization (a ground glass appearance) of collagen in the upper dermis and mild increase of vascularity with slight perivascular infiltrate and edema. melanocytes are decreased in number with scanty or absent pigment granules. except three cases, infiltrate (which is chiefly lymphocytic) was patchy, scanty, and perivascular. in three specimens the infiltrates are slightly heavy in the border of the active lesions and in one the infiltrate invaded the epidermis. no degeneration of nerve fibrils seen and the sweat glands and other appendages are normal. the blood histamine values of vitiligo patients were significantly increased in comparison with values of matched controls (normal human volunteers) as shown by the overall mean values in [table 2 ]. blood histamine levels (ng / ml) in vitiligo patients versus normal patients when the blood histamine values of the vitiligo patients were further analyzed forming groups in terms of presence of or absence of pruritus, and length of duration, it was found that the blood histamine values were higher in all cases except those of long duration where the values are significantly lower than the general trend (p < 0.05) blood histaminase levels were also determined (expressed in provisional units / ml) and were found to be significantly high in vitiligo patients compared with normal group [table 4 ]. high plasma histaminase values along with high blood histamine levels indicate even higher value of histamine in vitiligo than what has been found in the patients. significantly higher values of histamine in short duration cases is shown in a histogram [figure 1 ]. blood histamine levels (ng / ml) in vitiligo patients plasma histamine levels (pu / ml) in vitiligo patients versus normal patients histamine value histogram of the 50 patients studied, pruritus was a significant finding in 28 patients and atopy in 12 patients. regarding distribution of lesions, the histology of lesions of recent origin revealed flattening of epidermis, homogenization (a ground glass appearance) of collagen in the upper dermis and mild increase of vascularity with slight perivascular infiltrate and edema. melanocytes are decreased in number with scanty or absent pigment granules. except three cases, infiltrate (which is chiefly lymphocytic) was patchy, scanty, and perivascular. in three specimens the infiltrates are slightly heavy in the border of the active lesions and in one the infiltrate invaded the epidermis. no degeneration of nerve fibrils seen and the sweat glands and other appendages are normal. the blood histamine values of vitiligo patients were significantly increased in comparison with values of matched controls (normal human volunteers) as shown by the overall mean values in [table 2 ]. blood histamine levels (ng / ml) in vitiligo patients versus normal patients when the blood histamine values of the vitiligo patients were further analyzed forming groups in terms of presence of or absence of pruritus, and length of duration, it was found that the blood histamine values were higher in all cases except those of long duration where the values are significantly lower than the general trend (p < 0.05). blood histaminase levels were also determined (expressed in provisional units / ml) and were found to be significantly high in vitiligo patients compared with normal group [table 4 ]. high plasma histaminase values along with high blood histamine levels indicate even higher value of histamine in vitiligo than what has been found in the patients. significantly higher values of histamine in short duration cases is shown in a histogram [figure 1 ]. blood histamine levels (ng / ml) in vitiligo patients plasma histamine levels (pu / ml) in vitiligo patients versus normal patients histamine value histogram multiple theories have been proposed, including genetic, autoimmune, neural, and biochemical mechanisms. reviews addressing the etiology of vitiligo, viewed in totality suggest that vitiligo is probably a heterogeneous disease encompassing multiple etiologies. this study, performed in earlier times when modern immunological techniques were not available, showed that a considerable number of patients presented with pruritus and atopy and it seems reasonable that histamine might be acting as a toxic mediator in these cases. histopathological study revealed slight perivascular infiltrate and moderately increased vascularity with some vasodilation and significantly increased number of mast cells. this flattening of the epidermis and vacuolization of some epithelial cells reflect an involvement of histamine since it has now been reported that histamine acts as an inhibitor of human keratinocytes and suppressor of epidermopoiesis in humans and animals. blood histamine values of vitiligo patients are significantly higher than the values found in normal persons (p < 0.05). also blood histaminase levels were determined and were found to be significantly elevated in vitiligo cases of short duration compared with normal control group. high plasma histaminases along with high blood histamine indicate even higher value of histamine in vitiligo. these observations support the hypothesis that histamine has a role in the pathogenesis of a particular type of vitiligo, characterized by faint white patches, pruritus, occasional intolerance to melanizing agents, and an association of atopy. histamine might also be operative in the pathogenesis of other types of vitiligo but the present study has been restricted to a group of patients having vitiligo of a particular type specified. now it has been established that histamine regulates t - cell and b - cell function by differential expressions of h1 and h2 receptors. histamine enhances th1 responses by triggering the h1 receptor, whereas both th1 and th2 responses are negatively regulated by h2 receptor via the activation of different intracellular signaling pathways. these findings indicate an important regulatory mechanism in the control of immune functions through release of histamine. this theory is based on increased number of immune phenomena and immunological disorders seen in vitiligo patients. an increased frequency of hypothyroidism (e.g., hashimoto thyroiditis, graves disease), diabetes mellitus, and alopecia areata are commonly seen in vitiligo patients. several investigators have also addressed the role of peripheral blood and lesional cytokine expression in the pathogenesis of vitiligo. elevated levels of serum soluble il-2 receptor, il-6, and il-8 and elevated lesional tissue levels of il-2 have been reported in vitiligo patients. histamine, through the h2 receptor, reduces the production of il-1, il-6, and tnf- from endotoxin - stimulated monocytes. thus, it has now been clear that histamine mediates some actions through various interleukin pathways and thus this finding can be taken to correlate with this study, which was performed much earlier, showing role of histamine in the pathogenesis of vitiligo of a particular kind. from our findings of high blood histamine level as well as high blood histaminases level in cases of a particular type of vitiligo of short duration and characterized by faint hypopigmented patches with significant itching, we hypothesize that histamine has a definite role in the pathogenesis of vitiligo. this study, which was performed much earlier, highlighted that some allergic phenomena were operative in the pathogenesis of vitiligo as evidenced by high levels of blood histamine and histaminases. the idea raised by this study that some allergic phenomena were suspect in the causation of vitiligo has been corroborated by subsequent workers showing autoimmune nature of the disease. blood histamine as well as histaminases levels are found to be significantly high in a particular group of vitiligo patients. this points to autoimmune basis of etiology of vitiligo and indicate possible benefit to vitiligo patients with antihistamine therapy along with standard treatment regimen for vitiligo. | background : the precise cause of vitiligo is still unclear. multiple theories have been proposed, including genetic, autoimmune, neural, and biochemical mechanisms. an immune mediated pathogenesis is indeed the most popular theory. the autoimmune hypothesis considers the role of toxic mediator that might cause an injury to the melanocytes with the release of an antigenic substance and subsequent autoimmunization.aims:this study performed over a period of 10 years (february 1975 to june 1985) aims at exploring the role that histamine might play in the pathogenesis of vitiligo.materials and methods : fifty patients with a particular type of vitiligo characterized by faint white patches occurring with significant pruritus and a history of atopy were selected and blood histamine levels were determined by bio - assay method.results:blood histamine values of patients with vitiligo of short duration and with pruritus were significantly increased in comparison with values of matched controls.conclusion:histamine appears to play a significant role in the pathogenesis of a particular type of vitiligo characterized by faint hypopigmented patches with significant itching. |
the course of the three major nerves crossing the elbow is quite consistent, yet in some instances variations are encountered particularly if the elbow has deformed following previous episode of fracture and surgery. we present here a case of entrapment of radial nerve in the bone without any signs of nerve palsy resulting from an old supracondylar fracture of the humerus. a 23-year - old male patient presented with cubitus varus deformity of the left elbow. the patient developed the deformity following some fracture around elbow in the childhood at the age of 8 years that was managed conservatively in plaster cast after closed reduction. on examination, the boy had 15 of cubitus varus deformity, full range of elbow movements, and no distal neural deficit. radiograph showed an oblique joint line suggestive of varus deformity and evidence of old healed remodeled fracture line. two foramina of 3 - 4 mm diameter were seen on anteroposterior view on a vertical plane. the distal hole had a sharp margins while proximal had indistinct margins, similar holes were seen in oblique view [figure 1 ]. (a) anteroposterior and (b) lateral radiographs of the elbow showing two foramina marked with black arrows this child was undertaken for lateral wedge corrective osteotomy at elbow, the lateral approach to the elbow between the flexor and extensor compartments was used to expose the site of osteotomy. when the perisoteum from the anterior surface of the lower humerus was lifted, some anomalous structure entering into the bone was noticed on the medial side of the supracondylar region. on further dissection it looked like neural tissue [figure 2 ], and was thought to be the median nerve. we attempted to make a window into the bone and free the nerve but it was seen that the nerve was severely entrapped in the bone and on our repeated attempts to remove it, it got transected. we planned to explore all the three nerves at the elbow to ascertain the identity of the nerve as its course was very aberrant. post operatively the function of both ulnar and median nerves was normal, but there was radial nerve palsy [figure 2a and b ]. (a) per - operative clinical photograph showing entrapped nerve in the bone and (b) the damaged radial nerve after attempts to remove it by cutting the bone the elbow was mobilized after 1 month. at 2 months all implants were removed and tendon transfers for radial nerve palsy, namely, pronator teres to extensor carpi radialis brevis, palmaris longus to extensor pollicis longus, and flexor carpi radialis to extensor digitorum communis was done. with extensive physiotherapy, it is very unusual to find the radial nerve to be entrapped in the callus. one such case was reported by symeonides.3 duthie1 has described a case of radial nerve palsy of long standing after a fracture of the shaft of the humerus in which the nerve was found to be enclosed in an osseous tunnel that was evident in the radiographs. roaf2 referred to a case of median nerve paralysis of late onset after dislocation of the elbow with fracture of the medial epicondyle, which during healing created a tunnel ensheathing the nerve. in both cases the nerve palsy indicated the correct diagnosis, which was supported by the radiographic findings. in our case no such palsy existed and this led us to take it as a usual case. this case is interesting because it had no preoperative nerve palsy, the unusual position of the osseous tunnel and the high risk of division or severe damage to the nerve. we feel that before embarking on a reconstructive operation for post - traumatic cubitus varus, it is essential to examine the radiographs carefully for the presence of foramina suggestive of nerve entrapment, and if suspected, always explore the radial nerve at an early stage in the procedure. | entrapment of a nerve in the callus of a healing fracture is not a common entity, but it does exist. the entrapment usually presents without neurological deficit. it is difficult to suspect the radial nerve injury if we need to operate on the same site. we present a case of entrapment of radial nerve in the callus of a supracondylar humerus fracture with cubitus varus deformity. the surgery for correction of the deformity led to the damage of the nerve. in retrospect a careful assessment of the x - rays showed two 3 - 4 mm diameter holes. awareness of this finding would have given us sufficient indication of nerve entrapment to prevent this mishap. |
on page 24 of this issue of critical care, meduri introduces a new layer of complexity to our understanding of the inflammatory response in acute respiratory distress syndrome (ards). he postulates that cytokines secreted by the host during ards may favor the growth of some strains of bacteria and consequently explain the association between exaggerated and protracted systemic inflammation and the development of nosocomial infections. evidence for this novel theory comes from in vitro studies evaluating the extracellular and intracellular responses of clinically relevant bacterial species to graded concentrations of pro - inflammatory cytokines. bacterial growth was enhanced at both extremes of this curve, suggesting that insufficient or dysregulated inflammation may play an active role in stimulating bacterial growth and/or impairment of bacterial clearance, with the subsequent development of nosocomial infections. this new finding has important implications for our understanding and management of patients with ards. over the past two decades, the recognition that neutrophils, macrophages, and other components of the inflammatory cascade participate in the generation and progression of acute lung injury (ali) and ards has resulted in the use of anti - inflammatory agents as pharmacological probes to define this syndrome. furthermore, preclinical models of endotoxin - induced sepsis demonstrated a survival benefit if pro - inflammatory cytokines were neutralized, leading to a number of studies in which this therapy was used in patients with ards. the u - shaped bacterial growth curve may be a partial explanation for the lack of efficacy of these trials as decreasing cytokine activity may be beneficial, or may be harmful, depending on the specific location on the dose response curve. for an effective host response to be mounted against infection, the cellular components of the innate and acquired immune system need bidirectional communication. the interaction between cytokines and bacteria may be an important factor in the development of organ injury and death from severe infections, although numerous host and local factors, including inflammatory cells, profoundly influence the role of a specific cytokine. it has recently been proposed that patients with sepsis or a systemic inflammatory response have an ' immunoparalysis ' and are, in fact, immunosuppressed. the use of growth factors or cytokines to augment the host response to infection has been proposed in the critically ill. a small preclinical trial with granulocyte colony stimulating factor showed favorable mortality results in patients with community acquired pneumonia and sepsis. although a recent phase iii trial did not detect a mortality difference between the treatment and the placebo group in a post hoc analysis, nelson and colleagues documented faster radiological resolution of pneumonias, which was associated with a decreased incidence of ards. further evidence for the role of augmentative cytokine therapy comes from clinical data using interferon to upregulate hla - dr expression and consequently increase the lipopolysaccharide - induced tumor necrosis factor- responses ex vivo, and from improved clinical outcome in eight out of nine septic patients. in contrast, agents that block tumor necrosis factor-, interleukin-1, and endotoxin have been shown to attenuate nuclear factor-b (nf-b) activation, inflammation, and organ dysfunction. these studies, however, did not look at the incidence of nosocomial pneumonia as an outcome in patients with ards. from a biological standpoint, it may be that blocking a single mediator, especially after the initiating insult, is insufficient to inhibit nf-b activation in complex clinical conditions. this is primarily because of the redundancy of proximal mediators with the potential to activate nf-b. furthermore, none of these molecules appears to be both a critical and essential pathway for activation of nf-b. if we have learned anything from clinical trials in sepsis / inflammation it is that the transfer of information from the bench to the bedside can be fraught with difficulty. the intricate relationship between innate and adaptive response shapes patient outcome, and this is rarely determined by a single factor. there are, in fact, many more levels of complexity ; with multiple cytokines and multiple u - shaped curves that interact, it may be impossible to predict whether a specific anti - cytokine therapy will benefit or harm a given patient, especially as the cytokine profiles change during the course of the disease. secondly, even if these concepts are correct in vivo, the impact of nosocomial pneumonias on the mortality of patients with ali / ards in not entirely clear. despite the fact that at postmortem almost two - thirds of non - survivors have histological evidence of pneumonia, sutherland. found that the incidence of nosocomial pneumonia in patients with ards was only 15% (antibiotic use may have inhibited bacterial growth in this study). in all three studies, however, the presence or absence of ventilator - associated pneumonia had little or no effect on mortality. in contrast, headley. reported that the rate of nosocomial infection per day of mechanical ventilation was 1% in survivors and 8% in non - survivors. even if nosocomial infections do not directly determine outcome in this population of patients, they may play a key role in the loss of pulmonary compartmentalization of the inflammatory response, and consequently the development and progression of multi - organ dysfunction syndrome. data presented by meduri suggest that bacterial growth and impaired clearance is secondary to a dysregulated inflammatory response and is not the inciting event leading to loss of pulmonary compartmentalization. ranieri and slutsky, however, showed that an injurious ventilatory strategy increases the level of serum inflammatory mediators and that this increase is related to an increased incidence of organ dysfunction. whether this may be, in part, amplified by concurrent nosocomial pulmonary infections and the u - shaped dose response to cytokines is yet to be determined. moreover, treating cytokines in isolation of the underlying pathophysiology may not alter important clinical outcomes. compelling evidence looking at different ventilatory strategies in the management of patients with ards has demonstrated that protective ventilatory strategies that attenuate the pulmonary and systemic inflammatory responses, by addressing the underlying pathophysiology of ventilator - induced lung injury in patients with ards, improve outcome. evidence from both animal and clinical studies suggest that cyclic stretch induces changes in pro - inflammatory and anti - inflammatory gene expression. if this is the case, mechanical ventilation primarily used in the treatment of respiratory failure and responsible for ventilator - induced lung injury may now become a therapeutic tool in the immunomodulatory management of ventilated patients with ards. this is an exciting time for intensivists involved in the care of patients with ards / ali. the rate - limiting step in developing novel therapies for acute inflammatory diseases of the lung is not delineating the molecular mechanisms of lung injury, but understanding how the pieces of the puzzle fit together. to this end, meduri has made a significant contribution to our understanding of the mechanisms underlying nosocomial infections in patients with ards. the challenge now is in the generation of meaningful questions that will pave the way towards novel strategies in the management of this patient population. ali = acute lung injury ; ards = acute respiratory distress syndrome ; nf-b = nuclear factor-b. | the recognition that neutrophils, macrophages, and other components of the inflammatory cascade participate in the generation and progression of acute lung injury / acute respiratory distress syndrome has resulted in the use of anti - inflammatory agents in an attempt to attenuate this inflammatory response and to prevent further progression of the acute lung injury. the recent finding that cytokines, in part mediators of this ' overwhelming ' inflammatory reaction, may also stimulate bacterial growth, impair bacterial clearance, and promote the subsequent development of nosocomial infections may have important implications to the management of the acute lung injury / acute respiratory distress syndrome patient. |
a total of 34 molecules with dpp iv inhibitory activity were selected for hqsar analysis and chemical structure constructed on the sketch module of sybyl x2.0 software. the hqsar studies require the minimization of structure, calculation of the force field and charges. the energy minimization and charge calculation done by tripos force field and pullman charge, respectively. the series of total thirty four -amino amide analogues with ic50 nm collected from the previous reported literature, which was suitable for the hqsar analysis. the similarity on pharmacological activity (mouse dpp iv enzyme) of dataset is one of the important aspects for hqsar studies (fig. 1). for performing the further analysis the pharmacological activity of selected series ic50 (ic50=activity ranges from 569 to 24.9 nm) was converted to pic50 (pic50=activity ranges from 7.943 to 6.001). the converted pic50 was considered as dependent variable in the hqsar analysis for model generation. thus the dataset was divided into the test set and the training set by diversity and dissimilarity method, so that all structure dataset covers the structural diversity, chemical assessment, chemical prototype and complete range of pharmacological activity of both set. the series consist of eight tests set molecule for external validation and remaining considered as training set molecule for internal validation. therefore it has been recommended that generated models should be tested on a sufficiently large test set to establish a statistically meaningful and reliable hqsar model. the activity data of 34 -amino amide analogues hqsar technique does not require the alignment of dataset on common template, after completion of statistical parameter analysis provides exact information of required of functional group with contribution into the chemical structure. hqsar is a novel technique requires 2d structure which employs specialized fingerprints as predicted variable of pharmacological activity. the hqsar model generated on the two steps firstly calculation of molecular fingerprints and secondly pls validation analysis. concerned sensitivity of the generated model depends on the parameters as hologram length, fragment size and fragment distinct. the different combination were tried to obtain a better model which statistically provides the information regarding the structural requirement. the fragment distinct available were atoms (a), bonds (b), connections (c), hydrogen atoms (h), chirality (ch), and donor and acceptor (da). the several combinations were taken in search of better understanding of the dataset and future suggestion of the novel structure. we performed the hqsar analyses by screening the 12 default series of hologram length values ranging from 53 to 401 bins, initially using the fragment size default (47). the 16 combination which were selected for analysis as a / b, a / b / c, a / b / h, a / b / ch, a / b / da, a / b / c / h, a / b / c / ch, a / b / c / da, a / b / h / ch, a / b / h / da, a / b / ch / da, a / b / c / h / da, a / b / c / h / da, a / b / c / h / da, a / c / h / da and a / c / h / ch / da. the fragment distinction based model generated the statistical parameter on the basis of which further analysis performed. the statistical parameter obtained after completion of analysis were nc, q, r, se, bhl and predicted pic50, which provides the useful information on the basis of best model subsequently fingerprint structure saved with color coding. the best model coming out of sixteen combinations were a / b / c and a / b / da. the predicted pic50 activity of the best model a / b / c of default fragment size 4 - 7 presented in the table 1. on the default fragment size 4 - 7 two statistically optimum combination obtained with different fragment distinction, chosen for further study which developed statistically best model. the selected fragment distinctions with better result were a / b / c and a / b / da on which additional analysis performed through different fragment size. the 13 different fragment size preferred for analysis were 2 - 5, 3 - 6, 4 - 7, 5 - 8, 6 - 9, 7 - 10, 8 - 11, 2 - 6, 3 - 7, 4 - 8, 5 - 9, 6 - 10 and 7 - 11. the statistical parameter generated on these fragment size as nc, q, r, se and bhl. a total of 34 molecules with dpp iv inhibitory activity were selected for hqsar analysis and chemical structure constructed on the sketch module of sybyl x2.0 software. the hqsar studies require the minimization of structure, calculation of the force field and charges. the energy minimization and charge calculation done by tripos force field and pullman charge, respectively. the series of total thirty four -amino amide analogues with ic50 nm collected from the previous reported literature, which was suitable for the hqsar analysis. the similarity on pharmacological activity (mouse dpp iv enzyme) of dataset is one of the important aspects for hqsar studies (fig. 1). for performing the further analysis the pharmacological activity of selected series ic50 (ic50=activity ranges from 569 to 24.9 nm) was converted to pic50 (pic50=activity ranges from 7.943 to 6.001). the converted pic50 was considered as dependent variable in the hqsar analysis for model generation. thus the dataset was divided into the test set and the training set by diversity and dissimilarity method, so that all structure dataset covers the structural diversity, chemical assessment, chemical prototype and complete range of pharmacological activity of both set. the series consist of eight tests set molecule for external validation and remaining considered as training set molecule for internal validation. therefore it has been recommended that generated models should be tested on a sufficiently large test set to establish a statistically meaningful and reliable hqsar model. hqsar technique does not require the alignment of dataset on common template, after completion of statistical parameter analysis provides exact information of required of functional group with contribution into the chemical structure. hqsar is a novel technique requires 2d structure which employs specialized fingerprints as predicted variable of pharmacological activity. the hqsar model generated on the two steps firstly calculation of molecular fingerprints and secondly pls validation analysis. concerned sensitivity of the generated model depends on the parameters as hologram length, fragment size and fragment distinct. the different combination were tried to obtain a better model which statistically provides the information regarding the structural requirement. the fragment distinct available were atoms (a), bonds (b), connections (c), hydrogen atoms (h), chirality (ch), and donor and acceptor (da). the several combinations were taken in search of better understanding of the dataset and future suggestion of the novel structure. we performed the hqsar analyses by screening the 12 default series of hologram length values ranging from 53 to 401 bins, initially using the fragment size default (47). the 16 combination which were selected for analysis as a / b, a / b / c, a / b / h, a / b / ch, a / b / da, a / b / c / h, a / b / c / ch, a / b / c / da, a / b / h / ch, a / b / h / da, a / b / ch / da, a / b / c / h / da, a / b / c / h / da, a / b / c / h / da, a / c / h / da and a / c / h / ch / da. the fragment distinction based model generated the statistical parameter on the basis of which further analysis performed. the statistical parameter obtained after completion of analysis were nc, q, r, se, bhl and predicted pic50, which provides the useful information on the basis of best model subsequently fingerprint structure saved with color coding. the best model coming out of sixteen combinations were a / b / c and a / b / da. the predicted pic50 activity of the best model a / b / c of default fragment size 4 - 7 presented in the table 1. on the default fragment size 4 - 7 two statistically optimum combination obtained with different fragment distinction, chosen for further study which developed statistically best model. the selected fragment distinctions with better result were a / b / c and a / b / da on which additional analysis performed through different fragment size. the 13 different fragment size preferred for analysis were 2 - 5, 3 - 6, 4 - 7, 5 - 8, 6 - 9, 7 - 10, 8 - 11, 2 - 6, 3 - 7, 4 - 8, 5 - 9, 6 - 10 and 7 - 11. the statistical parameter generated on these fragment size as nc, q, r, se and bhl. the selected dataset homogeneity achieved by in vivo analysis on mouse by dpp iv inhibition assay, compound 21 has least ic50 of 24.9 nm. hqsar analysis was performed on the dataset to identify the minimal 2d sub - structural requirement for antidiabetic activity besides the well - known role of the -amino amide analogues. the dataset selected for the hqsar study consist of 34 -amino amide analogs is presented in table 1. for hqsar analysis purpose given ic50 nm converted to pic50 nm. the frequency of statistical parameters depend on the range of acceptably distributed ic50 (569 - 24.9) and pic50 (7.943 - 6.001). the dataset taken shows the diversity ratio range of pharmacological activity, in which it was easy to perform the analysis data. the most commonly used techniques to generate qsar models are multiple linear regression (mlr), genetic algorithm, principle component analysis, single linear regression and partial least squares (pls). classical qsars most frequently use mlr where the ratio of the data points to the number of number of descriptors should not exceed five. while pls analyses are particularly suited to situations where the number of descriptor variables exceeds the number of observations it is often the case that the principal components extracted from the descriptor variables has unclear physical meaning. it should be noted that the hqsar technique does allow physical interpretation of pls extracted qsar model components in terms of 3d contour maps and also fragment counting and pls analysis, are very fast. the generated model consistency depends on statistical parameters, quality of both training and test sets in terms of chemical structural diversity and property value distributions. training and test sets were carefully divided in such a way that structurally diverse ratio maintains on molecules of a wide range of pharmacological activities were included in both sets (fig. set, twenty six compounds were selected as members of the training set for internal model predictivity, whereas the other eight compounds (2, 5, 9, 13, 15, 18, 20 and 24) were selected as members of the test set for external model predictivity. the graph was generated to suggest the distribution of the data set. a statistical cluster analysis confirmed that the composition of both training and test sets is representative of the whole data set, as can be seen in fig. series 1= training set ; series 2=test set ; series1, series2. the training and test molecule utilized in generation of the best statistical model which were further helpful in exploring novel compound. thus, the dataset after dividing into the training and test set considered as appropriate for the purpose of hqsar model development. thus hqsar gave an insight into the quantitative role in determination of the chemical structural features in modulating antidiabetic activity in terms of favourable and unfavourable maps. hqsar models were generated on resultant series of dpp iv inhibitors activity (table 1). hqsar correlates pharmacological activity of dataset to structural fragments of selected series. in the hqsar analysis several parameters were available slight changes in the parameter affects the results thus tried on different ways. as hqsar models can be generated by a number of parameters concerning hologram generation, several combinations of fragment distinction were considered during the hqsar modeling runs. holograms were created using different combinations of atoms (a), bonds (b), connections (c), hydrogen atoms (h), chirality (ch), and donor and acceptor (da) as fragment distinctions. we performed the hqsar analyses by screening the 12 default series (53, 59, 61, 71, 83, 97, 151, 199, 257, 307, 353 and 401) of hologram length values ranging from 53 to 401 bins, initially using the fragment size default (47). the patterns of fragment counts from the training set inhibitors were related to the experimental biological activity using the partial least square pls analysis. the 16 combination which were selected for analysis as a / b, a / b / c, a / b / h, a / b / ch, a / b / da, a / b / c / h, a / b / c / ch, a / b / c / da, a / b / h / ch, a / b / h / da, a / b / ch / da, a / b / c / h / da, a / b / c / h / da, a / b / c / h / da, a / c / h / da and a / c / h / ch / da. the statistical results obtained from pls validation analyses using several fragment distinction combinations and the default fragment size (47) is presented in table 2. the statistics models of fragment size (4 - 7) on analysis different model were generated on the basis of the statistical parameters the best model selected. according to table 2, the best statistical results among all models using the training set compounds were obtained for model 03 (r=0.971, q=0.971, bhl 353, nc 6), which was resultant using the following combination of fragment distinctions : a, b, and c, with six being the optimum number of pls components. this indicates that bonds, connections and donor and acceptor atoms are essential features of the molecular structures for biological activity. the two best fragment distinction were selected as a / b / c and a / b / da and tried on the different fragment size. in the fragment size on 13 different fragments size with selected fragment distinction a / b / c and a / b / da for further study started. the influence of fragment size is of primary importance in the generation of hqsar models, as this parameter controls the minimum and maximum lengths of fragments to be encoded in the hologram fingerprint. hence, distinct fragment size combinations (2 - 5, 3 - 6, 4 - 7, 5 - 8, 6 - 9, 7 - 10, 8 - 11, 2 - 6, 3 - 7, 4 - 8, 5 - 9, 6 - 10 and 7 - 11) were investigated for the best model (model 13, table 3) generated with the fragment size default (47). the hqsar results obtained for several fragment sizes are displayed in table 3, but no improvements were achieved in the statistical parameters. although a measure of internal consistency, available in the forms of q and r, is certainly important and significant, the most valuable test of a qsar model is its ability to predict the activity of compounds not included in the training set. the structure encoded within a 2d fingerprint is directly related to biological activity of molecules within the training set, the high quality hqsar models generated in this study can predict the activity of new structurally - related amino amide analogs from its fingerprint. in this way, the predictive power of the best hqsar model derived from the training set molecules (fragment distinction a / b / c ; fragment size 47, table 1) was assessed by predicting the pic50 values for the test set compounds. the statistical parameters of external validation results are listed in tables 2 and 3, and the graphic results for the experimental versus predicted activities of both compound sets (training and test sets) are displayed in fig. the statistics parameter of fragment size and distinct the training set internal predictivity residual value obtained as difference of the actual and predicted pic50 (table 1), gives idea of the compound of minimum and maximum change in the activity of dataset while prediction of the model. the residual value least obtained for compounds 16 and 32 as 0.005 contains a functional group phenyl so2nh2 and 3 phenyl pyridine. the both compound contains the phenyl ring with the nitrogen atom free as amine and in ring as pyridine. thus the clue obtained after prediction is that if the nitrogen containing ring is attached with the electron donating then the residual value obtained was less and more with the electron withdrawing functional group. the ic50 value for the compound 16, 32 and 33 (45.3, 30.5 and 113.9), predicting value for these compound were 7.33, 7.510 and 7.103, respectively. the range of the pic50 obtained after generation of the suitable model was 7.59 - 6.202 and for residual value was -1.004 - 0.84. the data points have larger residual value, concern to higher difference among actual activity and predicted activity. the correlation of physicochemical parameter and predicted activity of compounds 6 and 33 (fig. 3) have an extreme change in value for one or more leverage predictors parameters, therefore have large effects on the pls analysis therefore predicted value alters rapidly. such removal is seldom acceptable and if performed, must be carefully recoded. in building the models, compound 33 and 6 was treated as an outlier, because including this compound the optimal models yielded a high residual value and poor biological activity respectively. the external validation is trustworthy processes as the test set compounds are completely excluded while the internal predictivity of the training of the model. for external predictivity the test set compound included and final process performed. the very good relation between experimental and predicted pic50 values for the test set compounds indicates the robustness of the hqsar model (rpred=00.91). as seen in table 1, the predicted values fall close to the experimental pic50 values, deviating by less than 0.027, 0.034 and 0.076 log units for 20, 24 and 13 compounds respectively. the hqsar model obtained is reliable and can be used to predict the pharmacological activity of novel compounds within this structural class. besides predicting the pharmacological activity of untested molecules, hqsar models provide important information regarding clues as to what molecular fragments are directly related to pharmacological activity this idea of better understanding can be achieved through a careful interpretation of the chemical structural fragments integrated to the hologram - based qsar models. hqsar models can be graphically represented in the form of contribution maps where the color of each molecular fragment reflects the contribution of an atom or a small number of atoms to the activity of the molecule under study. the contribution map obtained from the hqsar module implemented in sybyl - x 2.0 uses a color scheme to discriminate individual atomic contributions to activity. the colors encoded in structure fragment at the red end of the spectrum (red, red - orange and orange) reflect poor contributions, whereas colors encoded in structure fragment at the green end (yellow, green - blue and green) reflect favorable contributions the intermediate contributor was helpful in maintaining the common structure only but they are not contributing more towards the activity side. atoms corresponding to the maximal common structure (mcs) are colored cyan, since it is common to all compounds and contributes in the same manner for all molecules in the training set. the most important fragments of compounds 7 and 11 (two of the most potent inhibitors of the data set) along with slight lower activity of compound 8 and 1, the least potent inhibitor of the training set are 3, 4 and 6 presented in fig. 3. according to the contribution maps, the molecular fragments corresponding to the phenyl moiety with cyano group are strongly related to pharmacological affinity (green). we also observed important structural features such as regions with poor contributions (colored in orange and red) that can be identified as potential achieved targets for molecular modification and further creation of sar studies (fig. the color coding is based on the activity contribution of the individual atoms of the molecules. 4 where the bulky and electron donating group were attached to the -amino amide ring define the antidiabetic activity, in addition to the well - known -amino amide. in compound 1, triflouro phenyl ring is marked with yellow color at 3rd position indicates that positive contribution (no bulky group is required). in compound 3, diflouro phenyl ring attached with piperazine is covered with red color at 3rd position indicates negative contribution (electron donating group is required). in compound 4 the 4 hydroxyl ethyl phenyl ring attached with piperazine is marked with red color at 3rd position indicates negative contribution (that electron donating group is required). in compound 6 the bis phenyl ring attached with piperazine is marked with red color at different position indicates negative contribution (that electron donating group is required). in compound 7 the 2-cyano phenyl ring attached with piperazine is marked with green color at 1st and 4th position indicates positive contribution (that bulky group is required to increase the biological activity). the piperazine ring also contains the green color indicates positive contribution (requirement of bulky group). in compound 8 the 4-cyano phenyl ring attached with piperazine is marked with yellow color at 1st and 3rd position indicates positive contribution (no bulky group is essential to increase the biological activity). the piperazine ring also contains the yellow color indicates positive contribution (requirement of no bulky group). in compound 11 the piperazine is marked with yellow color at 1st and 5th position indicates positive contribution (that no bulky group is required to increase the biological activity). the piperazine ring also contains the green color at 2nd and 6th indicates positive contribution (necessity of bulky group). the amino ketone contains the yellow color indicates positive contribution (no bulky group attached on specified position). the compound 7 shows the positive contribution, compound 1, 8 and 11 indicates moderate contribution and compound 3, 4 and 6 shows negative contribution (fig. 5. the compounds 1, 3, 4, 6, 7, 8 and 11 contributing map. the color encoded (a) and structural fragment contribution (b) for activity. the green and yellow color (represents positive contribution), white color (indicates intermediate or moderate contribution) while red and orange (negative contribution), suggested the structure fragment requirement for enhancing the binding affinity. the present study describes the successful application of computational approaches to identify essential structural requirements in 3d chemical space for the modulation of antidiabetic activity of substituted -amino amide. applied hqsar effectively to rationalize the 3d space in diverse substituted -amino amide in terms of their steric, electrostatic and hydrophobic interaction for their antidiabetics activity. the developed models showed good statistical significance in internal validation (q), external validation (r) and performed very well in predicting the antidiabetic activity of eight substituted -amino amide in the test set. hqsar study based sets provided the 2d sub - structural requirements and showed good statistical significance in internal validation (r) as well as predicting very well the antidiabetic activity of the test set compounds. the hqsar models were generated using the different fragment size combined with various fragment distinct and various hologram lengths as summarized in tables 2 and 3. the model with 4 - 7 fragments with an r value of 0.971 at six components and 353 hologram lengths was selected. in order to further analyse this, the dataset was divided into the training and 8 test set as in studies in order to access the predictive values of the model. the observed q and r value 0.971 and 0.971 between actual and predicted pic50 of the training and test set, respectively, further signified the quality of the model. the predictive pic50 values of the training as well as test set molecules based on the hqsar model generated. an attractive property of the qsar technique is that it provides straightforward clues about the individual atomic contributions to biological activities through the use of different color codes. the piperazine ring on 3rd position is marked with red colour indicating the necessity of electron donating group and trfluoro phenyl ring not required the bulky group at 3rd position. the amide moiety contains the yellow colour it means that it does nt requires the bulky sustituents. the three structures were designed (r=(ch2)2c6h5, (ch2)3c6h5 and (ch2)4c6h5) on the basis of hqsar showed in the fig 5 with good predicted pic50. | comparative study was performed on 34 -amino amide derivatives as dipeptidyl peptidase iv inhibitors in order to determine their structural requirement to enhance the antidiabetic activities. hologram quantitative structure activity relationships models utilized specialized fragment fingerprints (hologram length 353) which showed good predictivity with cross - validated q2 and conventional r2 values of 0.971 and 0.971, respectively. models were validated and optimized by a test set of eight compounds and gave satisfactory predictive ability. hologram quantitative structure activity relationships maps were helpful in prediction of the structural features of the ligands to account for the activity in terms of positively and negatively contributing towards activity. the information obtained from maps could be effectively use as a guiding tool for further structure modifications and synthesis of new potent antidiabetic agents. |
initial research on informality viewed it as economic practice beyond the reach of the state, connected to the income generation activities of the urban sub - proletariat seek[ing ] informal means of increasing their incomes (hart, 1973 : 67). subsequent scholarship broadened the concept to include unregulated land - use (e.g. informal settlements) and service systems (e.g. water and waste management). paradoxically, then, while some scholars identify activities and spaces as informal if they are beyond the reach of the state, others argue that the state actively produces informality. in both of these formulations this article suggests that a focus on the state can hinder our understanding of informality, and it makes this claim with a focus on the role played by middle - class associations in regulating informal - sector street hawkers and waste collectors in delhi, india. in many affluent neighbourhoods in delhi, door - to - door delivery of basic foodstuffs and the collection of waste has become so routinized that the rigid distinction between formal / informal commerce has broken down. while middle - class associations can not lawfully charge street hawkers or wastepickers a fee to operate, such practices are widespread and institutionalized, and as such they serve to sanction hawkers and wastepickers use of space while also shielding them from formal regulations and low - level municipal officials. given these citizen - led practices, it is misleading to privilege the state as the primary reference point for identifying and understanding informality. instead, an understanding of informality should be broadened to account for the ways in which middle classes and other influential non - state actors also sanction the informal use of space and services. middle classes rarely appear in accounts of informality, largely because of the scholarly preference for studying producers rather than consumers of informal services. this bias may be a product of the longstanding concern with defining who or what exactly should be considered informal. such debates involved more than proposing typologies (hart, 1973). a number of international organizations set about devising ways to measure informality, and by the 1980s the international labour organization had established itself as the primary source of standardized country - level data on the informal economy (elyachar, 2003). despite the work of statisticians to render the informal visible, measurable and comparable, their efforts failed to provide policy makers or scholars with useful categories for differentiating the formal and the informal. portes (1983 : 156) anticipated the limitations of prevailing formulations of informality, noting that the classification of people / activities as informal was imprecise because it included entrepreneurs and their workers, self - employed artisans and merchants, disguised wage laborers subcontracted by formal firms, and direct subsistence workers. he further argued (portes, 1983 : 156) that that by looking for a rigid dividing line between the formal and informal, scholars failed to understand that informal practices were part and parcel of a single economic system. an impetus for both the definitional and conceptual rethinking of informality came from the neoliberal economist hernando de soto s (1989) efforts to expand the concept to include land - use. with a focus on the ways in which land is occupied and evolves into informal settlements in cities of the developing world, he found informality is a potential source of growth rather than a barrier. but in order to unleash its pent - up energy, he also argued that regulations must be rolled back and bureaucracies weakened. thus, informality went from being a narrowly - defined set of economic activities that hindered growth, to a broad set of practices surrounding economic activity and land - use with the potential to foster economic growth. scholars struggling with theory developed in the global north to understand urbanization in the global south further broadened the scholarly conceptualization of informality. in their landmark volume, alsayyad and roy (2004 : 1) diverge from de soto s view of the state, and demonstrated that governments actively facilitated activities and land - use hitherto considered informal. roy (2009 : 82) went so far as to identify informality as an idiom of urbanization in india, in the sense that legal norms and forms of regulation are in and of themselves permeated by the logic of informality. this insight complements research on urbanization in india that demonstrates how the state, operating through a mixture of formal and informal channels, imposes formal land - use regulations selectively (bjrkman, 2014 ; ghertner, 2010 ; johnston, 2014). more recently, the sectoral domains in which informality operates have been broadened further to include service provision. incomplete urban infrastructure systems are a lasting legacy of colonialism (gandy, 2004 ; mcfarlane and rutherford, 2008), and scholarship has shown that in response, informal networks facilitate the supply of water in many cities (see de alba, this issue ; gopakumar, 2014 ; graham., 2013). similarly, formal waste management systems are complemented by vast informal systems in many cities, with the two interlinked and difficult to disentangle (schindler and kishore, 2015). all in all, urban informality is now broadly defined and includes economic activity, land - use and service provision in which these spheres oftentimes overlap in a plethora of configurations. in the remainder of this article, i draw on my own fieldwork to suggest that when it comes to service provision, the state is only one actor among many that seeks to govern cities. stated differently, localized governance regimes are as likely to be constructed and imposed by non - state actors as the state. in particular, i argue that middle - class associations play an important role sanctioning informal economic activity, regulating space, and managing localized service provision. the data come from 10 months of fieldwork in 2011 and follow - up visits in 2012 and 2013 in delhi, india. during my visits i researched street hawking and volunteered with an ngo whose activities support wastepickers in various ways. both groups are considered a threat to public order ; yet in both instances, members of the middle class are eager to take advantage of the cheap services they offer. thus, middle - class associations sought to render street hawkers and waste collectors non - threatening by reworking and regulating urban space in ways that structure the terms of their interactions. in fact, the regimes imposed by these middle - class associations became institutionalized to such an extent that it makes little sense to refer to them as informal, even as their actions vis - a - vis informal service providers also challenged the latter s own informal status. informality in urban india is a constantly moving constellation of activities whose relationship with public - sector bureaucracies and private - sector enterprises can shift over time and in space. in many cases an activity s designation as informal simply indicates an absence of a state - issued licence. for example, unlicensed street hawkers may be subjected to raids by municipal authorities, but their activities can suddenly be formalized with a favourable court ruling. the boundary between formal / informal is contested by a range of interest groups, such that the definition of informality is ever - shifting and what is deemed informal today may be formal tomorrow or vice versa (bjrkman, 2014 ; schindler, 2014a). informal about a particular economic activity, but rather, the boundary between formal and informality is blurry, fluid and determined by a corpus of regulations, court rulings, enforcement practices, and efforts to skirt regulations. while the boundary between formal and informal is blurry, even so, many are able to operate, and hence earn a livelihood, precisely because of their relationship with middle - class associations. in the context of urban india the term middle class is contested (see lemanski and lama - rewal, 2013), but there is a general consensus that a new class has emerged or at least grown considerably whose newness refers to a process of production of a distinctive social and political identity that represents and lays claim to the benefits to liberalization (fernandes, 2006 : xviii). this class is highly visible : its members live in exclusive gated communities that are remaking skylines, their expensive imported automobiles are ubiquitous in snarled traffic, and they conspicuously consume in high - profile shopping centres. in addition, india s new middle class is increasingly politically assertive in its attempt to influence the transformation of the city, while it is also dependent on cheap services provided informally (e.g. drivers, nannies, waste collectors, domestic servants, street hawkers, gardeners, security guards, clothes washers, parking attendants and so on). associations representing the new middle class regulate activity and urban space in ways that allow their members to benefit from the availability of cheap, informal - sector services such as street hawking and waste collecting, but circumscribe informal - sector workers use of space. delhi residents are legally obliged to deposit waste in neighbourhood depots, where its removal becomes the responsibility of municipal authorities who are increasingly reliant on private - sector waste management enterprises (municipal corporation of delhi act, 1957). in reality, delhi s public - sector solid waste management services have a spotty track record, so there are between 150,000 and 200,000 informal - sector waste workers in delhi hereafter wastepickers whose labour has historically augmented municipal efforts to manage waste (chaturvedi and gidwani, 2011). most work independently or in teams and have standing agreements with buyers of recyclable materials, while some are contracted by middlemen. the most comprehensive study of delhi s informal waste sector showed that it exhibits a rigid division of labour, with individuals specializing in particular materials or activities such as segregating, collecting or processing (gill, 2010). according to gill (2010 : 99), wastepickers throughout the industry face regular interference from police and security guards in residential colonies. not only is this interference a result of rent - seeking by those powerful enough to determine how and by whom urban space is used, but as demonstrated below, it is also a result of middle - class associations seeking to impose order within their environs. given the inability of the public waste management system to collect and process delhi s waste, middle - class residents are dependent on the services offered by wastepickers. in one focus group discussion with representatives of market traders in an affluent satellite city on delhi s outskirts, there was unanimity that public officials were unable to manage the city s waste, but disagreement over whether the state was unaccountable or incompetent : the government people, you tell them that there s a problem with the garbage collection. they will buy the best of the trucks, but just after one or two years you will find that [the trucks ] are broken. another participant agreed that municipal efforts to manage waste were inadequate, but insisted that part of the problem was that i intervened and asked if waste was disposed of haphazardly by local residents, and municipal authorities failed to collect it, how was it collected at all ? one participant explained that somehow or other waste is collected, and the conversation shifted to the complex arrangements that the participants developed with informal - sector waste collectors in the market and their neighbourhoods. these arrangements varied from place to place, but there were two underlying principles in all the agreements. first, the composition and volume of waste determined whether wastepickers paid or were paid to collect waste. one participant explained that in most of the western world the segregation of garbage is done on the basis of degradable and bio - degradable. here there s only one factor, valuable and non - valuable. wastepickers pay to collect waste composed of a large amount of recyclable material (e.g. plastic, metal and paper), while they are paid to collect waste that is primarily organic or inert (i.e. non - recyclable). the market generated a significant amount of recyclable waste, much sought after by wastepickers, but participants in the focus group explained that there was a constant struggle to ensure that wastepickers also collected organic waste. all of the agreements between middle - class residents and traders only covered waste collection and removal ; none of them addressed disposal. once waste was collected, wastepickers segregated the recyclable from non - recyclable material, but they had little incentive to dispose of it at the dumping grounds designated by municipal authorities because attendants there charged a fee. middle - class residents and wastepickers were in agreement that this system made little sense the former was incensed by haphazard disposal of waste throughout the city, while the latter complained of constant pressure from low - level officials to pay bribes. unlike older residential communities in delhi, the neighbouring residential community lacked a depot for residents to deposit their waste. as a result, it had to be collected from residents doorsteps ; and in the absence of an effective public waste management system residents were left with little choice but to contract wastepickers. this was arranged collectively, and since a significant portion of the waste was non - recyclable, each household above the ground floor paid rs 100200 per month. security was a primary concern among residents, and while the community was originally not gated the resident welfare association had erected metal gates to the consternation of residents from the neighbouring community because it limited their access to a main thoroughfare. wastepickers were provided with identification, which was inspected by security guards stationed at the entrances of the community. while wastepickers provided the only waste removal services in the community, they were also subject to suspicion as the conversation below demonstrates : many of these ragpickers who collect this garbage early in the morning, they are more interested in finding some opportunity where they can pick up something from inside the house. it is a kind of disguise. i have experienced this, in my home also there was a burglary some years back. you know these rag pickers, they come at such an early hour, it s very difficult to do policing at that hour, and you know what they do, they just go inside the houses, pick up things. if you detain them, you see, they know all their human rights, have the agencies which will come to the police station [to help them ]. residents developed a licensing system in an effort to reconcile their goals of maintaining security and ensuring waste removal. the wastepickers who worked in this colony expressed satisfaction with the arrangement because it guaranteed monthly income. the use of security guards was highly effective at prohibiting entry of anyone who was an unlicensed non - resident. one security guard beamed with pride as he explained that there had not been a single complaint regarding security in five years. the licensing system is not limited to wastepickers but includes other informal service sector workers. for example, in the centre of the community is a small field in which a tailor sits most days with a pedal - operated sewing machine. thus, the residents of this community managed to modify the built environment (i.e. erect gates) and impose a localized regulatory regime that determined who could enter and circulate through their community. the limits to their control were evident : the land directly behind the community had become an informal landfill where wastepickers disposed of non - recyclable waste. the inability of residents to control this land highlighted both the fragility of their control over urban space as well as the patchwork nature of space in delhi. in conclusion, the absence of effective formal solid waste management services motivated middle - class delhi residents to interact with wastepickers. arrangements became unique and localized, with their exact terms determined by the composition of waste (i.e. the proportion of recyclable material). as such, the local community was forced to pay wastepickers to collect their waste because it was primarily organic. residents sought to impose rules that would ensure their waste was removed while maintaining control over who circulated within their environs. residents were able to enforce a licensing regime because they had erected gates and stationed security guards at the entrances to their community. meanwhile, limits to their control of urban space were evidenced by the emergence of an informal dumping ground behind the community. the juxtaposition of an affluent neighbourhood bordering a de facto landfill is an example of splintering urban space par excellence, produced as a result of the arrangements forged between wastepickers and residents. retail in india is largely informal, and in delhi approximately 500,000 street hawkers sell a range of goods from food to household goods and decorative items (joseph., 2008 ; sewa, 2012). the vast majority of street hawkers are unlicensed and hence they run the risk of having their goods confiscated in raids conducted by municipal officials. the criminalization of street hawkers is heightened in certain areas where authorities hope to showcase a clean and green, world - class vision of urban transformation (dupont, 2011 ; truelove and mawdsley, 2011). periodic raids conducted by municipal authorities are the primary threat to street hawkers, and in order to limit risk and gain access to urban space they must navigate physical barriers and a plethora of overlapping governance regimes established by non - state actors. unlike municipal officials who steadfastly resist legally sanctioning of street hawkers use of urban space, associations that represent the middle class facilitate street hawkers access to urban space in exchange for their adherence to a strict code of conduct regarding their demeanour and appearance, when they can operate, how much they can charge for their products and so on (schindler, 2014b). in one bustling market in a rather affluent area of south delhi, large crowds are drawn by the range of products offered from cheap imitations of branded goods to luxury wedding garments. street food stalls dish out local favourites just steps away from a kfc outlet. the traders association seeks to maintain the character of the market, which means allowing a certain number of street hawkers to operate. the president of the market s largest traders association explained that from our level [the ] market should be neat and clean, shop person should be neat and clean. you ll items here, you ll get fruits, all items you re getting, even textiles, jewellery, medicine. your hawkers are there, rich people, all are there. thus, the traders association considers hawkers an integral part of the market, and it seeks to regulate their activity and number. the president of the association explained that we are a little bit strict with the hawkers. moreover we have some security guard outside, instructing them not to harass any customers. while hawkers are subjected to the regulations imposed by the market traders and enforced by private security guards on an everyday basis, they must be wary of municipal authorities who carry out periodic raids, typically once per week, in search of unlicensed hawkers. during these raids the vast majority escape to nearby alleyways and parks, only to return after the departure of authorities. these raids inevitably disrupt commerce, which partly explains why the market traders association opposes them. it affects our business whenever the mcd [municipal corporation of delhi ] or different people come [to raid the market ] moreover, the customers get harassed what happened here ? why did it happen ? when [a raid ] is there in the market customers get panicked. furthermore, the raids serve as a challenge to the market traders authority to regulate the market. this was illustrated by the opposition of the president of the traders association to a municipal scheme that involved licensing a number of hawkers : mcd has planned to build small stalls inside here, the market, under the direction of the supreme court. supreme court said 2.5% of the population [are hawkers ] they want to build up kiosks around the park [in the centre of the market ]. mcd has planned to build small stalls inside here, the market, under the direction of the supreme court. supreme court said 2.5% of the population [are hawkers ] they want to build up kiosks around the park [in the centre of the market ]. the hawkers who work in this market are somewhat cynical about the payments they have to make to middlemen in order to operate. when pressed about who she pays, one female hawker just shrugged and said everybody takes [money]. the fee for operating in the market varies according to a range of factors, such as a hawker s age, gender and what they sell. while most hawkers considered the fee rather high, they were not opposed to the system in principle because it provided a secure livelihood. one hawker explained that if there were no restrictions everyone who is unemployed would become a vendor. echoing the president of the market traders association, hawkers valued the heavy foot traffic within the market. one hawker who sold socks and had previously worked at another market explained that as a result of the limited number of hawkers who operate in the market he is able work fewer hours : over here i come at 2, i work until 9. but in the previous location i would have had to work from early morning [to earn the same amount of money]. another hawker explained : in the shopping mall they sell [these products ] for more. that does not make a difference to me, there are so many people in this world, they do nt all go to the same place. some feel products here are nice, some feel products there are nice people who come here are not just the people with money, there are different kinds of people coming here. in the shopping mall they sell [these products ] for more. that does not make a difference to me, there are so many people in this world, they do nt all go to the same place. some feel products here are nice, some feel products there are nice people who come here are not just the people with money, there are different kinds of people coming here. this hawker directed his ire at municipal authorities, a sentiment that was nearly universal among hawkers within the market. a similar arrangement obtained in a nearby neighbourhood, in which hawkers paid a fee to a resident welfare association (rwa) for permission to sell door - to - door. in this case, however, there were far fewer hawkers and they were required by the rwa to undergo a thorough licensing procedure (licences listed identifiable marks on hawkers bodies). hawkers who had operated in the neighbourhood for years prior to the implementation of the licensing system were favoured ; and in comparison to the market, the fee was trivial because the primary concern of residents was to regulate those who entered their neighbourhood. a candidate contesting an election for the hawker menace was ever - present, and this explained the rwa s regulation of the practice. since the licence was not issued lawfully it could be revoked by the rwa at any time. thus, hawkers were forced to maintain a peaceful disposition, because, as one hawker explained : if they make one call in a minute you have to move. nevertheless, the hawkers were satisfied with these terms because the system limited competition from unlicensed hawkers and municipal authorities did not patrol the neighbourhood. although there was near universal agreement among residents that hawkers provided a valuable service and that hawking should be regulated, disagreement ensued over various aspects of the regulatory regime, often impacting association politics. one candidate for the rwa election explained that only residents on one side of the neighbourhood had invested in security, and unlicensed hawkers were able to enter the other side. this created tension among residents because those who had invested in security felt others were free - riding and that the neighbourhood remained unsafe. these conflicts translated into political disagreement which influenced the rwa and how it chose to regulate the neighbourhood. for example, one citizen candidate faced opposition to an idea of constructing a toilet for informal service sector workers within the colony, forcing her to acknowledge that it could result in other problems for the rwa : where to build it ? who will maintain it ? then people go there and start doing some [bad ] things. and while residents and hawkers were satisfied with the licensing system in principle, other hawkers took advantage of the absence of security in half of the neighbourhood to operate without approval from the rwa. one unlicensed hawker claimed that because he sold household products (e.g. soap) he did not have regular customers who purchased from him daily like some of the hawkers who sold fruit. he thus had to operate in numerous neighbourhoods, all of which had similar licensing schemes, thus forcing him to purchase multiple licences. in both the market and the neighbourhood, the police had erected metal detectors and metal gates at some of the entrances. while the metal detectors where perpetually out of order, they served to mark the boundary of the market for the hawkers. beyond the gates hawkers did not pay to operate, yet by operating in the shadow of the market they avoided detection by municipal authorities. one hawker who sold bangles outside the gates of the market claimed that he used to work in another south delhi market but had the good fortune of obtaining a licence to operate because of a disability. however, he claimed that his licence was not recognized by the middleman who collected fees for operating within that market ; and when he complained to police, they demanded bribes to help him assert his lawful right to operate. if these assertions are true, then they demonstrate that it can be easier and cheaper for hawkers to operate in the shadows than to operate legally. hawkers operating there were less exposed to authorities than they would be on a main road, even as they were not forced to obtain a licence from the rwa. according to one fruit vendor whose stall sat outside the gates of the neighbourhood, there was little reason to pay for the privilege of selling door - to - door : what s there to a licence ? i ll earn whether i m inside or outside. another hawker received orders by phone for milk and other perishable goods from residents, employing a boy to deliver them. this was only possible because he had established a rapport with many of the residents over a period of years. in these examples, hawkers operated without sanction from authorities or a local powerbroker, thus reducing their operating costs. but it remains unclear if, in the long term, they are at a disadvantage in comparison to their peers working in the market and gated neighbourhood. delhi residents are legally obliged to deposit waste in neighbourhood depots, where its removal becomes the responsibility of municipal authorities who are increasingly reliant on private - sector waste management enterprises (municipal corporation of delhi act, 1957). in reality, delhi s public - sector solid waste management services have a spotty track record, so there are between 150,000 and 200,000 informal - sector waste workers in delhi hereafter wastepickers whose labour has historically augmented municipal efforts to manage waste (chaturvedi and gidwani, 2011). most work independently or in teams and have standing agreements with buyers of recyclable materials, while some are contracted by middlemen. the most comprehensive study of delhi s informal waste sector showed that it exhibits a rigid division of labour, with individuals specializing in particular materials or activities such as segregating, collecting or processing (gill, 2010). according to gill (2010 : 99), wastepickers throughout the industry face regular interference from police and security guards in residential colonies. not only is this interference a result of rent - seeking by those powerful enough to determine how and by whom urban space is used, but as demonstrated below, it is also a result of middle - class associations seeking to impose order within their environs. given the inability of the public waste management system to collect and process delhi s waste, middle - class residents are dependent on the services offered by wastepickers. in one focus group discussion with representatives of market traders in an affluent satellite city on delhi s outskirts, there was unanimity that public officials were unable to manage the city s waste, but disagreement over whether the state was unaccountable or incompetent : the government people, you tell them that there s a problem with the garbage collection. they will buy the best of the trucks, but just after one or two years you will find that [the trucks ] are broken. another participant agreed that municipal efforts to manage waste were inadequate, but insisted that part of the problem was that i intervened and asked if waste was disposed of haphazardly by local residents, and municipal authorities failed to collect it, how was it collected at all ? one participant explained that somehow or other waste is collected, and the conversation shifted to the complex arrangements that the participants developed with informal - sector waste collectors in the market and their neighbourhoods. these arrangements varied from place to place, but there were two underlying principles in all the agreements. first, the composition and volume of waste determined whether wastepickers paid or were paid to collect waste. one participant explained that in most of the western world the segregation of garbage is done on the basis of degradable and bio - degradable. here there s only one factor, valuable and non - valuable. wastepickers pay to collect waste composed of a large amount of recyclable material (e.g. plastic, metal and paper), while they are paid to collect waste that is primarily organic or inert (i.e. non - recyclable). the market generated a significant amount of recyclable waste, much sought after by wastepickers, but participants in the focus group explained that there was a constant struggle to ensure that wastepickers also collected organic waste. second, all of the agreements between middle - class residents and traders only covered waste collection and removal ; none of them addressed disposal. once waste was collected, wastepickers segregated the recyclable from non - recyclable material, but they had little incentive to dispose of it at the dumping grounds designated by municipal authorities because attendants there charged a fee. middle - class residents and wastepickers were in agreement that this system made little sense the former was incensed by haphazard disposal of waste throughout the city, while the latter complained of constant pressure from low - level officials to pay bribes. unlike older residential communities in delhi, the neighbouring residential community lacked a depot for residents to deposit their waste. as a result, it had to be collected from residents doorsteps ; and in the absence of an effective public waste management system residents were left with little choice but to contract wastepickers. this was arranged collectively, and since a significant portion of the waste was non - recyclable, each household above the ground floor paid rs 100200 per month. security was a primary concern among residents, and while the community was originally not gated the resident welfare association had erected metal gates to the consternation of residents from the neighbouring community because it limited their access to a main thoroughfare. wastepickers were provided with identification, which was inspected by security guards stationed at the entrances of the community. while wastepickers provided the only waste removal services in the community, they were also subject to suspicion as the conversation below demonstrates : many of these ragpickers who collect this garbage early in the morning, they are more interested in finding some opportunity where they can pick up something from inside the house. it is a kind of disguise. i have experienced this, in my home also there was a burglary some years back. when i talked with the police guy he said you know these rag pickers, they come at such an early hour, it s very difficult to do policing at that hour, and you know what they do, they just go inside the houses, pick up things. if you detain them, you see, they know all their human rights, have the agencies which will come to the police station [to help them ]. residents developed a licensing system in an effort to reconcile their goals of maintaining security and ensuring waste removal. the wastepickers who worked in this colony expressed satisfaction with the arrangement because it guaranteed monthly income. the use of security guards was highly effective at prohibiting entry of anyone who was an unlicensed non - resident. one security guard beamed with pride as he explained that there had not been a single complaint regarding security in five years. the licensing system is not limited to wastepickers but includes other informal service sector workers. for example, in the centre of the community is a small field in which a tailor sits most days with a pedal - operated sewing machine. thus, the residents of this community managed to modify the built environment (i.e. erect gates) and impose a localized regulatory regime that determined who could enter and circulate through their community. the limits to their control were evident : the land directly behind the community had become an informal landfill where wastepickers disposed of non - recyclable waste. the inability of residents to control this land highlighted both the fragility of their control over urban space as well as the patchwork nature of space in delhi. in conclusion, the absence of effective formal solid waste management services motivated middle - class delhi residents to interact with wastepickers. arrangements became unique and localized, with their exact terms determined by the composition of waste (i.e. the proportion of recyclable material). as such, the local community was forced to pay wastepickers to collect their waste because it was primarily organic. residents sought to impose rules that would ensure their waste was removed while maintaining control over who circulated within their environs. residents were able to enforce a licensing regime because they had erected gates and stationed security guards at the entrances to their community. meanwhile, limits to their control of urban space were evidenced by the emergence of an informal dumping ground behind the community. the juxtaposition of an affluent neighbourhood bordering a de facto landfill is an example of splintering urban space par excellence, produced as a result of the arrangements forged between wastepickers and residents. retail in india is largely informal, and in delhi approximately 500,000 street hawkers sell a range of goods from food to household goods and decorative items (joseph., 2008 ; sewa, 2012). the vast majority of street hawkers are unlicensed and hence they run the risk of having their goods confiscated in raids conducted by municipal officials. the criminalization of street hawkers is heightened in certain areas where authorities hope to showcase a clean and green, world - class vision of urban transformation (dupont, 2011 ; truelove and mawdsley, 2011). periodic raids conducted by municipal authorities are the primary threat to street hawkers, and in order to limit risk and gain access to urban space they must navigate physical barriers and a plethora of overlapping governance regimes established by non - state actors. unlike municipal officials who steadfastly resist legally sanctioning of street hawkers use of urban space, associations that represent the middle class facilitate street hawkers access to urban space in exchange for their adherence to a strict code of conduct regarding their demeanour and appearance, when they can operate, how much they can charge for their products and so on (schindler, 2014b). in one bustling market in a rather affluent area of south delhi, large crowds are drawn by the range of products offered from cheap imitations of branded goods to luxury wedding garments. the traders association seeks to maintain the character of the market, which means allowing a certain number of street hawkers to operate. the president of the market s largest traders association explained that from our level [the ] market should be neat and clean, shop person should be neat and clean. you ll items here, you ll get fruits, all items you re getting, even textiles, jewellery, medicine. your hawkers are there, rich people, all are there. thus, the traders association considers hawkers an integral part of the market, and it seeks to regulate their activity and number. the president of the association explained that we are a little bit strict with the hawkers. moreover we have some security guard outside, instructing them not to harass any customers. while hawkers are subjected to the regulations imposed by the market traders and enforced by private security guards on an everyday basis, they must be wary of municipal authorities who carry out periodic raids, typically once per week, in search of unlicensed hawkers. during these raids the vast majority escape to nearby alleyways and parks, only to return after the departure of authorities. these raids inevitably disrupt commerce, which partly explains why the market traders association opposes them. it affects our business whenever the mcd [municipal corporation of delhi ] or different people come [to raid the market ] moreover, the customers get harassed what happened here ? why did it happen ? when [a raid ] is there in the market customers get panicked. furthermore, the raids serve as a challenge to the market traders authority to regulate the market. this was illustrated by the opposition of the president of the traders association to a municipal scheme that involved licensing a number of hawkers : mcd has planned to build small stalls inside here, the market, under the direction of the supreme court. supreme court said 2.5% of the population [are hawkers ] they want to build up kiosks around the park [in the centre of the market ]. mcd has planned to build small stalls inside here, the market, under the direction of the supreme court. supreme court said 2.5% of the population [are hawkers ] they want to build up kiosks around the park [in the centre of the market ]. the hawkers who work in this market are somewhat cynical about the payments they have to make to middlemen in order to operate. when pressed about who she pays, one female hawker just shrugged and said everybody takes [money]. the fee for operating in the market varies according to a range of factors, such as a hawker s age, gender and what they sell. while most hawkers considered the fee rather high, they were not opposed to the system in principle because it provided a secure livelihood. one hawker explained that if there were no restrictions everyone who is unemployed would become a vendor. echoing the president of the market traders association, hawkers valued the heavy foot traffic within the market. one hawker who sold socks and had previously worked at another market explained that as a result of the limited number of hawkers who operate in the market he is able work fewer hours : over here i come at 2, i work until 9. but in the previous location i would have had to work from early morning [to earn the same amount of money]. another hawker explained : in the shopping mall they sell [these products ] for more. that does not make a difference to me, there are so many people in this world, they do nt all go to the same place. some feel products here are nice, some feel products there are nice people who come here are not just the people with money, there are different kinds of people coming here. in the shopping mall they sell [these products ] for more. that does not make a difference to me, there are so many people in this world, they do nt all go to the same place. some feel products here are nice, some feel products there are nice people who come here are not just the people with money, there are different kinds of people coming here. this hawker directed his ire at municipal authorities, a sentiment that was nearly universal among hawkers within the market. a similar arrangement obtained in a nearby neighbourhood, in which hawkers paid a fee to a resident welfare association (rwa) for permission to sell door - to - door. in this case, however, there were far fewer hawkers and they were required by the rwa to undergo a thorough licensing procedure (licences listed identifiable marks on hawkers bodies). hawkers who had operated in the neighbourhood for years prior to the implementation of the licensing system were favoured ; and in comparison to the market, the fee was trivial because the primary concern of residents was to regulate those who entered their neighbourhood. the hawker menace was ever - present, and this explained the rwa s regulation of the practice. since the licence was not issued lawfully it could be revoked by the rwa at any time. thus, hawkers were forced to maintain a peaceful disposition, because, as one hawker explained : if they make one call in a minute you have to move. nevertheless, the hawkers were satisfied with these terms because the system limited competition from unlicensed hawkers and municipal authorities did not patrol the neighbourhood. although there was near universal agreement among residents that hawkers provided a valuable service and that hawking should be regulated, disagreement ensued over various aspects of the regulatory regime, often impacting association politics. one candidate for the rwa election explained that only residents on one side of the neighbourhood had invested in security, and unlicensed hawkers were able to enter the other side. this created tension among residents because those who had invested in security felt others were free - riding and that the neighbourhood remained unsafe. these conflicts translated into political disagreement which influenced the rwa and how it chose to regulate the neighbourhood. for example, one citizen candidate faced opposition to an idea of constructing a toilet for informal service sector workers within the colony, forcing her to acknowledge that it could result in other problems for the rwa : where to build it ? who will maintain it ? then people go there and start doing some [bad ] things. and while residents and hawkers were satisfied with the licensing system in principle, other hawkers took advantage of the absence of security in half of the neighbourhood to operate without approval from the rwa. one unlicensed hawker claimed that because he sold household products (e.g. soap) he did not have regular customers who purchased from him daily like some of the hawkers who sold fruit. he thus had to operate in numerous neighbourhoods, all of which had similar licensing schemes, thus forcing him to purchase multiple licences. in both the market and the neighbourhood, the police had erected metal detectors and metal gates at some of the entrances. while the metal detectors where perpetually out of order, they served to mark the boundary of the market for the hawkers. beyond the gates hawkers did not pay to operate, yet by operating in the shadow of the market they avoided detection by municipal authorities. one hawker who sold bangles outside the gates of the market claimed that he used to work in another south delhi market but had the good fortune of obtaining a licence to operate because of a disability. however, he claimed that his licence was not recognized by the middleman who collected fees for operating within that market ; and when he complained to police, they demanded bribes to help him assert his lawful right to operate. if these assertions are true, then they demonstrate that it can be easier and cheaper for hawkers to operate in the shadows than to operate legally. hawkers operating there were less exposed to authorities than they would be on a main road, even as they were not forced to obtain a licence from the rwa. according to one fruit vendor whose stall sat outside the gates of the neighbourhood, there was little reason to pay for the privilege of selling door - to - door : what s there to a licence ? i ll earn whether i m inside or outside. another hawker received orders by phone for milk and other perishable goods from residents, employing a boy to deliver them. this was only possible because he had established a rapport with many of the residents over a period of years. in these examples, hawkers operated without sanction from authorities or a local powerbroker, thus reducing their operating costs. but it remains unclear if, in the long term, they are at a disadvantage in comparison to their peers working in the market and gated neighbourhood. i have shown that resident associations representing middle classes play an important role in determining provision of regulated and unregulated services in delhi. localized regimes comprised of middle - class associations, regulatory authorities and service providers confer legitimacy on the work of street hawkers and waste workers and on their capacity to use urban space and provide services. formalization in the treatment of informal providers by middle - class associations, they also expose a fragility in the control exercised by such resident associations, who can be superseded by municipal authorities and challenged by workers. the existence of such practices renders the city into a dynamic institutional kaleidoscope of overlapping jurisdictions. rather than essentializing particular activities (i.e. street hawking) as formal or informal, these activities should be understood as the product of complex relationships. in the cases presented here, negotiated relations between formally registered non - state institutions (i.e. resident welfare associations and market traders associations), on the one hand, and street hawkers and waste collectors, on the other, determined the patterns of these findings suggest that rather than a priori classifying which people or institutions, activities or land - use are labelled (in)formal, a relational approach provides a deeper understanding of actually existing practices that define everyday life of urban residents, and which are produced collectively by multiple actors. likewise, these findings demonstrate that the state is simply one of a number of actors struggling to regulate activity, land - use and service provision in indian cities. although state actors may seek to impose order through formal, legal channels, they are often joined by or pitted against organized non - state actors, like middle - class associations, who also have a position on informality. as such, we must be prepared to analyse and theorize local governance regimes comprised of state and non - state actors, whose combined priorities will sanction and institutionalize economic activity, land - use and service provision and its attendant status as formal or informal. to be sure, further research focused on the co - production and enforcement of such regimes would certainly show that street hawkers and waste collectors are vulnerable to exploitation by state- and non - state actors alike. a focus on relations and regimes imposed by powerbrokers would also leave room for a revamped conceptualization of informality as defined in the context of local negotiations over the rules of space occupation and service provision, rather than as attributable to a certain activity. for example, street hawkers who operate just outside the gates of markets and gated communities exist in limbo : beyond the reach of middle - class associations but close enough that they are not at large and thereby avoid scrutiny from officials. similarly, waste collectors act informally when they surreptitiously dump non - recyclable waste adjacent to affluent communities to the consternation of residents and officials alike. all this suggests that future research should focus on instances in which particular actors (e.g. state officials or non - state associations) are more or less successful at imposing their will, with what potential challenges, and by whom. is the state more likely to foster unregulated service provision (e.g. waste collection) than economic activity (street hawking), and why ? are officials wilfully ceding regulatory control to non - state actors in certain places (e.g. the urban periphery or within gated communities), and where ? these questions will loom large in future research on informality, even as they help reveal the wide range of actors who seek to regulate or legitimize informality in land - use and service provision in urban india and perhaps even elsewhere. | this article presents original research on relations between middle - class residents and informal - sector workers in delhi, india. it shows how middle - class associations used their consumption preferences as well as relationships with local authorities to legitimize the work of street hawkers and waste workers. these findings suggest that the toleration of informality can be traced to governance regimes comprised of both state and non - state powerbrokers. |
cementodentinal junction (cdj) is the area at the interface between cementum and dentin. the attachment of cementum to dentin is said to be due to the presence of adhesive proteoglycans primarily and secondarily due to fiber intermingling fortified by mineralization. studies on cdj have proved that this junctional tissue is a distinct tissue in its own right. the tissue is atubular, has a unique organic matrix and is more mineralized than either cementum or dentin. this junctional tissue plays an important role in periodontal regeneration and it is therefore imperative to develop a detailed understanding of its architecture. pathologic granules have been reported at or near the cdj in periodontally exposed root surfaces. sites at or near the cdj are said to be rich in unmineralized collagen and degradation of this collagen by bacterial toxins penetrating the surface of roots is said to be the etiology of the observed pathologic granules. pathological granules, which are vacuoles due to collagen degradation, are purely light and electron microscopic observations of undemineralized teeth. studying the collagenous architecture of demineralized teeth is likely to throw more light on the pathological alterations of exposed root surfaces at cdj. scanning electron microscopy (sem) is superior to transmission electron microscope (tem) when extended sections of root are to be examined because, with tem, a sample can be viewed not as whole but at one point only, and therefore, we chose sem over tem in our study. the collagenous architecture of cdj of healthy teeth under a sem has been described in a few studies and in the first phase of our study. cdj appears as a fibril poor groove under sem and the width of a healthy cdj is 24 m. a pubmed search revealed no studies pertaining to pathological alterations of fibrous architecture of cdj as observed under sem. the aim and objective of this study was to observe and report the pathological alterations of the fibrous architecture at the cdj in periodontitis - affected teeth under sem. the compositional differences of this tissue in disease are beyond the scope of this study. twenty healthy and periodontitis - affected noncarious teeth were collected and processed. the periodontitis samples comprised teeth with a hopeless prognosis from patients with either chronic or aggressive periodontitis with no prior history of treatment for periodontitis. healthy teeth samples comprised teeth extracted for orthodontic reasons. all extractions were done in department of periodontics. one - half of sample was processed for light microscopy and the other half for sem. extent of demineralization was checked periodically by taking radiographs. when adequate demineralization was confirmed by radiography, the samples were immersed in 2.5% glutaraldehyde in 0.06 m cacodylate buffer (ph 7.4) for a week. the samples were then taken up for sodium hydroxide (naoh) maceration using 10% naoh for 23 days. we followed the methodology that was suggested by yamamoto. in their studies. the macerated specimens were treated with 2% tannic acid (to enhance electron density of elastin and collagen apart from being a fixative and mordant), postfixed in 1% osmium tetroxide (to stabilize proteins during alcohol dehydration). then, they were dehydrated in graded series of alcohol, critical point dried, coated with palladium and examined under a scanning electron microscope. sem was chosen over tem as samples can not be viewed as a whole but are viewed at one particular point only and findings in one point can not be generalized to the whole length of the root. in the first phase of the study, the observations of healthy cdj were reported. the identification of dentinal tissue was possible due to the presence of numerous dentinal tubule openings that were circular in shape [figure 1a ]. the collagen fibers appeared to be inadequately demineralized and ran parallel to dentin surface (in all periodontitis samples). the contact of fibers from dentin and cementum at cdj was mostly point - like in nature. (periodontitis sample) d : dentin, c : cementum, cdj : cementodentinal junction (sem, x750) (b) cementum showing unusual honeycomb appearance (periodontitis sample) (sem, 1000). (c) width at cdj - 8 m (sem, 750). inner surface of cementum (e) fiber intermingling (sem, 1500). (f) mean width measured (sem, 1500) fiber intermingling between dentin and cementum is point - like. extensive criss - cross intermingling of fibers were not observed in both periodontitis samples [figure 1a f ] healthy samples [figure 2a and b ] and. it was observed that the point - like contact was more frequently observed in healthy samples as compared to periodontitis samples. numerous dentinal tubule openings seen, dentin (d) and cementum (c) in close approximation with fiber intermingling. width measured is 4.5 m at cementodentinal junction (cdj) : (a) sem, 1000, (b) sem, 2000 : in all images, collagen fiber architecture was better appreciated in cementum compared to dentin probably because demineralization was uniform and complete in cementum compared to dentin. both the extrinsic and intrinsic fibers and the surface of cementum appear coarser than that in dentin. more fibers from cementum crossed over to dentin [figure 1a e ]. in one sample, we observed an unusual honeycomb - like pattern of collagen architecture [figure 1b ]. the detachment along the entire surface of the root can be appreciated in lower magnifications [figure 3a d ]. width measurement not possible (sem, 120) (b) detachment of cementum present. (d) cementum detachment (sem, 190) the cdj appeared to be a fibril poor groove due to demineralization of the interfacial proteolytic substance. width measurements were possible only in samples where detachment was absent and was measured along two to three sites along the length of the root [figure 1b and e ]. the mean width of the cdj in periodontitis samples was 7.1 as compared to 3.4 in health. the inner surface of cementum could be observed in some samples [figure 1e ]. the identification of dentinal tissue was possible due to the presence of numerous dentinal tubule openings that were circular in shape [figure 1a ]. the collagen fibers appeared to be inadequately demineralized and ran parallel to dentin surface (in all periodontitis samples). the contact of fibers from dentin and cementum at cdj was mostly point - like in nature. (periodontitis sample) d : dentin, c : cementum, cdj : cementodentinal junction (sem, x750) (b) cementum showing unusual honeycomb appearance (periodontitis sample) (sem, 1000). (d) arrow denotes fiber intermingling (sem, 1000). inner surface of cementum (e) fiber intermingling (sem, 1500).. extensive criss - cross intermingling of fibers were not observed in both periodontitis samples [figure 1a f ] healthy samples [figure 2a and b ] and. it was observed that the point - like contact was more frequently observed in healthy samples as compared to periodontitis samples. numerous dentinal tubule openings seen, dentin (d) and cementum (c) in close approximation with fiber intermingling. width measured is 4.5 m at cementodentinal junction (cdj) : (a) sem, 1000, (b) sem, 2000 : in all images, collagen fiber architecture was better appreciated in cementum compared to dentin probably because demineralization was uniform and complete in cementum compared to dentin. both the extrinsic and intrinsic fibers and the surface of cementum appear coarser than that in dentin. more fibers from cementum crossed over to dentin [figure 1a e ]. in one sample, we observed an unusual honeycomb - like pattern of collagen architecture [figure 1b ]. the detachment along the entire surface of the root can be appreciated in lower magnifications [figure 3a d ]. the cdj appeared to be a fibril poor groove due to demineralization of the interfacial proteolytic substance. width measurements were possible only in samples where detachment was absent and was measured along two to three sites along the length of the root [figure 1b and e ]. the mean width of the cdj in periodontitis samples was 7.1 as compared to 3.4 in health. the inner surface of cementum could be observed in some samples [figure 1e ]. periodontally affected teeth undergo significant changes on the root surface as well as at cdj. penetration of bacteria and its products into cementum causes alterations in organic and inorganic contents both on cemental surface and at cdj. on the external root surface of periodontally exposed root surfaces areas of remineralization and necrotic bays are observed. at cdj due to seepage of bacterial products (endotoxins), denaturation of collagen at the cdj the interface at cdj is rich in unmineralized collagen which gets easily denatured and degraded. when collagen and other proteins are lost at the interface, there is a possibility of increase in the width of cdj and subsequent weakening of the junction. it is therefore necessary to understand the pathologic changes at the junction and the probable clinical implications of a weak junctional tissue. the objective of this study was to observe and report the pathological alterations of the collagenous architecture that occurred at cdj in disease. the fibrous architecture of cdj of healthy teeth as observed under scanning electron microscope was described by yamamoto. and they reported the width of healthy cdj as ranging between 2 and 4 which was in accordance with the first phase of our study comprising of healthy samples where the mean width of the samples was 3.9. in this study, we observed an increase in width at cdj throughout the root surface of exposed portions. the mean width of periodontitis samples in our study was 7.1 as compared to 3.9 in healthy samples. frequent detachment of cementum from dentin was another significant observation in our study as compared to healthy samples. of 20 samples, 7 had detached cementum and dentin whereas no detachment was observed in healthy samples for the same period of naoh maceration. the reasons we propose for the detachment observed are : increased denaturation and destruction of unmineralized collagen fibers at interface manifesting as increased width at interfacethough detachment of cementum from dentin is expected to occur in prolonged naoh maceration (r), in our study, detachment was present only in periodontitis samples for the same period of naoh maceration in both healthy and periodontitis samples. the only reason could be the pathologic alterations at cdj in periodontitis samples causing detachmentcementum resorption could have caused thinning of cementum which could have contributed to frequent detachment in periodontitis samples. increased denaturation and destruction of unmineralized collagen fibers at interface manifesting as increased width at interface though detachment of cementum from dentin is expected to occur in prolonged naoh maceration (r), in our study, detachment was present only in periodontitis samples for the same period of naoh maceration in both healthy and periodontitis samples. the only reason could be the pathologic alterations at cdj in periodontitis samples causing detachment cementum resorption could have caused thinning of cementum which could have contributed to frequent detachment in periodontitis samples. a pubmed search revealed no studies describing the pathological alterations of fibrous architecture of cdj using a scanning electron microscope and it was not possible to compare our results with similar studies. based on the observations of our study, the possible clinical implications of a weakened cdj could be as follows. root planing on periodontally affected root surfaces, which attempts to remove diseased and necrotic cementum, could result in complete removal of cementum from root surfaces. with the removal of cementum, are lost cementum attachment proteins that are being increasingly implicated in periodontal regeneration and the barrier function that is being attributed to this interfacial tissue. for regeneration of acellular cementum during these important properties and functions of this junctional tissue at cdj should be kept in mind during mechanical procedures such as root planing. furthermore, the optimal pressure for root planing that removes only necrotic cementum without the risk of complete cementum removal is still to be ascertained. it appears that it is required to develop pressure sensitive curettes for root planing to avoid overzealous root planing which can have a detrimental effect on cdj. we like to propose that it is time to revisit the root planing procedure, as inadvertent root planing can remove this important biological link between the cementum and dentin the interfacial tissue at cdj. | background : the cementodentinal junction (cdj) forms a biological and structural link between cementum and dentin. this biological link is regarded as a distinct tissue in its own right. certain important proteins responsible for periodontal regeneration are said to be present in this tissue. few studies have described the structure and composition of this layer by light and electron microscopy. scanning electron microscopic studies pertaining to cdj in health and disease are few and documentation of periodontal pathological changes of cdj is unclear. in the first phase of our study, the collagenous architecture of cdj of healthy teeth has been reported.aim:the objective of this study is to observe and report periodontal pathological changes in the fibrous or collagenous architecture of cdj of periodontitis - affected teeth and discuss the probable clinical implications of cdj in disease.materials and methods : twenty periodontitis - affected teeth were collected and processed for observing under a scanning electron microscope.results:the results are as follows : increased width of interface at cdj in periodontitis samples (7.1) compared to that of healthy samples ; fewer areas of fiber intermingling at cdj in periodontitis samples as compared to healthy samples ; frequent detachment of cementum from dentin during sodium hydroxide maceration of samples.conclusion:it may be inferred from results that there is a possibility of a definite weakening of cdj in periodontally affected root surfaces and we believe that clinical procedures such as scaling and root planning may have a detrimental effect on the cementodentinal attachment of periodontally involved root surfaces. |
efficient use of operating room (or) time is increasingly important in modern medicine, as delays in patient arrival, induction of anesthesia, surgical positioning, and recovery in the or all increase time in the or not spent operating. computer simulations have determined that or utilization efficiency of 85 to 90% provides the best cost benefit ratio with the lowest patient delays or staff overtime.1 this efficiency is calculated by adding the anesthesia induction and recovery time and the surgical time and the interpatient change over time, and dividing this result by the overall allocated or time. several suggestions have been made in attempts to improve efficiency, including structural changes to the or environment for improved patient flow (rooms for anesthetic induction / recovery separate from the or) to scheduled induction or incision times.2 3 further studies have been concerned with increased anesthesia induction time based on the complexity of anesthetic induction and/or the presence of anesthesia residents.3 4 5 studies suggest that the presence of learners has a very small but significant effect on anesthetic induction time (3 to 5 minutes).4 6 patient - specific factors, including age, american society of anesthesiologists (asa) grade, and body mass index (bmi) have been studied in various surgical disciplines, and age and bmi have been found to increase anesthetic induction times.5 7 8 patients undergoing spine surgery vary in the complexity of their anesthetic induction. some procedures may not require arterial cannulation (such as some single - level diskectomies), but some may require central access, arterial access, and spinal cord monitoring setup and baselines, and patients may have to undergo positioning procedures such as 180-degree flip of the or table while in traction. these factors have significant effects on anesthetized, nonoperative time (total time between intubation and extubation, minus the time between incision and closure). patient - specific factors (age, bmi, asa grade) may also have noticeable effects on these times. in this study, we sought to determine what factors increase this time by utilizing a database of over 5,000 consecutive neurosurgical spine cases at our institution. the surgical records were searched in a retrospective fashion to identify all spine surgeries performed between january 2010 and july 2012. patient demographic and procedural information (table 1) was obtained from the medical record, and anesthetized, nonoperative time was obtained from the anesthesia record by subtracting the incision to closure time from the intubation to extubation time. the anesthesia record is a detailed database of patient information, including vital signs, medications administered, and procedural events recorded at specific times during the operation. when an event such as intubation / extubation or incision / closure is performed, the anesthesiologist records the specific time of the event in the record, allowing for accurate determination of operative events to the minute. this record is kept during all anesthetized cases in the same fashion by all involved anesthesiologists. multiple factors were analyzed, including age, bmi, asa grade (table 2), level of pathology, and surgical approach. abbreviations : asa, american society of anesthesiologists, bmi, body mass index. abbreviation : asa, american society of anesthesiologists. recognizing that fusion operations are often longer and require more anesthesia preparation compared with nonfusion operations, these two procedure types were analyzed separately. the demographic and surgical factors were compared with anesthetized, nonoperative time using student t tests, anova, and multivariate linear regression, with a p value of 0.05 deemed significant. during the interval stated, we identified 5,515 surgical cases. the demographic information is provided in table 1. the mean patient age was 60.5 years (0.2, range 14 to 97) and 3,226 (58%) were male. a fusion procedure was performed in 1,176 (21%) cases, and 11 different surgeons performed these procedures. the level of pathology was predominantly lumbar (4,010 cases, 73%), and the majority of cases were performed via a posterior approach (5,130 cases, 93%). fusion cases had a significantly longer total anesthetized, nonoperative time when compared with nonfusion cases (mean standard error of the mean, fusion : 98 1 minutes, nonfusion : 76 0.5 minutes, mean difference : 22 minutes, p 65 years : 79 0.6 minutes, 65 years was significantly associated with increased nonoperative time (age > 65 years : 102 1.2 minutes, age < 65 years : 96 1.2 minutes, mean difference : 6 minutes, p < 0.01). there were very few asa grade i or iv cases in the fusion cohort ; the few asa grade i cases were included with asa ii cases, and the asa grade iv cases were included with the asa grade iii cases so the comparison was made between asa grade i to ii and asa grade iii to iv. there was a significant increase in nonoperative time between asa i to ii cases and asa grade iii to iv cases (asa i to ii : 95 12 minutes, asa iii to iv : 104 1.8 minutes, mean difference 9 minutes, p < 0.0001). increasing bmi was significantly associated with increased nonoperative time as well (bmi < 25 : 96 1.8 minutes, bmi 25 to 29 : 98 1.8 minutes, bmi 30 to 39 : 99 1.8 minutes, bmi 40 + : 113 4.2 minutes, p < 0.01). both level of pathology and approach were significantly associated with differences in nonoperative time (cervical : 100 1.2 minutes, thoracic : 124 7.2 minutes, lumbar : 95 1.2 minutes, p < 0.0001) and (anterior : 92 1.8 minutes, posterior : 101 1.2 minutes, combined : 123 6 minutes, p < 0.0001). we sought to identify the patient- and procedure - specific factors that have significant effects on anesthetized, nonoperative times in spine surgery. multiple studies have looked at nonoperative or time, attempting to identify factors within the patient flow or anesthesia team that contribute to increased times,1 4 5 6 but few studies have focused on patient- or procedure - specific factors that influence this nonoperative time. some studies have looked into patient - specific factors, identifying age and bmi as important factors in predicting increased anesthetized, nonoperative times,5 7 8 but to our knowledge, this analysis has not been performed in a high - volume, tertiary care spine practice at a major teaching institution. this study has several interesting findings : first, there is an average increase in anesthetized, nonoperative time of 22 minutes when comparing fusion procedures to decompression - only cases. this finding likely represents the extra time required for the complex positioning on specialized surgical tables, the need for more invasive access by the anesthesia team, and the presence of neuromonitoring in some of these cases. there are small but significant increases in nonoperative times as patient age, bmi, and asa grade increase for both fusion and decompression operations, and these findings remained significant on multivariate analysis in both operations. even though the increase seems minimal (minutes), the effect is likely additive, and the time increase becomes very apparent for a 65-year - old obese patient with multiple comorbidities set to undergo a cervical fusion requiring monitoring and a jackson table flip. the level of pathology and approach also influence the nonoperative time for both fusion and decompression operations, with cervical and thoracic levels increasing nonoperative times compared with lumbar pathology for both cohorts. this result may be due to the more complex positioning and the need for monitoring in some of these cases. there is a similar effect noted when an anterior approach is selected over a posterior approach for both cohorts, which may represent the added time required for fluoroscopic imaging prior to skin incision as well as complex positioning required in many of these cases. these nonoperative times are from a large, tertiary care teaching institution, and there is likely significant variation around the world in the anesthetized, nonoperative time surrounding spine surgery. nonetheless, this data does identify patient- and procedure - specific factors that may increase the nonoperative time and represents areas for potential improvement. the early recognition of patients and procedure types that lead to increased nonoperative times could allow the surgeon or anesthesiologist to proactively address this problem. certain basic access lines could be obtained by anesthesia in the preoperative area, and specific patients could be labeled high - efficiency, leading to extra nurse - anesthetist or resident assistance during induction and positioning in the or. this study has several limitations, including the retrospective nature of the analysis and the fact that these cases took place at a large, tertiary care teaching hospital where learners at all stages are present and involved in patient care. the effects of learners on operative and anesthetic times have been studied ; for anesthesia residents, the increase in time is minimal (3 to 5 minutes per induction), and the effect on operative times for surgical residents is conflicting and dependent on procedure type and specialty, with no overall consensus met.4 6 9 10 11 12 13 each group, both fusion and nonfusion, includes a wide variety of cases, involving differing numbers of involved levels and very likely significant differences in patients ' baseline health characteristics, which may increase nonoperative times significantly more than just age or bmi. we attempted to account for this variety with asa grade ; however, this grade is not the best comorbidity index as the asa system is designed mainly for risk of undergoing anesthesia. although surgeon variability was analyzed in this study and did not cause a significant change in the nonoperative times, anesthesiologist variability, presence of a nurse - anesthetist or resident, and type of invasive monitoring required were not independently analyzed and could have effects on the nonoperative times. or efficiency has been studied and attempts have been made to best utilize work - flow changes to increase the efficiency of the or environment. there appear to be patient- and procedure - specific factors that lead to tangible increases in preincisional time in the or, and these factors should be accounted for when or efficiency is being calculated in spine surgery. identification of these variations in operative and anesthetized time in the future should be compared with surgical outcomes to determine if any associations are present. if discovered, changes within the system aimed to decrease nonoperative time could be made in attempt to lessen the risk of complications. patient and surgical factors, such as age, asa grade, bmi, level of pathology, and surgical approach, have noticeable effects on anesthetized, nonoperative times in spine surgery. | study design retrospective study.objective efficient use of operating room time is important, as delays during induction or recovery increase time not spent operating while in the operating room. we identified factors that increase anesthetized, nonoperative time by utilizing a database of over 5,000 consecutive neurosurgical spine cases.methods surgical records were searched to identify all spine surgeries performed between january 2010 and july 2012. anesthetized, nonoperative time was calculated from the anesthesia record and compared with both patient and procedure characteristics to determine any significant relationshipsresults there were 5,515 surgical cases with a mean age of 60.5 and mean body mass index (bmi) of 29.7 ; 3,226 (58%) were male subjects. there were 1,176 (21%) fusion cases, and level of pathology was predominantly lumbar (4,010 cases, 73%). fusion cases had a significantly longer total anesthetized, nonoperative time (fusion : 98 minutes, nonfusion : 76 minutes, mean difference : 22 minutes, p 65 years significantly increased nonoperative time (mean difference 6 minutes, p < 0.01), as did increasing asa (mean difference 9 minutes, p < 0.0001) and increasing bmi.conclusion patient and surgical factors, including asa grade, bmi, level of pathology, and surgical approach, have noticeable effects on anesthetized, nonoperative times in spine surgery. |
endovascular embolization has become a common method for the treatment of intracranial aneurysms in many centers of the usa and europe [1, 2 ]. however, coiled aneurysms present a significant rate of recanalization, which occurs in approximately 20 % of patients [3, 4 ]. due to the possibility of recanalization and the availability of a relatively safe endovascular retreatment, follow - up of coiled aneurysms, digital subtracted angiography (dsa) has been a method of choice for the follow - up of coiled aneurysms. however, several recent studies have proven a high diagnostic performance of magnetic resonance angiography (mra) in detecting the incomplete aneurysm occlusion [815 ]. therefore, due to a low invasiveness and a relatively low cost, mra has been proposed as the first - choice modality for routine follow - up. on the other hand, the question whether time - of - flight mra (tof - mra) or contrast - enhanced mra (ce - mra) is a better method for the imaging of coiled aneurysms remains unresolved. in fact, both techniques present similar specificity and sensitivity in detecting the incomplete occlusion [8, 10 ], but ce - mra offers better imaging of large aneurysm remnants and stented segments [9, 17 ]. apart from detecting the incomplete aneurysm occlusion, follow - up imaging also aims at measuring the aneurysm remnant since the size of residual filling volume is the most important factor that determines the possibility of re - embolization. however, technical differences between tof - mra and ce - mra raise a question of the accuracy of residual volume measurements with these modalities. tof - mra is a flow - detecting modality which highlights blood flowing in limited directions above a threshold of velocity. therefore, tof - mra may be unable to properly detect the actual volume of the residual aneurysm because of significant blood flow turbulence within the coil mesh. the purpose of the study was to test the hypothesis that tof - mra is inadequate for measuring the residual filling volume in the embolized aneurysms and therefore should not be used for planning retreatment. therefore, we compared the volume of the residual filling in the coiled aneurysms measured at follow - up with the use of three - dimensional dsa (3d - dsa), tof - mra, contrast - enhanced tof - mra (ce - tof - mra), and ce - mra. the study was based on a population of patients that participated in a prospective single - center study on the diagnostic value of dsa and mra in the follow - up of ruptured intracranial aneurysms. a total number of 72 patients (24 men ; mean age, 51.5 12.4 years) with 72 aneurysms were prospectively included in the study. those patients were scheduled for the first follow - up imaging at 3 months after endovascular treatment for subarachnoid hemorrhage caused by aneurysm rupture. patients were excluded for the following reasons : (a) age under 18 years ; (b) contraindications to mr imaging, including severe claustrophobia, ferromagnetic foreign bodies, or electronic implants ; (c) the presence of neurosurgical clips ; and (d) estimated glomerular filtration rate 25 mm)0 (0.0)sack - to - neck ratio1.513 (50.0)1.62.511 (42.3)>2.52 (7.7)number of coils placed39 (34.6)468 (30.8)>69 (34.6)result of embolizationclass 118 (69.2)class 28 (30.8)class 30 (0.0)the assessment of the result of embolization was performed with 2d - dsa and 3d - dsa, while all the measurements were based on 3d - dsaaccording to roy. baseline characteristics of the included patients with percentages in parentheses the assessment of the result of embolization was performed with 2d - dsa and 3d - dsa, while all the measurements were based on 3d - dsa according to roy. the aneurysm remnants were classified as class 2 (residual neck) in eight cases and as class 3 (residual aneurysm) in 18 cases (fig. 1). compared to the initial results of embolization, recanalization of a totally occluded aneurysm was noted in 18 cases : class 2 in seven patients and class 3 in 11 patients. the progression of residual filling from class 2 to class 3 was observed in seven cases. measurement of the flow area with the four tested angiographic methods gave significantly different results (anova : p < 0.04 ; table 2 and fig. the measures determined with the use of 3d - dsa and ce - mra were significantly higher than those with tof - mra and ce - tof - mra (wilcoxon signed - rank test : p < 0.01 ; fig. follow - up dsa resulted in a decision for retreatment in 12 patients. a respective analysis of mra images allowed for a positive decision on re - embolization in nine patients based on tof - mra and ce - tof - mra and in 11 patients based on ce - mra. the most definite differences were seen in the case of large aneurysm remnants (fig. intra - observer variability of the measurement was low, ranging from 3.4 to 4.1 %. 1residual aneurysm (arrows) of the left internal carotid artery presented on mip reconstructions of 3d - dsa (a), tof - mra (b), ce - tof - mra (c), and ce - mra (d)table 2comparison of the largest diameter, the lowest diameter, and volume of the aneurysm remnants between the tested angiographic methods (mean values sd) largest diameter (mm)lowest diameter (mm)volume (mm)3d - dsa5.08 (2.80)2.26 (0.97)30.5 (44.6)tof - mra3.73 (2.09)2.08 (0.75)16.3 (19.0)ce - tof - mra3.86 (2.21)2.18 (0.86)17.4 (22.5)ce - mra4.36 (2.42)2.30 (0.94)26.8 (41.7)fig. 2mean volumes of aneurysm remnants with their 95% confidence intervals as measured on 3d - dsa, tof - mra, ce - tof - mra, and ce - mra imagesfig. 3direct comparison of the residual flow volume measured with 3d - dsa, tof - mra, ce - tof - mra, and ce - mra in particular aneurysmsfig. the aneurysm remnant (arrows) has different sizes in 3d - dsa (a), tof - mra (b), ce - tof - mra (c), and ce - mra (d) residual aneurysm (arrows) of the left internal carotid artery presented on mip reconstructions of 3d - dsa (a), tof - mra (b), ce - tof - mra (c), and ce - mra (d) comparison of the largest diameter, the lowest diameter, and volume of the aneurysm remnants between the tested angiographic methods (mean values sd) mean volumes of aneurysm remnants with their 95% confidence intervals as measured on 3d - dsa, tof - mra, ce - tof - mra, and ce - mra images direct comparison of the residual flow volume measured with 3d - dsa, tof - mra, ce - tof - mra, and ce - mra in particular aneurysms a case of recanalization of the right internal carotid artery aneurysm. the aneurysm remnant (arrows) has different sizes in 3d - dsa (a), tof - mra (b), ce - tof - mra (c), and ce - mra (d) there was a significant correlation between the residual filling volume calculated based on 3d - dsa and all mra modalities (p < 0.001). the highest correlation was noted between 3d - dsa and ce - mra (0.95 ; table 3). correspondingly, ce - mra had the lowest mean relative error of volume measurement, while tof - mra and ce - tof - mra presented similar values (table 3). there was a moderately significant correlation between the residual filling volume and the relative error of measurement in the case of tof - mra and ce - tof - mra (table 3 and fig. 5).table 3analysis of the relation between the volume of aneurysm remnants measured with 3d - dsa and the three tested mra methods rvev (%) retof - mra0.8358.8 (41.6)0.50ce - tof - mra0.6954.7 (46.9)0.55ce - mra0.9535.4 (30.9)0.25the relation is expressed as volume correlation (rv), relative error of volume measurement (ev), and correlation between the reference volume and relative error (re)significantly different from tof - mra and ce - tof - mra (p < 0.05)statistically significant (p < 0.05)fig. 5relation between the volume of aneurysm remnants measured with 3d - dsa and the relative error of volume measurement with tof - mra, ce - tof - mra, and ce - mra. aneurysm remnant volumes were natural log - transformed in order to reduce unilateral skewness of the data analysis of the relation between the volume of aneurysm remnants measured with 3d - dsa and the three tested mra methods the relation is expressed as volume correlation (rv), relative error of volume measurement (ev), and correlation between the reference volume and relative error (re) significantly different from tof - mra and ce - tof - mra (p < 0.05) statistically significant (p < 0.05) relation between the volume of aneurysm remnants measured with 3d - dsa and the relative error of volume measurement with tof - mra, ce - tof - mra, and ce - mra. aneurysm remnant volumes were natural log - transformed in order to reduce unilateral skewness of the data according to our knowledge, this is the first clinical study to confirm that tof - mra at 1.5 t is inadequate for measuring aneurysm remnants. we found that the size of residual filling space measured with tof - mra and ce - tof - mra was significantly smaller than that measured with 3d - dsa and ce - mra. these differences were most pronounced in the case of large aneurysm remnants. in a recent study by daugherty., a significant variability among experienced operators was demonstrated when deciding whether a series of aneurysms should be retreated. the inter - reader discrepancies, which might have been substantial for patient management, were found in as many as 63 % of cases. therefore, there is a need for strict criteria for the decision making on retreatment. one of such parameters may be the size of the residual flow area of at least 2 mm, which provides an appropriate space for an additional placement of the smallest coils. other proposed indications for retreatment include growth of an aneurysm remnant caused by coil loosening or coil compaction with unchanged aneurysm boundaries and aneurysm regrowth in increasing boundaries compared with the initial aneurysm size [20, 21 ]. with the use of a contemporary reference method of cerebral vessel imaging, i.e., 2d - dsa, a precise measurement of the aneurysm remnant is not an obvious issue. despite the significant advantages of the dsa technology, it still offers linear measurements in pixels, not in millimeters, and requires calibration. therefore, precise measurements on 2d - dsa images require calibration on fiducial markers or diagnostic catheters. another solution is the use of 3d - dsa, which has a finite isocenter and acquisition geometry, similar to those in ct and mr imaging that provide measurements in real millimeters. several studies proved the high diagnostic value of mra in detecting aneurysm remnants ; therefore, in many centers, mra has become a first - line follow - up method after aneurysm embolization [815 ]. once an aneurysm remnant is detected, it must be measured to determine possible progression and to decide on the need for retreatment. however, according to our results, the choice of follow - up method is essential. we found that the residual flow volume determined with the use of 3d - dsa and ce - mra was significantly higher than those with tof - mra and ce - tof - mra. the mean volume of the flow area measured with the use of tof - mra was 87 % lower than in 3d - dsa and 64 % lower than in ce - mra. three - dimensional dsa is considered a method of choice for the detection, analysis, and planning of endovascular aneurysm therapy [17, 23 ]. it may also be considered the most precise modality of flow quantification since coils are selected for embolization based on 3d - dsa images without a need for any additional calibration. thus, although tof - mra seems to be an accurate method for the detection of residual flow, it may not be considered a reliable method for flow quantification and for decision making on retreatment, which is a more important outcome of follow - up imaging. the nature of tof - mra which detects blood flowing in limited directions above a threshold of velocity provides an explanation of the possible differences in filling volume quantification between the tested modalities. therefore, tof - mra suffers signal loss in areas of slow and turbulent flow due to intravoxel dephasing and spin saturation. the signal - loss effect may explain more evident differences in the volume of the aneurysm remnant in large - flow areas, as observed in our study. moreover, the addition of a small amount of contrast medium during tof - mra acquisition did not result in a significant improvement of flow measurements. this indicates that the underestimation of the aneurysm remnant size in tof - mra is related to the time - of - flight technique itself rather than to the signal intensity. although our results are quite obvious from the technical point of view, they seem to influence clinical practice significantly. if tof - mra replaces dsa as a standard method of follow - up to detect aneurysm incomplete occlusion, as proposed by several authors [16, 24, 25 ], in the case of positive results, it should be followed with ce - mra or 3d - dsa to decide on possible retreatment. firstly, the sample size was calculated for a different study that was aimed at determining the diagnostic value of dsa and mra in the follow - up of intracranial aneurysms, and the 26 remnants found may be considered inadequate. nevertheless, the presented differences in the residual flow size between the studied angiographic methods are statistically significant. secondly, some measurement errors related to the 3d - dsa image reconstruction might have influenced our results because the flow size was dependent on individual window adjustment to some extent. however, the values of intra - observer and inter - observer variability were relatively low and did not differ significantly between the techniques. moreover, none of our imaging methods was calibrated using dedicated phantoms. the study was designed to approach clinical practice, where the precision of measurements depends on the internal calibration of imaging devices and is controlled by routine quality assurance procedures. application of a state - of - the - art 3-t system may provide different results because of the increased signal - to - noise ratio, spatial resolution, and contrast resolution. we found that in our limited patient population, the size of residual filling space in the embolized aneurysms measured at follow - up with 3d - dsa and ce - mra was significantly higher than in tof - mra or ce - tof - mra. therefore, in our opinion, tof - mra and ce - tof - mra may underestimate the size of the residual flow. in concordance with several previous reports, we still consider tof - mra as a first - line modality for follow - up to detect the aneurysm recurrence mainly because of its low invasiveness and the limited rate of aneurysm retreatment. however, once the recurrence is found, we suggest referring to ce - mra of 3d - dsa to quantify the filling space, while a definite decision on re - embolization may be made based on 3d - dsa. the design of the study did not allow for the investigation of possible sources of the observed differences. future research based on a larger patient population should be performed using automatic aneurysm segmentation and analysis systems, which have been proposed for both the 3d - dsa and mra. this article is distributed under the terms of the creative commons attribution license which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. | introductionthe possibility of recanalization and the need for retreatment are the most important limitations of intracranial aneurysm embolization. the purpose of the study was to compare the size of aneurysm remnants measured at follow - up with three - dimensional digital subtracted angiography (3d - dsa) and magnetic resonance angiography (mra).methodstwenty - six aneurysms were found incompletely occluded in 72 consecutively examined patients at a follow - up after 3 months. the diameters and volume of aneurysm remnants were compared between 3d - dsa, time - of - flight mra (tof - mra), contrast - enhanced tof - mra (ce - tof - mra), and contrast - enhanced mra (ce - mra) at 1.5 t.resultsthere was a significant correlation between remnant volumes calculated based on 3d - dsa and all mra modalities. the intraobserver variability of the measurements ranged from 3.4 to 4.1 % and the interobserver variability from 5.8 to 7.3 %. there were no significant differences in the variability between the techniques. the mean residual filling volume ranged from 16.3 19.0 mm3 in tof - mra to 30.5 44.6 mm3 in 3d - dsa (p < 0.04). significant differences were found in the volumes measured with 3d - dsa and ce - mra as compared to tof - mra and ce - tof - mra (p < 0.01). there was a moderate significant correlation between the residual filling and the relative error of measurement in the case of tof - mra and ce-tof-mra.conclusionstof-mra seems to underestimate the size of aneurysm remnants detected at follow - up and should not be used as a sole imaging method to decide on re - embolization. |
endophytic actinobacteria have a capacity to produce numerous secondary metabolites with a mass of biological activity, such as antibiotics, antitumor and anti - infection agents, plant growth promoters and enzymes, and may promote plant establishment under adverse environmental stresses. introducing such bacterial strains to plant tissues can result in increased plant growth, usually due to suppression of plant pathogenic microorganisms. it seems to be pivotal for obtaining a healthy microfloral balance within plants, soil appearing to be an important and moderating source of bacterial endophytes. recently, our group has isolated from a carrot sample from xinjiang uyghur autonomous region (china) a novel species of paenibacillus dauci sp. 100608 = jcm30283), which can produce potential antimicrobial substances playing the part of endophytic actinobacteria. comparisons with 16s rrna gene sequences as shown in fig. 1 revealed that the novel strain had the highest similarity to paenibacillus hunanensis fel05 (97%). however, the phylogenetic distances from recognized species (fig. 2) indicated that p. dauci sp. nov. is not affiliated to any of these recognized species. we can therefore conclude that this strain represents a novel species of the genus paenibacillus. what 's more, high nitrogenase activity, strong antagonism against plant pathogenic fungi, extensive carbon source utilization, and stress resistance were also uncovered. in consequence, investigation of the genetic information and characteristics of p. dauci knowledge of the genome sequence and bioinformatics will be of great help in this regard. here we present the draft genome sequence of strain p. dauci h9 obtained using the illumina hiseq 2000 system, which was performed by shenzhen bgi. tech. the reads were assembled with soapdenovo,, the version is 2.04, and the sequence was annotated using the rast annotation server (fig. sequencing was performed based on the paired - end strategy of 473 reads to produce 790 mb of filtered sequences, representing a 126-fold coverage of the genome. the sequence of paenibacillus algorifonticola xj259 is 5,449,237 bases with a g + c content of 46.5%, which was assembled into 26 contigs and 19 scaffolds. it contains 4766 open reading frames (orfs), 77 trna genes, and 1 rrna gene (table 1) identified by glimmer 3.02, genemark, trnascan - se, and rnammer. according to the genomic analysis of strain p. dauci, we analyzed 36 orfs related to antibiotic metabolic process. additionally, 12 orfs were also discovered related to trehalose, which makes us believe that it could be related to the shock - resistant mechanism since the trehalose is regarded as a molecular chaperone. what 's more, the biosynthesis of vitamin b was annotated in the strain p. dauci as there were 19 orfs related to vitamin b12 production and vitamin b6 metabolism. further studies will be performed to confirm their functions, and a complete genome sequence will be included in the future to reveal the unique molecular characteristics of strain p. dauci. this whole genome shotgun project has been deposited at ddbj / embl / genbank under accession number laqq00000000. the version described in this paper is the first version, with accession number laqq01000000. the authors declare that there is no conflict of interest on any work published in this paper. | paenibacillus dauci sp. nov., a new kind of endophytic actinobacteria, is separated from the inner tissues of carrot sample, which forms intimated associations with carrot acting as biological control agents. here we report a 5.37-mb assembly of its genome sequence and other useful information, including the coding sequences (cdss) responsible for biological processes such as antibiotic metabolic process, antimicrobial metabolism, anaerobic regulation and the biosynthesis of vitamin b and polysaccharide. this novel strain can be a potential source of novel lead products for exploitation in the field of pharmaceutical, agriculture and industry. |
diabetic nephropathy (dn) is the leading cause of end - stage renal disease. mesangial cell proliferation, excessive extracellular matrix (ecm) proteins accumulation, basement membrane thickening, mesangial expansion, and other mesangial region lesions are involved in the renal pathological process, which ultimately lead to glomerular sclerosis. although hyperglycemia, hyperlipemia, hypertension, blood flow, and inflammation are participated in the pathogenesis of dn, the exact cause of dn remains unclear [14 ]. naringenin (4,5,7-trihydroxy flavanone, nar) is a flavanone compound found in citrus fruits, which is rich in the seeds and peels of fruits. recent researches showed that nar had many potentially pharmacological effects such as antioxidant, anti - inflammation, anticancer, and antifibrosis [58 ]. meanwhile, it was reported that nar possessed antiproliferative activity in lung cancer, colorectal cancer, and leukemia cell and regulated extracellular matrix synthesis in hepatic satellite cell [912 ]. furthermore, nar could decrease the blood glucose level in stz induced diabetic rats [13, 14 ], suppress macrophage infiltration into adipose tissue in an early phase of high - fat diet - induced obesity, and inhibit production of il-1, il-6, type iv collagen, fibronectin, tgf-1, and monocyte chemoattractant protein-1 (mcp-1) in the kidney of diabetic mice. however, the mechanism of the proliferation effect of nar in dn is unknown up to now. microrna let-7 and its family members have been reported to participate in many diseases including kidney diseases. let-7a regulated glucose metabolism and insulin synthesis / secretion with type 2 dm by targeting lin28 pathway [17, 18 ]. let-7a and let-7d could affect glucose metabolism by downregulating il-13 in the skeletal muscle of type 2 dm patients. also, let-7 family members regulated collagen expression in glomerular mesangial cells under diabetic conditions. furthermore, our previous experiments showed that let-7a was downexpressed in dn patients, and the let-7a-3 promoter hypermethylation and the rs1143770 polymorphism of let-7a-2 were participated in dn [21, 22 ]. moreover, let-7a had been reported to modulate ecm deposition in breast and pancreas cells [2325 ]. these findings suggested that let-7a may be an important factor in the effects of nar in dn. in the present study, we aimed to explore the protective effects of nar on kidney as well as its effects on let-7a / tgfbr1 signaling in diabetic nephropathy rats and mesangial cell under high glucose condition. this study demonstrated that let-7a and its related pathway - tgf-1/smad signaling formed a negative feedback to inhibit the deposition of ecm by targeting tgfbr1 in dn. moreover, nar might repress glomerular mesangial cells proliferation and accumulation of ecm by let-7a / tgfbr1 signaling in dn, and let-7a may be a novel potential target for nar protecting against diabetic nephropathy. twenty - five male sprague - dawley rats weighting 120 20 g (four weeks old) were provided by the experimental animal center at chongqing medical university. the animals were housed in the clean environment under conditions of controlled temperature of 2025c and humidity 65~69%. the rats were randomly divided into a control group (con, n = 5) and a dn group (n = 20). the control rats were fed with the normal diet, while the rats in diabetic group were fed with the high - sugar - high - fat diet. five weeks later, diabetic nephropathy was induced by a single intraperitoneal injection of stz (sigma, st. mmol / l) and high urinary total protein level (total protein level in dn group was more than twice higher than the control group) were measured to confirm early dn in rats. then, the dn rats (n = 18) were assigned into two groups : dn rats treated with saline (dn group, n = 8) and dn rats treated with nar (nar group, n = 10). the rats in nar group were treated with naringenin (sangon, shanghai, china) (50 mgkgday, gavage), while the rats in dn group were treated with the equal volume of normal saline. among the three groups, blood glucose was measured each week, and 24 h urine was collected every two weeks. renal tissues from each rat were disposed as follows : one was immediately frozen in liquid nitrogen, and the other was fixed with 4% paraformaldehyde. all animal experiments were performed in accordance with the protocols approved by chongqing medical university animal care committee. 24 h urinary protein was measured by the coomassie brilliant blue (cbb) method. urinary creatinine (ucr) and serum creatinine (scr) were measured by clinical laboratory. urinary creatinine clearance (ccr) ratio was calculated using the following equation : ccr (mlminkg) = [urinary cr (mmol / l) urinary volume (ml)/serum cr (mmol / l) ] [1/1,440 (min) ]. right kidney weight (kw) and body weight (bw) were assessed to calculate kidney index : the glomerular areas (m) with 50 fields of view were analyzed by image - pro plus 6.0. 0.1 g nar powder was dissolved in 1 ml dmso and then filtrated using 0.22 m micropore filter, preserved at 4c for subsequent use. the solution were diluted in dmem to different working concentration of 100 mol / l, 200 mol / l, 400 mol / l, 600 mol / l, and 1000 mol / l. mouse glomerular mesangial cell (mmc) line (academy of sciences, shanghai, china) was cultured in dmem with 20% fbs in a humidified atmosphere containing 5% co2 at 37c. mmcs were maintained in 5 mmol / l glucose plus 20 mmol / l mannitol as the control group (lg). cells were maintained in 25 mmol / l glucose as the high glucose group (hg), and cells were treated with 25 mmol / l glucose plus nar as the nar treatment group (nar). 293 t cells were preserved in our laboratory and grown in dmem with 10% fbs as previously described. mmcs were seeded at a density of 1.0 10 cells / well in 96-well plates with nar treatment. after treated with nar for 0 h, 12 h, 24 h, and 36 h, 20 l mtt reagent was added into each corresponding cultured well. the absorbance in 490 nm was measured by the microplate reader (bio - rad, usa). mmcs were treated with nar for 24 h, then were digested with trypsin and were made into cell suspension, were washed with precooling pbs twice, were fixed with 75% precooling ethanol overnight at 4c, collected the cells by centrifuge, were washed with 1 ml pbs, were added 100 l rnasea incubated at 37c for 30 min, were added 400 l pi incubated at 4c for 30 min at dark, 1 10 cells for cell cycle analysis with bd flow cytometry by standard procedure. mmcs were seeded at a density of 0.75 10 cells / ml in serum - free dmem, with the addition of a transfection agent and let-7a mimics oligonucleotides (let7a - m), negative control mimics (nc - m), let-7a inhibitor oligonucleotides (let7a - i), and negative control inhibitor (nc - i) (jima, shanghai, china). six hours after transfection, the medium was changed and the cells were incubated with fresh serum - containing medium for another 24~48 h. in addition, mmcs were transfected with let-7a mimics plus nar as the nar + let7a - m group ; cells were transfected with let-7a inhibitor plus nar as the nar + let7a - i group. all transfections were performed with the aid of a lipofectamine 2000 transfection agent (invitrogen, usa) following the manufacturer 's instructions. total rna was extracted by trizol reagent (invitrogen) according to the manufacturer 's instructions. small rnas (< 300 nt) were isolated when 2 to 5 g total rna sample was size - fractionated using a ym-100 microcon centrifugal filter (millipore). the primescript rt reagent kit (takara, dalian, china) and sybr premix ex taq tm ii (takara, dalian, china) were used for mirna and mrna quantification. relative expressions were calculated using 2 method and normalized to the expression of u6 or gapdh. primers for real - time pcr were as follows : col-4, (f) : 5-caaaccacagccaatccttca-3, (r) : 5-aagaagggaaaacccactgtagagt-3 ; fn, f : 5-catggctttaggcgaacca-3, r : 5-catctacattcggcaggtatgg-3 ; tgf-1, f : 5-agggctaccatgccaacttc-3, r : 5-ccacgtagtagacgatgggc-3 ; tgfbr1, f : 5-tggcggaatccacgaaga-3, r : 5-acggatggatcagaaggtacaag-3 ; smad2, f : 5-acaacaggcctttacagcttc-3, r : 5-ctctgtggctcaattcctgc-3 ; smad7, f : 5-ccatcaaggcttttgactatgaaa-3, r : 5-ccatggctgctgcatgaac-3. all real - time rt pcr was performed in triplicate, and the data were presented as means sd. total protein from cells and renal tissues were extracted, subjected to 10% sds - polyacrylamide gels (beyotime, shanghai, china) and transferred to polyvinylidene difluoride membrane. membranes were blocked with 5% nonfat dry milk dissolved in tbst and then incubated with primary antibody overnight at 4c. antibodies and dilutions included the following : rabbit monoclonal to col4 antibody (1 : 1,000, proteintech), rabbit polyclonal to fn antibody (1 : 1,000, proteintech), rabbit monoclonal to smad2 antibody (1 : 1,500, proteintech), rabbit polyclonal to p - smad2 antibody (1 : 500, bioworld), rabbit polyclonal to tgf-1 antibody (1 : 800, proteintech), rabbit polyclonal to tgfbr1 antibody (1 : 700, bioworld), and rabbit polyclonal to gapdh antibody (1 : 2,000, proteintech). the membranes were incubated with the goat anti - rabbit igg (1 : 5,000, abcam) for 1.5 h. signals were detected with chemidocxrs system (bio - rad, usa). kidney tissue paraffin sections (4 m) were subjected to immunofluorescence staining.antibodies and dilutions were as follows : rabbit monoclonal to col4 antibody (1 : 50, proteintech), rabbit polyclonal to fn antibody (1 : 100, proteintech), rabbit polyclonal to tgf-1 antibody (1 : 50, proteintech), and rabbit polyclonal to tgfbr1 antibody (1 : 50, bioworld). the tissue sections were then incubated with fitc or tritc for 1 h. images were acquired using the fluorescence microscope (olympus japan). tgfbr1 (nm_009370.2) 3-utr - luciferase constructs were made using the pmir - rb - report vector, and the primers for tgfbr1 3 utr - wt were as follows : tgfbr1-wt - f : 5-gcgctcgaggggtgtttaggaggctggt-3 ; tgfbr1-wt - r : 5-aatgcggccgccatacaacttttccttcgg-3. the pcr products were excised with noti and xhoi. the potential binding sequences of let-7a on the tgfbr1 3utr were mutated by the quikchange site - directed mutagenesis kit (stratagene). for transfection, 293 t cells were seeded into 96-well plates at a density of 1.5 10 per well ; then cells were transfected with tgfbr1 - 3utr - wt (200 ng / ml), tgfbr1 - 3utr - mut (200 ng / ml), and let-7a mimics (50 nmol / l) using lipofectamine 2000. after 48 h data for multiple variable comparisons were analyzed by one - way analysis of variance (anova). results showed blood glucose level went up steadily with time in dn rats, while blood glucose level was decreased at 6 weeks in nar group (figure 1(a)). the 24 h urinary protein went up steadily with time in dn rats, while after nar treatment, it was decreased (figure 1(b)). and creatinine clearance ratio (ccr) is generally considered as the feature of renal function, reflecting renal filtration function. kidney index (ki) and glomerular area (ga) are the morphological markers of glomerular hypertrophy. we evaluated the effects of nar on 24 h urinary protein, ccr, ki, and ga. 24 h urinary protein (8.49 1.87 versus 40.41 4.68 mg/24 h, p < 0.001). ki (2.87 0.17 versus 4.83 0.30, p < 0.001) and ga (146.32 23.74 versus 194.29 40.60 m, p < 0.05) were significantly increased in dn group compared with those in con group, whereas ccr (3.31 0.74 versus 1.39 0.30 ml / min, p < 0.01) was decreased in dn group. after treatment with nar, ccr was obviously increased (1.39 0.30 versus 2.08 0.55 ml / min, p < 0.05) (figure 1(c)) ; ki was significantly decreased (4.83 0.30 versus 4.33 0.34, p < 0.05) (figure 1(d)). ga was reduced (194.29 40.60 versus 165.15 41.15 m, p < 0.05) in the nar group compared with that in dn group (figures 1(e) and 1(f)). to evaluate the effect of nar on mesangial cells proliferation, mtt and cell cycle analysis were used. mtt results showed that nar obviously inhibited cell proliferation at the concentration of 400, 600, and 1000 mol / l for 24 h, 36 h, and 200 mol / l for 36 h, whereas cell proliferation rates were unchanged at the concentration of 100 mol / l (figure 2(a)). moreover, the cell cycle analysis showed cells were treated with 400, 600, and 1000 mol / l nar for 24 h, respectively. the results showed that g2 phase of nar group was significantly increased when compared with that in hg group, while s phase was shortened in nar group at the concentration of 600 and 1000 mol / l. therefore, these data indicated that nar delayed mesangial cell growth at g2 phase (figure 2(b)). a key feature of dn was the accumulation of excessive extracellular matrix proteins, predominant collagens (col4), and fibronectin (fn). to determine whether nar affected col4 and fn expression in vivo and in vitro, col4 and fn mrnas and proteins of kidney tissues were examined by real - time rt pcr (figure 2(c)), western blot (figures 2(d), 2(e), and 2(f)), and immunofluorescence (figures 2(g) and 2(h)). the results showed that the mrna and protein of col4 and fn were remarkably increased in the dn or hg group compared with the con or lg group and decreased when nar was treated in mice and cells. taken together, our results suggested that nar could improve the excessive deposition of ecm. our previous study demonstrated that several mirnas were differentially expressed in blood samples of dn patients by mirna array and real - time pcr, including let-7a, let-7d, let-7f, mir-363, and mir-4429 (data not shown). furthermore, our result displayed that only let-7a was reversed when treated with nar among the five mirnas in mesangial cells with high glucose (figure 3(a)). to determine whether nar affected the expression of let-7a in vivo, the results showed that let-7a was significantly decreased in the dn group compared with the con group. after the treatment of nar, the expression of let-7a was significantly enhanced in the nar group compared with the dn group (figure 3(b)). these results demonstrated that nar upregulated let-7a expression both in vivo and in vitro in dn. we further observed whether nar affected fibrosis markers col4 and fn expressions by regulating let-7a in cells. mmcs were transfected with let-7a mimics (let7a - m), let-7a inhibitor (let7a - i), nar, or nar with let-7a intervention. the results showed that let-7a was highly expressed in let-7a mimics group and decreased in inhibitor group. the expression of let-7a was significantly elevated in nar + let-7a group, whereas let-7a declined in nar + let-7a inhibitor group (figure 3(c)). moreover, the expressions of col4 and fn were decreased in let-7a or nar group compared with those in the untreated hg group. interestingly, the expressions of col4 and fn were lower after transferring let-7a mimic and nar into mesangial cell compared with nar or let-7a group (figures 3(d) and 3(e)). so our results suggested that nar could improve the excessive deposition of ecm by upregulating let-7a expression. to evaluate possible functions of let-7a, we screened potential target genes of let-7a. firstly, according to bioinformatics software targetscan (http://www.targetscan.org/), we found that dn related gene - tgfbr1 was a potential target of let-7a. by analyzing homology, we found that the putative mmu - let-7a target site in tgfbr1 3-utr was highly conserved in sixteen genomes (figure 4(a)). transcripts carrying the tgfbr1 3-utr - wt exhibited a significant reduction in luciferase activity in the presence of let-7a. in contrast, the mimics negative control had no significant effect on the luciferase activity (figure 4(b)). meanwhile, western blot results showed that the expression level of tgfbr1 protein was reduced significantly in the let-7a mimics group compared with the hg group (figures 4(c) and 4(d)). tgf-1 is recognized as a major mediator of renal fibrosis because it is able to stimulate the accumulation of ecm protein and tgf-1/smad signaling activation involving in this process. to determine that whether nar affected the tgf-1/smad signaling in vivo, we examined tgf-1, tgfbr1, smad2, and smad7 mrna and protein expressions in kidney tissue of dn rats. the results of real - time rt pcr showed that tgf-1, tgfbr1, and smad2 mrnas were remarkably increased in the dn group compared with the con group, while smad7 mrna was declined. nar reduced the expressions of tgf-1, tgfbr1, and smad2 and increased smad7 mrnas (figure 5(a)). meanwhile, the western blot results showed that tgf-1/smad signaling was highly activated in dn group as revealed by a marked upregulation of tgf-1, tgfbr1, and p - smad2/smad2 and downexpression of smad7, whereas nar directly reduced tgf-1, tgfbr1, and p - smad2/smad2 and increased smad7 protein expression (figures 5(b) and 5(c)). we further observed the effects of nar on tgf-1, tgfbr1, smad2/p - smad2, and smad7 protein in mmcs. we found that the expressions of tgf-1, tgfbr1, and smad2/p - smad2 significantly decreased and smad7 increased in nar group compared with those in hg group (figures 5(b) and 5(d)). the results of immunofluorescence for tgf-1 and tgfbr1 were consistent with the results of western blot (figure 5(e)). together, our results suggested that tgf-1/smad signaling was activated in dn rats and mmcs in high glucose condition and nar could inhibit tgf-1/smad signaling activation in vivo and vitro. furthermore, we observed whether nar affected tgf-1/smad signaling by regulating let-7a in mmcs or not. we found that overexpression of let-7a and nar treatment decreased the ratio of p - smad2/smad2 and tgfbr1 proteins compared with mmcs without treatment. additionally, nar alleviated the change in the ratio of p - smad2/smad2 and tgfbr1 proteins cooperation with let7a - m more significantly than nar group and let7a - m group, whereas the ratio of p - smad2/smad2 and tgfbr1 protein was increased in the nar + let-7a inhibitor group compared with nar group (figures 5(f) and 5(g)). our results suggested that tgf-1/smads signaling was activated in dn rats and mmcs in high glucose condition and nar inhibited tgf-1/smads signaling activation through upregulating let-7a and suppressing tgfbr1 expression. glomerular mesangial cell acts actively in glomeruli, which can secrete ecm and produce cytokine, phagocyte, and clear macromolecules, and it has systolic function like smooth muscle cell. studies have confirmed that mesangial cell was the important glomerular resident cells in the synthesis of ecm proteins [30, 31 ]. deposition of excessive ecm molecules, predominant collagens, and fibronectin in the kidney will lead to kidney hyperplasia and glomerular area enlargement, which adversely affected the structure and function of the kidney. it played an important role in diabetes and its complications. researches revealed that nar could affect dyslipidemia, apob overproduction, and hyperinsulinemia in ldl - receptor null mice with diet - induced insulin resistance. the antidiabetic effect of nar might be insulin - like effect in type 2 diabetic rats. additionally, it was reported that nar supplement increased its deposit in the liver and kidney of diabetic mice, and plasma levels of glucose and blood urea nitrogen were both decreased in nar group, while insulin level and creatinine clearance were increased in nar group compared with the diabetic control group. in this study, our results showed nar could not only decrease the blood glucose, 24 h urinary protein, kidney index, and glomerular area but also increase ccr in dn rats. also, we examined the therapeutic effects of nar in dn rats and mesangial cells under diabetic condition. our data showed that nar inhibited mesangial cells proliferation by delaying cell cycle at g2 phase. moreover, col4 and fn were highly expressed in dn rats and mmcs under high glucose condition, while nar directly reduced the expressions of col4 and fn mrna and proteins. therefore, these findings displayed that nar might participant in the development and progress of dn and suggested that nar could play an important role in dn. however, the exact mechanism of nar in dn is still unclear. to explore the underlying mechanism of nar in dn, several dn results showed let-7a was the only mirna which reversed the expression level when treated with nar in mesangial cells cultured with high glucose. furthermore, numerous researches showed that let-7a was closely linked to modulate cell proliferation in various diseases [3638 ]. also, our previous studies also showed that the promoter hypermethylation and single nucleotide polymorphism of let-7a played important roles in dn [21, 22 ]. therefore, these studies suggested that let-7a might be related to the therapeutic effects of nar in dn. in our study, real - time rt pcr results exhibited that let-7a expression was significantly decreased in both blood and kidney tissues of dn rats and mesangial cells under hyperglycemic condition. and additionally, nar alleviated the changes of col4 and fn proteins cooperated with let7a mimics more significantly than nar group, whereas the inhibitory effect of nar cooperated with let-7a inhibitor was weakened. so these results suggested that nar alleviated the deposition of ecm proteins by upregulating let-7a expression. in the famous dn related pathway - tgf-1/smad signaling pathway subsequently, phosphorylated smad2 and smad3 bound to the common smad4 and formed the smad complex to regulate the downstream gene transcription. in this process, smad7 could block the activation of tgf-1/smad signaling as an inhibitory factor. therefore, tgfbr1, tgf-1, and smads were key factors in the tgf-1/smad signaling pathway. research showed nar decreased cell invasion and metastasis by inhibition of tgf-1/smads signaling pathway in pancreatic cancer, and nar also reduced tgf-1-induced hepatic satellite cell extracellular matrix deposition by inhibiting tgf-1/smads signals [12, 40 ]. in this study, our data displayed that there was a significant reduction of tgfbr1 protein in the presence of let-7a mimics by dual - luciferase reporter assay, and overexpression of let-7a could decrease the expression of tgfbr1 protein by western blot. our results showed that tgf-1/smads signaling was highly activated in dn rats and mmcs under high glucose condition, whereas nar directly suppressed activation of tgf-1/smad signaling. more importantly, in vitro experiments, overexpression of let-7a decreased the expression of p - smad2 and tgfbr1 proteins compared with hg group and it suggested that let-7a may negatively regulate tgf-1/smads signaling by targeting tgfbr1. meanwhile, nar cooperated with let7a mimics ; its effects were more remarkable than nar or let-7a mimics ' individual effect in the reductions of p - smad2 and tgfbr1 proteins, while the reductions of p - smad2 and tgfbr1 proteins in the nar cooperated with let-7a inhibitor group were weakened. taken together, our data exhibited that nar regulated the alteration of tgf-1/smads signaling through upregulating let-7a expression and suppressing tgfbr1. in summary, our study suggested that nar ameliorated kidney injury and inhibited mesangial cells proliferation and accumulation of ecm in dn. / tgfbr1, and let-7a might be a novel therapeutic target for nar protect against dn. | diabetic nephropathy (dn) is one of the most common complications of diabetes mellitus (dm). however, the exact mechanism is not clearly understood. in this study, our results showed that 24 h urinary protein, kidney index, and glomerular area were decreased, while creatinine clearance ratio was increased in dn rats when the rats were treated with nar 50 mg / d for 6 weeks. mesangial cell (mmcs) proliferation was inhibited in the nar group by 3,(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2h - tetrazolium bromide (mtt), and the cell cycle analysis showed that cells stayed in g2 phase in nar group. and nar treatment attenuated the deposition of ecm in dn rats and mmcs. moreover, our data showed that let-7a was downexpressed in both dn rats and mmcs under high glucose condition. surprisingly, nar affected the expressions of col4 and fn through upregulating let-7a in mmcs. in addition, we found that let-7a negatively regulated the expression of transforming growth factor-1 receptor 1 (tgfbr1), and tgfbr1 was required for the let-7a - mediated downregulation of tgf-1/smad signaling. interestingly, nar inhibited tgf-1/smads signaling activation by upregulating let-7a. therefore, our findings indicated that nar ameliorated kidney injury by regulating let-7a / tgfbr1 signaling. |
peritoneal dialysis (pd) is a well - established means of renal replacement therapy. a tenckhoff catheter is electively inserted into the peritoneal cavity before pd starts. after a healing period of at least two weeks 500 ml volumes are used for the first two days of training and titrated upwards, based on body surface area, over a two - week period. in our centre, there are 3540 patients on pd at any one time. approximately 2 patients join our program per month, and a similar number exit the program due to transplantation, switch to haemodialysis, or death. patients starting pd in our unit use standard dextrose - based, lactate - buffered dialysate. if infusion pain is a problem, bicarbonate / lactate buffered dialysate is used instead. a daytime icodextrin - based dialysate dwell is often required in patients with little residual renal function for extra ultrafiltration. the main complications of pd are either infectious, such as peritonitis and exit site infections, or pressure related, such as abdominal wall hernias and gastrooesophageal reflux. this phenomenon appears to be due to increased intraabdominal pressure in the setting of congenital or acquired diaphragmatic defects. the incidence rate of pleuroperitoneal leak development is thought to be less than 2% in newcomers to peritoneal dialysis. we report three cases of pleuroperitoneal leak that occurred within a nine - month period at our institution. this corresponded to a 12% incidence rate amongst newcomers to pd in that calendar year (25 newcomers). prior to that, there had been no cases in our department for over 10 years. a 35-year - old philipino female presented to our unit with advanced chronic kidney disease, secondary to medullary cystic kidney disease, which was diagnosed many years earlier in the philipines. one year later, she was approaching end - stage kidney disease and a tenckhoff catheter was inserted. training for pd began four weeks later, using standard dextrose - based solutions. the high - pleural - fluid - serum - glucose ratio confirmed the clinical suspicion of a pleuroperitoneal leak. the pleural effusion resolved over a number of days with conservative management and the maintenance of a dry peritoneal cavity. she had received two courses of heavy immunosuppression for this and was then lost to follow up. she had no known heart disease. her renal ultrasound showed small, shrunken kidneys, which confirmed the suspicion of advanced chronic kidney disease. acute hd was initiated but, as the patient 's preference was for pd, a tenckhoff catheter was inserted. her target pd prescription consisted of four cycles of two litre exchanges with standard dextrose - based standard solution. after six days of pd training, she presented with dyspnoea that was exacerbated by infusing dialysate. she was seven kg above her dry weight and had clinical evidence of a rightsided pleural effusion and pedal oedema. her electrocardiogram (ecg) and routine blood tests were unchanged. as she appeared volume overloaded, she had three litres of isolated ultrafiltration, using her central venous catheter. again, she had 3 litres of isolated ultrafiltration. with this, she developed bad cramping. although the initial presumed diagnosis was volume overload, the high pleural fluid glucose relative to the serum glucose confirmed the presence of a pleuroperitoneal leak (table 2). in accordance with patient preference, pd was discontinued and the tenckhoff catheter was removed. a twenty - four - year - old irish male with a background history of congenital deafness, intellectual impairment and repair of a posterior urethral valve initially presented to the paediatric nephrology services with nephrotic syndrome. a renal biopsy revealed secondary focal segmental glomerulosclerosis and significant tubuleinterstitial fibrosis. following introduction of renin - angiotensin - aldosterone system blockade, a bicarbonate / lactate buffered solution was used to avoid infusion pain, which he would be unable to verbalise. the following months were complicated by dialysis - associated pericarditis that resolved with intensive haemodialysis for a number of weeks. his baseline pd prescription consisted of seven cycles of two litre exchanges with 1.36% dextrose solution. five months later, he was admitted with clinical and radiological evidence of a large, rightsided pleural effusion with pleural thickening. the exact duration of the effusion was unclear as he was unable to verbalise symptoms. it was thought to have developed over weeks given the apparent absence of symptoms and the degree of pleural thickening. the pleural fluid biochemistry was atypical for that seen with pleuroperitoneal leak (table 3). however, as the patient was so well clinically, and numerous pleural fluid cultures were sterile, it was felt that the effusion was not related to infection. it was also felt that the effusion was not due to volume overload given the degree of loculation within the effusion and the absence of other clinical signs of volume overload. the low pleural fluid glucose and high lactate dehydrogenase (ldh) were difficult to interpret as the sampled fluid was walled off within a loculation, probably for many weeks. the effusion did not resolve with drainage of the peritoneal cavity, and a chest drain was inserted. this drain became dislodged and was replaced by a third drain with further intrapleural alteplase administration. at this point, however, a chest radiograph confirmed persistence of the large, loculated effusion with a small pneumothorax and a thick pleural rind. video - assisted thorascopic surgery with decortication was performed. a rapid postoperative recovery ensued and the postoperative chest drains were removed without event. a chest radiograph six weeks later showed a well - expanded right lung, without effusion or pleural abnormality. the first description of a pleuroperitoneal leak causing a pleural effusion in a pd patient was in 1967. since then, several reports have estimated the incidence of this complication ; the largest report estimated an incidence of 1.6%. it is thought that congenital or acquired communications between the pleura and peritoneum underpin this problem. this had been demonstrated both in scintigraphy and in autopsy specimens with localized absence of diaphragmatic muscle fibres. the raised intraabdominal pressure with dialysate infusion, in a patient with such a communication, promotes the translocation of dialysate into the pleural space. this is probably related to the increased intraabdominal pressure in these patients and, therefore, higher pleuroperitoneal pressure gradients. there is also a generalized connective tissue weakness in this condition that may contribute to inherent diaphragmatic weakness. the timing of this complication varies from days to years after the initiation of pd. half of cases occur within one month of starting pd ; these probably represent patients with congenital diaphragmatic defects. presumably the preponderance of rightsided cases is due to diaphragmatic protection by the heart on the left. transudative effusions develop when systemic factors affect the pleural starling forces, as seen, for example, in congestive cardiac failure. exudative effusions develop when local factors influence the formation of pleural fluid, as seen in malignant effusions. light 's criteria are applied to the pleural and serum biochemistry to make the distinction between a transudate and an exudate. an effusion is an exudate if the pleural - fluid - to - serum - protein ratio is > 0.5 or the pleural - fluid - to - serum - ldh ratio is > 0.6. transudative pleural effusions due to volume overload or congestive cardiac failure are relatively common in this population. in pd patients, such effusions would typically be managed by increasing the dialysate volume and tonicity to increase ultrafiltration. however, this can exacerbate the problem if the effusion is due to a pleuroperitoneal leak. this highlights the importance of the pleural fluid glucose measurement. in the absence of loculation, a high pleural fluid to serum glucose concentration gradient is a very sensitive and specific test for diagnosing a pleuroperitoneal leak. the ratio of pleural fluid to serum glucose is dynamic, and varies depending on the type of fluid instilled, the volume and the contact time. this is due to the presence of hypertonic, usually dextrose - based, dialysate in the pleural space atypical biochemistry can be seen when the fluid has been in the pleural cavity for a prolonged period and has been partially reabsorbed by lymphatics, as seen in case 3. other diagnostic tests are less practical and include technetium-99 m labelled peritoneal scintigraphy and computed tomography (ct) with intraperitoneal dye. in terms of management, however, most cases of pleuroperitoneal leak are initially managed by drainage of the peritoneal cavity. many patients choose to remain on hd in the long term and, therefore, formal repair of the diaphragm is not required. for those that wish to return to pd, there are a number of management options., thorascopic diaphragmatic repair was performed using absorbable polyglycolic acid felt, and fibrin glue. this allows resolution of the effusion and, in some cases, healing of the diaphragmatic defects. a trial of low - volume pd two six weeks later is successful in a significant proportion of cases. recurrent hydrothorax necessitates either a permanent switch to haemodialysis or definitive management of the pleural - peritoneal communication. this method had relatively high rates of success, with 48% of patients resuming long - term pd after pleurodesis in one large systematic review. video - assisted thorascopic surgery, with direct visualization of the diaphragmatic defect and suture repair, has shown much promise in recent times for the management of this condition [13, 14 ]. using this approach, 88% of patients in one study successfully resumed long - term pd without recurrence. the three cases described above highlight the variability of this condition in terms of timing, symptoms, and management. pleuroperitoneal leak should be considered in the differential diagnosis of a pleural effusion, particularly a rightsided effusion, in a patient on peritoneal dialysis. | pressure related complications such as abdominal wall hernias occur with relative frequency in patients on peritoneal dialysis. less frequently, a transudative pleural effusion containing dialysate can develop. this phenomenon appears to be due to increased intra - abdominal pressure in the setting of congenital or acquired diaphragmatic defects. we report three cases of pleuroperitoneal leak that occurred within a nine - month period at our institution. we review the literature on this topic, and discuss management options. the pleural effusion resolved in one patient following drainage of the peritoneum and a switch to haemodialysis. one patient required emergency thoracocentesis. the third patient developed a complex effusion requiring surgical intervention. the three cases highlight the variability of this condition in terms of timing, symptoms and management. the diagnosis of a pleuroperitoneal leak is an important one as it is managed very differently to most transudative pleural effusions seen in this patient population. surgical repair may be necessary in those patients who wish to resume peritoneal dialysis, or in those patients with complex effusions. pleuroperitoneal leak should be considered in the differential diagnosis of a pleural effusion, particularly a right - sided effusion, in a patient on peritoneal dialysis. |
we have reported a 78 year old man with complaint of abdominal pain and vomiting. in patients preoperative evaluation for surgical management of an intra - abdominal mass, a large intracardiac mass has found incidentally during the echocardiography. pathologic biopsy of right atrial mass that has removed by open heart surgery shown : non hodgkin - b cell lymphoma. the patient has treated by chop chemotherapy regiment successfully and after completion of treatment, there was complete response. gross tumor formation in any of the cardiac chambers has been rare, particularly at the time of presentation and diagnosis of lymphoma (2). symptoms were usually very subtle and non - specific, particularly in the setting of co - existing comorbidities (3). as imaging modalities and treatment options for lymphoma have improved, more unusual disease presentation might be observed more frequently. in this article we have reported a 78-year - old man with an incidental large cardiac mass whose symptoms was abdominal pain and vomiting in the setting of pre - operative evaluation for surgical management of intra - abdominal mass. a 78-year - old man has affected by abdominal pain, vomiting and weakness and has evaluated at june 2013. studying his medical history, he had hip joint replacement surgery, then in initial physical examination has shown no significant finding, except a few tenderness on the middle abdominal quadrant. in laboratory assessment, complete blood count, renal function tests - alkaline phosphatase and lactate dehydrogenase were normal, but hemoglobin and transaminases were abnormal as follows : hb = 9.1 mg / dl, ast = 71 u / lit, alt = 656 u / lit. in abdominal ct scan, there was a 71 61 mm mass at the aortic bifurcation in favor of tumoral lesion or adenopathy. ecg had no significant and specific changes and in echocardiography, a large mass with diameter of 74 60 mm has seen in right atrium (figure 1) and lv ejection fraction was 65%. also, in thoracic sections of ct scan, an intra - cardiac mass has seen (figure 2). bases on these new findings management of the patient has changed to cardiac surgery and open heart surgery has recommended and performed at august 2013. pathologic examination of removed cardiac mass has reported as below after immunohistochemistry study : hmb 45 and ck : negative ; cd20 : positive. compatible with non - hodgkin lymphoma in favor of b - cell origin (figures 3 and 4). he has referred to oncologist after recovery of heart surgery (september 2013). in evaluation of medical history and further physical examination, he had no history of fever and sweating, but weight loss of 2 - 3 kg during recent weeks. karnowsky performance status was 80%. at physical examination, he had an adenopathy of 2 1 cm at left jugulodigastric chain, and the another of 3 1 cm at left supraclavicular area and physical exam was normal otherwise. in bone marrow biopsy, the patient has planned to treat by r - chop chemotherapy regimen (rituximab - cyclophosphamide - doxorubicin - vincristine - prednisolone). he could not provide rituximab due to economic problems, therefor he has received only chop regimen. after first cycle of treatment, cervical adenopathies have disappeared and at the end of seventh cycle, imaging of the neck, chest and abdominopelvic cavity by ct scan had no positive finding of disease but the patient has not satisfied to undergo bm biopsy for second time. patient treatment has completed after eight cycles of chop chemotherapy regimen at february 2014, but he was in good condition, without any evidences of disease after six months of follow up. cardiac masses have been arising from the heart or pericardium, were potentially lethal whether defined as benign or malignant. metastatic deposits have represented the vast majority of cardiac malignancies ; the common primary malignancies sources have included cancers of lung, esophagus and breast as well as lymphoma, leukemia and melanoma (5). cardiac involvement as an initial presentation of malignant lymphoma was a rare occurrence (2). secondary involvement of the heart has seen in 8.7 - 27.2% of documented clinical case of lymphoma (2, 6, 7). despite its life - threatening nature (8), the cardiac manifestations of lymphomatous involvement of the heart these symptoms and signs might include arrhythmias, pericardial effusion or tamponade, tumor embolization and obstruction of blood flow and valvular dysfunction. these symptoms have related on tumor location, size, growth rate, degree of invasion and friability. in the present case and many other reports the majority of intracavital tumors have occurred on the right site of the heart, the reason for which has yet been to be found (1, 11). plain chest radiographs lack sensitivity and specificity as an initial diagnostic tool but could demonstrate cardiomegaly or specific chamber enlargement. echocardiography was the first non - invasive study for examining the chambers of the heart and pericardium (12) but trans esophageal echocardiography (tee) was a more sensitive technique for assessing patients (13). ct scan and mri with gadolinium contrast injection were useful tools for demonstrating morphology, location, extension of disease, blood flow and cardiac function (14, 15). fdg - pet imaging has recently reported to reveal previously unsuspected cardiac involvement (16, 17). although traditionally this has required a thoracostomy, less invasive procedures has recently been available such as tee - guided biopsy, endomyocardial biopsy, or percutaneous intracardiac biopsy with combined fluoroscopy and tee or pericardial fluid sampling (18, 19). the available literature suggested systemic chemotherapy was the only effective therapy (18) and the majority of cases have treated with combination chemotherapy with varying results (20, 21). there was an improvement in response and survival rates by adding of monoclonal therapies to chemotherapy (22). radiation therapy has indicated in cardiac mass that progresses despite chemotherapy and its adverse side effects have been pericarditis, cardiomyopathy, diastolic dysfunction, conduction defects and coronary artery disease. cardiac involvement was rare as an initial presentation of malignant lymphoma and has often been subclinical. these tumors have seen more common in the right site of the heart and tee, ct scan and mri with gd were effective tools in assessment of patients. pathologic diagnosis would be essential to management of cardiac masses and the only effective treatment has been chemotherapy. | introduction : cardiac involvement as an initial presentation of malignant lymphoma has been a rare occurrence.case presentation : we have reported a 78 year old man with complaint of abdominal pain and vomiting. in patients preoperative evaluation for surgical management of an intra - abdominal mass, a large intracardiac mass has found incidentally during the echocardiography. pathologic biopsy of right atrial mass that has removed by open heart surgery shown : non hodgkin - b cell lymphoma. bone marrow biopsy was taken and was positive for lymphomatous involvement.conclusions:the patient has treated by chop chemotherapy regiment successfully and after completion of treatment, there was complete response. |
it was recently revealed that one quarter of paediatric intensive care beds in holland are closed and that many critically ill children have to be transferred to receive care. problems organizing paediatric intensive care exist in most health care systems. if we are to avoid crises such as this then we have to solve two fundamental problems : the way in which we staff the intensive care units with nurses ; and the lack of information that we have regarding the service that we are trying to commission. first, they are usually required to have specific higher postgraduate training in order to work at a basic grade. such training may not enhance their pay as compared with other nurses in other disciplines. second, their career structure is pyramidal, which limits the opportunities for individual progression and increases the appeal of lateral career moves into less stressful environments such as community nursing or (in the uk) national health service direct. from the nurse 's perspective, salary progression is usually linked purely to administrative responsibility and often fails to recognise significant additional practical and intellectual skills, such as intensive care training itself or additional experience (e.g. in techniques such as haemofiltration or extracorporeal membrane oxygenation). even when additional recurrent funds are identified to commission a paediatric intensive care service, it can thus prove prohibitively difficult to open intensive care beds. furthermore, when service provision is inadequate, problems with recruitment suffer from negative reinforcement. centralization of care in large high volume units enables the best return from any limited resource, and it is tempting to assume that nurses will be the same as any other resource in this respect. nurses are unlikely to commute large distances to find work in intensive care in preference to a local change in specialty. effective planning and commissioning of a paediatric intensive care service requires close audit of activity, which we lack. in many cases the capacity of a paediatric intensive care service can be described in terms of the number of physical bed spaces present, but this does not reassure us that the beds are accessible. variations in patient dependency, the numbers of nurses available and their skill mix all have to be taken into account when deciding whether a bed can be used at a given time. even knowledge of the number of accessible beds tells us nothing about the amount of work being done. such information can only be gained by looking at patient flow (admission rate, duration of stay, occupancy, readmission rate) and intervention rates. even then, information regarding quality of care is lacking. a limited view of the quality of care (its effectiveness) can be inferred from standardized mortality ratios generated using mortality prediction models. however, the use of mortality data in this way has been questioned in paediatric intensive care, where survival rates are greater than 90% and morbidity may be of increased relevance because of the potential longevity of survivors. most literature and research using standardized mortality is based on the performance of individual units or groups of units. from an epidemiological perspective, however, it is preferable to know what happened to every child from a defined population who received intensive care (irrespective of where it was provided) and whether a lack of resources meant that some children were denied intensive care. there is evidence that increasing numbers of children are receiving or are expected to receive intensive care. in the uk (or at least in birmingham) this is occurring without a change in the intubation rate, implying that the change could represent partial resolution of an asserted shortage. where there are ample resources there is a tendency to provide high dependency care and ' observation ' on the intensive care unit, whereas triage otherwise limits this tendency. hence, when great variation in the incidence of intubation is observed within or between health care systems, one can infer variation in resource provision. the greatest concern must be when refused admissions occur in units with high intubation rates. the appropriateness of intensive care admission or intervention ultimately still has to be judged on a case review basis. the development of the mortality prediction model ' pim ' (paediatric index of mortality) has involved a collaboration that has, among others, incorporated all paediatric intensive care delivered in australia. the epidemiological superiority of these data will increase the influence of the conclusions drawn from it. in the uk, where we have long suffered from similar problems to those currently affecting holland first, this is being achieved through a study designed to assess the relevant mortality prediction models, which is to include morbidity (united kingdon paediatric intensive care outcome study, ukpicos). the study has recruited all the major providers of paediatric intensive care in the uk. second, the english department of health has commissioned a continuous audit of paediatric intensive care to follow on from that study called ' picanet ' (paediatric intensive care audit network), which will include the successful severity model. hence, commissioners will have access to comparative, risk adjusted, performance data on which to make their decisions. | problems with commissioning paediatric intensive care stem both from difficulties in recruitment and retention of nurses, and from incoherent or nonexistent national audit. pyramidal career structures and patterns of remuneration that concentrate on administrative responsibility over clinical skills underlie the former, whereas poor audit conceals variations in both service quality and demand. epidemiologically superior data are required if we are to solve commissioning problems. we need to know what happened to every child from a defined population receiving intensive care and whether a lack of resources means that some children are denied intensive care. |
lead is an element that expanded on the environment as a result of human activity during the past thousands of years. lead poisoning is due to increased levels of lead in the body (1) and hasnt specific signs or symptoms. lead is found in a variety of organs including the heart, bones, intestines, kidneys and nervous system, and enters in the body via air, water, soil and food (2 - 4) ; but food is the main way of entering, through contaminated grains and vegetables. years ago, literature emphasized on the toxic effects of lead including infertility, miscarriage and premature birth. lead toxicity interferes with the normal development of central and peripheral nervous system (5). increase in blood lead levels over than 10 microgram per deciliter can decrease the memory, intelligence quotient, focus and attention (5 - 7). various studies have shown that high levels of blood lead in pregnant women, even in limited quantities, can increase this element in the fetal blood (9 - 10). in other studies it was concluded that brain edema and finally irreversible brain damage may result from exposure to high levels of lead (11,12). in all studies, it is concluded that lead poisoning in children causes severe disorders in the nervous system and leads to neuro developmental disabilities which may result in sensory, motor and cognitive impairments (13,14,22). seizures are the prevalent nervous disorders and all of seizures can result from exposure to variant poisons such as lead (21). febrile convulsions are seizures that appear during the course of an illness with a high fever in a child (21).therefore, it is important to examine the association between febrile convulsions and exposure to the lead. the diagnostic scale for lead poisoning is measuring the blood lead levels. a study in patients with amyotrophic lateral sclerosis (als) showed a significant association between lead levels in plasma and cerebrospinal fluid. many studies in children have been done on blood lead levels, but there are few researches on the cerebrospinal fluid lead levels (15 - 17). assessment of cerebrospinal fluid levels and plasma levels of lead can help to further understanding of the mechanisms of its effects on the brain. in some parts of the world including major cities of iran, the air contains high level of emissions, and lead is the important ingredient in the emissions. tehran is an industrial city and there is high level of lead in the air of tehran (18). this study investigated the blood lead concentration and its association with convulsion in a group of febrile children that admitted to the pediatric ward of rasoulakram hospital and bahrami hospital in tehranin the year 2012 ad. this cross - sectional study conductedin children admitted to pediatric wardof rasoulakram hospital and bahrami hospital in tehran. research field consisted of hospitalized babies aged 1 - 72 months whom fever was detected by physical examination. after permission from the university s ethic committee and hospital authorities, sixty babies, enrolled to the research via non - probability sampling (convenience method). a questionnaire was designed for data collection. following the informed consent of all parents, all of babies underwent blood sampling the blood lead levels measured by atomic absorption spectrometry method, then these values enrolled in the questionnaire. also other samples information including gender, age, weight and history of seizures recorded in the questionnaire. finally all of data transfered to the spss version 20 software for statistical analysis.p values of lower than 0.05 were considered statistically significant. finally all of data transfered to the spss version 20 software for statistical analysis.p values of lower than 0.05 were considered statistically significant. 40 of the samples (66.7%) were male and 20 samples (33.3%) were female. the mean and standard deviation of sample s age was 32.57 38.27 months, ranging from one month to 168 months (14 years). the mean and standard deviation of sample s blood lead level was 4.833.50g / dl. the highest and lowest blood lead level in all samples was 14.80 and 0.3 g / dl. according to international standards, amounts of blood lead levels in 6 cases (10%) was greater than 10g / dl and in 54 cases (90%) was less than 10g / dl. in general, seizure was found in 32 cases (53.3%) and other cases (46.7%) were seizure free. in samples with seizures, the mean and standard deviation of sample s blood lead level was 4.91 3.65g / dl, and 4 cases of samples with seizures (12.5%) had blood lead levels above 10g / dl. in samples without seizures, the mean and standard deviation of sample s blood lead level was 4.73 3.38 g / dl ; the 2 cases without seizures (7.14%) had blood lead levels above 10g / dl. the mean of sample s blood lead levels in children with seizures and without seizures was nt significant difference (p=0.8). according to international standards (blood lead levels above and below the 10g / dl), was nt significantly different between two groups (p=0.67). tables 1 to 4 show the frequency of variables and the p - value corresponding to the difference between two groups (with seizure and without seizure). this study showed that blood lead levels in babies with fever and a seizure (febrile convulsion) has no significant difference with those without seizure. the results of this study is similar to findings of some other studies have concluded that higher levels of lead in the blood can cause neurological symptoms. in one study, noted that blood lead levels over than 10g / dl, may decreased intelligence and concentration, and impaired short term memory. in that study, blood lead levels of patients was not associated with fever and age of patients (3). the result of some other studies is different to the present study. in one study, 2.1% of the children and 1.3 % of adults have blood lead levels above 10g / dl, that was lower than in our study (19). in one study, blood lead levels in children with neurologic symptoms such as seizures was 19.3g / dl, compared with 11.69g / dl in the control group ; and blood lead levels in both groups were higher than in our study (20). in some previous studies, high levels of blood lead levels the study of woolf. found that trace amounts of lead (less than 10g / dl) can cause neurological disorders (4). but talia sanders study emphasizes that lead can passes from to blood - brain barrier in children. meyer and colleagues emphasizes that lead can cause seizures, coma and death in the children (6). in the study by bellinger, it was seen that severe intelligence decline and academic impairment is associated with less than 10g / dl of blood lead levels. also in this study it was concluded that there is no safe level of lead exposure, and contact in low amounts on children causes neurodevelopment disorders ; so primary prevention of lead exposure is the most important mechanism (7). in this study, febrile convulsion in babies has no significant relationship with blood lead levels. it is recommended that future studies be done by more samples to validate the results and to increase the ability of generalize the results to other populations. moreover, the association of seizures and other neurological disorders should be evaluated with lead levels in various samples such as cerebrospinal fluid. | background : lead elements have an adverse effect on human health. the most important complications of lead poisoning are disorders of nervous system particularly seizure.this study aimed to evaluate the blood lead levels and its association with convulsion in a group of hospitalized febrile children. methods : in this analytic cross - sectional study, 60 hospitalized febrile children with 1- 60 month old participated in the study via non - probability convenience sampling method. all of the information included sex, age, weight, blood lead levels and history of convulsion gathered in the questionnaire. finally all of data were statistically analyzed. results : 66.7% of samples were male and 33.3% were female. the mean age was 32.5738.27 months and the mean weight was 13.049.61 kg. the mean and standard deviation of blood lead level was 4.833.50g / dl. 10% of samples had lead levels greater than 10g / dl. 53.3% of patients have convulsion and other do nt have it. blood lead levels was 4.913.65g / dl in children with convulsion and 4.73 3.38g / dl in children without it ; the difference was not significant (p= 0.8). conclusion : overall, no significant association was found between blood lead levels and convulsion. |
the index patient, a 26-year - old woman, was admitted to the infectious disease ward of a university hospital with a temperature of 40c and myalgias 3 days after she returned from a 3-week trip to cambodia and thailand. she was discharged in good condition after the fever subsided. on the day of admission of the index patient (day 0i), a nurse sustained a needlestick injury with a hollow needle that had been used for drawing blood from the index patient. the needlestick resulted in a bleeding puncture wound that was immediately treated with an antiseptic. the index patient did not report any high - risk activity for hiv or hepatitis b virus, and the nurse had been immunized against hepatitis b virus. therefore, no specific postexposure prophylaxis was performed. the nurse had previously been in good health and had not traveled outside germany in the preceding 12 months. four days after the needlestick, headache, myalgias, and arthralgias developed in the healthcare worker, for which she took ibuprofen. seven days later, when she was experiencing an intense headache and noticed a macular rash on her trunk, she sought treatment from a local doctor (day 0n). physical examination showed bilateral cervical lymphadenopathy. on day 2n, she visited our service, where dengue virus infection was diagnosed by using a light cycler (roche diagnostics, mannheim, germany) polymerase chain reaction (pcr) method. her symptoms lessened gradually over the course of 4 weeks, and she was on sick leave for 5 weeks. the time frame of the respective clinical presentation and the virologic results of the index patient and the nurse are shown in the figure ; laboratory data are presented in the table. time line of the signs, symptoms, and diagnostic tests in the index patient (i) and nurse (n). ig, immunoglobulin ; eia, enyzyme immunosorbent assay ; pcr, polymerase chain reaction ; nd, not done. serologic studies were performed with the panbio dengue immunoglobulin (ig) m capture enzyme - linked immunosorbent assay (elisa) and panbio dengue indirect igg elisa (panbio ltd., brisbane, australia) (3) ; arbitrary units relative to a simultaneously measured calibrator > rna was prepared from 140 l of serum by using the qiaamp viral rna mini kit (qiagen, hilden, germany), according to the manufacturer s instructions. to detect specific dengue virus rna, we adapted a taqman - reverse transcription (rt)-pcr (4) to detect any of the four serotypes by using the following : degenerated forward primer (den fp), reverse primer (den rp) ; and probe (den p) : den fp 5aaggactagaggttakaggagaccc3, den rp 5ggccytctgtgcctggawtgatg3 and the probe den p 5 fam - aacagcatattgacgctgggaragacc - tamra-3. rt - pcr conditions for the light cycler (roche diagnostics) were : rt at 61c for 20 min, activation at 95c for 5 min, and 40 cycles of pcr at 95c for 15 s, 60c for 60 s. we used the rna master hybridization probes kit (roche diagnostics) with 500-nm primers and 200-nm probes. the kit includes an aptamer - blocked thermus thermophilus dna polymerase, which performs rt and, once the aptamer drops out at activation, hotstarts pcr amplification. this is the fourth reported case, to our knowledge, of nosocomial dengue virus transmission (57) and the first in which taqman rt - pcr was used to provide evidence of nosocomial transmission before the detection of an antibody response. the index patient had acquired a dengue virus infection in southeast asia and experienced typical symptoms. in particular, she was febrile on admission, when the needlestick injury of the nurse occurred. in the health care worker who sustained the injury, cephalgia and myalgias developed after an incubation period of 4 days. a typical rash appeared after 11 days, when she also had a severe headache. the absence of fever, the most common sign of dengue fever, is likely due to the administration of ibuprofen. however, the healthcare worker was on sick leave for 5 weeks with resulting socioeconomic consequences. the diagnosis was confirmed in both cases by both seroconversion and detection of dengue viral rna by taqman rt - pcr ; the latter gave positive results in both cases 3 and 6 days, respectively, before serum specimens were shown to contain antibody. dengue viremia is known to correlate well with the presence of fever (8), which was the case in the index patient. our report illustrates the potential of percutaneous nosocomial transmission of dengue viruses. this risk is likely to increase with the increase in the number of dengue infections imported to countries where dengue viruses are not endemic | recent transmission of dengue viruses has increased in tropical and subtropical areas and in industrialized countries because of international travel. we describe a case of nosocomial transmission of dengue virus in germany by a needlestick injury. diagnosis was made by taqman reverse transcription polymerase chain reaction when serologic studies were negative. |
dental identification can be used for identifying the deceased or the assailant in a crime scene or for identification of victims of a mass disaster. in the asia pacific region, because of its wide range of variations in topography and climatic conditions, india is a disaster prone country with an average of eight major natural calamities a year. while floods, cyclones, droughts, earthquakes and epidemic are frequent from time to time, major accidents occur in railways, mines and factories causing extensive damage to human life and property. in recent times, this is relatively a young science of dentistry and still in its infancy state in india where as in other developed countries it has acquired a recognized branch of dentistry in medical forensicology. in india, so, an attempt should be made to reinforce dental awareness among forensic personnel not only about the role of dentists in person identification also to awaken the social responsibility of maintaining dental records of all patients. one such condition that can be noted in the dental records is transposition, which is one of the most difficult of clinical situations to treat and is a condition that has been observed and studied since the early 19 century. in his first edition titled a dictionary of dental sciences, biography, bibliography and medical terminology harris in 1849 gave a description of transposition as an aberration in the position of teeth. it is in fact a unique and extreme form of ectopic eruption wherein a permanent tooth develops and erupts in a position normally occupied by another permanent tooth. transposition is used to refer to an interchange in the position of two adjacent teeth within the same quadrant of the dental arch. whereas, ectopic eruption refers to an abnormal eruption path taken by a tooth. during identification of this condition, a distinction should be made between a complete and an incomplete transposition. a complete transposition is a condition wherein both crowns and the entire root structures of the involved teeth are found in their transposed positions. whereas incomplete transposition is also called transposition the crowns may be transposed while the root apices remain in their normal positions or the crowns may be in the correct order while the root apices are transposed. the involved teeth overlap and their long axes cross each other. in addition, the crowns and roots of the involved teeth may completely superimpose each other on normally projected radiographs. displacement and migration of teeth is a common phenomenon and literature evidence point to the fact that maxillary canine is probably the most frequently displaced tooth. when displaced in the palatal or labial plane when displaced distally or mesially, an ectopically erupting canine can become transposed with one of the adjacent teeth. the objective of this review is to intimate medical and dental practitioners of the crucial role of dentist in the victim 's identification and to further update the trainee dental specialist about this unique condition. sandham and harvie conducted a study on scottish school children and concluded that 0.38% was seen to have transposition out of a sample of 800, which was corroborated by a study in india where the occurrence was seen to be 0.4%. thilander and jakobsson reported prevalence of 0.26% in swedish school children. according to peck and peck and feichtinger., transposition affect both sexes equally, but some authors reported more frequency in females and others have found a higher prevalence in males. unilateral transposition has been reported more often than bilateral transposition, with the left side being somewhat more frequently involved than the right. transpositions have a more female preponderance than males and more often in the maxilla with the maxillary canine as the tooth most frequently involved in transposition, usually with the first premolar and less often with the lateral incisor. a classification system with six classes grouped according to the teeth involved in the transposition has been suggested for the maxillary arch. these are : maxillary canine - first premolar [figure 1]maxillary canine - lateral incisormaxillary canine - to - first molar site [figure 2]maxillary lateral incisor - central incisormaxillary canine to central incisor sitemandibular lateral incisor - canine. maxillary canine - first premolar [figure 1 ] maxillary canine - lateral incisor maxillary canine - to - first molar site [figure 2 ] maxillary lateral incisor - central incisor maxillary canine to central incisor site mandibular lateral incisor - canine. according to kuttapa., etiological possibilities include genetics, retained primary teeth, deviation of eruptive path of permanent teeth and abnormality in the sequence of eruption of permanent teeth. the maxillary canine - to - first premolar transposition was determined to be an anomaly resulting from genetic influences within a multifactorial inheritance model. in a study conducted by peck., evidence was found to suggest that the maxillary canine - to - first premolar transposition is genetically influenced, which has been proven by observations such as moderate rate of bilateral occurrence, sex - associated frequency differences, increased prevalence of additional dental anomalies and occurrence along family lines. in some cases, the canine - to - first premolar transposition occurs simultaneously with developmentally absent lateral incisors and is the most frequently appearing maxillary transposition type, comprising 71% of the cases. the etiology of tooth transposition has been the subject of much controversy and is still not completely understood. multifactorial genetic factors, an interchange in the position of the developing dental lamina of the involved teeth and even trauma to the deciduous teeth in which dilacerations of the permanent incisor root was found have all been suggested as causes for transposition of teeth. another theory suggests that retained deciduous canines, observed in a large number of canine transpositions, might be the primary cause for the displacement and migration of the permanent canine from its normal path of eruption. although not a true transposition, this migration theory may help to explain those extreme cases in which the canine erupted in the position of the incisor, second premolar or first molar. transposition is often accompanied by other congenital dental anomalies such as hypodontia [figure 3 ], peg - shaped or small maxillary lateral incisors, retained deciduous teeth, severe rotations and malposition, dilacerations or malformation of the adjacent teeth. when transposition occurs, the involved teeth show a characteristic malposition and appearance. bilateral transposition forensic odontology is a vital and integral part of forensic science that is most widely utilized for identification of the living and deceased persons. in india, so, an attempt should be made to reinforce awareness in dental practitioners about the role of dentists in person identification and to awaken the social responsibility of maintaining dental records of all patients. transposition is a rare and severe positional anomaly that represents a challenge for a dentist. it requires a keen eye on the part of the forensic pathologist to identify the condition. in this article, transposition of teeth is a condition that is recorded and managed during the dental treatment. this recording of transposition at dental clinical examination can be used to aid identification of mass disaster victims. the presence or absence of dental treatment (which gives information on the attitude and dental awareness of an individual) as well as the quality and quantity of dental treatment (type of restoration, type of prostheses or appliance) may give some clues on the socio - economic status of the individual. in short, we can say, in post mortem dental profiling, a forensic dentist looks for all possible methods to narrow down the identity of the deceased so as to enable search for the ante mortem records. this as a method of forensic dental identification is used when comparative and other methods of identification are not sufficient to establish the identity of the individual. hence, it is the social responsibility of each and every dentist to maintain the dental records of their patients for the noble cause of identification in the event of mass disaster. | dental identification plays a key role in mass casualties and is usually based on disturbances of tooth eruption, malocclusions and/or previous dental treatments, changes brought about by age, pathological conditions and developmental disturbances. tooth transposition is a disturbance of tooth eruption and is defined as change in the position of two adjacent teeth within the same quadrant. this review aims to discuss the prevalence and the etiology of transposition through a literature survey and to discuss its importance and implications as pertaining to the field of forensics. in summary, transposition is a rare and severe positional anomaly that represents a challenge for a dentist. it requires a keen eye on the part of the forensic pathologist to identify the condition. |
ctc are usually detected in the peripheral circulation, but we can find ctc in other body fluids like the cerebrospinal fluids or the urines. the limitations to discover the ctc in these fluids are the same than in the blood circulation. however, it is possible to extract a relatively big amount of blood without harming the patient and much easier. we will focus on the methods of ctc detection in the blood. as we describe above, ctc in the peripheral circulation occur at an estimated number of one ctc per 10 peripheral blood mononuclear cell or pbmc. because of the scarcity of the target cells, it is necessary to concentrate the sample. since enrichment will inevitably be accompanied by some loss of ctc, irrespective of the method, some essays are performed directly in whole blood. two different groups of techniques can be used to enrich samples, the nonspecific and the specific enrichment techniques. the nonspecific enrichment techniques use physicochemical ctc properties (size, density, etc.). advantages of the nonspecific and specific enrichment techniques are summarized in the table 2 and described in the following paragraphs. the tumor cells, epithelial cells, platelets, and low - density leukocytes from leukocytes and erythrocytes can be separated by the propriety of their particular density (table 2). density gradient centrifugation is the preferred method to purify cells, subcellular organelles, and macromolecules. density gradients can be generated by placing layer after layer of gradient media such as sucrose in a tube with the heaviest layer at the bottom and the lightest at the top in either a discontinuous or continuous mode. the cell fraction to be separated is placed on top of the layer and centrifuged. density gradient separation can be classified into two categories : (1) rate - zonal (size) separation. rate - zonal separation takes advantage of particle size and mass instead of particle density for sedimentation. in isopycnic separation, a particle of a particular density will sink during centrifugation until a position is reached where the density of the surrounding solution is exactly the same as the density of the particle. once this quasi - equilibrium is reached, the length of centrifugation does not have any influence on the migration of the particle. a common example for this method a variety of gradient media can be used for isopycnic separations [157161 ]. in the context of the ctc enrichment by centrifugation the cells that have a density higher than the density of the buffer will stay in the bottom of the tube. if the density of the cells is lower than the buffer, they will remain on the top of the liquid, forming a ring. on the contrary, if the density of the cells is the same than the buffer, the cells will form a ring in the middle of the tube. a well - known example of the method is the commercial buffer ficoll tube or ficoll - paque plus (ge healthcare bioscience, amersham biosciences ab) or lymphoprep (nicomed) to separate the red blood cells from the other cells including ctc (table 2). oncoquick (greiner) method uses a specific buffer able to isolate the ctc [47, 139, 140 ]. these methods are usually fast but expensive and found in a context of clinical laboratory used in routine diagnosis (table 2). alternative and cheaper methods can be used by preparing in the laboratory the gradient / density buffers. the same tube can contain one, two or three gradient buffers to increase the specificity of the separation between the different cells present in the blood [27, 47, 162, 163 ]. it is possible to expose the samples to buffer(s) that can be hypo - or hyperosmotic to any cell different to the target cells. after the lysis step the mix is centrifuged and the pellets will contain the ctc. after lysis, the next step is the extraction of dna or rna (e.g., red lysis buffer from qiagen or panomics) or the extracted cells can be purified by immunomagnetic beads enrichment [147149 ]. however, methods using lysis buffer can induce the death of a lot of cells including the ctc and it is not appropriate if the sample contains few ctc leading to false negative results. the cytocentrifugation was designed for hypocellular fluids ; it spins at lower speeds and has more gradual acceleration and deceleration than normal centrifuges cytocentrifugation could be used in research purposes and is also widely used in the routine surgical pathology practice. this method is fast and affordable [65, 144, 145, 164 ]. methods to identify ctc can after be used (see below). as it occurs with magnetic beads, cytospin increases mortality of the target cells (table 2). because enrichment by cytocentrifugation is a critical step, addition of 10% buffered formaldehyde solution added to the blood sample can preserve morphology of the cells and will certainly preserve nucleic acids integrity, but the disadvantage of this method is that formaldehyde kills the cells (table 2). liquid - based cytology (lbc) using a filtration process and computer assisted thin layer deposition of cells has been developed as a replacement for cytocentrifugation and/or smearing, owing to its improved cell recovery capabilities and better cell preservation. in one is that it produces a thin layer of cells which is easier to evaluate than a thick smear. in addition, the entire cell sample is captured in the fixative vial which leads to a more representative smear being prepared. one of the most important advantages of this test is that the material that is left over after a smear has been prepared can be used for adjunctive testing. computer software reads the smears and registers the coordinates of the fields with what it regards as the most abnormal cells. on review, the system directs the cytotechnologists to these fields where they are evaluated. there are also some disadvantages, which include increased manpower needed to prepare the smears and the dependence of smear preparation on the instrument. the red blood cells need to be eliminated (see table 2) and after the sample can be processed by this technique (table 2). however, optimization of cell capture and fixation can be achieved by methods other than cytyc thinprep lbc, particularly while using meticulous modern cytocentrifugation methods in the study of hypocellular fluids [166, 167 ]. in their study, conclude that cytyc thinprep lbc and modern cytocentrifugation techniques are appropriate methods for cytology - based molecular studies. from an economical point of view (standard cytocentrifugation are around $ 538 compared to cytyc thinpreph $ 1,278), and taking into account the value of a meticulous technique, cytocentrifugation with disposable sample chambers remains the quality standard for current treatment of urinary samples for example. a nonspecific method of enrichment using filters can captured the cells with a certain size. the cells captured on the filter can after be transferred and analyzed on a slide. in this case the samples can come from blood or body fluids (urines, cerebrospinal fluid, and ascites). we will describe tow kinds of methods using this technology and usually used to isolate ctc (table 2) : the isolation by size of epithelial tumor cells (iset) method and the micro - electro - mechanical system (mems). (iset) method (metagenex, paris, france, http://www.metagenex.fr/) separates cells by size with a filter. cells larger than 10 m, including tumor cells from carcinomas, are enriched from leukocytes (erythrocytes are lysed, see above) on a filter. enriched cells are stained on the filter and ctc are precisely counted after cytopathological evaluation. the cells on the filter can be also studied by immunolabelling, fish, tunel, and molecular analysis. the filter can be also mounted between slide and coverslip for routine microscope observation and storage. although promising, this method is expensive, time consuming, and the filters are not easily available [47, 68, 141 ]. a second potential main advantage is that ctc could be compared to the primary tumor in order to better understand the mechanism of metastatic process. however, this approach has been rarely performed and neither firm recommendation nor conclusion could be drawn. the technique also avoids damaging the tumor cell which can be diagnosed using a simple pathologist analysis. however, the pathologist should get use to this technique to avoid a misinterpretation with others types of cells. the use of iset technology to detect and characterize ctc in hcc has been reported in one study. vona. reported that microemboli and isolated ctc could be detected in hcc patient. -catenin mutations were found in only 3 ctc that highlighted the weak impact of these mutations in the initial step of tumor cell invasion. it is a parylene membrane microfilter device for single stage capture and electrolysis of circulating tumor cells in human blood and the potential of this device to allow genomic analysis. after the ctc, are captured in the filter, electrical lysis of cells on membrane filter is applied and the dna as well as rna can be extracted and analyzed by pcr or rt - pcr, respectively. ctc enrichment is performed by either gradient centrifugation of ctc based on their buoyant density or magnetic separation of epithelial ctc, both of which are laborious procedures with variable efficiency, and ctc identification is typically done by trained pathologists through visual observation of stained cytokeratin - positive epithelial ctc. the micro - electro - mechanical system (mems-) based makes the process simpler faster and better to separate ctc (~90% recovery) from blood cells. since enrichment will inevitably be accompanied by loss of ctc, irrespective of the exact method, some essays are performed directly in whole blood. but the disadvantages of this technique are that morphology of the cells is lost, besides markers also and the capacity to count exactly the number of ctc (table 2). these methods use antibodies against the protein tumoral markers coupled to steel beads, by applying a magnetic field the cells expressing the marker can be captured. several immune - magnetic methods (macs system, deanabeads invitrogen, macroiron beads, ferrofluid(colloidal iron-) based systems) to enrich the sample have been used successfully. another approach to enrich the sample is to use the properties of ctc to grow - up in a specific culture cell medium. a method (epispot) that combines the capacity of ctc to secret specific markers and grow - up in specific cell medium was developed (see table 2). to use immune - magnetic detection system the first step is to deplete the whole blood of the red cells (by lysis buffers or density gradient) to obtain the pbmc. after, the magnetic particles coated and surrounded by a specific antibody are added to the pbmc supposing containing the ctc. labeled cells are then collected by applying a magnetic force while nonlabeled cells are containing in the supernatant and are discerned. this use of magnetic beads to catch specifically ctc is called positive selection [40, 47, 49 ]. since a large number of leukocytes (potential source of false negative ctc) still remain trapped with the cells, some methods include a negative selection of leukocytes (with anti - cd 45 beads for example) followed with a positive selection with antibodies specific to epithelial cells (epcam, ck) [47, 169, 170 ]. the problem of this procedure is that gets ride the majority of leukocytes but still hold in nonmalignant epithelial cells and loses tumor cells which whish do not express epithelial antigens and/or are lysed during the first step [47, 171 ]. the methods using antibodies like immune - magnetic methods (macs system, deanabeads invitrogen, macroiron beads, ferrofluid(colloidal iron-) based systems) to enrich the sample will induce false - positive extraction. for example, antibodies against cytokeratin (ck) or other epithelial - specific antigens have been reported to bind both specifically and nonspecifically to macrophages, plasma cells and nucleated hematopoietic cells precursors. the nonspecific binding of the antibodies involves fc receptor - bearing leukocytes and monocytes or illegitimate expression of epithelial antigens in normal hematopoietic cells. variable numbers of epithelial cells have been found in peripheral blood of subject without malignancy in some physiopathological conditions like benign epithelial proliferative diseases, inflammation, surgeries, and tissue trauma [47, 65, 169, 172174 ]. moreover, epithelial ctc may lose epithelial markers during dissemination through the process called epithelial - to - mesenchymal transition (emt). since the epithelial markers that get lost during emt may include markers used for ctc measurement, underestimation of the actual ctc number may occur, inducing de facto false - negative results [46, 47, 49, 175, 176 ]. in the case that the method induce false positive, the problem can be diminished avoided using a second marker or a full panel of markers and techniques (see below) to characterize the ctc, like rt - pcr, immunocytochemistry or immunefluorescence, morphology by optical microscopy [37, 47, 49 ]. in another hand, in the case of the false negative results the doubt persist, and only strict followup of the patient by repeating the detection of the ctc can potentially eliminate this doubt. no available antibodies are 100% tumor or tissue specific [13, 47, 172 ]. to isolate ctc a method using a ligand biotinylated biotinylated asialofetuin, a ligand of asialoglycoprotein receptor, was experimented and followed by magnetic separation or density gradient (ficoll - paque plus ; ge healthcare). the cells were identified by microscopy, fish, immunofluorescence staining, flux cytometry, and rt - pcr. this promising approach has to be confirmed in a larger cohort of patients and still depends on the receptors expressed at the surface of the ctc. after isolation of the ctc by the different methods described above, to increase the number of ctc, the primary tumor cells can be cultured in the specific culture medium. the good conditions of culture growth and specially the culture medium leading the growth of the ctc, but not the other epithelial or nonepithelial cells, has to be determined through an experiment. for example, the cancer cell isolation kit from panomics includes lysis buffer to increase the number of ctc. one of the main problems is that cultured cells can lose their original markers and derive. mimicry of tumoral microenvironment in vitro is particularly difficult because for most tumors it is largely unknown. another problem is that the samples containing the ctc are usually contaminated by stromal cells like fibroblasts, which create competition in the petri dish. after few days, only the fibroblasts are present in the flask. a technique that allows the detection of only viable cells after a cd45 cell depletion was introduced for ctc analysis from bone marrow aspirates and blood samples [40, 43, 151 ]. it is a protein - secreting profiling based on the secretion or active release of specific marker proteins using an adaptation of the enzyme - linked immunospot technology. as immunospots are the protein fingerprint left only by the viable releasing epithelial cells, a cell culture is needed to accumulate a sufficient amount of the released marker proteins (table 2). the dying cells do not secrete adequate amounts of protein and are not detected [40, 150152 ]. this assay can also provide important information on the profile of secreted proteins potentially relevant for metastasis formation. however, this technique has still to be validated in large - scale clinical studies on cancer patients [40, 151 ]. after the enrichment and isolation of the ctc, the next step is to identify, characterize, and finally enumerate them. the chemicals usually used are diethylnitrosamine (den), peroxisome proliferators, aflatoxine, carbon tetrachloride (ccl4), choline deficient diet or thiacetamide [178, 179 ]. transgenic mouse models were also developed, for example, mice that contained hbv or hcv viruses or expressed specifically oncogenes (c - myc, c - myc + e2f1) or growth factors (tgf-, tgf- + c - myc, egf, fgf19, gmnt, pdgf, 1-antitrypsin). circulating tumor cells one reason is the huge differences between models and the presence of specific markers for each situation. in order to solve these problems, researchers developed ectopic implantation that is fast and easy to perform. however, there is still many differences between the cell lines, no direct interaction with the liver tissues and difficulty to export to humans. orthotopic implantation is a more suitable model because the cells are directly implanted in the liver tissue. there are big differences between cell lines and the choice of the markers is still limited. currently, there are few models of orthotopic implantation of human tumoral cells [180, 181 ]. an experimental model of human orthotopic hcc transplantation in nod / scid (nonobese diabetic / several compromise immunodeficient) mice allows to generate and to modulate ctc [180, 181 ]. in this mouse model, tumoral spreading is an early event during tumoral development and the number of ctc is directly correlated to the tumor size. when injected under the liver capsule, a primary tumor develops and continuously yields circulating tumor cells. liver tumor removal led to a very low level of tumoral cells in blood 30 days later. after complete tumor removal, the number of ctc significantly decreases but still remains detectable even at a low level. the facs was used to detect ctc (detection of human hla marker in mouse bloodstream). an important finding is that the bone marrow could be early and permanently colonized by ctc. with the recent development of the small imaging apparatus (example : ivis lumina ii xr imaging system, positron emission tomography) to study development and the progression of diseases in the live animals like rheumatism, this technique was applied to study the ctc in ectopic or orthotopic hcc cell lines implantation. as we discuss below, the lack of specific hcc markers makes ctc studies very challenging. the idea is to bind luminescence tag (luciferase, yellow fluorescence, or red fluorescence proteins) in the hepatoma cell lines injected in the liver that be detected by bioluminescence machine. for example, thymidine kinase - luciferase was placing under the transcriptional control of endogenous afp promoter to develop a transgenic mouse model that injected with den will develop hcc. the development of the hcc was followed in the live animal by bioluminescence and pet analyses. the inconvenient of this method is that the hcc model has to express afp. to avoid this problem hepatoma cell lines where engineered with luciferase (hcc - lm3) or red luminescence protein this approach to study ctc in the context of hcc is very promising, but the major problem is the sensitivity of the bioluminescence machine. this approach has not yet studied in the context of ctc in the blood or in organs other than liver. in vivo flow cytometry method to detect ctc from hcc has been developed. this method combined the flow cytometry technology that can detect specific fluorochromes based on their wavelengths, the specificity of these fluorochromes attached to an antibody that detects the ctc or fluorescently labelled cells as described in li. briefly, fluorescence signal from a given circulating cell population is recorded as the cells pass through the slit of light. confocal detection of the excited fluorescence enables continuous monitoring of labeled cells in the upper layers of scattering tissue, such as the skin of a mouse ear. based on algorithm and data analysis the computer is able to estimate the number of ctc in the blood stream. this method is still used in animal models to detect ctc from hcc but as promising future to detect ctc in human patients. the second problem is that few cells are present in the bloodstream. to overcome these problems, few years ago new approaches have been developed such as the techniques to study membrane proteins by mass spectrometry and the development of fluorescent hepatoma cells. however, it is undeniable that early detection of tumors and metastasis is urgently needed in medicine and these new exciting techniques and findings are changing our point of view of carcinogenesis very fast. in the future, ctc detection will certainly be an important diagnostic tool in cancer patients, providing a new and accurate assessment of lesion staging. | liver cancer is the fifth most common cancer in men and the seventh in women. during the past 20 years, the incidence of hcc has tripled while the 5-year survival rate has remained below 12%. the presence of circulating tumor cells (ctc) reflects the aggressiveness nature of a tumor. many attempts have been made to develop assays that reliably detect and enumerate the ctc during the development of the hcc. in this case, the challenges are (1) there are few markers specific to the hcc (tumor cells versus nontumor cells) and (2) they can be used to quantify the number of ctc in the bloodstream. another technical challenge consists of finding few ctc mixed with million leukocytes and billion erythrocytes. ctc detection and identification can be used to estimate prognosis and may serve as an early marker to assess antitumor activity of treatment. ctc can also be used to predict progression - free survival and overall survival. ctc are an interesting source of biological information in order to understand dissemination, drug resistance, and treatment - induced cell death. our aim is to review and analyze the different new methods existing to detect, enumerate, and characterize the ctc in the peripheral circulation of patients with hcc. |
the american dental association (ada) defines dental amalgam as an alloy composed of mercury, silver, tin, and copper along with other metallic elements added to improve physical and mechanical properties. dental amalgam has been an accepted part of dental treatment for more than 170 years [25 ]. mackert and wahl (2004) reported that more than 75% of dentists in united states of america surveyed in 2001 placed dental amalgam restorations. the ada presented a recent estimate that more than 70 million dental amalgam restorations have been placed in the united states. in 1999, about 60% of the restorations of class i and ii defects in the united states were restored with dental amalgam., dental amalgam is relatively inexpensive compared to most other materials used in dental treatment, and the longevity of dental amalgam restorations is relatively high. dental amalgam is easy to place in the prepared tooth, has low creep, high compressive strength and high resistance to wear, and experiences minimal dimensional change with time [1, 5 ]. it is the only dental material known for marginal - sealing capacity due to the corrosion products released from dental amalgam restorations [1, 4, 10 ]. it also tolerates a wide range of clinical placement conditions such as wet fields (for zinc - free products). however, toxicity of dental amalgam due to mercury has always been a concern. the purpose of this paper is to review the literature regarding the toxicology of mercury from dental amalgam and to evaluate current statements of different public agencies and councils on dental amalgam use. entering the two key words dental amalgam and toxicity, publications on dental amalgam biocompatibility published in peer - reviewed journals were searched in pubmed. a total of 379 papers were listed. when the search was limited to papers with abstracts and written in english, each abstract was read to evaluate whether the paper was relevant to the topic of the current review paper. using the online library of ukurova university, 43 out of 98 manuscripts that were relevant to the topic of the current review paper were accessed. a manual search was also conducted to find additional articles related to the biocompatibility of dental amalgam. even if dental amalgam has provided excellent clinical service for many years and there are only extremely rare cases of documented adverse effects, dental amalgam has always generated some concerns [11, 12 ] due to the mercury (hg) content which is around 4055%. mercury, which is the only metal in the liquid phase at normal room temperature, has a high vapor pressure that increases rapidly with temperature. (the other metal that is in the liquid state near room temperature is gallium, which has a melting temperature near 30c.) people can be exposed to mercury from diet, drinking water, air, and dental amalgam restorations. mercury vapor in humans has been sampled in exhaled breath, in the oral cavity [16, 17 ] with the mouth open or closed, and through a catheter placed in the trachea via a bronchoscope. the data from these studies suggest that mercury is continuously released in the oral cavity from dental amalgam restorations. the release rate is dependent upon many factors including area, age, eating and individual habits, composition of the amalgam, and the quantity of the surface oxide layer. exposure to mercury from dental amalgam restorations occurs through several ways : (1) mouth air containing elemental mercury released from the dental amalgam can be inhaled ; (2) dental amalgam particles can be abraded from restored surfaces during mechanical wear of the restorations or can be produced during placement or replacement of the restorations, and abraded particles from the restorations can be ingested ; (3) the saliva into which both elemental and corrosion - produced inorganic mercury products are dissolved can be swallowed ; (4) tattooing may be created when particles from the restorations are physically embedded in soft tissue adjacent to the restoration area. lorscheider and his coworkers (1995) pointed out that dental amalgam restorations were the major contributing source of mercury in humans who were not occupationally exposed to mercury and reported that research evidence had not supported the safety of dental amalgam at that time. mercury vapor can be released from dental amalgam during all steps involved with the restorations like trituration, condensation, setting, polishing, and removal. mastication and drinking hot beverages cause release of mercury from dental amalgam restorations as well. however, the world health organization (who) has announced that eating seafood once in a week raises urine mercury level to 520 g / l, which is higher than the exposure from dental amalgam (1 the amount of mercury vapor that is accepted by the occupational safety and health administration (osha) in the united states is 100 times more than the amount to which a person with 9 dental amalgam restorations will be exposed. the maximum amount of mercury vapor allowed in the workplace, the threshold limit value (tlv), is set as 0.05 mg / m by osha. in their textbook on restorative dental materials, craig and powers reported (2002) that fetuses exposed to mercury concentrations of 5 mg / m, which is far beyond the tlv, were stillborn. abrasive stress (like chewing and brushing) on exposed surfaces of dental amalgam restorations can alter the protective characteristics of the oxide layer formed at the surface and increase the elemental mercury release rate. dental amalgam restorations release not only elemental mercury, but also inorganic mercury, as corrosion products. the clinical use of dental amalgam for restorations can also alter the mercury - containing phases, 1 and 2, and cause mercury release ; most of the released mercury reacts with unreacted particles of the starting alloy for dental amalgam and only little of it escapes from the restoration. medical research has demonstrated that mercury is continuously released as vapor into the air, then inhaled, absorbed into body tissues, oxidized to ionic hg, and finally covalently bound to cell proteins. unlike some other groups reporting the highest accumulation levels of mercury in the kidneys [21, 22 ], for cases with more than 12 amalgam surfaces guzzi and his coworkers (2006) reported the highest level of mercury accumulation in the brain of 18 cadavers compared to the thyroid and renal cortex. accumulation of mercury in other organs like the lungs, liver, gastrointestinal tract, and exocrine glands has also been reported. furthermore, long - term dermal exposure to inorganic mercury may also lead to toxicity. it was reported that mercury levels in the kidneys, thyroid, and brain were higher in cadavers with higher numbers of amalgam surfaces. (2010) reported that dental amalgam was the main source of mercury in the kidneys. increased mercury levels in the liver, spleen, and lungs with increased numbers of amalgam restorations were also reported. mercury concentrations were reported to be 2 - 3 fold and 9-fold higher, respectively, in the brain and kidneys of people with dental amalgam restorations compared with those without these restorations. okabe. (2003) reported greater release rate of mercury from high - copper dental amalgams with single - composition starting alloy particles that are mixed with mercury, compared to dental amalgams prepared from an admixture of low - copper and high - copper starting particles. it should be noted that an increase in mercury level does not mean that the biochemical function of the previously mentioned organs would have been changed. (2003) reported a relationship between oral lichenoid reactions and dental amalgam restorations and that 97.1% of patients benefited from removal of these restorations. it has been reported that elemental mercury, which has a limited ability to cross biological membrane, can nonetheless cross the placenta and the blood - brain barrier after being dissolved in blood and then become distributed throughout the body. this can be attributed to the high lipophilicity of elemental mercury that is the origin of mercury retention in the brain and fetal tissues if an overdose is taken. a prospective, blinded epidemiological study was carried out to evaluate the relationship between mercury exposures from maternal dental amalgam restorations during pregnancy. this group reported an increased risk of autism severity at the threshold of 6 or more maternal dental amalgam restorations during pregnancy and early infant temporal periods. however, lindbohm. (2007) investigated whether dental workers exposed to acrylate compounds, dental amalgam, solvents, or disinfectants are at an increased risk of miscarriage. they did not find a strong association or a consistent dose - response relationship between exposure to chemical agents in the dental workplace and the risk of miscarriage. the new england children 's amalgam trial was completed on 534 children aged 6 to 10 years at baseline. the neuropsychological and renal functions of children whose dental caries were restored using dental amalgam (n = 267) or resin composite (n = 267) were compared. the 5-year change in full - scale iq scores and tests of memory and visuomotor ability was evaluated. the authors reported no statistically significant differences in adverse neuropsychological or renal effects observed in children whose caries were restored using dental amalgam or composite resins. a followup study of the new england children 's amalgam trial was completed to compare full - scale iq score, general memory index, and visual motor abilities. the authors reported that dental amalgam was not associated with an increase in the risk of children experiencing neuropsychological dysfunction. another randomized clinical trial was performed to assess the safety of dental amalgam restorations in 507 children in lisbon, portugal. children were randomized to either dental amalgam (n = 253) or resin composite (n = 254) restorations, and only children aged 8 to 10 years with at least 1 carious lesion on a permanent tooth were included in the study. memory, attention / concentration, motor / visuomotor domains, and nerve conduction velocities were measured. a statistically significant difference in neurobehavioral assessments or in nerve conduction velocity these authors suggested that dental amalgam should remain as a viable restorative option for children. a further randomized, prospective trial examining the safety of dental amalgam was conducted (n = 507) on children aged between 8 through 12 years. the authors concluded that exposure to mercury from dental amalgam did not adversely affect neurological status in children. unlike the reports from the aforementioned studies, a jama editorial needleman (2006) presented an opposing view on the neurotoxic effects of dental amalgam. he urged further examination of the molecular effects of dental amalgam at appropriate doses, with consideration of the exposure as precisely as possible, along with the vulnerability factors. one worst case estimate of hg loss was 2 g / day while another article reported a lesser amount. however, one group has reported an hg release up to 2025 g / day from dental amalgam restorations. the lowest dose of mercury that can start a toxic reaction is reported as 37 g / kg body weight. same authors reported that 500 g hg / kg of body weight causes paresthesia, while 1000 g hg / kg of body weight causes ataxia. still higher doses of 2000 g hg / kg and 4000 g hg / kg of body weight can cause joint pain and hearing loss, respectively. it should be noted that these doses are enormously greater than the mercury values that can be released from dental amalgam. metallic mercury will be disposed through urine, and urine mercury levels can be used for determining exposure to inorganic mercury. mercury levels in urine caused by dental amalgam restorations can be monitored by using radioactive mercury in the dental amalgam. symptoms of mercury poisoning have been reported at concentrations above 2550 mg hg / l urine. neurological changes can be observed only when the urine mercury level is higher than 500 g / l, and it should be noted that this level is nearly 170 times the peak levels that have been found when a dental amalgam restoration is placed. whether given elevated mercury level in urine is high enough to be harmful for the body should also be questioned. urinary mercury levels in children were reported to be highly correlated with both number of dental amalgam restorations and time since placement. (1987) and coworkers reported a significant positive correlation between an increased number of surfaces of dental amalgam restorations and urine mercury. however, this group stated that a consensus should not be driven by the foregoing correlation, since the observed levels of urine mercury were below any value of toxicological significance. they reported that there was no correlation between urine hg and allergy, as well as between the extent of dental amalgam restorations and allergy. although mercury vapor is released from amalgam restorations, research over the past decades has failed to identify deleterious health outcomes. this can be attributed to insufficient mercury being released from dental amalgam restorations to cause a medical problem. although pesch. (2002) reported that mercury analysis in urine was a suitable way to estimate mercury exposure due to dental amalgam restorations, there are studies arguing that mercury in urine will not represent the mercury toxicity and/or mercury content in other body fluids or tissues [42, 43 ] and hence should not be used to measure mercury toxification. the latter group stated that the mercury concentration in critical organs of humans can be neither directly measured nor reliably estimated by means of media such as blood or urine. nevertheless, the increased amount of mercury in urine might imply that body can metabolize mercury to some extent and that the reported increased levels of mercury in urine fail to pose a risk of mercury toxicity from dental amalgam restorations. on the other hand, woods. (2007) reported significantly higher concentrations of urine mercury in girls compared to boys, which might suggest a possible sex - related difference in susceptibility to mercury toxicity. no significant differences between treatment groups for the average levels of renal biomarkers (urinary excretion of albumin, alpha-1-microglobulin, -glutamyl transpeptidase, and n - acetyl--d - glucosaminidase) were found. this group reported that the number of dental amalgams that yielded these biomarkers was not significant, either. the only significant difference between dental amalgam and resin composite restoration groups was the increased prevalence of microalbuminuria (ma) among children in the dental amalgam group in years 35, which was stated as a possible random finding. mercury exposure from dental amalgam restorations has been calculated by measuring the total blood mercury level using atomic absorption spectroscopy. the maximum medically acceptable level of mercury in the blood is 3 g / l. 1996) reported toxic and lethal doses of mercury in blood as 200 ng / ml and 600 ng / ml, respectively. (2008) reported the amount of inorganic mercury in erythrocytes and plasma as 0.37 ng / ml and 0.38 ng / ml, respectively, and this group reported the total plasma mercury level as 0.49 ng / ml. 2008) reported that dental amalgam restorations were the major source of plasma mercury (3.91 ng / ml), yet dental amalgam was not found to have a significant effect on plasma - total antioxidant activities. the foregoing controversial results can be attributed to different methods used for evaluating the total plasma mercury concentrations and the influence of other mercury sources like diet, drinking water, and inhaled air, which might increase the blood mercury concentration. it is also very difficult to directly associate a mercury increase in blood to the mercury released from dental amalgam restorations. blood mercury levels will increase to 1 - 2 g / l during placement of these restorations, and there is a decrease in blood mercury level after removal of dental amalgam restorations. the consequences of mercury release from dental amalgam, its absorption, accumulation, and excretion by the body, along with the ill effects of cumulative storage have been reviewed [49, 50 ]. these earlier reviews concluded that the low levels of mercury in body fluids reported in the literature were not likely to constitute a health hazard. the mercury release rate from dental amalgam restorations has also been investigated using saliva and breath mercury levels as biomarkers. using an in vitro model, they measured the air mercury levels for dry and saliva - coated dental amalgam discs and found higher air mercury levels for dry dental amalgam compared to wet dental amalgam. the release of mercury was higher from abraded dental amalgam compared to fresh dental amalgam. when mercury is mixed with the alloy particles for dental amalgam, however, the amount of liquid mercury mixed with these alloy particles is insufficient to consume the starting alloy powder particles completely. therefore, the set amalgam contains incompletely consumed dental amalgam alloy powder particles (historically termed core), along with the reaction phases (historically termed matrix). research has shown that the 1 (ag2hg3) phase contains a small amount of tin and that it transforms to the phase over long periods of time. the mercury released from the 2 (sn8hg) phase will further react with the unreacted alloy particles, and only minute amounts of hg vapor can be released from set amalgam. the amount of mercury released from dental amalgam restorations has been overestimated [16, 17 ]. even if they are rare, allergic reactions to mercury do occur for patients with dental amalgam restorations [19, 53, 54 ]. there are case reports of allergic contact dermatitis, gingivitis, stomatitis, and remote cutaneous reaction to dental amalgam restorations. allergic reactions to dental amalgam usually disappear in a couple of days or after removal of these restorations. atomic emission spectroscopy and atomic absorption spectroscopy have been used to measure the mercury release from dental amalgam into various media. low - copper dental amalgams release more ions than high copper ones because they are more prone to corrosion. (2002) reported that although several differences in health and cognitive functioning were found between dentists and control subjects, these differences could not be directly attributed to exposure to mercury. another group investigated the associations between hg and symptoms, mood, motor function, and nonspecific cognitive alterations in task performance and reported that symptoms were similar in an occupationally exposed group to hg and the general us population. (2002) declared that amalgam placement appeared to present minimal mercury exposure risk from a neurotoxicological point of view. jones (1999) reported that there is no conclusive evidence in the scientific literature to demonstrate a link between the causes of irreversible neurological disorders or impaired kidney function and mercury vapor from dental amalgam restorations. animal experiments to date have not been able to establish any conclusive cause - and - effect link that can be extrapolated to human exposure to mercury from dental amalgam restorations [5759 ]. mercury pollution from dentistry is considered to be insignificant compared to that from industrial use and natural sources. the safety of dental amalgam for restorative treatment has been reviewed many times by different agencies in the united states. the us public health service (usphs) published a broad scientific report about the safety of dental amalgam in 1993, and the conclusions of this report were reaffirmed in 1995 and 1997 [61, 62 ]. the usphs analyzed 175 peer - reviewed studies and reported that the data in these studies did not warrant a conclusion that mercury release from dental amalgam restorations will cause neurologic, renal, or developmental problems. on the other hand, previous studies have documented that dental amalgam restorations can cause allergic or hypersensitivity reactions although they are rare. even if most agencies agree that the available data do not confirm a health hazard caused by dental amalgam restorations, there are some countries that restrict or limit the use of dental amalgam. health canada (1996) has recommended that the use of dental amalgam is to be avoided for hypersensitive individuals or people with impaired kidney function, children, and pregnant women. the german ministry of health (1997) and the commission of the european union (2008) have also stated that dental amalgam restorations should not be placed for these groups of people who are hypersensitive [64, 65 ], have impaired function, or lie in other special categories (lsro, 2004). recently, the european commission (2008) reported no clinical justification to remove clinically satisfactory dental amalgam restorations. those patients who are suspected to have allergic reactions and positive patch tests should be excluded. the council of scientific affairs of the american dental association (ada) concluded in 1998 that amalgam continues to be a safe and effective restorative material in view of scientific information available at that time, and the ada affirmed this statement in 2002, 2003, and 2009 [1, 7, 66 ]. the ada stated that if the organization considered that dental amalgam posed a threat to the health of dental patients, they would advise their members to cease using this material for restorations. the ada has concluded that dental amalgam offers a safe and cost - effective treatment option. recently, the council of european dentists (ced) declared that dental amalgam continued to be the most appropriate material for many restorations due to its ease of use, durability, and cost - effectiveness (ced, 2010). the us food and drug administration (fda) published its statement on dental amalgam in december 2002. it was reported that this organization continues to investigate the safety of dental amalgam and that there is presently no valid scientific evidence which has shown that dental amalgam restorations causes harm to patients. the national institute of dental and craniofacial research (nidcr) of the us national institutes of health funded a project that had been performed by the life sciences research office (lsro). the lsro was asked to examine the peer - reviewed, primary scientific, and medical literature published between january 1, 1996 and december 31, 2003 relating to dental amalgam and human health. approximately 300 studies out of 950 met the scientific and study design criteria and were used to construct the final report. the review was mainly based on the studies of mercury vapor or dental amalgam exposure in humans. the report concluded that there was little evidence to support a causal relationship between mercury in dental amalgam restorations and health problems for patients. the report also noted that there were existing research gaps, which, if addressed, may settle the dental amalgam controversy. for more detailed information on review and analysis of the literature on the potential adverse health effects of dental amalgam according to the available articles and data reviewed in this paper, the following conclusions can be drawn. mercury released from dental amalgam restorations does not contribute to systemic disease or systemic toxicological effects. allergic reactions to mercury from dental amalgam restorations have been demonstrated, but these are extremely rare. available scientific data do not justify the discontinuation of dental amalgam use from clinical practice or the replacement with other single - tooth restorative dental materials. | objective. the purpose of this review paper is to review the literature regarding the toxicology of mercury from dental amalgam and evaluate current statements on dental amalgam. materials and methods. two key - words dental amalgam and toxicity were used to search publications on dental amalgam biocompatibility published in peer - reviewed journals written in english. manual search was also conducted. the most recent declarations and statements were evaluated using information available on the internet. case reports were excluded from the study. results. the literature show that mercury released from dental amalgam restorations does not contribute to systemic disease or systemic toxicological effects. no significant effects on the immune system have been demonstrated with the amounts of mercury released from dental amalgam restorations. only very rarely have there been reported allergic reactions to mercury from amalgam restorations. no evidence supports a relationship between mercury released from dental amalgam and neurological diseases. almost all of the declarations accessed by the internet stated by official organizations concluded that current data are not sufficient to relate various complaints and mercury release from dental amalgam. conclusions. available scientific data do not justify the discontinuation of amalgam use from dental practice or replacement with alternative restorative dental materials. |
endodontic treatment aims to disinfect and to shape the root canals in order to make easy the irrigation procedures and the placement of root canal dressing of filling material. the preservation of the radicular anatomy is one of the most important concerns during root canal preparation. some enlargement techniques have been developed to minimize errors, such as ledging, zipping, loss of working length, and apical transportation. apical transportation is defined as the removal of canal wall structure on the outside curve in the apical half of the canal due to the tendency of files to restore themselves to their original linear shape during canal preparation. the use of rotary nickel - titanium (niti) instruments allows easier and safer root canal shaping with predictable results. moreover, there is less iatrogenic damage even in severely curved root canals. however, complete instrumentation of the root canals is critical especially at the apical third. rdig and kahlmeier (2007) stated that in curved canals the instruments tend to straighten the root canal owing to the major cutting effect toward the inner aspect of the curvature at the cervical root third and toward the outer aspect of the curvature at the root canal end point. previous reports had pointed that niti instruments tend to be more centered, rapid, and attain a more conservative shaping of canals than stainless steel instruments. especially the centering ability of niti instruments is owed to their super elastic behavior and shape - memory, even though apical transportation occurs even when super elastic instruments are used. several reports about apical transportation have been published regarding protaper universal instruments (dentsply maillefer, ballaigues, switzerland) ; however, there are few reports regarding wizard cd plus (medin, prague, czech republic). according to the manufacturers, wizard cd plus instruments present a triangular cross section, with no surface treatment, a working part taper ratio of 10%, 8%, 6%, 4% and 2%, and cutting edges discontinued by grooves in the helix, which were intended for machine preparation of root canals by means of the crown - down method. protaper universal system has triangular convex cross section and three cutting edges with a negative cutting angle. the shaping instruments have a progressive taper sequence (increasing from tip to coronal), whereas the finishing instruments have a decreasing taper profile. it is claimed that the progressive taper sequence will enhance the flexibility of the files in the middle and at the tip region, and that the decreasing taper sequence will enhance the strength of the files while making them rather stiff. in endodontics, apical transportation is evaluated after superposition and subtraction of two images (i.e., pre - operative and post - operative images). autocad and adobe photoshop (adobe systems inc, san jose, usa) are currently used for this purpose ; however, the main disadvantage of the autocad and adobe photoshop is that both need manual superimposition of the images which depends on the operator. in the beginning of the 2000s, the brazilian national institute for space research in partnership with the electrical and computer engineering department from university of california developed a computer program for mapping the earth through satellite images. this software is called regeemy - image registration and mosaicking, version 0.2.43 can be downloaded from the internet for free (http://regima.dpi.inpe.br/download.html). this program automatically selects pixels of the same tone in two images and superposes them. up to date, only one study used the regeemy program to superpose images in dentistry. the authors evaluated the ability of the program in detecting simulated external root resorption. in the endodontic context, the ability of regeemy in superposing and subtracting tomographic or radiographic images is unknown. thus, the aims of this study were : (1) to evaluate the apical transportation of the wizard cd plus and protaper universal after preparation of simulated root canals ; (2) to compare, with adobe photoshop, the ability of a new software (regeemy) in superposing and subtracting images. the hypotheses were : (1) that wizard cd plus and protaper universal would promote similar apical transportation ; and (2) regeemy would permit the superposition and subtraction of images. twenty - five simulated root canals made of clear resin (endo training block ; dentsply maillefer, ballaigues, switzerland) with an initial.02 taper, 0.15 mm diameter at the apex and 20 curvature were divided into two groups according to the rotary system (10 specimens per group) and one control group (n=5). every working length was established to 15 mm (1 mm shorter than the apex) by inserting a size 15 k - file (dentsply maillefer, ballaigues, switzerland) into the simulated root canal. thereafter, the samples had previously been numbered and properly positioned in devices made of acrylic resin and, with the file in position, a cone beam computed tomography (cbct) (icat cone beam, hatfield, usa) was carried out. all cbct was acquired with the same setting at 70 kvp, 4 ma, 10 s and with the 88 cm field of view (fov) selection. the data set consisted of axial, sagittal and coronal reconstructions ; the size of the reconstructed voxels was 0.16 mm. images were saved on a computer for further evaluation and comparison. in control group, the specimens were subjected to a new cbct under identical conditions to assess the feasibility of the software (regeemy and adobe photoshop) in superposing and subtracting both tomographic images. simulated root canals in experimental groups were instrumented by the same operator, who was previously calibrated to each one of techniques described below. the resin blocks were mounted on a vise (neboluz, so paulo, brazil) that kept them fixed, without allowing the operator to see the instruments inside the simulated canals. protaper group was prepared with the protaper universal system using the sx and s1 instruments for preparing the cervical third, followed by the s2 instrument in the middle third. the f1 and f2 instruments were later used at the working length, and each instrument was used in a uniform and continuous motion without applying pressure. wizard cd plus group was prepared using this system through the crown - down technique, with input motion, light apical pressure and anti - curvature pressure. next, a 25.4 file was used in middle third and the beginning of the apical third and finally 20.04 and 25.04 files were used in full working length. after each instrument change, a size 10 k - file was inserted up to the entire working length and the canal was irrigated with 1 ml of 2% sodium hypochlorite., jaguar, brazil) electric motor was used for simulated root canals preparation, at a speed of 250 rpm with a torque of 2 n.cm. after canal preparation, the acrylic blocks underwent a second cbct scan under the preoperative conditions as described previously. the tomographic images from the simulated canals were edited in the icat vision and coreldraw software for precise standardization of the position of the acrylic resin block with regard to the x and y axes. the subtraction of post - instrumentation and pre - instrumentation cbct images of the acrylic - resin blocks was performed using the regeemy and adobe photoshop software according to their tutorials. once the final images were obtained (pre - instrumentation plus post - instrumentation image), the tips of the files in subtracted images were analysed using imagej software (national institutes of health, bethesda, usa) under 25% magnification. the scale was calibrated using the bottom of the acrylic resin block (10 mm) as reference to convert pixels to millimetres. a straight line was drawn joining the tip of the files in the subtracted images for measuring (figure 1). this process was performed in all images and repeated three times at intervals of 48 hours, by one blinded examiner who had previously been calibrated to the measurement procedure. a) pre - instrumentation image ; b) postinstrumentation image ; c) regeemy : the tip of the files was delimitated and a straight line was drawn joining both tips (black : file in the pre - instrumentation image ; white : file in the post - instrumentation image) ; and d) adobe photoshop : white points indicated the files tips in both images and then a straight line was drawn to join these points the kappa test was used to analyze the agreement between the readings of the examiner at different times. shapiro - wilk normality test was used to assess if the data adhere to a gaussian distribution. student 's t - test for independent samples was used to compare the means of the apical deviations between the two groups. and finally, student 's t - test for paired samples was used to compare the ability of each software in superposing and subtracting images from one rotary system per time. the tomographic images from the simulated canals were edited in the icat vision and coreldraw software for precise standardization of the position of the acrylic resin block with regard to the x and y axes. the subtraction of post - instrumentation and pre - instrumentation cbct images of the acrylic - resin blocks was performed using the regeemy and adobe photoshop software according to their tutorials. once the final images were obtained (pre - instrumentation plus post - instrumentation image), the tips of the files in subtracted images were analysed using imagej software (national institutes of health, bethesda, usa) under 25% magnification. the scale was calibrated using the bottom of the acrylic resin block (10 mm) as reference to convert pixels to millimetres. a straight line was drawn joining the tip of the files in the subtracted images for measuring (figure 1). this process was performed in all images and repeated three times at intervals of 48 hours, by one blinded examiner who had previously been calibrated to the measurement procedure. a) pre - instrumentation image ; b) postinstrumentation image ; c) regeemy : the tip of the files was delimitated and a straight line was drawn joining both tips (black : file in the pre - instrumentation image ; white : file in the post - instrumentation image) ; and d) adobe photoshop : white points indicated the files tips in both images and then a straight line was drawn to join these points the kappa test was used to analyze the agreement between the readings of the examiner at different times. shapiro - wilk normality test was used to assess if the data adhere to a gaussian distribution. student 's t - test for independent samples was used to compare the means of the apical deviations between the two groups. and finally, student 's t - test for paired samples was used to compare the ability of each software in superposing and subtracting images from one rotary system per time. the regeemy software provided the subtraction of the pre- and post - instrumentation tomographic images of the acrylic blocks, allowing the analysis of apical transportation using protaper universal and wizard cd plus systems. in control group, apical transportation did not occur (figures 2a and 2b). the entire final image presented intermediate gray levels (128 grayscale value) when regeemy was used (figure 2c). figure 2d shows the coincidence of the tips of the files in pre- and post - operative images when adobe photoshop was used. the student 's t - test did not reveal any difference between the experimental groups (p>0.05). wizard cd plus and protaper universal presented few apical transportation regardless of the software used for image superimposition and subtraction (p>0.05) (table 1). the values of apical transportations achieved using the regeemy were similar to those obtained using adobe photoshop (p>0.05). a and b) in control group, five specimens were subjected to two cbct under identical conditions ; c) result of a superposition and subtraction using regeemy (note the intermediate gray levels) ; and d) result of a superposition and subtraction using adobe photoshop (note the coincidence of the tips of the files in the final image) means, standard deviations and confidence intervals of apical transportation after using the two rotary systems and both software the student 's t - test did not reveal any significant difference between the experimental groups (p>0.05) both acrylic resin blocks and extracted human teeth are used for apical transportation analysis. extracted human teeth provide similar conditions to the clinical situation when compared with acrylic resin blocks. moreover, they present actual surface texture, hardness and cross - sectioning dentin areas. however, natural teeth present variation in morphology which impairs the comparison of the experimental groups. on the other hand, acrylic resin blocks allow the observation of the preparation in three dimensions along the whole canal length and a direct comparison of the shaping ability of different instruments. in addition, they provide standardized length, diameter and angle of curvature of the simulated root canals. from a statistical point of view, the standard deviation might increase whenever a range of curvatures is used, as opposed to the use of standardized acrylic resin blocks where this problem is minimized. the uses of acrylic resin blocks facilitate the evaluation of the feasibility of the regeemy in comparison with adobe photoshop in superposing and subtracting images. however, owned to the difference between materials nature (i.e. acrylic resin and dentin), care should be taken in the extrapolation of these findings to clinical use where dentine is involved. both rotary systems promoted similar apical deviation after preparation of the simulated root canals (p>0.05). similar to other studies that have compared different rotary ni - ti systems regarding the apical transportation, the present study did not detect significant differences between the protaper and wizard cd systems. good flexibility and the centralizing ability of root preparation by the f2 (protaper) and 25.04 files (wizard cd plus) likely contributed to the small and similar apical transportation values. different cross - sectional geometries of rotary instruments are believed to increase cutting efficiency, consequently reducing contact areas and torsional loads. it is also known that the mass of the instrument plays an important role on the centering ability of these instruments. it also presents a triangular convex cross section with shallow u - shaped grooves. all these features try to improve the flexibility of the larger instruments. despite presenting the same taper along the entire cutting blades, thus, continuous and multiple tapers did not influence the apical transportation in simulated root canals. the findings of the present study agree with those published in a master 's dissertation in the year of 2012. moreover, the authors did not find differences regarding the apical transportation between wizard cd plus and other two rotary systems (protaper and wizard navigator). the author stated that irregularities in wizard cd plus surface may have contributed with a poor standardization of centering ability, which was corroborated by the high standard deviations observed. the same did not occur in this study, in which wizard cd plus ' standard deviation was similar to that observed in the protaper group. according to grazziotin - soares,.(2011), protaper instruments present lower flexibility after the third use. thus, in order to avoid apical transportation originating from repeated preparation, each instrument was used in only three acrylic resin blocks and then discarded. regardless of the final instrumentation size, the risk of transportation always increases in curved canals with an increase of file size. schafer and vlassis (2004) stated that protaper may induce apical transportation towards the outer aspect of the root canal especially because of the progressive tapers along the cutting surface of these instruments. the decreasing taper sequence of the finishing files enhances the strength of the files, but it increases the stiffness of their tip. on that basis, in this study the canal preparation was performed up to f2 instrument in protaper group. other reason for using f2 instruments was to permit direct comparison with wizard cd plus size 25.04, which has similar mass and identical diameter of the tip. wizard cd plus is a new rotary system and due to that there are no studies related to its behavior regarding cyclic fatigue and number of uses. closing partially this gap, wizard cd plus seems to promote similar apical deviation when compared with protaper files in acrylic resin blocks. however, further investigations are needed to secure a better indication of its use in clinical practice. clinically, it seems questionable whether these comparably small values in apical transportation have any clinical significance. anyway, the apical transportation values for the two systems are believed to be reliable because of the comparison of a new software with a current one (adobe photoshop) to superpose and subtract images. the student 's t - test for paired samples revealed that the readings performed by each software were similar (p>0.05). the subtraction of one image from another requires superposing these images in order to analyze the differences that have occurred over time. regeemy software subtracts the structures that have not changed between two radiographic / tomographic images pixel by pixel, resulting in a third image that is surrounded by a neutral gray background with grayscale values of approximately 128 for the unchanged areas. patchy areas in the pre- and post - operative images are conventionally shown by a dark - gray shade or black (with grayscale values approaching zero) and by a light - gray tone or white (with grayscale values close to 255). however, the process of superposition must be performed manually with the post - instrumentation image separately positioned over the pre - instrumentation image. images must be aligned manually and this process may be influenced by the operator. to avoid this drawback, the present study performed three superposition processes and three readings per resin block in both software. therefore, the readings achieved using regeemy and adobe photoshop were similar for the rotary systems. the effectiveness of the software in superposing and subtracting pre- and post - instrumentation images was confirmed by the control group. all the specimens from the control group were exactly superposed. after the subtraction process using regeemy when adobe photoshop was used, the accuracy of the superposition process was assessed after marking the tip of the file in each image. if the points were coincident at the final image, then the superpose process was correct. the inclusion of a control group aimed to validate the methods for superimposition and subtraction of the cbct images from the experimental groups. besides being originally developed to map the deforestation in native areas, regeemy was used for the first time in dentistry in 2005. this software has proven to be an alternative technique to current ones for subtracting radiographic / tomographic images. it reduces the variation of gray levels in the subtracted image, indicating that the software superposes the pre- and post - operative images more accurately than a priori tools (i.e., film, phosphor plates, radiographic film holders). in addition, six years later, ono,. (2011) used this software to correct geometric discrepancies and equalize the contrast of two sequential radiographs before the use of the digital subtraction technique in cases of simulated root resorption. the main difficulty that occurs when working with adobe photoshop is that this software is not widely available because they are limited to institutions or are too expensive to be easily purchased. regeemy closes this gap because it is a program that can be downloaded for free upon registration with the dpi - inpe. this program provides the necessary support for research because it performs superimposition, subtraction and geometric correction of images by automatically marking multiple control points with the same software. moreover, it allows a practical and simple process, with few variations, and costless. two conclusions can be drawn : (1) wizard cd plus and protaper universal systems promoted slight and similar apical transportation after the preparation of simulated canals ; (2) regeemy consists in a feasible software to superpose and subtract images and appears to be an alternative to adobe photoshop. | objectivethis study has two aims : 1) to evaluate the apical transportation of the wizard cd plus and protaper universal after preparation of simulated root canals ; 2) to compare, with adobe photoshop, the ability of a new software (regeemy) in superposing and subtracting images. material and methodstwenty five simulated root canals in acrylic - resin blocks (with 20 curvature) underwent cone beam computed tomography before and after preparation with the rotary systems (70 kvp, 4 ma, 10 s and with the 88 cm fov selection). canals were prepared up to f2 (protaper) and 24.04 (wizard cd plus) instruments and the working length was established to 15 mm. the tomographic images were imported into icat vision software and coreldraw for standardization. the superposition of pre- and post - instrumentation images from both systems was performed using regeemy and adobe photoshop. the apical transportation was measured in millimetres using image j. five acrylic resin blocks were used to validate the superposition achieved by the software. student 's t - test for independent samples was used to evaluate the apical transportation achieved by the rotary systems using each software individually. student 's t - test for paired samples was used to compare the ability of each software in superposing and subtracting images from one rotary system per time. resultsthe values obtained with regeemy and adobe photoshop were similar to rotary systems (p>0.05). protaper universal and wizard cd plus promoted similar apical transportation regardless of the software used for image 's superposition and subtraction (p>0.05). conclusionwizard cd plus and protaper universal promoted little apical transportation. regeemy consists in a feasible software to superpose and subtract images and appears to be an alternative to adobe photoshop. |
deep venous thrombosis (dvt) is a complication well - known to be associated with nephrotic syndrome. in patients with nephrotic syndrome, dvt is reported to be observed mostly in the lower extremities, renal veins, and pulmonary arteries [1, 2, 3 ]. however, there are no reports of dvt developing in the upper extremities of patients with nephrotic syndrome. we herein report a case in which dvt developed in the left arm during treatment of nephrotic syndrome due to idiopathic membranous nephropathy. a 56-year - old male was admitted to our hospital in may 2012 for evaluation of nephrotic syndrome. he had neither a personal nor family history of notable illness such as thrombotic diseases. one month previously, he had presented with bilateral leg edema. two weeks before admission, he had been diagnosed with massive proteinuria with hypoalbuminemia in another clinic. physical examination on admission revealed the following : height 168 cm, weight 61.6 kg, blood pressure 124/75 mm hg, pulse rate 80 beats / min with a regular rhythm, and temperature 36.4c. urinary protein excretion was 11.8 g/24 h. blood analysis, biochemical and serological examination showed a white blood cell count of 7.7 10/l, hemoglobin 15.4 g / dl, platelet count 315 10/l, total protein 3.7 g / dl, albumin 0.8 g / dl, urea nitrogen 15 mg / dl, creatinine 0.96 mg / dl, uric acid 5.8 mg / dl, total cholesterol 460 mg / dl, hemoglobin a1c 5.7%, igg 213 mg / dl, iga 320 mg / dl, and igm 57 mg / dl. antinuclear antibody, rheumatoid factor activity, hepatitis b and c, and human immunodeficiency virus were all negative. there was a marked elevation in fibrinogen (658.9 mg / dl) and d - dimer (3.1 g / ml), and a decrease in antithrombin iii activity (66.3%). prothrombin time, prothrombin time - international normalized ratio, and activated partial thromboplastin time were all normal. a fecal occult blood test, computed tomography (ct) through the chest and abdomen, and upper endoscopy did not suggest the presence of malignancy. because our patient initially refused renal biopsy, he was empirically treated with 40 mg / day of prednisolone from the third day after admission, together with continuous intravenous infusion of heparin for prophylaxis of thrombotic complications. however, he presented no clinical improvement and then received a percutaneous renal biopsy on day 34. the specimen consisted of 18 glomeruli showing diffuse and irregular thickening of the glomerular basement membrane with deposition of igg4, compatible to idiopathic membranous nephropathy stage ii. during prednisolone treatment, he developed a gradually progressive swelling of the upper and lower left arm. levofloxacin was administrated because phlegmon in the upper extremity was considered, but the swelling worsened. contrast - enhanced ct on day 54 showed obstructions of the left internal jugular vein and the left subclavian vein by large thrombi (fig. the blood levels of protein c, protein s, and 2-glycoprotein i were within the normal ranges. in addition to the heparin infusion, oral warfarin was added, with prothrombin time - international normalized ratio monitoring between 2 and 3. edema of the patient 's left upper limbs gradually improved and disappeared within 1 month. a contrast ct 89 days after discharge confirmed a significant reduction of thrombi (fig. his nephrotic syndrome was in remission, and no further thrombotic symptoms have been seen to date. the major types of thrombotic complications in nephrotic syndrome cases are dvt, pulmonary embolism, and renal vein thrombosis [1, 3 ]. sometimes the inferior vena cava, and, rarely, the portal, splenic, and superior mesenteric vein can be affected [2, 5, 6 ]. additionally, a pediatric case of nephrotic syndrome exhibiting thrombosis of the internal jugular vein accompanied by neck pain has been reported. however, there have been no reports of adult nephrotic cases with thrombosis of the internal jugular vein or of nephrotic cases with thrombosis of the subclavian vein. upper - extremity dvt is a rarer manifestation of venous thromboembolic disease than that in the lower extremities. in recent years, that manifestation has become more commonly recognized because of the increased use of central venous catheters, artificial heart pacemakers, and defibrillators. mechanical stenosis and venous obstruction by those devices, pulmonary cancer, or thoracic outlet syndrome induce the formation of thrombi in the brachial, axillary, subclavian, and internal jugular vein, or the superior vena cava, resulting in dvt in the upper extremities [8, 9 ]. furthermore, left innominate vein stenosis due to extrinsic compression by the sternum and arch vessels can cause venous stasis in the upper extremities. secondary pathogenesis by mechanical stenosis and venous obstruction described above is associated with more than 80% of the cases with upper - extremity dvt. the rest, which accounts for less than 20% of the cases, is caused by arm exercise or idiopathic conditions. in our case, there were no clinical symptoms or imaging findings suggestive of structural abnormalities in the venous system of the upper extremities or the neck. in addition, there was no episode of arm exercise during the hospitalization. in adult cases of nephrotic syndrome, most of the venous thromboses occur within 6 months after the diagnosis of nephrotic syndrome, especially in association with the increase of urinary protein and decrease of serum albumin. in the present case, dvt occurred approximately 2 months after the diagnosis of nephrotic syndrome when marked proteinuria and hypoalbuminemia had persisted because of poor effects of corticosteroid therapy. in addition, dvt in our case improved alongside the improvement of the nephrotic syndrome after the administration of cyclosporine. therefore, we believe that the most probable cause of upper - extremity dvt in this case was associated with nephrotic syndrome, which is hardly ever the case, as described above. furthermore, the 2-month duration of oral corticosteroid therapy, which is also an important factor for venous thrombosis, presumably had some influence on dvt in this case. we consider that rest during hospitalization, especially after renal biopsy, also might have advanced the likelihood of thrombosis. the first - line therapy of upper - extremity dvt is anticoagulation by heparin or warfarin when dvt involves the axillary or more proximal veins. in the present case, the swelling of the upper limb was successfully improved along with a reduction of thrombus size after the administration of warfarin and heparin without causing pulmonary embolism, which is a life - threatening complication of upper - extremity dvt. in addition to the effectiveness of anticoagulation therapy, the remission of nephrotic syndrome and the tapering of prednisolone might have contributed to the improvement of upper - extremity dvt by reducing the thrombophilic state. in conclusion, to the best of our knowledge, this is the first case report of upper - extremity dvt associated with nephrotic syndrome. it is necessary to consider upper - extremity dvt when upper - extremity edema is observed in patients with nephrotic syndrome. the detailed mechanisms of upper - extremity dvt in association with nephrotic syndrome need to be elucidated. | deep venous thrombosis (dvt) in the upper extremities is a rare but important clinical illness, which leads to severe complications such as pulmonary embolism. unlike dvt in the lower extremities, which is mainly induced by a hypercoagulable state, dvt in the upper extremities is usually caused by mechanical obstruction or anatomical stenosis in the venous system. we herein report a case in which dvt developed in the left upper limb during treatment of nephrotic syndrome. this is the first case report of upper - extremity dvt in association with nephrotic syndrome in the literature. our patient was a 56-year - old male with nephrotic syndrome due to idiopathic membranous nephropathy who was treated with 40 mg / day of prednisolone. during corticosteroid therapy, he developed a swelling of the left upper limb. computed tomography revealed thrombi in the left internal jugular vein and the left subclavian vein without anatomical abnormalities in his venous system. thus, he was diagnosed with dvt of the upper extremities. after the initiation of warfarin treatment and subsequent regression of nephrotic syndrome, the swelling disappeared and the thrombi significantly diminished. dvt should be considered when upper - extremity edema is observed in patients with nephrotic syndrome. |
major depressive disorder (mdd) constitutes the first leading cause of years lived with disability, and its incidence is on the rise globally. yet, until recently, little was known about its pathogenesis, as these conditions are not associated with relevant brain alterations or clear animal models for spontaneous recurrent mood episodes. the clinical phenomenology of major depression implicates brain neurotransmitter systems involved in the regulation of mood, anxiety, fear, reward processing, attention, motivation, stress responses, social interaction, and neurovegetative function. mdd is associated with blunted reactivity to both positively and negatively stimuli ; thus, the decline in hedonic responses may be related to generalized affective insensitivity, instead of deficits in the capacity to feel pleasure at the level of basic sensory experience. from the middle of the last century, a great effort has been made to elucidate the brain areas involved in emotion control and in the pathophysiology of mood disorders. animal and human studies have indicated the involvement of the limbic system including the hippocampal formation, cingulate gyrus, and anterior thalamus the amygdala and different cortical structures as well as the hypothalamus in these processes [5, 6 ]. these structures are connected in two main networks : the orbital and the medial prefrontal networks. the orbital network appears to function both as a system for integration of multimodal stimuli and as a system for assessment of the value of those stimuli, and, probably, the support of abstract assessment of reward. the structures of the medial prefrontal network have been shown to contain alterations in gray matter volume, cellular elements, neurophysiological activity, receptor pharmacology, and gene expression. dysfunction within this system underlies the disturbances in emotional behavior and other cognitive aspects of the major depressive disorder. treatments for depression, involving pharmacological, neurosurgical, and deep brain stimulation methods, appear to suppress pathological activity within the components of medial prefrontal network such as the subgenual anterior cingulate cortex, ventromedial frontal cortex, striatum, and amygdala. although the causes of mdd are not yet completely known, genetic factors appear to play an important role although other factors deal with acute or chronic stress, childhood trauma, viral infections, and others [12, 13 ]. regarding genetic causes, certain polymorphisms in genes related to the serotonergic system as the serotonin transporter, the brain - derived neurotrophic factor, the monoamine oxidase a, or the tryptophan hydroxylase 1, may increase the risk for depression or the vulnerability to stress. not all the studies published to date have found gene - environment interactions ; however, the combination of both factors seems to predict more accurately a person 's risk to suffer from major depressive disorder better than genes or environment alone. the discovery that some drugs as iproniazid and imipramine exert an antidepressant effect dates back to the 1950s. in 1965, it was shown that these drugs act through the monoaminergic system by increasing the brain levels of those monoamines. these observations led to the development of the classical monoaminergic hypothesis of depression, which proposes that low monoamine brain levels in depressed individuals are responsible for this pathology. the classic antidepressants that increase monoamine neurotransmitters in the synaptic cleft are generally used for first - line treatment. however, the clinical benefit of these treatments is not immediate, taking 3 - 4 weeks to obtain a full response. other therapeutic problems of currently used antidepressant drugs include relapses, drug side effects, incomplete resolution, residual symptoms, and drug resistance. traditionally, research in the neurobiology of major depressive disorder has been focused on monoamines. however, several lines of evidence have led to the conclusion that the abnormalities associated to depression go beyond monoaminergic neurotransmission : thus, the development of better antidepressants will surely depend on the discovery and understanding of new cellular targets. in this regard, in the late 90 's a new hypothesis has tried to explain major depression based on molecular mechanisms of neuroplasticity. the neuroplasticity hypothesis was postulated based on several findings : first, stress decrease hippocampal neurogenesis and synaptic plasticity in prefrontal cortex (pfcx) [1922 ]. moreover, most known antidepressant therapies stimulate the proliferation of hippocampal progenitor cells, which constitutes the first stage of adult hippocampal neurogenesis. however, the contribution of hippocampal neurogenesis to the pathogenesis of depression is far from being fully understood. second, hippocampal morphologic analyses in depressed patients reveal volume loss and gray matter alterations. while some studies suggest that decreased adult neurogenesis could be responsible for such fluctuating changes, others show that the hippocampal volumetric reductions could be due to changes in neuropil, glial number, and/or dendritic complexity, and not necessarily to a cell proliferation decrease. third, different neuroplasticity- and proliferation - related intracellular pathways appear to be involved in the antidepressants ' action as brain - derived neurotrophic factor (bdnf), -catenin [10, 26 ], or the mammalian target of rapamycin (mtor). dentate gyrus proliferation is decreased by stress [1922 ], and in several animal models of depression as unpredictable stress, chronic administration of corticosterone, olfactory bulbectomy, or maternal deprivation [22, 2831 ]. this loss in cell proliferation is correlated with a decreased hippocampal volume [3234 ]. hippocampal proliferation decrease is also observed in other disease models such as diabetic mice, which present a high incidence of depression reported in individuals with that primary illness. in these animals, the reduced hippocampal proliferation is reversed with chronic antidepressant treatments. in animals subjected to acute or chronic stress, a period of at least 24 h or 3 weeks, respectively, is required to get a recovery of the cellular proliferation. however, although all these changes have been extensively studied, major depression is not generally considered as hippocampal disorder. it is unlikely that impaired adult hippocampal neurogenesis alone may fully explain the neuropathology of major depression. in this sense, other studies have addressed cellular proliferation in anatomical structures quite relevant to depressive disorders, such as prefrontal cortex and amygdala, by using animal models of depression. thus, medial frontal cortex presents a reduction in cell proliferation, downregulation of genes implicated in cell proliferation [37, 38 ], decreased cell growth and survival, and apoptosis inhibition. structures such as amygdala present an opposite pattern, with an increase in neuronal dendrite length in stress models. chronic administration of antidepressants leads to an increased proliferation in prefrontal cortex [36, 40 ] although the fate of the new generated cells goes toward the formation of glia rather than neurons, in contrast to hippocampus. no data are available regarding antidepressant effects on amygdalar cell proliferation ; however, this structure has been involved in the negative control of the hippocampal cell survival induced by antidepressant treatments, based on the increased cell survival observed in hippocampus, after the basolateral complex of the amygdale (bla) lesion. it is interesting to note that amygdala implicated in fear - related learning that impairs the memory processing of the hp - pfcx memory shows an enhancement of ltp under stress situations, which is not reverted by antidepressants. thus, antidepressants as tianeptine are able to restore the normal functionality of hp and pfcx under stress situations, while the amygdala retains the ability to increase its activity in the same stress conditions. it could only be the most conspicuous feature of a more fundamental type of cellular plasticity, which could also govern the prefrontal cortex and other regions. it has also been proposed that, in addition to neural proliferation, changes in synaptic plasticity would also be involved in the biological basis of depression, being modulated by antidepressant treatments [43, 44 ]. pfcx is also a region sensitive to stress - induced effects, with a reduction in the number and length of spines in apical dendrites of the pyramidal cells in the medial prefrontal cortex area [46, 47 ], as well as changes in the number, morphology, metabolism, and function of glial cells, that produce changes in the glutamatergic transmission, resulting in memory impairments [4851 ], and reduced synaptic plasticity in the hp - pfcx neuronal pathway. the increase in extracellular glutamate could be one of the reasons underlying the molecular changes associated to stress. however, while frontal cortex and hippocampus are reduced and hypofunctional in major depression, structures such as amygdala present hypertrophy and hyperactivity. an increased apoptosis has also been related to a higher risk of suffering major depression since increased cell death in areas as dentate gyrus (dg), ca1, and ca4 areas of the hippocampus, entorhinal cortex, and subiculum are reported in studies using human postmortem brain samples though this phenomenon does not seem to account for the hippocampal volume reduction. animal studies also report that acute stress increase hippocampal apoptosis, while chronic stress induces no changes, increased apoptosis in cortex [54, 55 ], or hippocampus. antidepressant treatment decreases cell death by different mechanisms, as the activation of the expression of trophic factors (bdnf and its receptor trkb) which results in increased cell survival [56, 57 ] or directly reducing cellular apoptosis in animal stress models as reported for fluoxetine [28, 58 ]. it has been suggested that an increase in serotonin levels mediates the raise in cell proliferation, while the depletion of this neurotransmitter does not lead to an immediate effect over the hippocampal cell division. in line with that treatments exerting a direct action over the serotonergic system include chronic but not acute administration with drugs such as tricyclic antidepressants, monoamine oxidase inhibitors (maoi), serotonin - selective reuptake inhibitors (ssri), serotonin and noradrenaline reuptake inhibitors (snri), and 5ht4 agonists [8, 19, 20, 6065 ]. a nonpharmacological intervention such as the silencing of the serotonin transporter (sert) by rnai in dorsal raphe serotonergic neurons also leads to increased hippocampal proliferation. the administration of other drugs, such as lithium in combination with antidepressants as desipramine, produces an increase in hippocampal proliferation and a decrease in apoptosis of hippocampal progenitor cells in irradiated animals. treatments with antidepressants that increase serotonin levels in brain act by targeting different progenitor cell populations. thus, chronic administration of the ssri fluoxetine or subchronic treatment with a 5-ht4 agonist increases cell proliferation and neurogenesis - targeting amplifying neural progenitors (anps) (figure 1) while chronic electroconvulsive seizure (ecs) produces a fast - acting effect targeting both quiescent neural progenitors (qnps) and anps. an increased hippocampal proliferation as a consequence of chronic antidepressant treatment has been proven necessary for some [7173 ], but not all the antidepressant - like effects in animals. the antidepressant - like effects have been related to the increased hippocampal proliferation [8, 71, 74 ], dendritic arborization, maturation, and functional integration of newborn neurons. however, other drugs with potential antidepressant action do not mediate their effect through the activation of progenitor cells division, since the complete elimination of hippocampal proliferation by direct irradiation of this structure does not block the antidepressant response promoted by the blockade of drugs acting on other neurotransmitter systems as the corticotrophin - releasing factor receptor (crf) or arginine vasopressin 1b (v1b) receptors. classically, the modulation of different neurotransmitter systems has been implicated in the mediation of the antidepressant effects, and, for some of them, a link with proliferative or plastic changes has been reported. the traditionally involved neurotransmitter systems include the serotonergic, adrenergic, and dopaminergic ones, while others, such as the glutamatergic and cannabinoid systems and the corticotropin - releasing factor (crf) system implicated in the secretion of acth are acquiring increasing importance in the last years. here we will focus on the serotonergic receptors most relevant to modulating neural proliferation and synaptic plasticity processes. the partial lesion of dorsal and medial raphe nuclei, which results in a decrease of serotonergic neurons that innervate the dentate gyrus of the hippocampus and other projection areas as cortex and amygdala, decreases the proliferation in the subgranular zone of the dentate gyrus. several serotonin receptors have been involved in the antidepressant - induced increase of cell proliferation in the hippocampus, together with neurite outgrowth and cell survival in cells expressing these receptors. however, other authors report a lack of changes in proliferation and/or neurotrophic factors expression after chronic treatment with the antidepressant fluoxetine, questioning the importance of the serotonergic system in hippocampal proliferation [133135 ]. the importance of this serotonergic subtype in the effects of antidepressants has been shown in studies in vivo using 3 day treatment with the 5-ht1a agonist 8-oh - dpat, and chronic administration of this drug [74, 79, 80 ] that produce an increase in proliferation in the subgranular zone (sgz) of the hippocampus that depends on the 5-ht1a postsynaptic receptors. in studies using hippocampal neural progenitors, the serotonin - mediated increase in proliferation the acute administration of 5-ht1a antagonists produces a decrease of hippocampal proliferation, or no changes after 14 days. knock out animals for the 5-ht1a receptor subtype present no changes in basal proliferation compared to wild type animals [9, 71 ], but present a decreased hippocampal cell survival. the 5-ht1a receptor subtype has been proven necessary for the hippocampal proliferative effect of some antidepressants as fluoxetine, although other drugs as imipramine, acting on other neurotransmitter systems, increases hippocampal proliferation in a 5-ht1a - independent manner (table 1). the role of the 5-ht2a / c receptors in the regulation of neurogenesis is less clear. the chronic administration of 5-ht2a antagonists as ketanserin, and 5-ht2c antagonists as sb243,213 and s32006, produce the increase in hippocampal proliferation, while the acute treatment with 5-ht2a / c agonists or antagonists produce no changes or a decrease in proliferation, respectively [74, 81 ]. interestingly, the subchronic treatment with ketanserine in combination with the ssri fluoxetine increases a series of synaptic plasticity markers as -catenin and n - cadherin present in the membrane fraction, together with bdnf gene expression, however, hippocampal proliferation is not significantly modified. the increased proliferation or synaptic plasticity parallel the antidepressant - like effect observed for the treatments with antagonists [83, 137, 138 ], while the administration of 5-ht2a agonist counteracts the effect of ssris. the blockade of 5-ht2a receptor subtype located in gabaergic interneurons produces the activation of hippocampal pyramidal neurons that modulates dendritic activation and synaptic plasticity (table 1). in the last years, the 5-ht4 receptor subtype has been proven to have an outstanding role on the depressive pathology. this receptor subtype density and signaling cascade through camp are up - regulated in the frontal cortex and caudate - putamen of depressed humans. chronic treatments with classical antidepressants produce a desensitization of this subtype in structures as hippocampus [97, 98 ]. in the last years, it has been described a short - term antidepressant - like response mediated by 5-ht4 partial agonists [8, 64, 65 ], or when coadministered with classical antidepressants. the antidepressant effect of 5-ht4 agonist is mediated by an increase in hippocampal proliferation in vivo [8, 64 ], together with other proliferative and plasticity markers as -catenin, akt, bdnf [8, 65 ], phosphorylated camp response element binding (creb) protein [8, 6365 ]. the 5-ht4 implication in serotonin - induced hippocampal proliferation has been observed blocking this receptor with the 5-ht4 antagonist dau 6285 in primary hippocampal progenitor cell cultures (table 1). the role of the 5-ht6 receptor subtype in depression is not clear, but tricyclic antidepressants as amitriptyline and atypical antidepressants as mianserin have high affinity for this serotonin receptor subtype, acting as antagonists. this receptor subtype is present postsynaptically in brain areas as cortex and hippocampus and is implicated in learning and memory. the action over this receptor to date is contradictory since it has been published that both antagonists and agonists exert antidepressant and anxiolytic effects alone [142, 143 ] or enhance the beneficial effect when combined with antidepressant drugs. however, this effect is not mediated by increased neurogenesis but for an increase in neural cell adhesion molecule polysialylation (psa - ncam) that may mediate memory consolidation through long - term changes in synaptic plasticity (table 1). recent studies have shown that the blockade of the 5-ht7 receptor subtype produces antidepressant - like behaviour [147, 148 ]. this is supported by studies in animal depression models as the olfactory bulbectomy, the antidepressant - like behaviour of knock - out mice for the 5-ht7 receptor subtype, and clinical data using the antagonist lu aa21004. moreover, a 7-day treatment with the 5-ht7 antagonist sb-269970 produces an increase in proliferation in the subgranular zone of the hippocampus although changes in the number of dividing cells do not appear in 5-ht7 knock - out animals (table 1). in an attempt to explain those brain changes implicated on depression and/or antidepressant effect that could not be included in the initial monoaminergic hypothesis of depression, it was postulated the so - called neurotrophic hypothesis of depression that later was revised to a this hypothesis links the changes in depression models to a decrease of brain - derived neurotrophic factor (bdnf) and the antidepressant effect to an increase in bdnf in hippocampus [18, 19, 151, 152 ]. moreover, the decreased bdnf observed in heterozygous knock - out mice (bdnf) is related to a depression - like phenotype. these changes in brain bdnf expression are paralleled by serum levels, so that it has been proposed as a biomarker for depression disease, positive or negative response of the individuals to the antidepressant treatment [153156 ], and even a marker of suicidal depression. however, the role of bdnf is still not clear in the depressive pathology since some authors describe a lack of changes on the bdnf levels associated to stress animal models [57, 158160 ]. the infusion of bdnf in brain [161, 162 ] or more specifically in hippocampus [163, 164 ] produces antidepressant - like effects moreover, within the hippocampus, the infusion of bdnf in the dg but not in the ca1 region produces an antidepressant - like effect, which is supported by the lack of antidepressant action in mice selectively knocked out for the bdnf gene in the dg and not in the ca1. even peripherally administered bdnf is able to display antidepressant - like actions, resembling the increased serum bdnf observed after antidepressant treatments. chronic administration of antidepressants produces an increase in hippocampal bdnf mrna expression and bdnf protein levels (figure 2) [8, 65, 167 ]. the blockade of 5-ht2a receptor reverses the effect of stress - induced downregulation of bdnf mrna expression in hippocampus. also, the subchronic treatment with ssri and 5-ht2a antagonists is able to increase bdnf expression in the dentate gyrus of the hippocampus ; however, the protein level is not yet modified in subchronic treatments (figure 2). the main role of bdnf regarding adult neurogenesis is not linked to proliferation, but to the increase in cell survival, as described using bdnf and its receptor trkb knock - out animals which present a reduced bdnf expression [61, 169 ]. bdnf is implicated in synaptic plasticity, and proteins as neuritin that are induced by bdnf are decreased in stress - induced animal models of depression and increased after chronic antidepressant treatment, contributing to the bdnf antidepressant effect [170, 171 ]. the existence of a single - nucleotide polymorphism (snp) in the human bdnf gene, bdnf (val66met) is associated to reduced bdnf secretion, and to an increased incidence of neuropsychiatric disorders [173, 174 ]. in animals bdnf (val66met) predisposes to a depression - like behaviour after stress situations that recover normal values after the administration of antidepressants. other important trophic factor is the vascular endothelial growth factor (vegf) implicated in the this theory proposes the need of vascular recruitment associated to active sites of neurogenesis formed by proliferative cells that present an endothelial phenotype in 37% of the cases. vegf expression is reduced in hippocampal dentate gyrus after irradiation, and in stress models although other authors do not show changes associated to stressed animal models. from studies using irradiated rats, it was proposed that the decrease of progenitor cells responsible for the expression of vegf would underlie the decrease of this factor. some antidepressant treatments, as the electroconvulsive therapy (ecs) [178, 181, 182 ], approache with antidepressant - like effect as exercise, or mood stabilizers as lamotrigine, result in the upregulation of vegf expression. moreover, the local administration of this trophic factor produces an increase in hippocampal proliferation. in addition, the silencing of hippocampal vegf or the use of antagonists for its receptor flk-1 blocks its antidepressant - like effect and decreases markers of newborn neurons as doublecortin (dcx). even though these data indicate the importance of vegf brain levels in the depressive disorder, preliminary reports do not show a clear correlation between peripheral vegf and depressive disorders, not allowing for the use of this molecule as a marker of depression and/or antidepressant response [185, 186 ]. the activation of receptor tyrosine kinases by neurotrophic factors promotes the activation of the pi3k / akt pathway that is linked to the wnt/-catenin through the inhibition of gsk-3 and to the mtor pathway through the phosphorylation of mtor protein that are discussed below. the pi3k / akt pathway per se has an outstanding role in promoting adult hippocampal proliferation and the inhibition of cell differentiation. antidepressant treatments also produce increases in akt levels in structures as hippocampus [8, 10 ] and frontal cortex. the upstream and downstream components of the camp signaling pathway have been extensively involved in the pathophysiology of mood disorders as well as in the actions of antidepressant drugs. alterations in several elements of this pathway, such as g proteins (gs or gi), adenylate cyclase (ac), camp levels, camp - dependent protein kinase (pka), and the camp response element - binding protein (creb) transcription factor, have been described in peripheral cells and the postmortem brain of patients with affective disorders, both untreated or after antidepressant therapy [11, 100, 189, 190 ]. various elements along this pathway have been identified as potential targets for antidepressant drugs (table 2). in peripheral cells and postmortem brains of patient with mayor depression, there is a reduction of the adenylyl cyclase (ac) activity in response to forskolin, 2-adrenergic agonists [8893 ], and 2-adrenoceptor agonists. chronic treatment with antidepressant drugs produces the increase in camp levels in rat hippocampus, cortex, and striatum, as well as in postmortem human frontal cortex samples from depressed patients (figure 3(a) ; personal observation). this effect has been attributed to both enhanced coupling of gs proteins to adenylyl cyclase and increased adenylyl cyclase activity [95, 96 ]. the direct injection of camp or inhibition of camp degradation by rolipram produces antidepressant - like effect in animals. chronic antidepressant treatment in rat desensitizes camp response to serotonergic receptor as 5-ht1a receptor (figure 3(b)) and 5-ht4 receptor [8, 97, 98 ] and increases the cb1-mediated inhibition of adenylyl cyclase (ac) in prefrontal cortex, an effect that is modulated by 5-ht1a receptors. the next step in this signaling pathway is the activation of camp - dependent protein kinase (pka) by camp, so that pka activity is increased after chronic antidepressant administration.active pka phosphorylates proteins as creb, a transcription factor that regulates the expression of several genes involved in neuroplasticity, cell survival, and cognition [191195 ]. creb has been widely involved in the pathophysiology of depression and both behavioural and cellular responses to antidepressant treatments [11, 190 ]. hippocampal expression of creb is reduced in response to stress exposure [102, 103 ]. in contrast, chronic but not acute antidepressant therapy and electroconvulsive shock (ecs) increase levels of creb mrna, creb protein (figure 4), and creb activity promoting the phosphorylation of this protein effects that seems to be area and drug dependent [11, 103, 105108 ]. thus, increased phosphorylated creb levels in hippocampus are linked to antidepressant - like behaviour, as observed after viral - mediated overexpression of creb in hippocampus in behavioural models of depression. contrary to what could be expected, creb overexpression in the nucleus accumbens produces prodepressive effects, and lowered creb in the nucleus accumbens in mice exhibits an antidepressant - like response. a different pattern appears also for amygdala, in which high creb levels produce opposite effects depending on the timing. thus, when creb overexpression is induced before learned helplessness training, there is a prodepressant effect, while the increase of creb after the training is antidepressant. studies in postmortem human brain indicate lower levels of creb protein in depressed antidepressant - free subjects, in contrast to the increased creb level in patients taking an antidepressant at the time of death. these results are parallel to studies in human fibroblasts of patients with major depression, which is consistent with animal studies. among the several target genes regulated by creb, two of the more relevant, are the brain - derived neurotrophic factor (bdnf) and the vascular endothelium growth factor (vegf) [19, 60, 197, 198 ]. a growing body of data shows that other signalling cascades can modulate creb activity through phosphorylation, such as the calcium / calmodulin - dependent kinase (camkii) and the mitogen - activated protein (map) kinase cascades, and may also be implicated in the mechanism of action of antidepressants [11, 199 ]. initially, all effects of camp increase were attributed to the activation of pka / creb, but two novel targets as the camp - regulated ion channels and epac (exchange protein directly activated by camp) are now known to be involved in mediating camp responses. an increase in epac-2 levels, but not epac-1, has been found in postmortem samples of prefrontal cortex and hippocampus of depressed subjects. the wingless - type (wnt) family of proteins has key roles in many fundamental processes during neurodevelopment. the role of this pathway in neural development, through the modulation of neural stem cells ' (nsc) proliferation and differentiation, has been clearly demonstrated. some of the processes regulated by wnt/-catenin pathway activity are neural differentiation, hippocampal formation [203, 204 ], dendritic morphogenesis [205, 206 ], axon guidance [207, 208 ], and synapse formation. moreover, it also plays an important role in spatial learning and memory, including long - term potentiation (ltp) phenomena. in the absence of wnt signaling, -catenin function is blocked by a destruction complex consisting of axin, apc, and gsk-3 and ck1a kinases, which phosphorylates -catenin for destruction in the proteasome [212, 213 ]. canonical wnt signaling results in the inhibition of gsk-3 which is constitutively active, and the non - phosphorylated -catenin is stabilized in the cytoplasm and translocated to the nucleus, which is essential for canonical wnt signaling. once in the nucleus, -catenin forms a complex with the t - cell factor / lymphoid enhancer factor (tcf / lef) transcription factors, to activate the expression of wnt target genes. tcf / lef transcription factors are bound to groucho, a protein producing repressive effects. nuclear -catenin promotes the displacement of groucho and the binding of the histone acetylase cyclic amp response element - binding protein (creb), activating the transcription machinery [214, 215 ]. the noncanonical pathway or -catenin independent is mediated through rac / rho (wnt / pcp) or through calcium (wnt / ca). in the last years several evidences have implicated wnt - signaling pathway in the pathophysiology and treatment of mood disorders and other cognitive pathologies. gsk-3 and -catenin are regulated either directly or indirectly by lithium, valproate, antidepressants, and antipsychotics [8, 10, 113117 ], while gsk-3 has also been identified as a target for the treatment of alzheimer 's disease (table 2). postmortem human brain samples from depressed subjects and teenage suicide victims present a dysregulation of wnt / gsk-3 signaling with a decrease in -catenin expression in prefrontal cortex. -catenin knock - out mice with 5070% decrease of -catenin expression in forebrain regions present an increased immobility time in the tail suspension test indicating a depression - like state, but not in other anxiety tests. the inhibition of gsk-3 activity, either pharmacologically [117119 ], or through deletion in mouse forebrain, results in an increase in brain -catenin levels, as well as in antidepressant - like effects or decreased anxiety, as observed by the direct overexpression of -catenin in mouse brain. gsk-3 inhibition by lithium is an important regulator of cell survival related to mood stabilizers and displays antidepressant efficacy [115, 118, 215, 217, 218 ]. in contrast, gsk-3 knockin mice displayed increased susceptibility to stress - induced depressive - like behaviour, presenting decreased cell proliferation in the subgranular zone of the dentate gyrus, accompanied by a reduction in vegf, but not bdnf, and blunted neurogenesis in response to antidepressant treatments. these data support the importance of the wnt pathway activation and -catenin levels associated to mood disorders and their treatment. in addition, snp variation in the promoter region of gsk-3 plays a protective role in the onset of bipolar illness and increased antidepressant response. recent studies have identified the wnt / gsk-3/-catenin - signaling pathway as a key regulator of adult neurogenesis in hippocampus [220, 221 ] or subventricular zone, highlighting the role of gsk-3 on neural progenitor homeostasis. wnt proteins are signaling molecules that are released from hippocampal neural stem cells (nsc) and astrocytes, acting autocrinally to regulate proliferation via wnt canonical pathway [220, 221 ]. wnt/-catenin pathway is activated by antidepressant treatments as electroconvulsive therapy, chronic treatments with classical antidepressants as the dual serotonin - noradrenaline reuptake inhibitor (snri) venlafaxine (figure 5(a)), and 5-ht4 partial agonists. the antidepressant - induced -catenin increase is observed in the subgranular zone (sgz) of the dentate gyrus (dg) of the hippocampus, in membrane and nuclear fractions [10, 26 ]. the increased proliferation observed in sgz after chronic antidepressant treatments is localized in cell clusters that also show a positive -catenin staining [8, 10 ]. other treatments with antidepressant - like efficacy, such as the subchronic administration of ssri fluoxetine together with the 5-ht2a antagonist ketanserin, also produce a -catenin increase in the membrane fraction but not in the nuclear one, which corresponds with a lack of changes in hippocampal proliferation (figure 5(b)). the increase in membrane - associated -catenin is parallel to an elevation of n - cadherin protein, both members of the -catenin / n - cadherin complex present in pre- and postsynaptic terminals [223, 224 ], where -catenin recruits scaffolding proteins, conforming cell - cell adhesion complexes, recruiting synaptic vesicles [209, 227 ], and acting on the development of new synapses. this suggests a preference of modifications in synaptic plasticity instead of proliferation, as previously reported for other antidepressant treatments. in addition, frizzled receptors and gpcrs can interact through several pathways [228, 229 ]. some gpcrs act through gq and/or gi proteins activating pkb (protein kinase b)/akt which inhibits gsk-3 via phosphorylation. these receptors can also activate gs proteins that activate prostaglandin e2 (pge2), phosphoinositide 3-kinase (pi3k), and pkb / akt, leading to the inhibition of gsk-3. other receptors act on gq or g12/13 proteins, activating the phospholipase c (plc) and protein kinase c (pkcs) and inhibiting gsk-3. taken together, these data support the possible existence of interactions between the gsk-3/-catenin pathway and other neurotransmitter systems involved in depression, including serotonin. the pharmacological modulation of the different elements of the wnt/-catenin pathway with antidepressant purposes has to be clarified in the near future, probably modulating at the level of wnts or -catenin activity. interestingly, a number of patents regarding gsk-3 inhibition as the therapeutic mechanism for treatment of neuropsychiatric disorders are being launched, including treatment of depression. target of rapamycin (tor) genes, members of the phosphoinositol kinase - related kinase (pikk) family of kinases, was first described in yeast as the pharmacological targets of the microbicide rapamycin. mtor, the mammalian form of this protein, exists in two different functional multiprotein complexes within the cells, mtorc1 and mtorc2, which are evolutionarily conserved from yeast to mammals [232, 233 ]. mtorc2 is involved in cytoskeletal remodeling and in the regulation of cell survival and cell cycle progression. mtorc1, the primary target of rapamycin, is involved in cell proliferation, cell growth and survival by protein translation, energy regulation, and autophagy in response to growth factors, mitogens, nutrients, and stress [235237 ]. in neurons, mtorc1 activity is regulated by phosphorylation in response to growth factors, as bdnf, mitogens, hormones, and neurotransmitters through the activation of g protein - coupled receptors (gpcrs) or ionotropic receptors. the mtorc1 phosphorylation is mediated by erk / mapk, pi3k, pka, and epac. the activation of mtorc1 results in the phosphorylation and activation of several downstream targets as the eukaryotic initiation factor 4e - binding protein 1 (4e - bp1), p70 ribosomal s6 kinase (p70s6k), rna helicase cofactor eif4a, extracellular signal - regulated kinase (erk, including both erk1 and erk2), or pkb / akt ; and the inhibition of the eukaryotic elongation factor 2 kinase (eef2) [238, 239 ]. mtor has been extensively studied related to cancer, development, metabolism, and more recently to the central nervous system (cns) physiology and diseases [238, 240, 241 ]. mtor - signaling pathway is involved in synaptic plasticity, memory retention, neuroendocrine regulation associated with food intake and puberty, and modulation of neuronal repair following injury. the target proteins of mtor, 4e - bp1, and eukaryotic initiation factor-4e (eif4e) have been detected in cell bodies and dendrites in cultured hippocampal neurons and their distribution completely overlaps with the postsynaptic density protein-95 (psd-95) at synaptic sites, suggesting the postsynaptic localization of these proteins. the activation of mtor has been functionally linked with local protein synthesis localized presynaptically as synapsin i, or postsynaptically as psd-95 and glur1, and cytoskeletal proteins as the activity - regulated cytoskeletal - associated protein (arc) [27, 241, 243 ]. mtor - signaling pathway has been also related to a number of neurological diseases, such as alzheimer 's disease, parkinson 's disease, and huntington 's disease, tuberous sclerosis, neurofibromatosis, fragile x syndrome, epilepsy, brain injury, and ischemic stroke. dysfunction of mtorc1 is associated with the pathogenic mechanisms of alzheimer 's disease, and the activation of p70s6k, downstream of mtorc1, has been identified as a contributor to hyperphosphorylated tau accumulation in neurons with neurofibrillary tangles. recent studies have also associated mtor signaling in affective disorders since the administration of ketamine produces a fast - acting antidepressant - like effect in animals and human. in stressed rats, a reduction in pi3k - akt - mtor - signaling the inhibition in mpfcx of calcineurin, a serine / threonine protein phosphatase that participates in the regulation of neurotransmission, neuronal structure and plasticity, and neuronal excitability, induces a depression - like behaviour, accompanied by a decrease in mtor activity. this effect can be reverted by the activation of mtor by nmda or the chronic administration of the antidepressant venlafaxine, promoting an antidepressant - like effect. in human postmortem samples of prefrontal cortex of depressed subjects, there is a decrease in the expression of mtor, as well as some of the downstream targets of this pathway, as p70s6 kinase (p70s6k), eif4b, and its phosphorylated form, which suggests the impairment of the mtor pathway in major depressive disorder (mdd) that would lead to a reduction in protein translation (table 2). the subchronic, but not acute, administration of rapamycin in rodents has an antidepressant - like effect shown in two behavioural tests as forced swimming and tail suspension tests. acute administration of different nmda receptor antagonists as the ketamine, ro 25 - 6981, and mk-801 or antagonists of the group ii of the metabotropic glutamate receptors (mglu2/3), as mgs0039 and ly341495, produce a fast antidepressant effect [250, 251 ] mediated by mtor - signaling pathway activation. ketamine rapidly activates the mammalian target of rapamycin (mtor) pathway, increases synaptogenesis, including increased density and function of spine synapses, in the prefrontal cortex of rats [27, 243 ], and increases hippocampal bdnf expression, that results in a rapid antidepressant - like effect in rats [27, 243 ] and humans. moreover, blockade of mtor signalling by the specific antagonist rapamycin completely blocks the ketamine induction of synaptogenesis and behavioural responses in models of depression. other antidepressant strategies as the electroconvulsive treatment (ect) also activate the mtor pathway, leading to an increase in vegf. therefore, modulation of mtor could be a novel approach to develop strategies for the treatment of affective disorders. the neurogenesis hypothesis of depression was based upon the demonstration that stress decreased adult neurogenesis in the hippocampus. this reduction in the production of newborn granule cells in the hippocampal dentate gyrus is related to the pathophysiology of depression. since then, several studies have established that newborn neurons in the dentate gyrus are required for mediating some of the beneficial effects of antidepressant treatments since the increase in cell proliferation after antidepressant treatment is only observed in the sgz and not in svz, suggesting a specificity of the antidepressants to regulate hippocampal neurogenesis. moreover, psychotropic drugs without antidepressant activity do not increase neurogenesis [135, 256 ]. the disruption of hippocampal proliferation by irradiation is not sufficient to drive a depression - like phenotype. both x - irradiation and genetic manipulation approaches demonstrated a requirement of hippocampal neurogenesis in mediating some of the antidepressant treatment effects [71, 76, 257 ], while mice exposed to x - irradiation of the svz or cerebellum responded normally to the antidepressants. however, some drugs with potential antidepressant action do not mediate their effect through the increase in hippocampal proliferation, as drugs acting on corticotrophin releasing factor receptor (crf) or arginine vasopressin 1b (v1b) receptors, as indicated previously. the appearance of the antidepressant - like effect in behavioural tests after 2 - 3 weeks parallels the time needed for the growth of newborn cells in hippocampus. however, this time course does not always take so long. for classic antidepressants as the serotonin transporter inhibitors, a chronic regime is needed to observe that increased proliferation rate [10, 60 ], while, for others as ecs and 5-ht4 agonists [8, 64 ], an acute or subacute treatment, respectively, is enough to increase proliferation. the putative role of changes in synaptic plasticity and/or neural proliferation in the depressive pathology is proposed some time ago. synaptic plasticity, as indicated for proliferation, is also modulated by antidepressant treatments [43, 44 ]. the neural plasticity is not only functional but structural and is impaired in animal models. for example, there is a decrease in spine number in hippocampal ca1 and ca3 areas in bulbectomized animals that are reverted with antidepressant treatment [259261 ]. this structural plasticity is more striking when new neurons are born, or there is an increase in neuron survival as a consequence of antidepressant treatment or ecs. the new dendritic spines formed are associated to smaller postsynaptic densities (psds) and a higher frequency of miniexcitatory postsynaptic currents (mepscs), suggesting an increased number of new and active glutamatergic synapses. the rapid antidepressant response to drugs as ketamine acting through the blockade of nmda receptors appears as a new target for having fast - acting effects on the treatment of mood disorders compared to the weeks or months required for standard medications. ketamine and other glutamate antagonists through the increase of the number and function of new spine synapses in rat prefrontal cortex by the activation of mtor do not modify hippocampal cell proliferation. it would also be critical for future work to validate the relative importance of antidepressant - induced neurogenesis and synaptic plasticity in the antidepressant effects. however, evidence is strong that neurogenesis is required for at least some of the beneficial effects of antidepressant treatment. the exact role of neuroplastic / neuroproliferative changes in other brain structures as mpfcx and amygdala should be elucidated. as indicated in this review, the importance of either proliferation or plasticity, or both, is still a matter of debate. as the involvement of proliferation and plasticity has been mainly studied in hippocampus, we might be underestimating its role in the antidepressant effect. in this sense, as the hippocampus is responsible for the learning and cognition part of the depressive disorder, the fact that the impairment of hippocampal proliferation would not block the antidepressant effect of some drugs does not necessarily conclude that the proliferation is only dependent on hippocampus. in the last years, prefrontal cortex, a structure with a great importance in mood control and working memory, is gaining increasing relevance in the plastic changes linked to antidepressant effects promoted by drugs as ketamine. in this sense, hippocampal proliferation would be only a small part of the plastic changes that are taking place within the hippocampus, and other brain areas. thus, we must not underestimate the implication of synaptic plasticity in those antidepressant treatments that are not accompanied with increased proliferation. | it is widely accepted that changes underlying depression and antidepressant - like effects involve not only alterations in the levels of neurotransmitters as monoamines and their receptors in the brain, but also structural and functional changes far beyond. during the last two decades, emerging theories are providing new explanations about the neurobiology of depression and the mechanism of action of antidepressant strategies based on cellular changes at the cns level. the neurotrophic / plasticity hypothesis of depression, proposed more than a decade ago, is now supported by multiple basic and clinical studies focused on the role of intracellular - signalling cascades that govern neural proliferation and plasticity. herein, we review the state - of - the - art of the changes in these signalling pathways which appear to underlie both depressive disorders and antidepressant actions. we will especially focus on the hippocampal cellularity and plasticity modulation by serotonin, trophic factors as brain - derived neurotrophic factor (bdnf), and vascular endothelial growth factor (vegf) through intracellular signalling pathways camp, wnt/-catenin, and mtor. connecting the classic monoaminergic hypothesis with proliferation / neuroplasticity - related evidence is an appealing and comprehensive attempt for improving our knowledge about the neurobiological events leading to depression and associated to antidepressant therapies. |
odontogenic cysts are caused from odontogenic epithelium in the process of dental apparatus development and can be originated from one part of dental organ. inflammatory cysts have an inflammatory reason but the cause of the developmental type is unknown. odontogenic cysts can cause bone inflation, teeth mobility, fistula formation, pain, parasthesia, and mucofacial fold swelling. odontogenic cysts like odontogenic keratocysts (okcs), calcifying odontogenic cysts and glandular odontogenic cysts can have recurrence and aggressive growth behavior. metastases can be made in odontogenic cysts including, okcs, radicular and dentigerous cysts. also, malignant changes like primary intraosseous carcinoma and squamous cell carcinoma might arise in these lesions. it derives from the above that we need to diagnose these lesions accurately and as soon as possible to have a suitable treatment which can be facilitated through the knowledge of the origin, clinico - pathological characteristics and biological behavior of these lesions. studies carried out in isfahan had mostly been scattered, and were on a limited number of dysfunctions. thus, the purpose of this study was evaluating odontogenic cysts regarding prevalence rate, age, gender, and involved regions for patients referring to the oral pathology department of the dental school of isfahan university of medical sciences (iran) between 1988 - 2010. as this oral pathology department is the sole center for such evaluations for patients from all regions of isfahan and chaharmahal bakhtiari provinces, it may be concluded that the acquired results can be generally applied to all these regions. in this study, a comparison has also been made of the results obtained with those of other geographic regions. this study was a retrospective descriptive re - evaluation based on diagnosis documents (including complete files, microscopic slides, panoramic radiographs, computer scanings, etc.,) of patients referring to the oral pathology department of the dental school of isfahan university of medical sciences between 1988 and 2010. in this study, 7412 microscopic slides prepared between 1988 and 2010 were stained with hematoxylin - eosin and re - evaluated by co - worker pathologists of the center. lesions which were compatible with the world health organization (who) published in 2005 [table 1 ] were included in our study. then, variables such as age, gender, infected jaw, and specific region of these odontogenic cysts were obtained from recorded files by two dentistry scholars. categories of odontogenic cysts modified from the 2005 who classification in this evaluation, extracted information was subjected to descriptive statistical analysis, using spss software version 16.0. the following locations were examined : anterior region (central, lateral and canine), posterior region (premolar, molar and posterior to them), mandible, and maxilla. among 7412 recorded lesions in the oral pathology department over 23 years, 1603 cases (21.62%) were related to odontogenic cysts (male to female ratio was 1.31:1). the mean age of patients was 29.53 16.1, with peak involvement in the second decade of life. six hundred and forty - one (48.12%) of odontogenic cysts were inflammatory and 691 (51.87%) were developmental cysts. the frequency of the odontogenic cysts altogether 746 (46.54%) odontogenic cysts were reported in the maxilla, 418 (56.03%) in men and 328 (43.97%) in women. also, 857 (53.46%) odontogenic cysts were recorded in the mandible, 492 (57.41%) in men and 365 (42.59%) in women. inflammatory cysts were more prevalent in the maxilla 441 (56.46%), and developmental cysts were more prevalent in the mandible 517 (64.11%). also, 540 cysts were seen in the anterior zone (33.69%), 895 cysts in the posterior (55.83%), and 168 items in both zones (10.48%). the distribution of the odontogenic cysts according to site prevalence of the cases was : radicular cysts 466 (34.98%), dentigerous cysts 350 (26.27%), okcs 307 (23.04%) and residual cysts 208 (12.98%) constituting 1331 (96.45%) of the total number. the frequency of these four common cysts is shown in figure 1 based on age decades and genders. according to this figure, radicular cyst was more prevalent in the third decade, dentigerous cyst in the second decade, okc between second and third decades and residual cyst in the fifth decade of life. comparative figure of frequency percentage of the four most frequently found cysts (radicular cyst, dentigerous cyst, okc and residual cyst) according to gender and age in decades the most diagnosed lesion was radicular cyst constituting 563 (35.12%) of odontogenic cysts (male to female ratio was 1.19:1). the most prevalent site for this cyst was in the upper anterior zone including 187 (33.21%) cases. dentigerous cyst was seen in 413 (25.77%) cases, with male to female ratio of 1.47:1. the most affected site was lower posterior zone, 203 (49.15%), followed by upper anterior zone, 106 (25.67%). the next prevalent cyst was okc including 362 (22.58%) cases with male to female ratio of 1.26:1. the fourth and last prevalent lesion was residual cyst constituting 208 (12.98%) cases of the total. male to female ratio was 1.77:1. also, the most prevalent site was lower posterior zone, 84 (40.38%). other recorded odontogenic cysts included 21 calcifying odontogenic cysts (1.31%) with peak involvement between second and third decades, 13 lateral periodontal cysts (0.81%) which were more prevalent in the third decade, 10 paradental cysts (0.62%) with peak involvement in the third decade, 7 glandular cysts (0.46%) all between fourth and seventh decades, 4 orthokeratinized cysts (0.25%) equally in third and fourth decades, 1 eruption cyst (0.06%) in a 7-year - old child (male) and 1 gingival cyst of the adult (0.06%) in a 43-year - old woman. there were no cases of malignancy or neoplastic changes reported in the odontogenic cyst walls. as many odontogenic cysts have similar clinical, radiographic and histologic characteristics, information about the prevalence of odontogenic cysts according to age, gender and affected area can direct dentists and specially pathologists to an early and correct diagnosis for appropriate treatment. as this information is lacking in iran and specially in isfahan we planned this research to have guidelines for our dentists and also compared our data with the other parts of the world. the oral pathology department of the isfahan dental school is an educational center in which any case is evaluated and diagnosed by several pathologists and specialists in oral medicine with their scholars. so all the recorded files had complete information about the patients and their lesions, and we did not have any concern about missing data. in all, 7412 specimens were received over a 23-year period (1988 - 2010) ; among which, 1603 odontogenic cysts (21.62%) were diagnosed. this finding is higher than most of the studies and is lower than a study from spain but in general, this prevalence is in the range 0.8% to 45.9% which was mentioned by skinner., and gultelkin. male predominance in our study is consistent with most studies from other countries but is inconsistent with the study done by grossmann. the most involved sites were, respectively, posterior zone of mandible (42.73%) and anterior zone of maxilla (28.2%) which is like the other studies and is different from studies done in kaunas and jordan. this finding is similar to some studies and is different from others. according to the study of mosqueda., and souza. radicular cysts, dentigerous cysts, okcs and residual cysts were the most common odontogenic cysts, constituting a sum of 96.45% of the total which is similar to the other studies., is that most of these cysts are caused by advanced lesions, and thus in many cases may be prevented. in this study, the result obtained here is approximately similar to that acquired by mosqueda., (the reason may be that most of the patients of this center are cases which are referred from other centers (private oral pathology diagnostic services, urban and rural centers around isfahan), so this center mostly has more complicated cases. it is noticeable that most of the radicular cysts were in the upper anterior zone. so it may be concluded that a main reason for a greater case prevalence is people 's concern about their facial appearance, especially in the upper anterior zone. the male predominance in radicular cysts is inconsistent with studies done in mexico, chile and brazil but is consistent with the findings of other studies. in the study by meningaud., it has been deduced that the probability of neglect of hygiene and also having trauma to the maxillary anterior teeth is more in men. this cyst was more common in the third decade, like the study done by regezi. and this result is similar to the studies of souza., (20.1%) and prockt., (22.2%) but is different from the studies of mosqueda., (33%), ochsenius., (18.5%), jones., (18.1%), grossmann. the reason for a greater prevalence of this cyst in comparison with many other studies can be related to the fact that many patients postpone the extraction of their impact teeth until it becomes annoying. this reason is less common in developed countries, because of regular examinations, which are routinely done every 6 months. like the studies from chile, brazil and west malaysia dentigerous cyst was mostly seen in the second decade of life. also, the most prevalent sites were the lower posterior zone and upper anterior zone. the reason for this finding, according to the study by jones., and prockt., okc was the third most prevalent case, with a frequency of 22.58% which is similar to that reported by mosqueda., in mexico (21.49%) but is different from the study done by ochsenius in chile (14.3%), jones., in uk also, the peak incidence of okc was found between the second and third decades of life which is similar to the study done by grossmann., but is different from others. residual cyst was the fourth more frequent odontogenic cyst, constituting 12.98% of all cysts. this rate is fairly higher than many studies but is lower than the study from west malaysia (21.4%). as residual cysts are those which remain in the jaw after the carious tooth has been extracted and these cysts were found to be high in our study, it is very important to care about the surgical procedures according to bhaskar 's recommendation. in our study, like most studies, this cyst was more common in males. the most common region for residual cyst was the lower posterior zone which is different from the other studies that present maxilla as the most common place for residual cyst. also, residual cyst was more common in the fifth decade of life which is similar to the study from chile and is different from the study from brazil and west malaysia. odontogenic cysts are relatively frequent jaw lesions (22.43%), of which radicular cyst was the most common cyst. in general, the prevalence rates in our study are similar to the studies from other geographic parts of the world but with a lower incidence of inflammatory cysts, higher prevalence of dentigerous cysts and residual cysts and also mandibular predominance for residual cysts. so, further studies should be done specially in iran, to prepare regional guidelines for our dentists, to have an early and correct diagnosis. | background : odontogenic cysts are relatively common lesions which can cause different complications. as demographic information is lacking in iran and specially in isfahan, the aim of this study was to determine the prevalence of odontogenic cysts according to age, gender and affected area among patients referring to the oral pathology department of the dental school of isfahan university of medical sciences (iran) over a 23-year period.materials and methods : a total of 7412 diagnosed lesions recorded in the oral pathology department archives of isfahan dental school between 1988 and 2010 were reevaluated, then odontogenic cysts were separated through reviewing microscopic slides according to the 2005 world health organization classification and variables such as age, gender, the infected jaw, and its specific region were obtained by spss version 16.0 from the recorded database.results:21.62% of the lesions were odontogenic cysts, of which 48.72% were inflammatory and 51.28% were developmental cysts. these cysts were more common in the mandible. the mean age of patients was 29.53 16.1. male to female ratio was 1.31:1. the four most frequent odontogenic cysts were radicular cysts (35.12%), dentigerous cysts (25.77%), odontogenic keratocysts (22.58%) and residual cysts (12.98%).conclusion : odontogenic cysts are fairly frequent jaw lesions (21.62%), of which radicular cyst was the most common cyst. the four most common lesions constituted a sum of 96.45% of the total. in general, the prevalence rates in our study are similar to the studies from other geographic parts of the world but with a lower incidence of inflammatory cysts, higher prevalence of dentigerous cysts and residual cysts and also mandibular predominance for residual cysts. |
photocuring is the key technique for the preparation of films and coatings as it offers a broad and economic application spectrum for industry. during the curing process it absorbs energy from a photon either in a direct or an indirect process, transferring it into chemical energy. after the excitation process a reactive radical can be formed, which is able to induce the polymerization of a wide range of monomers. among the bimolecular type ii pis for radical photopolymerization, excitable chromophores like benzophenone in combination with tertiary amines as co - initiators are commonly applied. the ketone amine interactions proved to be highly efficient concerning radical formation due to electron transfer. the efficiency of the photochemical process depends on the rate constant of electron and proton transfer as well as the reactivity of the -amino alkyl radical toward reactive double bonds and quenching by side reactions. a wide range of co - thiols and si h groups are also described as efficient co - initiators in the literature, but only limited storage stability is given for such formulations. unfortunately, the efficiency of this system is usually reduced by back electron transfer (bet), the solvent cage effect, and limited diffusion capability in highly viscous formulations or water - based systems. molecular oxygen from the atmosphere easily inhibits the polymerization process. consequently, pi systems, which are unperturbed by oxygen are preferred because it is unfavorable to work under a nitrogen atmosphere. using n - phenylglycine as co - initiator for benzophenone, the decarboxylation step delivers enough co2 to displace o2 from the curing material. recently, a very efficient class of pis has been created by covalently linking benzophenone and n - phenylglycine, thus keeping the co - initiator in close proximity. also, oxime esters might produce co2 after cleavage of the n o bond and decarboxylation of the acyloxy radical. accordingly, this type of functional group in combination with photosensitizers was considered as an alternative concept for type ii initiator systems. several investigations on the photolysis of o - acyl oximes in the presence of photosensitizers can be found in the literature. yoshida. described the nature of the triplet states and the subsequent photochemistry of aromatic o - acyl oximes. they postulated a requirement of close triplet state energies of the oximes (et = 289305 kj mol) and their ketone - based sensitizers, displaying a character. moreover, the photolysis of aldoxime esters in presence of a sensitizer like 4-methoxyacetophenone was investigated by mccarroll and walton, performing epr measurements and radical trapping experiments, thus presenting a new class of radical precursors for spectroscopic studies (scheme 1). furthermore, such sensitized o - acyloximes were tested in a patent, but unfortunately no exact data on their performance was given. structure related -keto - o - acyloximes have found specialized industrial applications, such as color filter resists, however, thermal stability of such compounds is always crucial. very recently, we have investigated some benzaldoxime esters in combination with 4-methylbenzophenone as sensitizer and have found surprisingly high photoreactivity in photo - dsc experiments. all reagents were purchased from sigma - aldrich and were used without further purification. hdda and 2-hydroxy-2-methyl-1-phenyl-1-propanone (darocur 1173 ; d1173) were received as a gift from ivoclar vivadent and basf, respectively. nanosecond transient absorption spectroscopy was carried out using the third harmonic (355 nm) of a q - switched nd : yag laser (spectra - physics lab-150) with a pulse duration of 8 ns. transient absorbances were measured in a right - angle setup using a cell holder with incorporated rectangular apertures defining a reaction volume of dimensions 0.17 cm (height), 0.32 cm (width), and 0.13 cm (depth) within the cell. pulse energies between 0.1 and 4 mj / pulse were used, the typical value for the measurement of transient spectra being 2 mj / pulse. pulse energies were measured using a ballistic calorimeter (raycon - wec 730). time - resolved continuous - wave electron paramagnetic resonance (cw tr - epr) experiments were performed using a frequency - tripled nd : yag laser (continuum surelite ii, 20 hz repetition rate ; 355 nm ; ca. 10 mj / pulse ; ca. 10 ns), a bruker esp 300e x - band spectrometer (unmodulated static magnetic field), and a lecroy 9400 dual 125 mhz digital oscilloscope. the tr - epr spectrum is obtained by scanning the desired magnetic field range recording the accumulated (usually 50100 accumulations) epr time responses to the incident laser pulses at a given static magnetic field. the system is controlled using a program developed, kindly provided and maintained by dr. argon - saturated solutions were pumped through a quartz tube (inner diameter 2 mm, flow ca. the epr spectra were simulated using the easyspin package for matlab (version 3.1.7). the hyperfine coupling constants (hfcs) of the free radicals were calculated using the gaussian03 package. all calculations (geometry optimizations and single point calculations) were conducted at the b3lyp level of theory with the basis set tzvp. photo - cidnp experiments were performed on a 200 mhz bruker avance dpx spectrometer. irradiation was carried out using a frequency - tripled spectra - physics nd : yag indi laser (355 nm, ca 10 ns). the following pulse sequence was used : presaturation laser flash30 rf detection pulse (2.2 s)free induction decay. the concentrations of the initiators were typically 0.01 m in d3-acetonitrile or d6-benzene, deaerated by bubbling argon through the solution. dsc photocuring experiments were carried out in hdda with 0.12 m of each component (2 wt % of 1) under a nitrogen atmosphere, using an exfo omnicure 2001 uv lamp with a 200500 nm filter and a netzsch dsc 204 f1 phoenix with autosampler. nanosecond transient absorption spectroscopy of solutions of benzophenone and the co - initiating o - acyloximes 1 and 2 as well as solutions of the covalently bound o - acyloxime 4 was used to gain information on the early photochemical steps. in case of the co - initiating oximes, the experiments were performed in deaerated mecn in equimolar (5 10 and 1 10 m) and different concentrations of sensitizer bp (1 10 m) and oxime (1 10 m), respectively. the irradiation wavelength (355 nm) exclusively excites benzophenone chromophores into the n, state. upon irradiation of solutions bp/1 and bp/2, as expected, the first transient appearing at the nanosecond time scale was the characteristic benzophenone triplet triplet absorption around 520 nm. at a longer time scale, however, the microsecond - range lifetimes of these transients suggested that they originated from radical - type precursors. the degradation kinetics of the benzophenone triplet (bp) in the conducted experiments under variation of sensitizer and co - initiating oxime concentrations gave no indication of ground - state complex formation. regarding transients originating from bp, no traces of benzophenone ketyl radicals or radical anions could be detected. because of the lack of product species originating from h abstraction reactions or electron transfer processes, the sensitization presumably proceeds via an efficient energy transfer. in contrast to the co - initiating systems bp/1 and bp/2, no local triplet state of the benzophenone moiety was detectable in the photolysis of covalently bound benzophenone o - acyloxime 4. here the sensitization process is successfully shifted from a diffusion - controlled, bimolecular process to an intramolecular energy transfer due to the spatial arrangement of the chromophore system and the oxime moiety. as a result of this fundamental change in the sensitization mechanism, the triplet lifetime is shortened to an extent (< 5 ns) that is no longer directly assessable by the time resolution of our laser flash photolysis setup. nevertheless, other transient absorption bands on a longer time scale remained completely identical. in regard to possible primary cleavage products in the photolysis of the co - initiating o - acyloxime 1, a transient subsequent to triplet states on the nanosecond time scale obviously originates from the triplet bp. the visible spectrum of this transient (6) exhibited a slow but continuous progress of absorption in minor intensity from below 550 nm up to and above 800 nm, resembling the absorption of the benzoyloxyl radical obtained by photolysis of dibenzoyl peroxide. in case of the oxime 2, which should produce a less stable alkoyloxyl radical, an analogue transient to 6 the degradation of the triplet bp at 530 nm and the buildup of the absorption of 6 at 830 nm in the photolysis of o - acyloxime 1 are illustrated in figure 2. the kinetic congruence between both traces is a strong indication that the benzophenone triplet bp is the precursor of the benzoyloxyl radical 6. temporal absorbance change of bp at 530 nm and 6 at 830 nm upon 355 nm laser flash photolysis of an equimolar solution of benzophenone and the o - acyloxime 1 in mecn (1 10 m). unfortunately, 6 displays a low extinction coefficient in the accessible wavelength range, and related values given in the literature vary significantly. nevertheless, the yield of the benzoyloxyl radical 6 was determined as the product 830 (6) in an equimolar solution of 1 and benzophenone in mecn (1 10 m). the results are shown in figure 3 in the form of the absorbance of bp at 530 nm and 6 at 830 nm, versus the energy of the laser pulse. absorption of bp at 530 nm obtained at 20 ns and 6 at 830 nm at 50 ns after 355 nm laser flash photolysis of an equimolar solution of benzophenone and the o - acyloxime 1 in mecn (1 10 m) as a function of laser pulse energy. the dependence determined for both the yield of triplet benzophenone bp and benzoyloxyl radical 6 is linear. the value of the product 830 (6) in mecn was found to be 200 m cm. additionally, an important conclusion that can be drawn from this experiment is that the formation process is purely monophotonic. in the photo - dsc experiments the co - initiating oximes 1 and 2 displayed a higher activity as pis compared to the covalently bound o - acyloxime 4. therefore, two different conclusions are possible : pi activity of 4 is reduced due to (1) a reduction of quantum yield for the cleavage or (2) a less reactive initiating species produced. in nanosecond transient absorption spectroscopy, the covalently bound o - acyloxime 4 yields a transient, which is completely congruent to the benzoyloxyl radical 6 but shows accelerated buildup kinetics. apart from the differences in sensitization, 4 follows an analogue photodegradation chain as 1. however, in comparison to the co - initiating oxime 1, the product 830 thus, the spatial arrangement of the benzophenone and oxime moieties in the structure of 4 causes a reduction in radical quantum yield in comparison to the co - initiating system. it must be assumed that the benzoyloxyl radical 6 is produced by a homolytic scission of the n o bond upon photolysis of 4 and 1. consequently, this type of photodegradation should result in the formation of an iminyl radical. nevertheless, no transient absorption in the measured wavelength range (300840 nm) could be assigned to a primary formed iminyl radical. since iminyl radicals are rarely reported in the literature as transients in laser flash photolysis, it can be reasonably argued that this species shows no or an insufficient absorbance for a detection in the applied analytical setting. apart from primary photolysis products, secondary radicals appear as subsequent transients at the nanosecond time scale in the photolysis of all o - acyloxime pis. these transients possess absorptions between 350 and 500 nm and resemble adducts of benzoyloxyl radicals to aromatic rings as described in the literature. the degradation of the benzoyloxyl radical 6 at 830 nm and the buildup of one of these transients (t1) at 390 nm in the photolysis of o - acyloxime 1 are illustrated in figure 4. the kinetic resemblance between the traces is another strong indication that the benzoyloxyl radical 6 is the precursor of the secondary adduct t1 (see scheme 2). temporal absorbance change of bp and t1 at 390 nm and 6 at 830 nm upon 355 nm laser flash photolysis of an equimolar solution of benzophenone and the o - acyloxime 1 in mecn (1 10 m). the decay of the transient 6, as shown in figure 4, proceeded with a first - order rate constant k1 = 4 10 s. this rate has to be regarded as the product of a superposition of two well - known concurrent reactions : the first - order decarboxylation process after escape from the solvent cage and the pseudo - first - order addition to aromatic structures of the photolysis solution. the trace of t1 in figure 4 is partially distorted due to a spectral overlap by at least a second, similar benzoyloxyl radical adduct t2 which exhibits different degradation kinetics. in contrast to t1, an adduct transient which resembles t2 was also detected in the photolysis of o - acyloxime 4. in the case of the covalently bound o - acyloxime, the congruence between the degradation of the benzoyloxyl radical and the buildup kinetics of t2 could be more easily studied since no overlap with a triplet spectrum occurs. in the photolysis of the co - initiating o - acyloxime 2, which produces an alkoyloxyl radical, the relative absorbance of transients comparable to t1 or t2 is significantly lower. this is the logical consequence of an acceleration of the concurrent reaction, the decarboxylation of the less stable alkoyloxyl radical. to obtain insight into the early stages of polymerizations, continuous - wave tr - epr and h via epr one is able to establish the radicals formed within the first 50 ns after irradiation, whereas using cidnp one can gain information about the products formed via the primary radical pair. as the general model, the system bp/1 was investigated by both tr - epr and h cidnp. additionally, we present h cidnp results for bp/2, bp/3, and 4. upon irradiation of a mixture of bp (10 mm) and 1 (10 mm) in acetonitrile in an epr spectrometer, employing a 355 nm pulsed light source, the time - resolved epr spectrum shown in figure 5 (lower panel) is recorded. all signals appear in absorption with similar signal intensities in the low- and high - field portions of the spectrum, indicating that the radicals are formed via the triplet mechanism. the nitrogen - centered radical 5 dominates the spectrum and is characterized by two triplets centered at 338.2 mt. the benzoyloxyl radical 6 gives rise to a broad peak at 336.8 mt, with a high g value characteristic for oxygen - centered radicals. additional signals stemming from phenyl radical 7 in the center of the spectrum are shown in figure 6. from the associated time traces it can be inferred that 6 produces 7 via decarboxylation within about 500 ns. the extracted hyperfine coupling constants (hfcs) for 7 are in agreement with published data and calculations (see figure 8). no signals stemming from (reduced) bp or related radicals could be identified, again indicating that bp only acts as a sensitizer. tr - epr spectrum of a solution of 1 (10 mm) and bp (10 mm) in acetonitrile in the absence (lower panel) and presence (upper panel) of 0.1 m butyl acrylate. the upmost panel represents the spectrum at the time delay (150 ns) indicated by the dashed red line in the 3d spectrum, showing the nitrogen - centered radical (and its simulation) as well as the benzoyloxyl radical. zoom - in on the central part of the tr - epr spectrum shown in figure 5 in the absence of butyl acrylate. for better visibility of the low intensity radical 7 signals the color map was cut at values far below the maximum of the radical 6 signal maximum. the blue and green spectra and time traces are cuts along the field and time axis at values indicated by the colored dashed lines. to study the time profiles of the addition of radicals to monomers, butyl acrylate (ba) was added to the bp/1 system. upon this addition (epr spectrum in figure 5, upper panel) one can immediately see that the time evolution of radicals 5 and 6 is hardly affected. but a change in the signal pattern of the central part of the spectrum can be clearly discerned (figure 7). in the presence of 0.1 m ba, 7 vanishes and gives rise to a new signal, which can be assigned to the addition product of phenyl radical 7 to ba, 7-ba. no direct hyperfine data for the adduct 7-ba could be found in the literature, but epr data for the addition of phenyl radicals to methyl acrylate and benzoyl radicals to ba(38) as well as theoretical calculations are in agreement with this assignment. thus, we were able to establish the primary radicals formed directly upon photolysis of 1 by tr - epr. by the addition of ba it could be shown that there is no reactivity of the nitrogen - centered iminyl radical 5 toward the monomer in the observed time scale. additionally decarboxylation of 6 toward 7 is fast enough that no addition of 6 to ba could be discerned from the spectra. the addition of phenyl radicals 7 to ba is fast enough to repress the epr signal of 7 (figure 7). zoom - in on the central part of the tr - epr spectrum shown in figure 5 in the presence of butyl acrylate (0.1 m). the 2d spectrum and time traces are obtained by cuts along the axis at the indicated colored dashed lines. initially experiments irradiating only the benzaldoxime esters 1, 2, and 3 were performed. except for some small polarized signals of parent compounds, no reaction products could be discerned, reflecting the necessity of a photosensitizer. as the reference experiment, the mixture benzophenone bp / benzaldoxime benzoate 1 was photolyzed inside the nmr spectrometer. the nmr spectrum before irradiation (see figure 9a) shows a distinct signal for the aldoxime hydrogen at = 8.70 ppm. the rest of the spectrum is made up of two separated groups in the aromatic region the one with the higher shift (= 8.098.15 ppm) stemming from the protons of the benzoate moiety. the signals of bp as well as the other aromatic hydrogens of 1 make up the rest of the spectrum. it is caused by an interaction of the electron and nuclear spin in the radical pair. therefore, the determining factors to the effect are the sign and magnitude of the radicals magnetic properties (g value, hyperfine, and j coupling) as well as the initial spin state and the reaction pathway (cage or the resulting cidnp signals can easily be rationalized employing kaptein s rules. immediately after irradiation using a single nd : yag laser pulse, a cidnp spectrum was recorded (see figure 9b). it can be assigned as follows : the emissive peak at = 8.70 ppm corresponds to the reformation of parent compound 1. a second emissive peak can be found at = 8.03 ppm, which is assigned to the z - isomer 1i of the parent compound (e - isomer), also generated by in cage recombination. the shift difference of = 0.67 ppm is characteristic for the two isomers. of the signals in absorption, it is generated by the decarboxylation of benzoyloxyl radical 6 to phenyl radical 7 and followed by hydrogen transfer from iminyl radical 5, the most likely hydrogen donor (see scheme 3). benzonitril 8, the byproduct of this reaction, is not distinguishable owing to its aromatic hydrogens stemming from iminyl radical 5 where they only had small hfcs, thus leading to low polarizations. the two absorptive signals at = 8.55 and 8.42 ppm can be assigned to the e- and z - isomers of n - benzylideneaniline 11 and 12, respectively. those are formed from the recombination of phenyl radical 7 and iminyl radical 5. the e - isomer displays higher signal intensity in addition, the e - isomer is thermodynamically favored leading to thermal isomerization of the z - isomer. there are also another few possibilities of recombination, which are indicated in scheme 3. the recombination of two phenyl radicals 7 leads to biphenyl 14 which can be accommodated by the occurrence of small signals at around = 7.4 ppm. the low intensity is expected because the phenyl ring does not carry a lot of polarization in addition to 14 being an escape product. recombination of two radicals 6 is not expected because of the fast decarboxylation reaction. radical 5 can also abstract a hydrogen (most likely from another 5) and form benzaldimine 10. the cidnp spectra of 1, 2, and 3 are all expected to give identical follow - up products via radical 5. this is corroborated by identical peaks at = 7.89 and 8.30 ppm in all three spectra. (b) h cidnp spectrum obtained immediately after the laser pulse (355 nm). benzaldoxime acetate 2 shows a similar behavior as 1, except for the differing carbon - centered radical fragment. to avoid a signal overlap appearing in d3-acetonitrile, the reaction is compatible in both solvents. in the nmr spectrum (figure 10a) of the mixture bp/2 there are only two identifiable singlet peaks, namely the signal of the aldoxime hydrogen at = 7.81 ppm and the singlet of the methyl end group at = 1.73 ppm. the remaining signals stem from the aromatic hydrogens of both compounds, which are not individually attributable. the solvent signal is visible at = 7.16 ppm. upon irradiation of the solution (nd : yag laser - single pulse) there are more signals in the cindp spectrum (figure 10b) than in the case of 1. there are signals in emission at = 7.81 and 7.21 ppm, which stem from recombination of the primary radicals 5 and 15 to the parent compound 2 and its isomer 2i, respectively (= 0.60 ppm). the acetoyl radical 15 resulting from triplet cleavage of 2 undergoes decarboxylation generating methyl radical 16. the first one is hydrogen transfer from radical 5, which leads to methane 19 and can be found in absorption at = 0.15 ppm. as for 1, benzonitrile 8 is a byproduct but is not clearly distinguishable in the spectrum. another absorptive signal in the aliphatic region is found at = 0.79 ppm and can be assigned to the escape reaction of two methyl radicals forming ethane 20. moreover, the recombination of radicals 5 and 16 leads to the e- and z - isomer of n - benzylidenemethanamine, 17 and 18, respectively. the corresponding signals are two quadruplets at = 8.48 and 7.89 ppm as well as two doublets at = 3.35 and 3.27 ppm. because these signals stem from coupled polarized protons, they both show the multiplet effect a / e (first absorption, then emission). this behavior, also described in kaptein s rules, is easily visible for the two methyl doublets. for the two iminyl quadruplets there is also overlying enhanced absorption ; thus, only the latter peaks are visible in emission. the two isomers could be assigned using the j coupling constant, which is known for the e - isomer (j = 1.6 hz). therefore, the signals at = 7.89 and 3.27 ppm belong to 17 (j = 1.6 hz) and the signals at = 8.48 and 3.35 ppm to 18 (j = 2.2 hz). two other signals at = 8.31 and 7.82 ppm are assigned to substances 9 and 10 in analogy to 1 (see above). the slightly different shift values are caused by the different solvent (d6-benzene vs d3-acetonitrile). (b) h cidnp spectrum obtained immediately after the laser pulse (355 nm). but, contrary to the other substances investigated in this work, 3 features an end group including a reactive vinyl moiety, causing additional follow - up products and polarization effects. the h nmr spectrum of bp/3 shows the aldoxime hydrogen signal at = 8.56 ppm, and the protons of the aromatic ring are concentrated in the region = 7.447.81 ppm. further features of the nmr spectrum are two multiplets at = 5.75 and 6.19 ppm assigned to the e- and z - hydrogen of the vinyl bond, respectively. additionally a multiplet stemming from the methyl group can be seen at = 2.01 ppm. the h cidnp spectrum shows typical features of recombination reactions of the initial radical pair of 5 and 21, leading to polarized signals of parent 3 at = 8.56 ppm and of isomer 3i at = 7.93 ppm (= 0.63 ppm). also substances 9 and 10 appear in the spectrum as two polarized doublets at = 7.89 and 8.30 ppm. the iminyl hydrogens of products 23 and 24 stemming from recombination of radicals 5 and propen-2-yl radical 22 after decarboxylation can be found at = 8.32 and 8.11 ppm, respectively. there are some additional signals visible in this region, which are probably generated by additional recombination reactions of 5. all the other fragmentation products lead to compounds containing one or more double bonds generating a number of polarized multiplets for vinyl and aliphatic hydrogens. for those it is impossible to discern the single components, owing to several overlapping resonances (see supporting information). the unimolecular initiator 4 shows similar behavior and spectra as the bimolecular type bp/1. the h nmr spectrum (see figure 11a) shows one isolated resonance signal at = 8.80 ppm stemming from the aldoxime hydrogen. the remaining protons of the molecule are attached to aromatic rings and occur as one block of signals (= 7.528.15 ppm). upon irradiation, the initiator 4 undergoes cleavage of the n o bond analogous to 1 (see laser flash photolysis section). the most prominent signal in the h cidnp spectrum (figure 11b) is benzene 13 at = 7.37 ppm in absorption generated via decarboxylation of benzoyloxyl radical 6. the recombination isomer of 4 (emissive signal at = 8.80 ppm), 4i, can be found in emission at = 8.15 ppm. the shift difference of = 0.65 ppm is in accordance with the isomerization of the other three molecules 13. the two remaining absorptive signals are assigned to the recombination reactions of iminyl radical 27 and benzyl radical 7 after decarboxylation. in the same way as for the bimolecular system bp/1, the two e- and z - isomers (31 and 32, respectively) can be found at = 8.67 and 8.54 ppm, 31 showing the higher intensity. furthermore, signals stemming from biphenyl 14 can be seen at low intensity at the base of the benzene signal. there are also products 2830, analogous to 810 formed from the iminyl radical 5 stemming from 1. the 4-cyanobenzophenone 28 did not show polarization in the cidnp spectrum, but the peaks at = 8.05 and 8.42 ppm are tentatively assigned to 29 and 30. (b) h cidnp spectrum obtained immediately after the laser pulse (355 nm). to study the reactivity of the generated radicals toward monomers, cidnp experiments were performed in the presence of two acrylates, butyl acrylate (ba) and 3,3-dimethyl-2-methylenebutanoate (t - bam), analogous to the tr - epr measurements. the bulky tert - butyl substituent of t - bam hampers the polymerization process and thus does not lead to a propagating polymer chain. this is desired, because it reduces the number of follow - up reactions and therefore the influence of the growing chain on the studied reactions can be followed. it can be seen in figure 12 that the addition of the monomer ba leads to an easily identifiable effect in the cidnp spectrum. the benzene signal intensity is reduced by about 60%. a similar reduction of intensity can be seen for the two products 11 and 12, which are recombination products formed after decarboxylation. in contrast, the two emission peaks of the parent compound and its isomer are not affected by the addition of quencher (the monomer). this reveals that the formation of cage products is hardly influenced by the polymerization process. the clearly diminished intensity of the peaks corresponding to escape products 1113 shows that phenyl radical 7 adds to the acrylates. consequently all products formed at longer time scales from 7 are outcompeted by the monomer, which is present at much higher concentration compared to photoinitiator radicals. there was no effect seen on the two minor peaks at = 7.89 and 8.30 ppm (compare above), which are attributed to compounds 9 and 10. therefore, the cidnp spectra reflect that the iminyl radical is not reactive toward the acrylate. this behavior of the two radicals 5 and 6 is in agreement with the tr - epr results above. zoom - in of the h cindp spectrum of the initiator system bp/1 and the same with the addition of butyl acrylate (spectrum horizontally shifted). the same experiment performed with t - bam gave comparable relative intensities of the different signals. furthermore, the reaction was performed with styrene as monomer, but the cidnp spectra only gave very small signals compared to noise. this is attributed to the ability of styrene to act as a quencher of the bp triplet while the oxime benzoate itself is not able to efficiently generate radicals under irradiation. preliminary experiments have indicated that 4-methyl benzophenone a is an efficient sensitizer for 1. to establish the range of suitable sensitizers, a photo - dsc provides insights into the overall performance of polymerizing systems. here the parameter tmax, the time needed to reach the maximum heat of polymerization, comprises effects which can be traced back to the efficiency of the photoinitiator. a comparison of tmax values for selected sensitizer / initiator combinations for the polymerization of hdda (1,6-hexanediol diacrylate) is shown in figure 14. sensitizer c does not reveal any effect, owing to its rather low triplet energy of 173 kj mol. the type ii initiating system, a and triethanolamine (tea), leads to tmax = 10 s, and even a itself shows activity, but tmax amounts to 26 s. this can be traced back to the hydrogen - abstraction ability of the corresponding excited triplet state. however, when sensitizers a and b (itx, 2-isopropylthioxanthone) are utilized in combination with 1, tmax reaches the level of reference systems a / tea and darocur 1173 (d1173). similar results were achieved for benzil and 2-ethylanthraquinone as sensitizer (data not shown). photo - dsc data for oxime ester 1 with equimolar amounts of the sensitizers a and b as well as reference pi systems a / tea, a, and d1173. in this study we have shown that benzaldoximes like o - benzoyl benzaldoxime ester 1 act as highly reactive type ii photoinitiators when combined with an appropriate sensitizer. reactivities similar to classical monomolecular compounds are possible, with the advantage that the spectral range of sensitivity can be easily tuned. it could be established that the radical initiation proceeds via triplet energy transfer from the sensitizer, followed by cleavage of the oxime n o bond. in first instance the latter radical decarboxylates to give a carbon - centered radical, which induces polymerization. on the other hand, the iminyl radical does not contribute to the initiation at the observed time scale. trans photoisomerization at the c = n bond of the oxime moiety is observed in the cidnp experiments. in summary, the benzaldoxime - based initiators reveal efficient systems, which circumvent the complication of back electron transfer in type ii systems. | typical bimolecular photoinitiators (pis) for radical polymerization of acrylates show only poor photoreactivity because of the undesired effect of back electron transfer. to overcome this limitation, pis consisting of a benzaldoxime ester and various sensitizers based on aromatic ketones were introduced. the core of the photoinduced reactivity was established by laser flash photolysis, photo - cidnp, and epr experiments at short time scales. according to these results, the primarily formed iminyl radicals are not particularly active. the polymerization is predominantly initiated by c - centered radicals. photo - dsc experiments show reactivities comparable to that of classical monomolecular type i pis like darocur 1173. |
samples of vegetation affected by the typical fusarium wilt were collected from several areas by cutting the infected part of the stem from the zucchini plants. the infected tissues were surface - sterilized with a 1% naocl solution for 1min and rinsed 2~3 times with sterilized distilled water. after drying, we cultured the samples in 90-mm petri dishes containing potato dextrose agar (difco, sparks, md, usa) in the dark at 25 for 1 wk. kacc47262) and used for the pathogenicity test and molecular analysis. for the pathogenicity test, 10 zucchini seedlings (cv. taeyang) were inoculated with the pathogen by dipping the roots into a conidial suspension (2 10 conidia / ml). another 10 seedlings serving as controls were processed similarly by dipping the roots into sterilized distilled water. the plants were retained in a humid chamber for the first 48 hr and then maintained in the greenhouse with 80% relative humidity at 25 2. three days after inoculation, wilt symptoms started to develop in the plants. this led to etiolation and vascular discoloration seven days post inoculation ; these symptoms were identical to those originally observed in the plastic greenhouse. for morphological observation, a small piece of living tissue containing fungal structures was mounted in a drop of water. bright - field and differential - interference contrast light microscopy (zeiss ax10 microscope ; zeiss, jena, germany) were used to observe the specimen. colonies on potato dextrose agar were 35 mm in diameter and pinkish - white ; they felted with cottony and aerial mycelia within a week (fig. 1f). in culture, microconidia formed abundantly on monophialides, while falcate macroconidia formed on (usually abundant) pale orange sporodochia. the macroconidia were short, falcate to almost straight, thin - walled, and usually threeseptate. generally, abundant microconidia were formed in false - heads on short monophialides on the hyphae and were hyaline, smooth, oval to ellipsoidal, aseptate, oneseptate, or very rarely two - septate, slightly constricted at the septa with a size range of 4~11 2.5~5.0 m (fig. differences in gene dna sequence have previously been used to support morphology - based identification of fusarium species. further, phylogenetic analysis of dna sequences has been used successfully to distinguish and evaluate the genetic relationship among closely related fusarium species. the dna sequences of the translation elongation factor 1 gene (tef) have been widely used for identification of fusarium species. to further confirm our tentative identification based on morphological characteristics, the complete internal transcribed spacer (its) region of ribosomal dna (rdna) and a partial sequence of tef were amplified using primers its1/its4 and ef-1/ef-2, respectively. the amplicons were separated by 1.5% agarose gel electrophoresis, followed by purification using a pcr purification kit (core - one ; core - bio, seoul, korea). reactions were sequenced using the bigdye terminator cycle sequencing kit (applied biosystems, foster city, ca, usa) and analyzed on an abi 3130 automated dna sequencer (applied biosystems). the identity of the isolates was established by comparing their its and tef sequences with those in the genbank database (national center for biotechnology information [ncbi ] us national institute of health, bethesda, md, usa ; http://www.ncbi.nlm.nih.gov/blast) and fusarium i d (http://isolate.fusariumdb.org/blast.php), respectively. phylogenetic analysis of its and tef was conducted by neighbor - joining methods using mega version 6.0, and the sequence distance was calculated based on the tamura - nei parameter model. bootstrap analysis, with 1,000 replications, was performed to determine the percentage support for each clade. the its and tef sequences from a representative isolate were deposited in genbank with the accession numbers kf372590 (535 bp) and kf372592 (679 bp). a blast search of the its sequence in genbank yielded 100% nucleotide identity with the f. oxysporum (kc577181) sequence ; in fusarium i d, the tef sequence was also identical (fd-01376). the phylogenetic trees generated using the neighbor - joining method grouped the three zucchini isolates, including jabres2 and jabres3, in the same clade (figs. 2 and 3). f. oxysporum - induced fusarium wilt in c. pepo has been reported worldwide, such as in mexico, poland, and greece. although there is a previous record of fusarium sp. on cucurbita sp., this is the first report of f. oxysporum causing fusarium wilt on zucchini in korea. because this plant is of great economic importance, this practice is one potential reason for the relatively rapid spread of these pathogens, which can also be transmitted via infected weeds or survive on decaying plant material in the soil as saprotrophic mycelia and chlamydospores. currently, the best control strategies against fusarium wilt in zucchini are crop rotation and soil disinfection. hence, there is an urgent need to develop chemical and ecofriendly control methods for reducing the crop damage caused by these fungal pathogens. | fusarium wilt of zucchini in jeonju, korea, was first noticed in may 2013. symptoms included wilting of the foliage, drying and withering of older leaves, and stunting of plants. infected plants eventually died during growth. based on morphological characteristics and phylogenetic analyses of the molecular markers (internal transcribed spacer rdna and translation elongation factor 1), the fungus was identified as fusarium oxysporum. pathogenicity of a representative isolate was demonstrated via artificial inoculation, and it satisfied koch 's postulates. to our knowledge, this is the first report of f. oxysporum causing wilt of zucchini in korea. |
the gastrointestinal tract is the most common site of extranodal non - hodgkin 's lymphoma (nhl) and the small bowel is considered the most commonly affected part of the gastrointestinal tract. lymphoma of the hepatobiliary system usually presents as secondary manifestation of systemic malignant lymphoma. however, primary malignant lymphomas arising from the hepatobiliary tree are extremely rare. a 71-year - old male patient with history of inflammatory bowel disease presented with progressive jaundice. on physical examination, laboratory evaluation confirmed cholestasis with the following findings : total bilirubin 86.6 mol / l (normal : < 26 mol / l), direct bilirubin 66 mol / l (normal < 7 mol / l), aspartate aminotransferase (ast) 95 u / l (normal : 035 u / l), alanine aminotransferase (alt) 77 u / l (normal : 336 u / l), and alkaline phosphatase 438 u / l (normal : 35100 the cancer antigen 19 - 9 (ca 19 - 9) was elevated with a value of 215 u / ml (normal : < 37 u / ml). serologic markers of hepatitis b and c were negative. mrcp and contrast - enhanced magnetic resonance imaging (mri) showed dilatation of the intrahepatic and extrahepatic bile ducts down to tight stenosis at the middle part of the common bile duct, measuring 2.3 cm and located almost 3.6 cm from the bifurcation of the common hepatic duct. at the area of stricture, there was circumferential mural thickening with intermediate signal intensity in t1- and t2-weighted images and homogeneous post - contrast enhancement [figures 1 and 2 ]. (a) magnetic resonance cholangiopancreatography (mrcp) coronal projection demonstrate 2.3 cm tight stricture at the mid - cbd (white arrows) with severe upstream dilatation. (b and c) non - contrast mri upper abdomen axial t1- and t2-weighted images show circumferential mural thickening at the area of maximum stenosis with intermediate signal intensity (black arrows). contrast - enhanced mri with axial post - contrast t1-weighted images at different levels : (a) at the level of the hepatic duct bifurcation, shows severe bilobar intrahepatic biliary dilatation (short white arrows) ; (b) at the level of the junction of the markedly dilated proximal cbd (curved white arrow) and the stenotic segment (straight white arrow) ; (c) at the level of mid - cbd stricture show that the lesion enhances homogeneously (white arrow) ; (d) at the level of distal cbd shows the normal caliber of the cbd within the pancreatic head (black arrow). no further diagnostic studies were arranged as the radiological, clinical, and laboratory features were indicative of cholangiocarcinoma. the surgical plan was to perform whipple 's operation and the head of the pancreas, duodenum, common bile duct (cbd), and gallbladder were resected. gross examination showed a firm mass measuring 2.2 2 1.4 cm surrounding the duct and the cut surface showed grayish - white, lobulated tissue markedly compressing the distal cbd and showed a slit - like opening. histopathologically, the mass was found to consist of lymphoid cell nodules surrounding and constricting the cbd. these nodules were composed of small cleaved lymphocytes (centrocytes) and larger lymphoid cells (centroblasts). the centroblasts counted more than 16 cells per high - power field [figure 3a and b ]. histological sections stained with hematoxylin and eosin (h and e) (a) low - power view, (25) shows nodules of lymphoid cells (white arrows) surrounding the common bile duct (dotted white arrows). (b) medium - power view, (200) immunochemical tests (c) shows the neoplastic lymphoid cells are positive for cd20 marker and (d) the cells are positive for cd10 marker. immunohistochemical staining showed the neoplastic cells were positive for cluster of differentiation 20 (cd20), cluster of differentiation 10 (cd10), and b cell lymphoma 6 (bcl6) markers [figure 3c and d ]. they were negative for cd3, cd5, b cell lymphoma 2 (bcl2), and multiple myeloma oncogene 1 (mum1). ki-67 (named after the location where it was discovered ; kiel university) was expressed by 70% of cells within the follicles and 10% outside the follicles. reviewing the english language medical literature on primary nhl originating from the bile duct, only 30 cases were found and most of them presented with jaundice and the most common subtype among these cases was diffuse large b - cell lymphoma (dlbcl). there is increasing incidence of nhl, which may be primarily due to a variety of factors, particularly the rising incidence of human immunodeficiency virus (hiv) infection. follicular lymphoma of the gastrointestinal tract is extremely rare, accounting for only 1% of all gastrointestinal nhls. among those cases reviewed by lee., three cases were follicular lymphoma, of which two were males aged 33 and 32 years and one was a female aged 53 years, with all of them having the lymphomatous infiltration affecting the bifurcation of the cbd with gross soft tissue masses [table 1 ]. while in our case, the lymphoma involved the middle part of the of the cbd without sizable soft tissue mass and was mainly seen as stenotic area. reported cases of primary follicular lymphoma of the common bile duct follicular lymphoma is considered to be an indolent lymphoma, but the clinical behavior of this lymphoma depends on the histologic grade and the extent of disease at presentation. with time, accurate pre - surgical diagnosis may alter the treatment choice, and chemotherapy should be the first choice for primary biliary lymphoma. surgery should play a role if an accurate preoperative diagnosis can not be made, and the involved lesions produce complications, such as bile duct stricture, that are not amenable to non - surgical therapies. also, failure of chemotherapy to eradicate localized disease is another situation where surgery may have a role. on the other hand, radiotherapy should be reserved for residual disease after primary chemotherapy, or to relieve symptoms of pain caused by the disease. correct pre - surgical diagnosis is quite difficult, but smooth surface of the stricture segment of the biliary tree seen by endoscopic retrograde cholangiopancreatography (ercp) or percutaneous transhepatic cholangiography (ptc) may indicate the extramural nature of the mass, and thus be suggestive of lymphoma. homogenous intensity in both pre- and post - contrast study at the stenotic site of bile duct is another suggestive feature of lymphoma. primary nhl is one of the rare differential diagnoses of cholangiocarcinoma and shows similar imaging findings. the clinical symptoms and signs, and the laboratory study are non - specific and sometimes misleading. pre - surgical diagnosis is quite challenging due to non - specific clinical manifestations, laboratory profile, and imaging findings. if an accurate diagnosis is made before surgical intervention, chemotherapy is the first choice of treatment. surgical resection should be reserved for those cases without a definite diagnosis, or for patients with complicating biliary obstruction, or who fail to respond to chemotherapy. | primary non - hodgkin 's lymphoma of the common bile duct is extremely rare. we present a case with history of inflammatory bowel disease and clinical manifestations of obstructive jaundice. abdominal magnetic resonance imaging with magnetic resonance cholangiopancreatography (mrcp) was done and demonstrated tight stricture at the middle part of common bile duct, and radiological findings were supportive of extra - hepatic cholangiocarcinoma. whipple 's procedure was performed and the case was histopathologically proven to be non - hodgkin 's lymphoma of follicular subtype involving the common bile duct. lymphoma of the hepatobiliary system is usually present as secondary manifestation of systemic malignant lymphoma. however, primary malignant lymphomas arising from the hepatobiliary tree are extremely rare. the radiological appearance of common bile duct lymphoma is very similar to cholangiocarcinoma, making preoperative diagnosis very difficult, as in our present case. we also compare the imaging findings of our case to those seen in reported cases of follicular lymphoma of the common bile duct. |
since the discovery of transposable elements (tes) in corn, dna sequencing has revealed that genomes of eukaryotic organisms are largely comprised of evolutionarily significant tes responsible for creation of considerable genetic diversity. the movement of transposable elements is either autonomous or dependent on other elements. classified according to mode of transposition, class i tes, or retrotransposons, are retroviral - type elements which may or may not have long terminal (direct) repeats (ltrs). movement of class i elements necessarily involves an rna inter - mediate in what can appropriately be termed replicative retrotransposons are transcribed into rna, and then the reverse transcriptase and integrase make and insert a dna copy at a secondary genomic location dna transposons, but it is important to note that class i retrotransposons are also comprised of dna except during transposition. transposases permit class ii transposable elements to move by a cut and paste footprints, telltale evidence for a previous dna transposon insertion, result from imprecise excision. class ii transposons characteristically have relatively short inverted repeat sequences near their termini and an excision site at each end recognized by the transposase. one of the first plant transposons mcclintock described, en1, or the maize suppressor - mutator (spm), is the original example of a cacta class, or superfamily, of transposons. cacta transposons were thought until recently to be found only in plants, but a similar element was discovered in the genome of schistosoma mansoni, the causative agent of schistosomiasis. evidence that retrotransposons account for much of the sugar beet (beta vulgaris l.) genome was first obtained by schmidt., who described (1) repetitive dna sequences in beta vulgaris similar to long interspersed nuclear elements (lines), a type of retrotransposon without ltrs, and (2) other repetitive dna sequences that resembled ltr retrotransposons of the ty1-copia class. vulmar1, a mariner - class transposon in beta vulgaris,, 3 909 bp in length, has 32 bp terminal inverted repeats and carries a single orf that encodes a transposase with a characteristic dde signature motif in a single exon. our interest in repetitive dna developed from our recent discovery of a number of ltrs and retrotransposon genes as well as a transposase gene in the region between two clusters of core plant genes on a 130 kb sugar beet bac [7, 8 ]. one gene cluster has an npr1-class disease resistance - potentiating gene adjacent to another core plant gene whose predicted product has high similarity to a heat shock factor protein. the other cluster consists of a signal peptide calmodulin - binding protein kinase gene located near a ck1-class protein kinase gene. in this communication, we report the discovery in beta vulgaris of coe1, a class ii dna transposase gene within putative ltrs and other features that are characteristic of class i ltr - retrotransposons. also, a genome scan of arabidopsis thaliana found a similar arrangement of transposon and retro - element genes on chromosome 4. the identification of a sugar beet genome - derived bacterial artificial chromosome (bac) carrying the npr1 disease resistance control gene has been previously described as well as the basic methods used for dna sequence analysis. in this study, analysis of the npr1 bac was performed using ltr_struc (http://www.genetics.uga.edu/retrolab/data/ltr_struc.html), repfind (http://zlab.bu.edu/repfind/form.html) analysis identified identical direct repeats. etandem (http://bioweb.pasteur.fr/seqanal/interfaces/etandem.html) and einverted (http://edukon.biologie.uni-konstanz.de/cgi-bin/emboss/einverted) were used to identify tandem and inverted repeats. emboss (http://emboss.sourceforge.net/) was also utilized to identify tandem repeats and inverted repeats. repeats were also found using ncbi 's blastprogram (http://www.ncbi.nlm.nih.gov/blast) by blast of a contig against itself using blastn. a sugar beet expressed sequence tag (est) database (http://genomics.msu.edu/sugarbeet/blast.html) was employed for nucleotide and protein blasts in order to identify possible functional gene expression. phylogenetic tree analysis was performed using mega 4 software (http://www.megasoftware.net/). a new multicopy direct tandem repeat (mdtr) within an intronic region within the coe1 transposase gene was identified by blast of the intron against the entire 130 kb bac and plotting a diagram of repeat versus dna base positions with respect to the bac. in order to find the starting points of the repeats, a window which was of a constant length less than one repeat was used in a sliding window technique. the first base used in this window was the putative starting point of the first repeat in the mdtr, as determined by the blast output. this window was blasted against the whole intron. if blast found any repeated dna using this template, the window was actually still within the repeated segment ; therefore, the starting base of the first repeat was deduced to be further towards the 5th end. the window was then moved a few bases in the 5th direction and the amended sequence was subjected to another blast. genbank accession ef101866 provides annotation of the 130 kb npr1-carrying bac derived from the sugar beet genome. conserved microsynteny of four core plant genes was observed with other eudicots (kuykendall., submitted). to scan the arabidopsis thaliana genome for a coe1-like element(s), each chromosome was individually subjected to ltr_struc analysis, and then each putative ltr - retrotransposon element was examined for both a dna transposase gene and a retrotransposon - like integrase or reverse transcriptase gene within its ltrs. blast and ltr_struc analyses performed on an annotated 130 kb npr1 gene - carrying sugar beet bac (genbank accession ef 101866) revealed the presence of coe1, which appears to be a new and unique composite of class i and class ii transposable elements. us h20 was the source of genomic dna for a sugar beet bacterial artificial chromosome (bac) library 8 from which a bac clone carrying the npr1 disease resistance control gene was recently identified. initially detected by ltr_struc analysis as a ltr - retrotransposon, coe1, defined as 14.5 kb by two putative 169 bp ltrs, has both an rvt2-domain reverse transcriptase pseudogene and another retroviral - like hypothetical gene. however, a dna transposase gene was found within its central region (figure 1). in addition to coe1, ltr_struc analysis performed on the 130-kb npr1 bac identified at least two other ltr - retrotransposons, briefly : (1) a copia or ty1-like retroelement, bvrtr1, which has a reverse transcriptase with active site yvddiif ; and (2) bvrtr2, a gypsy or ty3-like retroelement with active site fiddili in its conserved rvt1 domain (unpublished). precedence in the literature exists for similar yet considerably smaller repetitive dna sequences from sugar beet largely uncharacterized except for genomic distribution. the question then arises of whether the transposase gene of coe1 represents a class ii transposon inserted into a class i ltr - retrotransposon. this is probably how coe1 originated. in any case, coe1 has salient features of a class ii dna transposon within a class i retrotransposon (figure 1) as described below. the transposasegene of coe1 has a predicted protein product that is evidently a cacta superfamily dna transposase as deduced from the results of blast amino acid sequence alignments of the predicted protein product with en / spm - type dna transposons (figure 2). evidence for probable expression of coe1 's transposase gene, or at least a similar gene, were two sugar beet (expressed sequence tags)(ests) whose nucleotide sequence aligned by blast with coe1 's dna transposase gene : cf542726 (e = 0.0) and bq595658 (2e 96). the coe1 dna transposase gene is flanked by inverted repeats and a cacta sequence motif (figure 1). in addition to coe1, the prototypical cacta superfamily transposon en / spm of corn, tam1 of snapdragon and seven other tnp2-domain transposons, from various plant species, were compared using megalign. figure 2 shows the amino acid sequence alignments obtained with one of two conserved domains. cluster analysis of these data (figure 3), a neighbor joining analysis tree, indicates that the coe1 transposase falls into a group we designate as i subgroup a, with other plant tnp2-domain transposases from arabidopsis thaliana (bab09502), cleome spinosa (abd969441), and brassica rapa (baa85462.1). another subgroup of group i, b has en / spm of zea mays (aaa66266) and oryza sativa japonica np_001062816. in the amino acid sequence alignments of this particular conserved region (figure 2), two other dissimilar groups (ii and iii) had the remaining four dna transposases (figure 3). the en / spm - like superfamily of plant transposons, exemplified by barbara mcclintock 's suppressor / mutator transposons of corn, has been named cacta for the sequence motif recognized for excision. conservation is well established over the taxonomic divide between eudicots, and monocots. coe1 has a centrally located transposase gene, flanked downstream by a pair of imperfect 51 bp i14 inverted repeat sequences (94% match) separated by only 10 bp, and upstream by another repeated sequence, i24, that aligns with i14 with about 75% identity over 41 bp. these distal i24/i14 inverted repeats are each flanked by a cacta sequence motif. coe1 has a total of three orfs : a retroviral - like hypothetical gene orf1, the tnp2-domain transposase gene and an apparent rvt2-domain reverse transcriptase pseudogene, orf2. coe1 has putative long terminal repeats characteristic of ltr retrotransposons (figure 1). the 3.6% sequence divergence in the ltrs is consistent with possibility that the retroelement - like features of coe1 are no longer active. the 5th end of the coe1 positive strand has a pair of i13 inverted repeats 173 bp apart with 76% match over 190 bp and an internal cactataa sequence motif. i15 inverted repeats are found downstream of coe1 and these inverted repeats, near another cactataa sequence motif, are 52 bp apart with about 74% match over 51 bp. orf1, the first retroelement - like gene of coe1, encodes, in a single exon, a hypothetical protein for which no significant blast alignment is currently found. the predicted protein product of orf1 had initially produced a significant blast with a orf2 produced only a relatively weak nucleotide blast alignment (2e 25) to est bi643401. orf2 is apparently a pseudogene since a stop signal occurs in the sequence prior to that part of the sequence that would otherwise encode the active site of an rvt2 domain reverse transcriptase. although a sequencing error is possible, it is unlikely ; therefore, it is reasonable to deduce from the sequence data that orf2 of coe1 is a reverse transcriptase pseudogene. disregarding the stop signal, the predicted protein product of the rvt2-like gene of coe1 aligned well with other rvt2-domain gene products (figure 4). the coe1 rvt2 domain reverse transcriptase has a ty1-copia - like yvddiil active site which is most highly conserved in comparison with that of the medicago truncatula accession (figure 4). among the protein alignments performed, the hypothetical sugar beet rvt2-domain containing gene product also showed higher similarity with retrotransposon - type reverse transcriptase proteins encoded by genes in two subspecies (indica and japonica) of oryza sativa than with most others from a wide taxonomic range (figure 4). we recently performed a genome - wide scan or survey of the arabidopsis thaliana genome looking specifically for a composite dna transposon within ltr retrotransposon features similar to coe1, and a similar single tnp2-domain transposase gene flanked by putative ltrs and other retrotransposon - like features was identified, as described below. an arabidopsis thaliana dna transposase gene within putative ltrs and between ltr - retrotransposon genes the apparent ltr - retrotransposon is 9 078 bp and has 506 bp and 471 bp ltr regions with about 90% identity. this element was found on bac t26n6 from chromosome iv at 19.3 cm (accession af07243). the first orf (at4g04426) appears to be a highly degraded pseudogene of a reverse transcriptase, the central orf (at4g04430) is a cacta - class transposase gene, and the third orf (at4g04440) has a predicted protein product with an rvt2 reverse transcriptase domain similar to ty1-copia - like retrotransposons. alignment of a conserved region of the predicted product of the reverse transcriptase and a neighbor joining tree from cluster analysis (not shown) revealed a number of similar blast hits but none of these was very nearly identical to the predicted product of the arabidopsis element. the finding of a coe1-like element in arabidopsis supports the concept that coe1 in beta vulgaris is not a unique instance of a class ii transposon within a class i retrotransposon. regarding the subject of coe1 in beta vulgaris, it is noteworthy that within the transposase gene most of the dna sequence of an intron, when blast against itself yielded multipl, relatively small regions of imperfect dna sequence identity. these results, when graphed, showed a distinct pattern (figure 6) that suggested a whole series of multicopy direct tandem repeats (mdtrs). repeats of the apparent mdtr found by blast were of different lengths, but the first repeat in each set began at the same position, and the second repeat in each set ended at the same position. each successive set of repeats was shorter by about the same number of bases. each repeated dna sequence, aligned in megalign, gave the following consensus sequence : aggaacatgaaacccaaaaaagggct cgaaatggcttagtttctatcattttcattggctaagtgtattaaacttgcttagaatcata caaccatgtagtagaaagtttaaatgagtattttaggacttgcatgagccattagaactt gaaataggcatagaggtaggatta. an intron within coe1 's transposase gene was thus determined to have 15 complete 173 bp mdtr and a partial repeat at the 3 end. the sequence of this mdtr - carrying intron did not yield any megablast hits against the ncbi database. one or more individual repeat(s) could have transposed into the intron followed by duplication(s), or possibly the entire series of multicopy tandem direct repeats transposed into the intron altogether. the latter possibility may be supported by the observation that the last repeat is partial, presumably a deletion. how did coe1, or an arrangement of transposable genes that resembles coe1, originate ? a dna transposon could have moved into the middle of an ltr - retrotransposon. in other words, coe1 's central transposase gene, flanked by inverted repeats and cacta sequence motifs, could have transposed into an ltr - retrotransposon. the cactataa sequence motif, located 16.3 kb apart, outside the putative ltrs near large inverted repeats, could perhaps be extreme boundaries of coe1 instead of the two putative ltrs (figure 1) separated by 14.5 kb. it is possible that the intact larger and more complex composite transposon could move about using dna transposase. the ltrs are flanked by pairs of inverted repeat sequences that may be nonautonomous, miniature inverted [repeat ] sequence transposable elements (mites) (figure 1). mites, sometimes called class iii transposons, are dependent on dna transposase. the 8-mer sequence motif cactataa flanks the coe1 ltrs near or within relatively large inverted repeats that are perhaps mites. we hypothesize that originally a class i ltr - retrotransposon inserted between pairs of mites. then, a class ii dna transposon moved into the middle of the ltr - retrotransposon, and voila, a composite of class ii and class i elements resembling coe1, at least conceptually. to summarize, coe1 has a tnp2-domain transposase gene flanked by putative ltrs and between two retrotransposon - like genes, all within cactataas near or within pairs of inverted repeats (figure 1). one may ask, what possible selective advantage would a cacta dna transposon within an ltr retrotransposon have over a simple class i or class ii element alone ? a combination of class i and class ii features may offer little if any selective advantage, and thus such a composite might be unique. the finding of a similar gene arrangement in arabidopsis provides a second example of a composite class ii transposon within a class i retrotransposon. a change in the expression of a gene when placed under the control of another can confer a selective advantage on the host plant. increased fitness might also be characteristic of the host of a versatile element which can hypothetically transpose in either of two known mechanisms. such versatility could facilitate more rapid genetic change due both to transposition and to subsequent blockage of gene conversion. in conclusion, based on results of in silico analyses, coe1, found in the sugar beet genome, can be viewed as an incipient or emerging cacta super - family dna transposon amalgamated within an ltr - retrotransposon. a similar arrangement of a central tnp2-domain transposase gene within ltrs and between retrotransposon genes was found in chromosome 4 of arabidopsis thaliana by a genome scan. more dna sequencing of the sugar beet genome, either of larger stretches or of the complete genome, is likely to be needed in order to distinguish whether coe1 represents an evolutionarily significant gene arrangement or a mere coincidental merging of transposable genes. in either case, as far we know, the two examples shown here of a class ii dna transposon within a class i retrotransposn are novel. | we describe discovery in beta vulgaris l. of coe1, a dna transposase gene within putative long terminal repeats (ltrs), and other retrotransposon - like features including both a retroviral - like hypothetical gene and an rvt2-domain reverse transcriptase pseudogene. the central dna transposase gene encodes, in eight exons, a predicted 160-kda protein producing blast alignments with en / spm - type transposons. except for a stop signal, another orf encodes a ty1-copia - like reverse transcriptase with amino acid sequence domain yvddiil. outside apparent ltrs, an 8-mer nucleotide sequence motif cactataa, near or within inverted repeat sequences, is hypothetical extreme termini. a genome scan of arabidopsis thaliana found another example of a tnp2-domain transposase gene within an apparent ltr - retrotransposon on chromosome 4. |
acne inversa (formerly hidradenitis suppurativa) is a rare chronic and debilitating inflammatory skin disease. it forms inflammatory nodules, abscesses, fistulas, and scars in the apocrine - gland - bearing regions [1, 2 ]. the disease usually occurs after puberty and starts in the areas, where there is skin - to - skin contact, such as the armpits, the groins, sites under the breasts, or around the anus and genital organs. the latest concept of pathogenesis emphasizes that intrafollicular hyperkeratinization leading to the occlusion, dilation, and subsequent rupture of the follicles is the main cause of the inflammatory process. the hallmark of acne inversa is the formation of purulent fistulas and scarring [25 ]. smoking and obesity are both known as risk factors and are associated with a more severe course of the disease [6, 7 ]. first - line treatment consists of topical therapy with antibiotic and comedolytic compounds. in more advanced cases systemic antibiotics, anti - inflammatory agents, and retinoids (oral / topical) are recommended. in case of conservative management failure, surgical treatment of the involved areas should be considered. the authors report a case of a 45-year old male who presented with acne inversa in the inguinal, perineal, and scrotal areas. after unsatisfactory pharmacological treatment, a wide surgical excision of the affected skin was performed with good cosmetic and functional results. a male, 45 years of age, was admitted to the department of urology with the diagnosis of acne inversa located in genital organs and armpits. the first symptoms had occurred 10 years before and, despite repeated pharmacological treatments with antibiotics and retinoids, the disease gradually progressed and significantly limited the patient 's sexual life. on admission the lesions were estimated at the third degree according to the hurley scale (diffuse or broad involvement across a regional area with multiple interconnected sinus tracts and abscesses). the diagnosis was confirmed by a biopsy of the full - thickness skin and subcutaneous tissue from the scrotum. because of the unsatisfactory result of the previous treatment and advanced stage of penile and scrotal lesions, he was qualified for surgical treatment. the scrotal operation consisted of two stage excision of diseased skin and subcutaneous tissue of the entire scrotum with a margin of 1 cm and with subsequent covering of the testes using transfer of the lipocutaneous flap to close the defects in scrotum (fig. then a meshed split - thickness skin graft from the thigh was used to cover the defect (fig. the partial - thickness skin graft from thigh used to cover the penile skin defect. the outcome of the treatment was clinically evaluated by three independent observers within 2-years of follow - up. attention was paid to the cosmetic result, pain, and restoration of sexual activity as well as to the extent of the remaining acne inversa lesions that were compared using the images obtained before and after surgery. patient 's preoperative and postoperative quality of life was also estimated by using visual analog scale (vas). the time of each of the two first scrotal operations was 80 minutes and the third penile surgery lasted 130 minutes. the patient received ceftriaxone and metronidazole in doses of 2x1000 mg and 3x500 mg respectively for seven days post - operatively. there were no early or late surgical complications and the patient showed good tolerance to the treatment. the patient presented with a very good cosmetic and functional result that made it possible to resume a normal sexual lifestyle. his subjective score of quality of life increased nearly four times from 2.1 to 8.3 in vas. unfortunately, the patient still has some lesions in the armpits requiring periodic antibiotic therapy. the term hidradenitis suppurativa was first used in 1865 by french surgeon verneuil who linked the skin inflammation to the disease of apocrine sweat glands [7, 10 ]. recently a new term, acne inversa, has been proposed but has not yet gained widespread popularity. the name suggests that it is caused primarily by follicular occlusion with secondary inflammation of the apocrine glands. the initiating events are micro - tears in the hair follicle caused by mechanical friction in the intertriginous areas of the skin [11, 12 ]. these tears lead to discontinuity of the epithelial lining, inflammation subsequent to leakage of follicular content, and the formation of characteristic acne inversa lesions. recently much attention has also been given to the role of the sebaceous gland in the etiology of acne inversa [1320 ]. it may be possible that propensity to acne inversa is the consequence of the loss of one or more of several sebaceous gland functions : anti - bacterial, endocrine, or anti - inflammatory. so, the infection, most often caused by the colonization of staphylococcus aureus, may be a secondary event and therefore treatment focused on bacterial elimination alone can not be successful. it is for this reason that new topical therapies for acne inversa have been described. these new therapies are based on the administration of an anti - tnf drug such as infliximab [22, 23, 24 ]. photodynamic therapy (pdt) with 20% 5-aminolevulinic acid (ala) may also be a safe and effective option. advanced disease has a significant emotional impact on patients and leads to their isolation due to fear of stigmatization. sexual life is often disturbed if the lesions involve the sexual organs as in the presented case. unfortunately, many studies show that patients are often treated conservatively for very long periods time, even when the treatment is evidently ineffective, and that surgical intervention is not offered to them early enough [2730 ]. this is likely caused by the lack of knowledge about this disease, fear of surgical treatment, and the location of the lesions that make the surgical excision difficult. [2932 ]. on the otherhand, we know that non - effective treatment of acne inversa can lead to severe complications such as tissue contractures, systemic infections, anemia, amyloidosis, arthropathy, or even squamous cell carcinoma [33, 34 ]. in most cases, surgical treatment of recurrent and progressive disease should not be limited solely to skin incision and drainage. it may provide some pain relief, but is not curative and, on the contrary, often only leads to extensive scaring caused by poor wound healing. many authors emphasize that the complete excision of the involved skin areas together with subcutaneous tissue is the only curative treatment for acne inversa [1, 9, 35 ]. however, wide tissue excision poses the problem of excised skin replacement [1, 9, 35 ]. thus, many different kinds of skin flap techniques have been proposed for the closure of defects in acne inversa, such as : lipocutaneous, fasciocutaneous, myocutaneous, and free flaps [27, 30, 3639 ]. in the presented case we chose the lipocutaneous flap to close the defects on the scrotum and a meshed split - thickness skin graft to cover the penile shaft. it must be underlined that meticulous dressing care and antibiotic therapy were crucial to achieve proper healing. the described technique resulted in less deformation of the organs and made it possible to obtain good graft acceptance and wound healing [40, 41 ]. the follow - up did not reveal any new lesions in the operated areas, but the patient will be monitored further as the disease may recur. sometimes the only curative option for extensive acne inversa affecting the sexual organs is aggressive surgery. delaying its implementation may lead to severe local and generalized complications. in the presented case the surgical treatment was effective and well tolerated. we recommend it for all advanced cases of acne inversa as well as those resistant to conservative treatment. | acne inversa is a rare chronic and debilitating inflammatory skin disease.the authors report a case of a 45-year old male who presented with acne inversa in the inguinal, perineal, and scrotal areas. after unsatisfactory pharmacological treatment a wide surgical excision of the affected skin was performed in stages. on follow - up the patient presented with a very good cosmetic and functional result. a review of the most recent literature is also presented. |
the tiny protrusions emerging from dendrites known as dendritic spines are the primary subcellular locations of excitatory synapses in the mammalian central nervous system. dendritic spines are typically ~1 - 2 m in length and 0.51 m in width of the spine head, with diverse morphologies, such as mushroomlike, stubby, and thin spines. these structures are mainly supported by the f - actin cytoskeleton. thus, f - actin cytoskeletal proteins and regulators are important factors for generating dendritic spines. many membrane proteins and adaptor and signaling molecules are also involved in controlling dendritic spine formation and maintenance. the most popular mechanism is that dendritic filopodia serve as precursors for dendritic spine formation. interestingly, filopodia are ubiquitously found on various cell types. in contrast, dendritic spines are neuron - specific structures. thus, the transition from filopodia to spines should be controlled by neuron - specific factors. these proteins or responses directly or indirectly regulate f - actin rearrangement and dynamics to promote dendritic spine formation. studies of cytoskeleton - associated cortactin - binding protein 2 (cttnbp2) and heparan sulfate transmembrane proteoglycan (hspg) syndecan-2 serve as examples for these two categories, respectively. cttnbp2 is a neuron - specific cytoskeleton - associated protein and that is enriched at dendritic spines of mature neurons. although syndecan-2 is widely expressed in many cell types, it is highly concentrated at synapses in neurons. syndecan-2 cooperates with other proteins to trigger neurotransmission through a neuron - specific signal to induce dendritic spine formation. genomic analyses of patients with autism spectrum disorders (asds) indicated that both cttnbp2 and syndecan-2 were associated with asds [4, 5 ]. additionally, neurofibromin, cask, and vcp coordinate with syndecan-2 to control dendritic spinogenesis and were also associated with neurological disorders. these findings suggest that these genes are critical for neuronal function, likely through their regulation of dendritic spine formation. in this review, we will summarize the functions of these proteins in dendritic spinogenesis and use these proteins as examples to discuss how neuron - specific molecules coordinate with ubiquitously expressed proteins to generate neuron - specific signals for dendritic spine formation. syndecan-2 is a type i membrane protein with a heparan sulfate modification at its ectodomain (figure 1). in mammals, the syndecan protein family contains four members, syndecan-1, syndecan-2, syndecan-3, and syndecan-4. in rodent brains, syndecan-2 and syndecan-3 are the two major syndecans expressed in neurons with differential distribution ; syndecan-2 is highly concentrated at synapses, while syndecan-3 is distributed along the axonal shaft. syndecan-2 is involved in cell - cell and cell - matrix interactions through its heparan sulfate modification. it can also bind growth factors, such as fibroblast growth factor (fgf) and epidermal cell growth factor, and it acts as a coreceptor for these growth factors. syndecan-2 is broadly and dynamically expressed in several tissues and cell types [7, 8 ]. during neural development, its expression gradually increases concurrent with synapse formation [8, 9 ]. in mature neurons, such as cultured rat hippocampal neurons at 18 days after plating in vitro (div) or later more importantly, overexpression of syndecan-2 in immature rat hippocampal cultured neurons, such as 1 - 2 div, when endogenous syndecan-2 is not yet expressed, dendritic filopodia are massively induced at 4 - 5 div and dendritic filopodia are then transformed to dendritic spines at 8 - 9 div [9, 11 ]. those dendritic spines are expected to be functional, as they are adjacent to the presynaptic marker synaptophysin based on confocal microscopy [11, 12 ]. syndecan-2-induced dendritic spinogenesis serves as a model to explore the mechanisms underlying the initiation of dendritic spinogenesis (namely, dendritic filopodia formation), the transition from filopodia to spines, and dendritic spine maturation and maintenance. the ectodomain of syndecan-2 heparan sulfate modification is involved in cell - cell and cell - matrix interactions. its transmembrane domain is required for homodimerization or oligomerization, which is critical for the protein - protein interactions of syndecan-2. the cytoplasmic domain of syndecan-2 contains only 32 amino acid residues (figure 1). although it is short, it is divided into three motifs, conserved domain 1 (c1), the variable region (v), and conserved domain 2 (c2). the c1 and c2 motifs are conserved among different syndecans, while the sequences of the v regions vary (figure 1). the c1 motif is essential for syndecan-2-induced dendritic filopodia formation of rat hippocampal cultured neurons, as the syndecan-2c1 mutant completely loses the ability to promote filopodia formation and spine formation at 5 as well as 9 div [11, 15 ]. the c2 is required for the dendritic filopodia - spines transition and dendritic spine maintenance [15, 16 ]. expression of the c2 deletion mutant syndecan-2c2 at 2 div promotes dendritic filopodia formation at 5 div. however, those filopodia are unable to transform into dendritic spine at 9 div [11, 15, 16 ]. these analyses indicate that the function of syndecan-2 in dendritic spinogenesis can be separated into two sequential steps, namely, filopodia and spine formation, which are controlled by two distinct motifs in syndecan-2. because both c1 and c2 motifs are short and lack recognizable enzymatic domains, syndecan-2 binding partners have been identified to determine its molecular mechanism underlying dendritic spine formation. several direct binding partners (summarized in table 1) have been identified for the c1 domains of syndecan-2, including neurofibromin and ezrin., the interactions between syndecan-2 and neurofibromin and cask have been shown to be relevant in dendritic spine formation. because the cytoplasmic tail of syndecan-2 is very short, it is unlikely that a single syndecan-2 molecule can simultaneously interact with all of its binding partners. because the c1 and c2 motifs are involved in two sequential processes, it is likely that neurofibromin and cask sequentially interact with syndecan-2. alternatively, it is possible that because syndecan-2 forms at least a dimer through its transmembrane domain, different syndecan-2 molecules in dimers or oligomers separately interact with neurofibromin and cask. this would suggest that syndecan-2, neurofibromin, and cask form a single large complex. neurofibromin encoded by the neurofibromatosis type i (nf1) gene is characterized by its rasgap- (ras gtpase activating protein-) related domain (grd) (figure 2(a)) [2124 ]. similar to syndecan-2, neurofibromin is widely expressed in different cell types, though its expression level is much higher in the nervous system. nf1 is one of the most common human inherited disorders featured by changes in skin pigmentation, benign tumor growth, and learning difficulty [26, 27 ]. in addition to its ras activity, neurofibromin can increase camp concentration by activating adenylate cyclase. although the molecular mechanisms are less clear, the grd and c - terminal region of neurofibromin are required for camp pathway activation (figure 2(a)). both gs - dependent and gs - independent pathways are involved in neurofibromin - regulated adenylate cyclase activation. the camp pathway has been shown to be involved in learning and memory in drosophila and dendritic spine formation in the mammalian nervous system. in a yeast two - hybrid screen using different fragments of neurofibromin as baits, syndecan-2 was identified as a neurofibromin binding partner. one is the jn fragment corresponding to amino acid residues 13571473 in the grd of human neurofibromin ; the other is the pn fragment containing amino acid residues 26192719 (figure 2(a)). in addition to biochemical studies demonstrating the direct interaction between syndecan-2 and neurofibromin, fluorescence immunostaining further demonstrated the colocalization of syndecan-2 and neurofibromin at synapses in cultured hippocampal neurons. moreover, both nf1 knockdown and haploinsufficiency reduce the density of dendritic spines in both rat hippocampal and mouse cortical cultured neurons and in brains [11, 32 ], consistent with a function of neurofibromin in regulating dendritic spine formation. one study examined syndecan-2 downstream signaling for triggering filopodia formation. using a panel of inhibitors to suppress various kinase activities, protein kinase a (pka) was identified to be required for syndecan-2-induced filopodia formation. combined with the analysis using different motif deletion mutants of syndecan-2, we found that the c1 motif of syndecan-2 is essential for pka - dependent filopodia formation. because neurofibromin interacts with the c1 motif and also activates the camp pathway, cultured hippocampal neurons were then used to investigate whether neurofibromin mediates syndecan-2-induced filopodia formation. both nf1 knockdown and jn fragment expression, which acts as a dominant - negative to disrupt the interaction between endogenous neurofibromin and syndecan-2, thus, neurofibromin mediates the signal from syndecan-2 to the camp pathway to initiate dendritic spinogenesis. because filopodia are supported by f - actin bundles, the syndecan-2-neurofibromin - camp pathway has to induce f - actin polymerization and bundle formation to promote dendritic filopodia formation. the ena (enabled)/vasp (vasodilator - stimulated phosphoprotein) protein family is a group of f - actin regulators that initiate actin polymerization and bundling. pka phosphorylation promotes ena / vasp protein activity to regulate the f - actin cytoskeleton. upon syndecan-2 overexpression, ena / vasp phosphorylation increases, consistent with camp pathway activation moreover, disruption of ena / vasp activity impairs syndecan-2-induced dendritic filopodia formation. in summary, these studies indicate that syndecan-2 overexpression enhances the ability of neurofibromin to activate the pka pathway, which then induces the ena / vasp activity to promote f - actin bundling and filopodia formation. although the pka pathway is required for dendritic filopodia formation, increased intracellular camp concentrations alone can not induce dendritic filopodia formation, suggesting that other factor(s) are involved. from an immunoprecipitation - mass spectrometry study, valosin - containing protein (vcp, also known as p97) was identified as a neurofibromin - binding protein. the entire d1 and d2 atpase domains of vcp are required for the interaction with the leucine - rich domain (lrd) of neurofibromin. vcp is a causative gene of inclusion body myopathy associated with paget 's disease of bone and frontotemporal dementia (ibmpfd). in addition, vcp mutations are associated with asds and amyotrophic lateral sclerosis [36, 37 ]. a combination of human genetic studies, mouse genetic models, and cultured hippocampal and cortical neurons have indicated that neurofibromin interacts with vcp and guides vcp to promote dendritic spinogenesis. the roles of vcp and neurofibromin in dendritic spine formation may account for the neural phenotypes in patients with mutations in the nf1 and vcp genes. however, it is still unclear how vcp regulates dendritic spine formation. to fully address the molecular regulation of neurofibromin and vcp in dendritic spinogenesis, the function of the syndecan-2-neurofibromin interaction in dendritic spine formation is summarized in figure 2(b). mutations in the human cask gene result in x - linked mental retardation and microcephaly with pontine and cerebellar hypoplasia [3943 ]. cask belongs to the membrane - associated guanylate kinase (maguk) family and functions as a scaffold protein to interact with more than two dozen cellular proteins. it is widely distributed in neurons, including synapses, dendrites, axons, and soma. at synapses, pontine explants and rat hippocampal cultured neurons, cask knockdown impairs synapse formation at the pre- and postsynapse, respectively [16, 45 ]. at presynaptic sites, it binds the membrane protein neurexin and other scaffold proteins, such as mint1, mlin7, and liprin, to control presynaptic button formation [4548 ]. cask uses its pdz domain at the postsynaptic site to interact with the c2 motif of syndecan-2. in cultured hippocampal neurons, expression of the pdz alone of cask or the c - terminal tail of syndecan-2 that disrupts the interaction between endogenous cask and syndecan-2 reduces dendritic spine density, narrows spine heads, and shortens spine length at 18 div, suggesting that the cask - syndecan-2 interaction is critical for dendritic spine formation. to investigate whether cask is involved in dendritic spinogenesis initiation or dendritic spine stabilization, a time course study using a knockdown approach in cultured hippocampal neurons the time window of 1518 div covering the initiation toward maturation of dendritic spinogenesis was used for analysis. at 15 div, wild - type dendritic spines are immature, long, and thin, and they are present at a low density. as they mature at 18 div, dendritic spine density increases, spine length decreases, and spine width increases. compared to control neurons, cask knockdown does not affect spine density, length, or size at 15 div, suggesting that cask is not critical for dendritic spinogenesis initiation. at 18 div, the data indicate that cask is important for dendritic spine maturation, likely by linking the membrane protein syndecan-2 to the f - actin cytoskeleton via protein 4.1 to stabilize dendritic spines (figure 3). in human embryonic kidney hek293 cells, syndecan-2 however, these filopodia can not mature into spines. because neurofibromin and cask are also expressed in hek293 cells, the aforementioned studies can not explain why syndecan-2-induced dendritic spines are only present in neurons. a neuron - specific factor must be present to control dendritic spine formation. because neurotransmission is a neuron - specific event and because dendritic filopodia are able to receive neurotransmission signals from presynaptic buttons, neurotransmission seems a likely factor that triggers the filopodia - spines transformation in a neuron - specific manner. indeed, egta treatment to chelate extracellular calcium or ap5 treatment to block nmdar activity, a major neurotransmitter gated calcium channel, impairs the endogenous filopodia - spines transition at 1517 div and syndecan-2-induced filopodia - spines transition at 59 div. in syndecan-2-overexpressing neurons, intracellular calcium concentration is increased compared to control neurons at 5 div. this increase is due to nmdar - regulated calcium influx because ap5 treatment effectively reduced the intracellular calcium concentration induced by syndecan-2. the c2 motif of syndecan-2 is required for syndecan-2 overexpression - induced calcium influx, suggesting that the interaction with cask is involved in calcium influx. previous studies have shown that cask interacts with mlin7 via the l27 domains in both proteins [5052 ] and that mlin7 interacts with the c - terminal tail of nmdar subunit 2b (nmdar2b) through its pdz domain. the interaction between syndecan-2, cask, mlin7, and nmdar2b facilitates nmdar localization to the tips of dendritic filopodia, where nmdar may be activated by presynaptic stimulation, namely, glutamate, and induce calcium influx. disruption of the syndecan-2, cask, mlin7, and nmdar complex by overexpressing the interacting domains impairs nmdar filopodial distribution, calcium influx, and the filopodia - spines transition, suggesting that syndecan-2 triggers calcium influx via the cask - mlin7-nmdar complex and induces the filopodia - spines transition (figure 3). the morphological feature of the filopodia - spines transition is dendritic spine head enlargement and spine length shortening. calcium is known to regulate f - actin dynamics in dendritic spines [5456 ], and gelsolin is a calcium - activated f - actin regulator. gelsolin deficiency impairs filopodial retraction of developing neurons and inhibits activity - dependent f - actin remodeling in mature dendritic spines. it is also critical for the filopodia - spines transition induced by the syndecan-2-cask - mlin7-nmdar complex, as gelsolin knockdown maintains syndecan-2-induced protrusions at the filopodial stage. it is possible that other calcium regulated f - actin regulators also act downstream of syndecan-2 to control the filopodia - spines transition. more investigations are required to further elucidate the regulation. through its interactions with intracellular binding partners, the ubiquitously expressing protein syndecan-2 modulates the f - actin cytoskeleton, triggers neurotransmission, and promotes neuron - specific synapse formation. from dendritic filopodia formation, filopodia - spines transition to dendritic spine maturation, syndecan-2 interacts with different binding partners to control f - actin behaviors. syndecan-2 first activates the pka pathway via neurofibromin to promote f - actin polymerization and bundling for dendritic filopodia formation. it recruits nmdar to filopodial tips through its interaction with the cask - mlin7 complex and increases the postsynaptic responsiveness to presynaptic stimulation. calcium influx induces f - actin cytoskeleton rearrangement to allow for the morphological change from filopodia to spines. to further promote dendritic spine maturation and maintenance, syndecan-2 binds to the protein 4.1 through interactions with cask. throughout the entire process, neuron specificity falls within nmdar - mediated calcium influx, which induces f - actin cytoskeleton remodeling to result in morphological changes to the dendritic spine. these studies provide a comprehensive example of how a neuron - specific ion channel coordinates with other adhesion molecules and synaptic proteins to control dendritic spine formation. to identify a neuron - specific f - actin regulator involved in dendritic spinogenesis, we searched the database and literature and focused on cortactin - binding protein 2 (cttnbp2). cttnbp2 gene encodes a brain - specific protein that interacts with the sh3 domain of cortactin through its proline - rich domain. cortactin promotes and stabilizes f - actin branching [63, 64 ] and thus plays a critical role for dendritic spine morphological maintenance. because cortactin is a ubiquitously expressed protein, its function in controlling dendritic spinogenesis must be regulated by a neuron - specific factor. the specific expression of cttnbp2 in the brain makes it a good candidate to control cortactin in dendritic spinogenesis. furthermore, de novo mutations in the cttnbp2 gene have been repeatedly identified in asd patients [5, 37, 66 ]. in a genomic analysis covering 3871 asd patients, results indicated that cttnbp2 is a high - confidence risk factor for asds with a false discovery rate less than 0.05%. these genetic data support a critical role for cttnbp2 in brain development and function. in the expression tag sequence (est) database (http://www.ncbi.nlm.nih.gov/), three variants have been identified as cttnbp2 transcripts, namely, cttnbp2-short (cttnbp2-s), cttnbp2-intron (cttnbp2-i), and cttnbp2-long (cttnbp2-l). based on the nucleotide sequence, the first 625 predicted amino acid residues are shared among all variants. using an antibody against the common region of the cttnbp variants, immunoblotting revealed that the short form of cttnbp2 is the predominant protein product in brains. it is still unclear whether the cttnbp2-i and cttnbp2-l variants play any role in neurons. therefore, mutation analysis of asd patients is meaningful when the mutation was located within the cttnbp2-s variant sequences. seven de novo asd mutations in the cttnbp2 gene have been identified in the exons encoding cttnbp2-s. to further explore the association of cttnbp2 with asd, these mutations should be investigated in detail to determine their effects on cttnbp2 molecular function and neuronal morphogenesis. analysis of the amino acid sequence of cttnbp2-s predicts a coiled - coil domain at the n - terminal region and proline - rich domain at the c - terminus. the n - terminal coiled - coil domain mediates cttnbp2-s homooligomerization and heterooligomerization of cttnbp2-s and the striatin family [68, 69 ]. both endogenous cttnbp2-s and overexpressed myc - tagged cttnbp2-s were found to be highly concentrated at dendritic spines in mature cultured hippocampal neurons. immunofluorescence analysis of adult brains also indicated that cttnbp2-s colocalized with f - actin puncta in vivo, presumably to dendritic spines. cttnbp2-s is critical for dendritic spine formation, as cttnbp2 knockdown right before dendritic spinogenesis at 12 div reduces spine density and spine head width measured at 18 div. consistent with the morphological changes, the frequency of mepsc (miniature excitatory postsynaptic synaptic current) is lower in cttnbp2 knockdown neurons at 18 div. in addition to dendritic spine formation, cttnbp2-s is involved in dendritic spine maintenance, as cttnbp2-s knockdown in mature neurons, such as 20 div, still reduces dendritic spine density at 26 div. cortactin is required for cttnbp2-s 's regulation of dendritic spinogenesis, as a cttnbp2-s mutant that can not interact with cortactin can not rescue cttnbp2 knockdown - induced spine deficiency. moreover, fluorescence recovery after photobleaching (frap) analysis indicates that cttnbp2-s regulates cortactin mobility in mature dendritic spines. in the presence of cttnbp2-s, the data suggest that cttnbp2-s retains cortactin in dendritic spines and controls dendritic spine formation and maintenance. the striatin protein family contains three mammalian members, namely, striatin, zinedin, and sg2na. they function as b - type regulatory subunits of protein phosphatase 2a (pp2a) to control pp2a subcellular location and substrate specificity [70, 71 ]. striatin protein distribution to synapses is mediated by its interactions with cttnbp2-s through the n - terminal coiled - coil domains of both cttnbp2-s and striatin family members., cttnbp2-s regulates f - actin dynamics and pp2a signaling at dendritic spines. in cos cells, exogenous cttnbp2-s was unexpectedly associated with the microtubule cytoskeleton in addition to the cortactin - f - actin cytoskeleton. cell - matrix interactions influence the cytoskeleton association of cttnbp2-s. in cos cells, cttnbp2-s cttnbp2-s gradually shifts its preference to the microtubule cytoskeleton when establishing cell - matrix interactions. cttnbp2-s is highly concentrated at dendritic spines in mature neurons where cttnbp2-s interacts with f - actin cytoskeletons. in the premature stages when dendritic spines have not yet formed, cttnbp2-s is already expressed and forms puncta attached on microtubule bundles along the dendritic shaft. the mid domain is required for the association of microtubule, and the n - terminal coiled - coil domain is involved in cttnbp2-s oligomerization. oligomerization allows the cttnbp2-s oligomer to contain multiple microtubule binding sites to induce microtubule bundling. during the dendritic extension stage, cttnbp2-s knockdown or disruption of microtubule bundling by overexpression of the n - terminal coiled - coil domain or mid domain impairs dendritic arborization. the studies suggest that, in addition to controlling the f - actin cytoskeleton, cttnbp2-s regulates microtubule stability to influence dendrite morphology. the dual roles of cttnbp2-s in controlling f - actin and the microtubule cytoskeletons require further investigation. as a neuron - specific morphology regulator and a high - confidence risk factor for asds for instance, what is the molecular mechanism regulating the association between cttnbp2-s and f - actin and microtubules ? are the associations of cttnbp2-s with f - actin and microtubules mutually exclusive ? alternatively, can cttnbp2-s act as a bridge to link f - actin and microtubules ? only cultured hippocampal neurons have been examined in functional studies of cttnbp2-s. in the future, in vivo studies should be considered. particularly, to address the association of cttnbp2 with asds, a mouse genetic model is required. the impact of cttnbp2 asd mutations on the molecular function of cttnbp2-s, brain development, and cognition must be studied to further understand the biological significance of cttnbp2. although hundreds of genes are involved in dendritic spine formation, they should be either neuron - specific or directly or indirectly controlled by or linked to neuron - specific signaling or proteins to specifically regulate dendritic spine formation in neurons. in this review, syndecan-2-induced dendritic spine formation and the role of cttnbp2-s in controlling neuronal morphology provide two distinct examples of how neuronal morphology can be regulated in a neuron - specific manner. understanding these regulations is crucial for basic research and for understanding neurological disorder etiology, which could contribute to potential therapeutic treatments of the diseases. | dendritic spines are the location of excitatory synapses in the mammalian nervous system and are neuron - specific subcellular structures essential for neural circuitry and function. dendritic spine morphology is determined by the f - actin cytoskeleton. f - actin remodeling must coordinate with different stages of dendritic spinogenesis, starting from dendritic filopodia formation to the filopodia - spines transition and dendritic spine maturation and maintenance. hundreds of genes, including f - actin cytoskeleton regulators, membrane proteins, adaptor proteins, and signaling molecules, are known to be involved in regulating synapse formation. many of these genes are not neuron - specific, but how they specifically control dendritic spine formation in neurons is an intriguing question. here, we summarize how ubiquitously expressed genes, including syndecan-2, nf1 (encoding neurofibromin protein), vcp, and cask, and the neuron - specific gene cttnbp2 coordinate with neurotransmission, transsynaptic signaling, and cytoskeleton rearrangement to control dendritic filopodia formation, filopodia - spines transition, and dendritic spine maturation and maintenance. the aforementioned genes have been associated with neurological disorders, such as autism spectrum disorders (asds), mental retardation, learning difficulty, and frontotemporal dementia. we also summarize the corresponding disorders in this report. |
the patients were prospectively recruited in the diabetes department of jean verdier hospital between 1992 and 2006. eligibility criteria included type 2 diabetes ; no history of myocardial infarction or angina pectoris ; normal 12-lead resting electrocardiogram (ecg) ; and presence of at least one of the following additional cardiovascular risk factors : dyslipidemia, hypertension, smoking, nephropathy, family history of premature cad, and peripheral / carotid occlusive arterial disease (pcoad) (14). diabetic retinopathy was graded according to the early treatment of diabetic retinopathy study severity scale and defined as absent or present, and also as absent, mild / moderate (minimal and moderate nonproliferative retinopathy), and severe (severe nonproliferative or proliferative retinopathy). the diagnosis of peripheral neuropathy was based on the presence of any two or more of the following : neuropathic symptoms, decreased distal sensation, or decreased or absent ankle reflexes. because antidiabetic, lipid - lowering, and antihypertensive treatments have been more intensively used since the year 2000 (15), we considered the percentage of follow - up time spent after 2000 to estimate the quality of treatment. when the follow - up duration spent after year 2000 was 10% of the overall follow - up duration, the patient was considered as being on current multifactorial care. finally, the 10-year cardiovascular ukpds (3) and the 10-year cardiac framingham (4) risk scores were calculated. each patient underwent a tl myocardial scintigraphy after an ecg stress test, a pharmacological stress test (dipyridamole injection), or both. the ecg stress test was performed in patients who could exercise on a bicycle ergometer and were expected to have an interpretable exercise ecg. when the patient was unable to exercise or when the ecg stress test result was indeterminate, a pharmacological stress test using dipyridamole was carried out. smi was defined as an abnormal ecg stress test, an abnormal myocardial scintigraphy imaging (i.e., defects in at least 3 out of 17 segmental regions), or both. a selective coronary angiography was performed in the patients with smi within a period of 2 months after the noninvasive investigation. cad was defined either as a 70% narrowing of the luminal diameter in the left anterior descending artery, the circumflex artery, a well - developed marginal vessel, or the right coronary artery or as a 50% narrowing of the left main coronary artery diameter. the following measurements were recorded at the time of screening for smi : hba1c (dimension technology, siemens healthcare diagnosis inc., newark, nj), serum total cholesterol, hdl cholesterol and triglycerides (enzymatic colorimetry, hitachi 912, roche diagnostics, meylan, france), creatininemia (colorimetry, kone optima, thermolab system, paris la dfense, france), 24-h proteinuria, and the 24-h urinary albumin excretion rate (laser immunonephelometry, bn100, dade - behring, paris, france). ldl cholesterol was calculated according to the friedewald formula and creatinine clearance with the cockcroft formula. the date of the noninvasive cardiac testing was considered to be the beginning of the follow - up. the patients were evaluated for cardiovascular signs and symptoms (angina, dyspnea, edema, and arrhythmia) and had a 12-lead ecg. for each cardiac event when a patient died, the cause of death was documented with the help of the family, the general practitioner, or the cardiologist. the following cardiovascular events were considered : death of cardiac origin (sudden death, death caused by myocardial infarction, or congestive heart failure), nonfatal acute coronary syndrome, heart failure (new york heart association stage iii or iv and need for hospitalization), secondary need for coronary revascularization, lower limb or carotid revascularization procedure, lower leg amputation, and stroke. continuous variables were expressed as means sd values and compared by one - way anova or mann - whitney u test as adequate. the significance of differences in proportions was tested with the test. because great interindividual differences were observed in the duration of follow - up, two types of analyses were conducted. in the first analysis, the kaplan - meier method was used to examine the time - dependent cumulative probabilities of cardiovascular events. cox regression analyses were used to determine hazard ratios (hrs) for cardiovascular events in relation to the parameters that predicted cardiovascular events according to the kaplan - meier method. we considered the cumulative probabilities of cardiovascular events first according to the presence of smi or cad after adjustment on the parameters included in the cox regression analyses and then according to subgroups, considering routine cardiovascular risk assessment and the presence of smi or cad. in the second analysis logistic regression was used for multivariate analyses based on models including the factors that were associated with the occurrence of a cardiovascular event during the first 5 years of follow - up with a p value 0.10 in univariate analyses. we used c statistic to determine if smi or cad added to the prediction of a cardiovascular event above and beyond the risk prediction based on the other parameters. finally, we calculated the hosmer - lemeshow statistic (hl) to test the difference in expected and observed probabilities of an event in the different models. statistical analyses were carried out using spss software (spss, chicago, il). each patient underwent a tl myocardial scintigraphy after an ecg stress test, a pharmacological stress test (dipyridamole injection), or both. the ecg stress test was performed in patients who could exercise on a bicycle ergometer and were expected to have an interpretable exercise ecg. when the patient was unable to exercise or when the ecg stress test result was indeterminate, a pharmacological stress test using dipyridamole was carried out. smi was defined as an abnormal ecg stress test, an abnormal myocardial scintigraphy imaging (i.e., defects in at least 3 out of 17 segmental regions), or both. a selective coronary angiography was performed in the patients with smi within a period of 2 months after the noninvasive investigation. cad was defined either as a 70% narrowing of the luminal diameter in the left anterior descending artery, the circumflex artery, a well - developed marginal vessel, or the right coronary artery or as a 50% narrowing of the left main coronary artery diameter. the following measurements were recorded at the time of screening for smi : hba1c (dimension technology, siemens healthcare diagnosis inc., newark, nj), serum total cholesterol, hdl cholesterol and triglycerides (enzymatic colorimetry, hitachi 912, roche diagnostics, meylan, france), creatininemia (colorimetry, kone optima, thermolab system, paris la dfense, france), 24-h proteinuria, and the 24-h urinary albumin excretion rate (laser immunonephelometry, bn100, dade - behring, paris, france). ldl cholesterol was calculated according to the friedewald formula and creatinine clearance with the cockcroft formula. the date of the noninvasive cardiac testing was considered to be the beginning of the follow - up. the patients were evaluated for cardiovascular signs and symptoms (angina, dyspnea, edema, and arrhythmia) and had a 12-lead ecg. for each cardiac event, medical records were obtained from the hospital or the primary care physician. when a patient died, the cause of death was documented with the help of the family, the general practitioner, or the cardiologist. the following cardiovascular events were considered : death of cardiac origin (sudden death, death caused by myocardial infarction, or congestive heart failure), nonfatal acute coronary syndrome, heart failure (new york heart association stage iii or iv and need for hospitalization), secondary need for coronary revascularization, lower limb or carotid revascularization procedure, lower leg amputation, and stroke. continuous variables were expressed as means sd values and compared by one - way anova or mann - whitney u test as adequate. the significance of differences in proportions was tested with the test. because great interindividual differences were observed in the duration of follow - up, two types of analyses were conducted. in the first analysis, the kaplan - meier method was used to examine the time - dependent cumulative probabilities of cardiovascular events. cox regression analyses were used to determine hazard ratios (hrs) for cardiovascular events in relation to the parameters that predicted cardiovascular events according to the kaplan - meier method. we considered the cumulative probabilities of cardiovascular events first according to the presence of smi or cad after adjustment on the parameters included in the cox regression analyses and then according to subgroups, considering routine cardiovascular risk assessment and the presence of smi or cad. in the second analysis logistic regression was used for multivariate analyses based on models including the factors that were associated with the occurrence of a cardiovascular event during the first 5 years of follow - up with a p value 0.10 in univariate analyses. we used c statistic to determine if smi or cad added to the prediction of a cardiovascular event above and beyond the risk prediction based on the other parameters. finally, we calculated the hosmer - lemeshow statistic (hl) to test the difference in expected and observed probabilities of an event in the different models. statistical analyses were carried out using spss software (spss, chicago, il). a total of 731 patients were enrolled between 1992 and 2006. among them, 688 were followed, whereas 43 (6.0%) were lost to follow - up. the latter patients did not differ significantly from the former when considering either the main clinical and biological criteria or the smi status (data not shown). a coronary angiography was subsequently performed in 191 of the 207 subjects with smi. out of them, 76 (i.e., 11.0% of the 688 patients) had cad, including one - vessel disease in 47 and two- and three - vessel disease in 15 and 14 patients, respectively. characteristics of the total population of the 688 patients who were followed up and of the patients who did or did not have a 5-year occurrence of a first cardiovascular event (n = 371) data are n (%) or mean sd. 22 were treated by coronary angioplasty and 6 by coronary artery bypass, whereas the remaining patients were medically treated, according to the cardiologist s decision. a total of 98 patients had a first cardiovascular event during a 5.4 3.5 (range : 0.119.2) year period : 10 cardiac deaths, 39 acute coronary syndromes, 10 nonfatal congestive heart failures, 1 secondary coronary revascularization procedure, 21 strokes, 12 peripheral revascularization procedures, and 5 lower - leg amputations. kaplan - meier survival analyses showed that smi (adjusted log - rank test 21.2, p 20%, and retinopathy. routine assessment was based on the presence of at least one of the following criteria : macroproteinuria, no current multifactorial care, and pcoad. table 1 shows the variables that were associated with the occurrence of a cardiovascular event during the first 5 years of follow - up. the variables predicting cardiovascular events were entered into three logistic regressions : ukpds risk score 20% (age, sex, smoking, diabetes duration > 20 years, and hba1c 10% were not entered into the model because they were already included in this score), retinopathy, nephropathy, peripheral neuropathy, and pcoad in model a ; plus smi in model b ; and plus cad in model c. the results are shown in table 3 ; macroproteinuria, pcoad (model a, b, and c), and smi (model b) or cad (model c) were independently predictive of a cardiovascular event during the first 5 years. the area under the receiver operating characteristic (aroc) curve for model a parameters to predict a 5-year cardiovascular event was 0.705 (95% ci 0.6160.794 ; p 20 years, hba1c 10%, retinopathy, macroproteinuria, peripheral neuropathy, and pcoad in model a ; plus smi in model b ; and plus cad in model c. framingham risk score and pcoad (model a, b, and c), hba1c and macroproteinuria (model a), and smi (model b) or cad (model c) were independently predictive of 5-year events (table 3). a total of 731 patients were enrolled between 1992 and 2006. among them, 688 were followed, whereas 43 (6.0%) were lost to follow - up. the latter patients did not differ significantly from the former when considering either the main clinical and biological criteria or the smi status (data not shown). a coronary angiography was subsequently performed in 191 of the 207 subjects with smi. out of them, 76 (i.e., 11.0% of the 688 patients) had cad, including one - vessel disease in 47 and two- and three - vessel disease in 15 and 14 patients, respectively. characteristics of the total population of the 688 patients who were followed up and of the patients who did or did not have a 5-year occurrence of a first cardiovascular event (n = 371) data are n (%) or mean sd. of the 76 patients with silent cad, 22 were treated by coronary angioplasty and 6 by coronary artery bypass, whereas the remaining patients were medically treated, according to the cardiologist s decision. a total of 98 patients had a first cardiovascular event during a 5.4 3.5 (range : 0.119.2) year period : 10 cardiac deaths, 39 acute coronary syndromes, 10 nonfatal congestive heart failures, 1 secondary coronary revascularization procedure, 21 strokes, 12 peripheral revascularization procedures, and 5 lower - leg amputations. kaplan - meier survival analyses showed that smi (adjusted log - rank test 21.2, p 20%, and retinopathy. routine assessment was based on the presence of at least one of the following criteria : macroproteinuria, no current multifactorial care, and pcoad. table 1 shows the variables that were associated with the occurrence of a cardiovascular event during the first 5 years of follow - up. the variables predicting cardiovascular events were entered into three logistic regressions : ukpds risk score 20% (age, sex, smoking, diabetes duration > 20 years, and hba1c 10% were not entered into the model because they were already included in this score), retinopathy, nephropathy, peripheral neuropathy, and pcoad in model a ; plus smi in model b ; and plus cad in model c. the results are shown in table 3 ; macroproteinuria, pcoad (model a, b, and c), and smi (model b) or cad (model c) were independently predictive of a cardiovascular event during the first 5 years. the area under the receiver operating characteristic (aroc) curve for model a parameters to predict a 5-year cardiovascular event was 0.705 (95% ci 0.6160.794 ; p when the presence of smi (model b) or cad (model c) was added into the model, the aroc curve increased to 0.788 (0.7200.855 ; p 20 years, hba1c 10%, retinopathy, macroproteinuria, peripheral neuropathy, and pcoad in model a ; plus smi in model b ; and plus cad in model c. framingham risk score and pcoad (model a, b, and c), hba1c and macroproteinuria (model a), and smi (model b) or cad (model c) were independently predictive of 5-year events (table 3). the present data show that in this cohort of asymptomatic type 2 diabetic patients with at least one additional cardiovascular risk factor, the performances of ukpds or framingham risk scores to predict cardiovascular events are limited and may be improved by considering the presence of macroproteinuria and pcoad. furthermore, we show here for the first time that the presence of smi or silent cad is independently associated with cardiovascular events and improves cardiovascular risk prediction. although some studies (16) suggest that the presence of diabetes should be regarded as a risk of coronary mortality similar to established cad, we show in the current study that type 2 diabetic patients may be further stratified by evaluating their a priori cardiovascular risk using the calculation of a specific (ukpds) or nonspecific (framingham) risk score. however, the association between a high risk score and the occurrence of events disappeared in multivariate analyses (table 2). recent studies have also shown that risk equations are likely to overestimate cardiovascular risk (5,6), partly because the current multifactorial therapy has markedly improved the cardiovascular prognosis in the diabetic population. in the current study, we considered the year 2000 as the threshold time, from when the treatment of risk factors has been intensified in accordance to the current guidelines (15). it is interesting that shorter time exposure to contemporary treatment (expressed as percentage of follow - up duration spent after 2000) was independently predictive of events. other parameters may be useful to evaluate the cardiovascular prognosis in the diabetic population, such as the presence of retinopathy or nephropathy. the presence of these microangiopathic complications has usually been considered as a good marker of exposure (in time and intensity) not only to hyperglycemia but also to other risk factors including hypertension. in the current study, any stage of retinopathy and severe retinopathy both predicted events, although only severe retinopathy was previously shown to be associated with a high cardiovascular risk (9). our data also support the high risk of events associated with incipient nephropathy and the even higher risk associated with macroproteinuria (8). an alternative could be the identification of vascular integrators of risk (i.e., parameters that may reflect the cumulative exposure to cardiovascular risk factors and its intensity). for example, it was shown that the presence of arterial stiffness or arteriosclerotic plaques could improve the risk prediction when added to the systemic coronary risk evaluation in healthy subjects (17). in the current study, the procedure for diagnosing pcoad is usually easy, with ultrasound examination being performed especially in patients with clinical signs or symptoms. silent cad in diabetic patients was shown to be associated with a higher incidence of cardiac events (10,11). with regard to diabetic patients with smi but no cad, we have previously reported evidence for abnormalities of coronary flow reserve and endothelium function and shown that such functional abnormalities were also associated with a worse prognosis (18). the current study confirms that both smi and cad are strong predictors of cardiovascular events and shows for the first time that diagnosing cad in asymptomatic patients improves cardiovascular prediction in addition to the risk estimation based on traditional risk factors, risk equations, nephropathy, pcoad, and current multifactorial care. the present results are in line with some recommendations for smi screening in diabetic patients with high cardiovascular risk (1,2,19). this proposal is, however, under debate (20,21) because of several considerations. first, such a screening can not be performed in all diabetic patients, and the current selection criteria still need to be improved (22,23). second, the cardiovascular prognosis has been markedly improved in diabetic patients by intensifying preventive medical treatments. however, the current article shows that the prognosis associated with smi remains poor despite more intensive treatment as prescribed since 2000. finally, the detection of silent myocardial ischemia in asymptomatic diabetic subjects (diad) study has recently shown that screening for smi was not associated with a better prognosis (12). however, very few patients with smi underwent coronary angiography and revascularization during this study. nevertheless, another randomized study suggested that screening for smi and cad may improve the prognosis if a coronary revascularization was performed in patients with coronary stenoses (24). the diabetic patients who were included had at least one additional risk factor and, therefore, the results are not necessarily generalizable to the diabetic population. cad status was unknown in the patients without smi because they did not undergo a coronary angiography for ethical reasons. however, the present series includes the largest series ever published in the literature of coronary angiographies in patients with smi. the prognosis was not adjusted on medical therapy but on the period of treatment. in conclusion, smi is a common condition in patients with type 2 diabetes and at least one additional cardiovascular risk factor. smi and silent cad are strong predictors of cardiovascular events in diabetic patients, beyond their a priori cardiovascular risk and independent of more or less intensive medical therapy. risk prediction is improved by adding coronary status to routine prognosis assessment. however, screening for silent coronary disease is expensive and not easily available in routine assessment and, therefore, should not be performed in all diabetic patients. the selection criteria for screening still need to be improved, and the benefit of screening and subsequently treating smi and silent cad remains to be extensively addressed in further studies (25). | objectiveto evaluate if silent myocardial ischemia (smi) and silent coronary artery disease (cad) provide significant additional value to routine cardiovascular risk assessment in type 2 diabetic patients.research design and methodswe followed up to a first cardiovascular event 688 subjects (322 men, aged 59 8 years) out of 731 consecutive asymptomatic type 2 diabetic patients with 1 additional risk factor who had been prospectively screened between 1992 and 2006 for smi by stress myocardial scintigraphy and for silent cad by coronary angiography.resultssmi was found in 207 (30.1%) patients and cad in 76 of those with smi. of the patients, 98 had a first cardiovascular event during a 5.4 3.5 (range : 0.119.2) year follow - up period. cox regression analysis considering parameters predicting events but not smi and cad (routine assessment) showed in univariate analyses that macroproteinuria (hazard ratio [hr ] 3.33 [95% ci 1.746.35 ] ; p < 0.001), current multifactorial care (0.27 [0.150.47 ] ; p < 0.001), and peripheral / carotid occlusive arterial disease (pcoad ; 4.33 [2.158.71 ] ; p < 0.001) independently predicted cardiovascular events. when added into the model, smi (hr 1.76 [1.003.12 ] ; p = 0.05) and cad (2.28 [1.244.57 ] ; p < 0.01) were also independently associated with events. smi added to the prediction of an event in the following 5 years above and beyond routine assessment risk prediction (c statistic with or without smi 0.788 [0.7200.855 ] and 0.705 [0.6160.794 ], respectively).conclusionsalthough screening for smi and silent cad should not be systematic, these complications are predictive of cardiovascular events in type 2 diabetic patients in addition to routine risk predictors, especially represented by pcoad, macroproteinuria, and nonintensive management. |
posterolateral rotary knee dislocation is a rare orthopedic injury that is considered to be irreducible by closed reduction because of soft tissue incarceration. here, we present a case of posterolateral rotary knee dislocation, which was reduced by closed manipulation. the patientwas a 33-year - old man who sustained a twisting injury to his right knee that was diagnosed as posterolateral rotary knee dislocation by plain radiographs and the characteristic physical finding known as a dimple sign. under general anesthesia, the knee dislocation was reduced by closed manipulation with internal rotation of the lower leg at knee flexion and reproduced by valgus and external rotation stress. there were was complete tear of posterior cruciate ligament, and partial tear of the anterior cruciate ligament which were not reconstructed. one year postoperatively, the range of motion was 0145. there was no knee symptom and no ligament instability. dislocation of the knee is a serious but rare injury, representing less than 0.2% of all orthopedic injuries. posterolateral rotary dislocation is much rarer and considered to be irreducible by closed reduction because of incarceration of soft tissues such as the medial capsule and retinaculum, vastusmedialis, and medial meniscus. the dimple sign is a physical finding caused by invagination of the skin and soft tissues into the medial joint space and is known to be characteristic of irreducible knee dislocation. to the best of our knowledge, there has been no reported case of posterolateral rotary knee dislocation successfully reduced by closed manipulation. here, we present a case of posterolateral rotary knee dislocation with a clear dimple sign, which was reduced using a closed procedure. we believe that this is the first report of a successful closed reduction for posterolateral knee dislocation. a 33-year - old man presented to the emergency department of our hospital with a twisting injury to his right knee and an open fracture of the left lower thigh that occurred while he was operating a rotary snow removal vehicle and his left lower thigh became trapped in the rotary blade. physical examination revealed that the right knee joint was fixed at 30 flexion with a lateral shift of the patella. radiographic evaluation confirmed lateral dislocation of the patella and posterolateral subluxation of the knee (fig. radiographs showing lateral dislocation of the patella and posterolateral subluxation of the tibia. on the day of injury, the open fracture of the left lower thigh was stabilized with an external fixator after debridement and the dislocated patella of the right knee was reduced. plain radiographs after manipulation showed widening of the medial joint space and tibial posterolateral displacement (fig. (a) anteroposterior and (b) lateral radiographs after reduction of the patella. invagination of the skin over the medial joint line (arrow heads) is shown (dimple sign). the knee was flexed to 120 and valgus stress and internal rotation of the lower thigh were applied. after reduction, ligament instability tests were positive for valgus stress, with signs of posterior sagging in the posterior drawer test, and negative for the lachman test, pivot shift test, extension recurvatum test, and dial test. a subsequent arthroscopic examination also revealed a complete midsubstance tear of the posterior cruciate ligament (pcl) (fig. 4a) and a partial tear of the posterolateral bundle of the anterior cruciate ligament (acl), which were not reconstructed (fig. a peripheral longitudinal tear of the lateral meniscus was repaired using the fast fix 360 meniscal repair system (smith & nephew, andover, ma, usa) (fig. (c) a peripheral longitudinal tear of the lateral meniscus was repaired using the fast fix360 meniscal repair system. thereafter, a 7-cm medial longitudinal incision was made to repair the medial collateral ligament (mcl). the medial retinaculum and capsule were torn along with the distal end of the vastusmedialis. button holing of the medial femoral condyle through the medial retinaculum and the capsule could be reproduced by valgus stress and external rotation in the knee flexion position (fig. in addition, the dislocation could be reduced by internal rotation of the lower thigh. the mcl was fixed to the femoral footprint using suture anchors (mitek products, johnson & johnson company, westwood, ma, usa). range of motion (rom) exercises was started after 3 weeks of immobilization with a cylinder cast. one year postoperatively, no knee symptoms were observed and the rom was 0145. there was no ligament instability except for the pcl at grade ii. (a) the medial retinaculum and capsule were torn along with the distal end of the vastusmedialis. (b) buttonholing of the medial femoral condyle was reproduced by valgus stress and external rotation at the knee flexion position. the most effective mechanism for posterolateral knee dislocation is considered valgus and rotational stress during knee flexion. however, the direction of rotational stress is reportedly internal rotation or external rotation. in the present case, the dislocation was reduced by internal rotation of the lower leg with knee flexion and reproduced by valgus and external rotation stress. therefore, valgus and external rotation stress during knee flexion may have been the cause of knee dislocation in our patient. reportedly, the mcl, acl, and pcl are usually completely ruptured in posterolateral knee dislocation, whereas the posterolateral structures are usually left intact ; however, some recent studies have shown that a posterolateral injury may occur in combination with this type of dislocation. therefore, combined ligament injuries should be carefully assessed by magnetic resonance imaging (mri) or physical examination after reduction. in the present case, complete tearing of the mcl and pcl however, the acl in our case was only partially torn and exhibited no instability. only one report by jeevannavar. has described a partial acl tear associated with posterolateral knee dislocation. the remaining acls may prevent complete button holing of the medial femoral condyle through the medial retinaculum and produce reducibility. samini. reported cases of this type of dislocation with medial and lateral meniscal injuries. in the present case, the first - line therapeutic approach for posterolateral knee dislocation is conventionally considered immediate reduction by open surgery. however, as we demonstrated in the present case of posterolateral rotary dislocation, it may be possible to reduce this injury by closed manipulation. closed manipulation by valgus stress and internal rotation could be tried as a first - line choice. combined ligament injuries should be treated in consideration of patient age and activities of daily living. in the present case, the partial acl tear did not cause any instability, where the pcl injury was left untreated and a posterior drawer test of grade ii was identified at the final follow - up, although no clinical symptoms originated from this instability. we experienced the case of posterolateral rotary knee dislocation which was reduced by closed manipulation. this is the first report of a successful closed reduction for posterolateral knee dislocation. in the present case, the dislocation was reduced by internal rotation of the lower leg with knee flexion and reproduced by valgus and external rotation stress. the mechanism of posterolateral knee dislocation was considered valgus and external rotation stress during knee flexion. posterolateral rotary knee dislocation is a rare orthopedic injury that is considered to be irreducible by closed reduction because of soft tissue incarceration. however, with the result of the presented case, the closed manipulation by valgus stress and internal rotation could be tried as a firstline choice. | introduction : posterolateral rotary knee dislocation is a rare orthopedic injury that is considered to be irreducible by closed reduction because of soft tissue incarceration. here, we present a case of posterolateral rotary knee dislocation, which was reduced by closed manipulation.case report : the patientwas a 33-year - old man who sustained a twisting injury to his right knee that was diagnosed as posterolateral rotary knee dislocation by plain radiographs and the characteristic physical finding known as a dimple sign. under general anesthesia, the knee dislocation was reduced by closed manipulation with internal rotation of the lower leg at knee flexion and reproduced by valgus and external rotation stress. there were was complete tear of posterior cruciate ligament, and partial tear of the anterior cruciate ligament which were not reconstructed. the medial collateral ligament that was detached from the femoral footprint was repaired. one year postoperatively, the range of motion was 0145. there was no knee symptom and no ligament instability.conclusion:this is the first report of a successful closed reduction for posterolateral knee dislocation. the mechanism of dislocation was considered valgus and external rotation stress during knee flexion. |
in early 2016, we sent a 70-question survey to the original 56 designated us hlius, including the 10 resptcs. results were collected through adobe acrobat pro (https://acrobat.adobe.com/us/en/acrobat/acrobat-pro.html) and analyzed by using descriptive statistics. the university of nebraska medical center institutional review board declared the study exempt (# 17216x). of the 33 that completed the full survey, 3 reported they no longer maintained their hliu capabilities. the 2 that provided qualitative information about their decision to close reported needing hliu resources for other, more pressing areas and cited close proximity to at least 1 other hliu as reasons for closing. nineteen (58%) hospitals reported using their hliu for non - hid patients when not activated ; the other 14 (42%) use the unit exclusively for patients with hids or for training (table 1). when the 19 hospitals with adaptive isolation units (i.e., units otherwise used for normal hospital care) are activated, an average of 6.31 beds (median 6, range 212) must be taken offline when caring for 1 patient with an hid and an average of 6.97 beds (median 7.75, range 212) for 2 patients. ten (53%) hlius with adaptive units stated preference for a unit dedicated to care for patients with hids ; however, when asked the estimated costs of developing a unit for 2 hid patients, estimates ranged from $ 1 million to $ 12 million. perceived benefits of a dedicated unit included minimizing disruption of other patients (4 hospitals), a constant state of readiness (3 hospitals), and an ability to train in the unit (4 hospitals). ed, emergency department ; hliu, high - level isolation unit ; pui, patient under investigation. average time necessary to activate hliu after notification of pending patient transfer is 4.58 h (median 4 h, range 1.24 h). one facility sends a mobile response team to a pui s home for evaluation, and another plans to use a mobile treatment unit (i.e., tent) for pui placement. our initial 2015 survey reported that hospitals designated as etcs incurred an average per hospital of $ 1,197,993 (4). since that time, 25 (76%) of those original facilities reported receiving some degree of federal reimbursement, and 8 (24%) had not received any reimbursement. a cumulative total of $ 28,146,558 in federal funding (average $ 1,407,328, range $ 33,650$6,000,000) was reported by the 20 (60%) reporting hlius. after we excluded federally funded resptcs and hlius that did not report initial investments in the pilot survey, the remaining 14 hlius reported a gap in reimbursement of $ 9,113,072.50 (mean $ 650,933.75 per hliu). although 1 hliu reported lacking specific protocols or an ability to care for patients with an hid other than evd, all other hlius (97%) reported being prepared to care for patients with hids other than evd (figure 1). our survey also queried hlius about the challenges they experienced and challenges they foresee in maintaining the capabilities and capacity needed for hid care (figure 2). hlius also detailed facility modifications and/or capabilities they would add if additional hypothetical funding were available (table 2). challenges to establishing an hliu and to maintaining hid care reported by survey respondents, united states, 2016 (n = 32 hlius). other challenges include external support, lack of dedicated unit space, competing priorities, staffing needs, and decreasing hospital capacities. individual hlius self - reported data through an electronically administered survey administered in 2016. developed during the height of the west africa ebola outbreak, most newly established us hlius invested immense resources and effort into preparing for patients with evd. however, no formal network of hlius has been established in the united states, except for the 10 resptcs, and at least 3 former hlius no longer maintain hliu capabilities. moreover, 14 hlius not designated as resptcs reported having spent $ 9.1 million more than they have been reimbursed to initially develop hliu capabilities. as a result, these hospitals reported struggling to fund ongoing operations and sustain readiness. although many facilities have created adaptable - use hlius because they lack the capital funds, space, or both to create a dedicated unit, such units have major disadvantages because healthcare workers are unable to train in the unit, existing patients must be relocated when the unit is activated for an hid patient, and multiple additional rooms must be taken off - line for the care of 1 patient with an hid (8). thus, more than half of us hlius that routinely care for non - hid patients would build an hid - dedicated unit if funds were available. however, because future funding sources for non - resptcs are unclear, lessons on sustainability might be learned from flexible - use hlius in italy and the netherlands, which offer levels of containment based on a patient s condition and offset costs by routine use (1). the current status of hlius that did not participate in the follow - up survey is unknown. a decrease in participation from the initial survey to the follow - up could also be due to the longer, more detailed follow - up and could indicate the lack of attention to this area now that the evd outbreak is over. the study population was based solely on a list published by the centers for disease control and prevention (9) and does not include data from other hospitals that similarly tried to strengthen their ability to treat hid patients. in conclusion, a network of hospitals capable of treating patients with hids was rapidly constructed in response to the recent evd outbreak. however, without the impending threat of evd or another hid on the immediate horizon, public attention on hid preparedness tends to waver, and governments tend to prioritize and shift funding elsewhere. additional external funding sources remain generally uncertain for us hlius not designated as resptcs ; therefore, these hlius must strategize methods and models of sustainability if they are to maintain capabilities and readiness. | to identify barriers to maintaining and applying capabilities of us high - level isolation units (hlius) used during the ebola virus disease outbreak, during 2016 we surveyed hlius. hlius identified sustainability challenges and reported the highly infectious diseases they would treat. hlius expended substantial resources in development but must strategize models of sustainability to maintain readiness. |
we appreciate prof. di guardo s interest in our recent work published in nature methods where we describe that a subpopulation of cancer stem cells (cscs) present in numerous epithelial solid tumors contains intracellular autofluorescent vesicles. we would like to take this opportunity, however, to formally address specific issues raised by prof. di guardo regarding the source of the autofluorescent phenotype we describe and characterize in our study. since the first description of cellular autofluorescence over a century ago, we have now come to appreciate that autofluorescence should not be discarded as a biological artifact but embraced as a biological phenomenon with potentially important cellular relevance. indeed, cellular and tissue autofluorescence has been attributed to a spectrum of unrelated molecules such as porphyrins, vitamins (vitamin a, riboflavin, thiamine), structural proteins, lipofuscin and ceroid pigments. while we definitively show that riboflavin (vitamin b2) is the underlying causative agent of autofluorescence in epithelial cscs, prof. di guardo takes the liberty to dispute our exhaustive investigation by proposing lipofuscin as an alternative source and additionally raises the notion that not considering lipofuscin and lipofuscin - like compounds among the biomolecular substrates potentially - putatively responsible for the autofluorescence specifically detected in epithelial cscs could be regarded as a conceptual error leading to a methodological slip. to avoid confusing the reader autofluorescence in cells and tissues can be detected due to the presence of intrinsic biomolecules acting as endogenous fluorophores, with favourable spectral properties and quantum efficiency (excitation / emission ranges within the blue region where most endogenous fluorophores emit). specifically, the auto - fluorescence in the cytoplasm of epithelial cscs has a distinct green spectral profile (excitation and emission 480 - 490 nm and 530 - 540 nm, respectively) and can be excited only with a standard blue laser, but not with yellow - green (e.g., 561 nm) or red (e.g., 640 nm) lasers. riboflavin has a near identical spectral profile (excitation and emission 480 - 490 nm and 530 - 540 nm, respectively), while lipofuscin and lipofuscin - like lipopigments have a much broader spectral profile with excitation and emission wavelengths of 400 - 500 nm and 480 - 700 nm, respectively (figure 1). thus, the autofluorescence of lipofuscin or lipofuscinlike lipopigments covers the yellow - red region, depending on the variability of its composition (e.g., proteins, lipids, carotenoids and metals). lipofuscins have been shown to consist, in part, of undigested material (e.g., lipids and covalently cross - linked proteins) remaining from phagocytosis and/or autophagy and therefore they can be occasionally observed in the cell cytoplasm as intracytoplasmic granules. in our work, we specifically excluded a link between csc autofluorescence and autophagy, and csc autofluorescent vesicles also did not co - localize with lipid droplets or lysosomes, as demonstrated by co - staining with nile red or lysotracker, respectively. in addition, autofluorescence was not observed in paraffin sections of pancreatic tumors (data not shown), which is in contrast to lipofuscin autofluorescence, which is not lost when tissues are formalin fixed and paraffin embedded, likely due to its non - degradable makeup. while the spectral data and the aforementioned experimental observations alone would argue that the source of the csc autofluorescence we observe in freshly digested or cultured tumors is not lipofuscin, our abcg2-specific studies leave no doubt that riboflavin and not lipofuscin is the source of autofluorescence in cscs. specifically, we show that inhibition of atp and not autophagy eliminates csc autofluorescence, that the atp - dependent transporter abcg2 is overexpressed in autofluorescent cscs and co - localizes with the membrane of intracellular autofluorescent vesicles, the abcg2-specific inhibitor fumitremorgin c reversibly eliminates csc autofluorescence, riboflavin is a substrate for abcg2, and only the addition of riboflavin to vitamin - deprived csc cultures is capable of restoring autofluorescence. thus, the sum of these data unequivocally supports the conclusion that the source of csc autofluorescence is the vitamin riboflavin. we thank the journal for sharing prof. di guardo s opinion, and we hope that our response provides evidence - based clarity to support our claim that riboflavin and not lipofuscin is the source of autofluorescence in epithelial cscs and that no methodological slip has been made. these minor quibbles, however, should not distract from the clear consensus of all the authors that autofluorescence in cscs represents an important advance in our understanding of these biologically important cells in the context of cancer and chemoresistance. | since the first description of cellular autofluorescence over a century ago, we have now come to appreciate that autofluorescence should not be discarded as a biological artifact but embraced as a biological phenomenon with potentially important cellular relevance. indeed, cellular and tissue autofluorescence has been attributed to a spectrum of unrelated molecules such as porphyrins, vitamins (vitamin a, riboflavin, thiamine), structural proteins, lipofuscin and ceroid pigments. we have recently shown that freshly isolated epithelial cancer stem cells (cscs) bear autofluorescent vesicles in the cytoplasm. our studies definitively prove that riboflavin and not lipofuscin is the source of autofluorescence in cscs as the inhibition of atp and not autophagy eliminates csc autofluorescence, that the atp - dependent transporter abcg2, for which riboflavin is a substrate, is overexpressed in autofluorescent cscs and co - localizes with the membrane of intracellular autofluorescent vesicles, the abcg2-specific inhibitor fumitremorgin c reversibly eliminates csc autofluorescence, riboflavin is a substrate for abcg2, and only the addition of riboflavin to vitamin - deprived csc cultures is capable of restoring autofluorescence. thus, the sum of these data unequivocally supports the conclusion that the source of csc autofluorescence is the vitamin riboflavin. |
the triathlon is a relatively new sport with only three decades of competition at international level. the triathlon involves a combination of three separate disciplines - swimming, cycling and running. the order of events is usually swimming, cycling, and running although some professional sprint triathlons vary. the olympic distance triathlon includes swimming (1500 meters), cycling (40 kilometers) and running (10 kilometers) (1). the most successful athletes have amorphology of competitors in, such as to the ironman triathlon event, as these athletes are usually heavier and have a stronger build. recognizing current participants with potential in sports is important, and to develop their skills and groom their learning ability has its own importance. in most organizations, physiological parameters and anthropometry may guide coaches and trainers in optimizing training and identifying talent (3). however, the coaching staff remains in a dilemma to determine what somatotype, proportions, and shape are best in order to maximize sporting performance (4). earlier, it had been established that body type could play a crucial role in determining the position of players in the game of volleyball. sports scientists were encouraged to utilize such information while determining the position of a specific program (5). similar observation were suggested in playing positions for handball players after analyzing anthropometric profiling (6). height and body mass had been found to be correlated with sprint performance using anthropometric profile for young teen soccer players (7). however, knechtle (8) noticed that no association existed between total race performance time, body weight loss and skeletal mass. similarly, in another study knechtle (9) found that anthropometry and its influence on race were very little on ultra - endurance triathletes in the longest triathlon. while in swimming events, the length of limbs played a more vital role than the frequency of stride or stroke length. on the other hand, body fat was marked negatively as a dead weight that an athlete needs to carry with him or her during the whole event (10). therefore, there is a need to identify the influence of anthropometric profiling on triathlon events, particularly on running and cycling performances. overall, anthropometric characteristics and performances are interlinked in the majority of athletic sports (11). past studies have been observed at international competition level and with good validity to predict success by using anthropometric characteristics. however, very few studies have been conducted to date on the anthropometric characteristics of the new zealand junior elite triathletes and little data exists to compare with international data. therefore, the general objective of this study was to determine the correlation between physical traits of calf girth or sum of eight skinfolds (anthropometry) and running or cycling performance of junior elite triathletes selected for the new zealand national squad. in addition, we also compared the anthropometric data from our study of new zealand junior elite triathletes with that of previously published data from the world elite and world junior elite triathletes (4). this was a cross - sectional study conducted at a sports camp in hamilton, new zealand. the study population comprised of junior elite triathletes who were selected for the new zealand national squad. all junior elite triathletes who were selected for the new zealand national squad were invited to the camp. subsequently, athletes who agreed to be the part of investigation and showed a willingness to sign informed consent were examined in the study. the standard procedure for anthropometric profiling by the international society for advancement of kinanthropometry (isak) guideline was followed for each athlete. criterion anthropometrist (isak level 3 accredited) marked the key anthropometric positions on the triathletes and then directed the athletes towards three stations. this included skinfold (8 measurements), length (7 measurements), girth (7 measurements), breadths (7 measurements), body weight and height. all triathletes were measured by a trained anthropometrist (isak level 2), whose technical error was less, than which was recommended by isak. the 5-km running time and 10-km cycling time were evaluated as minute : seconds (m : s). the correlation between anthropometric profile and cycling and running performances were tested using interclass correlation (icc) along with 90% confidence interval (ci) limits. all collected data was compiled on microsoft excel 2007, and analyzed using the statistical package for social sciences (spss inc. this was a cross - sectional study conducted at a sports camp in hamilton, new zealand. the study population comprised of junior elite triathletes who were selected for the new zealand national squad. all junior elite triathletes who were selected for the new zealand national squad were invited to the camp. subsequently, athletes who agreed to be the part of investigation and showed a willingness to sign informed consent were examined in the study. the standard procedure for anthropometric profiling by the international society for advancement of kinanthropometry (isak) guideline was followed for each athlete. criterion anthropometrist (isak level 3 accredited) marked the key anthropometric positions on the triathletes and then directed the athletes towards three stations. this included skinfold (8 measurements), length (7 measurements), girth (7 measurements), breadths (7 measurements), body weight and height. all triathletes were measured by a trained anthropometrist (isak level 2), whose technical error was less, than which was recommended by isak. a 5-km running performance the 5-km running time and 10-km cycling time were evaluated as minute : seconds (m : s). the correlation between anthropometric profile and cycling and running performances were tested using interclass correlation (icc) along with 90% confidence interval (ci) limits. all collected data was compiled on microsoft excel 2007, and analyzed using the statistical package for social sciences (spss inc., chicago, il, usa) program, version 15. the participation in the study was voluntary. prior to anthropometric profile testing, written informed consent was obtained from all participants. the study included 11 junior elite triathletes (6 females, 5 males ; av. furthermore, the overall performance data for the 5-km run on two occasions and 10-km cycling time trial for top 5 athletes are given in table 2. the individual body measurements, (i.e. skinfold and girth average) the top 5 triathletes are given in table 3. the findings of correlation analysis between skinfold measurements and athlete performance data are given in table 4. similarly, the findings of correlation analysis between girth measurements and athlete performance data are given in table 5. overall, a non - significant positive correlation was observed between the sum of eight skinfolds and running performance (icc : 0.10 ; 90% ci : 0.68 0.77 ; p>0.05) as well as cycling performance (icc : 0.15 ; 90% ci : 0.65 0.79 ; p>0.05), which suggested athletes with greater body fat may have a better athletic performance. conversely, a significant negative correlation was observed between calf girth and running performance (icc:0.66 ; 90% ci : 0.94 0.12 ; p0.05). this study was to investigate whether the physical traits of calf girth or sum of eight skinfolds (anthropometry) correlate with running or cycling performances in the triathlon event. from the data, it can be said that athletes with i d number 13 and 17 had a very close overall performance time. athlete number 13 had a higher thigh girth than athlete number17, and secured a faster time in the 5-km run. athlete number 17 had a higher calk girth than athlete number 13, and had better cycling performance. however, it should be noted that athlete number10 secured first place in both events despite having a lower calf and thigh girth than athlete number 8. additionally, the anthropometric data obtained by ackland. (4) on world elite and world junior triathlons were compared with new zealand junior triathlons from the present study. new zealand female athletes had a lower amount of 8 skinfolds by 8% ; had a larger arm span by 12% ; had about 5% less chest girth, waist girth, femur breadth, and thigh girth ; had a 4% longer forearm length ; and a 3% longer hand length as compared to the world junior athletes. similarly, new zealand male athletes had a lower sum of 8 skinfolds by 17% ; had a longer thigh length by 9% ; had a lower thigh girth by 5% ; a lower chest girth by 6% ; a lower waist girth by 4% ; and a lower femur breadth by 4% as compared to the world junior athletes. the stature of new zealand s athletes was longer than world junior athletes by 3%. the comparison of anthropometric profile between the new zealand junior triathletes and the world junior triathletes could help in identifying and selecting youth players from schools and the communities. it can be considered as a little step towards an era where sports will select the athlete rather than the athlete select the sport. however, it should also be considered that if only by body shape or by physical characteristic one could determine the success of an athlete, it could be easier to judge the winner. although many other aspects are involved in it, we are of strong opinion that body structure or shape is a major contributing factor in choosing an athlete. the present study investigated whether the physical traits of calf girth or sum of eight skinfolds (anthropometry) correlate with running or cycling performances of junior elite triathletes from new zealand. the study indicated a correlation between the calf girth and performance, suggesting that the triathletes ran well if they had smaller calves. we believe that anthropometric data can help in predicting the ideal body profile for specific athletic events, and may help in choosing the ideal athlete. | introductionthe triathlon involves a combination of three separate disciplines - swimming, cycling and running. to date, very few studies have been conducted on the anthropometric characteristics of the new zealand junior elite triathletes. the aim of this study was to determine the correlation between physical traits of calf girth or sum of eight skinfolds (anthropometry) and running or cycling performances in the triathlon event.methodseleven junior elite triathletes (6 females, 5 males ; (av. age : 17) who were selected for the new zealand national squad, were examined in this cross - sectional study. all athletes were measured for the complete anthropometric profile, as per the international society for advancement of kinanthropometry (isak) guidelines. it was then correlated with the cycling and running performances using interclass correlation (icc) with 90% confidence interval (ci) limits.resultsa non - significant positive correlation observed between eight skinfolds tests on running performance (icc : 0.10 ; 90% ci : 0.680.77 ; p>0.05) and biking performance (icc : 0.15 ; 90% ci : 0.650.79 ; p>0.05), suggested athletes with greater body fat may render a better athletic performance. conversely, a significant negative correlation was observed between calf girth and running performance (icc:0.66 ; 90% ci : 0.94 0.12 ; p0.05).conclusionanthropometric data can help in predicting an ideal body profile. this research indicates the similarities and differences of the new zealand junior profile and the world junior profile. |
malaria is one of the major public health problems worldwide causing more than one million deaths each year. it is widespread in hot humid regions of africa, asia, and south and central america. according to world health organization (nearly 85% of malaria is caused by plasmodium falciparum and is responsible for about 90% of the deaths from malaria. malaria has been consistently reported as one of the three leading causes of morbidity and mortality in ethiopia. malaria - related morbidity and mortality has been increasing in sub - saharan africa, primarily as a result of increased resistance to the common first line drugs chloroquine (cq) and sulphadoxine - pyrimethamine (sp) [4, 5 ]. accordingly, the who recommends that treatment policies for falciparum malaria in all countries experiencing resistance to monotherapy should be combination therapies containing artemisinin derivatives. artemisinin antimalarial drugs decrease parasite density more rapidly than other antimalarial drug when used alone. the short half - life of the artemisinin derivatives minimizes the period of parasite exposure to subtherapeutic blood levels. artemether reduces parasitaemia, and lumefantrine eliminates residual parasites. as the parasites are never exposed to artemether alone, this is thought to minimize the development of resistance. however, the wide spread use of artemisinin - based combination therapies (acts) could have a major impact on the treatment of malaria. widespread resistance of malaria parasites to commonly available anti - malarial drugs has necessitated countries to review and deploy new anti - malarial drug policies to ensure effective case management. thus, this study aimed to evaluate the clinical and parasitological therapeutic efficacy of artemether - lumefantrine (al) or coartem against uncomplicated p. falciparum malaria in alamata district, north ethiopia. a prospective study was conducted in alamata district, tigrai regional state, north ethiopia, during august the sample size was determined based on who standard protocol assuming the anticipated population proportion of clinical failure of 20%, with 95% confidence interval (pi), 10% precision, and 20% dropout, 73 patients were enrolled. patients above 6 months of age, slide confirmed infection with p. falciparum, initial density of 1000100,000 asexual parasite/l, and temperature 37.5c were included. patients with pregnancy, mixed infection, infections other than malaria, history of allergy to drugs tested, presence of severe malnutrition, danger signs, and history of hypersensitivity reactions to the drug were excluded. falciparum positive cases were treated with 6 doses of al scaled by age / weight as outlined in the monogram of the producer. al was given as a tablet of 20 mg of artemether and 120 mg of lumefantrine (novartis, geneva, switzerland). patients were observed for at least 30 min to ensure that they do not vomit the drug. when vomiting occurred, the full - treatment dose was repeated. the first dose was given on observation and the rest five doses taken at home under the supervision of trained community health workers. those who agreed to participate in the study had informed to come back during the scheduled visit for followup on days 1, 2, 3, 7, 14, 21, 28 for both clinical and parasitological assessment. the health personnel involved in data collection was oriented on the use of the study procedures designed by the who. screening was done by a health officer in an outpatient setting to identify patients meeting the criteria. data including age, sex, address, and clinical findings (axillary temperature of patients) during screening were retrieved. patients who did not meet these basic enrollment criteria were treated in accordance with routine practice. finger prick blood sample collection, preparation, and staining of blood slides were the followed procedures outlined in malaria microscopy, using giemsa staining at ph 7.2. the blood films were prepared for microscopy by a laboratory technician before treatment on day 0 and on days 1, 2, 3, 7, 14, 21, and 28 that the patient was brought to the health center before the next scheduled visit. one of the slides was used for rapid staining with 10% giemsa stain for 1015 minutes and read while the patient was in attendance. the second slide was used for subsequent standard staining with 3% giemsa stain for 3045 min. was examined for the presence of parasitaemia by counting the number of asexual parasites and the number of white blood cells (wbcs) in limited microscopic fields. adequate parasitaemia for enrollment requires at least 1 parasite/68 wbcs, which corresponds to approximately 1000 asexual parasites/l. the second blood smear was examined to determine parasite density and the number of asexual parasites per hpf according to the method described in the who protocol. parasitaemia was measured by counting the number of asexual parasites against a number of leucocytes in the thick blood film, based on a putative mean count of 8000 leucocytes per l. the number of asexual parasites was counted against 200 + leucocytes using hand tally counter. thus, parasitaemia was calculated using the formula : parasitaemia/l = number of parasites 8000/number of leucocytes. when 500 + parasites were identified before counting 200 leucocytes, counting was stopped and parasitaemia was calculated according to the formula above. a blood slide was declared negative when the examination of 100 hpf did not show the presence of asexual forms of p. falciparum. quality control was of microscopy results of parasite counts that were made by cross - checking 10% of the total slides. based on the who 2003 modified protocol, the following definitions of therapeutic responses are used. early treatment failure (etf)it is the development of danger signs for severe malaria on days 1, 2, or 3 in the presence of parasitemia : parasitemia on day 2 higher than day 0 count irrespective of axillary temperature ; parasitemia on day 3 with axillary temperature 37.5 c ; parasitemia on day 3 25% of count on day 0. it is the development of danger signs for severe malaria on days 1, 2, or 3 in the presence of parasitemia : parasitemia on day 2 higher than day 0 count irrespective of axillary temperature ; parasitemia on day 3 with axillary temperature 37.5 c ; parasitemia on day 3 25% of count on day 0. late clinical failure (lcf)it is the development of danger signs for severe malaria after day 3 in the presence of parasitemia, without previously meeting any of the criteria of etf ; presence of parasitemia and axillary temperature 37.5c or history of fever on any day from day 4 to day 28, without previously meeting any of the criteria of etf. it is the development of danger signs for severe malaria after day 3 in the presence of parasitemia, without previously meeting any of the criteria of etf ; presence of parasitemia and axillary temperature 37.5c or history of fever on any day from day 4 to day 28, without previously meeting any of the criteria of etf. late parasitological failure (lpf)it is the presence of parasitemia on any day from day 7 to day 28 and axillary temperature 15 years of age 29 (39.7%) (table 1). the median age of the study population was 14 years (270 years), and the majority 45 (61.6%) of the study cases were males. the mean body weight was 36.2 17.3 kg (range : 974 kg). on recruitment, 64/71 (90.1%) of the patients receiving al had body temperature > 37.6c. the association between initial parasite density at recruitment and length of parasite clearance time was significant (p = 0.030) (tables 2 and 3). concerning the fever clearance time and parasite density at day 0, no significant association was found (p = 0.067) (table 3). clinical failure (lcf) was 2.8% observed on day 21 and day 28, 1.4% lcf on each days. the cure rate (acpr) was 97.2% on the study site and the parasite clearance is rapid and complete clearance of parasitaemia within 32 hours was observed in all (100%) patients. the mean parasite clearance time (pct) was 26.5 2.3 hrs. proportion of patients with gametocytes at enrolment was 1.4% by day 7. from day 14 fever and parasite cleared rapidly over 32 hours after starting treatment (table 4). the rate of parasite clearance was 100% after 32 hours of starting treatment and patients were no longer parasitaemic by day 2. the kaplan meier survival analysis of the data showed estimates of success of 1.00 from day 0 to 20, 0.986 from day 21 to 27 and 0.972 on day 28. the estimate of failure cumulative incidence was 0.00 from day 020, 0.014 from day 2127, and 0.028 on day 28. the proportion of success and failure of patients at each point in time is not significant as the (95%ci, 0.9331.010) and (0.0670.010), respectively. thus, the estimate of success (cure) rate was 97.2% and estimate of failure was 2.8% during the 28 days followup. in the intent to treat analysis, the lost to followup were included in the denominator of the study analysis, but were excluded in the per - protocol analysis approach. the study outcomes by follow - up days showed 0% on day 7 and day 14, but 1.4% lcf on day 21 and 2.8% lcf by day 28. the acpr was 100% on day 7 and day 14 but 98.6% on day 21 and 97.2% on day 28 (table 5). al treatment failure was 0% after 14 days and 0.09% after 28 days followup in the first line treatment of uncomplicated p. falciparum malaria at national level. the present study showed that the standard six - dose of al first line treatment was effective against uncomplicated p. falciparum malaria with rapid clearance of fever and parasitaemia and cure rate of 97.2% in 28 days. according to the kaplan meier survival analysis, the data obtained was 0.972 (95%ci, 0.9331.010) showing the effectiveness of the drug. the finding 97.2% of adequate clinical and parasitological response (acpr) is consistent with the therapeutic efficacy study done in the country during deployment of the drug in 2004. the aggregated mean of clinical and parasitological treatment response to al was 100% and 99.01% (pcr unadjusted) for 14 and 28 days followup, respectively. in addition the study showed consistency with other therapeutic efficacy studies with 100% adequate clinical and parasitological response. another study on therapeutic efficacy of al for the treatment of uncomplicated p. falciparum malaria in rural endemic area of ethiopia showed pcr unadjusted acpr of 95.8% and 96.2%, respectively, and the pcr corrected acpr in the two sites was 96.8% and 97.4%, respectively. this is much higher than the study done in african children where they found 86.5% acpr without pcr correction. the higher efficacy of al in this study may be due the relatively shorter period of deployment. another study conducted in zambia, which assessed therapeutic efficacy of a pediatric formulation of al for the treatment of uncomplicated malaria in children less than 10 kg in 2005 was same acpr after 28 days followup (100% pcr corrected but 96.0% pcr uncorrected). a study conducted in india in 2006 also showed a cure rate of 100% (pcr corrected) in the treatment of uncomplicated p. falciparum malaria with six - dose al regimen. our study showed fast parasite clearance time with mean time of 26.5 hrs and good compliance due to fixed dose combination and short treatment duration. the failure to adherence in this study was 2 (2.7%).the fast parasite and fever clearance is due to the rapidly absorbed and its main active metabolite dihydroartemisinin (dha) achieve a fast reduction in parasite biomass and prompt symptomatic improvement, while the lumefantrine concentrations that persist in the blood after the three days treatment course eliminate any remaining parasites to prevent recrudescence. the proportion of female patients was found low (38.4%) in the study group compared with male patients (61.6%). the proportion of female patients was found 30% in a study done in two study sites in zambia with 49% and 54.6%. in a study conducted among children the low proportion of female patients in our study may be related to difference in health seeking behavior rather than difference in disease prevalence. similar mean temperature 38.5c 0.6 was reported from sudan and 38.7c from zambia. in our study, the mean fever clearance and parasite clearance times were 26 and 26.5 hours, respectively. in a study conducted in 2003 for the efficacy of al for uncomplicated malaria, fever clearance and parasite clearance time were 47 and 36 hours, respectively. in another study, the median fever clearance time was 24 hours and the median parasite clearance time 48 hours. in our study the median fever clearance and parasite clearance time were 25 and 26 hrs, respectively. the variation of fever and clearance time in different areas may be due to differences in parasite density at day 0. it may also be due to differences in times of the drug deployments in the different regions. generally, the fever clearance time was fast because the drug has antipyretic property and the drug is fast acting on different stages of the parasite which makes the parasite clearance time shorter. bivariate analysis showed that the only base line characteristic that affected parasite clearance time was parasite density at day 0. there was an association between the mean parasite clearance time and parasite density (p = 0.030). this was because of the higher density of the parasite at day 0 which prolongs the parasite clearance time. regarding with temperature at recruitment and clearance time association, it was not found to be significant (p = 0.392 and 0.178) and this may be due to uses of antipyretic drug like paracetamol. similarly, there was no association between parasite density at day 0 and fever clearance time (p = 0.067) for the same reasons mentioned above. this may have impact in reduced absorption of the drug.in conclusion, al was safe and effective drug for the treatment of uncomplicated falciparum malaria in the study area 5 years after the deployment of the drug. this highly efficacious drug showed rapid fever and parasite clearance and the efficacy (97.2%) met the who criteria for efficacy (> 95%) in malaria endemic regions. the efficacy of this act needs to be carefully monitored periodically since the treatment failures can occur due to resistance as well as subtherapeutic levels due to inadequate absorption or low adherence to the drug. for better absorption, al was safe and effective drug for the treatment of uncomplicated falciparum malaria in the study area 5 years after the deployment of the drug. this highly efficacious drug showed rapid fever and parasite clearance and the efficacy (97.2%) met the who criteria for efficacy (> 95%) in malaria endemic regions. the efficacy of this act needs to be carefully monitored periodically since the treatment failures can occur due to resistance as well as subtherapeutic levels due to inadequate absorption or low adherence to the drug. for better absorption | introduction. multidrug resistance of plasmodium falciparum is spreading throughout africa. this has posed major challenges to malaria control in sub - saharan africa. objective. the aim of the study was to evaluate the efficacy of artemether - lumefantrine for the treatment of uncomplicated plasmodium falciparum malaria in north ethiopia. methods. this prospective study was undertaken during august november 2009 on 71 malaria patients that fulfilled the inclusion criteria set by the who. patients were followed up for 28 days. thick and thin blood films were prepared by giemsa stain for microscopy to determine parasite density. a standard six - dose regimen of artemether - lumefantrine was administered over three days and was followed up with clinical and parasitological evaluations over 28 days. results. the cure rate (acpr) was found to be high (97.2%) in this study. the parasite and fever clearance time was also rapid. artemether - lumefantrine for the treatment of acute uncomplicated plasmodium falciparum malaria in the study area showed 97.2% cure rate and only 2.8% failure rate. conclusion. the result showed that the drug could continue as first line for the treatment of uncomplicated plasmodium falciparum malaria in the study area. the efficacy of artemether - lumefantrine needs to be carefully monitored periodically in sentinel sites representing different areas of the country. |
antibodies are multifunctional glycoproteins, able to bind antigens through variable fab domains and cellular receptors via the constant fc region. this dual functionality enables the recruitment of the cellular immune system to sites of infection by antibody - dependent cellular cytotoxity (adcc) and antibody - dependent cellular phagocytosis (adcp), and can lead to the localized activation of the complement system. glycan and protein engineering of the fc domain can generate therapeutic monoclonal antibodies with tailored receptor binding functionality. in contrast to chemical and chemoenzymatic methods to modulate glycan structures, we use glycosidase inhibitors and a cell line deficient in a glycosyltransferase to generate antibody glycoforms containing specific carbohydrate structures. the fc region of immunoglobulin g (igg) is a homodimer consisting primarily of heavy chain c2 and c3 domains. protein interface, occluding over 1100 of protein surface, and adopt rigid conformations that exhibit little structural variation. in contrast, the c2 domain protomers have only been observed to interact via glycan glycan contacts between opposing n - linked chains at asn297. glycan - mediated maintenance of the spacing between the c2 domains is critical for cellular fc receptor (fcr) binding, which occurs asymmetrically at the tip of the c2 domains and lower hinge region. deglycosylation, for example, by bacterial endoglycosidases, leads to disruption of c2 spacing and significantly impairs fcr binding. the impact of asn297 glycosylation upon fc structure is not limited to influencing c2 spacing. these glycan protein contacts are believed to limit both the processing by golgi - resident glycosyltransferases and the conformational freedom of the glycan. this model is supported by an nmr study, which proposes that fc glycans exist in an equilibrium with an approximately equal proportion of a free state, with highly mobile glycans, and a less mobile bound state, observable by x - ray crystallography, with ordered protein glycan interactions less accessible to enzymatic processing. the glycosylation exhibits limited processing and consists of a predominantly biantennary complex - type framework with partial occupancy of galactose, core 16-linked fucose, low levels of bisecting glcnac, and sialic acid. this limited processing is in contrast to the highly sialylated complex - type glycosylation typically observed on secreted glycoproteins. the human fcrs (fcri, fcriia, fcriib, and fcriiia) display binding properties dependent upon the presence and composition of the fc glycan. for example, afucosylated antibody glycoforms, which may find utility in anticancer treatment, are inflammatory and exhibit enhanced adcc due to elevated binding to the activatory fcriiia. in contrast, anti - inflammatory igg glycoforms display increased levels of terminal sialylation and are under investigation for enhanced intravenous immunoglobulin therapy. biosynthetic fc precursors have also been investigated for therapeutic applications due to their altered fcr - dependent effector functions. monoclonal antibodies found in the early steps of carbohydrate maturation including oligomannose- or afucosylated hybrid - type glycans, for example, display increased affinity for fcriiia and enhanced adcc functionality, albeit with potentially elevated serum clearance. here, we have generated and characterized a panel of such glycoform intermediates and present the crystal structure of the key precursor bearing hybrid - type glycosylation. in the context of the biosynthetic pathway of n - linked carbohydrates, this glycoform represents the intermediate formed between the immature oligomannose and the native, complex - type states. this fc glycoform, generated by recombinant mammalian protein expression in the presence of the golgi -mannosidase ii inhibitor, swainsonine, was crystallized and subjected to x - ray crystallographic analysis to 2.4 resolution. together with thermostability analyses, the structure provides a model for the conformational transitions that igg fc undergoes upon glycoprotein maturation and provides a template for the structure - guided engineering of therapeutic antibodies. a panel of igg1 fc glycoforms, corresponding to key stages of the mammalian n - linked biosynthesis after calnexin / calreticulin - mediated protein folding, was generated using either a lectin - resistant cell line deficient in glycosyltransferase activity or by the use of glycosidase inhibitors (figure 1). the n - linked glycosylation processing pathway (left) and maldi - tof ms analysis of associated igg1 fc glycoforms (right). following protein folding and hydrolysis of the glucose cap, glycoforms were isolated by stalling the pathway at sequential stages of biogenesis. (a) (b) the man5glcnac2 glycoform resulted from expression in a glcnac transferase (gnt) i - deficient cell line. (c) hybrid - type glycosylation resulted from expression in the presence of the golgi -mannosidase ii (gmii) inhibitor, swainsonine. (d) complex - type glycosylation resulted from activity of golgi - resident glycosyltransferases. the following symbols were used to represent glycans and are shown as a key in panel d : yellow, galactose ; blue, glcnac ; green, man ; red with black dot, fucose ; pink, sialic acid. linkage positions are shown by the angle of the lines linking the sugar residues (vertical line, 2-link ; forward slash, 3-link ; horizontal line, 4-link ; back slash, 6-link). we isolated igg1 fc bearing man9glcnac2, man5glcnac2, hybrid-, and complex - type glycan structures. these glycoforms are generally representative of the carbohydrates appearing in the er, and the early, medial, and late golgi apparatus, respectively. the n - linked glycosylation of each fc glycoform was assessed by positive ion matrix - assisted laser desorption / ionization (maldi) time - of - flight (tof) mass spectrometry (ms) of enzymatically released glycans (figure 1). expression of fc in the presence of the er and golgi 12-mannosidase inhibitor, kifunensine, resulted in a largely homogeneous man9glcnac2 glycan (m / z = 1905.6 ; figure 1a) with limited processing to the man8glcnac2 derivative (m / z = 1743.6 ; figure 1a). expression of the fc region in gnt i - deficient human embryonic kidney (hek) 293s cells resulted in a similarly homogeneous spectrum dominated by man5glcnac2 glycans (m / z = 1257.4 ; figure 1b). the next glycoform in the n - linked biosynthetic pathway, the hybrid - type glycan, was isolated using the golgi -mannosidase ii inhibitor, swainsonine. swainosine prevents hydrolysis of the mana and manb saccharides of the 6-arm of the trimannosyl core. however, this inhibition does not impede the addition of a glcnac residue to the 3-arm man4 by gnt i or subsequent structural elaborations. consistent with this mode of action, maldi - tof ms analysis of the n - linked glycans of igg1 fc expressed with 10 m swainsonine revealed an heterogeneous spectrum of putative hybrid - type glycans indicating variable terminal 14-linked galactose, bisecting 14-linked glcnac, and a population of sialylated hybrid - type glycans (m / z = 2081.7 ; figure 1c). finally, fc bearing complex - type glycans were generated using hek 293 t cells with no inhibitors present. maldi - tof ms analysis revealed biantennary complex - type glycans with variable terminal galactose (figure 1d). this spectrum is consistent with previous observations that fc glycosylation is highly protein - directed and substantially less processed than other glycoproteins similarly expressed using the phlsec expression vector in hek 293 t cells. levels of both galactose and sialic acid in the hybrid - type spectrum were higher than those observed for the complex - type glycoforms. as sialic acid can alter the ionization efficiency of glycans in mass spectrometry, we also subjected the hybrid and complex - type glycans to electrospray ionization (esi) mass spectrometry (figure 2). ms of the glycans released from the fc glycoform bearing complex - type glycans (figure 2b). in contrast, the spectrum of glycans deriving from fc expressed in the presence of swainsonine contained a prominent peak at m / z 2035.7 corresponding to a sialylated core - fucosylated hybrid - type glycan (figure 2a). negative ion electrospray mass spectra of recombinant igg1 fc n - linked glycans following expression in the (a) presence and (b) absence of the golgi -mannosidase ii inhibitor, swainsonine. neutral glycan ions are [m + h2po4 ], sialylated glycans are [m h ]. isomeric assignments were determined by esi ms / ms (figure 3). the presence of a minor population of man4-based hybrids was detected in the fragmentation spectra by very low abundance a3 ions at m / z 424 (figure 3b, d). isomeric assignments of the hybrid - type structures were determined by negative - ion esi ms / ms of the enzymatically released glycans. the fragmentation spectra of the most abundant species are presented in figure 3. the m / z values of the d - type ions, as defined by harvey, are a signature of the 6-arm. these d - type ions are annotated in the spectra and are formed by the formal loss of the 3-arm and the fucosylated di - n - acetylchitobiose core. similarly, the d-type ions, formed by cleavage of the 6-arm, reveal the cluster of mannose residues on the 6-arm. bisecting glcnac residues are revealed by an abundant [d 221 ] ion at m / z 629 and the virtual absence of a d - type ion (figure 3b). the absence of an ion at m / z 306 shows that the sialic acid residue is 23-linked (figure 3a). negative ion fragmentation spectra of the major n - linked glycans from the hybrid - type gycoform of igg1 fc. neutral glycan ions are [m + h2po4 ], while the sialylated glycan forms a [m h ] ion. (a) sialylated, fucosylated hybrid glycan (man5gal1glcnac3fuc1neunac1), m / z 2035.7. (b) bisected, fucosylated hybrid glycan (man5glcnac4fuc1), m / z 1883.6. (d) agalactosylated, fucosylated hybrid glycan (man5glcnac3fuc1), m / z 1680.5. the nomenclature describing fragmentation ions follows that of domon and costello and is distinct from the carbohydrate residue labels (figure 1). to assess the level of sialic acid in the hybrid - type glycans, we expressed an intact igg1 antibody hybrid - type glycoform and subjected the fluorescently derivatized glycans to normal - phase hplc. this analysis revealed that 20% of these swainsonine - induced hybrid - type glycans were sialylated (figure 4a). ms data of igg1 fc glycans, no sialylated structures were observed in igg produced in the absence of swainsonine (figure 4b). swainsonine is not known to affect galactosyltransferase or sialyltransferase activity, as confirmed by the similar glycan profiles of the same glycoproteins expressed in hek 293 t cells in the presence of swainsonine and in hek 293 t lec36 cells that are devoid of golgi -mannosidase ii activity. similarly, there was no evidence of increased terminal processing upon disruption of golgi -mannosidase ii activity as compared to glycoproteins expressed in hek 293 t cells. therefore, the increased abundance of galactose and sialic acid residues in the 3-arm of the hybrid - type glycoform, as compared to the complex glycoform, may be indicative of increased steric accessibility of the fc glycans to processing enzymes. one explanation for the increased 3-arm processing of the hybrid - type glycoform as compared to that of the complex - type glycan is that the accessibility of the glycans is influenced by composition and structure of the glycan because of the highly processed composition of the hybrid - type glycoform, we hypothesized it would exhibit distinct glycan protein packing interactions with altered stability. we assessed our panel of fc glycoforms by differential scanning flourimetry (figure 5). this analysis revealed that relative to the melting temperature (tm) of the complex - type glycoform, the other glycoforms exhibited reduced tm values : man9glcnac2 (tm = 2.8 0.7 c), hybrid - type glycoforms (tm = 4.0 0.7 c), and endoglycosylated - treated fc (5.2 1.0 c). therefore, in addition to reducing glycan accessibility to glycosyltransferases, the enzymatic action of golgi -mannosidase ii, to produce complex - type glycans, is permissive for the biosynthesis of a more thermally stabilized fc structure. we sought to investigate the structural basis for this observation by x - ray crystallography. hplc analysis of fluorescently labeled n - linked glycans from recombinant igg1expressed in hek 293 t cells in (a) the presence and (b) the absence of the gnt i inhibitor, swainsonine. the lower panels show the spectra of glycans following digestion with arthrobacter ureafaciens sialidase. single thermostability measurements of oligomannose (man9glcnac2), hybrid, and complex - type glycoforms are shown. crystallographic structures of igg fc have been reported for a number of glycoforms ranging from oligomannose man9glcnac2, to homogeneous complex - type, and endoglycosidase - deactivated and aglycosylated states. however, no crystallographic information is available for the hybrid - type fc glycoform that represents the biosynthetic transition point between oligomannose and complex - type glycosylation states. the hybrid - type glycoform crystallized in the primitive orthorhombic spacegroup, p212121, with one homodimer in the asymmetric unit. the c3 protomers were very similar in structure (0.3 root - mean - square deviation over 103 equivalent c residues) and exhibited noncrystallographic 2-fold rotational symmetry. however, the orientations of the c2 protomers were arranged such that they introduced asymmetry to the homodimer, as has been frequently observed (figure 6a, b). the protein and carbohydrate components of the c2 domain of one chain (referred to here as chain a) were largely ordered, while those from the other (chain b) exhibited higher b - values where some c3-distal loop regions and associated glycan residues were disordered and not clearly visible in the electron density (figure 6a). i(hkl)|/hklii(hkl;i), where i(hkl;i) is the intensity of an individual measurement and i(hkl) is the average intensity from multiple observations. rwork = hkl||fobs| k|fcalc||/hkl|fobs|. rfree is calculated as for rwork, but using only 5% of the data, which were sequestered prior to refinement. (a) the fc structure with the protein moiety shown as a gray ribbon with the n - linked glycan of n297 shown as sticks. carbohydrate residues are colored and labeled as in figure 1. a maximum likelihood weighted 2fo fc electron density map is plotted around the glycan at 1. (b) panel a rotated 70 with a close - up view of the protein and carbohydrate components of the c2 domain from chain a of the hybrid fc crystal structure. (c) overlay of the protein backbone of the hybrid (gray), oligomannose (cyan ; pdb accession code 2wah), and complex - type (pink ; pdb accession code 3ave) glycoforms. (d) the overlay in panel c rotated 90 with a dashed line corresponding to a 17 distance between equivalent ser298 c atoms in the hybrid- and complex - type glycoforms. the different configurations of the c2 domains may arise due to differences in stabilizing crystallographic packing interactions. this analysis reveals that the c2 domain of the more ordered chain a exhibits 37% more buried surface area with symmetry - related molecules than does the corresponding domain in chain b. in chain a of our hybrid - type glycoform, we observe electron density for eight saccharide residues, corresponding to the entirety of the fucosylated oligomannose component of the hybrid - type glycan (figure 6b). the 3-arm is entirely solvent exposed with the nearest component of a symmetry - related molecule located 9 away. while we can not formally exclude the possibility of selective crystallization of a subset of hybrid - type glycoforms, this distance, and the large accessible volume surrounding the 3-arm, provides no evidence for such a phenomenon. from the observation that the conformations of complex - type glycans are not influenced by the presence of fucose, we suggest that the structure of the man5glcnac2 component of the hybrid - type glycan reported herein is likely to resemble the man5glcnac2 glycoform that occurs in the preceding stage of the pathway (figure 1). this assertion, combined with analysis of the previously reported man9glcnac2 fc structure and the series of complex - type structures by krapp., now enables us to propose a model of glycan maturation during antibody biogenesis. the folded man9glcnac2 glycoform is generated following the hydrolysis of the glucose cap and consequent release from the calnexin / calreticulin folding check - point. all available structures of fc glycoforms show a conserved mode of interaction of the saccharide residues proximal to the protein attachment site. the man14glcnac14glcnac core and the observable 3-arm residues exhibit highly similar conformations and glycan protein packing interactions. in contrast, the 6-arm residues exhibit divergent conformations reflecting the different chemical compositions and/or surrounding environments of the glycan residues (figure 7). the structural rearrangements that occur within the oligosaccharide when carbohydrates are modified are illustrated by the hydrolysis of terminal 12 mannose residues of the man9glcnac2 glycoform. the mand3 residue in the man9glcnac2 structure anchors the oligosaccharide chain to the protein surface at the junction of the c2 and c3 domains (figure 7a). as the solvent accessible mand1 and mand2 residues are disordered in the crystal structure, hydrolysis of mand3 is likely to induce the observed rearrangement of the 6-arm and cause the 6 shift of manb (figure 7a, b). this cleavage also results in the associated relaxation of the man416man3 linkage (from = 69, = 178, = 62 to = 77, = 101, = 30 ; figure 7a, b). despite this movement, the man4 residue in the man5glcnac2 glycoform is orientated in a direction opposite to that of complex - type structures (figure 7c). this orientation is maintained by the presence of mana and manb residues of the 6-arm that sterically prevent further rotation of the man416man3 linkage (figure 7b). the action of gnt i on man5glcnac2 catalyzes the formation of hybrid - type glycans and allows downstream carbohydrate processing (figure 1). gnt i transfers 12-linked glcnac to the man4 residue of the 3-arm to form the glcnac512man4 linkage (figure 7b, c). as for many structures of complex - type glycoforms, we do not observe interpretable electron density for the solvated and mobile residues on this arm. additionally, gnt i catalysis also renders the core glcnac residue (glcnac1) of the hybrid - type glycan susceptible to 16-fucosylation. we observe electron density for the fucose and note the conformation closely resembles that of the complex - type glycoform (figure 7b, c). this supports our assertion that man5glcnac2 glycans are not affected structurally by fucosylation. golgi -mannosidase ii hydrolyses the 13-linked mana and 16-linked manb residues from the 6-arm and is dependent upon the prior activity of gnt i (figure 1). elimination of these residues relieves steric restraints around the 6-arm and allows the reorientation of the man416man3 linkage (from = 77, = 101, = 30 to = 62 = 171, = 175 ; figure 7b, c), causing close alignment of the glycan to the protein surface. structural transitions of igg1 fc glycans between (a) oligomannose - type (pdb accession code 2wah), (b) hybrid - type, and (c) complex - type glycosylation (pdb accession code 3ave), as observed by x - ray crystallography. the central column shows a view with the 6-arm in the foreground. the right - hand column is a close - up and shows the conformational changes occurring within the 6-arm ; an asterix indicates the location of the c6 carbon of the man4 residue. the protein surface is colored gray, the f243 side - chain is colored pink, and the glycan is colored as in figure 1 except in the close - up where the oxygen atoms of mannose residues are shown in red. following this rearrangement, gnt ii catalyzes the transfer of 12-linked glcnac to man4, allowing the formation of hydrophobic stacking interactions between glcnac5 and phe243 (figure 7c). the formation of these canonical glycan protein interactions is consistent with the increased stability (figure 5 and supporting information figure s1) and decreased enzymatic processing of the mature complex - type glycoform relative to the artificially trapped hybrid - type glycoform (figures 1, 2, and 4). limited downstream compositional heterogeneity of the complex - type glycoform subsequently arises from the partial transfer of galactose to terminal glcnac5 and glcnac5 residues and leads to little change with respect to carbohydrate conformation or thermal stability. evidence for the suppression of galactosylation and sialylation by the interaction between glcnac5 and phe243 is provided by the analysis of igg from a patient with a homozygous mutation in the mgat2 gene.mgat2 encodes gnt ii that catalyzes the transfer of the 6-arm glcnac5 to man4. the igg fc glycans isolated from the patient lacked 6-arm glcnac5 but exhibited significantly elevated 3-arm processing as compared to wild - type structures with the majority of glycans containing the neunac726gal614glcnac5 motif. together with our structural observations, we suggest that the action of golgi -mannosidase ii and gnt ii enhance the glycan protein interface and limit glycosyltransferase accessibility to the 3-arm. the use of glycosidase inhibitors and cell - lines with genetically modified glycan processing enzymes offers a powerful route to the isolation of glycoproteins with defined glycan structures. these methods offer an attractive alternative to direct chemical synthesis and can be readily combined with chemoenzmatic methodologies. analysis of isolated biosynthetic intermediates of igg1 fc revealed distinct differences in the susceptibility of discrete glycan states to glycosyltransferases. specifically, we have shown by mass spectrometry that the trapped hybrid - type glycans are more readily accessible to galactosyl and sialyltransferases than are complex - type structures. the generation of hybrid - type glycoforms with increased fc sialylation is of note given the enhanced anti - inflammatory functionality exhibited by sialylated fc in, for example, intravenous immunoglobulin therapy. the biosynthetic intermediates also exhibited reduced stability, an important parameter in the development of antibody therapeutics. through our x - ray crystallographic analysis, we correlate this stability to structural transitions that occur during antibody biogenesis. we offer a molecular - level explanation for how stability arises from rearrangements of the glycan we deduce that glycan - dependent stabilization occurs during golgi -mannosidase ii and gnt ii processing, which respectively cause the relaxation of the 6-arm toward the protein surface and the formation of hydrophobic glycan protein interfaces. given the promising portfolio of effector functions exhibited by igg bearing oligomannose and hybrid - type glycans, knowledge of their three - dimensional structure and defined molecular transitions provides a template to support structure - guided stabilization and optimization for the clinic. j00228) was cloned into the phlsec vector and transiently expressed in hek 293 t cells (atcc number crl-1573), gnt i - deficient hek 293s cells, and in the presence of mannosidase inhibitors to isolate glycoforms of distinct composition. transfections were performed using 2 mg of dna per liter cell culture medium as previously described. fc bearing man9glcnac2 and hybrid - type glycosylation were obtained by expression in the presence of 20 and 10 m of the inhibitors, kifunensine and swainsonine, respectively (toronto research chemicals, canada). inhibitors were added at the time of transfection, and the supernatants were harvested after 5 days. igg1 fc glycoproteins were purified at room temperature by immobilized metal - affinity chromatography (ge healthcare, bucks, uk) and size exclusion chromatography using a superdex 200 10/30 column (amersham, bucks, uk), in a buffer containing 150 mm nacl and 10 mm tris ph 8.0. plasmids encoding igg1 b12 light and heavy chains were kindly provided by professor dennis burton (the scripps research institute, ca). the heavy and light chains were transiently cotransfected in hek 293 t cells in the presence or absence of 10 m swainsonine. igg1 b12 was purified by incubation for 2 h with protein a sepharose (ge healthcare, uk) at room temperature. the beads were washed with phosphate buffered saline (pbs) before elution using 0.1 m citric acid ph 3.4 followed by neutralization and size exclusion chromatography. the thermal stability of different fc glycoforms was assessed by differential scanning fluorimetry using a stratagene rt pcr 305 instrument. thermally induced unfolding of purified fc glycoforms was monitored, in triplicate, by measuring absorbance at 610 nm at 1.5 c increments in the presence of sypro orange (invitrogen, paisley, uk), a fluorescent stain sensitive to hydrophobic environments. oligosaccharides were released from target glycoproteins with peptide - n - glycosidase f (new englands biolabs) from coomassie blue - stained nupage gels. excised bands were washed five times alternatively with acetonitrile and deionized water, and rehydrated with a 3000 units / ml of aqueous pngase f solution. after 12 h incubation at 37 c, the enzymatically released n - linked glycans were eluted with water. samples were analyzed by maldi - tof ms with a shimadzu axima tof maldi tof / tof mass spectrometer (kratos analytical, manchester, uk) fitted with delayed extraction and a nitrogen laser (337 nm). samples were cleaned on a nafion 117 membrane (aldrich), and then prepared for maldi - ms by adding 0.5 l of an aqueous solution of the glycans to the matrix solution (0.3 l of a solution of 2,5-dihydroxybenzoic acid in acetonitrile : water ; 1:1, v : v) on the stainless steel target plate and allowing it to dry at room temperature. ms was performed with a waters synapt g2 traveling wave ion mobility mass spectrometer (waters ms - technologies, manchester, uk). samples were dissolved in a solution of methanol : water (1:1, v : v) containing 0.5 m ammonium phosphate and introduced into the instrument with waters thin - wall nanospray capillaries. the esi capillary voltage was 1.2 kv, the cone voltage was 20180 v, and the ion source temperature was 120 c. the t - wave velocity and peak height voltages were 450 m / s and 40 v, respectively. the t - wave mobility cell contained nitrogen and was operated at a pressure of 0.55 mbar and was used to provide an additional selection stage for the fragmentation experiments. fragmentation was performed after mobility separation in the transfer cell with a 3 mass unit selection window and with argon as the collision gas. the instrument was externally calibrated with sialylated n - glycans released from bovine fetuin. data acquisition and processing were carried out using waters driftscope (version 2.1) software and masslynx (version 4.1). fluorescent labeling of glycans with 2-aminobenzoic acid (2-aa) and subsequent hplc analysis was performed as previously described. excess 2-aa was removed using a spe - ed amide-2 column (systematic instruments, uk). hplc was carried out at room temperature in a 20 mm ammonium hydroxide solution (ph 3.9) with a linear gradient of acetonitrile and water. crystals of igg1 fc bearing hybrid - type glycans were grown by sitting - drop vapor diffusion using 100 nl of protein solution (11.4 mg ml) plus 100 nl of precipitant using the previously described semiautomated robotics of the oxford protein production facility. crystals of igg fc bearing hybrid - type glycans grew at 20 c in 20% w / v peg 3350 ph 5.5 with 0.2 m sodium / potassium phosphate after 4 days. crystals were flash frozen by immersion in a cryoprotectant containing 25% ethylene glycol and transferred to a gaseous nitrogen stream at 100 k. data were collected at beamline bm14 at the european radiation synchrotron facility, grenoble, france (table 1). diffraction data were integrated and scaled using the programs denzo and scalepack, and the structure was solved by molecular replacement using the program phaser with the protein chain from a natively glycosylated igg fc (pdb accession code 3ave) as a search model. generally, the hybrid fc structure was refined using refmac5 in the ccp4 suite and included iterative restrained refinement with translation libration screw parametrization and incorporation of automatically generated local noncrystallographic symmetry restraints. the molecular graphics program coot was used for manual rebuilding, and molprobity was used to validate the model. data processing, refinement, and structure validation statistics are presented in table 1. throughout this work, we have adopted the system of vliegenhart. for labeling residues within oligomannose- and biantennary - type oligosaccharides with the additional modifications of 7 and 7 for sialic acid, 1 for 16-linked core fucose (figure 1). the symbolic representation of glycans follows that of harvey. with residues in both the schematic diagrams and the molecular graphics following the color scheme of the centre for functional glycomics. carbohydrate fragmentation ions are labeled using the domon and costello nomenclature with an extension by harvey. dihedral angles were defined using the x 1 system for crystallography : = o5c1o c(x) and = c1o c(x)c(x 1) for man12man and man13man, where x = 2 or 3, respectively ; = o5c1o c6, = c1o c6c5, and = o | human igg fc glycosylation modulates immunological effector functions such as antibody - dependent cellular cytotoxicity and phagocytosis. engineering of fc glycans therefore enables fine - tuning of the therapeutic properties of monoclonal antibodies. the n - linked glycans of fc are typically complex - type, forming a network of noncovalent interactions along the protein surface of the c2 domain. here, we manipulate the mammalian glycan - processing pathway to trap igg1 fc at sequential stages of maturation, from oligomannose- to hybrid- to complex - type glycans, and show that the fc is structurally stabilized following the transition of glycans from their hybrid- to complex - type state. x - ray crystallographic analysis of this hybrid - type intermediate reveals that n - linked glycans undergo conformational changes upon maturation, including a flip within the trimannosyl core. our crystal structure of this intermediate reveals a molecular basis for antibody biogenesis and provides a template for the structure - guided engineering of the protein glycan interface of therapeutic antibodies. |
within the decade, treatment of urinary incontinence and prolapse using meshes has gained popularity. the use of synthetic meshes is becoming increasingly common to optimize surgical outcome and to reduce recurrence rates. it allows the development of new connective tissue, which is deficient in genital prolapse. postoperative complications are prosthetic material exposition linked to a defect in vaginal cicatrisation, symptomatic retractions of vaginal mucosa, infection of the prosthetic material, and bladder or rectal injuries. the tension - free vaginal tape (tvt) procedure, during which a suburethral tape is placed, has an operative complication of bladder wall perforation in 5.8% of cases. during a prolift procedure, a mesh is placed between the vaginal mucosa and the prolapsed organ, thus recreating support for weakened pelvic structures. trocar placement for anterior vaginal wall repair involves traversing the obturator membrane and the arcus tendineus fascia pelvis near the ischial spine. after a prolift procedure bladder perforation is easily managed when recognized intraoperatively with reinsertion of the trocar followed by foley catheter bladder decompression. unrecognized bladder perforation may cause postoperative hematuria, recurrent urinary tract infections, irritative bladder symptoms, pelvic and urethral pain, fistula formation, and bladder stone formation. undetected bladder perforation after the prolift procedure can cause vesicovaginal fistula formation due to urine leakage through the sutured vaginal incision. up to date, management of such a vesicovaginal fistula has not been reported yet. the aim of this report is to show treatment of a bladder perforation after the placement of the anterior prolift system. a 63-year - old woman underwent a prolift procedure because of anterior vaginal vault prolapse with complaints of stress urinary incontinence. three weeks after the operation, she was referred to our outpatient urology clinic with complaints of continuous loss of urine and urinary tract infections. at physical examination, after the bladder was filled with a methylene blue solution, a vesicovaginal fistula was diagnosed. urethrocystoscopy (70 vision) was performed and a piece of mesh was seen entering the bladder next to the left ureteral orifice and leaving the bladder at the left bladder wall. surgical removal under regional anaesthesia in lithotomic position included localizing the mesh with a cystoscope with 12 vision. through a standard suprapubic split - needle (5 mm), a laparoscopic babcock forceps entered the bladder grasping the tape halfway its course through the bladder. with traction on the tape, the mesh was cut transurethrally using bipolar electrocautery (fig. 1). 1traction on the tape with the babcock forceps and cutting it with electrocautery traction on the tape with the babcock forceps and cutting it with electrocautery this procedure was performed on each side of the tape, deep into the vesical mucosa. on urethrocystoscopy, the vesical mucosa was somewhat damaged and a cut edge of the tape was seen deep within the damaged mucosa. a suprapubical foley catheter was placed were the laparoscopic trocar had been, which was removed 2 weeks postoperatively. six weeks after the procedure, on urethrocystoscopy, no tape remnants were seen and the bladder wall was perfectly healed (fig. 2). fig. 2cystoscopic view on the healed bladder wall, 6 weeks postoperatively cystoscopic view on the healed bladder wall, 6 weeks postoperatively perforation of the bladder is an uncommon complication of a prolift procedure for vaginal vault prolapse. early detection of bladder injuries by performing an intra - operative cystoscopy with a 30 or 70 lens is mandatory when performing a tvt procedure. for a prolift procedure, this is only preferable but not mandatory. diagnosing bladder perforation intra - operatively is important because, when diagnosed, it can easily be managed by reinsertion of the trocar followed by foley catheter bladder decompression. alternatively, filling the bladder with a methylene blue solution can also be of help. some form of bladder injury detection should be mandatory for all procedures with a risk of bladder perforation. unrecognized bladder perforation may cause hematuria, urinary tract infections, irritative bladder symptoms, and stone formation. after a prolift procedure, unrecognized bladder perforation may also cause a vesicovaginal fistula because urine can leak from the perforation through the sutured vaginal incision. treatment of such a vesicovaginal fistula has not been described in the literature yet. however, in the case in which any type of mesh is found to have been eroded into the bladder and vagina causing a vesicovaginal fistula, complete excision of the mesh is warranted. removal of mesh can be exceedingly challenging due to tissue in - growth into the interstices of the graft. often, the graft and involved tissue must be sharply removed. in the described case, we chose to treat the vesicovaginal fistula by removing only the piece of tape in the bladder to abolish the fistula. we considered transurethral removal of the tape but chose to perform it combined with suprapubical assistance for tension on the tape in order to be able to remove the tape deep into the bladder mucosa. the bladder mucosa thus is enabled to close over the remaining tape remnants. without tension on the tape, residual mesh fibers may be left intravesically and, in time, could still cause stone formation, recurrent infections, and pelvic pain. with the described technique, maximal tape removal is enabled and there is no need for complete excision of the mesh. also, potential benefits of this technique are reduced postoperative pain, speedier recovery, and improved tissue healing. in conclusion, the combined transurethral and suprapubical approach to remove bladder perforating tapes causing a vesicovaginal fistula is the optimal method. moreover, this technique should be considered for other operative procedures in the bladder, whenever a single transurethral approach is insufficient, rather than performing complete excision of meshes. | bladder perforation is a complication which can occur after a prolift procedure and may enhance vesicovaginal fistula formation. different methods of management of bladder perforation caused by mesh procedures are described in the literature, and most authors advise complete excision of the mesh. in the case described in this article, we propose a combined transurethral and suprapubical approach as the optimal method for maximal tape removal, being both minimally invasive and less damaging to the vesical wall. a suprapubical catheter can be removed shortly after surgery to enable optimal tissue healing of the vesical mucosa. |
eif4e - binding protein 1 castration - resistant prostate cancer eukaryotic translation initiation factor 4e mammalian target of rapamycin complex 1 tumor suppression protein 53 positron emission tomography phosphatase and tensin homolog accelerated glucose metabolism in cancer cells under aerobic conditions, a phenomenon known as the warburg effect, leads to high uptake of the labeled glucose analog fluorodeoxyglucose (fdg), which can be clinically useful to detect tumors and monitor therapeutic responses of cancer patients by positron emission tomography (pet). thus, identification of the enzyme(s) that catalyze the elevated glucose metabolism in cancer cells could be exploited not only to distinguish cancer cells from normal cells, but also to preferentially target cancer cells while sparing healthy cells. hexokinases (hks) catalyze the essentially irreversible first step of glucose metabolism in cells by phosphorylating glucose to glucose-6-phosphate (g-6-p). there are 4 hk isoforms encoded by separate genes, hk1, hk2, hk3, and hk4 (also known as glucokinase). hk1 is ubiquitously expressed in almost all mammalian tissues and hk2 is normally expressed in insulin - sensitive tissues such as adipose, skeletal, and cardiac muscles. hk3 is usually expressed at low levels and hk4 expression is restricted to the pancreas and liver. although elevated hk2 expression has been observed in certain types of cancer cell and in tumor tissues from mouse models and/or human patients, the molecular mechanisms underlying hk2 upregulation remain incompletely understood. accumulating evidence suggests that co - deletion of tumor suppressor genes, such as phosphatase and tensin homolog (pten) and tumor suppressor protein p53 (tp53, best known as p53), plays a crucial role in the development of castration - resistant prostate cancer (crpc) in vivo. through integrated analyses of mouse embryonic fibroblasts (mefs) deficient in pten and p53, prostate cancer cell lines, xenografts, and genetically engineered mouse models (gemms), as well as clinic prostate cancer samples, we have found that pten / p53 deficiency selectively enhances expression of hk2, but not hk1, through post - transcriptional and translational regulation. regarding the underlying mechanism, we have demonstrated that activation of akt mtorc1 signaling as a result of pten deletion increases hk2 expression primarily at the translational level through phosphorylation of eif4e - binding protein 1 (4e - bp1), whereas loss of p53 decreases the biogenesis of mir143, which in turn causes degradation of hk2 mrna. as a result, the combined deficiency of pten and p53 in prostate cancer cells synergistically leads to robustly elevated hk2 expression (fig. 1 ; ref. 6). figure 1.induction of the hk2-mediated warburg effect is required for pten / p53 deficiency - driven prostate tumorigenesis. loss of pten in prostate epithelial cells activates akt mtorc1 signaling to initiate phosphorylation of 4e - bp1, which releases eif4e allowing formation of the translation initiation complex at the 5 end of hk2 mrna, and prompting cap - dependent translation. loss of p53 in prostate epithelial cells decreases the biogenesis of mir143, which in turn leads to the degradation of hk2 mrna. the overexpressed hk2 protein initiates warburg effect - dependent prostate tumor growth ; therefore, targeting hk2 may inhibit prostate tumorigenesis that is driven by pten / p53 deficiency. 4e - bp1, eif4e - binding protein 1 ; eif4e, eukaryotic translation initiation factor 4e ; mtorc1, mammalian target of rapamycin complex 1. induction of the hk2-mediated warburg effect is required for pten / p53 deficiency - driven prostate tumorigenesis. loss of pten in prostate epithelial cells activates akt mtorc1 signaling to initiate phosphorylation of 4e - bp1, which releases eif4e allowing formation of the translation initiation complex at the 5 end of hk2 mrna, and prompting cap - dependent translation. loss of p53 in prostate epithelial cells decreases the biogenesis of mir143, which in turn leads to the degradation of hk2 mrna. the overexpressed hk2 protein initiates warburg effect - dependent prostate tumor growth ; therefore, targeting hk2 may inhibit prostate tumorigenesis that is driven by pten / p53 deficiency. 4e - bp1, eif4e - binding protein 1 ; eif4e, eukaryotic translation initiation factor 4e ; mtorc1, mammalian target of rapamycin complex 1. notably, hk2 is almost exclusively expressed in human prostate cancer tissue compared with normal prostate tissue, and its expression is particularly elevated in human prostate cancer harboring pten / p53 mutations. in line with our findings that hk2 expression level positively correlates with the gleason score, the sensitivity and positive predictive value of fdg - pet based on hk2-mediated phosphorylation of fdg for detecting patients with advanced prostate cancers was as high as 87%. these results imply that hk2 expression distinguishes cancer cells from normal cells and could serve as a potential diagnostic and prognostic biomarker for advanced human prostate cancer, especially for patients harboring defects or mutations in pten and p53. our genetic studies demonstrated that the hk2-mediated warburg effect is required for the growth of pten / p53-deficient prostate cancer cells in vitro and in xenograft models carrying mouse or human pten / p53-deficient prostate cancer cell lines in vivo. these findings are consistent with a previous study of glioblastoma showing that hk2 depletion by shrna inhibits tumor growth in a xenograft model. more recently, a study using hk2 conditional knockout mice found that hk2 is required for tumor initiation and maintenance in mouse models of kras - driven lung cancer and erbb2-driven breast cancer. our study extends the biological significance of hk2 to prostate cancers carrying pten / p53 mutations, which drive the genesis of currently incurable castration - resistant prostate cancer (crpc). systemic deletion of hk2 in genetic mouse models inhibits tumor progression but does not impair normal glucose homeostasis or elicit any notable phenotypes in vivo, indicating that hk2 could be a selective therapeutic target for cancer without any adverse physiological consequences. given that our genetic findings support the crucial role of increased hk2 expression in driving the warburg effect and prostate tumor progression in the presence of physiological levels of hk1, selectively targeting hk2 in these prostate cancer cells could be exploited as a promising personalized therapeutic strategy for patients with crpc carrying pten / p53 mutations (fig. 1). however, it would be very challenging to design an isoform - specific pharmacological inhibitor because hk2 has overlapping enzymatic activities with the ubiquitously expressed hk1, which is required for glucose metabolism of normal cells. considering that only the c - terminal half of hk1 retains catalytic activity, whereas both n- and c - terminal halves of hk2 are catalytically active with the n - terminal half showing higher enzyme activity, it is possible to use computational bioinformatics to identify small molecular compounds that might specifically block hk2 activity by targeting the n - terminal half of hk2 in cancer cells. in addition, the enzymatic activities of hk1 and hk2 are inhibited to the same extent by their own product g-6-p, yet inorganic phosphate prevents the inhibition of hk1 by g-6-p while enhancing the inhibition of hk2. does genetic deficiency of hk2 (conditional deletion of hk2 in prostate epithelial cells) effectively inhibit pten / p53 deficiency - driven crpc in genetically engineered triple - deficient mouse models ? can currently available hk2 enzymatic inhibitors such as 2-deoxyglucoe (2-dg) and 3-bromopyruvate (3-brpa) inhibit pten / p53 deficiency - driven crpc in vivo ? does akt mtorc14ebp1-mediated translation signaling contribute to hk2 overexpression in prostate cancer cells carrying alterations in genes other than pten and p53 ? addressing these questions will provide deeper insights into the regulation and crucial role of hk2 in prostate tumorigenesis and potentially open up new avenues to treat currently incurable crpc. this work was supported, in part, by grants from the us national cancer institute (r01 ca160333, yd ; r21 ca155522, yd and jl ; r01 ca172169, jl and yd), the university of minnesota grant - in aid (yd) and start - up funds from the hormel foundation (yd). | aerobic glycolysis, known as the warburg effect, is one of the hallmarks of cancer cells. we recently reported that the hexokinase 2 (hk2)-mediated warburg effect is required for castration - resistant prostate cancer that is driven by pten / p53 deficiency, suggesting that hk2 might be a therapeutic target for prostate cancer patients carrying pten and p53 mutations. |
natural killer (nk) cells are derived from bone marrow - derived lymphocytes and belong to the innate immune system. in contrast to t and b cells, activation of nk cells is controlled by germ line - encoded receptors that do not undergo somatic dna recombination and mutation. nk cells can provide early immune defense against virus - infected and transformed cells. upon activation, nk cells eliminate target cells by polarized exocytosis of cytotoxic granules containing perforin, granzymes as well as fas ligand (1). they also control immune responses by secretion of cytokines and chemokines including tumor necrosis factor- (tnf-) and interferon- (ifn-). nk cells via these effector functions play important roles in innate resistance to viral pathogens, tumor surveillance, shaping adaptive immunity, graft - versus - leukemia activity, antibody - independent natural cytotoxicity and antibodydependent cellular cytotoxicity (adcc) against igg - coated target cells. the important role of nk cells in human health has been underscored by a wide spectrum of disease associations with nk cell dysfunction. patients with leukocyte adhesion disorder (lad), a syndrome due to the deficiency of 2 integrin subunit, display attenuated adcc and natural cytotoxicity by nk cells (2,3) and suffer severe recurrent infections of bacteria, infections of herpes simplex virus (hsv), and impaired immunity (4 - 6). nk cells from patients with hypohidrotic ectodermal dysplasia with immune deficiency (hed - id) have defective natural cytotoxicity but not adcc (6). in nk cells from patients with x - linked lymphoproliferative disease (xlp), activating receptors such as the signaling lymphocyte activation molecule (slam) family member 2b4 (cd244) and ntb - a induce inhibitory rather than activating signals as essential signaling adaptor sap is deficient. thus, 2b4 or ntb - a - mediated autologous killing of epstein - barr virus - infected b cells is abolished in xlp patients (7,8). recently, nk cells have gained increasing attention and are now being considered as promising therapeutic tools for cancer immunotherapy due to their intrinsic ability to rapidly recognize and kill cancer cells, while sparing normal healthy cells. allogeneic nk cells exhibit potent anti - tumor activities that are beneficial in the setting of hematopoietic stem cell transplantation into patients with acute myeloid leukemia (9). moreover, kir - hla - incompatible nk cells were shown to lyse melanoma and renal cell carcinoma cells in vitro (10). moreover, administration of rituximab (anti - cd20) to patients with large - cell non - hodgkin 's lymphoma induced nk cell cytotoxicity in vivo via adcc (11). despite significant progress made on the role of nk cells as a pivotal sentinel in virus and tumor surveillance, the molecular mechanisms that regulate nk cell responses nk cells possess a combinatorial array of activating and inhibitory receptors instead of a dominant single antigen receptor to sense their target cells. whether nk cells are activated toward target cells or maintain tolerance to self is determined by the signal balance between activating and inhibitory receptors (12 - 14). thus, understanding how signals from discrete activating receptors cooperate to control nk cell activation and how signals from inhibitory receptor antagonize such activation may provide strategies for harnessing nk cells in various clinical settings. a large array of nk cell activating receptors that are structurally distinct has been characterized (15,16). in contrast to inhibitory receptors that display variegated expression on nk cells, activating receptors are uniformly expressed on most nk cells. furthermore, activating receptors trigger diverse and discrete signaling cascades, whereas inhibitory receptors induce a common signaling mechanism where their cytoplasmic immunoreceptor tyrosine - based inhibition motif (itim) recruits the phosphatase src homology 2 domain - containing phosphatase 1 (shp-1) to dephosphorylate signaling molecules in the activation of nk cells (17,18). among activating receptors containing immunoreceptor tyrosine - based activation motif (itam) or associated with itam - carrying adapters are the low - affinity fc receptor fcriiia (cd16), natural cytotoxicity receptors (ncrs) such as nkp30 (cd337), nkp44 (cd336), and nkp46 (cd335), activating kirs including kir2ds and kir3ds, and cd94/nkg2c (cd94/159c) heterodimer (16). upon engagement, these itam - associated receptors are tyrosine - phosphorylated by src family kinases, and the phosphorylated itam - bearing subunits recruit syk and zap-70 tyrosine kinases. thereafter, these kinases phosphorylate linker for activation of t cells (lat) and non - t - cell activation linker (ntal) leading to activation of pi3k, plc-1, 2 and vav 2, 3 (19 - 23). non - itam receptors include c - type lectin - like family member nkg2d (cd314), cd2, 2b4, cracc (cd319), ntb - a, and the immunoglobulin - like type i transmembrane glycoprotein dnam-1 (cd226). upon stimulation, nkg2d associates with the adaptor protein dnax - activating protein of 10 kd (dap10) through its transmembrane region (24). the cytoplasmic tail of dap10 carries a tyrosine - based signaling motif (yinm). this yinm, after phosphorylation by src family kinases, recruits either a p85 subunit of pi3k or the small adaptor protein grb2. both interactions can activate vav1 and plc-2 and thus are essential for the activation of ca mobilization and cytotoxicity toward target cells (25). unlike itam - associated receptors, nkg2d signaling is independent of syk, zap70, lat and ntal (26 - 28). slam family receptors including 2b4, ntb - a, and cracc are also phosphorylated by src family kinases at immunoreceptor tyrosine - based switch motifs (itsm) in their cytoplasmic domain (29). this itsm, after phosphorylation, recruits small adaptor proteins such as sap, eat-2, and ert (30 - 33). sap then binds src family kinase fyn and this sap - fyn interaction is indispensable for 2b4-mediated nk cell activation (34,35). vav1, plc-2, and c - cbl are phosphorylated by 2b4 stimulation and implicated in such activation (31,36). cytoplasmic tail of dnam-1 can be phosphorylated by src - family kinases and protein kinase c, and recruit actin - binding proteins (37,38). although various signaling molecules implicated in nk cell activation have been uncovered, it has been difficult to identify critical molecules essential for nk cell activation because nk cells use diverse kinases, adaptors, and signaling modules depending on the engagement of different activating receptors. however, intersection of signals from discrete activating receptors by a single class of itim - associated inhibitory receptors implies that there exist critical control elements in the signaling pathway of nk cell activation. such examples include plc- and vav proteins that play a non - redundant role in nk cell activation by multiple activating receptors, and their deficiency is manifested by functional defects of nk cells (20,39,40). src family kinases that include lck, fyn, src, lyn, yes, and fgr are important for nk cell activation as most of the activating receptors on nk cells are dependent on their activities for activation. however, no single src family kinase is indispensable because their function is highly redundant for nk cell activation (41,42). plc- activation that induces ca mobilization from endoplasmic reticulum is critical for exocytosis of lytic granules and cytokine production. although plc-1 and plc-2 are redundant in itam - dependent signaling, nkg2d / dap10 and 2b4 signaling are highly dependent on plc-2 (36,40). vav has three isoforms, vav1, vav2, and vav3, and nk cells express all of these isoforms (20). vav acts as a guanine nucleotide exchange factor (gef) that activates small gtpase proteins of the rho family and as an adaptor protein through c - terminal sh2 and sh3 domains (43 - 45). it has an important role in the actin cytoskeleton dynamics for the co - activation receptor clustering and the lytic granule polarization, as well as in the lymphocyte receptor signaling including plc- activation (45,46). vav1 is essential for dap10 signaling, and vav2 and vav3 are required for itam - associated receptors (20,47,48). thus, the identification of critical signaling molecules that function as essential checkpoints for nk cell activation provides clues for understanding the mechanism of cooperative interplay by multiple co - activation receptors. activation of nk cells is tightly controlled by the requirement for the engagement of multiple co - activation receptors on nk cells upon encounter with target cells (16,49). the combined signals from specific pairs of nk cell receptors, such as nkg2d and 2b4, can operate in synergy to induce potent cytotoxicity toward sensitive target cells (16,50), while other combinations can result in different outcomes : no enhancement over each activating signal or simple additive effect. the mechanisms how distinct signals from different co - activation receptors are integrated to achieve proper functional activity are still unclear and difficult to study because each co - activation receptors use distinct signaling modules. among the combinations of activating receptors, nkg2d and 2b4 as well as 2b4 and dnam-1 are able to provide synergistic activation in resting nk cells, whereas nkg2d and dnam-1 do not synergize. even though nk cells are activated by synergistic signals from multiple co - activation receptors, inhibitory signals from a single class of itim - containing receptors, such as kirs and cd94-nkg2a, this suggests that there are central common checkpoints where signals from multiple co - activation receptors are converged and integrated but inhibitory signals intersect. a study with nkg2d and 2b4 synergy advocates such an example of checkpoint and an elaborate mechanism for regulating synergistic activation (36). the central role of vav1 in the signaling pathway for nk cell activation is emphasized by its identification as an essential target of shp-1 recruited to mhc class i - specific inhibitory receptors (51,52). the vav1 is phosphorylated by the engagement of nkg2d, 2b4 and dnam-1 on nk cells and functions as an essential component in signaling from such activating receptors. synergistic activation of nk cells via nkg2d and 2b4 combination results in synergistic phosphorylation of plc-2, ca mobilization and cytotoxic degranulation, which are completely dependent on vav1. signals from single receptor activation can also induce vav1 phosphorylation, but not the subsequent events such as the phosphorylation of plc-2, ca mobilization, degranulation and cytokine secretion. such dichotomy of nk cell activation can be explained by the finding that single receptor signal is unable to overcome activation threshold shaped by the e3 ubiquitin ligase c - cbl mediating the inhibition of vav1-dependent activation. such threshold can be overcome by the convergence of signals from nkg2d and 2b4 to achieve optimal activation of vav1 (fig. 1). this mechanism supports the presence of a central checkpoint for nk cell activation where vav1-mediated activation and c - cbl - mediated inhibition compete with each other. consecutive study of synergy between nkg2d and 2b4 revealed another interesting mechanism for synergy (53). the phosphorylation of vav1 by nkg2d and 2b4 synergy is equivalent to the sum of the extent of phosphorylation induced by each receptor alone. in contrast, phosphorylation of vav1 was not augmented by inactive receptor combination although each receptor induced vav1 phosphorylation independently. thus, synergy involves the integration of different activation signals for optimal activation of vav1, but such requires combination of specific receptor pairs, suggesting the presence of an upstream regulatory element to control vav1 activation. the adaptor proteins sh2 domain - containing leukocyte phosphoprotein of 76 kd (slp-76) and lat are known to contribute to vav1 signaling and are essential components of forming signaling complexes in t cells (54,55). furthermore, the activation of plc-, which is required for synergistic activation of nk cells (36), is dependent on both slp-76 and lat in t cells (56 - 58). in nk cells, the synergistic signaling pathway induced by co - engagement of nkg2d and 2b4 is largely dependent on slp-76, but not lat. signal from nkg2d induces preferential phosphorylation at tyrosine (tyr)128 of slp-76, whereas signal from 2b4 induces phosphorylation of slp-76 at tyr113 (fig. both tyrosine phosphorylations at tyr113 and tyr128 of slp-76 are required for the synergistic activation of nk cells (53). the slp-76 phosphorylation in nk cells is differentially regulated compared to tcr signaling in t cells because the single tcr engagement is sufficient for phosphorylation of both tyrosine residues in slp-76 (54). moreover, complementary phosphorylation of slp-76 at n - terminal tyrosine residues is a property of synergizing receptors that induce natural cytotoxicity because the engagement of the fc receptor cd16 also induces slp-76 phosphorylation at both tyrosines. selective phosphorylation of slp-76 at tyr113 or tyr128 each enabled the binding of slp-76 to vav1 to promote vav1 phosphorylation. thus, slp-76 may serve to integrate signals from synergizing co - activation receptors by recruiting vav1 to its phosphorylated tyrosine residues. this suggests that permissive activation of nk cells is kept in check by the requirement for the complementary phosphorylation of slp-76 during synergy among receptors that stimulate natural cytotoxicity. nk cell activation upon encounter with target cells is a result from dynamic process of signaling cascades triggered by combination of multiple receptors on nk cells. thus, diverse mechanisms may control each step of nk cell activation depending on the signaling pathways originated from not only a single receptor but also a cooperation of co - activation receptors. in this review, the requirement for complementary phosphorylation of slp-76 by synergizing receptors for optimal activation of vav1 and thereby to overcome inhibition by c - cbl is introduced as recently discovered mechanism regulating synergistic activation of nk cells. a challenge for future study is to find different checkpoints and signaling mechanisms that control synergistic activation of nk cells. this information will provide innovative and applicable strategies for exploiting nk cells in clinical immunotherapy. | natural killer (nk) cells play a pivotal role in early surveillance against virus infection and cellular transformation, and are also implicated in the control of inflammatory response through their effector functions of direct lysis of target cells and cytokine secretion. nk cell activation toward target cell is determined by the net balance of signals transmitted from diverse activating and inhibitory receptors. a distinct feature of nk cell activation is that stimulation of resting nk cells with single activating receptor on its own can not mount natural cytotoxicity. instead, specific pairs of co - activation receptors are required to unleash nk cell activation via synergy - dependent mechanism. because each co - activation receptor uses distinct signaling modules, nk cell synergy relies on the integration of such disparate signals. this explains why the study of the mechanism underlying nk cell synergy is important and necessary. recent studies revealed that nk cell synergy depends on the integration of complementary signals converged at a critical checkpoint element but not on simple amplification of the individual signaling to overcome intrinsic activation threshold. this review focuses on the signaling events during nk cells activation and recent advances in the study of nk cell synergy. |
the online version of this article (doi:10.1007/s40121 - 015 - 0100-z) contains supplementary material, which is available to authorized users. linezolid (lzd) is an oxazolidinone antibiotic characterized by a wide spectrum of activity against gram - positive pathogens resistant to -lactams and glycopeptides, and its use has progressively increased in recent years [1, 2 ]. lzd clearance is mainly non - renal (approximately 65%) through the formation of two major inactive metabolites, the hydroxyethyl glycine metabolite (pnu-142586) and the aminoethoxyacetic acid metabolite (pnu-142300), which account for 4050% and 910% of the total dose, respectively. more recent reports have suggested that the influence of renal dysfunction on high lzd blood concentration may lead to hematological side effects such as thrombocytopenia [8, 9 ]. however, the influence of low lzd blood concentration in conjunction with high creatinine clearance (crcl) still remains unknown. additionally, the pharmacokinetic / pharmacodynamic (pk / pd) index for the efficacy of lzd was previously shown to be a 24-h area under the plasma lzd concentration time curve / minimum inhibitory concentration (auc24/mic) ratio of 100 [46 ]. herein, we report the pk / pd profile of a patient with methicillin - resistant staphylococcus aureus (mrsa) pneumonia and bacteremia who developed diabetes insipidus (di) with a high level of crcl. despite the low auc24/mic of lzd in comparison with the efficacy level of auc24/mic (100) [46 ], blood samples for the quantification of lzd in plasma were collected through an indwelling arterial catheter both before and after the morning dosing, which was administered through an intermittent intravenous infusion of 600 mg over the course of 1 h. lzd was administrated twice a day (morning and night). blood samples were taken in the morning before dosing (trough) and after the morning s 1-h - long lzd administration. after centrifugation, plasma samples were separated and stored at 80 c until assayed. blood lzd concentration was measured after the patient s transfer to the general ward. to assess renal function, creatinine concentrations in both the serum and 24-h urine samples were determined. crcl (ml / min) was calculated using the formula:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{crcl } } = (c_{\text{urine } } \times v_{\text{urine } }) /(c_{\text{serum } }) \times (1.73/{\text{bsa } }) $ $ \end{document}crcl=(curinevurine)/(cserum)(1.73/bsa)where curine (mg / dl) is the creatinine concentration in urine, vurine (ml / min) is the urine volume, cserum (mg / dl) is the serum creatinine concentration, and bsa (m) is the body surface area. the drug concentration data were fit to a standard one - compartment model with zero - order input (1-h - long drug infusion) and first - order elimination. the pk parameters used were total clearance (l / h) and volume of distribution (l). a 19-year - old male was admitted to fukuoka university hospital after being involved in a traffic accident. a neurological assessment revealed a glasgow coma scale (gcs) score of 3/15. computed tomography (ct) of the head showed a subcutaneous and extradural hematoma. a craniotomy was immediately performed to remove the hematoma and to attain cerebral decompression and, as a result, the gcs score recovered to 10/15. on day 13, he developed polyuria. his 24-h urine volume reached 56 l / day with a urine osmolality of 159 mosm / l and a plasma osmolality of 340 mosm / l. as a basal skull fracture was present, an intravenous vasopressin infusion was administered to treat the di. however, it showed a poor therapeutic effect, polyuria continued, and crcl was revealed to be 180278 ml / min as a result of the di. we were required to administer approximately 67 l / day of fluid to compensate for the high urinary fluid output. on day 50, mrsa was detected in surveillance cultures of sputum and urine samples (mic for lzd was 1 mg / l). on day 55, he developed systemic inflammatory response syndrome (sirs), and pneumonia and/or a urinary tract infection was suspected based upon the results of preceding surveillance cultures. consequently, lzd was administrated intravenously (600 mg every 12 h) for 14 days. on day 57, a chest x - ray and ct scan showed a consolidation in the right lung (fig. it was found that blood cultures that had been drawn before the administration of lzd developed mrsa (mic for lzd was 1 based upon these findings, we diagnosed mrsa pneumonia with secondary bacteremia due to pneumonia or a urinary tract infection. blood, urine, and sputum cultures were negative on days 61, 64, and 68, respectively. a chest x - ray on day 68 and ct scan on day 70 showed improvement in the consolidation (fig. concomitant antibiotics were not administered because the results of the cultures showed the development of mrsa only (fig. a (chest x - ray) and b (chest ct scan ; day 57) show consolidation in right lower lung before treatment (b, arrow). c the chest x - ray (day 68) and d shows the chest ct scan (day 70) images after treatment, and show the improvement in the consolidationfig. lzd (600 mg) was administrated twice a day for 1 h. the concentration of lzd was shown before the day s first administration (trough) and after the first 1-h lzd administration for the day. crcl (ml / min) was calculated using the formula : crcl = (c urine v urine)/(c serum) (1.73/bsa) ; where c urine (mg / dl) is the creatinine concentration in urine, v urine (ml / min) is the urine volume, c serum (mg / dl) is the serum creatinine concentration, and bsa (m) is the body surface area. auc 24 /mic 24-h area under the plasma linezolid concentration time curve / minimum inhibitory concentration, crcl creatinine clearance, crp c - reactive protein, lzd linezolid, mrsa methicillin - resistant staphylococcus aureus, nd not detected, ne not examined, sirs systemic inflammatory syndrome chest imaging before and after treatment with lzd. a (chest x - ray) and b (chest ct scan ; day 57) c the chest x - ray (day 68) and d shows the chest ct scan (day 70) images after treatment, and show the improvement in the consolidation clinical course and lzd blood concentration. asterisk a + indicates at least two sirs criteria. plus lzd (600 mg) was administrated twice a day for 1 h. the concentration of lzd was shown before the day s first administration (trough) and after the first 1-h lzd administration for the day. crcl (ml / min) was calculated using the formula : crcl = (c urine v urine)/(c serum) (1.73/bsa) ; where c urine (mg / dl) is the creatinine concentration in urine, v urine (ml / min) is the urine volume, c serum (mg / dl) is the serum creatinine concentration, and bsa (m) is the body surface area. auc 24 /mic 24-h area under the plasma linezolid concentration time curve / minimum inhibitory concentration, crcl creatinine clearance, crp c - reactive protein, lzd linezolid, mrsa methicillin - resistant staphylococcus aureus, nd not detected, ne not examined, sirs systemic inflammatory syndrome blood concentrations of lzd from days 6068 were measured after the patient s transfer to the general ward. the auc24/mic values over the observation period were found to be 69.3 2 days after lzd administration, and the trough levels were too low to be detected (fig. 2). informed consent was obtained from the patient s family in relation to his being included in the study. blood samples for the quantification of lzd in plasma were collected through an indwelling arterial catheter both before and after the morning dosing, which was administered through an intermittent intravenous infusion of 600 mg over the course of 1 h. lzd was administrated twice a day (morning and night). blood samples were taken in the morning before dosing (trough) and after the morning s 1-h - long lzd administration. after centrifugation, plasma samples were separated and stored at 80 c until assayed. to assess renal function, creatinine concentrations in both the serum and 24-h urine samples were determined. crcl (ml / min) was calculated using the formula:\documentclass[12pt]{minimal } \usepackage{amsmath } \usepackage{wasysym } \usepackage{amsfonts } \usepackage{amssymb } \usepackage{amsbsy } \usepackage{mathrsfs } \usepackage{upgreek } \setlength{\oddsidemargin}{-69pt } \begin{document}$$ { \text{crcl } } = (c_{\text{urine } } \times v_{\text{urine } }) /(c_{\text{serum } }) \times (1.73/{\text{bsa } }) $ $ \end{document}crcl=(curinevurine)/(cserum)(1.73/bsa)where curine (mg / dl) is the creatinine concentration in urine, vurine (ml / min) is the urine volume, cserum (mg / dl) is the serum creatinine concentration, and bsa (m) is the body surface area. the drug concentration data were fit to a standard one - compartment model with zero - order input (1-h - long drug infusion) and first - order elimination. the pk parameters used were total clearance (l / h) and volume of distribution (l). a 19-year - old male was admitted to fukuoka university hospital after being involved in a traffic accident. a neurological assessment revealed a glasgow coma scale (gcs) score of 3/15. computed tomography (ct) of the head showed a subcutaneous and extradural hematoma. a craniotomy was immediately performed to remove the hematoma and to attain cerebral decompression and, as a result, the gcs score recovered to 10/15. on day 13, he developed polyuria. his 24-h urine volume reached 56 l / day with a urine osmolality of 159 mosm / l and a plasma osmolality of 340 mosm / l. as a basal skull fracture was present, an intravenous vasopressin infusion was administered to treat the di. however, it showed a poor therapeutic effect, polyuria continued, and crcl was revealed to be 180278 ml / min as a result of the di. we were required to administer approximately 67 l / day of fluid to compensate for the high urinary fluid output. on day 50, mrsa was detected in surveillance cultures of sputum and urine samples (mic for lzd was 1 mg / l). on day 55, he developed systemic inflammatory response syndrome (sirs), and pneumonia and/or a urinary tract infection was suspected based upon the results of preceding surveillance cultures. consequently, lzd was administrated intravenously (600 mg every 12 h) for 14 days. on day 57, a chest x - ray and ct scan showed a consolidation in the right lung (fig. it was found that blood cultures that had been drawn before the administration of lzd developed mrsa (mic for lzd was 1 based upon these findings, we diagnosed mrsa pneumonia with secondary bacteremia due to pneumonia or a urinary tract infection. blood, urine, and sputum cultures were negative on days 61, 64, and 68, respectively. a chest x - ray on day 68 and ct scan on day 70 showed improvement in the consolidation (fig. concomitant antibiotics were not administered because the results of the cultures showed the development of mrsa only (fig. a (chest x - ray) and b (chest ct scan ; day 57) show consolidation in right lower lung before treatment (b, arrow). c the chest x - ray (day 68) and d shows the chest ct scan (day 70) images after treatment, and show the improvement in the consolidationfig. (600 mg) was administrated twice a day for 1 h. the concentration of lzd was shown before the day s first administration (trough) and after the first 1-h lzd administration for the day. crcl (ml / min) was calculated using the formula : crcl = (c urine v urine)/(c serum) (1.73/bsa) ; where c urine (mg / dl) is the creatinine concentration in urine, v urine (ml / min) is the urine volume, c serum (mg / dl) is the serum creatinine concentration, and bsa (m) is the body surface area. auc 24 /mic 24-h area under the plasma linezolid concentration time curve / minimum inhibitory concentration, crcl creatinine clearance, crp c - reactive protein, lzd linezolid, mrsa methicillin - resistant staphylococcus aureus, nd not detected, ne not examined, sirs systemic inflammatory syndrome chest imaging before and after treatment with lzd. a (chest x - ray) and b (chest ct scan ; day 57) show consolidation in right lower lung before treatment (b, arrow). c the chest x - ray (day 68) and d shows the chest ct scan (day 70) images after treatment, and show the improvement in the consolidation clinical course and lzd blood concentration. asterisk a + indicates at least two sirs criteria. plus lzd (600 mg) was administrated twice a day for 1 h. the concentration of lzd was shown before the day s first administration (trough) and after the first 1-h lzd administration for the day. crcl (ml / min) was calculated using the formula : crcl = (c urine v urine)/(c serum) (1.73/bsa) ; where c urine (mg / dl) is the creatinine concentration in urine, v urine (ml / min) is the urine volume, c serum (mg / dl) is the serum creatinine concentration, and bsa (m) is the body surface area. auc 24 /mic 24-h area under the plasma linezolid concentration time curve / minimum inhibitory concentration, crcl creatinine clearance, crp c - reactive protein, lzd linezolid, mrsa methicillin - resistant staphylococcus aureus, nd not detected, ne not examined, sirs systemic inflammatory syndrome blood concentrations of lzd from days 6068 were measured after the patient s transfer to the general ward. the auc24/mic values over the observation period were found to be 69.3 2 days after lzd administration, and the trough levels were too low to be detected (fig. 2). informed consent was obtained from the patient s family in relation to his being included in the study. to the best of our knowledge, this is the first case to report a pk profile of lzd in a patient with di with high crcl. in this case, crcl was 180278 ml / min as a result of di. in regard to patients with a high level of crcl in the intensive care unit, it was reported that blood lzd concentrations were variable, showing trough concentrations from 0.13 to 14.49 mg / l (median 2.06 mg / l). in the current case, blood lzd trough levels were lower than the detection limit (< 0.5 mg / l) and the auc24/mic (69.3) was also remarkably low compared with those provided in previous reports concerning 20 critically ill patients (median 248 mg / l, interquartile range 144347 mg / l). since the lzd trough levels were lower than the detection limit (0.5 mg / l), the actual auc24/mic may have been lower than that in our calculated auc24/mic levels. the precise mechanism of the decreased lzd auc24/mic and blood trough levels in this case is unknown ; however, lzd pk might be altered by high crcl and a large volume of fluid administration. in the current case, we diagnosed mrsa pneumonia for the following reasons. first, the precedent surveillance culture of sputum only developed mrsa and no other significant microorganisms ; second, the chest ct scan showed a consolidation in the right lower lung, which suggested a transbronchial route of infection ; and third, the pneumonia was successfully treated with lzd only, not with any other antimicrobials. an american consensus review recommended vancomycin for the treatment of mrsa infections ; however, in a randomized - controlled study for mrsa nosocomial pneumonia, lzd showed better clinical efficacy and microbiological responses than vancomycin. rayner. reported that higher success rates for lzd may occur at auc24/mic values of 80120 for bacteremia, skin and skin structure infections, and lower respiratory tract infections. in this case, on day 50, the urine culture developed mrsa 10/colony - forming units / ml. it is unclear whether the patient had a urinary tract infection or if the observed mrsa in the urine had simply passed into the urine from the blood. additionally, on day 64, mrsa was not detected in the urine culture. to the best of our knowledge, little investigation has been conducted into the usefulness of lzd for the treatment of urinary tract infections. approximately 35% of lzd is excreted in urine. in this case, a high level of urine output was observed because of di and, consequently, the high doses of lzd may be passed though the urinary tract. therefore, despite low plasma lzd auc, the urine culture may become negative. interestingly, in spite of the remarkably low level of the auc24/mic in this case, mrsa pneumonia bacteremia was treated successfully after lzd administration. in lzd, the level of plasma protein binding is 31% and the volume of distribution approximates the total water content of the body (4050 l) [15, 16 ]. in lung tissues, it was reported that lzd concentrations in the epithelial lining fluid (64.3 33.1 g / ml) were much higher than those in the blood (7.3 4.9 g / ml) and alveolar cells (2.2 0.6 g / ml). these findings suggest that lzd is excluded or rapidly removed from the blood to the lung compartment. as this was a retrospective study for this reason we could not take cultures and blood samples every day. to our knowledge, this is the first report showing the successful treatment of mrsa pneumonia with bacteremia despite very low lzd auc24/mic. localized higher concentrations of lzd in the lung might have been sufficiently effective in treating the pneumonia and the secondary bacteremia as a result of the sites of these infections ; however, the precise mechanism of low lzd auc24/mic and successful treatment of mrsa infection in these cases remains generally unknown. in conclusion, sub - therapeutic levels of lzd blood concentrations may be caused by uncontrolled di with high crcl and a high level of fluid administration. in spite of the low level of auc24/mic, mrsa pneumonia and bacteremia were successfully treated with lzd. as this was a retrospective study, we were unable to evaluate the concentration of lzd on days 6068 after the 1-h lzd administration for the pk assessment. we must further study the actual pk assessment of lzd in patients with high crcl caused by di. further investigation is required into the mechanisms of low lzd auc24/mic and the successful treatment of these mrsa infections. below is the link to the electronic supplementary material. supplementary material 1 (pdf 243 kb) supplementary material 1 (pdf 243 kb) yoshihiko nakamura, masanobu uchiyama, shuuji hara, mariko mizunuma, takafumi nakano, hiroyasu ishikura, kota hoshino, yasumasa kawano, and tohru takata have nothing to disclose. informed consent was obtained from the patient s family in relation to his being included in the study. this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license (http://creativecommons.org/licenses/by-nc/4.0/), which permits any noncommercial use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the creative commons license, and indicate if changes were made. | introductionfew studies have investigated the effect of increased creatinine clearance (crcl) on linezolid (lzd) concentration. herein, we report the pharmacokinetic / pharmacodynamic (pk / pd) profile of lzd used in the management of methicillin - resistant staphylococcus aureus (mrsa) pneumonia with concomitant bacteremia in a patient with high crcl caused by diabetes insipidus (di).case reporta 19-year - old man was admitted to the intensive care unit following a traumatic brain injury. after admission, he underwent a craniotomy for the severe brain injury. however, he developed di after the operation. despite treatment with vasopressin, his urine output reached 56 l / day as a result of the di, and his crcl increased to 180278 ml / min. we were required to administer 67 l of fluid a day to compensate for the high urinary fluid output. on day 55, mrsa pneumonia with sepsis was suspected and, consequently, lzd was administrated intravenously (600 mg every 12 h). he was treated with lzd for 14 days. the patient has since successfully recovered from mrsa pneumonia with concomitant bacteremia, and was transferred to the general ward on day 82. blood lzd levels from days 6068, which were measured after the patient s transfer to the general ward, showed that the trough levels were lower than the threshold level of detection. the blood 24-h area under the plasma lzd concentration time curve (auc)24/minimum inhibitory concentration (mic) was 69.3.conclusionin spite of the low level of lzd auc24/mic caused by the high crcl with di, mrsa pneumonia with concomitant bacteremia was successfully treated with lzd.electronic supplementary materialthe online version of this article (doi:10.1007/s40121 - 015 - 0100-z) contains supplementary material, which is available to authorized users. |
cystic fibrosis (cf) is one of the most common genetic diseases among caucasians. the illness is best known for affecting the respiratory system, where the lungs become obstructed with thick sticky mucus, resulting in difficulty breathing and increased susceptibility to bacterial infections. the disease also affects the pancreas, liver, intestines, and male reproductive system. cf is caused by mutations in the gene for the cystic fibrosis transmembrane conductance regulator protein (cftr). in healthy individuals, cftr acts as a phosphorylation and nucleotide regulated channel which mediates the flux of chloride across the apical membrane of epithelial cells.(1) in cf patients, mutant cftr fails to correctly mediate chloride flux, and as a consequence, transepithelial chloride, salt, and water transport is impaired. this transport defect leads to dehydration of the airway surface fluid, mucus desiccation, and obstruction with recurrent episodes of inflammation and infection. currently, cf is treated through careful control of diet, physiotherapy, antibiotics and, when lung function is severely degraded, lung transplantation.(2) the average life expectancy for a cf patient is 47 years.(3) there are currently no pharmacological agents approved for use in the clinic that address the basic molecular defect underlying the disease. the most common mutation in cftr, occurring on at least one allele in 70% of cf patients, is the deletion of a phenylalanine residue at position 508 in the amino acid sequence (f508del - cftr).(4) this defect results in protein misfolding, retention in the endoplasmic reticulum, and its failure to reach the cell membrane.(5) in cell culture expression systems, this trafficking defect can be partially overcome by incubating cells at 27 c,(6) however the protein s ability to function as a chloride channel at the cell surface remains impaired relative to that of the wild - type cftr.(7) another less common mutation : g551d - cftr undergoes normal biogenesis and trafficking to the cell surface(5) yet it exhibits defective channel activation at that location.(8) thus, two classes of small molecules have been identified, which may prove to be useful in the pharmacological treatment of cf. correctors are those molecules which, through either direct interactions with mutant cftr or perhaps any of the various chaperone proteins, rescue the cell s ability to correctly traffic the protein to the cell membrane. potentiators are those molecules which result in a restoration of normal channel activity in the mutant protein once it appears in the cell membrane. in 2006, a group from vertex pharmaceuticals reported that 4-methyl-2-(5-phenyl-1h - pyrazol-3-yl)phenol (vrt-532, 1) was identified in a high - throughput screen for the ability to potentiate channel activity in mouse nih 3t3 cells expressing wild - type cftr or f508del - cftr after low - temperature correction of the trafficking defect.(11) subsequent reports have shown that 1 also partially promotes proper protein trafficking of f508del - cftr from the endoplasmic reticulum (er) to the cell membrane.(12) thus, 1 is both a potentiator and a corrector. it has been suggested on the basis of limited proteolysis studies that this molecule may modify the conformation of f508del - cftr such that it more closely resembles that of the wild - type protein, and that this interaction is sufficient to partially rescue both protein biogenesis and channel activity.(13) understanding the molecular basis for this interaction will provide insight into the mechanism of action of 1 as a modulator of cftr and provide a template for development of therapeutically efficacious compounds. to help elucidate the nature of the interaction between 1 and mutant cftr proteins, we have designed and prepared derivatives of 1, modified with functional groups useful in biochemical studies. we have also developed a protocol for hydrogen isotope exchange (deuteration by d2o, as a model for tritiation). we show in functional assays of the channel activity of the mutant cftr proteins that these derivatives retain the potentiator activity of the parent compound and, hence, have the potential to define the molecular basis for this activity. a photoaffinity label is a molecule that contains a recognition element for specific interactions with a site on a target protein as well as a photoactivatible functional group that reacts to form a covalent bond to the protein upon photoirradiation. the labeled site can then be identified using any of a number of biochemical techniques, for instance limited proteolysis followed by gel electrophoresis and/or mass spectrometry to suggest the location of the binding site for the unlabeled ligand.(14) our synthetic efforts to prepare derivatives of 1 including the photoaffinity label, aryl azide 11 are illustrated in scheme 1. reaction of 2-hydroxy-5-methylacetophenone 2 with 4-iodobenzoyl chloride 3 afforded the expected ester 6 in 86% yield. venkataraman rearrangement by heating with t - buok in thf, intending to isolate diketone 8.(15) the crude product of this reaction was a yellow solid which by h nmr spectroscopy suggested the presence of numerous species. enol tautomers, which ought to be competent in the subsequent pyrazole formation, it was decided to carry the crude yellow solid through the next step. treatment with hydrazine in acetic acid afforded the desired pyrazole 9 in a serviceable 68% yield (from ester 6). exchange of the iodide for azide using a cu / proline catalyzed methodology reported by ma(16) was hampered by the fact that the desired azide 11 and starting material iodide 9 have identical chromatographic properties on silica gel. it was therefore impossible to gauge reaction progress by tlc and impossible to isolate 11 from the reaction mixture by column chromatography. in fact, it was only by h nmr analysis of what appeared by tlc analysis to be clean recovered 9 that we were able to observe that the material was actually a nearly 1:1 mixture of 9 and another compound with the same nmr splitting pattern. after this discovery, tlc analysis of this material using a variety of common eluents failed to resolve the two compounds. treatment of a portion of the mixture with triphenylphosphine in wet thf (staudinger reaction conditions)(17) led to the formation of the amine compound 12, confirming that the second component of the 1:1 mixture was in fact the azide 11, formed in only about 50% conversion in the iodide - for - azide exchange reaction. given this poor conversion, as well as the inability to separate 11 from 9 by any practical means diazotization of 12 by treatment with t - butyl nitrite, followed by treatment with azidotrimethylsilane,(18) provided the desired azide 11 in excellent 94% yield. reagents and conditions : (i) pyridine, 0 c, 1 h ; (ii) kot - bu, thf, 50 c, 30 min ; (iii) h2n nh2xh2o, acoh, 65 c, 16 h ; (iv) nan3, cui, l - proline, naoh, dmso, 100 c, 16 h ; (v) pph3, h2o, thf ; (vi) sncl22h2o, etoh, 78 c, 16 h ; (vii) t - buono, tms - n3, mecn, 0 c to rt, 1 h. subsequent to these experiments, we discovered that the entire synthesis of the pyrazole core from acetophenone 2 and benzoyl chloride 5 could be accomplished in one pot, using pyridine as a solvent, at 50 c. with monitoring by tlc, additional 5 was added until 2 was completely converted. at this point, t - buok was added, again using tlc to gauge complete consumption of the intermediate ester. thus, in less than one day s reaction time, in one pot, and with only a single, final chromatographic purification step, 1 was isolated in 65% yield from 2. using the same one - pot sequence, 10 has also been prepared from 2 and 4 in 24% yield. under uv irradiation, aryl azides extrude a molecule of n2, transiently forming a reactive nitrene intermediate, which rearranges to an electrophilic cyclic ketenimine.(14) in photoaffinity labeling experiments, this occurs within a protein binding site, and the ketenimine is quenched by a nucleophilic functional group from the protein, thus forming a covalent linkage between the label and the protein (scheme 2a). to demonstrate that azide 11 is capable of undergoing this chemistry, a benzene solution of 11, containing an excess of diethylamine, was irradiated with an unfiltered (full spectrum) mercury lamp (scheme 2b). after workup and chromatographic purification, diethylamine adduct 13 was isolated in 40% yield., the azide decomposes to the reactive nitrene, which rearranges to the cyclic ketenimine, which is ultimately quenched by a nucleophilic functional group from the protein target. the amino group on compound 12 was envisaged to be a handle for further functionalization, for instance by reaction with fluorescent electrophiles like 4-chloro-7-nitrobenzofurazan (nbd chloride)(19) or 5-(dimethylamino)naphthalene-1-sulfonyl chloride (dansyl chloride),(20) however no reaction was observed on treatment of 12 with either of these reagents under their prescribed reaction conditions. rather than attempt to optimize reaction with these costly reagents, we reasoned that incorporation of a glycine amide might provide a more reactive aliphatic amino group for further derivatization. unfortunately, attempts to acylate 12 with boc - glycine using a variety of standard peptide coupling agents also failed. ultimately, we decided to abandon this approach, instead choosing to focus on palladium - catalyzed cross - coupling chemistry to install a fluorophore. the n - propargyl dansyl amide 14 was prepared(21) and found to react cleanly with iodide 9 under sonogashira reaction(22) conditions to afford 15 in 47% yield (scheme 3). given the success of this reaction, boc - propargylamine 16 was also prepared(23) and reacted with 9, affording 17 in 69% yield. upon boc - deprotection, this compound will afford a nucleophilic primary aliphatic amine, which can be readily derivatized with electrophiles, should the need arise to prepare new derivatives in the future. reagents and conditions : (i) pdcl2dppfch2cl2, cui, net3, thf, 45 c, 15 h. dansyl sulfonamides typically display fluorescence that is sensitive to their local environments. figure 1 shows the emission spectrum of 15, recorded in solvents of different polarity. when dissolved in chloroform, fluorescence emission is maximal and centered at about 504 nm. in the most polar of the media tested, an aqueous buffer solution, the emission maximum was red - shifted by 37 nm to 541 nm, with an intensity 32% that of the emission in chloroform. in the organic solvents dimethyl sulfoxide and methanol, which are increasingly more polar than chloroform, but less so than water, fluorescent emissions maxima were intermediate (529 nm in both) and intensity decreased with increasing polarity. probe 15 contains the recognition element of 1, conjugated to a fluorescent dansyl group through a propargylamine linker and, as such, is expected to be a useful probe for the binding interaction between 1 and cftr. the direct binding of probe 15 to cftr, and/or the conformational changes which mediate protein folding and function, may be detected in fluorescence anisotropy measurements.(24) the probe s fluorescence intensity or emission maximum may change upon binding to a hydrophobic pocket of cftr, which would be monitored by fluorescence experiments. alternatively, as the emission for the tryptophan residues in cftr overlaps with the excitation of this dansyl derivative, there may be measurable resonance energy transfer upon binding to the protein.(25) lastly, we anticipate that competition experiments with unlabeled drugs will identify other small molecules that bind directly to cftr and permit quantification of their relative binding constants. fluorescence emission spectra of 20 m solution of 15 in chcl3 (black solid line), dmso (black dotted line), meoh (gray solid line), and aqueous buffer containing 20 mm mops, 75 mm ki, 1 mm n - dodecyl--d - maltoside (gray dotted line). a radiolabeled version of 1 would also be useful for quantitative studies of its binding properties to cftr. radioligands have shown to be invaluable tools for the understanding of the mechanism of action of membrane proteins, receptors, transporters, and channels.(26) to date, binding of cftr modulators has been detected using functional assays which report the consequences of binding rather than binding per se. hence, the development of radiolabeled 1 would enable direct assay of the relative affinities for binding to cftr and mutant cftr proteins, thereby providing insight into potential genotype - specific structural differences in the binding site. further, this tool would enable comparison of the binding sites for various cftr modulators as they are identified. while it would be possible to incorporate a radioactive electrophile onto the propargylamino group accessible from 17, a method that would be much less disturbing to the original structure of 1 would be to replace a non - exchangeable hydrogen atom for a tritium atom. as a model for this, a study was conducted on the incorporation of less expensive and more safely handled nonradioactive deuterium. a small sample of 1 was dissolved in 1 m naoh in d2o and heated at 90 c. under these conditions, in addition to the classically exchangeable phenolic o h and pyrazole n h, the pyrazole c4h also gradually exchanged for deuterium (figure 2a). the singlet at 6.7 ppm, arising from the pyrazole c4h, was observed to gradually decrease in integration, reaching 50% deuterium incorporation over 24 h, decreasing to 20% (i.e., 80% deuterium incorporation) after 48 h. parts b and c of figure 2 show the aromatic region of the h nmr spectrum of 1 at the beginning (t = 0) and end (t = 48 h) of the experiment, respectively. after workup (including aqueous acid to re - exchange the phenolic o h and the pyrazole n h for protons) and tlc purification, 1 was reisolated in 88% yield and determined to have 80% deuterium incorporation at pyrazole c4. if these conditions were to be repeated using commercially available tritiated water (radioactivity level 185 gbq / g),(29) they would be expected to provide [h]-1 at a level of 1.33 10 bq / mol,(30) without the need for multiple synthetic steps or purification of radioactive materials. (b) aromatic region of the h nmr spectrum of 1 in 1 m naoh / d2o, prior to any heating. (c) the same region of the spectrum after heating at 90 c for 48 h, wherein 80% of the pyrazole c4 protons have been exchanged for deuterium. for these molecular probes to be of use in biochemical experiments, it must be demonstrated that the substitutions, in every case at the 4-position of the phenyl ring of the parent structure 1, do not interfere with the compound s ability to interact with the protein. to determine this, the effects of 912 and 15 on cftr channel function were assessed using patch clamp electrophysiology. in our version of this assay, baby hamster kidney (bhk) cells expressing f508del - cftr at the cell membrane (after biosynthetic rescue by low temperature culture conditions)(6) are loaded with nai, stimulated using forskolin (10 m), and then treated acutely with the compounds at a final concentration of 10 m at approximately the 500 s mark. the potentiation of channel function is observed as an increased rate of iodide efflux from the cells, measured using an iodide - sensitive electrode positioned in the cell bath. after sufficient data is collected (around 800 s), cells are lysed, releasing all remaining iodide. figure 3a depicts the measured level of iodide in the cell bath over time, after acute treatment with either 1 or 11 at a final concentration of 10 m or dmso control. the experiment was also repeated with addition of 9, 10, 12, and 15 (traces not shown). the channel potentiating effects of the compounds (measured as the maximum slope of the line prior to addition subtracted from the maximum slope after addition of the compound) are depicted in figure 3b. the dmso control showed negligible change in halide efflux post forskolin stimulation (1.4 0.4 nm / s, n = 4) whereas acute addition of 1 displayed a marked increase in efflux post forskolin stimulation (9.9 2.3 nm / s, n = 7). analogues 912 were found to be biologically active, with efflux rates ranging from 5.1 to 7.5 nm / s. in this assay, fluorescent analogue 15 proved to be inactive (1.7 1.2 nm / s, n = 6). the effects of 1 and 912 were all determined to be significantly different from dmso control, as assessed using analysis of variance (anova) statistics. importantly, the rates of efflux promoted by 912 were not significantly different than the rate observed for the parent compound 1, thus suggesting that substitution of a small functional group at the 4-position of the phenyl ring is not detrimental to the function of the molecule as a potentiator of cftr channel function. (a) typical iodide efflux traces for 1 (black line), 11 (dark - gray), and dmso control (light - gray). cells were activated with forskolin at 120 s (arrow i), treated with compound at 500 s (arrow ii), and completely lysed at 800 s (arrow iii). (b) potentiating effects of all compounds tested (measured as the maximum slope of the iodide efflux trace prior to addition of the compound, subtracted from the maximum slope post addition). the reduced activity in the iodide efflux assay of dansyl derivative 15 may be attributable to the compound s reduced ability to permeate the cell membrane rather than some hindered interaction with cftr. to test this possibility, we examined the effect of this molecule in a less complex reconstitution system, which allows the direct interactions of small molecules with isolated cftr to be studied. g551d - cftr, a clinically relevant mutant which exhibits more severely defective channel activity than f508del - cftr, was reconstituted into liposomes of egg phosphatidylcholine. in this reconstituted system, a population of protein molecules are oriented inside out within the liposome (i.e., domains that are normally intracellular in live cells face out of the liposome, and vice versa). therefore a compound does not need to cross the membrane in order to interact with the intracellular domains of the protein. if 15 retains the ability to interact with cftr, it should potentiate channel activity in this population of protein molecules. the liposomes were loaded with potassium iodide and suspended in a 10 m solution of the compound to be tested in buffer lacking iodide. the concentration of iodide outside the liposomes is continuously measured using an iodide sensitive probe, and cftr activity is observed after addition of protein kinase a and atp to activate cftr, and valinomycin to prevent charge build - up across the membrane due to cftr - mediated iodide efflux which would slow and eventually stop further efflux. figure 4a shows the traces of iodide concentration vs time for compound 1 (black line) and 15 (dark - gray) as well as a dmso control (light - gray). figure 4b shows the effect of each compound, measured as the maximum slope of the iodide efflux trace following valinomycin activation. under these conditions, compound 15 proved to be an effective potentiator of channel activity, with an iodide efflux rate 11.18 2.08 nm / s, n = 3, although with slightly diminished activity compared to 1 (16.85 1.26 nm / s, n = 5). these data suggest that 15 maintains the ability of the parent compound 1 to interact with cftr and modulate its activity but has a diminished ability to cross the cell membrane. therefore 15 should be a useful fluorescent probe in systems of purified and reconstituted protein and other in vitro experiments not involving whole live cells. (a) iodide efflux assay on purified g551d - cftr, reconstituted in proteoliposomes for compound 1 (black line), fluorescent derivative 15 (dark - gray) and dmso control (light - gray). (b) the effect of 1 and 15 on iodide efflux in this system, measured as the maximum slope of the iodide efflux trace after valinomycin activation. the interaction between 1 and mutants of cftr imbues the protein with properties more like the wild - type, including improved protein maturation and halide channel function (the two key deficiencies which lead to the symptoms of cystic fibrosis). however, little is known about the exact nature of this interaction. as tools to help elucidate these details, useful molecular probes based on the structure of 1 compound 11 bears an azide group substituted at the 4-position of the parent compound s phenyl ring. the compound (and other derivatives bearing small substitutions at the same position) maintains the ability to potentiate channel function in live cells expressing the major mutant f508del - cftr and also undergoes a photoreaction generating a strong electrophile. sonogashira coupling between iodide 9 and propargylamine derivatives provided further useful compounds, including the fluorescent dansyl sulfonamide 15. this compound is active as a potentiator in a purified proteoliposome assay, however exhibits almost no activity in live cells, suggesting that 15 maintains the ability to interact with cftr mutants but that the larger substituent abrogates the ability to cross the cell membrane. the environment - dependent fluorescence properties of 15 will make it a useful probe molecule for experiments in purified protein and/or cell lysates. finally, it has been demonstrated that the pyrazole c4h in 1 undergoes gradual exchange in hot alkaline water, and a protocol to exploit this property to incorporate radioactive tritium has been developed. these molecular probes enable an array of biochemical experiments to determine how and where 1 interacts with mutant cftr, which will in turn enable the design of new, more potent and specific compounds as potential treatments for cystic fibrosis. these experiments are currently underway, and their results will be reported in due course. all reagents and solvents were used as received from commercial suppliers, except for tetrahydrofuran, which was dispensed under nitrogen from an mbraun solvent purification system immediately prior to use as a reaction solvent. propargylamine derivatives 14(21) and 16(23) were prepared according to literature methods. tlc was carried out on silica gel 60 f254 aluminum backed plates, supplied by emd chemicals, eluting with the solvent system indicated, and visualizing with uv light. column chromatography was carried out on silicycle siliaflash p60, 4063 m silica gel, eluting with the solvent system indicated below for each compound. nuclear magnetic resonance (h nmr, 400 mhz, and c nmr, 100 mhz) spectroscopy was carried out on a bruker avance 400 instrument in the deuterated solvents indicated below for each compound, and spectra were referenced to the solvent residual proton and c peaks. high - resolution mass spectrometry was performed using esi - tof or dart - tof as indicated. uv / visible spectroscopy was performed using a perkin - elmer lambda 20 instrument. the purity of all compounds subjected to biological assays was determined to be 95% by hplc analysis, using an agilent zorbax rx - c8 4.6 mm 150 mm column, eluting at 0.6 ml / min with a binary gradient of 100% h2o to 100% mecn over the course of 1 h, except for compound 15, for which the gradient was 100% h2o to 50% mecn over the course of 1 h. solid 2-hydroxy-5-methylacetophenone (2, 3.948 g, 26.3 mmol) was added to an ice - bath cooled suspension of 4-iodobenzoyl chloride (3, 7.008 g, 26.3 mmol) in pyridine (140 ml). the resultant clear yellow solution was stirred over an ice - bath for one hour, after which time it was quenched by pouring into an ice / hcl mixture (2 m, 600 ml). this aqueous phase was extracted three times with ch2cl2 (200 ml each time). the combined organic extracts were washed aqueous hcl (1 m, 200 ml), then nahco3 (saturated, 200 ml), and finally nacl (saturated, 200 ml), before drying over na2so4 and evaporating to afford the title ester 6 as a yellow solid, which was used without further purification. h nmr (400 mhz, (cd3)2so) : 7.997.95 (m, 2h), 7.847.81 (m, 2h), 7.76 (d, j = 1.5 hz, 1h), 7.45 (ddd, j = 8.5 hz, j = 2.0 hz, j = 0.5 hz, 1h), 7.22 (d, j = 8.5 hz, 1h), 2.46 (s, 3h), 2.38 (s, 3h). c nmr (100 mhz, (cd3)2so) 196.87, 163.89, 145.74, 137.41, 135.39, 133.53, 130.92, 130.27, 129.58, 127.97, 123.19, 102.14, 28.83, 19.81. prepared as described above for 6, but using 2 (2.508 g, 16.7 mmol) and 4-nitrobenzoyl chloride (4, 4.324 g, 23.3 mmol). as above for 6, this compound was used after extractive workup without further purification. h nmr (400 mhz, cdcl3) : 8.388.36 (m, 4h), 7.68 (d, j = 2 hz, 1h), 7.42 (ddd, j = 12 hz, j = 2 hz, j = 1 hz, 1h), 7.13 (d, j = 8 hz, 1h), 2.54 (s, 3h), 2.45 (s, 3h). c nmr (100 mhz, (cd3)2co) 196.79, 163.47, 150.91, 146.75, 136.45, 135.19, 134.02, 131.32, 131.03, 130.22, 123.66, 123.55, 28.65, 19.97. potassium tert - butoxide (613 mg, 5.46 mmol) was dissolved in thf (25 ml). the solution was warmed to 50 c, and ester 6 (2.000 g, 5.26 mmol) was added, upon which a yellow precipitate was observed to form. the mixture was stirred at 50 c for 30 min, then cooled in an ice - bath and quenched by addition of aqueous acetic acid (10% v / v, 20 ml). the aqueous mixture was extracted three times with ch2cl2 (50 ml each time). the combined organic extracts were dried over na2so4 and evaporated to afford a yellow solid. this solid was taken up in glacial acetic acid (30 ml) and cooled in an ice - bath. hydrazine hydrate (5060%, 5.7 ml, 100 mmol) was added dropwise to the mixture. the ice bath was removed, and the mixture was warmed to 65 c for 16 h. the mixture was then cooled to room temperature and quenched with water (30 ml) and then extracted three times with ch2cl2 (50 ml each time). the crude product was purified by silica gel column chromatography, eluting with a gradient of 1:10 to 1:1 ethyl acetate / hexanes, to afford the title compound 9 as a yellow solid. h nmr (400 mhz, (cd3)2co) 13.03 (bs, 1h), 10.64 (bs, 1h), 7.86 (d, j = 8 hz, 2h), 7.68 (d, j = 8 hz, 2h), 7.58 (s, 1h), 7.28 (s, 1h), 7.01 (d, j = 8 hz, 1h), 6.84 (d, j = 8 hz, 1 h), 2.29 (s, 3h). c nmr (100 mhz, (cd3)2co) 177.09, 138.16, 135.28, 135.11, 129.74, 127.91, 127.44, 127.03, 124.44, 123.56, 118.14, 116.49, 116.23, 19.77. prepared as described above for 9 but beginning with ester 7 (3.500 g, 11.7 mmol) and driving the rearrangement step with 17.6 mmol of sodium tert - butoxide. the crude product was purified by silica gel column chromatography, eluting with a 3:17 ethyl acetate / hexanes, to afford the title compound 10 as an orange solid. h nmr (400 mhz, (cd3)2co) 12.94 (bs, 1h), 10.81 (bs, 1h), 8.35 (d, j = 1.5 hz, 2h), 8.17 (d, j = 9 hz. 2h), 7.62 (d, j = 1.5 hz, 1h), 7.46 (s, 1h), 7.04 (dd, j = 8.5 hz, j = 1.5 hz, 1h), 6.89 (d, j = 6 hz, 1h), 2.30 (s, 3h). c nmr (100 mhz, (cd3)2co) 161.24, 148.25, 136.27, 130.83, 129.35, 128.17, 127.12, 125.08, 124.46, 119.15, 117.37, 116.78, 102.01, 20.55. stannous chloride dihydrate (3.850 g, 17 mmol) was added to a solution of 10 (1 g, 3.4 mmol) in 95% ethanol (30 ml). the mixture was heated to reflux for 16 h. the mixture was cooled to room temperature and poured into aqueous naoh (1 m, 150 ml). the mixture was extracted twice with ethyl acetate (75 ml each time). the combined organic extracts were washed with aqueous nacl (saturated, 75 ml), then dried over na2so4 and evaporated. the crude product was purified by silica gel column chromatography, eluting with a 1:4 ethyl acetate / hexanes, to afford the title compound to afford the title compound 12 as a pale - yellow solid. h nmr (400 mhz, (cd3)2co) 13.2 (s, 1h), 10.9 (s, 1h), 7.54 (s, 1h), 7.48 (d, j = 8.5 hz, 2h), 7.03 (s, 1h), 6.97 (d, j = 8 hz, 1h), 6.79 (d, j = 8 hz, 1h), 6.63 (d, j = 8 hz, 2h), 5.42 (s, 2h), 2.27 (s, 3h). c nmr (100 mhz, (cd3)2co) 154.17, 149.38, 129.54, 129.34, 127.66, 126.77, 126.69, 126.32, 120.08, 116.72, 116.35, 114.36, 97.06, 19.70. esi - tof ms : m / z = 266.1288 (m + h) calculated for c16h16n3o : 266.1287. conversion of the amine to the azide was conducted using the method reported by moses.(18) amine 12 (265 mg, 1 mmol) was dissolved in acetonitrile (10 ml) and cooled in an ice - bath. to this was added tert - butyl nitrite (178 l, 154 mg, 1.5 mmol), followed by azidotrimethylsilane (158 l, 138 mg, 1.2 mmol). the mixture was warmed to room temperature and stirred for one hour, after which the solvent was evaporated and the crude product was purified by silica gel column chromatography, eluting with a gradient of 1:10 to 1:1 ethyl acetate / hexanes, to afford the title compound 11 as a yellow solid. h nmr (400 mhz, (cd3)2co) 12.82 (bs, 1h), 10.70 (bs, 1h), 7.93 (d, j = 8.5 hz, 2h), 7.59 (d, j = 2 hz, 1 h), 7.287.22 (m, 3h), 7.02 (dd, j = 8.5 hz, j = 2 hz, 1h), 6.83 (d, j = 8 hz, 1h), 2.30 (s, 3h). c nmr (100 mhz, (cd3)2co) 153.89, 143.72, 140.18, 129.68, 127.99, 127.14, 126.97, 126.38, 125.50, 119.63, 116.49, 116.37, 99.14, 19.76. benzoyl chloride (5, 510 l, 617 mg, 4.4 mmol) was added to a solution of 2 (601 mg, 4 mmol) in pyridine (10 ml), and the mixture was warmed to 50 c. at 15 min intervals, more 5 (50 l, 61 mg, 0.4 mmol) was added, until tlc analysis (1:3, ethyl acetate / hexanes) indicated complete conversion of 2 (rf = 0.8) into the ester (rf = 0.7) (three aliquots were added over 45 min, for a total of 660 l, 800 mg, 5.7 mmol benzoyl chloride in the reaction). while stirring at 50 c, solid potassium tert - butoxide (987 mg, 8.8 mmol) was gradually added to the reaction mixture. after 15 min, tlc analysis (1:3, ethyl acetate / hexanes) indicated substantial but incomplete conversion of the ester (rf = 0.7) to the rearranged dione (under these conditions, the tlc of this material was a streak extending from the baseline to a major spot with rf = 0.6). more potassium tert - butoxide (258 mg, 2.3 mmol) was added, and after an additional 30 min of stirring, tlc analysis indicated complete consumption of the ester. hydrazine hydrate (5060%, 2.5 ml, 44 mmol) was added over the course of one minute, followed by glacial acetic acid (2.0 ml, 2.1 g, 35 mmol). after 1.5 h, tlc analysis indicated completed conversion to the desired product (1:3, ethyl acetate / hexanes, rf = 0.5). the reaction mixture was poured into an ice / hcl mixture (1 m, 250 ml), which was then extracted three times with ethyl acetate (100 ml each time). the combined organic extracts were washed with nahco3 (saturated, 100 ml) and nacl (saturated, 100 ml) and then dried over mgso4 and evaporated. the crude product was purified by silica gel column chromatography, eluting with a 1:9 ethyl acetate / hexanes, to afford the title compound 1 as a yellow solid. yield 65% (648 mg) ; mp 160161 c (lit.(33) 156157 c). h nmr (400 mhz, (cd3)2co) 12.78 (bs, 1h), 10.65 (bs, 1h), 7.9087.876 (m, 2h), 7.606 (d, j = 2 hz, 1h), 7.5427.488 (m, 2h), 7.4547.397 (m, 1h), 7.274 (s, 1h), 7.022 (ddd, j = 8.5 hz, j = 2 hz, j = 0.5, 1h), 6.838 (d, j = 7.5 hz, 1h), 2.303 (s, 3h). c nmr (100 mhz, (cd3)2co) 154.82, 152.95, 145.16, 130.50, 130.28, 129.92, 129.57, 128.79, 127.79, 126.48, 117.33, 117.28, 100.04, 20.59. dart - tof ms : m / z = 251.1175 (m + h) calculated for c16h15n2o : 251.1184. the synthesis of 1 has been previously reported, however no characterization data aside from melting point have been published. prepared by a method analogous to 1 above, beginning with 1 g (6.7 mmol) of 2 and employing a total of 1.781 g (9.6 mmol) of 4-nitrobenzoyl chloride 4. a solution of 11 (40 mg, 0.14 mmol) and diethylamine (0.4 ml) in c6d6 (1.5 ml) in a quartz nmr tube was irradiated with a 140 w hanovia utility ultraviolet quartz lamp. the tube was held 10 cm from the light bulb, and a stream of air was blown over the tube to maintain the contents at room temperature. after 5 h of exposure, the mixture was evaporated under reduced pressure, and the crude product was purified by silica gel column chromatography, eluting with 3:7 ethyl acetate / hexanes to afford the diethylamine adduct 13. h nmr (400 mhz, (cd3)2co) 10.75 (bs, 1h), 7.54 (s, 1h), 7.21 (d, j = 8.0 hz, 1h), 6.98 (dd, j = 8.5 hz, j = 1.5 hz, 1h), 6.92 (s, 1h), 6.80 (d, j = 8.0 hz, 1h), 6.04 (d, j = 8.0 hz, 1h), 5.73 (t, j = 7.5 hz, 1h), 3.46 (q, j = 7.0 hz, 4h), 2.28 (s, 3h), 1.29 (bs, 2h), 1.261.01(m, 6h). c nmr (100 mhz, (cd3)2co) 154.05, 152.09, 146.01, 144.21, 142.88, 129.44, 129.40, 127.74, 126.79, 116.56, 116.35, 109.33, 106.77, 99.40, 42.95, 30.97, 19.66, 13.46. a 10 ml schlenck tube was fitted with a magnetic stirring bar and a glass stopper and flushed with argon gas. the tube was then charged with 9 (203 mg, 0.54 mmol), 14(21) (312 mg, 1.08 mmol), and pdcl2dppfch2cl2 (22 mg, 0.027 mmol). the tube was evacuated and backfilled with argon. under a stream of argon, thf (4 ml), triethylamine (0.12 ml, 0.8 mmol), and finally cui (4 mg, 0.02 mmol) were added. the tube was sealed, and the mixture was heated to 45 c for 15 h and then cooled back to room temperature. the mixture was diluted with ethyl acetate (25 ml) and extracted with 0.1 m hcl (10 ml), then brine (10 ml), then dried over anhydrous sodium sulfate and evaporated under reduced pressure. the crude material was purified by silica gel column chromatography, eluting with 1:4 ethyl acetate / hexanes, to afford the title compound 15 as a yellow solid. h nmr (400 mhz, (cd3)2co) 12.82 (bs, 1h), 10.62 (bs, 1h), 8.51 (d, j = 8.5 hz, 1h), 8.42 (d, j = 8.5, 1h), 8.33 (dd, j = 7.5 hz, j = 1.0 hz, 1h), 7.72 (d, j = 8 hz, 2h), 7.66 7.57 (m, 3h), 7.29 7.23 (m, 3h), 7.02 (dd, j = 8 hz, j = 2 hz, 1h), 6.94 (d, j = 8 hz, 2h), 6.84 (d, j = 8 hz, 1 h), 4.12 (d, j = 5 hz, 2h), 2.81 (s, 6h), 2.30 (s, 3h). c nmr (100 mhz, (cd3)2co) 152.85, 137.24, 137.21, 132.72, 130.98, 130.90, 130.75, 130.59, 130.29, 130.27, 128.93, 128.73, 127.86, 126.08, 124.27, 123.27, 120.40, 117.36, 117.28, 117.12, 115.97, 100.47, 86.47, 83.50, 45.59, 33.77, 20.57 (one c signal was not observed after 15000 scans). dart - tof ms : m / z = 537.1958 (m + h) calculated for c31h29n4o3s : 537.1960. hplc rt = 25.2 min. prepared by a method analogous to 15 above, but using 9 (610 mg, 1.62 mmol), 16(23) (500 mg, 3.24 mmol), pdcl2dppfch2cl2 (66 mg, 0.084 mmol), thf (12 ml), triethylamine (0.35 ml, 2.5 mmol), and cui (11 mg, 0.06 mmol). h nmr (400 mhz, (cd3)2co) 12.86 (bs, 1h), 10.66 (bs, 1h), 7.87 (d, j = 8 hz, 2h), 7.60 (d. j = 1.5 hz, 1h), 7.54 (d, j = 7 hz, 2h), 7.31 (s, 1h), 7.03 (dd, j = 8.5 hz, j = 2 hz, 1h), 6.876.82 (m, 1h), 6.45 (bs, 1h), 4.13 (d, j = 6 hz, 2h), 2.30 (s, 3h), 1.45 (s, 9h). c nmr (100 mhz, (cd3)2co) 156.32, 154.70, 136.16, 135.98, 133.02, 130.59, 128.90, 127.87, 126.46, 124.12, 119.04, 117.36, 117.16, 100.53, 89.87, 82.18, 79.38, 31.30, 28.59, 20.58. dart - tof ms : m / z = 404.1966 (m + h) calculated for c24h26n3o3 : 404.1974. to a standard nmr tube containing 1 ml of 1 m naoh in d2o was added 1 (25 mg, 0.1 mmol). reaction progress was monitored by periodically collecting a h nmr spectrum and observing the relative integration of the pyrazole c4h signal at 6.7 ppm. after 48 h, the reaction was cooled to room temperature and diluted with 10 ml of h2o. the mixture was cooled in an ice bath and acidified to ph 1 by dropwise addition of 1 m hcl. the mixture was extracted with 3 10 ml et2o, concentrated under reduced pressure, and purified by preparative tlc eluting with 1:3 etoac / hexanes to afford 22 mg (88%) of 1c4-d with 80% deuteration as determined by h nmr integration. h nmr (400 mhz, (cd3)2co) 12.78 (bs, 1h), 10.65 (bs, 1h), 7.917.88 (m, 2h), 7.61 (d, j = 2 hz, 1h), 7.537.49 (m, 2h), 7.457.41 (m, 1h), 7.27 (s, 0.2h), 7.02 (dd, j = 8.5 hz, j = 1.5 hz, 1h), 6.84 (d, j = 8.5 hz, 1h), 2.30 (s, 3h). c nmr (100 mhz, (cd3)2co) 155.94, 154.82, 142.80, 130.49, 129.97, 129.56, 128.80, 127.82, 126.48, 117.33, 117.30, 100.06, 20.58 (one c signal not observed after 13686 scans). a stock solution of 15 (5 mm in dmso) was diluted to 20 m in 100% chloroform, 100% methanol, 100% dmso or buffer containing 20 mm mops, 75 mm ki, and 1 mm n - dodecyl--d - maltoside (ddm). emission spectra were obtained with an excitation wavelength of 360 nm, and 4 nm excitation and emission bandpass, at 22 c in a 0.5 cm micro quartz cuvette on a pti (photon technology international, london, on, canada) quantamaster qm/80 steady state spectrofluorimeter. curves are an average of two measurements at 0.5 nm increments with a 1 s integration time and were corrected using a solvent blank measured under identical conditions. using bhk cells stably expressing f508del - cftr, continuous recording cell - based iodide efflux assays were performed as previously described.(27) in brief, cells were grown to approximately 90100% confluency. cells were loaded with nai loading buffer (3 mm kno3, 2 mm ca(no3)2, 11 mm glucose, 20 mm hepes, and 136 mm nai) at 37 c for 1 h. nai loading buffer was aspirated, and cells were washed four times in iodide - free efflux buffer (3 mm kno3, 2 mm ca(no3)2, 11 mm glucose, 20 mm hepes, and 136 mm nano3). cells were scraped in 1 ml of iodide - free efflux buffer and collected by centrifugation (350 g for 5 min at 25 c). iodide - free efflux buffer was removed, and the cell pellet was resuspended in 400 l of iodide - free efflux buffer. iodide efflux was measured at room temperature using an iodide - sensitive electrode (lazar research laboratories, los angeles, ca). f508del - cftr at the cell surface was stimulated with 10 m forskolin, followed by addition of 10 m of compound (1, 9, 10, 11, 12, or 15). five minutes after addition of each compound, triton x-100 (sigma) was used to lyse the cells to ensure iodide was properly loaded. the maximal iodide efflux rate was quantified over a 1 min interval associated with the largest positive slope during the 4- to 5-min time period after the addition of the activation cocktail. traces were recorded using the digidata 1320a data acquisition system with clampex 8 software (molecular devices, sunnyvale, ca). mutant g551d - cftr was purified from sf9 cells expressing the channel with a c - terminal his10 tag from 0.5 l of culture. cells were homogenized in the presence of protease inhibitors using an emulsiflex c3 high - pressure homogenizer (avenstin, ottawa, on. canada), and plasma membranes were isolated on a 35% sucrose cushion by ultracentrifugation. one - fifth of the membrane pellet was solubilized by the presence of 2% fos - choline 14 (anatrace, maumee, oh) for 1 h with resuspension by 30 g needle, and insoluble material was removed by ultracentrifugation. mississauga, on, canada), and the beads were washed with 1050 mm imidazole buffer containing 1 mm dodecylmaltoside (ddm). g551d - cftr was eluted with 600 mm imidazole buffer containing 1 mm ddm, and lower molecular weight contaminants and imidazole were removed by centrifugation with an amicon ultra centrifugal filter device (milipore corp. billerica, ma), yielding up to 0.25 mg of pure g551d - cftr protein per liter of culture used, in 20 mm mops, 75 mm ki, and 1 mm ddm, ph 7.4. g551d - cftr was reconstituted into 5 mg of egg phosphatidylcholine (avanti polar lipids, alabaster, ab) at a protein : lipid ratio of approximately 1:300 (w / w) by incubation in the presence of 20 mm mops, 75 mm ki, 1 mm ddm, and lipid for 30 min, followed by passage through an extracti - gel d detergent - binding column (pierce corp. the external iodide in the reconstituted protein sample was exchanged for 75 mm k - glutamate by sephadex g50 gel filtration resin equilibrated with 20 mm mops, 75 mm k - glutamate, yielding g551d - cftr liposomes containing 75 mm ki on the vesicle interior and 75 mm k - glutamate in the bulk solution. the increase in external iodide concentrations was monitored continuously using an iodide - selective electrode (lazar research laboratories, los angeles, ca) interfaced to the digidata 1320a data acquisition system and controlled by clampex 8 software (axon instruments, sunnyvale, ca), as described above for the cell - based assay. madison, wi) and mg - atp (200 nm and 1 mm, respectively) were added to the external solution to initiate iodide flux, and 20 nm valinomycin was added to prevent charge - buildup across the membrane that would limit iodide flux. control liposomes were prepared and treated identically but in the absence of g551d - cftr. verification that sufficient iodide was trapped in the proteoliposomes was done by lysing the liposomes with 0.5% triton x-100 at late time points. a working solution of 20 m was prepared from the stock in 20 mm mops and 75 mm k - glutamate buffer and added to the vesicle solution at a ratio of 1:1 to yield a final concentration of 10 m, 5 min before initiation of flux by valinomycin. | cystic fibrosis is a genetic disease caused by mutations in the gene for the cystic fibrosis transmembrane conductance regulator (cftr) protein. in vitro experiments have demonstrated that 4-methyl-2-(5-phenyl-1h - pyrazol-3-yl)phenol (vrt-532, 1) is able to partially restore the function of mutant cftr proteins. to help elucidate the nature of the interactions between 1 and mutant cftr, molecular probes based on the structure of 1 have been prepared. these include a photoreactive aryl azide derivative 11 and a fluorescent dansyl sulfonamide 15. additionally, a method for hydrogen isotope exchange on 1 has been developed, which could be used for the incorporation of radioactive tritium. using iodide efflux assays, the probe molecules have been demonstrated to modulate the activity of mutant cftr in the same manner as 1. these probe molecules enable a number of biochemical experiments aimed at understanding how 1 rescues the function of mutant cftr. this understanding can in turn aid in the design and development of more efficacious compounds which may serve as therapeutic agents in the treatment of cystic fibrosis. |
sunlight absorption by biological molecules plays a crucial role in life development and sustains the earths energy cycle ; as a counterpart, photoprotective mechanisms are necessary to minimize the potential damage of the uv portion of the solar spectrum that reaches organisms.1 the interest in natural uv photoprotection research has increased lately, given substantial losses in the stratospheric ozone layer and the consequent increase in uv radiation levels in the troposphere.2, 3 one of the major strategies used by organisms to minimize uv - induced damage is screening by intra- or extracellular compounds that are able to block uv radiation.1, 4, 5 mycosporine - like amino acids (maas) and gadusol (3,5,6-trihydroxy-5-hydroxymethyl-2-methoxycyclohex-2-en-1-one) belong to a series of natural uv - absorbing compounds that have been related to photoprotective and antioxidant functions in aquatic organisms.68 the photophysics and photochemistry of some of these secondary metabolites have been examined in aqueous solution.914 the main findings are : negligible fluorescence yields, high photostability, and efficient dissipation of the absorbed radiation energy as heat. in fact, various reports indicate that maas are biosynthesized and accumulated in response to uv radiation, thus preventing damaging photons from reaching potential cellular targets and avoiding photosensitization processes by the favorable competition of thermal de - excitation pathways.57, 15, 16 however, the precise connection between these properties and the chemical structures of these compounds remains to be fully addressed. in that sense, it is interesting to examine some trends in the correlation of the available photophysicochemical data with the structural features of this family of natural molecules. taurine, and mycosporine glutaminol glucoside, all of which share a cyclohexenone core, are efficient antioxidants,6, 1719 whereas the imino - mycosporines shinorine and porphyra-334 are rather resistant to oxidation.20 the photodecomposition quantum yield of gadusol in aqueous solution is low, but is 100-fold greater than that of the conjugate anion gadusolate, the prevailing species under physiological ph.14 it is known that cyclic,-unsaturated ketones produce relatively stabilized triplets if substituted at the -carbon atom;21 however, no triplet state from gadusolate could be observed by direct laser photolysis. moreover, interaction between gadusolate and some triplet sensitizers leads to reductive quenching of the latter.14 on the contrary, sensitization experiments have given evidence for only the energy transfer to yield the excited triplet states of the imino - maas shinorine, porphyra-334, and palythine.9, 10, 12 in this context, calculation of the deactivation pathways can provide valuable information for rationalization of the experimental results and consequently potentiate the future design of new synthetic photoprotectors. recently, a computational study using the caspt2//casscf strategy was carried out on palythine, the simplest structure among imino - maas.22 the fast relaxation on the excited - state energy surface via a conical intersection (ci) point is evident from this study. the main deformation of the structure corresponds to an out - of - plane movement of the imine moiety, while the adjacent carbon atoms approach each other and the alkene moiety remains almost planar. this result rules out the previously proposed deactivation pathway by simple c = n bond isomerization.12 it is well established now that conical intersections mediate a variety of chemical events and have enormous relevance in biology, as they are responsible for the efficient internal conversion channels that recover dna bases after sunlight activation in an ultrafast way.23, 24 this suggests that dna bases and maa structures were naturally selected for their ability to dissipate energy.25 gadusol represents the basic molecular structure of the oxo - compounds mentioned above. at the same time, it allows exploration of the influence of the substituents in the conjugated system by simply shifting the enol enolate equilibrium.26 a time - dependent density functional theory (td - dft) calculation of the transition energies for the enol form in water was carried out by arbeloa.14 the results support the assignment of the excited singlet state accordingly with the generalized solvatochromic shifts of the absorption spectra. however, no chemical calculation has been performed on gadusolate, the enolate form, which dominates the acid base equilibrium under biological ph conditions. herein we present the results of a theoretical study carried out with caspt2//casscf methodology in order to describe the underlying features responsible for the photoprotective role of gadusol. in turn, this information could be useful to understand the photoprotective mechanisms selected by natural evolution and for the design and synthesis of new and more efficient artificial sunscreens. the influence of the medium in the uv absorption of gadusol was recently reported.14 a bathochromic shift was observed as the polarity of the solvent increases. for instance, the maximum in the absorption band changes from 268 nm in water to 263 nm in acetonitrile ; ph dependence was also observed in aqueous solution. for acidic solutions (ph 2.5) maximal absorption was found at 268 nm, whereas at higher ph values (ph7) an increase in band intensity was measured together with a bathochromic shift to 296 nm. these observations were explained on the basis of a displacement in the acid base equilibrium between the neutral form (gadusol) present in acidic solutions and the enolate species (gadusolate) that dominates at ph 7, although the exact structure of the gadusolate remained unclear. therefore, as an initial step we computed the uv spectrum of gadusol in the gas phase, and the results are summarized in table 1. experimental and franck condon vertical caspt2 excitation energies, orbital transitions, and oscillator strengths (f) for gadusol and gadusolate in the gas phase. it follows from these results that the computed caspt2 uv spectrum for gadusol includes two n transitions to s1 and s3 with low oscillator strength values, as is usual for this type of transition. the relevant band corresponds to a transition located at 237 nm with an oscillator strength of 0.35. thus, the bright state in gadusol is s2, and this state will be mainly populated after radiation absorption. the experimental band maximum was reported to be 268 nm in water. therefore, to determine the relevance of the solvent in our calculations, we computed the uv spectrum using the polarizable continuum model (pcm) with water and acetonitrile (table 2). in both solvents, the state order was the same as that found in the gas phase, and the bright state was again s2 with oscillator strength values of 0.25 (water) and 0.26 (acetonitrile), both similar to the value of 0.35 obtained in the gas phase. the computed maximum in water was located at 242 nm, whereas in acetonitrile the maximum appeared at 239 nm. the effect of the basis set was also explored by recomputing the absorption spectra in solvent with the ano - l - vdz basis set. in this case, the absorption in water was found at 245 nm, whereas in acetonitrile it appeared at 241 nm. as can be seen from the results in tables 1 and 2, the caspt2 values with 6 - 31 g in gas phase are qualitatively good enough to reproduce the experimental data. next, we explored the excited - state deactivation of gadusol after light absorption and population of the bright - state s2. the minimum energy path (mep) computed for the relaxation along the s2 potential energy surface (pes) is reported in figure 1. condon region, very fast deactivation of s2 is expected, as no minima or energy barriers were found before crossing between s2 and s1 at a ci point. once the ci s2/s1 point is reached, decay to s1 can be easily achieved. the main molecular distortion after relaxation in s2 implies an out - of - plane movement of the oxygen atoms in the c = o and oh moieties of the chromophore. comparison between the structures of gadusol in the min s0 and ci s2/s1 structures shows that the molecule remains substantially planar in the ground state to minimize the energy through conjugation, whereas at the ci point the molecule is not planar due to partial breakage of the system. the c = o bond has an initial length in the ground state of 1.23, while the length in the ci s2/s1 point is 1.34. also, the c = c bond length changes from 1.35 to 1.49. in addition, the c = o and oh moieties at positions 1 and 3 of the chromophore move out of the plane of the molecule in the ci s2/s1 point (64 and 51, respectively) in agreement with the nature of the excited state. similarly, relaxation along the s1 pes leads directly to a different ci point connecting with the ground state, as shown in figure 2. thus, ultrafast deactivation takes place in s1 as well, as was predicted for s2. again, the main molecular distortions are related to breakage of the system together with the out - of - plane movement of the oxygen atoms in the carbonyl and hydroxy groups that are part of the chromophore. this implies that the same molecular movements are involved in the deactivation in both s2 and s1. in turn, this allows an ultrafast deactivation from the photon absorption to the ground - state recovery. the initial c = o bond subsequently lengthens along the s1 pes and at the ci s1/s0 point has a value of 1.58. correspondingly, the initial c = c bond reaches a value of 1.51. the substituents at positions 1 and 3 are displaced from the plane of the molecule by 34 (c = o moiety) and 65 (oh at position 3). the nuclear motion that lifts the degeneracy between the two states is represented by the gradient difference (gd) and derivative coupling (dc) vectors shown in figure 3. a) derivative coupling (dc) and b) gradient difference (gd) vectors for gadusol ci s1/s0. the nuclear motion pointed by the direction of the vectors suggests gadusol recovery once the ground state is reached. to check this, we optimized four different geometries in the ground state obtained from a slight distortion of the ci s1/s0 geometry in the directions marked by the dc and gd vectors. in all cases, the same geometry of the min s0 was found, probing the high photostability of gadusol. this is consistent with the low photodecomposition quantum yield experimentally determined in solution.14 this, together with the occurrence of two energetically accessible conical intersection points (ci), provides gadusol with excellent features as a photoprotective compound. these conical intersection points connect states s2/s1 and s1/s0 that can be reached by small geometrical changes, thus enabling the ultrafast decay from the franck energies are in kcal mol, relative to the ground - state minimum. as stated above, the photophysical properties of gadusol were found to be ph dependent.14 to explain this behavior, we aimed at studying the enolate forms that could be present in neutral solutions. from the various alternatives that could be found in a neutral medium these two structures correspond to deprotonation at two sites, both of which are considered to be capable of forming relatively stable anions. each of the structures in figure 5 was computed in the gas phase and in water using the pcm method. in both cases structure a was found to be more stable than b. this is not surprising, as the enolate a can delocalize the negative charge along the system, whereas the charge in enolate b is localized at the oxygen atom. this causes structure a to have similar co (1.23 in both cases) and cc (1.42 and 1.40) distances. however, structure b features clearly distinct co (1.21 vs. 1.34) and cc (1.47 and 1.33) bond lengths. in addition, the relative energies of these two species show that no mixture of compounds should be present in neutral solutions of gadusol, as the energy difference is, in any case, very high. results from cas(16,10)/6 - 31 g with pcm indicate that enolate a is 42.5 kcal mol more stable than b. thus, in the study of gadusol in aqueous solution, we performed our calculations exclusively on enolate a. the gas - phase absorption spectrum was computed, and the results are summarized in table 1. a strong absorption (f=0.97) centered at 248 nm and characterized by a (,) transition was found for s1, while s2 shows (n,) character with a very small oscillator strength. this is consistent with the experimental band maximum found for gadusol at ph 7.14 the inclusion of water in the calculations by using pcm does not affect the qualitative picture, and the bright state is also s1, with an oscillator strength value of 0.91 and a band centered at 263 nm. the use of the ano - l - vdz basis set yields a band at 273 nm. comparison between gadusol and gadusolate absorption spectra denotes some differences. first, in the gas phase the band maximum for gadusolate appears at 248 nm, whereas for gadusol the maximum is located at 237 nm. also, gadusolate has a much more intense absorption (f=0.97 vs. 0.38). thus, gadusolate, the main species present in neutral aqueous solutions under pseudophysiological conditions, shows both a higher and red - shifted absorption relative to gadusol. these two characteristics suggest an increased efficiency of gadusolate in terms of the photoprotective role in a natural environment. also, as s1 is the bright state, gadusolate could have a far simpler deactivation pathway to dissipate the light energy, thus implying an improved performance. so far this observation is in agreement with the experimentally observed lower photodecomposition quantum yield for gadusolate than for gadusol.14 to determine the photoprotective capacity of gadusolate, we computed the reaction pathway starting from the franck energies are relative to ground - state minimum. after light absorption, relaxation of gadusolate along interestingly, the path connecting the franck condon region with the ci point implies an ultrafast deactivation of the excited gadusolate, as no energy barrier is located along the reaction path. the main geometry deformation is the out - of - plane motion of the negatively charged oxygen atom of the chromophore (71) together with the c = c bond elongation (from 1.40 in min s0 to 1.45 at the ci point). in contrast, the c = o bond length remains unaltered (1.23 in both geometries) with a small out - of - plane displacement of 45. this deformation is similar to the geometry found for the ci points in related compounds, such as gadusol or palythine.22 the branching plane for this ci is characterized by the dc and gd vectors shown in figure 7. as expected, the nuclear motion that lifts the degeneracy between the states corresponds to the arrangement of the nuclei that make part of the chromophore, keeping the rest of the molecule almost unaltered. thus, it seems that both the excitation and geometry deformation are mainly located in just a part of the molecule. from a photophysical point of view, the photostability of gadusol is mainly due to the substituted cyclohexenone moiety, and the rest of the molecule is not relevant for the relaxation pathways of the excited state. a) derivative coupling (dc) and b) gradient difference (gd) vectors for gadusolate ci s1/s0. deformation of the ci point geometry in the directions indicated by the two vectors leads to direct recovery of the starting material. thus, no side - products are expected after irradiation of gadusolate which may account for the photodecomposition of this compound. as shown by the theoretical calculations, although the deprotonated form of gadusol is responsible for the main absorption at ph 7 and thus it is the relevant species under physiological conditions, both gadusol and gadusolate share some photochemical features that confer these compounds a remarkable uv - protective capacity. also, the absence of any intermediates along the reaction paths is in agreement with the lack of fluorescence observed for these compounds. this fact, together with the recovery of the starting material after irradiation supported by the low decomposition quantum yields, imparts high photostability to these molecules, which in turn allows for efficient energy wastage through subsequent photocycles. the photoprotective mechanism of gadusol and gadusolate is very similar to that previously described for maas.9, 10, 12, 14, 22 this also suggests the relation between gadusol and maas in terms of metabolic routes or even as different steps in the evolution of natural photoprotective compounds. the structural and mechanistic information provided by the molecular - level study of the photoprotective capacities of these and related compounds could encourage the design of new and more efficient products with interesting properties as sunscreens for commercial applications. computational details : the most stable ground - state conformation was selected as the starting structure for the complete photochemical study, performed at multi - state complete active space perturbation to second order with a complete active space self - consistent field reference wavefunction (i.e., ms - caspt2//sa - casscf methodology).27, 28 this methodology has already shown success in describing the photochemistry of various molecular systems.29, 30 for this study, the state averaged - complete active space self - consistent field (sa - casscf) method27 was used for calculation of the electronic transitions and the computed minimum energy paths (meps), including four states (s0, s1, s2, and s3) with the same weight in the averaged wavefunction. the active space chosen comprises all the and orbitals together with the n orbitals of the oxygen atoms that influence the chromophore (16 electrons in 10 orbitals). both casscf and caspt2 calculations were performed with the standard 6 - 31 g basis set. the uv spectra were also computed by using the ano - l - vdz basis set. meps were computed at the casscf level with the methodology present in molcas-6.4.31 meps representing steepest descendent minimum - energy reaction paths were built through a series of geometry optimizations, each requiring minimization of the potential energy on a hyperspherical cross - section of the potential energy surface (pes) centered on a given reference geometry and characterized by a predefined radius. the paths were computed by taking a value of 0.1 amu for the steps. starting from the franck condon (fc) structure, the path was followed to a conical intersection point. once each new structure was obtained, this was taken as the new hypersphere center, and the procedure was iterated until the bottom of the energy surface was reached. bulk solvent effects on the uv spectra were included by using the polarizable continuum model (pcm)32 as implemented in molcas-6.4. the molecule is considered as included in a cavity surrounded by an infinite medium with the dielectric constant corresponding to the specific solvent. the standard values of 78.4 for water and 38.8 for acetonitrile were considered in these calculations. the uv spectra were computed under non - equilibrium conditions, that is, only solvent electronic polarization is in equilibrium with excited - state electron density. this kind of calculation is more adequate to compute vertical excitation energies, as those needed for the uv spectra. calculations of the gradient difference (gd) and derivative coupling (dc) vectors were performed with the gaussian 03 software package,33 and molcas 6.4 was used for calculation of the meps and caspt2 single - point energy corrections. as a service to our authors and readers, this journal provides supporting information supplied by the authors. such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset. technical support issues arising from supporting information (other than missing files) should be addressed to the authors. | gadusol shows one of the simplest structures among a series of natural uv - absorbing compounds that have been related to the photoprotective and antioxidant functions in aquatic organisms. caspt2//casscf methodology was used to carry out a theoretical study on this basic structure in order to describe the underlying features responsible for the photoprotective capacity of the molecule. the influence of the enol enolate equilibrium on the photophysical properties was explored. the results confirm that both forms undergo a rapid deactivation, which very efficiently dissipates light energy as heat. this work highlights the potential of molecular - level studies to provide an understanding of natural photoprotective mechanisms and gives support to the future design of structurally related new synthetic sunscreens. |
subependymomas are uncommonly encountered ependymal tumors, accounting for less than 1% of all intracranial neoplasms and are distinguished from ordinary ependymomas by their overall better prognosis. it has been reported that there is 0.7% incidence of subependymoma among 1,000 patients with pathologically proven intracranial neoplasms. when symptomatic, subependymomas often obstruct critical portions of the cerebrospinal fluid pathway, causing hydrocephalus. the most common symptoms include headache, gait ataxia, vertigo or dizziness, nausea and vomiting. here, we present a case of symptomatic subependymoma with a very rare clinical presentation. a 19-year - old male presented to us with complaints of pain and numbness of 1 month 's duration on the left side of his body, including the face and the upper and lower extremities. this complaint was preceded by herpes zoster involving the v3 distribution of the trigeminal nerve. clinical examination revealed decreased perception of pain and touch involving the whole left side of his body. the rest of the detailed neurological examination was normal. with the suspicion of central pathology, magnetic resonance imaging (mri) of the brain with gadolinium was carried out which revealed presence of a posterior fossa mass (fig. 1, fig. the mass was almost occluding the fourth ventricle with infiltration to the right side immediately behind the pontine tegmentum and probably impinging on the right spinothalamic tract causing the presenting symptoms. postoperative tumor histopathology revealed the classical appearance of subependymoma with characteristic clusters of nuclei in a dense fibrillary background (fig. absence of perivascular pseudorosettes or true rosettes excluded the possibility of ependymoma. in the postoperative period, the patient remained pain free and no radiological evidence of recurrence was seen at follow - up after 1 year. written informed consent was obtained from the patient for publication of this case report and accompanying images. subependymoma is a rare, benign, slow - growing neoplasm that was first described by scheinker in 1945 as a tumor arising from the subependymal cell plate. subependymomas are most commonly located in the fourth and lateral ventricles, but have also been reported arising in the third ventricle, septum pellucidum, and spinal canal. since its original description, more than 100 case reports of intracranial subependymomas have been described. due to its rarity and variable imaging characteristics,. however, symptomatic subependymomas are usually larger, averaging about 35 cm in greatest dimension [5, 6 ]. most symptomatic patients (80%) present with symptoms related to hydrocephalus as a consequence of ventricular obstruction. less commonly, focal neurological deficits (27%), seizures (9%), and subarachnoid hemorrhage (4.5%) have been reported. males are more commonly affected and most reported cases (82%) have occurred in patients older than 15 years. at least half of the reported cases have occurred in the fourth ventricle, with most of the remainder arising in the lateral ventricle. the commonest symptoms were loss of balance (9/12) and vertigo (8/12). they usually present in the fifth or sixth decade of life. in our case, subependymomas have a white to grayish color and are well circumscribed with a firm texture. the tumors grow in a slow deliberate fashion, are usually avascular, and are attached to the ventricular wall by a narrow pedicle. although the exact histogenesis is still uncertain, they most likely arise from subependymal glial cells. other possible sites include astrocytes from the subependymal plate, ependymal cells, and a mixture of ependymal and astrocytic cells. in our case, characteristic clusters of nuclei in a dense fibrillary background were observed. common imaging characteristics of subependymoma include a lobulated, well - defined intraventricular mass with no paraventricular extension [7, 9, 10 ]. the majority of subependymomas are solid or solid with areas of cystic degeneration [1, 7 ]. computed tomography (ct) enhancement characteristics of subependymoma are variable ranging from absent to marked enhancement [1, 7, 9, 10 ]. in our case, there was central calcification, minimal enhancement to contrast and paraventricular extension. mri characteristics commonly include a well - defined solid or mixed solid and cystic intraventricular mass. the solid component is hypo- or isointense on t1-weighted images and hyperintense on t2-weighted images [1, 7, 9, 10 ]. the heterogeneous signal commonly seen in subependymomas correlates well with histopathologic findings, including necrosis, calcification, microcystic change, and hemorrhage. similar to ct, mri enhancement characteristics are variable, including absent to intense enhancement [7, 11 ]. mri has proven most useful in defining the size and extent of the tumor, as well as its relationship to other anatomical structures, such as vasculature, playing a critical role in preoperative planning. included in the differential diagnosis of fourth ventricular masses are ependymoma, subependymoma, choroid plexus papilloma, metastasis, rarely meningioma, central neurocytoma and subependymal giant cell astrocytcoma. age, location and imaging features are helpful in narrowing the number of differential diagnoses. in attempting to differentiate subependymomas from ependymomas with imaging studies alone, lobato. noted that subependymomas tend to be intraventricular, whereas ependymomas tend be paraventricular. they also reported that hyperattenuation compared with brain parenchyma, enhancement, calcification, and cyst formation was also more commonly seen in ependymomas than in subependymomas. however, none of these features are sufficiently pronounced to be pathognomonic for either lesion. like in our case, the tumor was paraventricular, which raised the suspicion in favor of ependymoma preoperatively. therefore, the distinctions between these tumors are even less apparent when they arise in the fourth ventricle. choroid plexus papillomas most commonly occur in young patients and intensely enhance after contrast administration. central neurocytomas are similar to subependymomas in their cystic appearance but are usually isointense with gray matter on both t1- and t2-weighted sequences, whereas subependymomas are almost always hyperintense on t2-weighted images. subependymal giant cell astrocytomas always occur near the foramen of monro, calcify frequently, enhance intensely, and are often associated with ventricular wall calcification [4, 7 ]. this can often be achieved with supratentorial subependymomas, given that these tumors are usually well demarcated, avascular, and noninvasive [1, 7, 10 ]. fourth ventricle subependymomas, however, frequently arise from the floor of the fourth ventricle and the likelihood of cranial nerve injury often precludes complete surgical resection [1, 8, 10 ]. perioperative mortality rates as high as 42% have been reported with surgical resection of fourth ventricle subependymomas. in cases of symptomatic fourth ventricle subependymomas where complete resection can not be achieved, surgery should be directed towards debulking and improving csf outflow [8, 10 ]. most authors do not advocate postoperative radiation therapy after complete surgical resection of pure subependymoma as there is a good prognosis with surgery alone [7, 9, 10 ]. lombardi. reported follow - up data in 21 patients who underwent surgery for subependymoma and found that, of the 19 patients who survived the perioperative period, 12 underwent gross total resection with no evidence of tumor recurrence or tumor - related death. the remaining 7 patients were treated with radiation therapy and follow - up imaging demonstrated a greater radiographic response at doses of 5,000 cgy or greater, supporting an argument for radiation therapy in patients with residual tumor or evidence or tumor progression. in our case, the tumor was well localized with minimal paraventricular spread and without cranial nerves involvement, which influenced the better surgical outcome. we conclude that subependymomas are rare, often asymptomatic masses related to the ventricular system. intraventricular subependymomas have some distinguishing clinical features as well as mri and ct characteristics, but none of them is pathognomic. the best treatment for subependymomas is total resection and, if this is not possible, debulking of the tumor followed by radiation therapy can be considered. diagnosis of subependymoma can be easily missed in view of such atypical presentation. a high index of suspicion is required to clinch the diagnosis early in the process because of its excellent prognosis with timely treatment. | a rare case of subependymoma in a young patient presenting with sensory dysesthesia is reported. computed tomography scan and magnetic resonance imaging revealed a posterior fossa mass occluding the fourth ventricle with infiltration to the right side immediately behind the pontine tegmentum and impinging on the right spinothalamic tract. postoperative tumor histopathology revealed the classical appearance of subependymoma. subependymoma is a rare, asymptomatic, slow - growing, low - grade glioma of the central nervous system. if symptomatic, the clinical features are commonly secondary to hydrocephalus, but subependymoma presenting with sensory dysesthesia has never been reported in the literature. |
tailgut cysts or retrorectal cystic hamartomas are rare congenital presacral lesions identified in all age groups. they are believed to arise from the remnants of the embryonic hindgut. malignancy in tailgut cysts is extremely rare, the majority being adenocarcinomas and carcinoid tumors. a unique feature of our case compared with previously reported tailgut cysts is that this patient 's blood irregular antibodies are positive with higher operational risks. a 44-year - old woman presented to our department complaining of pelvic and perineal pain for 6 months. a nontender, extrinsic, well - defined presacral mass was discovered by digital rectal examination which compressed the rectum. computed tomography (ct) scan of the abdomen and pelvis demonstrated a well - demarcated hypodense, multilocular cystic lesion, 10 cm in size, in the presacral region of the right of the midline (fig. 1). we found her blood irregular antibodies were positive in the preoperative examination. at exploratory laparotomy for excision of the lesion, we found that the mass was adherent to and not easily separated from the rectum and surrounding pelvic wall. abdominal ct demonstrated that lesion was bigger than the last ct image, 14 cm in size (fig. 2). what 's more, the patient had difficulty in passing her motions with shape changing. abdominal ct demonstrated that lesion was bigger than the last ct image, 16 cm in size (fig. 3). taking into account the cystic mass, paracentesis was carried out with about 2000 ml yellow liquid extracted. we found that the mass was adherent to and not easily separated from the rectum and surrounding pelvic wall. combined with clinical symptom and imaging, malignant transformation of retrorectal cystic hamartomas (tailgut cysts) was diagnosed (fig. 4). then tumor necrosis factor (tnf) and raltitrexed were infused into the cysts and 3 cycles oxaliplatin (130 mg / m) were completed. now although the lesion is shrinking, but yellow, viscous mucus still secrete constantly, 100 ml / w. as surgical excision is the essential for treatment, we still suggest this patient to operate by prestoring herself blood and autologous blood transfusion. the ct image took in february 2013, 10 cm in size, in the presacral region to the right of the midline. postoperative routine pathology : combined with clinical symptom and imaging, malignant transformation of retrorectal cystic hamartomas (tailgut cysts) was diagnosed. this study was approved by the institutional review boards and ethics committees of shandong cancer hospital and institute. in the literature, various terms have been used to describe tailgut cysts, including cyst of the postanal intestine, mucus - secreting cyst, retrorectal cystic hamartomas, simple cyst, retrorectal cyst, and enterogenous cyst. it was most often found in asymptomatic middle - aged women. because the lesion is located in the bathy - pelvis and extremely rare, so it is difficult to diagnosis. ultrasound shows multilocular cystic lesions with internal echoes due to mucoid material or inflammatory debris. abdominal ct demonstrated a well - demarcated hypodense, bilocular cystic lesion in the presacral region. there is one report of endoscopic ultrasonography - fine needle aspiration (eus - fna) with a flexible echoendoscope. puncture should be performed when other etiologies are considered or if malignant degeneration changes management. malignant transformation in the form of adenocarcinoma or neuroendocrine tumors, although rare, does occur. mathis reported 31 patients with tailgut cysts and 4 of them (13%) had malignant findings : adenocarcinoma in 3 and neuroendocrine tumors in 1. they concluded that presacral tailgut cysts should be removed because of the risk of malignant transformation, because 2 of the 4 patients with malignancy had died through the follow - up period. therefore, complete resection of these lesions is recommended, as surgical excision is the gold - standard treatment. the treatment of choice is complete excision of the lesion, with resection of the coccyx and a surrounding margin of grossly normal tissue. if surgery can not be carried out, systemic chemotherapy and local radiotherapy can be implemented. prognosis for tailgut cysts with malignant transformation depends on the status of complete surgical resection and tumor histology and grade. two cases with local recurrences and 1 case with a distant metastasis have been reported in adenocarcinomas arising in tailgut cysts in the literature. tailgut cysts should be taken into account, if a retrorectal mass can not be diagnosis clearly. given surgical excision is the essential for treatment, complete surgical excision should be implemented as far as possible. malignant transformation, although unusual, may be focal, so meticulous examination of the gross mass and thorough samplings are important. the coccyx and a surrounding margin of grossly normal tissue should also be excision, when malignant transformation was confirmed. but if surgery can not be carried out like the presented case, systemic chemotherapy and local radiotherapy are also available, which can alleviate the symptoms of oppression and improve the quality of life partly. | abstractretrorectal cystic hamartomas are rare congenital presacral lesions and malignancy is extremely rare. although surgical excision is the essential for treatment, a unique feature of our case compared with previously reported tailgut cysts is that this patient 's blood irregular antibodies are positive with higher operational risks.a 44-year - old woman presented to our department complaining of pelvic and perineal pain for 6 months. computed tomography (ct) scan of the abdomen and pelvis demonstrated a well - demarcated hypodense, multilocular cystic lesion, 10 cm in size, in the presacral region of the right of the midline. we found her blood irregular antibodies were positive in the preoperative examination. so she quitted surgery. exploratory laparotomy and incision and drainage of pelvic tumor were operated. postoperative routine pathology showed : (retroperitoneal tumors) moderately differentiated adenocarcinoma. combined with clinical symptom and imaging, malignant transformation of retrorectal cystic hamartomas (tailgut cysts) was diagnosed. taking into account that cyst is not sensitive to radiotherapy, so tumor necrosis factor (tnf) and raltitrexed were infused into the cysts and 3 cycles oxaliplatin (130 mg / m2) were completed. now although the lesion is shrink, but yellow, viscous mucus still secrete constantly, 100 ml / w.given surgical excision is the essential for treatment, complete surgical excision should be implemented as far as possible. but if surgery can not be carried out like the presented case, systemic chemotherapy and local radiotherapy are also available, which can alleviate the symptoms of oppression and improve the quality of life partly. |
determinar o impacto da implantao de um sistema informatizado de suporte deciso clnica combinado com seminrios instrucionais na utilizao de profilaxia para tromboembolia venosa (tev) de forma adequada. estudo transversal em duas fases (antes e depois da implantao de um novo protocolo de profilaxia para tev) para avaliar o impacto que a estratgia combinada teve na utilizao adequada da profilaxia para tev. o estudo foi conduzido no hospital nossa senhora da conceio, um hospital geral localizado em porto alegre (rs). foram includos pacientes clnicos e cirrgicos com mais de 18 anos com tempo de hospitalizao 48 h. nas fases pr e ps - implantao, foram includos 262 e 261 pacientes, respectivamente. as caractersticas de base das duas amostras foram semelhantes, inclusive em relao distribuio dos pacientes por nvel de risco. comparando - se os perodos pr e ps - implantao, verificou - se que a adequao da profilaxia para tev aumentou de 46,2% para 57,9% (p = 0,01). ao se observar populaes especficas de pacientes, o uso adequado da profilaxia para tve aumentou dramaticamente em pacientes com cncer (de 18,1% para 44,1% ; p = 0,002) e em pacientes com trs ou mais fatores de risco (de 25,0% para 42,9% ; p = 0,008), populaes essas que mais se beneficiam da profilaxia. possvel aumentar o uso de profilaxia adequada para tev em cenrios economicamente desfavorveis atravs do uso de protocolos informatizados e de profissionais treinados. a subutilizao da profilaxia permanece como um problema importante, destacando a necessidade da melhora continuada na qualidade da assistncia hospitalar. venous thromboembolism (vte) comprises two related conditions - deep - vein thrombosis and pulmonary embolism - and is responsible for a great number of complications in hospitalized patients. pulmonary embolism accounts for 5 - 10% of all deaths in hospitalized patients, making vte the most common preventable cause of in - hospital death. there is considerable evidence that primary prophylaxis with heparin significantly reduces the incidence of vte without increasing the risk of major bleeding. in addition, vte prophylaxis has proven to be cost effective, reducing treatment costs and shortening hospital stays. over the last decade, several guidelines aimed at improving preventive strategies and increasing their use have been published. although the majority of medical and surgical inpatients have multiple risk factors for vte, large prospective studies have demonstrated that methods of preventing vte are underutilized. in a multinational cross - sectional study, the proportion of hospital patients at risk for vte ranged from 36% to 73% and the proportion of patients receiving vte prophylaxis ranged from 2% to 84%. this situation has also stimulated new research to identify possible obstacles that limit the effectiveness of vte prevention measures and to evaluate strategies to implement changes. passive strategies and isolated measures, such as the distribution of guidelines and protocols or the staging of one - time trainings, have little impact on practices, whereas the use of multiple strategies with tools that work at the various stages of knowledge dissemination has been shown to be highly effective. computer - based clinical decision support systems (cdsss) and computer reminders are currently in use as strategies to improve the quality of healthcare and have been especially effective for vte prophylaxis. the objective of the present study was to evaluate the effects that a combined strategy of implementing a cdss and organizing training seminars has on the use of appropriate vte prophylaxis. we hypothesized that real - time presentation of vte prophylaxis guidelines through a cdss would increase the proportion of patients receiving appropriate prophylaxis. we devised a strategy for improving vte prophylaxis that involved the creation of a cdss and the organization of training seminars. we conducted a cross - sectional study in two phases (prior to and after the implementation of the new strategy) in order to assess the proportion of patients receiving appropriate vte prophylaxis. the study was conducted at the nossa senhora da conceio hospital, which is located in the city of porto alegre, brazil, and is the largest general hospital in the southern region of the country. the hospital is affiliated with the brazilian national ministry of health and provides treatment only via the brazilian unified health care system. it is a teaching hospital, with 750 adult inpatient beds available for use in a number of medical and surgical specialties, except for orthopedics, trauma, and neurosurgery. in august of 2008, a group of physicians from the internal medicine department the group created a protocol, adapted from existing guidelines, to guide the prescription of vte prophylaxis. the consensus guidelines of the american college of chest physicians, published in june of 2008, was selected as the primary source of recommendations for the protocol to be implemented. we reviewed the current evidence in order to clarify areas of concern, such as major risk factors, contraindications, prophylaxis in post - stroke patients, cancer, and some types of surgery. to incorporate new evidence, we searched the medline and cochrane databases, as well as meeting with teams of internists and other specialists to discuss articles pertaining to their practice. to launch the protocol recommendations, physicians from all departments of the hospital were invited to attend a final consensus meeting. the vte prevention protocol established risk factors, heparin contraindications, and appropriate prophylaxis measures in accordance with patient risk of vte. we adopted a model that could be easily followed by the prescribing physician, using a cdss in which vte risk was stratified into three levels. each level of vte risk was linked to a menu of acceptable prophylaxis options (chart 1). unfractionated heparin (ufh) and low - molecular - weight heparin (lmwh, enoxaparin) are available for vte prophylaxis. because of the higher cost of lmwh, only ufh was included in the vte prevention protocol, given that ufh is the therapeutic equivalent of lmwh in terms of efficacy and safety in the general medical and surgical population. we estimated that, assuming a 50% prevalence of appropriate prophylaxis in the first phase of the study, two samples of at least 227 patients each would be needed in order to detect differences of at least 15% in that prevalence between the two periods with sufficient precision (two - tailed alpha = 0.05 and beta = 0.10). in the first phase of the study, conducted between april and july of 2009 (prior to the implementation of the vte prevention protocol), the patient sample comprised 262 patients, whereas that of the second phase of the study, conducted between december of 2009 and february of 2010 (after the implementation of the protocol), comprised 261 patients. in both phases, the data were collected by six residents in internal medicine, previously trained in the appropriate techniques, who reviewed patient charts and prescription forms in order to obtain the pertinent data. we used a two - stage approach in order to implement the strategies and integrate the vte prevention protocol as a mandatory electronic cdss. first, one - hour seminars were held to present the protocol, emphasizing the importance of prophylaxis and its indications, as well as to explain how the cdss would work. the protocol established was then included as a standardized vte prevention module interfaced with the electronic medical records entry system of the hospital. the standardized vte prevention module was activated automatically at the second access of the electronic medical record after an admission or transfer between units, the first access typically being made by the admitting (staff) physician and the second access being by the attending physician. physicians were prompted to select a vte risk level for each patient, according to the predetermined risk profiles (chart 1), and to determine whether there were any contraindications to pharmacologic prophylaxis. when the risk level was selected, the recommended dose of ufh was automatically added to the electronic prescription for that patient. in patients with contraindications, ufh was not included in the prescription and the standardized vte prevention module was automatically activated every 48 hours in order to identify the persistence or resolution of the contraindication. physicians who chose not to follow the protocol recommendations were required to fill out a form justifying that choice. the main outcome measure was an increase in the proportion of patients receiving appropriate vte prophylaxis, comparing the pre - implementation and post - implementation periods. in both phases, patients were randomly selected from among those admitted to the medical or surgical wards, including the icu. randomization was performed by drawing bed numbers, with the number of beds used in each specialty proportional to the ratio between the number of beds available to that specialty and the total number of beds in the hospital. the inclusion criteria were being over 18 years of age and having been hospitalized for 48 h on any of the wards. the exclusion criteria were current anticoagulation, pregnancy, puerperium, and a history of acute thromboembolic disease. the main variables studied, the risk factors, and the contraindications are cited in a previously published article. each prescription was classified as appropriate or inappropriate on the basis of whether it followed the protocol, after considering the patient risk of vte and the presence of contraindications to heparin. two of the authors assessed the appropriateness of prophylaxis, and questionable cases were discussed by the research group as a whole. patients were stratified by medical or surgical ward and by the risk of vte (low, medium, or high). the absolute difference in the proportion of patients receiving appropriate vte prophylaxis between the two periods and the 95% confidence interval for that difference comparisons between the two periods in terms of the clinical characteristics of the patients were tested using the chi - square test or t - test, as appropriate. all data were analyzed using the statistical package for the social sciences, version 17.0 (spss inc., chicago, il, usa), and winpepi, version 11.4 (http://www.brixtonhealth.com/pepi4windows.html). the study was approved by the research ethics committee of the nossa senhora da conceio hospital, and all of the authors signed a data use agreement. except for a few risk factors, the baseline characteristics of the patients were similar in the two phases of the study (table 1). the distribution of the patients by risk level was also similar between the two phases. in the first and second phases, respectively, 21.4% and 20.3% of patients were postoperative patients, those having undergone major surgery accounting for 66% and 45%, respectively. table 1characteristics of the patients included in the two phases of the study.characteristicphase 1 phase 2 p(n = 262)(n = 261) age, mean sd59.1 16.652.2 17.10.539 male gender, n (%) 137 (52.3)138 (52.9)0.963 postoperative patients, n (%) 56 (21.4)53 (20.3)0.847 major specialties, n (%) internal medicine58 (22.1)51 (19.5)0.855 medical specialties102 (38.9)110 (42.1) general surgery35 (13.4)37 (14.2) surgical specialties50 (19.1)50 (19.2) gynecology17 (6.5)13 (5) vte risk, n (%) high143 (54.6)147 (56.3)0.626 moderate117 (44.7)110 (42.1) low2 (0.8)4 (1.5) risk factors, n (%) immobilization185 (70.6)219 (83.9) 35 kg / m 16 (6.1)17 (6.5)0.991 chemotherapy / radiotherapy7 (2.7)14 (5.4)0.179 history of vte3 (1.1)11 (4.2)0.57 use of oral contraceptives3 (1.1)3 (1.1)1 use of hormone replacement therapy 2 (0.8)3 (1.1)0.686 myeloproliferative disease5 (1.9)1 (0.4)0.216 inflammatory bowel disease0 (0)2 (0.8)0.249 contraindications, n (%) coagulopathy10 (3.8)17 (6.5)0.232 active peptic ulcer disease 2 (0.8)0 (0)0.499 active bleeding 13 (5)8 (3.1)0.378vte : venous thromboembolismbmi : body mass indexafrom april through july of 2009 (prior to the implementation of the vte prevention protocol). bfrom december of 2009 through february of 2010 (after the implementation of the vte prevention protocol). < 0.05 (statistically significant) : venous thromboembolism from april through july of 2009 (prior to the implementation of the vte prevention protocol). from december of 2009 through february of 2010 (after the implementation of the vte prevention protocol). < 0.05 (statistically significant) nearly all of the patients included in the study were classified as being at moderate or high risk of vte (43.4% and 55.4%, respectively). no other contraindications were identified. comparing the pre - implementation and post - implementation data, we found that the use of appropriate vte prophylaxis increased from 46.2% to 57.9% (table 2). the absolute difference between the two study periods was 11.7% (95% ci : 3.2% to 20.3%), which was statistically significant (p = 0.01). table 2use of appropriate venous thromboembolism prophylaxis in the two phases of the study.categoryphase 1 phase 2 differencentotal%ntotal%absolute95% cip(%) all patients12126246.215126157.911.73.2 - 20.30.01 patients with cancer137218.1306344.1269.9 - 42.30.002 patients with 3 or more risk factors26104255111942.917.94.8 - 30.90.008 afrom april through july of 2009 (prior to the implementation of the venous thromboembolism prevention protocol). bfrom december of 2009 through february of 2010 (after the implementation of the venous thromboembolism prevention protocol). < 0.05 (statistically significant). from april through july of 2009 (prior to the implementation of the venous thromboembolism prevention protocol). from december of 2009 through february of 2010 (after the implementation of the venous thromboembolism prevention protocol) the use of appropriate vte prophylaxis increased from 18.1% in the pre - implementation phase of the study to 44.1% in the post - implementation phase (absolute difference, 26% ; 95% ci : 9.9% to 42.3% ; p = 0.002). as can be seen in table 2, a significant increase was also observed in patients with multiple risk factors (from 25.0% to 42.9% ; absolute difference, 17.9% ; 95% ci : 4.8 - 30.9% ; p = 0.008). in addition, there was a post - implementation increase in the use of appropriate vte prophylaxis in patients at high risk of vte (table 3). among surgical patients in the postoperative period (defined as those who had undergone a surgical procedure in the last 30 days), there was a small post - implementation increase in the use of appropriate vte prophylaxis (from 53.6% to 60.4%), which was not statistically significant (absolute difference, 6.8% ; 95% ci : 13.6% to 27.2% ; p = 0.6). however, among medical patients, there was a significant improvement (from 44.2% to 57.2% ; absolute difference, 13% ; 95% ci : 3.0% to 23.1% ; p = 0.011). table 3use of appropriate venous thromboembolism prophylaxis according to patient risk level.vte riskphase 1 (before)phase 2 (after)differencentotal%ntotal%absolute95% cip% high3214322.46314742.920.59.3 to 31.70.0001 moderate8811775.28511077.32.19.9 to 14.00.835 low125034752593.0 to 100.01vte : venous thromboembolism. < 0.05 (statistically significant). our study demonstrates that the implementation of a cdss accompanied by training seminars had a positive effect on the practices of physicians, increasing the proportion of patients receiving appropriate prophylaxis for vte. our samples were representative of the risk profile of the patients seen at our hospital, most of whom are classified as being at moderate to high risk of vte, underscoring the need to implement measures to improve vte prophylaxis. neither sample included patients classified as being at very high risk of vte (orthopedic, neurosurgery, and trauma patients), because such patients are not treated at our hospital. most of the patients admitted to our hospital are referred from emergency rooms, which leaves few beds available for elective admissions. the increase in the use of appropriate vte prophylaxis was most pronounced among patients with cancer and among patients with three or more vte risk factors, populations that benefit the most from such prophylaxis. such recommendations include evaluating vte risk for every patient at admission and regularly during hospitalization, especially after transfer to the icu. considering these recommendations, the cdss created in our hospital is automatically activated at the second access of the electronic medical record after an admission or transfer between units (i.e., the first access by the attending physician). in addition, it is triggered whenever it detects that heparin has not been prescribed. there are studies currently underway that are aimed at identifying the characteristics that make a protocol effective. protocols for vte prophylaxis should consider many aspects of the decision - making process : vte risk factors ; the primary illness (cause of hospitalization) ; patient immobilization ; and the type of surgery the patient is scheduled to undergo. considering these aspects, protocols should include many features and yet must keep things efficient and simple enough for everyday use. possible errors include listing options for vte prophylaxis without providing any guidance about which choice is most appropriate or desirable, as well as supplying too much information, making the protocol too complicated. some order sets offer four to six levels of vte risk, but the evidence to distinguish the levels of risk, as well as the differences among the types of prophylaxis, is often weak. another possible error is to offer non - pharmacologic vte prophylaxis as a first - line option in patients without contraindications to pharmacological methods. in the creation of our protocol, we considered all these possible errors and built a concise tool that allows physicians to make a quick decision. in addition, because risk level and contraindications change frequently in acutely ill patients, a link to the protocol was permanently available in the electronic record for re - evaluation. when contraindications were reported, the protocol was automatically triggered for reassessment within 48 h. several studies have attempted to demonstrate the improvement in the appropriateness of vte prophylaxis after implementation of various strategies. in a randomized controlled trial involving 6,371 hospitalized patients, the use of electronic alerts has increased the use of heparin from 18.9% to 32.2%. in a french study of orthopedic patients, the use of electronic alerts increased the adherence to guidelines from 82.8% to 94.9%. demonstrated that the application of a cdss reduces the rates of deep vein thrombosis and pulmonary embolism. to our knowledge, ours is the first study to report testing the effects of a cdss for vte prophylaxis in a middle - income country. in brazil, studies conducted in the cities of so paulo and salvador showed that the distribution of written guidelines for physicians was not effective in increasing adherence to prophylactic measures. a meta - analysis that evaluated the effectiveness of different strategies to increase adherence to prophylactic measures for vte also showed that passive measures, such as the distribution of guidelines, were ineffective. the authors of that study found that the use of multiple strategies is more effective than is that of either strategy in isolation. among the studies evaluated in that meta - analysis, there were five that had rates of adherence to guidelines of more than 90%. all five of those studies utilized interactive processes of audit and feedback, as well as incorporating warning systems as reminders of vte risk assessment. kawamoto. identified characteristics of systems that are predictive of effective decision support : generating decision support automatically as part of the normal clinical workflow, at the time and place of decision making ; using computers to deliver support ; and offering specific recommendations rather than mere assessments. the authors found that 94% of cdsss presenting those characteristics were successful in improving physician practices. first, patients at very high risk of vte, for whom the evidence of lmwh superiority is more robust, are not admitted to our hospital. second, although economic analyses have marginally favored the use of enoxaparin, there have been no similar analyses of vte prevention in the context presented here - only studies addressing the treatment of an established thromboembolism. our local evaluations, focusing on hospital costs, support the use of ufh, mainly due to considerable differences in terms of drug acquisition costs. the major limitation is inherent in the observational design and the lack of a control population. we studied two populations sequentially, and it is therefore possible that some unrecognized temporal trend biased our results. data were obtained from reviews of patient charts, making it difficult to control for differences in data collection. in addition, we evaluated the effects of the implementation of the protocol only in terms of the proportional use of appropriate vte prophylaxis and did not evaluate patient outcomes. however, some authors now consider it preferable to evaluate processes rather than outcomes when assessing quality of care. although the use of a cdss increases the use of appropriate vte prophylaxis, it is still far from optimal. even with a simple and quick tool, the erroneous evaluation of the risk factors and contraindications can lead the physician to misclassify the level of the patient risk and make an inappropriate choice regarding the prophylaxis. another major limitation of our study is the fact that we used a protocol that was developed locally from the current guidelines and was not validated prospectively. in the literature, there are many models to assess vte risk, most of which have yet to be validated and are complex. maynard. recently published a study validating a model of risk stratification for vte. the authors demonstrated that a simple model with three levels of risk, implemented through a cdss, accompanied by educational measures, audit, and feedback, increased the use of appropriate vte prophylaxis from 58% to 98% over a three - year period and reduced the number of thromboembolic events occurring at the hospital under study. the results of our study show that it is possible to increase the use of appropriate vte prophylaxis at a general hospital in a middle - income country by implementing a cdss and by educating the hospital staff. the same cdss might be useful at other institutions, if the software were adapted to local conditions. our findings suggest that other hospitals in brazil should consider implementing a cdss to increase the use of vte prophylaxis, given that studies evaluating the use of non - computerized protocols have shown that such protocols provide no benefit. although the strategy employed in the present study produced significant results, it is still less than ideal and calls for ongoing staff training, as well as constant improvement of the cdss. | objective : to determine the impact that implementing a combination of a computer - based clinical decision support system and a program of training seminars has on the use of appropriate prophylaxis for venous thromboembolism (vte). methods : we conducted a cross - sectional study in two phases (prior to and after the implementation of the new vte prophylaxis protocol) in order to evaluate the impact that the combined strategy had on the use of appropriate vte prophylaxis. the study was conducted at nossa senhora da conceio hospital, a general hospital in the city of porto alegre, brazil. we included clinical and surgical patients over 18 years of age who were hospitalized for 48 h. the pre - implementation and post - implementation phase samples comprised 262 and 261 patients, respectively. results : the baseline characteristics of the two samples were similar, including the distribution of patients by risk level. comparing the pre - implementation and post - implementation periods, we found that the overall use of appropriate vte prophylaxis increased from 46.2% to 57.9% (p = 0.01). looking at specific patient populations, we observed that the use of appropriate vte prophylaxis increased more dramatically among cancer patients (from 18.1% to 44.1% ; p = 0.002) and among patients with three or more risk factors (from 25.0% to 42.9% ; p = 0.008), two populations that benefit most from prophylaxis. conclusions : it is possible to increase the use of appropriate vte prophylaxis in economically constrained settings through the use of a computerized protocol adhered to by trained professionals. the underutilization of prophylaxis continues to be a major problem, indicative of the need for ongoing improvement in the quality of inpatient care. |
down syndrome is the most common chromosomal disorder, occurring in every 700 to 1000 births. the average life expectancy of down syndrome patients has been prolonged, up to 50 yr according to recent reports (1). with this longer life expectancy, it is getting more and more important for down syndrome patients to have a good quality of life. common comorbidities of down syndrome include congenital heart disease, short stature, obesity, hypotonia, cervical instability, eye disorders (congenital cataract, nystagmus, strabismus, ametropia) and deafness. improving care and outcomes of these comorbidities results in improved quality of life for down syndrome patients and patient s guardians. relieving the burden in caring for the short stature improving effects of gh have been found not only in ghd short stature but also in turner syndrome, prader - willi syndrome and small - for - gestational age (sga) short stature, and gh has been approved for these indications. there have also been reports of gh being effective in down syndrome short stature (2). however, gh treatment is currently approved for down syndrome patients in japan only when ghd is also present. gh acts to increase the lean body mass of muscles and decrease total body fat and may have beneficial effects on the obesity and hypotonia of down syndrome patients with ghd short stature. we combined the treatment data on down syndrome short stature children with ghd from the pfizer international growth database (kigs) and okayama red cross general hospital and analyzed the growth effects and safety of gh treatment over three years. we investigated data on gh therapy in down syndrome short stature children with ghd from okayama red cross general hospital and the kigs database. all 20 subjects were prepubertal down syndrome short stature children who had been diagnosed with ghd. at okayama red cross general hospital, there were 14 down syndrome children with ghd who started receiving gh replacement therapy between june 2001 and november 2009. in the kigs database, there were 6 down syndrome children with ghd who started receiving gh replacement therapy between may 2000 and july 2002. all patients met the criteria for ghd based on a peak gh concentration level of not more than 10 ng / ml on two or three gh stimulation tests (6 subjects at okayama red cross general hospital met the criteria of a peak serum gh concentration of not more than 6 ng / ml using a gh method with recombinant gh as the reference standard). the average gh therapy dosage at treatment initiation was 0.21 0.03 mg / kg / wk among the 14 children from okayama red cross general hospital (the okayama group hereafter), and the value was 0.23 0.08 mg / kg / wk among the children from the kigs database (the kigs group hereafter). the dosage per unit body weight (mg / kg / wk) was adjusted as the children gained weight, and remained nearly constant throughout the treatment period. treatment was discontinued before reaching adult height or before epiphyseal closure in 6 children in the okayama group and 5 children in the kigs group. the reasons for treatment discontinuation were moving (1 patient), did not come to clinic for scheduled visit (3 patients) and refused injection (2 patients) in the okayama group ; the reasons were unknown for all 5 of the patients in the kigs group. five patients in the okayama group and one patient in the kigs group are still continuing their treatments as of today (november 2012). the mean gh treatment period was 5.2 yr (range : 1.0 to 10.4 yr). the height sd score (sds) and weight sds were calculated based on the sex and age standard heights and weights for japanese children in 2000 (3). the height sds (down syndrome) was calculated from the standard values for japanese down syndrome using the japanese down syndrome growth curve reported by kimura. the patients clinical characteristics at baseline are described below. the mean age for the entire cohort was 4.6 yr (range : 2 to 11 yr). the mean age in the okayama group was 5.1 yr (range : 4 to 11 yr), and the mean age in the kigs group was 3.5 yr (range : 2 to 5 yr). the children in the kigs group were therefore younger on average than the children in the okayama group. the height sds (mean sd) at treatment initiation was 3.5 1.3 and was below 3 sd in both groups (3.3 0.5 in the okayama group ; 4.1 2.2 in the kigs group). the height sds (down syndrome), based on the japanese down syndrome disease - specific standard values, was 1.9 1.2 (1.7 0.7 in the okayama group and 2.3 1.8 in the kigs group). the mean height velocity (cm / yr) before treatment initiation was 5.7 2.0 cm / yr. the weight sds (mean sd) at treatment initiation was 1.8 1.2 (1.5 0.5 in the okayama group and 2.4 2.2 in the kigs group). seven of the fourteen children in the okayama group had a medical history of congenital heart disease that could affect growth. the disposition of these diseases was atrial septal defect (3 patients), fallot s tetralogy (2 patients) and ventricular septal defect (2 patients). information was not available on medical history of congenital heart disease for the children in the kigs group. two of the children in the okayama group had hematologic diseases (transient abnormal myelopoiesis and acute myeloid leukemia) in their past treatment histories. these diseases had been cured before gh treatment initiation, and no exacerbations occurred during the treatment period. table 1table 1change in growth parameters during gh treatment shows the growth parameter profile for the 3 yr of gh treatment. the mean height velocity increased appreciably, from 5.7 cm / yr at baseline to 8.1 cm / yr after 1 yr of treatment. although the height velocity decreased in the second and third years of treatment compared with the 1 yr of treatment, it remained the same as or greater than the baseline height velocity. the mean height sds increased from 3.5 at treatment initiation to 2.5 after 3 yr of treatment. the mean change in height sds for the 3 yr was 1.1 (0.9 in the okayama group, but 1.6 in the kigs group). when we use the japanese down syndrome growth curve as the standard, the height sds (down syndrome) increased across the 3-yr gh treatment period. the mean change in height sds (down syndrome) for the 3 yr was 1.3 (1.2 in the okayama group and 1.7 in the kigs group), which was slightly higher than the mean change in height sds (1.1). the mean bmi remained unchanged from baseline (15.9 kg / m) to 3 yr after initiation of gh treatment (16.9 kg / m). in figs. 1 and 2fig. 1growth curves of ghd short stature down syndrome children (3 boys) receiving long - term gh therapy. 2growth curves of ghd short stature down syndrome children (4 girls) receiving long - term gh therapy. 4 was still continuing gh treatment as of november 2012., we plotted growth curves for patients receiving long - term gh therapy over the standard growth curves of japanese healthy children and that of japanese down syndrome children (for 7 patients in all, 3 boys and 4 girls). the growth curves during gh therapy paralleled the standard curves overall, and growth persisted even in late puberty, while the standard curve flattens at that time. three patients (cases 5, 6 and 7 [all girls ]) also received an lh - rh analogue (leuplin) temporarily. the rate of height increase flattened in a manner similar to that seen in healthy children receiving lh - rh analogue therapy. after lh - rh therapy was discontinued, the height increase returned to the pace seen prior to lh - rh analogue therapy or an even greater pace. growth curves of ghd short stature down syndrome children (3 boys) receiving long - term gh therapy. growth curves of ghd short stature down syndrome children (4 girls) receiving long - term gh therapy. this patient was diagnosed with precocious puberty 3.4 yr after gh treatment initiation (when he was 9.1 yr old) based on increased testicular volume (7 ml). it is not considered an adverse event related to gh treatment. in this cohort, the age of onset of puberty during gh therapy ranged from 11 to 13 yr in boys and 9 to 14 yr in girls, and otitis media was reported as an adverse event in four children, and growing pain was reported in one patient, but neither of these adverse events were related to gh treatment. this patient received oral levothyroxine sodium hydrate (thyradin - s), and his thyroid function was monitored. bone age was also measured periodically during gh therapy, but no excessive progression in bone age was noted when the values were compared with chronological age. most of the patients had comorbid congenital heart diseases, and gh therapy did not result in any clinically significant changes in these diseases. this report showed that at the baseline, the mean height sds in the down syndrome short stature children with ghd was 3.5, which was even lower than that seen with untreated turner syndrome or ghd short stature, for which gh therapy is approved in japan. also noted in this report was that height velocity 1 yr prior to treatment initiation of this cohort was slow as well. we presume that if these children were left untreated, the height velocity would have deviated even further from the standard height. the height sds (down syndrome) of this cohort was 1.9 relative to the standard value for the japanese down syndrome population, and it is therefore believed that, in addition to down syndrome, ghd also contributed to their short statures. as seen in growth disorders such as ghd short stature and turner syndrome, for which gh therapy is approved in japan, height velocity was highest in the first yr of therapy and decreased from the second yr and later. however, it remained at a level equal to or greater than that seen before treatment initiation. although the mean height velocity (8.1 cm / yr) in the first yr of treatment in this study was lower than the results obtained for gh in ghd short stature (11.0 cm / yr), it was greater than the height velocity of 6.4 cm / yr that was obtained for the first year of treatment in turner syndrome (genotropin package insert). the mean change in height sds for the three yr was 0.9 for the okayama group and 1.6 in the kigs group. this difference may be attributed to 1) the lower average age at treatment initiation in the kigs group (age of 3.5), 2) the higher incidence of comorbidities such as congenital heart disease and 3) the higher incidence of poor gh treatment compliance in the okayama group. with the sample size being so small, it is difficult to conclude if these three factors contributed to the height sds change or not. despite the improvement in height sds, the mean height sds at the third yr was 2.4 in the okayama group and 2.7 in the kigs group. further study is needed regarding whether or not initiating treatment earlier would increase treatment efficacy. the delta height sds results obtained in our study were nearly identical to the delta height sds values reported by fujieda. in the first and third yr after the start of treatment in ghd short stature children with peak gh levels of not more than 10 ng / ml in gh stimulation tests (5). this suggests that similar efficacy can be obtained from gh treatment in patients with ghd short stature associated with down syndrome. it is known that obesity in down syndrome patients is not pronounced until the age of six, but the incidence of obesity increases after the age of six (6). the mean obesity (%), calculated from the standard weights by height for children reported by ito. the effects of gh on body composition are hard to distinguish from natural processes of growth, and clear conclusions can not be drawn. the delta height sds (down syndrome) for three yr using the down syndrome standard value was greater than the delta height sds relative to the standard value for healthy children. this shows that the growth curve for down syndrome patients gets ever farther away from the standard growth curve for healthy children as age increases, suggesting the need for early treatment initiation. in patients treated for a longer period, the height sds decreased when compared with the standard height in healthy children. however, compared with the standard value for down syndrome, height sds was improved. the growth - promoting effects of gh were confirmed in patients with down syndrome over a longer term. no specific events were observed in association with gh treatment in down syndrome in this study. however, many of the subjects of this study had comorbid diseases, such as congenital heart disease and thyroid disease. down syndrome is also known to be accompanied by hematological malignancy comorbidities. careful monitoring is encouraged in order to detect progression of these life - threatening comorbidities in the early phase. twenty cases of down syndrome short stature children with ghd were treated with gh for three yr, and the growth - promoting effects and safety were investigated. the height sds increased across the three yr of gh treatment, and the mean height sds increased from 3.5 at treatment initiation to 2.5 after three yr of treatment. the growth - promoting effects of gh across a long period were confirmed as well. gh treatment for down syndrome short stature with ghd was as effective as gh treatment for ghd short stature, and no new safety concerns were found. | in this study, we investigated the effects of gh treatment in children with down syndrome who had been diagnosed with gh deficiency (ghd). a total of 20 subjects were investigated in this study. fourteen down syndrome children (5 boys and 9 girls) with short stature due to ghd were treated with gh at okayama red cross general hospital, and 6 down syndrome children (4 boys and 2 girls) with short stature due to ghd were registered in the pfizer international growth database (kigs). height sd score (sds) increased throughout the three - year gh treatment period. the overall mean height sds increased from 3.5 at baseline to 2.5 after 3 yr of treatment. the mean change in height sds during these 3 yr was 1.1. in addition, height assessment of sd score based on down syndrome - specific growth data in the japanese population revealed that the height sds (down syndrome) also increased across the 3-yr gh treatment period. the mean change in height sds (down syndrome) during these three years was 1.3. gh therapy was effective for down syndrome short stature accompanied by ghd, and no new safety concerns were found in this study. |
a circuit level understanding of immune cells and hematological cancers has been severely impeded by a lack of techniques that enable intracellular perturbation without significantly altering cell viability and function. here, we demonstrate that vertical silicon nanowires (nws) enable gene - specific manipulation of diverse murine and human immune cells with negligible toxicity. to illustrate the power of the technique, we then apply nw - mediated gene silencing to investigate the role of the wnt signaling pathway in chronic lymphocytic leukemia (cll). remarkably, cll - b cells from different patients exhibit tremendous heterogeneity in their response to the knockdown of a single gene, lef1. this functional heterogeneity defines three distinct patient groups not discernible by conventional cll cytogenetic markers and provides a prognostic indicator for patients time to first therapy. analyses of gene expression signatures associated with these functional patient subgroups reveal unique insights into the underlying molecular basis for disease heterogeneity. overall, our findings suggest a functional classification that can potentially guide the selection of patient - specific therapies in cll and highlight the opportunities for nanotechnology to drive biological inquiry. |
|
as soon as the pre - mrna has been transcribed from dna in the nucleus, it is processed into a mature ribonucleoprotein (mrnp) particle, which is competent to be exported from the nucleus. the tho complex, a nuclear protein complex conserved from yeast to humans, is involved in the biogenesis of mrnp particles and functions at the interface between transcription and rna export (figure 1). the tho complex functions in mrnp biogenesis at the interface between transcription and export of mrna from the nucleus. proteins are shown with their yeast name followed by the name of the human homolog, where the two differ, for nab2, mtr2/p15, sub2/uap56, mex67/tap, yra1/aly, or with the yeast name followed by the drosophila name for sus1/eny2. protein complexes are shown in capital letters : tho, thsc (also called trex-2) and saga. proteins that interact with each other or between which a physical connection has been reported are in the same color. although it is now clear that the tho complex has a role in rna metabolism, the initial studies that ended in the identification of this key complex had nothing to do with transcription, mrnp biogenesis or rna export. the first known component of tho, hpr1, subsequent genetic and molecular characterization of mutants in which the hpr1 gene had been deleted (hpr1 mutants) linked the hpr1 hyper - recombination phenotype to transcription and showed that hpr1 was involved in transcriptional elongation. tho2 was then identified as a high - copy - number suppressor of hpr1. yeast tho2 mutants also showed a strong hyper - recombination phenotype that was linked to a transcription elongation defect (reviewed in). hyper - recombination could have been seen as just a side effect of the physiological consequences of tho mutations, but it turned out to reveal a role for tho in forming an optimal mrnp particle, one that prevents the nascent rna from interacting with the dna template. in hpr1 mutants, the nascent rna forms an rna - dna hybrid (r - loop) with the dna template strand, while the other dna strand remains single stranded ; the formation of such ' r - loops ' is linked to hyper - recombination (reviewed in). research from an increasing number of laboratories has revealed tho to be a conserved nuclear factor with a key function in mrnp biogenesis and export as well as in development and cell differentiation. a recently reported analysis of a conditional knockout mouse of the thoc5 subunit of tho adds new perspectives to the role of tho in differentiation. the yeast tho complex was first purified from saccharomyces cerevisiae with a tagged his(6)-tho2 under high - salt conditions as a robust four - subunit complex formed by tho2, hpr1, mft1 and thp2. null mutations in all tho components confer the same phenotypes - transcription impairment, hyper - recombination and defective rna export - indicating that tho is a functional and physical unit. further purification of the tho complex together with the mrna export factors yra1 and sub2, the latter of which is an rna - dependent atpase involved in mrna export, in a larger complex termed trex (transcription - export complex), and the identification of sub2 as a high - copy suppressor of hpr1 led to the connection of tho with rna export (reviewed in). this conclusion was strengthened by the observation that sub2 mutants led to a similar transcription - dependent hyper - recombination phenotype to that of tho - complex mutants and that these also show rna - export defects. nevertheless, the physical interactions among the tho components are much stronger than those with other components of trex. tho is stable in high salt conditions in the absence of yra1 and in which sub2 is present in trace amounts that can be detected only by western blotting (reviewed in). indeed, the integrity of the yeast tho complex requires hpr1, tho2, mft1 and thp2 but not sub2. the human or drosophila tho complexes also contain htho2/thoc2, hhpr1/thoc1, tex1/thoc3 and three additional subunits called thoc5, thoc6 and thoc 7. the sub2 ortholog uap56 can be detected in low amounts in drosophila and is absent in human cells immunodepleted of htho2, indicating that in these organisms the core tho complex exists as a salt - resistant stable complex independent of uap56 and yra1. in yeast a plausible scenario is as follows (figure 1) : tho could be one of the first players to act during transcription elongation to facilitate a correct mrnp formation helping recruit other factors, such as sub2 or mex67. other rna binding proteins, such as yra1, which interacts with sub2, and the mex67-mtr2 export factor, could act at subsequent steps in this scenario to bring the mrnp to the nuclear pore complex. tho helps recruit mex67 to the mrnp through hpr1, an interaction that is regulated by rsp5, an ubiquitin ligase that polyubiquitinates hpr1. close to the nuclear pore complex, the thsc complex, also termed trex-2, could have an as - yet unknown function in mrnp biogenesis and export. interestingly, mutations in thsc confer the same phenotypes of transcription elongation impairment, defective rna export and transcription - dependent hyper - recombination as do tho mutations (reviewed in). human tho associates with proteins of the spliceosome and with spliced rnas, this latter interaction being independent of transcription. however, there is also evidence for transcription - dependent recruitment of tho to chromatin in drosophila. the recent observation that drosophila tho complex interacts with eny2, a protein previously identified as a transcriptional activator that interacts with the saga transcription factor, opens up the possibility of a co - transcriptional action of tho in higher eukaryotes. the impact of tho in rna physiology, however, may go beyond transcription elongation and its associated rna metabolism steps, as shown by the involvement of tho in mrna 3 ' end processing, whether or not direct, and by the identification in yeast tho mutants of a larger nuclear macromolecular structure containing components of the nuclear pore complex and polyadenylation factors. the relevance of tho in cell physiology has been clearly shown from yeast to humans. yeast tho null mutants are sick and slow growers and tho depletion has a negative effect on growth rate of human and drosophila cell lines. tho is required for viability of the early mouse embryo and for postnatal survival, as determined by a thoc1 knockout. whether the relevance of tho function is a consequence of a general, genome - wide role or whether its role is limited to a subset of genes is still an open question. in humans and drosophila, various studies have shown that tho is required for the export of heat shock mrnas, but nothing is known about other mrnas. similarly, it is unknown whether tho function is required equally in different cell tissues and throughout development and differentiation. importantly, however, thoc1 conditional knockout mice reveal abnormal testis development that causes sterility. understanding the relevance of tho in development and tissue differentiation as well as its putative impact in cancer and cell proliferation should provide a better understanding of its functional role., who have constructed and characterized an interferon - inducible cre - recombinase based conditional thoc5 knockout mouse. mice with the conditional knockout develop acute leukocytopenia (a reduction in white blood cell numbers) and anemia (a reduction in red blood cell numbers). the number of blood cells in peripheral blood is reduced drastically ; this is caused by apoptosis of bone marrow cells and loss of committed myeloid progenitor cells and of cells with long - term reconstituting potential. the data support the hypothesis that thoc5 is critical in bone marrow and in hematopoiesis, but not for hepatocytes and heart muscles. the results are consistent with previous work from this same group (referenced in) showing that human thoc5 affects granulocyte / macrophage differentiation and adipocyte differentiation, and further support the idea that the tho complex has a key role not only in early embryogenesis, but also in differentiation, as previously reported with thoc1 knockout mice. in the near future it would be interesting to know whether the subunits of the tho complex have different roles in the differentiation of distinct cell types. and it would certainly be important to understand how the role of the tho complex in development and differentiation is related to its molecular function in mrnp biogenesis and export. among the various possibilities that would need to be investigated to understand the role of this intriguing complex in differentiation are whether or not the tho complex has specific functions in different cell types and how this might be related to particular functions that tho could have for specific target mrnas or depending on the putative tho protein modifications (phosphorylation, ubiquitination, and so on) that might change its pattern of activity. we thank r luna and ag rondn for critical reading of the manuscript. the work of aa 's laboratory | the tho complex is a key component in the co - transcriptional formation of messenger ribonucleoparticles that are competent to be exported from the nucleus, yet its precise function is unknown. a recent study in bmc biology on the role of the thoc5 subunit in cell physiology and mouse development provides new clues to the role of the tho complex in cell differentiation.see research article http://www.biomedcentral.com/1741-7007/8/1. |
melanins are biological pigments that are found in human skin in two forms : black / brown eumelanin and red / brown pheomelanin. pump this technology has shown that increased eumelanin content correlates with increasing severity of a melanoma diagnosis. recently, we found that pump probe microscopy is also sensitive to the iron content in eumelanin ; however, under the conditions previously used to differentiate eumelanin from pheomelanin, iron - loaded eumelanin shares a similar pump probe response with pheomelanin, making them difficult to discriminate. characterizing the factors that influence melanin s the histological diagnosis of melanoma is fraught with uncertainty ; new indicators could potentially increase the certainty of diagnosis, which could not only help catch melanomas that might otherwise be missed but also decrease wasted healthcare costs associated with false positives. melanoma metastases have elevated ferritin levels, which may result in increased iron content in cutaneous melanin that would be detectable using pump probe microscopy. oxidative stress helps melanomas progress toward metastasis ; oxidative damage to melanins could be indicative of malignancy. additionally, melanin aggregate size may be relevant to melanoma diagnosis because small melanin aggregates are less efficient at converting absorbed light to heat. they may, instead, produce free - radicals, which could lead to malignancy. this work presents the pump probe response of iron - loaded eumelanin, eumelanin with metals removed, and pheomelanin, at a wider range of wavelengths than previous work. in general, we find that at shorter pump wavelengths pu, the response crosses over from a predominantly ground - state bleaching signal to an excited state absorption signal. the crossover wavelength pu, x is different for each type of melanin, and we find that iron shifts eumelanin s pu, x to shorter wavelengths. to identify the mechanism by which iron shifts pu, x, we characterize the effects of chemical oxidation, photodamage, and aggregate size. we find that iron s modification of the eumelanin pump probe response can not be attributed to differences in aggregation or raman resonances. after considering recent theoretical models of eumelanin s optical absorption, we conclude that iron shifts pu, x as a consequence of broadening the near - infrared absorption bands of individual chromophores in the heterogeneous melanin aggregate. another challenge to differentiating types of melanin stems from the changes in pump probe response exhibited with increasing optical intensity. probe response on optical intensity, finding that eumelanin likely exhibits a pump- and probe - dependent saturation, whereas pheomelanin and iron - loaded eumelanin exhibit a nonlinear excited state absorption. at very high power levels, the iron - loaded eumelanin, in particular, undergoes irreversible changes to the pump probe response. the laser exposure necessary to cause these changes is similar to the previously reported levels necessary to enhance eumelanin fluorescence. this suggests that the previously reported activation of eumelanin fluorescence may be caused in part by the dissociation of metal ions or the selective degradation of iron - containing melanin, thus reducing fluorescence quenching. eumelanin from sepia officinalis was purchased from sigma - aldrich and washed with edta to remove metals, as previously reported. a portion of the edta washed eumelanin was then saturated with iron(iii) chloride according to the previously reported method. iron content was measured with inductively coupled plasma mass spectrometry (icp - ms), as previously reported : the iron - saturated eumelanin contained 27 494 ppm iron, and the edta - washed eumelanin contained only 30 ppm iron. sepia melanin was separated by aggregate size, as previously reported. to prepare for imaging, the eumelanin samples were suspended in a drop of ultrapure water and evaporated on a slide to produce a thin layer of melanin particles. the synthetic pheomelanin, a fine powder, was embedded in agarose, thinly sliced, and allowed to dry, as previously reported. photodamage and oxidative damage studies in human eumelanin were conducted on black human hair cross sections. these were prepared by first embedding the hair in paraffin wax and then slicing the paraffin block into 5 m slices. a solution of 5% hydrogen peroxide continuously flowed over the black hair cross section while images were acquired. the laser system used for the majority of pump probe experiments (illustrated in figure 1) was a mode - locked, titanium - sapphire laser (chameleon, coherent, inc.) pumping a tunable, intracavity frequency - doubled optical parametric oscillator (mira - opo, coherent, inc.), both producing optical pulses with 5 nm bandwidth. the pulses from each source were compressed with prism pairs down to approximately 250 fs fwhm, as measured by two - photon absorption cross - correlation in rhodamine-6 g. the pump beam was intensity - modulated using an acousto - optic modulator (aom) at 2 mhz. the pump and probe beams were combined collinearly and sent into a home - built scanning microscope fitted with a 40, 0.75 na objective (olympus). both beams transmitted through the sample were collected with a 1.1 na condenser (olympus). the pump was blocked using a stack of appropriate chromatic filters, and then the probe was detected by an amplified photodiode. a lock - in amplifier (stanford research systems 844) detected the modulation passed from the pump beam to the probe beam. normal imaging conditions were around 0.1 mw of each beam measured at the sample. scan speeds were normally 25 ms / line with 512 pixels per line across a 400 m field of view. backscattered fluorescence was collected using a 600 nm short - pass dichroic filter (thorlabs fes0600) and a photomultiplier tube (hamamatsu, r3896). a separate system was used to simultaneously measure the pump probe response and fluorescence for hair samples. the system is similar to the one described above with minor alterations, primarily consisting of equipment. the probe beam is generated with a tsunami ti : sapphire oscillator (newport) tuned to 810 nm, which also pumps an opal - opo (newport) tuned to 1430 nm (chosen to optimize output power and stability). the output is then doubled with a bbo crystal to produce a 730 nm pump beam. the two beams are then coupled into a commercial zeiss lsm 510 microscope. custom detection instrumentation, including lock - in - amplifier, integrate pump probe microscopy with other detection ports of the lsm microscope (e.g., confocal and multiphoton detection). the cross - correlation of the two beams measured in rhodamine-6 g is 190 fs. pump probe response curves were acquired by varying the time delay between the pump and probe pulses using a motorized stage, as a stack of images was acquired. probe response curves shown here are averages of the entire field of view. by convention, we set the lock - in amplifier phase so that a positive signal indicates an increase in absorption of the probe. figure 2 shows the pump probe response of edta - washed sepia eumelanin, iron - loaded sepia eumelanin, and synthetic pheomelanin, at pr = 815 nm probe, scanning the pump from pu = 700 to pu = 725 nm in 5 nm increments. the data are normalized to either positive or negative peaks (whichever is greater) to facilitate comparison of the shape of the pump probe response curves. we refer to signals that require the pulses to be overlapped in time as instantaneous, and signals that persist beyond the 250 fs cross - correlation of the pulses as time - delayed. instantaneous signal contributions may include two - photon absorption (positive signal), stimulated raman gain (negative, only if pu pr), and optical kerr lensing (which is minimized by using a high - na condenser optic). time - delayed signal contributions may include excited state absorption (positive), stimulated emission (negative, only if pu pr, stimulated raman scattering induces a gain in the probe (positive signal). in figure 2, pu pr), stimulated raman gain is expected to produce a positive instantaneous signal. scanning a wider range of pump wavelengths will confirm a raman contribution to the signal if the magnitude of the instantaneous pump probe response varies proportionally to the raman spectrum. to span all three raman lines associated with eumelanin and with iron - loaded eumelanin (13501650 cm including associated raman line bandwidths), we measured the response of iron - loaded eumelanin at pr = 805 nm, scanning the pump from pu = 712 to pu = 728 nm in 4 nm increments. (the opo was not stable at 815/745 nm, so we shifted the scan to start at 805/728 nm. although this may change the time - delayed response, the raman response remains unaffected, as it depends only on the difference in pump and probe wavelength.) to compare the amplitude of signals across different wavelengths, we normalize the pump probe data by the magnitude of the 2-photon absorption cross - correlation measured in rhodamine 6 g. figure 4 shows the results, along with the approximate locations and bandwidths of the raman peaks and their overlap with the bandwidth of the pump and probe beams. clearly, the magnitude of the instantaneous negative pump probe signal is figure 4b does not track with the raman spectrum of eumelanin, further confirming that stimulated raman is not a major contribution to the pump probe response, and that differences in raman spectra can not account for the differences in pump probe response caused by adding iron to eumelanin. (a) corresponding wavenumber bandwidths for 805 nm probe wavelength with various pump wavelengths. overlaid (b) pump probe response of iron - loaded eumelanin at varying wavenumber differences. probe response of melanins scaled linearly with the product of pump and probe intensities, at low optical intensities, by the standard method of fitting a line to a plotting of the log of signal magnitude with respect to the log of optical intensity. here we performed a more detailed experiment to separate signal components that are linear with respect to the product of pump and probe intensities from those that are quadratic with respect to either the pump or probe. for each sample, we acquired a set of data at nine different pump and probe power levels (restricting intensity to below that which causes a noticeable change in the pump probe signal upon repeated scanning). figure 5a shows that the form of the edta - washed eumelanin response does not change appreciably under optical intensities comparable to the results in refs (1) and (2) (our objective na greater by a factor of 3, making the intensity greater by a factor of 9, for the same power) and remains stable until approximately 0.3 mw total power (data not shown), at which visible damage ensues. the power dependence of the other two pigments is very different at higher intensities. figure 5b shows that for the iron - loaded eumelanin, as the total power level increases, the ground state bleaching signal initially increases and then it decreases as it competes with an increasing excited state absorption signal. synthetic pheomelanin also has an excited state absorption that grows in with increasingly high power levels. this excited state absorption competes with the ground state bleaching signal and shortens its apparent lifetime. probe responses of edta - washed sepia eumelanin, iron - loaded sepia eumelanin, and synthetic pheomelanin at varying power levels. pump wavelength is 720 nm ; probe wavelength is 815 nm. at high intensities, the pump probe response of iron - loaded eumelanin changes irreversibly. the responses of pheomelanin and edta - washed eumelanin do not undergo irreversible changes in the power limits investigated thus far, so we focus our attention to eumelanins containing iron. an irreversible change to the pump probe response (observed as both a change in pump probe response form and a decrease in the magnitude of the pump probe signal, herein referred to as pump probe photobleaching) is likely caused by chemical changes to the melanins. because high power can also enhance melanin fluorescence, we investigate how the pump probe response changes correlate with melanin fluorescence enhancement. figure 6 shows images of iron - loaded eumelanin at four power levels. due to the spatial heterogeneity of these results, the pump probe data in figure 6 are rendered as false - color images, using phasor analysis. each pixel is colored to indicate the degree of similarity to the pump probe response of edta - washed eumelanin (red) or iron - loaded eumelanin (green). fluorescence intensity (collected with a pmt, 680 nm dichroic, a 600 nm short - pass filter, and a bg-39 filter to reject near - ir scattered light) is overlaid in white. melanin granules with notable behavior over the course of the power study are highlighted. the white box (with zoom inset) shows a melanin granule that first shifts from green to yellow, then pump probe photobleaches, and finally begins to fluoresce. the magenta arrow shows a granule of melanin where the pump probe response form gradually shifts from similar to iron - loaded eumelanin to resembling that of edta - washed eumelanin. when an image is taken at low power after exposure to high power (not shown), the melanin granules maintain their new pump additionally, changes to the melanin morphology, such as the piece of melanin shrinking as power increases from 0.3 to 0.7 mw (white box in figure 6) are irreversible. note that the pump kerimo. also found that melanin fluorescence activation takes variable amounts of optical intensity to induce and that melanin fluorescence was prone to photobleach under these conditions. fluorescence enhancement was also found in a fraction of the melanin sampled and most often seen in melanin granules undergoing morphological changes. images of iron - loaded sepia eumelanin at various total power levels taken in succession with 720 nm pump, 815 nm probe. the white box (with zoom inset) shows a melanin granule that first pump probe photobleaches and then begins to fluoresce. probe response form gradually shifts from similar to iron - loaded eumelanin to resembling that of edta - washed eumelanin. physiological iron content is much lower than in our iron - loaded sepia eumelanin. to test whether our finding from figure 6 applies to eumelanin with physiologically relevant metal ion content, we imaged a black hair cross section, embedded in paraffin wax. the samples were imaged using a 20, 0.8na zeiss objective, starting at 0.1 mw total powers until reaching 2 mw, measured at the sample (figure 7b, part 1). then the samples were reimaged in decreasing power intervals (figure 7b, part 2). the average spectrum for each image is shown in figure 7a, where the solid lines correspond to part 1 and the dashed lines to part 2. as power levels increase, the pump probe response curves have increasing levels of excited state absorption and decreasing levels of ground state bleaching, taking on more edta - washed eumelanin form (figure 2). when the samples were reimaged at decreasing power levels, the response curves did not return to their original forms, indicating that high power levels cause irreversible damage. (a) pump probe response of black hair as a function of power. solid lines are taken with increasing power levels, and the dashed lines are taken with decreasing power levels after reaching the maximum power of 2 mw. figure 7b displays the data according to the way the ratio of the positive peak to the negative peak changes with power level. note that from 0.1 to 1.1 mw, the spectra trace one path, and for powers > 1.1mw, they trace another. interestingly, the spectra continue on this new path after decreasing the power again in part 2, clearly indicating irreversible changes occur above 1 mw average power, which is the same as that reported by kerimo. found that activation occurs even with continuous wave laser exposure, indicating that peak power is less significant than average power. the similar average power required for these two phenomena suggests they may have a common cause. we simultaneously acquired fluorescence while imaging the hair but did not find bulk fluorescence activation under these conditions. not purging the sample with nitrogen most likely caused the melanins undergoing fluorescence activation to photobleach., blue circles are taken with increasing power levels, and the red circles are taken with decreasing power levels after reaching the maximum power of 2 mw. though we did not observe fluorescence activation in the hair cross sections, it is clear from figure 6 that iron - loaded eumelanin fluoresces when photodamaged, and from figures 6 and 7 that photodamage manifests itself by shifting the pump probe response toward that of edta - washed eumelanin. to test how iron affects melanin fluorescence, we collected fluorescence images for iron - loaded and edta - washed eumelanin at different power levels. shown in figure 9, at low power levels, edta - washed eumelanin is fluorescent, whereas iron - loaded eumelanin is not, but iron - loaded eumelanin fluoresces when exposed to higher optical intensity. multiphoton fluorescence of dry melanins at 0.4 and 0.8 mw total power with 720 nm pump and 815 nm probe. figure 10 shows the pump probe response of a black hair cross section being gradually oxidized chemically via hydrogen peroxide. the data are normalized to the negative instantaneous signal because the focal position was optimized at the beginning of every scan due to fluctuations in the flow cell focal position and because signal decreased throughout the experiment due to gradual photobleaching and the amount of melanin decreasing due to oxidative dissolution. power levels were kept low (0.1 mw for each beam) in the interest of isolating the effects of chemical oxidation from photodamage, so no fluorescence was obtained, but it has been previously reported that chemical oxidation increases uv - induced fluorescence. using higher power could have caused detrimental melanin pump probe photobleaching, intensity - related changes to the pump probe signal independent of the chemical oxidation, or even accelerated the chemical changes to the melanin. similarly to figure 7, the excited state absorption increases and ground state bleaching decreases as the melanin becomes increasingly damaged. as the experiment proceeds, we see a response more closely resembling that of edta - washed eumelanin, suggesting that one of the effects of chemical oxidation is to break the iron eumelanin bond. pump probe response of a black hair cross section as it is chemically oxidized. data are normalized to the negative peak because the focal position changed throughout the experiment and to account for pump suspecting that the iron - eumelanin bonds were breaking through oxidation (figure 10) or high power (figure 7), we considered consequences that this bond breakage may have that would modify the pump probe response : changing the unit spectra of individual chromophores, and/or changing the melanin aggregate size. previously suggested that the pump probe response differences between eumelanin and pheomelanin could be attributed to melanin aggregate size differences. edta - washing reduces particles to 138 nm ; subsequent iron - loading increases particle size to 143 nm. if iron affects the response of eumelanin through aggregation, then we would expect that increasing aggregate size and increasing iron content would have the same effect. we test this with several different filtered sizes of eumelanin particles at pu = 720 nm, pr = 815 nm, where loading eumelanin with iron changes the response from excited state absorption (positive) to ground state bleaching (negative). figure 11 shows that increasing eumelanin aggregation has the opposite effect on the response when compared with iron loading : small aggregates have a ground state bleaching response, and large aggregates have an excited state absorption. therefore, iron modifies the pump probe response through some mechanism other than aggregation. because sample preparation can dramatically change the size of melanin aggregates, poorly controlled sample preparation methods could cause the aggregate size to be a confounding factor in experiments where the metal content is varied. although sample preparation methods were identical for edta - washed eumelanin and iron - loaded eumelanin, additional edta - washing experiments were performed on natural melanin (previously purified directly from sepia officinalis as opposed to sigma - aldrich), from another bottle of sigma sepia melanin, and on melanin in a black hair cross - section (data not shown) to verify the trend observed in figure 2a, b. in both cases, probe response under the pu = 720/pr = 810 nm experimental conditions : the instantaneous negative signal decreased and the excited state absorption signal increased, although the negative signal did not always completely disappear. from this we conclude that sample preparation procedures are not the source of pump probe signal differences in figure 2. care should be taken when the chemical composition of melanins is varied to ensure the aggregate size is well - controlled. previously we found that the two major classes of melanin, eumelanin, and pheomelanin, have sufficient differences in their wavelength - dependent pump probe responses to be leveraged for imaging contrast. we have also found that the iron content of eumelanin dramatically changes the pump probe response. even though iron only causes slight changes to the linear optical absorption spectrum. here, we have characterized the response of these melanins for a range of pu from 700 to 725 nm (figure 2) and ruled out differences in raman resonances and changes in aggregation as mechanisms of iron s influence on the pump probe response of eumelanin (figures 3, 4, and 11). turning our attention to the time - delayed (t > 250 fs) response, we consider how these melanins differ, and what underlying causes might account for the differences. a positive time - delayed response (signaling a decrease in detected probe intensity when the pump is on) may be unambiguously interpreted as an excited state absorption, whereas a negative response may be attributed to both stimulated emission and excited state absorption (both of which can increase the detected probe intensity when the pump is on). stimulated emission is ruled out when pr 250fss(t) dt = 0). a summary of the approximate crossover pump wavelengths for various melanins, with an 810815 nm probe, is shown in table 1. natural sepia eumelanin, which has some native iron content, crosses over at pu, x = 750 nm. adding iron content by saturating with fecl3 shifts pu, x to approximately 715725 nm, suggesting that the net effect of bound iron is to shift pu, x to shorter wavelengths. if that is the case, we expect that removing the iron with edta would shift pu, x to > 750 nm. this is consistent with our observations that the response of edta - washed eumelanin is dominated by excited state absorption in all our measurements with pr = 817 nm, pu 750 nm (data not shown ; our opo is not tunable beyond 750 nm, preventing us from locating pu, x). the observation that bound iron content shifts pu, x to shorter wavelengths may be explained hypothetically within the framework that considers the broad optical absorption of melanins to be the sum of a large number of heterogeneous chromophores. though the sum optical absorption spectrum is broad and featureless, each underlying chromophore exhibits peaks whose locations and widths depend on the number and arrangement of its dhi(ca) units (or benzothiazine units in the case of pheomelanin), local chemical environment, stacking structure, and metal ions. only a subset of these chromophores (those having strong optical absorption at pu) are excited initially in a pump probe experiment. the time - delayed probe response reflects competition between ground state bleaching and excited state absorption, depending on a number of factors. if excited state absorption were absent, the ground state bleach signal would depend on pr in the same manner as a transient spectral hole burning measurement : the ground state bleach intensifies as pr approaches pu, and scanning pr would reveal the sum absorption spectrum of the subset of chromophores excited by pu. but excited - state absorption is not absent for pu and pr in the near - infrared, and this response replaces ground state bleaching as pu is tuned away from pr. although ground state bleaching is restricted to probe interactions with the pump - selected subpopulation, excited state absorption might involve excited state transitions either within the pump - excited chromophore or from a pump - excited chromophore to a nearby chromophore that has an available energy level in the vicinity of e hc/pu + hc/pr. in that case, given the high degree of heterogeneity within melanins, it is likely that any near - ir pu, pr combination will access an excited state absorption. thus we expect excited state absorption to dominate the response for pr outside the spectral hole burned by the pump, and to be overwhelmed by an increasingly dominant ground state bleach as we tune pr toward pu, consistent with our primary findings here in figure 2 and in figure 7 of ref (2). this hypothesis for ground state bleach / excited state absorption competition in melanins is illustrated by the four scenarios sketched in figure 12, showing combinations of chromophores having narrow and broad absorption spectra with pump / probe wavelengths having small and large detuning pp = |pu pr|. in figure 12a, the probe is within the narrow spectral hole burned by the pump, and the response is dominated by ground state bleaching. figure 12b shows that as the probe is tuned outside the spectral hole, ground state bleaching is weak, and excited state absorption to a neighboring chromophore occurs. figure 12c, d show the same pump and probe wavelengths, but with chromophores that have broader absorption bands. in this case, the larger pp still results in ground state bleaching, with no crossover to excited state absorption. this implies that the spectral widths of the pump - excited chromophores determine the crossover wavelength pu, x we reported here. schematic diagram showing the proposed explanation of the connection between pu, x and the individual oligomer absorption spectrum. the black curve represents the broad melanin absorption spectrum composed of the sum of individual oligomer absorption spectra. the dotted orange lines represent the absorption spectra of a neighboring chromophore. under this framework, the pump probe data can be interpreted in a manner that is consistent with the idea that melanin s broad, featureless absorption spectrum is the result of the sum of many individual chromophores. smaller chromophores, with fewer dhi(ca) subunits, account for the strong uv vis absorption, whereas larger chromophores, with extensive electron delocalization and red - shifted, broadened absorption bands, account for the near - ir absorption tail. this implies that longer - wavelength pu will access broader - absorbing chromophores, and the probe response will be increasingly dominated by ground state bleaching. indeed, pump probe measurements with pu 700750 nm and pp < 100 nm exhibit a mixture of excited state absorption and ground state bleaching (figure 2 here and figure 7 of ref (2)), whereas measurements with longer - wavelength pu 800815 nm and comparable pp are dominated by ground state bleaching (figure 3 here, and figures 2, 4, and 8 of ref (2)). this framework also allows us to infer the cause of iron effect on the pump probe response of eumelanin. the observed blue shift in pu, x that occurs with increasing iron content (figure 2 and table 1) corresponds with a broadening of available pp over which ground state bleaching is dominant, indicating that iron serves to broaden the absorption spectra of the underlying eumelanin chromophores just as predicted by density functional theory calculations on proposed eumelanin protomolecules. chemical oxidation could damage iron - containing melanin through the fenton cycle : iron present in melanin catalyzes the production of free radicals in the presence of hydrogen peroxide. because these free radicals would form first near the iron - containing melanin chromophores and subsequently degrade these particles, the pump probe response would become more dominated by the iron - free chromophores as oxidation progresses, as we observed in figure 10. figure 6 also shows the general pattern we have observed for the pattern of damage for iron - loaded eumelanin : first, the pump probe response changes, then the granule pump probe photobleaches and undergoes morphological changes, and finally (in some cases) the granule begins to fluoresce. this is in agreement with previously reported melanin fluorescence activation, which also follows morphological changes to the melanin. iron - catalyzed oxidative degradation may cause these morphological changes, which happen first to melanins containing the highest concentration of iron. high optical intensity, on the other hand, may damage the iron melanin bond itself. high optical intensity may cause the melanin to release iron, which would cause a pump probe response dominated by iron - free melanin, as we observed in figures 6 and 7. the power threshold of 1 mw average power reported here and by kerimo. suggest that in applications where higher average power is used, the melanin may be altered or damaged. multiphoton and fluorescence lifetime microscopy of the epidermis applies between 20 and 45 mw of average power to the skin, and although the exact power delivered depends on the imaging depth, this power level could easily damage epidermal melanins. probe response, iron quenches melanin fluorescence by forcing fluorescence to compete with additional nonradiative relaxation pathways. these additional pathways manifest themselves by broadening the absorption spectrum, as previously discussed. melanin ligand - to - metal charge transfer (lmct) band, which is between 700 and 800 nm, which relaxes via a nonradiative mechanism. degradation of iron - containing melanin particles and/or the iron melanin bond is a possible mechanism to explain the previously reported observations that oxidative damage and high optical intensity cause melanin fluorescence enhancement. chemical oxidation, before it completely breaks down all the melanin units capable of absorbing nir, will first break down iron - containing melanin, leaving intact only iron - free melanin, which fluoresces more readily because they have fewer nonradiative relaxation pathways. the explanation that high optical intensity causes the release of redox - active iron ions is particularly compelling because lai. attempted to prevent oxidative photobleaching by performing experiments under nitrogen gas. despite this attempt to prevent oxidation, the black hair melanin continued to photobleach, most likely because black hairs contain iron, which would catalyze melanin oxidation. chemical oxidation may also enhance melanin fluorescence via breaking large melanin aggregates into smaller aggregates. the strong fluorescence of small aggregates suggests narrow unit spectra ; however, ground state bleach dominates the pump probe response, which instead suggests broad unit spectra. however, in this case, our assumption that melanins always have a possible excited state absorption and a possible ground state bleach is no longer valid ; this assumption was based on the idea that eumelanins are heterogeneous mixtures of oligomers and that absorbed energy could always be passed to a nearby oligomer that will allow an excited state absorption. selecting only the smallest melanin aggregates from the bulk mixture reduces number of possible melanin aggregate configurations, making the unit absorption spectra much more similar to each other. making the melanins more homogeneous decreases the chances of an excited state absorption at any possible wavelength combination. obvious lifetime differences between the iron - loaded and edta - washed eumelanins at shorter wavelengths could discriminate them ; however, relying on lifetime differences requires much higher snr pump probe response curves than simply using signals with opposite signs. competing processes contribute to the pump probe response different amounts based on the exact power delivered. when these processes have different signs, such as those contributing to the melanin pump probe response curves, the power effectively modifies the lifetime that is observed. referring back to figure 5, the increasing dominance of the excited state absorption in the cases of pheomelanin and iron - loaded eumelanin shortens the apparent lifetime of the ground state bleach. if one were to calculate a lifetime for the ground state bleach based on observations at a single power level, the result would be a function of the relative contributions of the two processes and their respective lifetimes. a better option is combining information from two different pump wavelengths, such as 705 and 720 nm. under these conditions, a pixel that has a negative instantaneous signal at both wavelengths is pheomelanin, a pixel that has an excited state absorption at both wavelengths is edta - washed eumelanin, and a pixel that has a negative signal at 720 nm but an excited state absorption at 705 nm is iron - loaded eumelanin. making the two pump wavelengths closer, such as at 710 and 715 nm, makes the experiment easier to achieve in practice, but it is a poor choice because at these wavelengths, the signal becomes very weak in the case of iron - loaded eumelanin as the ground state bleach and excited state absorption nearly cancel one another. for differentiating melanins with the two wavelength combinations, power levels must be kept sufficiently low to prevent an excited state absorption from growing into the iron - loaded eumelanin and pheomelanin pump probe response, as shown in figure 5. because melanins have such broad absorption spectra, the near - infrared pump probe experiments might access energy levels comparable to ground - state transitions in the blue / ultraviolet spectral region if two photons are absorbed simultaneously from the pump or the probe. such contributions to the response are nonlinear in either the pump or the probe, and might be the origin of the excited state absorption observed in iron - loaded eumelanin and pheomelanin that grows in with increasing optical intensity. in imaging experiments, high power levels incident on iron - loaded eumelanin or pheomelanin could incorrectly suggest the presence of eumelanin lacking metals. additionally, increasing the power past saturation will cause unnecessary damage to the samples without improving the snr. however, the differences in the power dependencies may be leveraged for discriminating melanins when the laser setup requires that the wavelength is fixed. in this report, we have shown that at sufficiently low power, iron - loaded eumelanin, edta - washed eumelanin, and synthetic pheomelanin can be differentiated by imaging at two pump probe combinations : 705 and 720 nm pump with 815 nm probe. this is possible because the dominant response of the iron - loaded eumelanin switches sign around 715 nm, whereas for native iron concentrations in sepia eumelanin, the sign switch occurs at 750 nm and pheomelanin has a switch at 700 nm. analysis of the pump and probe intensity dependence shows that at higher powers, excited state absorption components grow in to the pump this could make discriminating melanins more difficult, especially in thick specimens and in vivo, where the exact optical power delivered to the focal spot can not be precisely determined. the differences in the pump probe responses between these melanins can not be attributed to stimulated raman scattering. rather, the wavelength at which the melanins switch from a ground state bleaching signal to an excited state absorption signal depends on the broadness of the absorption bands of the individual chromophores being excited. pump probe response curves suggest that chemical oxidation and photodamage both narrow the absorption bands of iron - loaded eumelanin, possibly by damaging the iron melanin bond. fluorescence data support this argument, as fluorescence is enhanced by chemical and photo - oxidation, as well as by removing metals. therefore, it is likely that the previously reported activation of eumelanin fluorescence comes from the dissociation of redox - active metal ions and rapid degradation of metal - containing melanin, both of which can reduce fluorescence quenching, in addition to the release of free ptca to produce smaller eumelanin particles. characterizing the pu, x for melanin in tissue has potential value for understanding how melanin chemistry is altered in different types of skin malignancies. drawing conclusions about melanin chemistry will be challenging because many factors contribute to the pu, x. for example, we previously reported that the pump probe response of eumelanin is different in dermal cells than in epidermal cells. the response differences suggest that dermal cells contain less iron, but considering the results contained herein, one can not eliminate the possibility that the melanin is under oxidative stress or simply forming large melanin aggregates. distinguishing between the many factors that contribute to changes to the pump probe signal will require further research, such as establishing pu, x for edta - washed eumelanin and measuring the effects of other metals, particularly redox - active metals such as copper. additional time - resolved fluorescence measurements may also lead to a better understanding of the effect of metals and degradation on radiative relaxation pathways. we will also extend this work to include pheomelanin with varying metal iron content. | ultrafast pump probe measurements can discriminate the two forms of melanin found in biological tissue (eumelanin and pheomelanin), which may be useful for diagnosing and grading melanoma. however, recent work has shown that bound iron content changes eumelanin s pump probe response, making it more similar to that of pheomelanin. here we record the pump probe response of these melanins at a wider range of wavelengths than previous work and show that with shorter pump wavelengths the response crosses over from being dominated by ground - state bleaching to being dominated by excited - state absorption. the crossover wavelength is different for each type of melanin. in our analysis, we found that the mechanism by which iron modifies eumelanin s pump probe response can not be attributed to raman resonances or differences in melanin aggregation and is more likely caused by iron acting to broaden the unit spectra of individual chromophores in the heterogeneous melanin aggregate. we analyze the dependence on optical intensity, finding that iron - loaded eumelanin undergoes irreversible changes to the pump probe response after intense laser exposure. simultaneously acquired fluorescence data suggest that the previously reported activation of eumelanin fluorescence may be caused in part by the dissociation of metal ions or the selective degradation of iron - containing melanin. |
molecular imaging techniques such as positron emission tomography (pet) and single photon emission computed tomography (spect) enable the in vivo characterization and measurement of biologic processes using high - affinity and high - specificity molecular probes. pet and spect use molecules labeled with a radionuclide that emits photons, known as a radiotracer or radioligand, that are detected in the scanner to provide data on the localization of the radiolabeled molecule in the tissue of interest. as such they provide a noninvasive means of visualizing, and characterizing physiological processes in vivo and the opportunity to make discoveries in the living, intact brain. the major differences between pet and spect stem from the nature of the radionuclides used to label the tracer. the most commonly used radionuclides are tc, in, i and t1 for spect, and c, n, o, and f for pet. the radionuclides used for spect have relatively long half - lives, in the range of hours, and emit a single photon. in contrast, those used in pet have shorter half - lives, in the range of minutes to just under 2 hours in the case of f, and emit a positron, which annihilates when it collides with nearby electrons to emit two photons. the difference in the nature of photon emission leads to differences in emission detectors and image construction spect uses collimation and pet uses coincidence detection. the advantages and limitations of both techniques follow from these properties as spect tracers have longer half - lives they do not need an on - site cyclotron and, multiple scans are possible from one synthesis ; this means they are cheaper to make than pet tracers. however, pet uses radionuclides that tend to be easily combined with biological molecules, and has better resolution. imaging in vivo can avoid the various potential biases or confounds of ex vivo studies, such as exposure to psychotropic drugs or mis - counting object fragments in a sectioned tissue volume whilst also enabling molecular alterations to be linked to clinical changes. an attractive feature of molecular imaging is that the pathophysiological target in a given disorder can be measured in animal models and in experimental human models in the same way, which enables translational research bridging the laboratory to the clinic. moreover, as molecular changes typically precede gross pathology, molecular imaging may enable early diagnosis and treatment of diseases. molecular imaging has provided a number of key insights into the pathophysiology and treatment of central nervous system (cns) disorders such as schizophrenia, parkinson 's disease, depression, and dementia. this review considers the application of molecular imaging to cns disorders, focusing on its potential to inform the development and evaluation of treatments. we focus on schizophrenia, parkinson 's disease, depression, and dementia as major cns disorders where molecular imaging has provided a number of key insights. we also review the potential of molecular imaging to guide new drug development for cns disorders. table i summarizes the ways molecular imaging has advanced our understanding of cns disorders, while table ii outlines its advantages and limitations. schizophrenia is a chronic, severe mental illness characterized by psychotic symptoms such as hallucinations and delusions often coupled with cognitive and social impairments. the discovery of the first antipsychotic drug, chlorpromazine, was the outcome of serendipity rather than rational drug design based on understanding of pathophysiology. it was subsequently discovered that chlorpromazine blocks dopamine receptors, and, despite varying widely in their affinity at other receptors, all antipsychotic drugs currently in the market block dopamine d2 receptors and their affinity for d2 receptors closely parallels their clinical effectiveness. thus the discovery of antipsychotic drugs informed understanding of the pathophysiology of schizophrenia, by providing indirect evidence that dopamine dysfunction contributed to the disorder. the focus then was on d2/3 receptors, and postmortem studies suggested there was a large elevation in schizophrenia (see paper by cross and review by howes and kapur). however, it was not until the application of molecular imaging to schizophrenia research that it became possible to test the dopamine hypothesis in the living brain and to investigate the locus of dopamine abnormalities in detail. since then there have been more than fifty molecular imaging studies of the dopaminergic system in schizophrenia, beginning with seminal findings in the mid-1980s and 1990s. these provide consistent and robust evidence for subcortical presynaptic dopamine abnormalities, specifically elevated dopamine synthesis and release capacity. a recent meta - analysis found the effect size for this was large cohen 's d=0.8 whilst there was little if any alteration in d2/3 receptors. molecular imaging has thus redefined understanding of the nature of dopaminergic dysfunction in schizophrenia by showing that the marked dopaminergic alterations in schizophrenia affect presynaptic function, and not d2/3 receptor availability, as was initially thought. as many of the environmental risk factors for schizophrenia may converge to dysregulate presynaptic dopamine, it has been suggested that this is the final common pathway to psychosis. this is supported by evidence that more of the variance in dopamine synthesis capacity is explained by environmental than heritable factors. imaging dopamine synthesis capacity has been shown to have high sensitivity and specificity for schizophrenia. furthermore, the studies to date indicate that patients with other common adult psychiatric disorders without psychosis, such as depression or bipolar disorder, do not show elevated dopamine synthesis capacity (see review by howes). elevated dopamine synthesis capacity is also not seen in healthy twin siblings of patients with schizophrenia, or in people with long - term subclinical psychotic symptoms who have not developed schizophrenia despite many years of symptoms, further suggesting specificity for the clinical disorder rather than a trait phenomenon. although this requires further evaluation, these findings suggests that molecular imaging of dopamine synthesis capacity may be clinically useful where there is diagnostic uncertainty such as early in the course of the illness. the importance of presynaptic dopaminergic dysfunction in schizophrenia is also supported by findings that elevated dopamine synthesis capacity predates the conversion to psychosis, and increases with the onset of psychosis. elevated dopamine synthesis capacity thus has potential as a biomarker for high risk of psychosis. findings of reduced frontal blood flow, altered cortical structure and the different distribution of dopamine receptors (ie, high density of d1 in cortex and d2 in subcortex) led to the reconceptualization of the dopamine hypothesis in 1980s to include regional specificity, which was first discussed by bannon and roth in 1983 and later by andreasen in 1988. drawing on these and other findings, davis hypothesized that positive symptoms resulted from subcortical hyperdopaminergia and negative symptoms resulted from frontal hypodopaminergia. the relatively low density of dopamine neurons and receptors in cortical regions means that cortical dopaminergic function has proven harder to image than subcortical changes, and has only become possible in the last decade with the development of high - affinity tracers. consequently, in contrast to the wealth of evidence for subcortical hyperdopaminergia, there have been relatively few studies of cortical dopaminergic function in schizophrenia, and, although meta - analysis suggests there are reductions in d2/3 receptors, the effect is not marked (unpublished data). nevertheless, recent evidence indicates that subcortical hyperdopaminergia is linked to cortical dysfunction, at least in the development of the disorder (see ref 21, and review in ref 34). the molecular imaging findings of subcortical presynaptic dopamine dysfunction indicate that by blocking postsynaptic d2 receptors, current antipsychotic drugs act to attenuate the effect of elevated dopamine release. however, though blockade of d2 receptors helps relieve the symptoms of schizophrenia, it does not correct the presynaptic dopamine abnormality and may even paradoxically worsen it in the short term. firstly, acute antipsychotic treatment in healthy volunteers increases dopamine synthesis capacity. secondly, although subchronic treatment is associated with a reduction, dopamine synthesis capacity nevertheless is elevated in patients even after long - term antipsychotic treatment. thus, given that the presynaptic abnormality is present despite long - term treatment, it is not surprising that patients relapse rapidly when antipsychotic drugs are stopped and there is nothing to block the consequence of the presynaptic dopamine dysregulation. whilst it has been known for some time that antipsychotic drugs block dopamine receptors, molecular imaging was able to show that the dopamine d2 receptor occupancy by antipsychotic drugs was significantly associated with clinical response to treatment. these studies also demonstrated that there was therapeutic window for d2 occupancy of between about 60% to 80% with occupancy below 60% associated with little likelihood of response, whilst occupancy above 80% was associated with little added therapeutic benefit and a higher risk of side effects. however, a number of the second - generation antipsychotic drugs developed in the 1990s showed significantly higher affinity for 5-ht2a receptors over d2 receptors. consequently focus shifted in the 1990s from dopamine to serotonin receptors, and particularly 5-ht2a receptors, where antagonism was thought to provide improved efficacy and tolerability. however, here molecular imaging studies have shown that antipsychotic efficacy is not associated with 5-ht2a occupancy by antipsychotic drugs, and that even in the newer drugs d2 receptor occupancy is still necessary for antipsychotic response. the evidence for presynaptic dopamine dysregulation in schizophrenia suggests that therapeutic advancement in schizophrenia requires targeting upstream regulation of dopamine, rather than d2 receptors. it has been suggested that dopaminergic dysregulation may result from upstream glutamatergic abnormalities and that the glutamatergic abnormalities may, in turn, be worsened by the dopaminergic dysfunction. hypofunction of n - methyl - d - aspartate (nmda) receptors is thought to result in increased release of glutamate via disinhibition of -aminobutyric acid (gaba)ergic interneuron and downstream dysregulation of dopamine neurons. one promising glutamatergic target for treating schizophrenia is the glycine transporter, and a number of inhibitors are currently being evaluated. increasing synaptic glycine levels by glycine transporter inhibition is a potential strategy to improve nmda receptor function without the risk of neurotoxic effects from the direct glutamatergic excitation of nmda receptors. indeed, the endogenous glycine transporter inhibitor sarcosine has been found to show efficacy in reducing negative, cognitive, and positive symptoms of schizophrenia and other glycine transporter inhibitor with higher affinity currently under development show promise in preclinical tests. these are located in perisynaptic areas and provide negative feedback on glutamate release, protecting neurons from excessive glutamate transmission. the mglur2/3 receptor agonist ly404039 (administered as the prodrug ly2140023) produced a promising result in the first trial, showing a marked reduction in positive, negative, and general symptom scores, though subsequent clinical trials have not been positive and this drug is no longer in the pipeline. activation of type 5 metabotropic glutamate receptors, functionally coupled with nmda receptors, thereby improving the function of nmda receptors, has also been suggested as an antipsychotic strategy. whilst there are promising developments, the example of ly2140023 indicates that there are considerable challenges in developing new and better treatments for schizophrenia. currently we know little about the nature of glutamatergic abnormalities in vivo in schizophrenia. clearly understanding these and their impact on the dopamine system the availability of novel tracers for imaging receptor subtypes and molecular processes in the brain, such as [c]cmgde, [c]abp688, and [c]ro5013853 for imaging type 2/3 and type 5 metabotropic glutamate receptors, and glycine transporter respectively, has the potential to play a critical role here. however, molecular imaging has also identified another major potential reason for the difficulties in developing better treatment for schizophrenia that is heterogeneity in the neurobiology of the disorder. for example, patients refractory to antipsychotic drugs do not exhibit the elevation in dopamine synthesis capacity, which may suggest a different underlying pathophysiology prompting the development of antipsychotic drugs with different mechanisms. currently clinical trials recruit patients on the basis of the clinical presentation and not the underlying neurobiology. however, it is unlikely that one drug could successfully treat patients with different neurobiology. patient stratification by underlying neurobiology based on a molecular imaging measure, for example, could be used to identify a homogenous group of patients to enter the trial. this was based on plasma kinetics, but it has become clear that there can be a marked disconnection between plasma levels and levels at the effector site in the brain. here molecular imaging has proven useful in providing information on the brain kinetics of candidate antipsychotic drugs to optimize study design and ultimately inform clinical dosing schedules. major depressive disorder (mdd) is a common disorder, affecting approximately 15% to 20% of the population at some point in life. it is characterized by affective, cognitive, and biological symptoms, and results in substantial personal suffering, as well as socioeconomic burden. as in the case of schizophrenia, the development of pharmacological treatments has informed understanding of the biology of major depression. with the discovery that imipramine, an inhibitor of norepinephrine and other monoamine transmitters, improves depressive symptoms, the norepinephrine hypothesis of depression was formed, which posits that a deficiency in norepinephrine contributes to depression (for review, see dell'osso).the next theory to gain favor, with the widespread use of antidepressant medication selectively targeting serotonin, was the serotonin hypothesis, which attributes the dysfunction of the serotonin system to depressive symptoms. further support for this has come from genetic studies that serotonin transporter (5-htt) polymorphisms is the risk for mdd. molecular imaging studies have contributed to testing the monoamine hypotheses of mdd by measuring the baseline level of monoamine receptors, and transporters in patients and controls. a number of pet studies have investigated 5-ht1a receptors, which are thought to play a key role in maintaining stable serotonin transmission and to be involved in the mechanism of antidepressant treatment. most of these have shown that patients with mdd have reduced 5-ht1a receptor density, particularly in the raphe nucleus. this apparent discrepancy may be due to methodological differences, particularly whether the 5-ht1a binding potential is determined using an arterial input function, which is considered the gold standard, or using a reference region. in support of this methodological difference underlying the discrepancy, the group that has found increased 5-ht1a receptor density in mdd using the arterial input function, report reductions when they reanalyze their data using the reference region approach. the 5-ht1b receptor is another presynaptic autoreceptor which inhibits serotonin and other monoamine neurotransmitter release. a 20% decrease in 5-ht1b binding potential in the ventral striatum and pallidum of patients with depression has been reported, suggesting there may be abnormalities in other autoreceptors in mdd as well. 5-htt has also been a focus of investigation in mdd, particularly because of the importance of serotonin transporter inhibitors in the treatment of mdd. the development of radiotracers such as [c]dasb that have a high ratio of specific binding to serotonin transporters relative to nonspecific binding has facilitated research into serotonin transporter function in mdd. though there are some conflicting results, the majority of neuroreceptor imaging studies with [c]dasb have found decreased 5-htt binding in patients with mdd. this is supported by a recent meta - analysis that found a reduction in serotonin transporter availability in mdd with a medium effect size (unpublished data). the finding that depressed suicide attempters had lower 5-htt binding compared with depressed nonattempters and control subjects suggests that 5-htt reductions are greater in patients with more severe illness. pet studies have also found evidence for alterations affecting one of the enzymes that break down monoamines. specifically the density of monoamine oxidase - a (mao - a) has been found to be elevated in mdd, suggesting that the metabolism of monoamines is increased in mdd. based on this, meyer hypothesized that the increased density of mao - a in depression is the primary driver of reduced monoaminergic signal transduction in mdd. there is some evidence on the dopaminergic system in mdd, showing slight decreases or no change in d1 and d2 receptor density, and a decrease in dopamine transporter binding. however, the paucity of radiotracers for the norepinephrine system has limited investigation of this system in mdd, though some tracers for imaging norepinephrine transporter and adrenergic receptors are under development. a major limit on understanding the role of serotonin in mdd has been that it has not been possible to index changes in serotonin levels in the brain. there is, however, emerging evidence that some serotonin receptor tracers are sensitive to changes in serotonin levels, which promises to provide a means of testing this crucial aspect of serotonergic function. the most widely used pharmacological treatments for depression are the selective serotonin reuptake inhibitors (ssris). evaluation of 5-htt binding of radiotracers with therapeutic doses of ssris shows an occupancy ranging from 65% to 87%. in contrast to the case of antipsychotic drugs, the relationship between the occupancy and response still remain undefined and the clinical efficacy does not seem to correspond to dose increases. an apparent paradox for many years has been the observation that whilst ssris rapidly produce high levels of serotonin transporter blockade, the clinical response typically takes several weeks. however, a recent pet imaging study provides evidence that the initial action of ssris is an acute reduction in serotonin levels in terminal fields, in line with preclinical studies which have shown that the initial effect of ssris is to reduce firing in the raphe nucleus and serotonin levels in the terminal fields. in preclinical studies this acute effect resolves over the next few weeks of treatment as the raphe desensitizes. thus, the reduction in serotonin in terminal regions seen with acute citalopram in the human study could explain why ssris take some days to work, even worsening some symptoms initially. new antidepressant developments have targeted acetylcholine receptors (spurred on by muscarinic and nicotinic antagonists showing antidepressant effects) and glutamate receptors (due to rapid antidepressant effects of ketamine, an nmda receptor antagonist). the development of radiotracer for these non - monoaminergic targets should help identify the best targets for drug development, as well as elucidation of the mechanism behind the slow onset of action of available antidepressants versus the rapid onset of action hoped for by the novel drugs. parkinson 's disease (pd) is characterized by motor dysfunction such as resting tremor, bradykinesia, and rigidity, and also by non - motor symptoms such as depression, fatigue, and cognitive impairments. mortem, degeneration of dopaminergic neurons in mesostriatal pathways and deposits of a protein, alpha - synuclein, are typically seen. however, whilst this tells us about the end stage of the pd, molecular imaging of the dopaminergic system has been critical in determining the development and progression of pd pathophysiology. dopamine transporter (dat) and vesicular monoamine transporter 2 (vmat2) are expressed in the terminals of dopaminergic neurons and radioligand binding to these targets is an indicator of the integrity of nigrostriatal projections. lower uptake of these tracers is correlated with greater symptom severity in pd, providing evidence linking loss of terminals with the clinical expression of the disorder. similarly, lower [f]dopa uptake in the putamen has also been correlated with greater severity of motor symptoms and greater severity of bradykinesia and rigidity. furthermore, several studies have demonstrated the striatal [f]dopa uptake declines more rapidly in pd than in age - matched controls, indicating the progression of pathophysiology. [f]dopa pet imaging has shown that the decline in dopamine function starts in the dorsal caudate and putamen contralateral to the side with dominant motor symptoms. furthermore, the rate of decline is greater in the putamen than in caudate, suggesting that the progression of dopaminergic hypofunction in the putamen is faster in the beginning of the disease. molecular imaging has also revealed abnormalities in the serotonergic system in pd patients. in particular, reduced 5-ht1a receptor density and reduced serotonin transporter availability have been found in the raphe nucleus in pd. these findings have been important in indicating that other midbrain nuclei are involved in the pathophysiology of pd, and linking abnormalities in serotoninergic function to some of the non - motor aspects of pd, such as fatigue and depression. for example, reduced [f]dopa uptake in the striatum has been correlated with impaired visual memory and verbal memory. whilst this may reflect the impact of altered striatal dopaminergic function on cognition, furthermore, longitudinal imaging of pd patients has shown that pd patients initially without dementia who later developed dementia (pdd) showed decreases in metabolism over time in the occipital cortex, posterior cingulate cortex, and caudate nucleus, whereas pd patients not diagnosed with dementia at follow - up showed only mild reductions over time in the primary occipital cortex. thus functional changes in both cortical and subcortical structures are associated with the development of cognitive impairments and dementia in pd. these findings indicate that pd is a multisystem neurodegenerative disorder, showing cholinergic and serotoninergic changes as well as pronounced nigrostriatal denervation. there are a number of similar neurodegenerative conditions, such as multiple system atrophy (msa), progressive supranuclear palsy (psp),corticobasal degeneration, dementia with lewy bodies, vascular parkinsonism, and essential tremor, which have different prognoses and treatments. a major challenge in the management of pd is thus making an early and accurate diagnosis. a search for biomarkers to help differentiate pd from other neurodegenerative diseases has yielded a few promising results, and one, datscan, has received fda approval and is available commercially. datscan uses [i]ioflupane spect to evaluate parkinsonian symptoms and is able to distinguish pd from essential tremor with a sensitivity and specificity of 95% and 93% respectively. early pd can be difficult to distinguish from essential tremor, but treatment is generally only indicated in pd. this datscan can be particularly useful to identify early pd, and avoid inappropriate treatment for essential tremor. though datscan is licensed only for the differentiation of essential tremor from pd, there has been much discussion on its use for the differentiation of other parkinsonian syndromes such as msa and psp from pd. other molecular imaging biomarker candidates to distinguish pd from other parkinsonian syndromes such as msa include [c]raclopride and [f]fdg pet. reduction of [c]raclopride binding potential and [f]fdg uptake in the putamen accurately discriminated msa from pd. the patients with pd show a significant glucose hypometabolism in the prefrontal, lateral frontal, and parietal cortices, and the cingulate and caudate areas, whilst msa patients exhibited decreased metabolism in the putamen, pons, and cerebellum. levodopa, a dopamine precursor, has been used as the main treatment for pd since the 1960s. along with levodopa, other enhancers of dopaminergic transmission are widely used. these include drugs that inhibit the break - down of dopamine such as monoamine oxidase b inhibitors selegiline, rasagiline, and deprenyl ; and the catechol - o - methyltransferase inhibitors entacapone and tolcapone ; and dopamine receptor agonists such as bromocriptine, pramipexole, apomorphine, and ropinirole. drugs that act on related systems such as amantadine and the antimuscarinic agents benztropine, trihexyphenidyl, procyclidine, and biperiden, also have a role, although primarily as adjunctive agents. deep brain stimulation (dbs), an implantation of a stimulatory electrode directly into certain areas of the brain, has been successful in managing pd symptoms. whilst these treatments provide symptomatic relief, transplantation of dopaminergic cell to substitute for the lost midbrain dopamine neuron could potentially reverse the pathophysiological changes, and initial trial results have been promising. for example, reductions in [c]raclopride binding in the putamen correlate with improvements in rigidity and bradykinesia, as well as the occurrence of dyskinesia after the treatment with levodopa. [f]fdg pet has also been used to assess the effect of cholinergic agents in pd with dementia, showing that donepezil treatment increases cerebral metabolism in the left angular gyrus and in the right superior and left middle orbitofrontal gyri. molecular imaging may also be used to inform the prognosis and response to treatment (so called theragnostics). for example, pd patients who initially fulfilled the pd diagnostic criteria with normal dopamine transporter scans show a good prognosis and can have their antiparkinsonian therapy withdrawn without clinical deterioration there are a number of difficulties when attempting to assess the progression of pd using clinical scales as these are mostly subjective, nonlinear scales and often biased toward specific symptoms. in addition, symptomatic therapy for pd effectively masks the symptoms for the assessment of disease progression. here molecular imaging provides an objective measure of the underlying pathophysiology that can be used to evaluate progression. in particular striatal [f]dopa uptake has been shown to correlate with dopaminergic cell densities in the substantia nigra and with striatal dopamine levels of patients. furthermore, [f]dopa pet imaging is also highly reliable and appears to be uninfluenced by dopaminergic medication, suggesting the usefulness of [f]dopa pet as a biomarker for monitoring the progression. as well as providing a means to monitor disease progression and the effect of treatment, molecular imaging can be useful to examine the efficacy of restorative approaches to pd. a recent long - term study of cell implantation in pd reported that post - transplantation increases in [f]dopa uptake were related to subsequent clinical outcome, suggesting it could be used to monitor the success of transplantation.. the most common forms of dementia are alzheimer 's disease (ad), vascular dementia, dementia with lewy bodies (dlb), and frontotemporal lobar dementia (ftld). hallmarks of ad are abnormally high amyloid beta (a) and tau protein deposits in the brain, cerebral atrophy, and reduced cholinergic function, although definite diagnosis of ad needs postmortem pathologic confirmation. accordingly, one process in ad pathophysiology is the accumulation of amyloid (40 a.a. and 42 a.a. isoforms) through cleavage of amyloid precursor protein by beta and gamma secretase, while another is the hyperphosphorylation of the tau protein that results in its aggregation intracellularly. mild cognitive impairment (mci) preceding dementia can be accompanied by many changes underlying ad, and such cases are at a higher risk of progressing to ad. dlb is characterized by proteinaceous deposits (made up of synuclein) throughout the brain, and by the degeneration of cholinergic and dopaminergic neurons. pet has been useful in the early diagnosis of ad, and in the differential diagnosis of different kinds of dementia. abnormalities in regional cerebral glucose metabolism, as measured by [f]fdg, have been shown in ad, with predominant reductions in glucose metabolism in temporoparietal regions, precuneus, posterior cingulate cortex and frontal cortex. the most extensively used and validated tracer for a plaques is n - methyl-[c]2-(4-methylaminophenyl)-6-hydroxybenzothiazole, also known as pittsburgh compound b (pib). higher binding potentials of [c]pib are seen in the prefrontal cortex, precuneus, and posterior cingulate of ad patients in comparison with controls. -amyloid deposition seems to be most active during the early phase of the disease, plateauing thereafter. cognitive impairment does not seem to correlate with the extent of [c]pib binding, further supporting the claim that a deposits are restricted to early stages of ad. the poor correlation between [c]pib binding and cognitive impairment has suggested that this imaging test must be interpreted with caution and has raised questions about the role of a protein as a contributor to the overall disease process. nevertheless, [c]pib pet imaging appears to be able to detect prodromal ad earlier and to better distinguish between mci subtypes than [f]fdg pet however, metabolic abnormalities in the brain closely parallel cognitive deficits, and share a more regionally specified distribution compared with -amyloid deposits. although pib has proven very informative for studying ad, the short half - life of carbon-11 limits its clinical application to centres with an on - site cyclotron. consequently considerable effort has gone into developing fluorinated tracers for amyloid plaques and this has resulted in [f]flutemetamol, [f]florbetapir, [f]florbetaben, and other fluorinated equivalents of [c]pib being developed. one of these, [f]florbelapir (amyvid, eli lilly), has recently been approved by the fda for pet imaging of -amyloid neuritic plaques in the living brain. the sensitivity of [f]florbetapir scans for the detection of -amyloid neuritic plaques was 92% (range, 69 to 95) and the specificity was 95% (range, 90 to 100). accurate and reliable estimation of the density of amyloid neuritic plaques by [f]florbetapir was verified through clinical and nonclinical studies and it is expected to provide prognostic and predictive information in ad. molecular imaging has enabled the investigation of other aspects of the pathophysiological process in ad, such as neuroinflammation. the pet tracer [c]pk11195 provides a measure of the activation of microglia in the brain, reflecting neuroinflammation. studies have found elevated [c]pk11195 binding in the temporoparietal, cingulate, and entorhinal cortex in ad, which was also correlated with impairments in cognitive performance. activation of astrocytes, as imaged with [c]ded, has also been shown to be increased in ad and mild cognitive impairment (mci), which is a syndrome defined as cognitive decline greater than expected for an individual 's age and education level that can be a precursor to ad. moreover, mci demonstrated higher [c]ded binding than ad suggesting the activation of astrocyte could be an early dynamic phenomenon in the time course of ad. as such, each tracer has its advantages and their combined use is expected to detect the earliest ad pathogenic events, improve classification and monitor progression. the alzheimer 's disease neuroimaging initiative (adni), a global research effort, has endeavored to validate such biomarkers for the early detection and tracking of ad. adni has developed standardized methods for clinical, mri and pet and cerebrospinal fluid (csf) biomarkers in a multicenter setting and found that combining mri, [f]fdg pet, and csf data with routine clinical tests significantly increased the accuracy of predicting conversion to ad compared with clinical testing alone, decreasing the misclassification rate from 41.3% to 28.4%. [f]fdg pet contributed more to the improvement in the accuracy than csf or mri, showing the usefulness of molecular imaging in the early diagnosis of ad. current drugs for ad include acetylcholinerase inhibitors such as donepezil and rivastigmine ; memantine, a drug that blocks nmda receptors, and drugs that combat the neurotoxic effect of a plaques including the l - type calcium channel antagonist nimopidine, and antioxidants such as vitamin e. candidate drugs for ad include beta and gamma secretase inhibitors, and immunogenic synthetic a42 or monoclonal antibodies (eg, bapineuzumab) against a42. molecular imaging is not only useful for the early detection of ad and mci, but also for predicting treatment response to anti - amyloid and other drugs, and may serve as a surrogate outcome measure. for example, some pet studies reported reduction of brain a plaques measured by [c]pib after the treatment with anti - amyloid agents, though the disease modifying effects need further confirmation. the imaging of inflammatory mediators such as microglia may help assess the effectiveness of drugs that are targeted toward reducing inflammation in the brain, such as nsaids. moreover, since abnormalities in cholinergic, noradrenergic, serotonergic, and dopaminergic systems are all thought to contribute to ad pathophysiology, imaging of these neurotransmitter systems will help develop further drug targets and evaluate their efficacy. molecular imaging enables molecular processes to be related to the clinical presentation, and subsequent course of cns disorders. for example, in the case of schizophrenia it has provided data on the regional nature of the dopamine alterations in the brain at the onset, and even predating the illness. furthermore, molecular imaging has narrowed down the nature of the dopaminergic alterations at onset of the disorder- identifying that the major alterations are presynaptic and not at the receptor or transporter level- and related this to subsequent clinical outcomes. this has enabled the dopamine hypothesis of schizophrenia to be revised in ways that would not have been possible with other techniques. molecular imaging also clarified how antipsychotics work demonstrating that d2/3, but not d1 or 5-ht2a, receptor occupancy is linked to subsequent treatment response and side effects. this finding has contributed to a change in clinical practice away from the use of high dose antipsychotics towards lower doses. these studies also identified that atypical antipsychotics also engage the same d2/3 mechanism as the typical ones. whilst cns disorders are currently largely diagnosed based on their clinical presentation, molecular imaging has begun to provide evidence of different molecular pathologies within the same syndrome, potentially explaining some of the heterogeneity in cns disorders. this has clear translational potential in schizophrenia where the finding that there are dopaminergic and nondopaminergic subtypes suggests the latter group could be identified for emerging alternatives to the dopamine blocking drugs that are currently available. the use of datscan for differentiation of parkinsonian syndromes has already made it to the clinic. furthermore, as shown in schizophrenia and dementia, molecular imaging is beginning to be applied to identify high - risk groups prior to the onset of the frank disorder. there is thus the potential to intervene early, before disability has progressed, to prevent the onset of disorder. firstly, it enables specific drug targets to be identified during the development and progression of a disorder. in schizophrenia, for example, molecular imaging has determined that current drug treatments act downstream of the major dopaminergic abnormality, and has identified the presynaptic regulation of dopaminergic function as a key new target for drugs, whilst in ad the identification of neuroinflammation early in the disease has contributed to the development of anti - inflammatory treatments for the disease. secondly, molecular imaging provides biomarkers to monitor treatments and provide pathophysiologically relevant end points to evaluate new therapies, as illustrated by the use of [f]dopa to monitor stem cell transplants in pd and [c]pib to assess the efficacy of antiplaque agents in ad. thirdly, it identifies endophenotypes to stratify patients with a given disorder on the basis of their underlying neurobiology. such neurobiologcally defined endophenotypes will trigger significant paradigm shifts in new drug development for cns disorders, from the past empirical approach based on trying treatments in heterogenous patient samples to targeting treatments to patients with a homogenous pathophysiology. finally, the identification of molecular imaging biomarkers in a number of cns disorders means it is possible to predict the efficacy of new treatments in animal models by measuring biomarkers, and to design clinical trials in an efficient way by subject stratification based on the endophenotypes. molecular imaging enables molecular processes to be related to the clinical presentation, and subsequent course of cns disorders. for example, in the case of schizophrenia it has provided data on the regional nature of the dopamine alterations in the brain at the onset, and even predating the illness. furthermore, molecular imaging has narrowed down the nature of the dopaminergic alterations at onset of the disorder- identifying that the major alterations are presynaptic and not at the receptor or transporter level- and related this to subsequent clinical outcomes. this has enabled the dopamine hypothesis of schizophrenia to be revised in ways that would not have been possible with other techniques. molecular imaging also clarified how antipsychotics work demonstrating that d2/3, but not d1 or 5-ht2a, receptor occupancy is linked to subsequent treatment response and side effects. this finding has contributed to a change in clinical practice away from the use of high dose antipsychotics towards lower doses. these studies also identified that atypical antipsychotics also engage the same d2/3 mechanism as the typical ones. whilst cns disorders are currently largely diagnosed based on their clinical presentation, molecular imaging has begun to provide evidence of different molecular pathologies within the same syndrome, potentially explaining some of the heterogeneity in cns disorders. this has clear translational potential in schizophrenia where the finding that there are dopaminergic and nondopaminergic subtypes suggests the latter group could be identified for emerging alternatives to the dopamine blocking drugs that are currently available. the use of datscan for differentiation of parkinsonian syndromes has already made it to the clinic. furthermore, as shown in schizophrenia and dementia, molecular imaging is beginning to be applied to identify high - risk groups prior to the onset of the frank disorder. there is thus the potential to intervene early, before disability has progressed, to prevent the onset of disorder. firstly, it enables specific drug targets to be identified during the development and progression of a disorder. in schizophrenia, for example, molecular imaging has determined that current drug treatments act downstream of the major dopaminergic abnormality, and has identified the presynaptic regulation of dopaminergic function as a key new target for drugs, whilst in ad the identification of neuroinflammation early in the disease has contributed to the development of anti - inflammatory treatments for the disease. secondly, molecular imaging provides biomarkers to monitor treatments and provide pathophysiologically relevant end points to evaluate new therapies, as illustrated by the use of [f]dopa to monitor stem cell transplants in pd and [c]pib to assess the efficacy of antiplaque agents in ad. thirdly, it identifies endophenotypes to stratify patients with a given disorder on the basis of their underlying neurobiology. such neurobiologcally defined endophenotypes will trigger significant paradigm shifts in new drug development for cns disorders, from the past empirical approach based on trying treatments in heterogenous patient samples to targeting treatments to patients with a homogenous pathophysiology. finally, the identification of molecular imaging biomarkers in a number of cns disorders means it is possible to predict the efficacy of new treatments in animal models by measuring biomarkers, and to design clinical trials in an efficient way by subject stratification based on the endophenotypes. | molecular imaging techniques have a number of advantages for research into the pathophysiology and treatment of central nervous system (cns) disorders. firstly, they provide a noninvasive means of characterizing physiological processes in the living brain, enabling molecular alterations to be linked to clinical changes. secondly, the pathophysiological target in a given cns disorder can be measured in animal models and in experimental human models in the same way, which enables translational research. moreover, as molecular imaging facilitates the detection of functional change which precedes gross pathology, it is particularly useful for the early diagnosis and treatment of cns disorders.this review considers the application of molecular imaging to cns disorders focusing on its potential to inform the development and evaluation of treatments. we focus on schizophrenia, parkinson 's disease, depression, and dementia as major cns disorders. we also review the potential of molecular imaging to guide new drug development for cns disorders. |
cranioplasty is performed for calvarial defects due to the facts that this region is vulnerable to trauma, calvarial defects may cause cerebral atrophy and convulsions or for cosmetic purposes7,10,12). improvement of neurological deficits, control of convulsions and partial prevention of cerebral atrophy are achieved after these operations12,14). edwards and ousterhout4) advocated autogenous bone graft being the most appropriate cranioplasty material for children and adolescents however allogreft material was emphasized as the ideal graft for adults3,5). one of the most important complications of cranioplasty is late infection or foreign body reaction mimicking infection2,3,7,14). infections are usually seen 3 - 10 months after the cranioplasty operations3,7) however late infections presenting 20 years after cranioplasty operations as seen in our case are very rare. a 43-year - old male patient was admitted to our hospital with the complaint of purulant discharge from the right temporal inscission site for one year. twenty days after craniectomy, cranioplasty had been performed to craniectomized region with allograft material. laboratory examination revealed normal levels of erythrocyte sedimentation rate (5 mm / h), c - reactive protein (0.2 mg / l) and white blood cells (7.910/l). in cranial computed tomography (ct) scan, allograft cranioplasty material and calcified tissue together was seen as hyperdense area (fig. 1a). in cranial mri scan, allograft cranioplasty material together with calcified and fibrotic tissue thereunder was seen (fig. ; white - yellow coloured tissue layer was seen on the surface of cranioplasty material (fig. after removal of the cranioplasty material ; calcified, fibrotic and white - yellow coloured tissue layer 5 mm in thickness was seen in epidural area (fig. there was no physical change in cranioplasty material after removal of surrounding tissues (fig. 2c). cranioplasy is performed to cranial defects for functional and cosmetic purposes5,7,12,14). in craniectomized patients ; scalp herniates towards brain through defect and makes irritation to brain by means of atmospheric pressure leading to cerebral atrophy and convulsions. improvement of neurological deficits, control of convulsions and partial prevention of cerebral atrophy are achieved after cranioplasty in these patients12,14). in our case infection rates are higher in patients previously operated for cranioplasty or another cranial operation and whose previous operations include frontal sinus3,7,13,14). infective complications are higher when time passing between craniectomy and cranioplasty is not long enough6,9,11,13 - 15). in our case, the time interval between craniectomy and cranioplasty is only 20 days which is not long enough and thought to be facilitating infection. no statistical significance was found between the infection rates and size of cranioplasty material used, choice of allograft or autograft, the prophylactical antibiotic used, age, sex, site and duration of operation14). edwards and ousterhout4) advocated that autograft is the ideal cranioplasty material for children and adolescents while allograft material was emphasized to be more appropriate for adults and previously infected patients3,5,7). the previously used cranioplasty material in our case was allograft and we replaced it with allograft material again. cheng.3) emphasized that neither negative culture of infected material rules out infection nor positive culture certainly indicates it. the culture of purulant discharge and removed graft with surrounding reactive tissues were negative in our case but we still diagnosed the case as late cranioplasty infection. detection of air bubbles and dural contrast enhancement in cranial ct are not signs of infection due to the fact that these findings are detected in infected as well as uninfected patients (1). for this reason, the most reliable indicator of infection is the clinical presentation of the patient as always instead of imaging techniques and laboratory findings only. in our case, infection of cranioplasty presented 20 years after the operation which is very rare in the literature. however, possibility of this late complication should be appreciated and that follow - up period after cranioplasty operations should not be short considering late cranioplasty infections. | cranioplasty is performed using autograft and allograft materials on patients to whom craniectomy was applied previously due to the facts that, this region is open to trauma and the scalp makes irritation and pressure onto the brain paranchyma causing brain atrophy and convulsions. dramatical improvement of neurological deficits, control of convulsions and partial prevention of cerebral atrophy are achieved after these operations. one of the most important complications of cranioplasty is late infection. here, we report a 43-year - old male patient admitted with the history of purulant discharge from the right temporal incission site for one year to whom cranioplasty had been performed with allograft material 20 days after craniectomy which had been performed in 1989. allograft cranioplasty material was removed and cranioplasty was performed using new allograft material with the diagnosis of late cranioplasty infection. |
during the past 20 years, gtp - binding proteins of the rho family have been identified as essential players in many cellular functions, and the basics of their biology have been reviewed extensively. this branch of the ras super family encompasses 22 genes in humans, of which rho, rac and cdc42 are the best characterized. through regulation of the actin cytoskeleton, rho gtpases control changes in cell morphology and cell motility triggered by extracellular stimuli (reviewed in refs. 4 and 5). rho gtpases mediate these functions through a large array of effector proteins and are themselves regulated by gdp / gtp exchange factors (gefs) and gtpase - activating proteins (gaps). at least 80 genes are present in mammalian genomes encoding rho gefs that are subdivided into proteins containing a dh - ph (dbl homology, pleckstrin homology) domain and the 11 members of the dock protein subfamily. gef proteins bind the gdp - bound gtpases and function to accelerate the exchange of gdp for gtp, thus generating the active, gtp - bound conformation of the gtpase. on the other hand, a blast search using the smart tool (http://smart.embl-heidelberg.de/) identifies more than 100 proteins (167 including multiple isoforms of some of them) containing a rhogap domain in humans, many of them uncharacterized. the gap proteins act opposite to the gefs by stimulating the rate of gtp hydrolysis and thus return the gtpase to its inactive, gdp - bound conformation. to add to the complexity, active (gtp - bound) rho gtpases can bind to over 50 proteins that fit the definition of an effector and have been functionally characterized. effector and target proteins often contain motifs that recognize the rho proteins that are bound to gtp and are recruited or activated by the rho gtpases. these effector / target proteins include many different functional families, such as serine / threonine protein kinases, lipid kinases and adaptor or scaffold proteins. depending on the cell type or the nature of the stimulus, a single rho can be activated by several gefs and, in turn, can trigger an array of various effectors. now that most of the actors have been identified, if not fully characterized, the challenge is to understand how cells mobilize the appropriate set of rho gtpases, gaps, gefs and effectors and organize them into specific signaling pathways to achieve defined cell functions. most of the cellular functions of the rho gtpases stem from their ability to trigger actin polymerization and bundling of actin cables and therefore to remodel the cytoskeleton. by doing so, they are involved in the control of cell shape and morphology, cell migration and chemotactic responses, axonal guidance and dendrite outgrowth in neurons, endocytosis and intra - cellular vesicle trafficking. in many instances, rho gtpases have also been shown to regulate cell cycle entry and cell cycle progression, in particular by regulating expression of a number of genes involved in g1/s transition, e.g., cyclin d1 or p21. indeed, at mitosis onset, rhoa activity increases and the resulting activation of its effector, the rho - associated kinase rock, mediates cortical retraction during mitotic cell rounding. during early mitosis, depending on the cell type, either the gef - h1/rhoa / mdia1 pathway (rat-2 cells) or the ect2/cdc42/mdia3 pathway (hela cells) are necessary for spindle assembly and attachment of microtubules to kinetochores. later in mitosis, rho gtpases are directly involved in cytokinesis by regulating the actin and myosin contractile ring, which eventually forms the cleavage furrow to separate daughter cells. one of the pathways that regulate rho activity in this process involves the gef ect2 and the gap mgcracgap. mgcracgap is active toward rac and cdc42 and, to a lesser extent, toward rhoa. both ect2 and mgcracgap localize in the nucleus of interphasic cells, associate to the spindle in metaphase and anaphase and accumulate at the midbody during cytokinesis. mgcracgap associates with the kinesin - like protein mklp1, resulting in a heterotetrameric complex designated centralspindlin, which is required for microtubule bundling. however, as shown by mutations of the catalytic arginine residue in drosophila or c. elegans, the gap activity of mgcracgap may not be necessary for cytokinesis. this gap activity may thus be required to reduce the levels of rac and cdc42 in metaphase, whereas at the time of cytokinesis, mgcracgap might only act to recruit ect2 and favor activation of rhoa. ect2 and mgcracgap are not the only rho regulators in mitosis and successful cytokinesis may also depend on gef - h1/lfc, myogef and p190rhogap (the a isoform). downstream of the rho gtpases, some of the effector proteins that have been described to participate in cytokinesis include rock, pkn, citron kinase and mdia, which activate myosin ii and actin polymerization. most of the studies have used sirna mediated knockdown or overexpression in hela cells to describe these functions. however, different types of cells may vary in their requirements, and at this time it remains to be elucidated which cell type uses which combination of proteins to build the mitotic rho regulatory pathways. we will discuss how, in turn, the cell cycle machinery influences rho signaling pathways to regulate mitosis - specific functions. gdp / gtp cycling stimulated by gefs and gaps represents the primary mode of regulation of small gtpases. however, in a few instances, it has been shown that cell stimulation or oncogenic processes may involve transcriptional or posttranslational regulation of expression of some gtpases, their effectors or their regulators. examples of such regulations have been described for some atypical rho gtpases, meaning these gtp - binding proteins such as rnd3/rhoe, rhoh or rhou / wrch1 that are gtpase - deficient (for review see ref. indeed, because they are not regulated by the classical gdp / gtp conformation switch, atypical rho proteins are often regulated at the level of expression : for instance, wrch1 is induced by wnt-1 signaling, and rhoe is a p53 target gene that is induced in response to genotoxic stress. more conventional gtpases may also be regulated at the transcriptional level : rhob was initially characterized as an immediate early gene in growth factor responses and is also induced by tgf signaling. another example is iqgap1, an effector of cdc42 involved in mitosis, which is also an early gene induced in response to tgf. in addition, more pathway components than anticipated are regulated at the transcription level in response to growth factors or during differentiation processes. for instance, arhgef8/net1, dock5 and wrch1 are increased during osteoclastic differentiation of raw264.7 cells induced by the cytokine rankl, and silencing either of these genes impedes differentiation. growth factor stimulation often leads to cell cycle entry and cell cycle progression, and indeed, expression of several gefs and gaps seems to correlate with cell cycle phases. in interleukin 2-stimulated lymphocytes arhgef3/xpln, a gef specific for rhoa and rhob, is induced early in the cell cycle (g1), whereas other gefs, such as net1 or ect2, are induced later, with peak protein expression in g2/m. unfortunately, except for ect2 (see below), the consequences of these phase - specific variations of expression have not yet been investigated. it is of interest that the levels of expression of the rho gtpase regulators that are known to be involved during mitosis, such as ect2, mgcracgap, p190rhogap and gef - h1, fluctuate during the cell cycle and reach their highest in g2/m. the transcription of ect2 and mgcracgap is induced when synchronized cells enter s - phase. chromatin immunoprecipitation experiments indicated that the promoters of these two genes contain binding sequences for e2f1 and cux1 another cell cycle - related transcription factor. thus transcription of ect2, mgcracgap, but also of the centralspindlin component mklp1 at the g1/s transition or in early s provides a rationale for the high protein expression in g2/m. also identified within the promoter sequences of these genes are chr elements that mediate repression of these promoters in the g1 phase of the cell cycle and contribute to reduce the level of expression after mitosis. rhobtb2, an atypical gtpase of the rho family, is also a transcriptional target of e2f1 ; its mrna is induced in s phase, and its protein level peaks in g2/m. although this has not been reported, it is not unlikely that cell cycle variations of the protein levels of p190rhogap might also be, at least in part, due to transcriptional regulation. one experimental procedure that has been used extensively to analyze the role of the rho pathways in mitosis is gene silencing through sirna knockdown. silencing of either rhoa, any of the gefs ect2, gef - h1, myogef, or of the gaps mgcracgap or p190rhogap results in multinucleated cells. one physiological condition, however, where failed cytokinesis is the rule, rather than an accident, is the differentiation of megakaryocytes, the hematopoietic cells that give rise to blood platelets. during their differentiation, megakaryocytes become polyploid by a process named endomitosis. activation of rock by rhoa has been known for a long time to be involved in the function of mature platelets, namely, aggregation and mediator release, but it also controls the fragmentation of megakaryocyte cytoplasm, which releases platelets. in addition, downregulation of this rho / rock pathway is required to prevent non - muscle myosin iia activation at the cleavage furrow to abort ring contraction and allow endomitosis. it was recently reported that these events are under the control of the megakaryocyte transcription factor mkl1, also known as mal, which represses the transcription of ect2 and gef - h1 as cells undergo differentiation. indeed, exogenous expression of either ect2 or gef - h1 forces megakaryocytes to complete cytokinesis, prevents endomitosis and leads to proliferation of 2n megakaryocytes. besides transcriptional regulation, many proteins that play key roles during mitosis and cytokinesis are further controlled by ubiquitin - mediated proteasomal degradation. the e3 ubiquitin ligase that is critical at the onset of mitosis is the anaphase - promoting complex / cyclosome (apc / c). indeed, apc / c mediates ubiquitylation, thus triggering subsequent proteasome - dependent degradation of key proteins, such as securin or cyclins a and b, allowing progression from prometaphase to mitotic exit. the apc is fully active as a ubiquitin ligase once it has bound to its co - activators cdc20 or cdh1, resulting in distinct assemblies named apc / cdc20 or apc / cdh1. apc / cdc20 activity is critical for metaphase / anaphase transition, whereas apc / cdh1 is fully active in late mitosis and g1 phase. several lysine residues (k-11, k-48, k-63) of ubiquitin can be used to build poly - ubiquitin chains, although the apc appears to preferentially assemble k-11 linked poly - ubiquitin chains to target the complex to the proteasome. the rho gtpases have been known for some time to be ubiquitylated under certain circumstances, for example, following action of bacterial toxins, and the responsible e3 ubiquitin ligases have been identified. the rac exchange factor dock180 is ubiquitylated in response to egf, depending upon its interaction with the adaptor crk, and protected from degradation by its association with the scaffold protein elmo. thus control of the protein levels by degradation is an integrate part of the regulation of the rho pathways. not surprisingly, ubiquitylation and post - mitotic degradation also target some of the rho pathway components involved in mitosis (table 1). the protein levels of p190rhogap - a decrease in late mitosis through ubiquitin - mediated degradation. interestingly, expression of non - degradable mutants of p190rhogap in hela cells results in multinucleation, indicating that reduced levels of p190rhogap are required before cytokinesis is completed. as p190rhogap acts on rhoa, reducing gap activity would allow for maintaining the levels of rhogtp throughout cytokinesis. the other known rhogap which is involved in the process, mgcracgap, was also observed to be degraded at this time following ubiquitylation by apc / cdh1 (bertoglio., unpublished). it was also found that ect2 is a substrate of apc / cdh1, and its poly - ubiquitylation sends it to degradation at the end of mitosis. nuclear localization of ect2, mediated through a bi - partite nls, is required for this event to occur. also critical is a region toward the c terminus of ect2 that contains tek - like boxes, which have been described by jin and colleagues as novel motifs that facilitate ubiquitin chain nucleation in apc substrates. although a precise comparison of the timing of protein degradation is hard to achieve with the current protocols used for synchronizing cells, it would appear that ect2 is degraded later than mgcracgap. to our knowledge, mdia2, a member of the formin family that contributes to contractile ring formation, is the only effector protein that has been described to undergo degradation in mitosis in mammalian cells. in yeast, the paralog of iqgap1, a cdc42 effector, is also degraded by apc / cdh1 at the end of cytokinesis. a shared mode of regulation of many gefs, gaps or rho effectors is through protein phosphorylation. most often protein phosphorylation on tyrosine and/or serine threonine residues controls the subcellular localization of these proteins as well as protein - protein interactions. in addition, there are many examples where phosphorylation induces a switch from an autoinhibitory to an active conformation. this has been well - documented for gefs such as ect2, and it appears to be the rule for effector kinases like pak or rho kinases that autophosphorylate upon binding the active gtpase. some of the kinases that target rho regulatory proteins are still under characterization. thus, given the scope of this review, we will only expand here on the role of the mitotic kinases. mitosis progression is indeed regulated by the activity of a number of kinases that comprise, among others, cdk1, aurora a and b kinases and polo kinases. their roles in mitosis progression are fairly well understood, even though some of their direct targets remain to be identified. proper mitotic processes require spatio - temporal coordination of activation of the mitotic kinases. before mitosis entry activation of cdk1 by the cdc25 phosphatase (by dephosphorylation of t14 and y15 of cdk1) at the g2/m transition allows mitosis entry. cdk1 phosphorylates various substrates such as histones, nuclear lamins, proteins interacting with microtubules and thus controls the condensation of chromosomes, nuclear envelope breakdown and spindle assembly. following breakdown of the nuclear membrane, active cdk1 is localized throughout the cytoplasm, with a strong enrichment on centrosomes and, to a certain extent, on kinetochores and spindle microtubules. at this stage, aurora a and plk1 localization is similar to that of cdk1. at metaphase - anaphase transition, cdk1 activates the apc / c that induces ubiquitin - dependent degradation of securin and activation of separase as well as degradation of cyclin b1, which, in turn, downregulates cdk1 activity. cdk1 inactivation is required for aurora b relocalization from kinetochores to the spindle midzone. similarly, plk-1, which was localized at centrosomes until anaphase onset, relocalizes to the spindle midzone following cdk1 inactivation. it has only been recently recognized that these mitotic kinases also participate in regulating the rho pathways that are active during mitosis (table 2). at mitosis onset, rhoa activity increases and the resulting activation of its effector rock is required for cortical retraction during mitotic cell rounding. inhibition of the p190rhogap - a through its phosphorylation by cdk1 may contribute to this increase in rhoa activity. in addition, three proteins with gef activity on rhoa have been shown to play a role in mitosis : ect2, gef - h1 and myogef. in early mitosis, gef - h1 is maintained inactive through aurora a- and cdk1-mediated phosphorylation. in contrast, ect2 phosphorylation at t341 and t412 by cdk1 increases the gef activity of ect2, through release of the intramolecular interaction between the n - terminal brct domains and the catalytic dh - ph region of ect2. this increase in ect2 gef activity probably accounts for most of the activation of rhoa at mitosis entry. during early mitosis, however, cdk1-mediated phosphorylation of t814 and t341 of ect2 limits the recruitment of ect2 to the plasma membrane and prevents precocious binding of ect2 to mgcracgap. either the gef - h1/rhoa / mdia1 pathway (rat-2 cells) or the ect-2/cdc42/mdia3 pathway (hela cells) is necessary for spindle assembly and attachment of microtubules to kinetochores. in the second model, aurora b - mediated phosphorylation of rho signaling proteins plays a major regulatory role., the mitotic spindle - associated protein prc1 has been found to bind to mgcracgap and to inhibit its gap activity toward cdc42. the phosphorylation of mgcracgap by aurora b might disrupt the prc1/mgcracgap complex and thus de - repress mgcracgap activity on cdc42. thus, the balance between prc1-mediated inhibition and aurora b - mediated de - repression of mgcracgap activity on cdc42 seems required for adequate formation of the spindle. second, aurora b phosphorylates kinetochore - located mdia3 at t66 and s196 which releases mdia3 autoinhibition. in addition, phosphorylation of s820 and t882 promotes function of the fh2 domain of mdia. proper phosphorylation of mdia on these sites seems critical for chromosome alignment at the metaphase plate as well as formation of stable kinetochore microtubule fibers. these regulatory phosphorylation events must be fine - tuned, since a nonphosphorylatable mdia3 mutant prevents chromosomes alignment at the metaphase plate in contrast to the phosphomimetic mutant that alters formation and stability of the kinetochore fibers. upon anaphase onset, mgcracgap associates with the kinesin mklp1 to form the centralspindlin, which is required for microtubule bundling. until the metaphase - anaphase transition, cdk1-mediated phosphorylation negatively regulates the functions of central spindle proteins, such as prc1 and mklp1. these regulatory mechanisms include phosphorylation of prc1, which prevents formation of the prc1/plk1 complex and the relocalization of plk1 to the central spindle as well as phosphorylation of mklp1, which prevents it from interacting with microtubules. in parallel, aurora b activity impacts on the targeting of centralspindlin to the midzone by phosphorylating mklp1. one of the functions of the centralspindlin is to trigger recruitment of ect2 to the midzone in a plk1-dependent manner. ect2 induces subsequent activation of rhoa at the cell equator, which, in turn, regulates the actin and myosin contractile ring that eventually forms the cleavage furrow to separate daughter cells. recruitment of ect2 onto the centralspindlin complex is prevented, until the metaphase - anaphase transition, by cdk1-mediated phosphorylation of ect2 on t341. in addition, plk1 phosphorylates mgcracgap to promote its interaction with ect2 and recruitment of ect2 to the spindle midzone. ect2 is probably not the only gef that is involved in rhoa activation during cytokinesis. indeed, two other gef active toward rhoa whose rna interference - mediated knockdown induces failed cytokinesis and cell multinucleation are myogef / plekhg6 and gef - h1. as for ect2, activity and localization of these gefs indeed, plk1 has been shown to phosphorylate myogef on threonine 574 to control its localization to the spindle and increase its exchange activity. in addition, gef - h1 phosphorylations by aurora and cdk1 maintain it inactive until just before cytokinesis, at which time it is dephosphorylated and activates rhoa. thus, it appears that all of the regulators of rho gtpases that participate in mitosis are, one way or the other, under the control of mitotic kinases. in addition, several of the downstream effectors of rho that have been shown to participate in cleavage furrow positioning and constriction can also be substrates for the mitotic kinases. for instance, plk-1 associates with rock2 specifically during mitosis and phosphorylates it on at least four identified residues to enhance its kinase activity in response to rhoa. plk-1 also binds rock1 and citron, although it is still unclear whether it phosphorylates these two proteins. although the evidence is indirect, it has also been suggested that prk2 may be phosphorylated by cdk1 in mitosis. cdk1 is the orchestrator of mitosis entry and progression and is tightly regulated by endogenous inhibitors (such as p21 or p27) and activators (such as cyclins a and b). these proteins that directly affect cdk1 activity could thus be viewed as indirect regulators of the rho pathways in mitosis. it is, however, surprising that recent reports indicate that direct effects of p27 or cyclin a on the rho pathways are, in both cases, independent of cdk1 activity. cyclin a2, whether wild - type or mutated in its cdk1 interaction domain, was found to directly associate with rhoa and promote its activation, resulting in actin remodeling. similarly, p27 binds citron kinase and prevents its activation by rhoa, leading to failed cytokinesis and a multinucleation phenotype. this phenotype was also observed with a form of p27 that is unable to bind or inhibit cyclin - cdk complexes. in both these reports, the experimental setting that lead to these observations does not allow conclusions as to whether these regulatory circuits are indeed involved in or of any importance during normal cell cycling. they may, however, be critical in the context of tumor cells that display deregulated expression of these proteins. as described above, several proteins of the rho pathways that contribute to mitosis are regulated both at the transcriptional level and by ubiquitin - dependent degradation. in this respect, obviously, these mechanisms are efficient and reliable ways for cells to make sure these proteins are present at the time their activity is required and absent later on. considering that activities of most of these proteins are also regulated by phosphorylation, one hypothesis is that expression of these proteins during inappropriate phases of the cell cycle may be detrimental for the cell. this could be the case for ect2, as non degradable mutants of this rhogef have been shown to promote cell transformation. another possibility is that degradation of these proteins is actually required for cytokinesis to be completed. expression of non - degradable mutants of p190rhogap, constitutively active rhob, deregulated expression of mdia2 or stable versions of iqgap1 (in yeast) all lead to cell multinucleation, likely by preventing dismantling of the intercellular bridge linking daughter cells and abscission. in fact, yeast cells with genetic knockdown of the apc activator cdh1 display abscission defects that result from failed disassembly of the contractile actin ring. given the large number of yet - uncharacterized gefs and gaps, it would not be unexpected if others than those discussed above turned out to also be regulated in a cell cycle - dependent manner. large scale gene expression and proteomics analyses in various systems will identify new cell cycle - dependent variations of members of the rho pathways, which will provide new hints at their functions, for example by analyzing those that are co - regulated. in addition, searching public databases and supplemental information that nowadays come with most publications, indeed yields a huge amount of yet - unexploited expression or phosphorylation data (table 3). one of the widely used models in these studies is the human hela cell line. of course, it should be understood that hela cells are not real life, and if indeed it helped in developing new concepts and methodologies, it still will be necessary to carefully analyze the rho signaling pathways in normal cells of various lineages. compiled from references 36,89,90 or from the websites www.phosphosite.org, www.phosida.de and www.cyclebase.org | the dynamics of the actin cytoskeleton and its regulation by rho gtpases are essential to maintain cell shape, to allow cell motility and are also critical during cell cycle progression and mitosis. rho gtpases and their effectors are involved in cell rounding at mitosis onset, in chromosomes alignment and are required for contraction of the actomyosin ring that separates daughter cells at the end of mitosis. recent studies have revealed how a number of nucleotide exchange factors and gtpase - activating proteins regulate the activity of rho gtpases during these processes. this review will focus on how the cell cycle machinery, in turn, regulates expression of proteins in the rho signaling pathways through transcriptional activation, ubiquitylation and proteasomal degradation and modulates their activity through phosphorylation by mitotic kinases. |
the precise mechanism of ribosomal peptide bond formation was always a matter of controversial debates starting from the assumption that a ribosomal protein of the 50s subunit catalyses protein synthesis. the ph dependence of the reaction suggested an ionizable group with a pka value between 7 and 8, thus a histidine residue was thought to participate in peptide bond formation (1). as long suspected by biochemical evidence (24), x - ray structure analysis of ribosomal subunits has revealed that the ribosome is indeed a ribozyme as no protein component could be detected in the near vicinity of the peptidyl transferase center (5). rna has only a few possibilities to catalyze chemical reactions : general acid / base catalysis and/or electrostatic stabilization of the transition state can be achieved by a nucleobase or by divalent metal ions. indeed, based on the x - ray structure of a 50s complex with a putative intermediate state analog (5), a model was proposed that attributed an important catalytic function to a2451 (escherichia coli numbering), a conserved nucleotide in the active site. although this hypothesis entailed many genetic and biochemical experiments, it is still heavily discussed (610). metal ions are crucial for the structure and function of the ribosome and neither monovalent metal ions nor polyamines can substitute for a certain amount of divalent metal ions (11,12). metal ions can carry out at least two distinct functions in rna enzymes : divalent cations may aid structural stabilization of folded rna and/or might be required for the chemistry of a reaction. in many rna - catalyzed reactions, the variety of possibilities of how a metal ion might promote rna catalysis have been extensively reviewed (18,19). as evidence was accumulating early on that the ribosome is indeed a ribozyme (2,3), we had previously proposed that divalent metal ions coordinated by rna might be involved in the catalysis of the peptidyl transfer reaction (4). there are at least four possibilities of how a metal ion may aid peptidyl transfer (figure 1) : one variant type involves direct metal - ion coordination to the bridging oxygen (metal ion 1) or to the oxygen of the carbonyl group (metal ion 2), thereby either stabilizing the developing negative charge on the leaving group or rendering the carbon center more susceptible to the nucleophilic attack. a third possibility (metal ion 3) would be coordination of a metal - ion hydroxyl - group, which could enhance the nucleophilicity of the attacking amino group by hydrogen bonding. the fourth possibility (metal ion 4) could be stabilization of the developing negative charge on the 2-oh group in case its proton migrates during reaction over to the 3-oxygen. in addition, this metal ion might donate a proton from its water shell, thereby restoring the 2-oh group. an important role of the 2-oh for activity has been recently proposed by several reports (2023). one way of testing a predicted metal - ion coordination in rna catalysis is to substitute oxygen by sulfur at the coordination site that is involved in the reaction. the substituted site has a lower affinity for mg, which results in decreased activity. however, it has enhanced affinity for divalent ions, such as mn and cd, which can consequently rescue the activity. these metal - ion - rescue experiments have been widely used to predict metal - ion binding sites in rna for both structure and catalysis (14,16,19). therefore, we started out to synthesize model p - site substrates to investigate whether metal ions might aid peptide bond formation. a prime candidate for a metal coordination was the 3-bridging oxygen of the p - site substrate because a metal is coordinated to the equivalent position in group i introns (14). in order to test whether a 3-thioated substrate would be active as p - site substrate, we took advantage of our recently established fragment reaction system in which the p - site substrate is an 2(3)-o-(n - acylaminoacyl)adenosine-5-phosphate and [c]phe - trna is the a - site substrate. the detailed characterization of this reaction has been published elsewhere (22). here, we report the synthesis of 3-thioamp, which was further chemically aminoacylated with n - acetyl - l - leucine. its peptidyl transferase activity was 23 times higher than that of the oxygen containing control substrate, di(acleu)-amp (2), but both activities were considerably lower than the monoaminoacylated acleu - amp (1). when tested in the presence of mn ions, competition experiments indicate that binding of the p - site substrates appear similar under all conditions employed. therefore, metal - ion - rescue experiments in a translation system using trnas with a 3-thioamp at their 3 end seem feasible. for chemical synthesis, all solvents, except triethyl phosphate, phosphoryl chloride and 1-bromocarbonyl-1-methylethylacetate, were distilled and dmf was stored over molecular sieves (4). the preparation of acleu - amp (1), diacleu - amp (2) acleu - damp (3), ribosomes and [c]phetrna and reaction conditions were as described previously (22). the 50s ribosomes (6 pmol) were preincubated for 15 min at 37c in reaction buffer containing 50 mm hepes koh, 100 mm kcl (ph of the buffer was adjusted to ph 7.5 at 0c in the presence of kcl), 20 mm magnesium acetate and 10 mm cytidine. after cooling for 10 min to 0c, acylaminoacylated mononucleotide substrate at 1 mm f.c. and 6 pmol [c]phetrna (1000 d.p.m./pmol) premixed with 0.3 pmol internal standard (ac[c]phe, 1100 d.p.m./pmol) were added (final volume of 25 l). the reaction was initiated by the addition of 25 l cold methanol ; however, all concentrations were calculated for the reaction mixture before the addition of methanol. in competition experiments, acleu - damp (3) was added to the reaction after the addition of p - site substrate, but before the addition of phetrna. after 2 h at 0c, the reaction was terminated by the addition of 25 l of 3 m naoh (f.c. 1 m) and incubated for 30 min at 37c to hydrolyse the ester bonds. the mixture was acidified with 100 l of 32% hcl and acleuphe product was extracted with 1 ml ethyl acetate. the ethyl acetate was evaporated in the speedvac, the remaining substance was dissolved in ethyl acetate and subjected to thin layer chromatography on silica gel 60 tlc plates (merck). the tlc plates were developed for 20 min in chcl3/meoh / acoh 96% = 10/2/1 and exposed overnight with tritium - sensitive phosphorimager screens. screens were scanned with a molecular dynamics storm 840 phosphorimager (amersham pharmacia) and quantitative data were obtained in the imagequant software version 5.0. under these conditions, the preparation of 3-thioadenosine was based on a synthesis route outlined by (24) with the addition of several purification steps that were essential to obtain highly purified 3-thioadenosine. the synthetic sequence started from adenosine that was transformed into the 2,3-d - ribo - epoxide derivative. the epoxide was then activated by a lewis acid catalyst and opened by a nucleophilic attack at c-3 with iodide ion. treatment with thiobenzoate in dmf installed the sulfur at the 3 carbon by sn2 displacement of the iodo group to afford the protected (benzoylated) 3-thioadenosine derivative. the 5-oh group was phosphorylated with phosphoryl chloride, termination of this reaction resulted in copious salt and its removal would have resulted in significant loss of product. therefore, unpurified 3-thioamp was used without prior removal of the salt, n - acetyl - l - leucine was attached to its thiol group using 1,1-carbonyldiimidazole (cdi) in h2o / dmf (25). the reaction afforded diaminoacylated 3-thioamp (4) and depending on the gradient conditions during reversed - phase high - performance liquid chromatography purification we could obtain diaminoacylated (2 and 3) or monoaminoacylated (2) thioamp (5). for detailed description of the synthesis, see supplementary material. the 50s ribosomes (6 pmol) were preincubated for 15 min at 37c in reaction buffer containing 50 mm hepes koh, 100 mm kcl (ph of the buffer was adjusted to ph 7.5 at 0c in the presence of kcl), 20 mm magnesium acetate and 10 mm cytidine. after cooling for 10 min to 0c, acylaminoacylated mononucleotide substrate at 1 mm f.c. and 6 pmol [c]phetrna (1000 d.p.m./pmol) premixed with 0.3 pmol internal standard (ac[c]phe, 1100 d.p.m./pmol) were added (final volume of 25 l). the reaction was initiated by the addition of 25 l cold methanol ; however, all concentrations were calculated for the reaction mixture before the addition of methanol. in competition experiments, acleu - damp (3) was added to the reaction after the addition of p - site substrate, but before the addition of phetrna. after 2 h at 0c, the reaction was terminated by the addition of 25 l of 3 m naoh (f.c. 1 m) and incubated for 30 min at 37c to hydrolyse the ester bonds. the mixture was acidified with 100 l of 32% hcl and acleuphe product was extracted with 1 ml ethyl acetate. the ethyl acetate was evaporated in the speedvac, the remaining substance was dissolved in ethyl acetate and subjected to thin layer chromatography on silica gel 60 tlc plates (merck). the tlc plates were developed for 20 min in chcl3/meoh / acoh 96% = 10/2/1 and exposed overnight with tritium - sensitive phosphorimager screens. screens were scanned with a molecular dynamics storm 840 phosphorimager (amersham pharmacia) and quantitative data were obtained in the imagequant software version 5.0. under these conditions, the preparation of 3-thioadenosine was based on a synthesis route outlined by (24) with the addition of several purification steps that were essential to obtain highly purified 3-thioadenosine. the synthetic sequence started from adenosine that was transformed into the 2,3-d - ribo - epoxide derivative. the epoxide was then activated by a lewis acid catalyst and opened by a nucleophilic attack at c-3 with iodide ion. treatment with thiobenzoate in dmf installed the sulfur at the 3 carbon by sn2 displacement of the iodo group to afford the protected (benzoylated) 3-thioadenosine derivative. the 5-oh group was phosphorylated with phosphoryl chloride, termination of this reaction resulted in copious salt and its removal would have resulted in significant loss of product. therefore, unpurified 3-thioamp was used without prior removal of the salt, n - acetyl - l - leucine was attached to its thiol group using 1,1-carbonyldiimidazole (cdi) in h2o / dmf (25). the reaction afforded diaminoacylated 3-thioamp (4) and depending on the gradient conditions during reversed - phase high - performance liquid chromatography purification we could obtain diaminoacylated (2 and 3) or monoaminoacylated (2) thioamp (5). for detailed description of the synthesis, see supplementary material. to be able to test the hypothesis that a magnesium ion might electrostatically stabilize the developing negative charge of the leaving group in peptide bond formation (figure 1, metal 1), we first synthesized 3-thioamp, which was further chemically aminoacylated with n - acetyl - l - leucine (see material and methods). the synthesis yielded di(acleu)-thioamp (4) in high purity, but no monoaminoacylated 3-s - acleu-3-thioamp could be isolated. this is due to the efficient migration of the amino acid from the 3-sh to the 2-oh and subsequent reacylation of the 3-sh with a second amino acid. however, applying stringent workup procedures resulted in the preparation of 2-o - acleu-3-thioamp (5) ; in these preparations, the majority of the amino acid group was located at the 2-position as judged by nmr analysis. to test whether the 3-thio amp derivatives are active as p - site substrate in peptide bond formation and to investigate the effect of the thio - substitution, control substrates acleu - amp (1) and di(acleu)-amp (2) were synthesized (22) and used to compare activities in parallel reactions. as the use of mononucleotide substrates instead of whole trnas makes the chemical synthesis of thiosubstrates more reasonable, we previously had established a simplified version of the fragment reaction for testing these substrates in peptide bond formation. in this system, acylaminoacylated mononucleotides are active as p - site substrates, provided they are used at high concentrations. furthermore, [c]phe - trna is used as a - site substrate and an internal standard allows quantification of the reactions. the reaction products are extracted by ethyl acetate, separated by thin layer chromatography and quantified by phosphorimager analysis. previously, acleu - amp (1) and di(acleu)-amp (2) have been thoroughly characterized and standard reaction conditions (1 mm p - site substrate and 2 h incubation time) have been defined (22). we also showed that the addition of 10 mm cytidine stimulated the reaction up to 30-fold. this is most probably caused by base pairing to the 23s rna, thereby simulating binding of the cca end of a trna, which results in a better positioning of the aminoacylated mononucleotides. under these conditions using acleu - amp (1), di(acleu)-amp (2) had only 10% of the activity of acleu - amp (1) (see also figure 3a), which suggested a significant contribution of the 2-oh to activity [see discussion in (22) ]. interestingly, di(acleu)-thioamp (4), showing a similar kinetic performance, was 23 times more active than di(acleu)-amp (2) with 30% of the activity of the monoacylated substrate (1) (figure 3a and b). both activities are equally well inhibited by a competitive but inactive inhibitor acleu - damp (3) (figure 3c), indicating similar binding modes. compared with oxoesters, thioesters are more reactive toward amino nucleophiles (26) and thiols are better leaving groups than alcohols. it is, therefore, conceivable that the higher activity of di(acleu)-thioamp (4) most probably reflects the higher energy of the thioester linkage in peptide bond formation. a possible magnesium coordination to the sulfur group should have reduced the activity compared with the ester substrate ; however, this effect might have been masked by the better leaving group properties of the thiol group. when testing acleu - thioamp (5) in this system, the activity was barely detectable (figure 3b, lane 4), which was expected of a substrate with an aminoester linkage predominantly at the unproductive 2-position. in order to promote migration of the amino acid group to the 3-position, acleu - thioamp (5) was preincubated for 10 min at 37c before the reaction at 0c. indeed, as shown in figure 3d, lanes 3 and 4, thermal activation of this substrate slightly enhanced the activity, which is in contrast to di(acleu)-thioamp (4) where activation showed no effect (lanes 1 and 2) as one would predict. consequently, acleu - thioamp (5) was not used for further analysis as the amino acid could not be shifted to the active 3-position in sufficient quantity. furthermore, as the thioester linkage is more labile in di(acleu)-thioamp (4), simple hydrolysis during the long incubation would produce predominantly acleu - thioamp (5), which does not contribute significantly to the activity. these experiments demonstrate that di(acleu)-thioamp (4) is the active component and consequently this substrate was used for further analysis. as already discussed in the introduction, metal - ion coordination to an oxygen group can be tested by metal - ion - rescue experiments, which take advantage of the different coordination abilities of oxygen and sulfur. as divalent ions, such as mn and cd, possess a higher affinity to sulfur than mg ions, their presence could stimulate the activity of thiosubstrates. although the activity of di(acleu)-thioamp (4) was enhanced compared with di(acleu)-amp (2), we reasoned that a stimulation of the activity of di(acleu)-thioamp (4) by mn and cd would suggest that a metal ion was coordinated to the bridging sulfur. hence, the activity of all three substrates (1,2,4) was tested under various ionic conditions. mg ions were continuously substituted by mn by keeping the total concentration of divalent ions at 20 mm (figure 4a). all substrates showed stimulated activity in the presence of mn ; however, the extent and optimal mn concentration varied (figure 4a and b). interestingly, di(acleu)-amp (2) always showed the best stimulation of all substrates with an optimum at 3 mm mn. acleu - amp (1) and di(acleu)-thioamp (4), however, had their optimal activity in the presence of 1 mm mn. at their optimal concentrations, acleu - amp (1) was stimulated 1.1-fold, di(acleu)-thioamp (4) 1.3-fold and di(acleu)-amp (2) 2.1-fold (figure 4b). the slight stimulation of acleu - amp (1) by mn is coherent with early experiments, which showed that mn can substitute mg ions when testing ribosomal activities by completely substituting mg with 1 mm mn (27). however, so far we can not explain the better stimulation of di(acleu)-amp (2) by 3 mm mn. one possible explanation would be that the 2 h reaction time in mn containing buffer could lead to the hydrolysis of one amino acid ester, producing the much higher active acleu - amp (1). however, preincubation of di(acleu)-amp (2) in mn ion buffer before the reaction did not enhance the activity significantly (data not shown). in addition, inhibition studies with the inactive acleu - damp (3) under different ionic conditions do not indicate different binding properties for these substrates (2,4) in mn buffer compared with mg buffer (figure 4c). using cd for metal - ion - rescue experiments, basically the same results were obtained : di(acleu)-thioamp (4) is only marginally better stimulated by cd than acleu - amp (1) and even lower stimulated than di(acleu)-amp (2) (c. panuschka and a. barta, unpublished data). taken together, these metal - ion - rescue experiments do not show a stimulation of the peptidyl transferase activity of thioated substrates by mn ions. however, it is not clear yet whether this means that no metal ion is coordinated to the bridging oxygen of the p - site substrate as the fragment reaction is so much slower under our conditions (50% methanol, 0c, endpoint is 3040% of phetrna reacted after 2 h). nevertheless, in this system acleu - damp (3) was found to be completely inactive (22) and an equivalent substrate was recently shown to be also inactive in a system using full - size trnas and pre - steady state kinetics (23). therefore, it is still possible that the coordination of a metal ion to the bridging sulfur might be masked in our system. only a full - size trna with a 3-thioadenosine used as p - site substrate in a system using pre - steady state kinetics of peptide bond formation could provide evidence for a metal - ion coordination to the 3-oxygen group of the p - site substrate. however, as sulfur is also a much better leaving group than oxygen, changing the ester to a thioester bond might not only change metal - ion coordination, but might make the reaction independent of the presence of metal - ion interaction. therefore, also in this experiment, we can not completely exclude metal - ion binding to the bridging oxygen in the case of the unmodified substrate. there is still an ongoing debate about how peptide bond formation is catalyzed by the ribosome. biochemical and structural analyses have shown that the invariant cca ends of both trna substrates carrying either the growing peptide chain or the next amino acid bind via rna interactions to 23s rna (5,2830) and this precise positioning is an important contribution to catalysis (31). however, it also became quite clear that the peptidyl transferase region is very flexible, changing structure depending on the substrates that are used in the x - ray analysis (32,33). in addition, chemical probing has shown that the peptidyl transferase center undergoes ph - dependent structural rearrangements (3436), which could in principle be the cause for the observed ph - dependency of the reaction. this makes a prediction which chemical groups at the active site might be involved in a catalytic function (such as in general acid / base catalysis, electrostatic stabilization of the transition state) quite imprecise. in silico reconstructions of a composite of several structures (33), theoretical considerations and the results of several experiments do not unambiguously support the proposed base - mediated catalysis by a2541 in peptide bond formation (8,10). interestingly, experiments with model p - site substrates with modifications in the 2-oh of the ultimate a76 suggested a significant influence of this group on the activity leading to a model proposing that this 2-oh might help in aligning the amino nucleophile (21,22). this model is supported by the composite computer model that places the 2-oh of the terminal a within 2.5 of the nucleophile (33) as well as by a chemical study showing the importance of the vicinal oh group for amide synthesis (20). while this manuscript was under revision, the strobel and green lab have published additional proof for the significance of the 2-oh for peptide bond formation (23). nevertheless, the apparent dependence of peptide bond formation on divalent metal ions let to the proposal that rna coordinated mg might function in catalysis [(4), see figure 1 ]. this has prompted a series of experiments to identify divalent metal - ion binding sites in both rrnas by metal - ion - induced rna cleavage. although these experiments provided evidence for metal ions close to the peptidyl transferase center (37,38), only the x - ray structure of the 50s subunit from deinococcus radiodurans (32) but not from haloarcula marismortui (5) shows density that could be attributed to two hydrated mg ions. therefore, we started experiments to determine whether mg ions might coordinate to either of the oxygen groups of p - site substrates (figure 1). to this end, we have synthesized model thioated p - site substrates, in which the 3-oxygen has been substituted by sulfur and have shown that these substrates can in principle be used as p - site substrate. in the context of a whole trna and using pre - steady state kinetics, these thioated substrates might provide evidence for a metal - ion coordination to the bridging oxygen of p - site substrates. model for possible interactions of metal ions during peptide bond formation. structure of acylaminoacylated mononucleotides used as p - site substrates. analysis of thioated p - site substrates in a fragment reaction with [c]phe - trna as a - site substrate. (c) competitive inhibition of the activity with increasing amounts of inactive acleu - damp (3). an aliquot of 0.5 mm p - site substrate was used under standard reaction conditions. (d) thin layer chromatography of fragment reactions with p - site substrates diacleu - thioamp (4) or acleu - thioamp (5). substrates were used without any prior treatment (n.a. ; lanes 1 and 3) or after thermal activation at 37c for 10 min (a. ; lanes 2 and 4). data in (a) and (c) represent an average of 35 independent series. mn ion dependence of the fragment reaction : mononucleotide p - site substrates were reacted with [c]phe - trna in different ionic conditions. (a) time course of acleu[c]phe formation. (b) manganese dependence of acleu[c]phe formation using different p - site substrate. (c) competitive inhibition of the activity with increasing amounts of inactive acleu - damp (3). an aliquot of 0.5 mm p - site substrate was used and the formation of acleu[c]phe was followed under different ionic conditions. (a c) data represent the average of at least three independent experimental series. | the ribosome is a large rnp complex but its main enzymatic activity, the peptidyl transferase, is a ribozyme. as many rna enzymes use divalent metal ions in catalysis, one of the hypotheses put forward proposed that metal ions might aid peptide bond formation. to be able to test a possible coordination of a metal ion to the 3-bridging oxygen of p - site substrates, a 3-thioamp was synthesized. its chemical acylation with n - acetyl - l - leucine yielded both mono and diaminoacylated 3-thioamp. these thioated substrates were tested for peptide bond formation in an optimized fragment reaction in comparison with their unmodified counterparts. as the amino acid was predominantly linked to the unproductive 2-oh in acleu - thioamp (5), this substrate was barely active and not used for further analysis. in contrast, di(acleu)-thioamp (4) was more active than di(acleu)-amp (2) which is in line with the higher energy of thioesters. both activities were slightly enhanced when mn2 + containing buffers were employed in the assay. these data show that thioated p - site substrates are active in peptide bond formation and can in principle be used for metal - ion - rescue experiments in a full translation system. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.